Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	MUTSIG_Significant_Genes	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
DNAJC1	64215	broad.mit.edu	37	10	22094922	22094924	+	Missense_Mutation	TNP	CGA	AAC	AAC			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22094922_22094924CGA>AAC	uc001irc.2	-	9	1370_1372	c.1083_1085TCG>GTT	c.(1081-1086)GGTCGA>GGGTTA	p.R362L	DNAJC1_uc001ird.2_Missense_Mutation_p.R248L	NM_022365	NP_071760	Q96KC8	DNJC1_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 1	362	Cytoplasmic (By similarity).|SANT 1.				negative regulation of proteolysis|regulation of protein secretion|regulation of transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane|microsome|nuclear membrane	ATPase activator activity|DNA binding|heat shock protein binding|unfolded protein binding			lung(1)	1		Breast(68;0.00869)|Prostate(175;0.0181)|Lung SC(717;0.0262)																---	---	---	---	capture		Missense_Mutation	TNP	22094922	22094924	4811	10	CGA	AAC	AAC	31	31	DNAJC1	AAC	1	1
KIAA0947	23379	broad.mit.edu	37	5	5463581	5463582	+	Missense_Mutation	DNP	GG	TC	TC			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5463581_5463582GG>TC	uc003jdm.3	+	13	4356_4357	c.4134_4135GG>TC	c.(4132-4137)ATGGAG>ATTCAG	p.1378_1379ME>IQ		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1378_1379										ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Missense_Mutation	DNP	5463581	5463582	8509	5	GG	TC	TC	47	47	KIAA0947	TC	2	2
CLCNKB	1188	broad.mit.edu	37	1	16374837	16374837	+	Splice_Site	DEL	G	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16374837delG	uc001axw.3	+	6	579	c.499_splice	c.e6-1	p.G167_splice	FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Splice_Site_p.G167_splice|CLCNKB_uc001axy.3_5'Flank	NM_000085	NP_000076			chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---	capture_indel		Splice_Site	DEL	16374837	16374837	3606	1	G	-	-	35	35	CLCNKB	-	5	5
RPS6KC1	26750	broad.mit.edu	37	1	213251154	213251155	+	Frame_Shift_Ins	INS	-	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213251154_213251155insT	uc010ptr.1	+	3	417_418	c.258_259insT	c.(256-261)GTGTTTfs	p.V86fs	RPS6KC1_uc001hkd.2_Frame_Shift_Ins_p.V74fs|RPS6KC1_uc010pts.1_5'UTR|RPS6KC1_uc010ptt.1_5'UTR|RPS6KC1_uc010ptu.1_Intron|RPS6KC1_uc010ptv.1_5'UTR|RPS6KC1_uc001hke.2_5'UTR	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	86_87	PX.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)														---	---	---	---	capture_indel		Frame_Shift_Ins	INS	213251154	213251155	14138	1	-	T	T	48	48	RPS6KC1	T	5	5
KAZALD1	81621	broad.mit.edu	37	10	102822791	102822809	+	Frame_Shift_Del	DEL	CTGCAGGAGGCGGCCCGCG	-	-	rs145868353	byFrequency	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102822791_102822809delCTGCAGGAGGCGGCCCGCG	uc001ksr.2	+	2	1367_1385	c.442_460delCTGCAGGAGGCGGCCCGCG	c.(442-462)CTGCAGGAGGCGGCCCGCGCTfs	p.L148fs	KAZALD1_uc001kss.3_RNA|KAZALD1_uc001kst.1_Frame_Shift_Del_p.L148fs	NM_030929	NP_112191	Q96I82	KAZD1_HUMAN	Kazal-type serine peptidase inhibitor domain 1	148_154	Kazal-like.				cell differentiation|multicellular organismal development|ossification|regulation of cell growth		insulin-like growth factor binding				0				Epithelial(162;6.21e-09)|all cancers(201;3.14e-07)														---	---	---	---	capture_indel		Frame_Shift_Del	DEL	102822791	102822809	8293	10	CTGCAGGAGGCGGCCCGCG	-	-	24	24	KAZALD1	-	5	5
FAM160A2	84067	broad.mit.edu	37	11	6244402	6244402	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6244402delC	uc001mcl.3	-	4	1203	c.844delG	c.(844-846)GATfs	p.D282fs	FAM160A2_uc001mck.3_Frame_Shift_Del_p.D282fs|FAM160A2_uc001mcm.2_Frame_Shift_Del_p.D282fs	NM_001098794	NP_001092264	Q8N612	F16A2_HUMAN	hypothetical protein LOC84067 isoform 2	282					early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|protein transport	FHF complex	protein binding			skin(2)	2																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	6244402	6244402	5673	11	C	-	-	29	29	FAM160A2	-	5	5
OR5M3	219482	broad.mit.edu	37	11	56237250	56237250	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56237250delG	uc010rjk.1	-	1	724	c.724delC	c.(724-726)CATfs	p.H242fs		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---	capture_indel		Frame_Shift_Del	DEL	56237250	56237250	11585	11	G	-	-	47	47	OR5M3	-	5	5
ZFP14	57677	broad.mit.edu	37	19	36831795	36831795	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36831795delG	uc002odx.1	-	4	1026	c.933delC	c.(931-933)CTCfs	p.L311fs	ZFP14_uc010xtd.1_Frame_Shift_Del_p.L312fs|ZFP14_uc010eex.1_Frame_Shift_Del_p.L311fs	NM_020917	NP_065968	Q9HCL3	ZFP14_HUMAN	zinc finger protein 14-like	311					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.162)																	---	---	---	---	capture_indel		Frame_Shift_Del	DEL	36831795	36831795	18227	19	G	-	-	33	33	ZFP14	-	5	5
ZNF787	126208	broad.mit.edu	37	19	56600346	56600346	+	Frame_Shift_Del	DEL	G	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56600346delG	uc010eth.1	-	3	314	c.195delC	c.(193-195)CCCfs	p.P65fs		NM_001002836	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	65	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)														---	---	---	---	capture_indel		Frame_Shift_Del	DEL	56600346	56600346	18757	19	G	-	-	35	35	ZNF787	-	5	5
GNPDA2	132789	broad.mit.edu	37	4	44724131	44724131	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44724131delC	uc003gwy.2	-	2	251	c.94delG	c.(94-96)GACfs	p.D32fs	GNPDA2_uc010iga.2_Frame_Shift_Del_p.D32fs|GNPDA2_uc011bzb.1_Intron|GNPDA2_uc003gwz.1_Frame_Shift_Del_p.D32fs	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	32					N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	44724131	44724131	6812	4	C	-	-	30	30	GNPDA2	-	5	5
PCDHGB4	8641	broad.mit.edu	37	5	140767492	140767497	+	In_Frame_Del	DEL	TGCCAG	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140767492_140767497delTGCCAG	uc003lkc.1	+	1	41_46	c.41_46delTGCCAG	c.(40-48)CTGCCAGTG>CTG	p.PV15del	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_In_Frame_Del_p.PV15del	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	15_16					calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)													OREG0016859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture_indel		In_Frame_Del	DEL	140767492	140767497	11985	5	TGCCAG	-	-	55	55	PCDHGB4	-	5	5
EYA1	2138	broad.mit.edu	37	8	72211919	72211919	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72211919delC	uc003xys.3	-	7	880	c.593delG	c.(592-594)GGAfs	p.G198fs	EYA1_uc003xyr.3_Frame_Shift_Del_p.G193fs|EYA1_uc003xyt.3_Frame_Shift_Del_p.G165fs|EYA1_uc010lzf.2_Frame_Shift_Del_p.G125fs|EYA1_uc003xyu.2_Frame_Shift_Del_p.G198fs|EYA1_uc011lfe.1_Frame_Shift_Del_p.G192fs|EYA1_uc003xyv.2_Frame_Shift_Del_p.G76fs	NM_172058	NP_742055	Q99502	EYA1_HUMAN	eyes absent 1 isoform b	198					double-strand break repair|histone dephosphorylation|positive regulation of DNA repair|protein sumoylation|regulation of transcription, DNA-dependent|response to ionizing radiation|sensory perception of sound|transcription, DNA-dependent	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	5	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)															---	---	---	---	capture_indel		Frame_Shift_Del	DEL	72211919	72211919	5522	8	C	-	-	30	30	EYA1	-	5	5
CNGB3	54714	broad.mit.edu	37	8	87588148	87588163	+	Frame_Shift_Del	DEL	TTCTAACTGAGTGGGG	-	-	rs78239264		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87588148_87588163delTTCTAACTGAGTGGGG	uc003ydx.2	-	18	2345_2360	c.2299_2314delCCCCACTCAGTTAGAA	c.(2299-2316)CCCCACTCAGTTAGAAGGfs	p.P767fs	CNGB3_uc010maj.2_Frame_Shift_Del_p.P624fs	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	767_772	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	87588148	87588163	3739	8	TTCTAACTGAGTGGGG	-	-	56	56	CNGB3	-	5	5
GYG2	8908	broad.mit.edu	37	X	2778086	2778087	+	Frame_Shift_Del	DEL	CG	-	-			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2778086_2778087delCG	uc004cqs.1	+	8	1192_1193	c.910_911delCG	c.(910-912)CGCfs	p.R304fs	GYG2_uc004cqt.1_Frame_Shift_Del_p.R273fs|GYG2_uc004cqu.1_Frame_Shift_Del_p.R273fs|GYG2_uc004cqv.1_Frame_Shift_Del_p.R118fs|GYG2_uc004cqw.1_Frame_Shift_Del_p.R264fs|GYG2_uc004cqx.1_Frame_Shift_Del_p.R273fs|GYG2_uc010ndc.1_Frame_Shift_Del_p.R118fs	NM_003918	NP_003909	O15488	GLYG2_HUMAN	glycogenin 2 isoform b	304					glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol|soluble fraction	glycogenin glucosyltransferase activity			ovary(1)|kidney(1)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)																---	---	---	---	capture_indel		Frame_Shift_Del	DEL	2778086	2778087	7186	23	CG	-	-	19	19	GYG2	-	5	5
CASZ1	54897	broad.mit.edu	37	1	10714050	10714050	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10714050G>C	uc001aro.2	-	11	2384	c.2064C>G	c.(2062-2064)CAC>CAG	p.H688Q	CASZ1_uc001arp.1_Missense_Mutation_p.H688Q|CASZ1_uc009vmx.2_Missense_Mutation_p.H712Q	NM_001079843	NP_001073312	Q86V15	CASZ1_HUMAN	castor homolog 1, zinc finger isoform a	688	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			skin(1)	1	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)														---	---	---	---	capture		Missense_Mutation	SNP	10714050	10714050	2804	1	G	C	C	48	48	CASZ1	C	3	3
MTOR	2475	broad.mit.edu	37	1	11298013	11298013	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11298013C>G	uc001asd.2	-	13	2216	c.2095G>C	c.(2095-2097)GCT>CCT	p.A699P		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	699					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29																		---	---	---	---	capture		Missense_Mutation	SNP	11298013	11298013	10347	1	C	G	G	26	26	MTOR	G	3	3
ARHGEF10L	55160	broad.mit.edu	37	1	17964465	17964465	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17964465G>T	uc001ban.2	+	19	2169	c.2010G>T	c.(2008-2010)ACG>ACT	p.T670T	ARHGEF10L_uc009vpe.1_Silent_p.T631T|ARHGEF10L_uc001bao.2_Silent_p.T631T|ARHGEF10L_uc001bap.2_Silent_p.T626T|ARHGEF10L_uc010ocr.1_Silent_p.T428T|ARHGEF10L_uc001baq.2_Silent_p.T431T|ARHGEF10L_uc010ocs.1_Silent_p.T443T|ARHGEF10L_uc001bar.2_Silent_p.T373T|ARHGEF10L_uc009vpf.2_RNA	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)	670					regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)														---	---	---	---	capture		Silent	SNP	17964465	17964465	909	1	G	T	T	38	38	ARHGEF10L	T	1	1
MYOM3	127294	broad.mit.edu	37	1	24384078	24384078	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24384078G>T	uc001bin.3	-	37	4253	c.4090C>A	c.(4090-4092)CCT>ACT	p.P1364T	MYOM3_uc001bil.3_Missense_Mutation_p.P257T|MYOM3_uc001bim.3_Missense_Mutation_p.P1021T	NM_152372	NP_689585	Q5VTT5	MYOM3_HUMAN	myomesin family, member 3	1364	Ig-like C2-type 4.									skin(2)|ovary(1)	3		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)														---	---	---	---	capture		Missense_Mutation	SNP	24384078	24384078	10488	1	G	T	T	43	43	MYOM3	T	2	2
EXTL1	2134	broad.mit.edu	37	1	26359739	26359739	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26359739C>A	uc001blf.2	+	8	2318	c.1451C>A	c.(1450-1452)CCA>CAA	p.P484Q		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	484	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---	capture		Missense_Mutation	SNP	26359739	26359739	5519	1	C	A	A	21	21	EXTL1	A	2	2
CCDC21	64793	broad.mit.edu	37	1	26581751	26581751	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26581751G>T	uc001bls.1	+	4	429	c.298G>T	c.(298-300)GGG>TGG	p.G100W	CCDC21_uc001blr.2_Missense_Mutation_p.G100W|CCDC21_uc010ofa.1_Missense_Mutation_p.G49W	NM_022778	NP_073615	Q6P2H3	CEP85_HUMAN	coiled-coil domain containing 21	100						centrosome|nucleolus|spindle pole					0		all_cancers(24;7e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.6e-26)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;9.48e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00917)|READ - Rectum adenocarcinoma(331;0.0649)														---	---	---	---	capture		Missense_Mutation	SNP	26581751	26581751	2918	1	G	T	T	35	35	CCDC21	T	2	2
CLSPN	63967	broad.mit.edu	37	1	36226273	36226273	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36226273C>A	uc001bzi.2	-	8	1329	c.1249G>T	c.(1249-1251)GAC>TAC	p.D417Y	CLSPN_uc009vux.2_Missense_Mutation_p.D417Y	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	417					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)																---	---	---	---	capture		Missense_Mutation	SNP	36226273	36226273	3698	1	C	A	A	29	29	CLSPN	A	2	2
GJA9	81025	broad.mit.edu	37	1	39341485	39341485	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341485C>T	uc001cct.1	-	2	567	c.286G>A	c.(286-288)GCA>ACA	p.A96T	RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa	96	Helical; (Potential).				cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)															---	---	---	---	capture		Missense_Mutation	SNP	39341485	39341485	6674	1	C	T	T	25	25	GJA9	T	2	2
KCNQ4	9132	broad.mit.edu	37	1	41304020	41304020	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41304020G>T	uc001cgh.1	+	14	1995	c.1913G>T	c.(1912-1914)GGC>GTC	p.G638V	KCNQ4_uc001cgi.1_Missense_Mutation_p.G584V	NM_004700	NP_004691	P56696	KCNQ4_HUMAN	potassium voltage-gated channel KQT-like protein	638	|Cytoplasmic.|A-domain (Tetramerization).				sensory perception of sound	basal plasma membrane|voltage-gated potassium channel complex				central_nervous_system(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)															---	---	---	---	capture		Missense_Mutation	SNP	41304020	41304020	8390	1	G	T	T	42	42	KCNQ4	T	2	2
TIE1	7075	broad.mit.edu	37	1	43782945	43782945	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43782945C>A	uc001ciu.2	+	15	2564	c.2485C>A	c.(2485-2487)CTG>ATG	p.L829M	TIE1_uc010oke.1_Missense_Mutation_p.L784M|TIE1_uc009vwq.2_Missense_Mutation_p.L785M|TIE1_uc010okg.1_Missense_Mutation_p.L474M	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	829	Cytoplasmic (Potential).				mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)																---	---	---	---	capture		Missense_Mutation	SNP	43782945	43782945	16421	1	C	A	A	24	24	TIE1	A	2	2
AGBL4	84871	broad.mit.edu	37	1	49332895	49332895	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49332895C>A	uc001cru.2	-	6	760	c.602G>T	c.(601-603)CGA>CTA	p.R201L	AGBL4_uc010omw.1_5'UTR|AGBL4_uc010omx.1_Missense_Mutation_p.R213L|AGBL4_uc001crv.1_Missense_Mutation_p.R54L|AGBL4_uc010omy.1_Missense_Mutation_p.R54L	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	201					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)														---	---	---	---	capture		Missense_Mutation	SNP	49332895	49332895	380	1	C	A	A	31	31	AGBL4	A	1	1
PRKAA2	5563	broad.mit.edu	37	1	57173172	57173172	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57173172G>C	uc001cyk.3	+	9	1516	c.1445G>C	c.(1444-1446)GGT>GCT	p.G482A		NM_006252	NP_006243	P54646	AAPK2_HUMAN	AMP-activated protein kinase alpha 2 catalytic	482					carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	57173172	57173172	12937	1	G	C	C	44	44	PRKAA2	C	3	3
EFCAB7	84455	broad.mit.edu	37	1	64027381	64027381	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64027381G>C	uc001dbf.2	+	11	1644	c.1350G>C	c.(1348-1350)GAG>GAC	p.E450D		NM_032437	NP_115813	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	450							calcium ion binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	64027381	64027381	5127	1	G	C	C	33	33	EFCAB7	C	3	3
LRRIQ3	127255	broad.mit.edu	37	1	74540356	74540356	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74540356A>T	uc001dfy.3	-	6	1178	c.986T>A	c.(985-987)CTC>CAC	p.L329H	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	329										ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	74540356	74540356	9406	1	A	T	T	11	11	LRRIQ3	T	4	4
FPGT	8790	broad.mit.edu	37	1	74670658	74670658	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74670658A>G	uc001dgb.1	+	4	964	c.927A>G	c.(925-927)GGA>GGG	p.G309G	TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Intron|FPGT_uc010oqu.1_Intron|FPGT_uc010oqv.1_Intron	NM_003838	NP_003829	O14772	FPGT_HUMAN	fucose-1-phosphate guanyltransferase	309					fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding			skin(1)	1																		---	---	---	---	capture		Silent	SNP	74670658	74670658	6283	1	A	G	G	10	10	FPGT	G	4	4
C1orf173	127254	broad.mit.edu	37	1	75037587	75037587	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037587C>A	uc001dgg.2	-	14	4026	c.3807G>T	c.(3805-3807)AGG>AGT	p.R1269S		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1269	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	75037587	75037587	2081	1	C	A	A	30	30	C1orf173	A	2	2
GFI1	2672	broad.mit.edu	37	1	92941612	92941612	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92941612G>A	uc001dou.3	-	7	1407	c.1243C>T	c.(1243-1245)CGG>TGG	p.R415W	GFI1_uc001dov.3_Missense_Mutation_p.R415W|GFI1_uc001dow.3_Missense_Mutation_p.R415W	NM_001127215	NP_001120687	Q99684	GFI1_HUMAN	growth factor independent 1	415	C2H2-type 6.				negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)	1		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)														---	---	---	---	capture		Missense_Mutation	SNP	92941612	92941612	6607	1	G	A	A	39	39	GFI1	A	1	1
OVGP1	5016	broad.mit.edu	37	1	111957655	111957655	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111957655C>A	uc001eba.2	-	11	1524	c.1468G>T	c.(1468-1470)GGA>TGA	p.G490*	OVGP1_uc001eaz.2_Nonsense_Mutation_p.G452*|OVGP1_uc010owb.1_Nonsense_Mutation_p.G138*	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	490					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity			ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)														---	---	---	---	capture		Nonsense_Mutation	SNP	111957655	111957655	11738	1	C	A	A	21	21	OVGP1	A	5	2
SPAG17	200162	broad.mit.edu	37	1	118635849	118635849	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118635849C>A	uc001ehk.2	-	8	1171	c.1103G>T	c.(1102-1104)AGC>ATC	p.S368I		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	368						cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)														---	---	---	---	capture		Missense_Mutation	SNP	118635849	118635849	15482	1	C	A	A	28	28	SPAG17	A	2	2
PDE4DIP	9659	broad.mit.edu	37	1	144915519	144915519	+	Nonsense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144915519T>A	uc001elw.3	-	14	2197	c.1906A>T	c.(1906-1908)AAA>TAA	p.K636*	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Nonsense_Mutation_p.K702*|PDE4DIP_uc001emc.1_Nonsense_Mutation_p.K636*|PDE4DIP_uc001emd.1_Nonsense_Mutation_p.K636*|PDE4DIP_uc001emb.1_Nonsense_Mutation_p.K799*|PDE4DIP_uc001eme.1_Nonsense_Mutation_p.K165*|PDE4DIP_uc001emf.1_Nonsense_Mutation_p.K421*	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	636	Potential.				cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)				T	PDGFRB	MPD								---	---	---	---	capture		Nonsense_Mutation	SNP	144915519	144915519	12064	1	T	A	A	61	61	PDE4DIP	A	5	4
NOTCH2NL	388677	broad.mit.edu	37	1	145281550	145281550	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145281550C>T	uc001emn.3	+	4	850	c.480C>T	c.(478-480)CTC>CTT	p.L160L	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Silent_p.L160L|NOTCH2NL_uc001emo.2_Silent_p.L160L|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	160	EGF-like 5; calcium-binding (Potential).				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	145281550	145281550	10952	1	C	T	T	29	29	NOTCH2NL	T	2	2
TARS2	80222	broad.mit.edu	37	1	150477403	150477403	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150477403C>T	uc001euq.2	+	16	1849	c.1842C>T	c.(1840-1842)TTC>TTT	p.F614F	TARS2_uc001eur.2_Silent_p.F532F|TARS2_uc009wlt.2_Silent_p.F240F|TARS2_uc009wls.2_Silent_p.F484F	NM_025150	NP_079426	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial	614					threonyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|threonine-tRNA ligase activity			ovary(1)	1	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)													---	---	---	---	capture		Silent	SNP	150477403	150477403	16082	1	C	T	T	30	30	TARS2	T	2	2
TDRKH	11022	broad.mit.edu	37	1	151752598	151752598	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151752598C>A	uc009wnb.1	-	4	432	c.250G>T	c.(250-252)GCT>TCT	p.A84S	TDRKH_uc001eyy.2_5'UTR|TDRKH_uc001ezb.3_Missense_Mutation_p.A80S|TDRKH_uc001ezc.3_Missense_Mutation_p.A84S|TDRKH_uc001eza.3_Missense_Mutation_p.A84S|TDRKH_uc001ezd.3_Missense_Mutation_p.A84S|TDRKH_uc010pdn.1_5'UTR	NM_006862	NP_006853	Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing isoform a	84	KH 1.						RNA binding			ovary(1)|pancreas(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)															---	---	---	---	capture		Missense_Mutation	SNP	151752598	151752598	16264	1	C	A	A	25	25	TDRKH	A	2	2
PRCC	5546	broad.mit.edu	37	1	156756874	156756874	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156756874G>T	uc001fqa.2	+	3	1281	c.991G>T	c.(991-993)GGG>TGG	p.G331W	PRCC_uc001fqb.2_Missense_Mutation_p.G331W	NM_005973	NP_005964	Q92733	PRCC_HUMAN	papillary renal cell carcinoma	331					cell cycle|mitotic cell cycle checkpoint	nucleus	protein binding		PRCC/TFE3(25)	kidney(25)|central_nervous_system(2)	27	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)							T	TFE3	papillary renal 								---	---	---	---	capture		Missense_Mutation	SNP	156756874	156756874	12889	1	G	T	T	47	47	PRCC	T	2	2
FCRL3	115352	broad.mit.edu	37	1	157659610	157659610	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157659610G>A	uc001frb.2	-	10	2080	c.1788C>T	c.(1786-1788)TAC>TAT	p.Y596Y	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Silent_p.Y596Y|FCRL3_uc009wsn.2_RNA|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_Silent_p.Y322Y|FCRL3_uc001frc.1_Silent_p.Y596Y	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	596	Cytoplasmic (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)																	---	---	---	---	capture		Silent	SNP	157659610	157659610	6033	1	G	A	A	40	40	FCRL3	A	1	1
KCNT2	343450	broad.mit.edu	37	1	196459055	196459055	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196459055C>G	uc001gtd.1	-	3	248	c.188G>C	c.(187-189)CGC>CCC	p.R63P	KCNT2_uc001gte.1_Missense_Mutation_p.R63P|KCNT2_uc001gtf.1_Missense_Mutation_p.R63P|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.R63P|KCNT2_uc009wyv.1_Missense_Mutation_p.R63P	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	63	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	196459055	196459055	8397	1	C	G	G	27	27	KCNT2	G	3	3
F13B	2165	broad.mit.edu	37	1	197019841	197019841	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197019841G>A	uc001gtt.1	-	10	1768	c.1724C>T	c.(1723-1725)CCA>CTA	p.P575L		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	575	Sushi 9.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	197019841	197019841	5535	1	G	A	A	47	47	F13B	A	2	2
NR5A2	2494	broad.mit.edu	37	1	200017659	200017659	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200017659G>A	uc001gvb.2	+	5	1029	c.823G>A	c.(823-825)GAC>AAC	p.D275N	NR5A2_uc001gvc.2_Missense_Mutation_p.D229N|NR5A2_uc009wzh.2_Missense_Mutation_p.D235N|NR5A2_uc010pph.1_Missense_Mutation_p.D203N	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	275					embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)																	---	---	---	---	capture		Missense_Mutation	SNP	200017659	200017659	11041	1	G	A	A	33	33	NR5A2	A	2	2
IGFN1	91156	broad.mit.edu	37	1	201195001	201195001	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201195001G>T	uc001gwc.2	+	11	2788	c.2016G>T	c.(2014-2016)GGG>GGT	p.G672G	IGFN1_uc001gwb.2_RNA	NM_178275	NP_840059			RecName: Full=Immunoglobulin-like and fibronectin type III domain-containing protein 1; AltName: Full=EEF1A2-binding protein 1; AltName: Full=KY-interacting protein 1;											ovary(2)|pancreas(1)	3																		---	---	---	---	capture		Silent	SNP	201195001	201195001	7891	1	G	T	T	41	41	IGFN1	T	2	2
PIK3C2B	5287	broad.mit.edu	37	1	204409374	204409374	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204409374C>A	uc001haw.2	-	23	3804	c.3325G>T	c.(3325-3327)GGG>TGG	p.G1109W	PIK3C2B_uc010pqv.1_Missense_Mutation_p.G1081W	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1109	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)															---	---	---	---	capture		Missense_Mutation	SNP	204409374	204409374	12334	1	C	A	A	22	22	PIK3C2B	A	2	2
LRRN2	10446	broad.mit.edu	37	1	204587979	204587979	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204587979T>C	uc001hbe.1	-	3	1530	c.1142A>G	c.(1141-1143)AAT>AGT	p.N381S	MDM4_uc001hbd.1_Intron|LRRN2_uc001hbf.1_Missense_Mutation_p.N381S|LRRN2_uc009xbf.1_Missense_Mutation_p.N381S|MDM4_uc001hbc.2_Intron	NM_006338	NP_006329	O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2 precursor	381	Extracellular (Potential).|LRRCT.				cell adhesion	integral to membrane	receptor activity			central_nervous_system(2)	2	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)															---	---	---	---	capture		Missense_Mutation	SNP	204587979	204587979	9411	1	T	C	C	52	52	LRRN2	C	4	4
RCOR3	55758	broad.mit.edu	37	1	211452590	211452590	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211452590G>C	uc001hig.2	+	6	647	c.478G>C	c.(478-480)GTA>CTA	p.V160L	RCOR3_uc010psv.1_RNA|RCOR3_uc001hie.2_Missense_Mutation_p.V218L|RCOR3_uc010psw.1_Missense_Mutation_p.V218L|RCOR3_uc001hif.2_Missense_Mutation_p.V218L	NM_018254	NP_060724	Q9P2K3	RCOR3_HUMAN	REST corepressor 3 isoform d	160					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)														---	---	---	---	capture		Missense_Mutation	SNP	211452590	211452590	13653	1	G	C	C	48	48	RCOR3	C	3	3
USH2A	7399	broad.mit.edu	37	1	215844328	215844328	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215844328C>G	uc001hku.1	-	64	14506	c.14119G>C	c.(14119-14121)GAG>CAG	p.E4707Q		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4707	Fibronectin type-III 32.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)											HNSCC(13;0.011)			---	---	---	---	capture		Missense_Mutation	SNP	215844328	215844328	17598	1	C	G	G	32	32	USH2A	G	3	3
OBSCN	84033	broad.mit.edu	37	1	228494091	228494091	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228494091G>T	uc009xez.1	+	44	11722	c.11678G>T	c.(11677-11679)CGG>CTG	p.R3893L	OBSCN_uc001hsn.2_Missense_Mutation_p.R3893L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	3893	Ig-like 40.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)																---	---	---	---	capture		Missense_Mutation	SNP	228494091	228494091	11217	1	G	T	T	39	39	OBSCN	T	1	1
LYST	1130	broad.mit.edu	37	1	235969541	235969541	+	Silent	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235969541A>T	uc001hxj.2	-	6	3070	c.2895T>A	c.(2893-2895)TCT>TCA	p.S965S	LYST_uc009xgb.1_RNA|LYST_uc010pxs.1_RNA|LYST_uc001hxl.1_Silent_p.S965S	NM_000081	NP_000072	Q99698	LYST_HUMAN	lysosomal trafficking regulator	965					defense response to bacterium|defense response to protozoan|defense response to virus|endosome to lysosome transport via multivesicular body sorting pathway|leukocyte chemotaxis|mast cell secretory granule organization|melanosome organization|natural killer cell mediated cytotoxicity|protein transport	cytoplasm|microtubule cytoskeleton	protein binding			ovary(6)|breast(4)|central_nervous_system(2)	12	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)											Chediak-Higashi_syndrome				---	---	---	---	capture		Silent	SNP	235969541	235969541	9505	1	A	T	T	15	15	LYST	T	4	4
RYR2	6262	broad.mit.edu	37	1	237711812	237711812	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237711812G>A	uc001hyl.1	+	26	3108	c.2988G>A	c.(2986-2988)GTG>GTA	p.V996V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	996	Cytoplasmic (By similarity).|2.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)															---	---	---	---	capture		Silent	SNP	237711812	237711812	14249	1	G	A	A	47	47	RYR2	A	2	2
CNST	163882	broad.mit.edu	37	1	246797278	246797278	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246797278G>A	uc001ibp.2	+	5	1047	c.669G>A	c.(667-669)TTG>TTA	p.L223L	CNST_uc001ibo.3_Silent_p.L223L	NM_152609	NP_689822	Q6PJW8	CNST_HUMAN	hypothetical protein LOC163882 isoform 1	223					positive regulation of Golgi to plasma membrane protein transport	integral to membrane|plasma membrane|protein complex|trans-Golgi network|transport vesicle	connexin binding				0																		---	---	---	---	capture		Silent	SNP	246797278	246797278	3772	1	G	A	A	46	46	CNST	A	2	2
OR2G3	81469	broad.mit.edu	37	1	247769302	247769302	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769302C>A	uc010pyz.1	+	1	415	c.415C>A	c.(415-417)CGG>AGG	p.R139R		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	139	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)															---	---	---	---	capture		Silent	SNP	247769302	247769302	11405	1	C	A	A	19	19	OR2G3	A	1	1
OR11L1	391189	broad.mit.edu	37	1	248004491	248004491	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004491C>A	uc001idn.1	-	1	708	c.708G>T	c.(706-708)AAG>AAT	p.K236N		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	236	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)															---	---	---	---	capture		Missense_Mutation	SNP	248004491	248004491	11336	1	C	A	A	32	32	OR11L1	A	2	2
OR11L1	391189	broad.mit.edu	37	1	248004498	248004498	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004498C>T	uc001idn.1	-	1	701	c.701G>A	c.(700-702)CGG>CAG	p.R234Q		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	234	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)															---	---	---	---	capture		Missense_Mutation	SNP	248004498	248004498	11336	1	C	T	T	23	23	OR11L1	T	1	1
OR2M5	127059	broad.mit.edu	37	1	248308605	248308605	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248308605C>G	uc010pze.1	+	1	156	c.156C>G	c.(154-156)GAC>GAG	p.D52E		NM_001004690	NP_001004690	A3KFT3	OR2M5_HUMAN	olfactory receptor, family 2, subfamily M,	52	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|kidney(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0388)															---	---	---	---	capture		Missense_Mutation	SNP	248308605	248308605	11419	1	C	G	G	17	17	OR2M5	G	3	3
OR2T4	127074	broad.mit.edu	37	1	248525260	248525260	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525260C>T	uc001ieh.1	+	1	378	c.378C>T	c.(376-378)GCC>GCT	p.A126A		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	126	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---	capture		Silent	SNP	248525260	248525260	11433	1	C	T	T	22	22	OR2T4	T	2	2
OR2G6	391211	broad.mit.edu	37	1	248685489	248685489	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685489T>C	uc001ien.1	+	1	542	c.542T>C	c.(541-543)GTG>GCG	p.V181A		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	181	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)															---	---	---	---	capture		Missense_Mutation	SNP	248685489	248685489	11406	1	T	C	C	59	59	OR2G6	C	4	4
GPR158	57512	broad.mit.edu	37	10	25886740	25886740	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25886740A>G	uc001isj.2	+	11	2245	c.2185A>G	c.(2185-2187)AAA>GAA	p.K729E	GPR158_uc001isk.2_Missense_Mutation_p.K104E	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	729	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	25886740	25886740	6938	10	A	G	G	13	13	GPR158	G	4	4
ZNF37A	7587	broad.mit.edu	37	10	38404208	38404208	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38404208G>A	uc001izk.2	+	7	1047	c.228G>A	c.(226-228)CAG>CAA	p.Q76Q	ZNF37A_uc001izl.2_Silent_p.Q76Q|ZNF37A_uc001izm.2_Silent_p.Q76Q	NM_001007094	NP_001007095	P17032	ZN37A_HUMAN	zinc finger protein 37a	76	KRAB.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)	1																		---	---	---	---	capture		Silent	SNP	38404208	38404208	18464	10	G	A	A	33	33	ZNF37A	A	2	2
BMS1	9790	broad.mit.edu	37	10	43285856	43285856	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43285856A>T	uc001jaj.2	+	5	891	c.533A>T	c.(532-534)AAA>ATA	p.K178I		NM_014753	NP_055568	Q14692	BMS1_HUMAN	BMS1-like, ribosome assembly protein	178					ribosome assembly	nucleolus	ATP binding|GTP binding|GTPase activity			ovary(2)|upper_aerodigestive_tract(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	43285856	43285856	1497	10	A	T	T	1	1	BMS1	T	4	4
FRMPD2	143162	broad.mit.edu	37	10	49448458	49448458	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49448458C>T	uc001jgi.2	-	6	752	c.645G>A	c.(643-645)GGG>GGA	p.G215G	FRMPD2_uc001jgh.2_Silent_p.G184G|FRMPD2_uc001jgj.2_Silent_p.G193G	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	215					tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)														---	---	---	---	capture		Silent	SNP	49448458	49448458	6308	10	C	T	T	30	30	FRMPD2	T	2	2
PCDH15	65217	broad.mit.edu	37	10	55698651	55698651	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55698651G>T	uc001jju.1	-	25	3692	c.3297C>A	c.(3295-3297)ACC>ACA	p.T1099T	PCDH15_uc010qhq.1_Silent_p.T1104T|PCDH15_uc010qhr.1_Silent_p.T1099T|PCDH15_uc010qhs.1_Silent_p.T1111T|PCDH15_uc010qht.1_Silent_p.T1106T|PCDH15_uc010qhu.1_Silent_p.T1099T|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.T1099T|PCDH15_uc010qhw.1_Silent_p.T1062T|PCDH15_uc010qhx.1_Silent_p.T1028T|PCDH15_uc010qhy.1_Silent_p.T1104T|PCDH15_uc010qhz.1_Silent_p.T1099T|PCDH15_uc010qia.1_Silent_p.T1077T|PCDH15_uc010qib.1_Silent_p.T1077T	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1099	Cadherin 10.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---	capture		Silent	SNP	55698651	55698651	11931	10	G	T	T	47	47	PCDH15	T	2	2
NDST2	8509	broad.mit.edu	37	10	75567217	75567217	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75567217G>A	uc001jvk.2	-	3	1734	c.930C>T	c.(928-930)GAC>GAT	p.D310D	NDST2_uc010qks.1_5'Flank|NDST2_uc010qkt.1_Silent_p.D187D|NDST2_uc009xro.2_5'Flank|NDST2_uc010qku.1_Silent_p.D187D	NM_003635	NP_003626	P52849	NDST2_HUMAN	heparan glucosaminyl	310	Lumenal (Potential).|Heparan sulfate N-deacetylase 2.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			ovary(1)	1	Prostate(51;0.0112)																	---	---	---	---	capture		Silent	SNP	75567217	75567217	10655	10	G	A	A	44	44	NDST2	A	2	2
SLK	9748	broad.mit.edu	37	10	105758924	105758924	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105758924A>G	uc001kxo.1	+	6	669	c.635A>G	c.(634-636)TAT>TGT	p.Y212C	SLK_uc001kxp.1_Missense_Mutation_p.Y212C	NM_014720	NP_055535	Q9H2G2	SLK_HUMAN	serine/threonine kinase 2	212	Protein kinase.				apoptosis|nucleotide-excision repair	cytoplasm|plasma membrane	ATP binding|DNA binding|nuclease activity|protein serine/threonine kinase activity			ovary(2)|stomach(2)|skin(2)|lung(1)|kidney(1)	8		Colorectal(252;0.178)		Epithelial(162;5.81e-10)|all cancers(201;2.35e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)														---	---	---	---	capture		Missense_Mutation	SNP	105758924	105758924	15246	10	A	G	G	16	16	SLK	G	4	4
PLEKHA1	59338	broad.mit.edu	37	10	124177426	124177426	+	Nonsense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124177426G>A	uc001lge.1	+	8	746	c.623G>A	c.(622-624)TGG>TAG	p.W208*	PLEKHA1_uc001lgf.1_Nonsense_Mutation_p.W208*|PLEKHA1_uc001lgg.1_Nonsense_Mutation_p.W208*|PLEKHA1_uc001lgh.2_Nonsense_Mutation_p.W208*	NM_001001974	NP_001001974	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A	208	PH 2.				B cell receptor signaling pathway|cellular response to hydrogen peroxide|establishment of protein localization|negative regulation of protein kinase B signaling cascade|phosphatidylinositol 3-kinase cascade|ruffle organization	cytoplasm|nucleus|ruffle membrane	PDZ domain binding|phosphatidylinositol-3,4-bisphosphate binding			kidney(1)	1		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)																---	---	---	---	capture		Nonsense_Mutation	SNP	124177426	124177426	12481	10	G	A	A	47	47	PLEKHA1	A	5	2
ADAM12	8038	broad.mit.edu	37	10	127806611	127806611	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127806611C>T	uc001ljk.2	-	6	1021	c.608G>A	c.(607-609)AGA>AAA	p.R203K	ADAM12_uc010qul.1_Missense_Mutation_p.R200K|ADAM12_uc001ljm.2_Missense_Mutation_p.R203K|ADAM12_uc001ljn.2_Missense_Mutation_p.R200K|ADAM12_uc001ljl.3_Missense_Mutation_p.R200K	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	203					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)														---	---	---	---	capture		Missense_Mutation	SNP	127806611	127806611	237	10	C	T	T	32	32	ADAM12	T	2	2
TUBGCP2	10844	broad.mit.edu	37	10	135099108	135099108	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135099108T>C	uc001lmg.1	-	12	2104	c.1747A>G	c.(1747-1749)ATC>GTC	p.I583V	TUBGCP2_uc001lmf.1_Missense_Mutation_p.I176V|TUBGCP2_uc010qvc.1_Missense_Mutation_p.I611V|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Missense_Mutation_p.I453V|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	583					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)														---	---	---	---	capture		Missense_Mutation	SNP	135099108	135099108	17321	10	T	C	C	51	51	TUBGCP2	C	4	4
NUP98	4928	broad.mit.edu	37	11	3789812	3789812	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3789812A>G	uc001lyh.2	-	8	1238	c.947T>C	c.(946-948)ATG>ACG	p.M316T	NUP98_uc001lyi.2_Missense_Mutation_p.M316T|NUP98_uc001lyj.1_Missense_Mutation_p.M316T|NUP98_uc001lyk.1_Missense_Mutation_p.M316T	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	316	Gly/Thr-rich.				carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)				T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								---	---	---	---	capture		Missense_Mutation	SNP	3789812	3789812	11178	11	A	G	G	8	8	NUP98	G	4	4
MMP26	56547	broad.mit.edu	37	11	5010971	5010971	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5010971G>C	uc001lzv.2	+	2	211	c.193G>C	c.(193-195)GGG>CGG	p.G65R		NM_021801	NP_068573	Q9NRE1	MMP26_HUMAN	matrix metalloproteinase 26 preproprotein	65					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)														---	---	---	---	capture		Missense_Mutation	SNP	5010971	5010971	10054	11	G	C	C	47	47	MMP26	C	3	3
OR51L1	119682	broad.mit.edu	37	11	5020271	5020271	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020271C>T	uc010qyu.1	+	1	59	c.59C>T	c.(58-60)CCT>CTT	p.P20L		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	20	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)														---	---	---	---	capture		Missense_Mutation	SNP	5020271	5020271	11512	11	C	T	T	24	24	OR51L1	T	2	2
OR52A5	390054	broad.mit.edu	37	11	5153222	5153222	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153222T>C	uc010qyx.1	-	1	651	c.651A>G	c.(649-651)ATA>ATG	p.I217M		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)														---	---	---	---	capture		Missense_Mutation	SNP	5153222	5153222	11520	11	T	C	C	61	61	OR52A5	C	4	4
UBQLN3	50613	broad.mit.edu	37	11	5529151	5529151	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5529151C>T	uc001may.1	-	2	1724	c.1638G>A	c.(1636-1638)ATG>ATA	p.M546I	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_5'Flank|OR51B5_uc001maq.1_5'Flank	NM_017481	NP_059509	Q9H347	UBQL3_HUMAN	ubiquilin 3	546										ovary(3)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Missense_Mutation	SNP	5529151	5529151	17456	11	C	T	T	25	25	UBQLN3	T	2	2
MRVI1	10335	broad.mit.edu	37	11	10622583	10622583	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10622583C>T	uc010rcc.1	-	15	2285	c.1899G>A	c.(1897-1899)ACG>ACA	p.T633T	MRVI1_uc001miw.2_Silent_p.T624T|MRVI1_uc010rcb.1_Silent_p.T625T|MRVI1_uc009ygb.1_Silent_p.T318T|MRVI1_uc001mix.2_Silent_p.T318T|MRVI1_uc001miz.2_Silent_p.T542T|MRVI1_uc009ygc.1_Silent_p.T542T|MRVI1_uc010rcd.1_Silent_p.T427T|MRVI1_uc009ygd.1_Silent_p.T318T|MRVI1_uc010rce.1_RNA	NM_001100167	NP_001093637	Q9Y6F6	MRVI1_HUMAN	JAW1-related protein isoform c	606	Potential.				platelet activation	endoplasmic reticulum membrane|integral to membrane|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum				ovary(2)|central_nervous_system(1)	3				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)														---	---	---	---	capture		Silent	SNP	10622583	10622583	10246	11	C	T	T	23	23	MRVI1	T	1	1
NAV2	89797	broad.mit.edu	37	11	20101645	20101645	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20101645C>T	uc010rdm.1	+	27	5744	c.5383C>T	c.(5383-5385)CGC>TGC	p.R1795C	NAV2_uc001mpp.2_Missense_Mutation_p.R1675C|NAV2_uc001mpr.3_Missense_Mutation_p.R1739C|NAV2_uc001mpt.2_Missense_Mutation_p.R788C|NAV2_uc009yhx.2_Missense_Mutation_p.R803C|NAV2_uc009yhy.1_Missense_Mutation_p.R701C|NAV2_uc009yhz.2_Missense_Mutation_p.R384C|NAV2_uc001mpu.2_Missense_Mutation_p.R177C	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	1795						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	20101645	20101645	10580	11	C	T	T	23	23	NAV2	T	1	1
LRRC4C	57689	broad.mit.edu	37	11	40136637	40136637	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136637C>A	uc001mxa.1	-	2	3170	c.1206G>T	c.(1204-1206)CGG>CGT	p.R402R	LRRC4C_uc001mxc.1_Silent_p.R398R|LRRC4C_uc001mxd.1_Silent_p.R398R|LRRC4C_uc001mxb.1_Silent_p.R398R	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	402	Ig-like C2-type.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)																---	---	---	---	capture		Silent	SNP	40136637	40136637	9383	11	C	A	A	30	30	LRRC4C	A	2	2
CHST1	8534	broad.mit.edu	37	11	45671652	45671652	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45671652C>A	uc001mys.1	-	4	1493	c.822G>T	c.(820-822)ACG>ACT	p.T274T		NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	274	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			skin(4)|pancreas(1)	5				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)														---	---	---	---	capture		Silent	SNP	45671652	45671652	3531	11	C	A	A	23	23	CHST1	A	1	1
OR4S1	256148	broad.mit.edu	37	11	48328166	48328166	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48328166C>A	uc010rhu.1	+	1	392	c.392C>A	c.(391-393)ACA>AAA	p.T131K		NM_001004725	NP_001004725	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S,	131	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	48328166	48328166	11492	11	C	A	A	17	17	OR4S1	A	2	2
OR4C3	256144	broad.mit.edu	37	11	48347034	48347034	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48347034C>T	uc010rhv.1	+	1	542	c.542C>T	c.(541-543)TCA>TTA	p.S181L		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	154	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	48347034	48347034	11456	11	C	T	T	29	29	OR4C3	T	2	2
OR4C15	81309	broad.mit.edu	37	11	55321832	55321832	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55321832C>T	uc010rig.1	+	1	50	c.50C>T	c.(49-51)ACC>ATC	p.T17I		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	Error:Variant_position_missing_in_Q8NGM1_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2															HNSCC(20;0.049)			---	---	---	---	capture		Missense_Mutation	SNP	55321832	55321832	11454	11	C	T	T	18	18	OR4C15	T	2	2
OR5M1	390168	broad.mit.edu	37	11	56380848	56380848	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56380848C>A	uc001nja.1	-	1	131	c.131G>T	c.(130-132)TGC>TTC	p.C44F		NM_001004740	NP_001004740	Q8NGP8	OR5M1_HUMAN	olfactory receptor, family 5, subfamily M,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	56380848	56380848	11582	11	C	A	A	25	25	OR5M1	A	2	2
OR5B12	390191	broad.mit.edu	37	11	58207613	58207613	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207613G>T	uc010rkh.1	-	1	12	c.12C>A	c.(10-12)AAC>AAA	p.N4K		NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,	4	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)																---	---	---	---	capture		Missense_Mutation	SNP	58207613	58207613	11558	11	G	T	T	48	48	OR5B12	T	2	2
C11orf9	745	broad.mit.edu	37	11	61545903	61545903	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61545903C>G	uc001nsc.1	+	14	2051	c.1955C>G	c.(1954-1956)ACC>AGC	p.T652S	C11orf9_uc001nse.1_Missense_Mutation_p.T643S|C11orf9_uc010rll.1_Missense_Mutation_p.T43S	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	myelin gene regulatory factor isoform 2	652					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	61545903	61545903	1711	11	C	G	G	18	18	C11orf9	G	3	3
PLCB3	5331	broad.mit.edu	37	11	64029467	64029467	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64029467C>A	uc001nzb.2	+	17	1957	c.1957C>A	c.(1957-1959)CGC>AGC	p.R653S	PLCB3_uc009ypg.1_Missense_Mutation_p.R653S|PLCB3_uc009yph.1_Missense_Mutation_p.R586S|PLCB3_uc009ypi.2_Missense_Mutation_p.R653S	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	653	PI-PLC Y-box.				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	64029467	64029467	12455	11	C	A	A	23	23	PLCB3	A	1	1
ZFPL1	7542	broad.mit.edu	37	11	64855447	64855447	+	Missense_Mutation	SNP	C	T	T	rs35212666	byFrequency;by1000genomes	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64855447C>T	uc001ocq.1	+	8	959	c.794C>T	c.(793-795)GCG>GTG	p.A265V		NM_006782	NP_006773	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	265	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|vesicle-mediated transport	Golgi apparatus|integral to membrane|nucleus	DNA binding|zinc ion binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	64855447	64855447	18246	11	C	T	T	27	27	ZFPL1	T	1	1
CAPN1	823	broad.mit.edu	37	11	64972295	64972295	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64972295G>T	uc009yqd.1	+	11	1418	c.1307G>T	c.(1306-1308)CGC>CTC	p.R436L	CAPN1_uc001odf.1_Missense_Mutation_p.R436L|CAPN1_uc001odg.1_Missense_Mutation_p.R436L|CAPN1_uc010roa.1_Missense_Mutation_p.R177L	NM_005186	NP_005177	P07384	CAN1_HUMAN	calpain 1, large subunit	436	Domain III.				positive regulation of cell proliferation|proteolysis	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|protein binding			ovary(1)	1		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)												OREG0021073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	64972295	64972295	2739	11	G	T	T	38	38	CAPN1	T	1	1
CABP4	57010	broad.mit.edu	37	11	67223114	67223114	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67223114C>A	uc001olo.2	+	1	297	c.220C>A	c.(220-222)CCC>ACC	p.P74T	GPR152_uc001olm.2_5'Flank|CABP4_uc001oln.2_Intron	NM_145200	NP_660201	P57796	CABP4_HUMAN	calcium binding protein 4	74					visual perception	cytoplasm|extracellular region|terminal button	calcium ion binding				0			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)															---	---	---	---	capture		Missense_Mutation	SNP	67223114	67223114	2649	11	C	A	A	30	30	CABP4	A	2	2
ANO1	55107	broad.mit.edu	37	11	70007316	70007316	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70007316C>G	uc001opj.2	+	17	1933	c.1628C>G	c.(1627-1629)TCC>TGC	p.S543C	ANO1_uc001opk.1_Missense_Mutation_p.S485C|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.S252C	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	543	Extracellular (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	70007316	70007316	703	11	C	G	G	30	30	ANO1	G	3	3
KCNE3	10008	broad.mit.edu	37	11	74168368	74168368	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74168368G>A	uc001ovc.2	-	3	588	c.241C>T	c.(241-243)CGC>TGC	p.R81C	KCNE3_uc001ovd.2_Missense_Mutation_p.R81C	NM_005472	NP_005463	Q9Y6H6	KCNE3_HUMAN	potassium voltage-gated channel, Isk-related	81	Cytoplasmic (Potential).					integral to membrane	voltage-gated potassium channel activity			ovary(1)	1	Breast(11;2.86e-06)																	---	---	---	---	capture		Missense_Mutation	SNP	74168368	74168368	8329	11	G	A	A	39	39	KCNE3	A	1	1
ME3	10873	broad.mit.edu	37	11	86209149	86209149	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86209149A>G	uc001pbz.2	-	5	815	c.561T>C	c.(559-561)GAT>GAC	p.D187D	ME3_uc001pca.2_Silent_p.D187D|ME3_uc009yvk.2_Silent_p.D187D|ME3_uc010rtr.1_RNA	NM_001014811	NP_001014811	Q16798	MAON_HUMAN	mitochondrial malic enzyme 3 precursor	187					aerobic respiration|malate metabolic process|oxygen metabolic process|pyruvate metabolic process	mitochondrial matrix	malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|metal ion binding|NAD binding			ovary(1)	1		Acute lymphoblastic leukemia(157;4.34e-06)|all_hematologic(158;0.00252)			NADH(DB00157)													---	---	---	---	capture		Silent	SNP	86209149	86209149	9808	11	A	G	G	8	8	ME3	G	4	4
DDI1	414301	broad.mit.edu	37	11	103907805	103907805	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103907805A>G	uc001phr.2	+	1	498	c.255A>G	c.(253-255)CCA>CCG	p.P85P	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	85					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)														---	---	---	---	capture		Silent	SNP	103907805	103907805	4499	11	A	G	G	7	7	DDI1	G	4	4
DDX10	1662	broad.mit.edu	37	11	108712165	108712165	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108712165A>G	uc001pkm.2	+	15	2274	c.2209A>G	c.(2209-2211)AAA>GAA	p.K737E	DDX10_uc001pkl.1_Missense_Mutation_p.K737E	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	737							ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)				T	NUP98	AML*								---	---	---	---	capture		Missense_Mutation	SNP	108712165	108712165	4513	11	A	G	G	5	5	DDX10	G	4	4
OR8B2	26595	broad.mit.edu	37	11	124253019	124253019	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124253019G>T	uc010sai.1	-	1	221	c.221C>A	c.(220-222)TCC>TAC	p.S74Y	OR8B2_uc001qab.3_RNA	NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)														---	---	---	---	capture		Missense_Mutation	SNP	124253019	124253019	11638	11	G	T	T	41	41	OR8B2	T	2	2
OR8B3	390271	broad.mit.edu	37	11	124267027	124267027	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124267027G>T	uc010saj.1	-	1	221	c.221C>A	c.(220-222)TCC>TAC	p.S74Y	OR8B2_uc001qab.3_Intron	NM_001005467	NP_001005467	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)														---	---	---	---	capture		Missense_Mutation	SNP	124267027	124267027	11639	11	G	T	T	41	41	OR8B3	T	2	2
CHEK1	1111	broad.mit.edu	37	11	125505413	125505413	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125505413G>T	uc009zbo.2	+	7	1595	c.703G>T	c.(703-705)GAT>TAT	p.D235Y	CHEK1_uc010sbh.1_Missense_Mutation_p.D251Y|CHEK1_uc010sbi.1_Missense_Mutation_p.D235Y|CHEK1_uc001qcf.3_Missense_Mutation_p.D235Y|CHEK1_uc009zbp.2_Missense_Mutation_p.D235Y|CHEK1_uc001qcg.3_Missense_Mutation_p.D235Y|CHEK1_uc009zbq.2_Missense_Mutation_p.D235Y|CHEK1_uc001qci.1_RNA	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	235	Protein kinase.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)									Other_conserved_DNA_damage_response_genes					---	---	---	---	capture		Missense_Mutation	SNP	125505413	125505413	3468	11	G	T	T	37	37	CHEK1	T	1	1
STYK1	55359	broad.mit.edu	37	12	10783902	10783902	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10783902C>A	uc001qys.2	-	5	714	c.193G>T	c.(193-195)GCC>TCC	p.A65S		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	65						integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8															HNSCC(73;0.22)			---	---	---	---	capture		Missense_Mutation	SNP	10783902	10783902	15879	12	C	A	A	25	25	STYK1	A	2	2
LRRK2	120892	broad.mit.edu	37	12	40722188	40722188	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40722188C>G	uc001rmg.3	+	39	5804	c.5683C>G	c.(5683-5685)CGA>GGA	p.R1895G	LRRK2_uc009zjw.2_Missense_Mutation_p.R733G|LRRK2_uc001rmi.2_Missense_Mutation_p.R728G	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1895	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---	capture		Missense_Mutation	SNP	40722188	40722188	9409	12	C	G	G	23	23	LRRK2	G	3	3
PRICKLE1	144165	broad.mit.edu	37	12	42853747	42853747	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42853747C>T	uc010skv.1	-	8	2647	c.2360G>A	c.(2359-2361)CGG>CAG	p.R787Q	PRICKLE1_uc001rnl.2_Missense_Mutation_p.R787Q|PRICKLE1_uc010skw.1_Missense_Mutation_p.R787Q|PRICKLE1_uc001rnm.2_Missense_Mutation_p.R787Q|PRICKLE1_uc001rnk.1_5'Flank	NM_001144881	NP_001138353	Q96MT3	PRIC1_HUMAN	prickle homolog 1	787					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cardiac muscle cell myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein import into nucleus	cytosol|nuclear membrane	zinc ion binding			ovary(3)|skin(1)	4	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)														---	---	---	---	capture		Missense_Mutation	SNP	42853747	42853747	12929	12	C	T	T	23	23	PRICKLE1	T	1	1
OR10AD1	121275	broad.mit.edu	37	12	48596351	48596351	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48596351C>G	uc001rrl.1	-	1	725	c.725G>C	c.(724-726)TGT>TCT	p.C242S		NM_001004134	NP_001004134	Q8NGE0	O10AD_HUMAN	olfactory receptor, family 10, subfamily AD,	242	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	48596351	48596351	11302	12	C	G	G	17	17	OR10AD1	G	3	3
MLL2	8085	broad.mit.edu	37	12	49444120	49444120	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49444120G>A	uc001rta.3	-	11	3251	c.3251C>T	c.(3250-3252)CCA>CTA	p.P1084L		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1084	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41								N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			---	---	---	---	capture		Missense_Mutation	SNP	49444120	49444120	10011	12	G	A	A	47	47	MLL2	A	2	2
HNRNPA1	3178	broad.mit.edu	37	12	54675662	54675662	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54675662G>C	uc001sfl.2	+	3	320	c.216G>C	c.(214-216)ATG>ATC	p.M72I	CBX5_uc001sfk.3_5'Flank|CBX5_uc001sfi.3_5'Flank|HNRNPA1_uc001sfm.2_Missense_Mutation_p.M72I|HNRNPA1_uc009zng.2_Missense_Mutation_p.M72I|HNRNPA1_uc009znh.2_Missense_Mutation_p.M72I|HNRNPA1_uc009zni.2_Missense_Mutation_p.M72I|HNRNPA1_uc001sfn.2_Missense_Mutation_p.M72I|HNRNPA1_uc001sfo.3_RNA|HNRNPA1_uc001sfp.1_Missense_Mutation_p.M27I|HNRNPA1_uc009znj.1_Missense_Mutation_p.M27I	NM_031157	NP_112420	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	72	Globular A domain.|RRM 1.				interspecies interaction between organisms|mRNA transport|nuclear import	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|single-stranded DNA binding			skin(2)|ovary(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	54675662	54675662	7549	12	G	C	C	45	45	HNRNPA1	C	3	3
TIMELESS	8914	broad.mit.edu	37	12	56811541	56811541	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56811541T>G	uc001slf.2	-	29	3754	c.3586A>C	c.(3586-3588)AAG>CAG	p.K1196Q		NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog	1196					cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	56811541	56811541	16433	12	T	G	G	64	64	TIMELESS	G	4	4
PTPRB	5787	broad.mit.edu	37	12	71029792	71029792	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71029792T>C	uc001swc.3	-	2	154	c.110A>G	c.(109-111)AAA>AGA	p.K37R	PTPRB_uc001swa.3_Missense_Mutation_p.K37R|PTPRB_uc001swd.3_Missense_Mutation_p.K36R|PTPRB_uc009zrr.1_Missense_Mutation_p.K37R|PTPRB_uc001swe.2_Missense_Mutation_p.K37R	NM_001109754	NP_001103224	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	Error:Variant_position_missing_in_P23467_after_alignment					angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)															---	---	---	---	capture		Missense_Mutation	SNP	71029792	71029792	13253	12	T	C	C	64	64	PTPRB	C	4	4
KCNC2	3747	broad.mit.edu	37	12	75444647	75444647	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75444647T>A	uc001sxg.1	-	3	1682	c.1138A>T	c.(1138-1140)AAT>TAT	p.N380Y	KCNC2_uc009zry.2_Missense_Mutation_p.N380Y|KCNC2_uc001sxe.2_Missense_Mutation_p.N380Y|KCNC2_uc001sxf.2_Missense_Mutation_p.N380Y|KCNC2_uc010stw.1_Missense_Mutation_p.N380Y	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	380	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	75444647	75444647	8320	12	T	A	A	61	61	KCNC2	A	4	4
NAV3	89795	broad.mit.edu	37	12	78400393	78400393	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78400393C>T	uc001syp.2	+	8	1248	c.1075C>T	c.(1075-1077)CCC>TCC	p.P359S	NAV3_uc001syo.2_Missense_Mutation_p.P359S	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	359						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17															HNSCC(70;0.22)			---	---	---	---	capture		Missense_Mutation	SNP	78400393	78400393	10581	12	C	T	T	22	22	NAV3	T	2	2
ATP2B1	490	broad.mit.edu	37	12	90013882	90013882	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90013882C>G	uc001tbh.2	-	10	1904	c.1723G>C	c.(1723-1725)GTC>CTC	p.V575L	ATP2B1_uc001tbg.2_Missense_Mutation_p.V575L|ATP2B1_uc001tbf.2_Missense_Mutation_p.V245L	NM_001682	NP_001673	P20020	AT2B1_HUMAN	plasma membrane calcium ATPase 1 isoform 1b	575	Cytoplasmic (Potential).				ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	90013882	90013882	1158	12	C	G	G	20	20	ATP2B1	G	3	3
C12orf74	338809	broad.mit.edu	37	12	93100489	93100489	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93100489C>T	uc001tch.1	+	2	312	c.82C>T	c.(82-84)CCA>TCA	p.P28S	C12orf74_uc001tci.2_Missense_Mutation_p.P28S	NM_001037671	NP_001032760	Q32Q52	CL074_HUMAN	hypothetical protein LOC338809	28											0																		---	---	---	---	capture		Missense_Mutation	SNP	93100489	93100489	1760	12	C	T	T	26	26	C12orf74	T	2	2
UHRF1BP1L	23074	broad.mit.edu	37	12	100444968	100444968	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100444968C>A	uc001tgq.2	-	16	3685	c.3456G>T	c.(3454-3456)AGG>AGT	p.R1152S	UHRF1BP1L_uc001tgp.2_Missense_Mutation_p.R802S	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	1152										ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	100444968	100444968	17527	12	C	A	A	22	22	UHRF1BP1L	A	2	2
GPR109B	8843	broad.mit.edu	37	12	123200902	123200902	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123200902C>A	uc001ucy.3	-	1	538	c.383G>T	c.(382-384)CGG>CTG	p.R128L	GPR81_uc001ucw.1_Intron	NM_006018	NP_006009	P49019	HCAR3_HUMAN	G protein-coupled receptor 109B	128	Cytoplasmic (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)|skin(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.12e-05)|Epithelial(86;3.19e-05)|BRCA - Breast invasive adenocarcinoma(302;0.196)	Mepenzolate(DB04843)|Niacin(DB00627)													---	---	---	---	capture		Missense_Mutation	SNP	123200902	123200902	6900	12	C	A	A	23	23	GPR109B	A	1	1
TMEM132B	114795	broad.mit.edu	37	12	125834780	125834780	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125834780G>C	uc001uhe.1	+	2	843	c.835G>C	c.(835-837)GAC>CAC	p.D279H		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	279	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)														---	---	---	---	capture		Missense_Mutation	SNP	125834780	125834780	16577	12	G	C	C	41	41	TMEM132B	C	3	3
PIWIL1	9271	broad.mit.edu	37	12	130827577	130827577	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130827577C>A	uc001uik.2	+	3	211	c.121C>A	c.(121-123)CCA>ACA	p.P41T	PIWIL1_uc001uij.1_Missense_Mutation_p.P41T	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	41					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)														---	---	---	---	capture		Missense_Mutation	SNP	130827577	130827577	12381	12	C	A	A	18	18	PIWIL1	A	2	2
RIMBP2	23504	broad.mit.edu	37	12	130926407	130926407	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130926407G>C	uc001uil.2	-	8	1603	c.1439C>G	c.(1438-1440)TCC>TGC	p.S480C	RIMBP2_uc001uim.2_Missense_Mutation_p.S388C|RIMBP2_uc001uin.1_Missense_Mutation_p.S139C	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	480						cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)														---	---	---	---	capture		Missense_Mutation	SNP	130926407	130926407	13838	12	G	C	C	41	41	RIMBP2	C	3	3
B3GALTL	145173	broad.mit.edu	37	13	31891773	31891773	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31891773G>T	uc010aaz.2	+	13	1245	c.1135G>T	c.(1135-1137)GGC>TGC	p.G379C	B3GALTL_uc001utn.3_RNA	NM_194318	NP_919299	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	379	Lumenal (Potential).				fucose metabolic process	endoplasmic reticulum membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)	2		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)														---	---	---	---	capture		Missense_Mutation	SNP	31891773	31891773	1273	13	G	T	T	39	39	B3GALTL	T	1	1
PHF11	51131	broad.mit.edu	37	13	50096223	50096223	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50096223C>A	uc001vdb.2	+	6	887	c.550C>A	c.(550-552)CTC>ATC	p.L184I	PHF11_uc001vdc.2_Missense_Mutation_p.L145I|PHF11_uc001vdd.2_RNA	NM_001040443	NP_001035533	Q9UIL8	PHF11_HUMAN	PHD finger protein 11 isoform a	184					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)														---	---	---	---	capture		Missense_Mutation	SNP	50096223	50096223	12245	13	C	A	A	24	24	PHF11	A	2	2
MYCBP2	23077	broad.mit.edu	37	13	77748550	77748550	+	Silent	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77748550T>A	uc001vkf.2	-	38	5524	c.5433A>T	c.(5431-5433)ACA>ACT	p.T1811T	MYCBP2_uc010aev.2_Silent_p.T1215T	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1811					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)														---	---	---	---	capture		Silent	SNP	77748550	77748550	10413	13	T	A	A	55	55	MYCBP2	A	4	4
ING1	3621	broad.mit.edu	37	13	111368196	111368196	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111368196G>T	uc001vri.2	+	1	838	c.406G>T	c.(406-408)GGG>TGG	p.G136W	CARS2_uc010tjm.1_5'Flank|uc001vre.2_5'Flank|ING1_uc001vrf.2_Intron|ING1_uc001vrg.2_Intron|ING1_uc001vrh.2_Intron	NM_005537	NP_005528	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1 isoform D	136					cell cycle|negative regulation of cell growth|negative regulation of cell proliferation	nucleus	zinc ion binding			ovary(1)	1	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)															---	---	---	---	capture		Missense_Mutation	SNP	111368196	111368196	8036	13	G	T	T	39	39	ING1	T	1	1
C14orf115	55237	broad.mit.edu	37	14	74824821	74824821	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74824821G>T	uc001xpw.3	+	2	1526	c.1335G>T	c.(1333-1335)CGG>CGT	p.R445R		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	445					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)														---	---	---	---	capture		Silent	SNP	74824821	74824821	1788	14	G	T	T	41	41	C14orf115	T	2	2
C14orf166B	145497	broad.mit.edu	37	14	77318716	77318716	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77318716G>C	uc001xsx.2	+	8	850	c.736G>C	c.(736-738)GTG>CTG	p.V246L	C14orf166B_uc010asn.1_Missense_Mutation_p.V6L|C14orf166B_uc001xsw.2_RNA|C14orf166B_uc010tvg.1_RNA|C14orf166B_uc010tvh.1_RNA	NM_194287	NP_919263	Q0VAA2	CN16B_HUMAN	hypothetical protein LOC145497	246											0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)														---	---	---	---	capture		Missense_Mutation	SNP	77318716	77318716	1805	14	G	C	C	40	40	C14orf166B	C	3	3
OCA2	4948	broad.mit.edu	37	15	28202871	28202871	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28202871G>T	uc001zbh.3	-	16	1757	c.1647C>A	c.(1645-1647)CAC>CAA	p.H549Q	OCA2_uc010ayv.2_Missense_Mutation_p.H525Q	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	549	Cytoplasmic (Potential).		H -> Q (in OCA2).		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)										Oculocutaneous_Albinism				---	---	---	---	capture		Missense_Mutation	SNP	28202871	28202871	11220	15	G	T	T	40	40	OCA2	T	1	1
BUB1B	701	broad.mit.edu	37	15	40498502	40498502	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40498502G>C	uc001zkx.3	+	15	2064	c.1852G>C	c.(1852-1854)GTA>CTA	p.V618L	BUB1B_uc010ucl.1_Missense_Mutation_p.V486L	NM_001211	NP_001202	O60566	BUB1B_HUMAN	budding uninhibited by benzimidazoles 1 beta	618					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell division|cell proliferation|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|phosphatidylinositol-mediated signaling|protein localization to kinetochore|spindle organization	anaphase-promoting complex|condensed chromosome outer kinetochore|cytosol|microtubule organizing center|perinuclear region of cytoplasm|spindle midzone	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|kidney(1)	4		all_cancers(109;1.12e-18)|all_epithelial(112;1.61e-15)|Lung NSC(122;5.63e-11)|all_lung(180;1.4e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0556)				Mis|N|F|S			rhabdomyosarcoma			Mosaic_Variegated_Aneuploidy_Syndrome				---	---	---	---	capture		Missense_Mutation	SNP	40498502	40498502	1605	15	G	C	C	48	48	BUB1B	C	3	3
FBN1	2200	broad.mit.edu	37	15	48789500	48789500	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48789500T>C	uc001zwx.1	-	19	2584	c.2256A>G	c.(2254-2256)TCA>TCG	p.S752S		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	752	EGF-like 11; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)														---	---	---	---	capture		Silent	SNP	48789500	48789500	5938	15	T	C	C	55	55	FBN1	C	4	4
GABPB1	2553	broad.mit.edu	37	15	50570937	50570937	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50570937T>G	uc001zyb.2	-	9	1504	c.1080A>C	c.(1078-1080)GAA>GAC	p.E360D	GABPB1_uc001zya.2_Missense_Mutation_p.E348D|GABPB1_uc010ufg.1_Missense_Mutation_p.E284D	NM_005254	NP_005245	Q06547	GABP1_HUMAN	GA binding protein transcription factor, beta	360					positive regulation of transcription from RNA polymerase II promoter	nucleus	protein binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			large_intestine(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	50570937	50570937	6409	15	T	G	G	56	56	GABPB1	G	4	4
UNC13C	440279	broad.mit.edu	37	15	54825265	54825265	+	Splice_Site	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54825265G>T	uc002ack.2	+	24	5696	c.5696_splice	c.e24+1	p.T1899_splice		NM_001080534	NP_001074003			unc-13 homolog C						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---	capture		Splice_Site	SNP	54825265	54825265	17544	15	G	T	T	40	40	UNC13C	T	5	1
DIS3L	115752	broad.mit.edu	37	15	66604126	66604126	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66604126A>T	uc010ujm.1	+	5	638	c.623A>T	c.(622-624)CAG>CTG	p.Q208L	DIS3L_uc010ujl.1_5'UTR|DIS3L_uc002app.2_Missense_Mutation_p.Q125L|DIS3L_uc002apq.2_Missense_Mutation_p.Q208L|DIS3L_uc010bho.2_Missense_Mutation_p.Q74L	NM_001143688	NP_001137160	Q8TF46	DI3L1_HUMAN	DIS3 mitotic control homolog (S.	208					rRNA catabolic process	cytoplasm|exosome (RNase complex)	exonuclease activity|protein binding|ribonuclease activity|RNA binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	66604126	66604126	4715	15	A	T	T	7	7	DIS3L	T	4	4
MAP2K1	5604	broad.mit.edu	37	15	66727503	66727503	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66727503G>A	uc010bhq.2	+	2	694	c.219G>A	c.(217-219)GAG>GAA	p.E73E	MAP2K1_uc010ujp.1_Silent_p.E51E	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	73	Protein kinase.				activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0														Cardiofaciocutaneous_syndrome				---	---	---	---	capture		Silent	SNP	66727503	66727503	9619	15	G	A	A	34	34	MAP2K1	A	2	2
IQCH	64799	broad.mit.edu	37	15	67681239	67681239	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67681239A>G	uc002aqo.1	+	12	1574	c.1527A>G	c.(1525-1527)AAA>AAG	p.K509K	IQCH_uc002aqq.1_Silent_p.K257K|IQCH_uc002aqp.1_Silent_p.K261K	NM_001031715	NP_001026885	Q86VS3	IQCH_HUMAN	IQ motif containing H isoform 1	509										skin(3)|ovary(1)	4				Colorectal(3;0.0856)														---	---	---	---	capture		Silent	SNP	67681239	67681239	8114	15	A	G	G	1	1	IQCH	G	4	4
PAQR5	54852	broad.mit.edu	37	15	69677203	69677203	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69677203G>A	uc002arz.2	+	5	745	c.367G>A	c.(367-369)GTC>ATC	p.V123I	PAQR5_uc002asa.2_Missense_Mutation_p.V123I	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	123	Helical; Name=3; (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	69677203	69677203	11855	15	G	A	A	40	40	PAQR5	A	1	1
MYO9A	4649	broad.mit.edu	37	15	72170530	72170530	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72170530G>T	uc002atl.3	-	31	6255	c.5782C>A	c.(5782-5784)CTA>ATA	p.L1928I	MYO9A_uc002atk.2_Missense_Mutation_p.L723I|MYO9A_uc002atm.1_Missense_Mutation_p.L724I	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	1928	Tail.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	72170530	72170530	10479	15	G	T	T	36	36	MYO9A	T	2	2
PARP6	56965	broad.mit.edu	37	15	72533854	72533854	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72533854T>C	uc002auc.2	-	23	2294	c.1835A>G	c.(1834-1836)GAC>GGC	p.D612G	PARP6_uc002aua.2_Missense_Mutation_p.D458G|PARP6_uc002aub.2_RNA|PARP6_uc002aud.3_RNA	NM_020214	NP_064599	Q2NL67	PARP6_HUMAN	poly (ADP-ribose) polymerase family, member 6	612	PARP catalytic.						NAD+ ADP-ribosyltransferase activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	72533854	72533854	11881	15	T	C	C	58	58	PARP6	C	4	4
HCN4	10021	broad.mit.edu	37	15	73635889	73635889	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73635889G>A	uc002avp.2	-	2	2040	c.1046C>T	c.(1045-1047)TCC>TTC	p.S349F		NM_005477	NP_005468	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic	349	Helical; Name=Segment S3; (Potential).				blood circulation|muscle contraction	integral to membrane	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity			ovary(5)|liver(1)	6				COAD - Colon adenocarcinoma(1;0.142)														---	---	---	---	capture		Missense_Mutation	SNP	73635889	73635889	7281	15	G	A	A	41	41	HCN4	A	2	2
C15orf59	388135	broad.mit.edu	37	15	74032896	74032896	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74032896A>T	uc002avy.2	-	2	589	c.244T>A	c.(244-246)TCT>ACT	p.S82T		NM_001039614	NP_001034703	Q2T9L4	CO059_HUMAN	hypothetical protein LOC388135	82										pancreas(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	74032896	74032896	1857	15	A	T	T	11	11	C15orf59	T	4	4
LINGO1	84894	broad.mit.edu	37	15	77906692	77906692	+	Silent	SNP	G	C	C	rs61737307	by1000genomes	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77906692G>C	uc002bct.1	-	2	1609	c.1557C>G	c.(1555-1557)CCC>CCG	p.P519P	LINGO1_uc002bcu.1_Silent_p.P513P	NM_032808	NP_116197	Q96FE5	LIGO1_HUMAN	leucine-rich repeat neuronal 6A	519	Extracellular (Potential).				negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	integral to membrane|plasma membrane				ovary(1)|lung(1)	2																		---	---	---	---	capture		Silent	SNP	77906692	77906692	9141	15	G	C	C	39	39	LINGO1	C	3	3
IL16	3603	broad.mit.edu	37	15	81601090	81601090	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81601090G>A	uc002bgh.3	+	19	4326	c.3950G>A	c.(3949-3951)AGG>AAG	p.R1317K	IL16_uc002bge.3_RNA|IL16_uc010unp.1_Missense_Mutation_p.R1358K|IL16_uc002bgg.2_Missense_Mutation_p.R1316K|IL16_uc002bgj.2_Missense_Mutation_p.R810K|IL16_uc002bgk.2_Missense_Mutation_p.R616K	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2	1317	PDZ 4.				immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	81601090	81601090	7934	15	G	A	A	35	35	IL16	A	2	2
HBA2	3040	broad.mit.edu	37	16	227341	227341	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:227341T>C	uc002cfw.2	+	3	426	c.360T>C	c.(358-360)CCT>CCC	p.P120P	HBA1_uc002cfx.1_Silent_p.P120P|HBA1_uc002cfy.1_Silent_p.P88P|HBQ1_uc002cfz.2_5'Flank	NM_000558	NP_000549	P69905	HBA_HUMAN	alpha 1 globin	120					hydrogen peroxide catabolic process|positive regulation of cell death|protein heterooligomerization	cytosolic small ribosomal subunit|haptoglobin-hemoglobin complex|hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity|protein binding				0		all_cancers(16;2.03e-06)|all_epithelial(16;5.16e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0138)|all_lung(18;0.0306)			Amodiaquine(DB00613)|Chloroquine(DB00608)|Iron Dextran(DB00893)|Mefloquine(DB00358)|Primaquine(DB01087)|Quinine(DB00468)											OREG0003687	type=REGULATORY REGION|Gene=SERPINB9|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	---	---	---	---	capture		Silent	SNP	227341	227341	7259	16	T	C	C	55	55	HBA2	C	4	4
PDIA2	64714	broad.mit.edu	37	16	335151	335151	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:335151G>C	uc002cgn.1	+	10	1854	c.746G>C	c.(745-747)CGC>CCC	p.R249P	PDIA2_uc010bqt.1_Missense_Mutation_p.R94P|PDIA2_uc002cgo.1_Missense_Mutation_p.R249P	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor	249					apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)																---	---	---	---	capture		Missense_Mutation	SNP	335151	335151	12089	16	G	C	C	38	38	PDIA2	C	3	3
WDR90	197335	broad.mit.edu	37	16	708597	708597	+	Missense_Mutation	SNP	G	T	T	rs142498602	by1000genomes	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:708597G>T	uc002cii.1	+	23	2893	c.2839G>T	c.(2839-2841)GCC>TCC	p.A947S	WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.A474S|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Missense_Mutation_p.A121S|WDR90_uc002cin.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	947	WD 10.									ovary(1)	1		Hepatocellular(780;0.0218)																---	---	---	---	capture		Missense_Mutation	SNP	708597	708597	17911	16	G	T	T	38	38	WDR90	T	1	1
TBL3	10607	broad.mit.edu	37	16	2026220	2026220	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2026220C>A	uc002cnu.1	+	13	1299	c.1197C>A	c.(1195-1197)AGC>AGA	p.S399R	TBL3_uc002cnv.1_Missense_Mutation_p.S285R|TBL3_uc010bsb.1_Missense_Mutation_p.S188R|TBL3_uc010bsc.1_Missense_Mutation_p.S285R|TBL3_uc010uvt.1_5'UTR|TBL3_uc002cnw.1_5'Flank	NM_006453	NP_006444	Q12788	TBL3_HUMAN	transducin beta-like 3	399	WD 8.				G-protein signaling, coupled to cGMP nucleotide second messenger|rRNA processing	nucleolus|small-subunit processome	receptor signaling protein activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	2026220	2026220	16169	16	C	A	A	27	27	TBL3	A	1	1
SALL1	6299	broad.mit.edu	37	16	51175301	51175301	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51175301A>G	uc010vgs.1	-	2	863	c.832T>C	c.(832-834)TCT>CCT	p.S278P	SALL1_uc010vgr.1_Missense_Mutation_p.S181P|SALL1_uc010cbv.2_Intron	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	278					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)															---	---	---	---	capture		Missense_Mutation	SNP	51175301	51175301	14290	16	A	G	G	12	12	SALL1	G	4	4
CDH11	1009	broad.mit.edu	37	16	65022115	65022115	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65022115G>T	uc002eoi.2	-	7	1378	c.944C>A	c.(943-945)TCG>TAG	p.S315*	CDH11_uc010cdn.2_Intron|CDH11_uc002eoj.2_Nonsense_Mutation_p.S315*|CDH11_uc010vin.1_Nonsense_Mutation_p.S189*	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	315	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)				T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			---	---	---	---	capture		Nonsense_Mutation	SNP	65022115	65022115	3226	16	G	T	T	37	37	CDH11	T	5	1
FUK	197258	broad.mit.edu	37	16	70505156	70505156	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70505156C>A	uc002eyy.2	+	13	1300	c.1242C>A	c.(1240-1242)GGC>GGA	p.G414G	FUK_uc010cft.2_Silent_p.G446G|FUK_uc002eyz.2_5'UTR	NM_145059	NP_659496	Q8N0W3	FUK_HUMAN	fucokinase	414						cytoplasm	ATP binding|fucokinase activity			ovary(1)	1		Ovarian(137;0.0694)																---	---	---	---	capture		Silent	SNP	70505156	70505156	6347	16	C	A	A	26	26	FUK	A	2	2
MON1B	22879	broad.mit.edu	37	16	77228951	77228951	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77228951G>T	uc002fez.2	+	4	1525	c.1195G>T	c.(1195-1197)GCC>TCC	p.A399S	MON1B_uc010vnf.1_Missense_Mutation_p.A290S|MON1B_uc010vng.1_Missense_Mutation_p.A253S|MON1B_uc002ffa.2_Missense_Mutation_p.A279S	NM_014940	NP_055755	Q7L1V2	MON1B_HUMAN	MON1 homolog B	399							protein binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	77228951	77228951	10090	16	G	T	T	46	46	MON1B	T	2	2
FOXC2	2303	broad.mit.edu	37	16	86601098	86601098	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86601098G>A	uc002fjq.2	+	1	242	c.157G>A	c.(157-159)GGC>AGC	p.G53S		NM_005251	NP_005242	Q99958	FOXC2_HUMAN	forkhead box C2	53					anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding				0														Late-onset_Hereditary_Lymphedema				---	---	---	---	capture		Missense_Mutation	SNP	86601098	86601098	6237	16	G	A	A	43	43	FOXC2	A	2	2
TP53	7157	broad.mit.edu	37	17	7579485	7579485	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579485C>A	uc002gim.2	-	4	396	c.202G>T	c.(202-204)GAG>TAG	p.E68*	TP53_uc002gig.1_Nonsense_Mutation_p.E68*|TP53_uc002gih.2_Nonsense_Mutation_p.E68*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Nonsense_Mutation_p.E68*|TP53_uc010cni.1_Nonsense_Mutation_p.E68*|TP53_uc002gij.2_Nonsense_Mutation_p.E68*|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Nonsense_Mutation_p.E29*|TP53_uc010cnk.1_Nonsense_Mutation_p.E83*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	68	Interaction with WWOX.|Interaction with HRMT1L2.		E -> Q (in a sporadic cancer; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.E68*(4)|p.G59fs*23(3)|p.E68G(2)|p.E68fs*55(2)|p.E68fs*76(1)|p.D48fs*55(1)|p.R65_P71delRMPEAAP(1)|p.E68fs*81(1)|p.P13fs*18(1)|p.R65fs*38(1)|p.D57_A76del20(1)|p.E68Q(1)|p.S33fs*23(1)|p.M66fs*80(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---	capture		Nonsense_Mutation	SNP	7579485	7579485	16923	17	C	A	A	32	32	TP53	A	5	2
MYH1	4619	broad.mit.edu	37	17	10400464	10400464	+	Silent	SNP	G	T	T	rs61730796		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10400464G>T	uc002gmo.2	-	33	4672	c.4578C>A	c.(4576-4578)CGC>CGA	p.R1526R	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1526	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---	capture		Silent	SNP	10400464	10400464	10424	17	G	T	T	46	46	MYH1	T	2	2
KCNJ12	3768	broad.mit.edu	37	17	21319347	21319347	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21319347G>T	uc002gyv.1	+	3	1398	c.693G>T	c.(691-693)CAG>CAT	p.Q231H		NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily	231	Cytoplasmic (By similarity).				blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)										Prostate(3;0.18)			---	---	---	---	capture		Missense_Mutation	SNP	21319347	21319347	8351	17	G	T	T	34	34	KCNJ12	T	2	2
SUPT6H	6830	broad.mit.edu	37	17	27011603	27011603	+	Splice_Site	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27011603G>T	uc002hby.2	+	18	2320	c.2230_splice	c.e18-1	p.A744_splice	SUPT6H_uc010crt.2_Splice_Site_p.A744_splice	NM_003170	NP_003161			suppressor of Ty 6 homolog						chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)																	---	---	---	---	capture		Splice_Site	SNP	27011603	27011603	15920	17	G	T	T	35	35	SUPT6H	T	5	2
SPACA3	124912	broad.mit.edu	37	17	31324532	31324532	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:31324532T>A	uc002hhs.1	+	4	647	c.572T>A	c.(571-573)CTG>CAG	p.L191Q	SPACA3_uc010cte.1_RNA	NM_173847	NP_776246	Q8IXA5	SACA3_HUMAN	sperm acrosome associated 3	191	Extracellular (Potential).				cell wall macromolecule catabolic process|defense response to Gram-positive bacterium|monocyte activation|peptidoglycan catabolic process|positive regulation of macrophage activation|positive regulation of phagocytosis|response to virus	acrosomal membrane|extracellular region|integral to membrane|lysosome	bacterial cell surface binding|lysozyme activity|protein binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.193)															---	---	---	---	capture		Missense_Mutation	SNP	31324532	31324532	15474	17	T	A	A	55	55	SPACA3	A	4	4
ACACA	31	broad.mit.edu	37	17	35598928	35598928	+	Silent	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35598928C>G	uc002hnm.2	-	23	3053	c.2862G>C	c.(2860-2862)CGG>CGC	p.R954R	ACACA_uc002hnk.2_Silent_p.R876R|ACACA_uc002hnl.2_Silent_p.R896R|ACACA_uc002hnn.2_Silent_p.R954R|ACACA_uc002hno.2_Silent_p.R991R|ACACA_uc010cuz.2_Silent_p.R954R	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	954					acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---	capture		Silent	SNP	35598928	35598928	107	17	C	G	G	30	30	ACACA	G	3	3
MED1	5469	broad.mit.edu	37	17	37564252	37564252	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37564252C>T	uc002hrv.3	-	17	4434	c.4222G>A	c.(4222-4224)GTG>ATG	p.V1408M	MED1_uc010wee.1_Missense_Mutation_p.V1236M|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	1408	Ser-rich.|Interaction with TP53.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)											HNSCC(31;0.082)			---	---	---	---	capture		Missense_Mutation	SNP	37564252	37564252	9814	17	C	T	T	20	20	MED1	T	2	2
KRT36	8689	broad.mit.edu	37	17	39645861	39645861	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39645861C>T	uc002hwt.2	-	1	256	c.256G>A	c.(256-258)GAG>AAG	p.E86K		NM_003771	NP_003762	O76013	KRT36_HUMAN	keratin 36	86	Head.					intermediate filament	protein binding|structural constituent of epidermis				0		Breast(137;0.000286)																---	---	---	---	capture		Missense_Mutation	SNP	39645861	39645861	8788	17	C	T	T	31	31	KRT36	T	1	1
EZH1	2145	broad.mit.edu	37	17	40880898	40880898	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40880898G>T	uc002iaz.2	-	3	207	c.62C>A	c.(61-63)TCT>TAT	p.S21Y	EZH1_uc002iba.2_Missense_Mutation_p.S21Y|EZH1_uc010wgt.1_Intron|EZH1_uc010wgu.1_Missense_Mutation_p.S27Y|EZH1_uc010wgv.1_Missense_Mutation_p.S21Y|EZH1_uc010wgw.1_Translation_Start_Site|EZH1_uc010cyp.2_Translation_Start_Site|EZH1_uc010cyq.2_Missense_Mutation_p.S21Y|EZH1_uc010cys.2_Missense_Mutation_p.S21Y	NM_001991	NP_001982	Q92800	EZH1_HUMAN	enhancer of zeste homolog 1	21					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	chromatin binding|DNA binding			ovary(3)	3		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0784)														---	---	---	---	capture		Missense_Mutation	SNP	40880898	40880898	5527	17	G	T	T	33	33	EZH1	T	2	2
KCNH6	81033	broad.mit.edu	37	17	61613156	61613156	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61613156C>A	uc002jay.2	+	6	1308	c.1228C>A	c.(1228-1230)CTC>ATC	p.L410I	KCNH6_uc002jax.1_Missense_Mutation_p.L410I|KCNH6_uc010wpl.1_Missense_Mutation_p.L287I|KCNH6_uc010wpm.1_Missense_Mutation_p.L410I|KCNH6_uc002jaz.1_Missense_Mutation_p.L410I	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	410	Helical; Name=Segment S5; (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)													---	---	---	---	capture		Missense_Mutation	SNP	61613156	61613156	8341	17	C	A	A	28	28	KCNH6	A	2	2
RNF157	114804	broad.mit.edu	37	17	74157722	74157722	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74157722C>T	uc002jqz.2	-	11	1028	c.959G>A	c.(958-960)CGG>CAG	p.R320Q	RNF157_uc002jra.2_Missense_Mutation_p.R320Q	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	320							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)															---	---	---	---	capture		Missense_Mutation	SNP	74157722	74157722	13931	17	C	T	T	23	23	RNF157	T	1	1
RNF213	57674	broad.mit.edu	37	17	78335564	78335564	+	Missense_Mutation	SNP	A	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78335564A>C	uc002jyh.1	+	14	5673	c.5450A>C	c.(5449-5451)CAG>CCG	p.Q1817P	uc002jyi.1_Intron|RNF213_uc010dhw.1_Missense_Mutation_p.Q199P	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---	capture		Missense_Mutation	SNP	78335564	78335564	13955	17	A	C	C	7	7	RNF213	C	4	4
CHMP6	79643	broad.mit.edu	37	17	78972932	78972932	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78972932G>T	uc002jyw.3	+	8	663	c.585G>T	c.(583-585)GCG>GCT	p.A195A		NM_024591	NP_078867	Q96FZ7	CHMP6_HUMAN	chromatin modifying protein 6	195				Missing: Membrane association; releases autoinhibition.	cellular membrane organization|endosome transport|protein transport	cytosol|endomembrane system|late endosome membrane	protein N-terminus binding	p.A195V(1)		ovary(1)	1	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0175)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)															---	---	---	---	capture		Silent	SNP	78972932	78972932	3494	17	G	T	T	39	39	CHMP6	T	1	1
BAHCC1	57597	broad.mit.edu	37	17	79430641	79430641	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79430641C>T	uc002kaf.2	+	26	7625	c.7625C>T	c.(7624-7626)GCG>GTG	p.A2542V		NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1	2542	BAH.						DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)															---	---	---	---	capture		Missense_Mutation	SNP	79430641	79430641	1317	17	C	T	T	27	27	BAHCC1	T	1	1
NOTUM	147111	broad.mit.edu	37	17	79915782	79915782	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79915782C>G	uc010wvg.1	-	6	867	c.595G>C	c.(595-597)GAG>CAG	p.E199Q		NM_178493	NP_848588	Q6P988	NOTUM_HUMAN	notum pectinacetylesterase homolog precursor	199						extracellular region	hydrolase activity				0	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)															---	---	---	---	capture		Missense_Mutation	SNP	79915782	79915782	10956	17	C	G	G	31	31	NOTUM	G	3	3
MYOM1	8736	broad.mit.edu	37	18	3079303	3079303	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3079303C>A	uc002klp.2	-	34	4856	c.4522G>T	c.(4522-4524)GGG>TGG	p.G1508W	MYOM1_uc002klq.2_Missense_Mutation_p.G1412W	NM_003803	NP_003794	P52179	MYOM1_HUMAN	myomesin 1 isoform a	1508						striated muscle myosin thick filament	structural constituent of muscle			ovary(3)|central_nervous_system(1)|pancreas(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	3079303	3079303	10486	18	C	A	A	23	23	MYOM1	A	1	1
LRRC30	339291	broad.mit.edu	37	18	7231852	7231852	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231852T>A	uc010wzk.1	+	1	716	c.716T>A	c.(715-717)CTC>CAC	p.L239H		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	239	LRR 8.									ovary(1)|liver(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	7231852	7231852	9360	18	T	A	A	54	54	LRRC30	A	4	4
KIAA0802	23255	broad.mit.edu	37	18	8824917	8824917	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8824917G>A	uc002knr.2	+	15	3551	c.3409G>A	c.(3409-3411)GAG>AAG	p.E1137K	KIAA0802_uc002knq.2_Missense_Mutation_p.E1096K|KIAA0802_uc002kns.2_Missense_Mutation_p.E477K	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	1447											0																		---	---	---	---	capture		Missense_Mutation	SNP	8824917	8824917	8501	18	G	A	A	37	37	KIAA0802	A	1	1
ABHD3	171586	broad.mit.edu	37	18	19244139	19244139	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19244139T>A	uc002ktl.2	-	5	748	c.608A>T	c.(607-609)CAC>CTC	p.H203L	ABHD3_uc002ktm.2_Intron|ABHD3_uc010xao.1_RNA|ABHD3_uc002ktk.2_5'UTR	NM_138340	NP_612213	Q8WU67	ABHD3_HUMAN	alpha/beta hydrolase domain containing protein	203						integral to membrane	carboxylesterase activity			central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	19244139	19244139	84	18	T	A	A	59	59	ABHD3	A	4	4
ZNF521	25925	broad.mit.edu	37	18	22671936	22671936	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22671936G>T	uc002kvk.2	-	6	4015	c.3768C>A	c.(3766-3768)TTC>TTA	p.F1256L	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.F1256L|ZNF521_uc002kvl.2_Missense_Mutation_p.F1036L	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	1256	C2H2-type 29.				cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)							T	PAX5	ALL								---	---	---	---	capture		Missense_Mutation	SNP	22671936	22671936	18559	18	G	T	T	45	45	ZNF521	T	2	2
CHST9	83539	broad.mit.edu	37	18	24496372	24496372	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24496372A>G	uc002kwd.2	-	5	1381	c.1183T>C	c.(1183-1185)TTT>CTT	p.F395L	C18orf16_uc002kwb.2_Intron|C18orf16_uc010xbm.1_Intron|CHST9_uc002kwc.2_Missense_Mutation_p.F310L|CHST9_uc002kwe.2_Missense_Mutation_p.F395L	NM_031422	NP_113610	Q7L1S5	CHST9_HUMAN	GalNAc-4-sulfotransferase 2	395	Lumenal (Potential).				carbohydrate biosynthetic process|glycosaminoglycan metabolic process|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	extracellular region|Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			ovary(2)|skin(1)	3	all_lung(6;0.0145)|Ovarian(20;0.124)																	---	---	---	---	capture		Missense_Mutation	SNP	24496372	24496372	3545	18	A	G	G	3	3	CHST9	G	4	4
DSG1	1828	broad.mit.edu	37	18	28911754	28911754	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28911754C>T	uc002kwp.2	+	6	820	c.608C>T	c.(607-609)CCT>CTT	p.P203L		NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	203	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)															---	---	---	---	capture		Missense_Mutation	SNP	28911754	28911754	4960	18	C	T	T	24	24	DSG1	T	2	2
RIT2	6014	broad.mit.edu	37	18	40695447	40695447	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40695447C>A	uc002lav.2	-	1	211	c.38G>T	c.(37-39)AGC>ATC	p.S13I	RIT2_uc010dnf.2_Missense_Mutation_p.S13I	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2	13					nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	40695447	40695447	13864	18	C	A	A	28	28	RIT2	A	2	2
SERPINB11	89778	broad.mit.edu	37	18	61379905	61379905	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61379905C>A	uc002ljk.3	+	5	397	c.335C>A	c.(334-336)ACA>AAA	p.T112K	SERPINB11_uc010xes.1_5'UTR|SERPINB11_uc010dqd.2_5'UTR|SERPINB11_uc002ljj.3_5'UTR|SERPINB11_uc010dqe.2_5'UTR|SERPINB11_uc010dqf.2_Intron	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11	112					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)																---	---	---	---	capture		Missense_Mutation	SNP	61379905	61379905	14586	18	C	A	A	17	17	SERPINB11	A	2	2
CCDC102B	79839	broad.mit.edu	37	18	66678275	66678275	+	Silent	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:66678275A>T	uc002lkk.2	+	9	1591	c.1368A>T	c.(1366-1368)GCA>GCT	p.A456A	CCDC102B_uc002lki.2_Silent_p.A456A	NM_001093729	NP_001087198	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	456	Potential.									ovary(1)|lung(1)|skin(1)	3		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)																---	---	---	---	capture		Silent	SNP	66678275	66678275	2857	18	A	T	T	7	7	CCDC102B	T	4	4
ZNF557	79230	broad.mit.edu	37	19	7082909	7082909	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7082909A>G	uc002mgb.2	+	8	911	c.426A>G	c.(424-426)GCA>GCG	p.A142A	ZNF557_uc002mga.2_Silent_p.A149A|ZNF557_uc002mgc.2_Silent_p.A149A	NM_001044388	NP_001037853	Q8N988	ZN557_HUMAN	zinc finger protein 557 isoform b	142					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2				Lung(535;0.179)														---	---	---	---	capture		Silent	SNP	7082909	7082909	18583	19	A	G	G	5	5	ZNF557	G	4	4
MAP2K7	5609	broad.mit.edu	37	19	7975984	7975984	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7975984C>A	uc002mit.2	+	7	860	c.795C>A	c.(793-795)AGC>AGA	p.S265R	MAP2K7_uc002miv.2_Missense_Mutation_p.S265R|MAP2K7_uc010xka.1_RNA|MAP2K7_uc010xkb.1_Missense_Mutation_p.S265R|MAP2K7_uc010dvv.2_Missense_Mutation_p.S140R	NM_145185	NP_660186	O14733	MP2K7_HUMAN	mitogen-activated protein kinase kinase 7	265	Protein kinase.				activation of JUN kinase activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus	ATP binding|JUN kinase kinase activity|magnesium ion binding|protein binding|protein kinase binding|protein phosphatase binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			large_intestine(7)|central_nervous_system(2)|ovary(1)|lung(1)	11					Etoposide(DB00773)													---	---	---	---	capture		Missense_Mutation	SNP	7975984	7975984	9625	19	C	A	A	27	27	MAP2K7	A	1	1
MUC16	94025	broad.mit.edu	37	19	9011492	9011492	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9011492G>T	uc002mkp.2	-	36	38945	c.38741C>A	c.(38740-38742)CCT>CAT	p.P12914H	MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---	capture		Missense_Mutation	SNP	9011492	9011492	10367	19	G	T	T	35	35	MUC16	T	2	2
RDH8	50700	broad.mit.edu	37	19	10132324	10132324	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10132324C>A	uc002mmr.2	+	6	1084	c.835C>A	c.(835-837)CGA>AGA	p.R279R		NM_015725	NP_056540	Q9NYR8	RDH8_HUMAN	retinol dehydrogenase 8 (all-trans)	279					estrogen biosynthetic process|response to stimulus|visual perception	cytoplasm|integral to plasma membrane	binding|estradiol 17-beta-dehydrogenase activity|NADP-retinol dehydrogenase activity|retinol dehydrogenase activity			ovary(3)|pancreas(1)	4			Epithelial(33;4.24e-05)		Vitamin A(DB00162)													---	---	---	---	capture		Silent	SNP	10132324	10132324	13665	19	C	A	A	27	27	RDH8	A	1	1
FDX1L	112812	broad.mit.edu	37	19	10421531	10421531	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10421531C>A	uc002mny.1	-	4	412	c.393G>T	c.(391-393)GAG>GAT	p.E131D	ZGLP1_uc002mnw.3_5'Flank|FDX1L_uc002mnx.1_RNA	NM_001031734	NP_001026904	Q6P4F2	ADXL_HUMAN	ferredoxin 1-like precursor	131	2Fe-2S ferredoxin-type.				electron transport chain|transport	mitochondrial matrix	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(20;9.5e-10)|Epithelial(33;2.11e-06)|all cancers(31;5.06e-06)															---	---	---	---	capture		Missense_Mutation	SNP	10421531	10421531	6042	19	C	A	A	32	32	FDX1L	A	2	2
ILVBL	10994	broad.mit.edu	37	19	15234199	15234199	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15234199C>T	uc002nam.2	-	3	445	c.324G>A	c.(322-324)ATG>ATA	p.M108I	ILVBL_uc010dzw.2_Missense_Mutation_p.M1I|ILVBL_uc010dzx.1_Missense_Mutation_p.M108I	NM_006844	NP_006835	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	108						integral to membrane	magnesium ion binding|thiamine pyrophosphate binding|transferase activity			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	15234199	15234199	8016	19	C	T	T	21	21	ILVBL	T	2	2
OR10H2	26538	broad.mit.edu	37	19	15839214	15839214	+	Missense_Mutation	SNP	G	T	T	rs113885700	byFrequency	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839214G>T	uc002nbm.2	+	1	381	c.361G>T	c.(361-363)GAC>TAC	p.D121Y		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)																	---	---	---	---	capture		Missense_Mutation	SNP	15839214	15839214	11312	19	G	T	T	37	37	OR10H2	T	1	1
KCNN1	3780	broad.mit.edu	37	19	18100568	18100568	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18100568T>C	uc002nht.2	+	8	1524	c.1214T>C	c.(1213-1215)ATC>ACC	p.I405T	KCNN1_uc010xqa.1_Missense_Mutation_p.I405T	NM_002248	NP_002239	Q92952	KCNN1_HUMAN	potassium intermediate/small conductance	405	Calmodulin-binding (By similarity).				synaptic transmission	voltage-gated potassium channel complex	calmodulin binding|small conductance calcium-activated potassium channel activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	18100568	18100568	8383	19	T	C	C	50	50	KCNN1	C	4	4
ATP13A1	57130	broad.mit.edu	37	19	19762598	19762598	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19762598C>T	uc002nnh.3	-	17	2263	c.2235G>A	c.(2233-2235)ATG>ATA	p.M745I	ATP13A1_uc002nne.2_5'UTR|ATP13A1_uc002nnf.3_Missense_Mutation_p.M113I|ATP13A1_uc002nng.2_Missense_Mutation_p.M627I	NM_020410	NP_065143	Q9HD20	AT131_HUMAN	ATPase type 13A1	745	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(3)|large_intestine(2)|central_nervous_system(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	19762598	19762598	1142	19	C	T	T	29	29	ATP13A1	T	2	2
ZNF91	7644	broad.mit.edu	37	19	23542464	23542464	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23542464T>C	uc002nre.2	-	4	3430	c.3317A>G	c.(3316-3318)TAC>TGC	p.Y1106C	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Missense_Mutation_p.Y1074C	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	1106	C2H2-type 35.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)																---	---	---	---	capture		Missense_Mutation	SNP	23542464	23542464	18804	19	T	C	C	57	57	ZNF91	C	4	4
LRP3	4037	broad.mit.edu	37	19	33698431	33698431	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33698431T>G	uc010edh.2	+	7	2356	c.2263T>G	c.(2263-2265)TGC>GGC	p.C755G	LRP3_uc002nuk.3_Missense_Mutation_p.C629G	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	755	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)																	---	---	---	---	capture		Missense_Mutation	SNP	33698431	33698431	9331	19	T	G	G	55	55	LRP3	G	4	4
SBSN	374897	broad.mit.edu	37	19	36019135	36019135	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36019135C>T	uc002oae.1	-	1	119	c.49G>A	c.(49-51)GGG>AGG	p.G17R	SBSN_uc002oad.1_Missense_Mutation_p.G17R	NM_198538	NP_940940	Q6UWP8	SBSN_HUMAN	suprabasin isoform 2 precursor	17						extracellular region				ovary(1)	1	all_lung(56;1.62e-08)|Lung NSC(56;2.47e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)															---	---	---	---	capture		Missense_Mutation	SNP	36019135	36019135	14345	19	C	T	T	22	22	SBSN	T	2	2
PSG9	5678	broad.mit.edu	37	19	43766118	43766118	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43766118G>C	uc002owd.3	-	3	702	c.603C>G	c.(601-603)ACC>ACG	p.T201T	PSG9_uc002owe.3_Silent_p.T201T|PSG9_uc010xwm.1_Intron|PSG9_uc002owf.3_Intron|PSG9_uc002owg.2_Silent_p.T201T|PSG9_uc002owh.2_Intron	NM_002784	NP_002775	Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9	201	Ig-like C2-type 1.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)																---	---	---	---	capture		Silent	SNP	43766118	43766118	13115	19	G	C	C	43	43	PSG9	C	3	3
ZNF235	9310	broad.mit.edu	37	19	44792476	44792476	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44792476C>G	uc002oza.3	-	5	1215	c.1112G>C	c.(1111-1113)GGA>GCA	p.G371A	ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_Intron|ZNF235_uc002ozb.3_Missense_Mutation_p.G367A|ZNF235_uc010xwx.1_Missense_Mutation_p.G285A	NM_004234	NP_004225	Q14590	ZN235_HUMAN	zinc finger protein 93 homolog	371					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)	3		Prostate(69;0.0352)|all_neural(266;0.116)																---	---	---	---	capture		Missense_Mutation	SNP	44792476	44792476	18379	19	C	G	G	30	30	ZNF235	G	3	3
LMTK3	114783	broad.mit.edu	37	19	49001464	49001464	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49001464T>C	uc002pjk.2	-	12	2949	c.2949A>G	c.(2947-2949)AGA>AGG	p.R983R		NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)														---	---	---	---	capture		Silent	SNP	49001464	49001464	9189	19	T	C	C	54	54	LMTK3	C	4	4
SIGLEC14	100049587	broad.mit.edu	37	19	52148761	52148761	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52148761G>C	uc002pxf.3	-	4	843	c.723C>G	c.(721-723)ATC>ATG	p.I241M		NM_001098612	NP_001092082	Q08ET2	SIG14_HUMAN	sialic acid binding Ig-like lectin 14 precursor	241	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion	integral to membrane|plasma membrane	protein binding|sugar binding			ovary(1)	1		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000965)|OV - Ovarian serous cystadenocarcinoma(262;0.0195)														---	---	---	---	capture		Missense_Mutation	SNP	52148761	52148761	14804	19	G	C	C	45	45	SIGLEC14	C	3	3
VSTM1	284415	broad.mit.edu	37	19	54561751	54561751	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54561751T>C	uc002qcw.3	-	3	340	c.164A>G	c.(163-165)AAT>AGT	p.N55S	VSTM1_uc010erb.2_RNA|VSTM1_uc002qcx.3_Missense_Mutation_p.N55S	NM_198481	NP_940883	Q6UX27	VSTM1_HUMAN	V-set and transmembrane domain containing 1	55	Ig-like V-type.					integral to membrane					0	all_cancers(19;0.0128)|all_epithelial(19;0.00564)|all_lung(19;0.031)|Lung NSC(19;0.0358)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.165)														---	---	---	---	capture		Missense_Mutation	SNP	54561751	54561751	17796	19	T	C	C	52	52	VSTM1	C	4	4
LILRB2	10288	broad.mit.edu	37	19	54783745	54783745	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54783745G>A	uc002qfb.2	-	4	522	c.256C>T	c.(256-258)CCA>TCA	p.P86S	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Missense_Mutation_p.P86S|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Missense_Mutation_p.P86S|LILRB2_uc010yet.1_5'UTR|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	86	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)														---	---	---	---	capture		Missense_Mutation	SNP	54783745	54783745	9117	19	G	A	A	43	43	LILRB2	A	2	2
ZSCAN5B	342933	broad.mit.edu	37	19	56701621	56701621	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701621A>G	uc010ygh.1	-	4	1063	c.1063T>C	c.(1063-1065)TTT>CTT	p.F355L		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	355	C2H2-type 1.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	56701621	56701621	18843	19	A	G	G	3	3	ZSCAN5B	G	4	4
RSAD2	91543	broad.mit.edu	37	2	7036064	7036064	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7036064G>C	uc002qyp.1	+	6	1213	c.1077G>C	c.(1075-1077)CTG>CTC	p.L359L		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	359					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)														---	---	---	---	capture		Silent	SNP	7036064	7036064	14175	2	G	C	C	47	47	RSAD2	C	3	3
APOB	338	broad.mit.edu	37	2	21225147	21225147	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21225147C>A	uc002red.2	-	29	13275	c.13147G>T	c.(13147-13149)GCC>TCC	p.A4383S		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4383					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---	capture		Missense_Mutation	SNP	21225147	21225147	796	2	C	A	A	26	26	APOB	A	2	2
CAD	790	broad.mit.edu	37	2	27465570	27465570	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27465570G>T	uc002rji.2	+	41	6467	c.6305G>T	c.(6304-6306)CGC>CTC	p.R2102L	CAD_uc010eyw.2_Missense_Mutation_p.R2039L	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	2102	ATCase (Aspartate transcarbamylase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)													---	---	---	---	capture		Missense_Mutation	SNP	27465570	27465570	2681	2	G	T	T	38	38	CAD	T	1	1
LCLAT1	253558	broad.mit.edu	37	2	30863187	30863187	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:30863187G>T	uc002rnj.2	+	7	1156	c.947G>T	c.(946-948)CGT>CTT	p.R316L	LCLAT1_uc010ymp.1_Missense_Mutation_p.R154L|LCLAT1_uc002rnl.2_Missense_Mutation_p.R278L|LCLAT1_uc010ymq.1_Missense_Mutation_p.R278L	NM_182551	NP_872357	Q6UWP7	LCLT1_HUMAN	lysocardiolipin acyltransferase 1 isoform 1	316					multicellular organismal development|phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	30863187	30863187	9001	2	G	T	T	40	40	LCLAT1	T	1	1
RASGRP3	25780	broad.mit.edu	37	2	33745744	33745744	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33745744T>C	uc002rox.2	+	7	988	c.361T>C	c.(361-363)TCC>CCC	p.S121P	RASGRP3_uc010ync.1_Missense_Mutation_p.S121P|RASGRP3_uc002roy.2_Missense_Mutation_p.S121P	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	121	N-terminal Ras-GEF.				MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)																	---	---	---	---	capture		Missense_Mutation	SNP	33745744	33745744	13537	2	T	C	C	50	50	RASGRP3	C	4	4
SLC8A1	6546	broad.mit.edu	37	2	40656773	40656773	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656773G>T	uc002rrx.2	-	1	672	c.648C>A	c.(646-648)ACC>ACA	p.T216T	SLC8A1_uc002rry.2_Silent_p.T216T|SLC8A1_uc002rrz.2_Silent_p.T216T|SLC8A1_uc002rsa.2_Silent_p.T216T|SLC8A1_uc002rsd.3_Silent_p.T216T|SLC8A1_uc002rsb.1_Silent_p.T216T|SLC8A1_uc010fan.1_Silent_p.T216T|SLC8A1_uc002rsc.1_Silent_p.T216T	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	216	Helical; (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---	capture		Silent	SNP	40656773	40656773	15203	2	G	T	T	35	35	SLC8A1	T	2	2
ZFP36L2	678	broad.mit.edu	37	2	43452044	43452044	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452044G>C	uc002rsv.3	-	2	1190	c.899C>G	c.(898-900)TCC>TGC	p.S300C	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	300					cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)																---	---	---	---	capture		Missense_Mutation	SNP	43452044	43452044	18235	2	G	C	C	41	41	ZFP36L2	C	3	3
TIA1	7072	broad.mit.edu	37	2	70443373	70443373	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70443373C>T	uc002sgj.3	-	10	948	c.731G>A	c.(730-732)CGA>CAA	p.R244Q	TIA1_uc002sgk.3_Missense_Mutation_p.R233Q|TIA1_uc002sgl.3_RNA	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding	244	RRM 3.				apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	70443373	70443373	16415	2	C	T	T	31	31	TIA1	T	1	1
EXOC6B	23233	broad.mit.edu	37	2	72719551	72719551	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72719551C>A	uc010fep.2	-	16	1699	c.1561G>T	c.(1561-1563)GAA>TAA	p.E521*	EXOC6B_uc002sij.2_Nonsense_Mutation_p.E521*	NM_015189	NP_056004	Q9Y2D4	EXC6B_HUMAN	SEC15-like 2	521					protein transport|vesicle docking involved in exocytosis	exocyst				central_nervous_system(2)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	72719551	72719551	5502	2	C	A	A	29	29	EXOC6B	A	5	2
BOLA3	388962	broad.mit.edu	37	2	74372367	74372367	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74372367G>C	uc002skc.1	-	2	156	c.118C>G	c.(118-120)CTC>GTC	p.L40V	BOLA3_uc002skd.1_Missense_Mutation_p.L40V|uc002ske.2_5'Flank|uc002skf.2_5'Flank|uc002skg.2_5'Flank	NM_212552	NP_997717	Q53S33	BOLA3_HUMAN	bolA-like 3 isoform 1	40						extracellular region					0																		---	---	---	---	capture		Missense_Mutation	SNP	74372367	74372367	1513	2	G	C	C	33	33	BOLA3	C	3	3
TEKT4	150483	broad.mit.edu	37	2	95540614	95540614	+	Silent	SNP	G	A	A	rs111598357		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95540614G>A	uc002stw.1	+	4	900	c.807G>A	c.(805-807)CTG>CTA	p.L269L	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	269					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3																		---	---	---	---	capture		Silent	SNP	95540614	95540614	16282	2	G	A	A	47	47	TEKT4	A	2	2
ITPRIPL1	150771	broad.mit.edu	37	2	96993075	96993075	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993075G>C	uc002svx.2	+	3	1041	c.706G>C	c.(706-708)GAT>CAT	p.D236H	ITPRIPL1_uc010yuk.1_Missense_Mutation_p.D228H|ITPRIPL1_uc002svy.2_Missense_Mutation_p.D244H|ITPRIPL1_uc010yul.1_Missense_Mutation_p.D228H	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	236	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	96993075	96993075	8228	2	G	C	C	45	45	ITPRIPL1	C	3	3
ITPRIPL1	150771	broad.mit.edu	37	2	96993224	96993224	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993224G>C	uc002svx.2	+	3	1190	c.855G>C	c.(853-855)CTG>CTC	p.L285L	ITPRIPL1_uc010yuk.1_Silent_p.L277L|ITPRIPL1_uc002svy.2_Silent_p.L293L|ITPRIPL1_uc010yul.1_Silent_p.L277L	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	285	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3																		---	---	---	---	capture		Silent	SNP	96993224	96993224	8228	2	G	C	C	47	47	ITPRIPL1	C	3	3
ITPRIPL1	150771	broad.mit.edu	37	2	96993431	96993431	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993431G>T	uc002svx.2	+	3	1397	c.1062G>T	c.(1060-1062)CTG>CTT	p.L354L	ITPRIPL1_uc010yuk.1_Silent_p.L346L|ITPRIPL1_uc002svy.2_Silent_p.L362L|ITPRIPL1_uc010yul.1_Silent_p.L346L	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	354	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3																		---	---	---	---	capture		Silent	SNP	96993431	96993431	8228	2	G	T	T	47	47	ITPRIPL1	T	2	2
MYO7B	4648	broad.mit.edu	37	2	128389944	128389944	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128389944C>A	uc002top.2	+	38	5348	c.5295C>A	c.(5293-5295)CCC>CCA	p.P1765P	MYO7B_uc002tos.1_5'Flank|MYO7B_uc002tot.2_5'Flank	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1765	MyTH4 2.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)														---	---	---	---	capture		Silent	SNP	128389944	128389944	10478	2	C	A	A	23	23	MYO7B	A	1	1
GPR148	344561	broad.mit.edu	37	2	131487618	131487618	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131487618A>G	uc002trv.1	+	1	896	c.894A>G	c.(892-894)ACA>ACG	p.T298T		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	298	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)																	---	---	---	---	capture		Silent	SNP	131487618	131487618	6928	2	A	G	G	8	8	GPR148	G	4	4
ZRANB3	84083	broad.mit.edu	37	2	135988217	135988217	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135988217C>A	uc002tum.2	-	13	1937	c.1820G>T	c.(1819-1821)AGT>ATT	p.S607I	ZRANB3_uc002tuk.2_Missense_Mutation_p.S150I|ZRANB3_uc002tul.2_Missense_Mutation_p.S607I	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	607						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)														---	---	---	---	capture		Missense_Mutation	SNP	135988217	135988217	18828	2	C	A	A	20	20	ZRANB3	A	2	2
LRP1B	53353	broad.mit.edu	37	2	140995827	140995827	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:140995827C>A	uc002tvj.1	-	89	14426	c.13454G>T	c.(13453-13455)GGA>GTA	p.G4485V		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4485	Cytoplasmic (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---	capture		Missense_Mutation	SNP	140995827	140995827	9328	2	C	A	A	30	30	LRP1B	A	2	2
ITGB6	3694	broad.mit.edu	37	2	161052922	161052922	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:161052922G>A	uc002ubh.2	-	3	167	c.151C>T	c.(151-153)CAT>TAT	p.H51Y	ITGB6_uc010fow.1_RNA|ITGB6_uc010fou.2_Missense_Mutation_p.H51Y|ITGB6_uc010zcq.1_Missense_Mutation_p.H9Y|ITGB6_uc010fov.1_Missense_Mutation_p.H51Y	NM_000888	NP_000879	P18564	ITB6_HUMAN	integrin, beta 6 precursor	51	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|multicellular organismal development	integrin complex	receptor activity			ovary(1)|lung(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	161052922	161052922	8203	2	G	A	A	45	45	ITGB6	A	2	2
TBR1	10716	broad.mit.edu	37	2	162273453	162273453	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162273453C>T	uc002ubw.1	+	1	834	c.532C>T	c.(532-534)CAG>TAG	p.Q178*	TBR1_uc010foy.2_5'Flank	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1	178						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	162273453	162273453	16173	2	C	T	T	17	17	TBR1	T	5	2
SLC4A10	57282	broad.mit.edu	37	2	162799319	162799319	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162799319C>G	uc002ubx.3	+	16	2199	c.2015C>G	c.(2014-2016)CCG>CGG	p.P672R	SLC4A10_uc002uby.3_Missense_Mutation_p.P642R|SLC4A10_uc010zcs.1_Missense_Mutation_p.P653R	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	672	Extracellular (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	162799319	162799319	15148	2	C	G	G	23	23	SLC4A10	G	3	3
GRB14	2888	broad.mit.edu	37	2	165365270	165365270	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165365270G>C	uc002ucl.2	-	7	1450	c.909C>G	c.(907-909)AAC>AAG	p.N303K	GRB14_uc010zcv.1_Missense_Mutation_p.N216K|GRB14_uc002ucm.2_RNA	NM_004490	NP_004481	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	303	PH.				blood coagulation|leukocyte migration	cytosol|endosome membrane|Golgi membrane|microsome|plasma membrane	SH3/SH2 adaptor activity			ovary(5)|upper_aerodigestive_tract(1)|lung(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	165365270	165365270	7034	2	G	C	C	36	36	GRB14	C	3	3
XIRP2	129446	broad.mit.edu	37	2	167760191	167760191	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167760191G>A	uc002udx.2	+	1	217	c.199G>A	c.(199-201)GGG>AGG	p.G67R	XIRP2_uc010fpn.2_Missense_Mutation_p.G67R|XIRP2_uc010fpo.2_Missense_Mutation_p.G67R|XIRP2_uc010fpp.2_Missense_Mutation_p.G67R	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	Error:Variant_position_missing_in_A4UGR9_after_alignment					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---	capture		Missense_Mutation	SNP	167760191	167760191	18011	2	G	A	A	35	35	XIRP2	A	2	2
HOXD3	3232	broad.mit.edu	37	2	177033999	177033999	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177033999C>A	uc002ukt.1	+	2	333	c.157C>A	c.(157-159)CCT>ACT	p.P53T		NM_006898	NP_008829	P31249	HXD3_HUMAN	homeobox D3	53					anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)														---	---	---	---	capture		Missense_Mutation	SNP	177033999	177033999	7615	2	C	A	A	22	22	HOXD3	A	2	2
NFE2L2	4780	broad.mit.edu	37	2	178098968	178098968	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098968T>A	uc002ulh.3	-	2	632	c.77A>T	c.(76-78)CAA>CTA	p.Q26L	NFE2L2_uc002ulg.3_Missense_Mutation_p.Q10L|NFE2L2_uc010zfa.1_Missense_Mutation_p.Q10L|NFE2L2_uc002uli.3_Missense_Mutation_p.Q10L|NFE2L2_uc010fra.2_Missense_Mutation_p.Q10L|NFE2L2_uc010frb.2_Missense_Mutation_p.Q10L	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	26					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---	capture		Missense_Mutation	SNP	178098968	178098968	10768	2	T	A	A	63	63	NFE2L2	A	4	4
FKBP7	51661	broad.mit.edu	37	2	179334381	179334381	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179334381C>G	uc002umk.2	-	3	634	c.505G>C	c.(505-507)GAG>CAG	p.E169Q	FKBP7_uc002umm.2_Missense_Mutation_p.E168Q|FKBP7_uc002uml.2_RNA|FKBP7_uc010zff.1_Intron	NM_181342	NP_851939	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7 isoform a precursor	206	1 (Potential).|EF-hand 1.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)															---	---	---	---	capture		Missense_Mutation	SNP	179334381	179334381	6151	2	C	G	G	31	31	FKBP7	G	3	3
TTN	7273	broad.mit.edu	37	2	179615473	179615473	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179615473G>T	uc002unb.2	-	46	11878	c.11654C>A	c.(11653-11655)ACA>AAA	p.T3885K	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---	capture		Missense_Mutation	SNP	179615473	179615473	17290	2	G	T	T	48	48	TTN	T	2	2
ANKRD44	91526	broad.mit.edu	37	2	197990703	197990703	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197990703C>A	uc002uuc.2	-	5	487	c.320G>T	c.(319-321)TGG>TTG	p.W107L	ANKRD44_uc002uua.1_Missense_Mutation_p.W82L|ANKRD44_uc002uub.2_Missense_Mutation_p.W107L|ANKRD44_uc010zgw.1_Missense_Mutation_p.W35L	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	107	ANK 4.						protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)															---	---	---	---	capture		Missense_Mutation	SNP	197990703	197990703	680	2	C	A	A	21	21	ANKRD44	A	2	2
CFLAR	8837	broad.mit.edu	37	2	202025532	202025532	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202025532G>T	uc002uxb.3	+	9	1623	c.1171G>T	c.(1171-1173)GGG>TGG	p.G391W	CFLAR_uc010zhk.1_Missense_Mutation_p.G295W|CFLAR_uc002uxc.3_Missense_Mutation_p.G356W|CFLAR_uc010zhl.1_Missense_Mutation_p.G295W|CFLAR_uc010fsw.1_RNA|CFLAR_uc002uxd.3_Missense_Mutation_p.G391W|CFLAR_uc002uxf.2_Missense_Mutation_p.G391W|CFLAR_uc010fsy.2_RNA|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_Missense_Mutation_p.G295W|CFLAR_uc010fsz.2_Missense_Mutation_p.G146W|CFLAR_uc002uxg.2_Missense_Mutation_p.G146W	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform	391	Interaction with caspase-8.|Interaction with caspase-3.|Interaction with TRAF1 and TRAF2.|Not proteolytically processed and involved in apoptosis inhibition.|Interaction with caspase-8 subunits p18 and p10.				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	202025532	202025532	3425	2	G	T	T	35	35	CFLAR	T	2	2
ACCN4	55515	broad.mit.edu	37	2	220379768	220379768	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220379768C>T	uc002vma.2	+	1	717	c.703C>T	c.(703-705)CCA>TCA	p.P235S	ACCN4_uc010fwi.1_Missense_Mutation_p.P235S|ACCN4_uc010fwj.1_Missense_Mutation_p.P235S|ACCN4_uc002vly.1_Missense_Mutation_p.P235S|ACCN4_uc002vlz.2_Missense_Mutation_p.P235S|ACCN4_uc002vmb.2_5'Flank	NM_182847	NP_878267	Q96FT7	ACCN4_HUMAN	amiloride-sensitive cation channel 4 isoform 2	235	Extracellular (Potential).					integral to plasma membrane	sodium channel activity|sodium ion transmembrane transporter activity			ovary(2)	2		Renal(207;0.0183)		Epithelial(149;5.47e-10)|all cancers(144;9e-08)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.0086)|READ - Rectum adenocarcinoma(5;0.156)														---	---	---	---	capture		Missense_Mutation	SNP	220379768	220379768	132	2	C	T	T	22	22	ACCN4	T	2	2
EPHA4	2043	broad.mit.edu	37	2	222301171	222301171	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222301171A>G	uc002vmq.2	-	13	2336	c.2294T>C	c.(2293-2295)TTT>TCT	p.F765S	EPHA4_uc002vmr.2_Missense_Mutation_p.F765S|EPHA4_uc010zlm.1_Missense_Mutation_p.F706S|EPHA4_uc010zln.1_Missense_Mutation_p.F765S	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor	765	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)														---	---	---	---	capture		Missense_Mutation	SNP	222301171	222301171	5362	2	A	G	G	1	1	EPHA4	G	4	4
SPHKAP	80309	broad.mit.edu	37	2	228883485	228883485	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228883485G>C	uc002vpq.2	-	7	2132	c.2085C>G	c.(2083-2085)AAC>AAG	p.N695K	SPHKAP_uc002vpp.2_Missense_Mutation_p.N695K|SPHKAP_uc010zlx.1_Missense_Mutation_p.N695K	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	695						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)														---	---	---	---	capture		Missense_Mutation	SNP	228883485	228883485	15560	2	G	C	C	48	48	SPHKAP	C	3	3
CSNK2A1	1457	broad.mit.edu	37	20	470440	470440	+	Missense_Mutation	SNP	T	C	C	rs61730060		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:470440T>C	uc002wdw.1	-	10	1100	c.707A>G	c.(706-708)CAT>CGT	p.H236R	CSNK2A1_uc002wdx.1_Missense_Mutation_p.H236R|CSNK2A1_uc002wdy.1_Missense_Mutation_p.H100R	NM_177559	NP_808227	P68400	CSK21_HUMAN	casein kinase II alpha 1 subunit isoform a	236	Protein kinase.				axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)															---	---	---	---	capture		Missense_Mutation	SNP	470440	470440	4098	20	T	C	C	51	51	CSNK2A1	C	4	4
FLRT3	23767	broad.mit.edu	37	20	14307905	14307905	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14307905A>T	uc002wov.1	-	3	715	c.248T>A	c.(247-249)CTG>CAG	p.L83Q	MACROD2_uc002wot.2_Intron|MACROD2_uc002wou.2_Intron|FLRT3_uc002wow.1_Missense_Mutation_p.L83Q	NM_198391	NP_938205	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	83	Extracellular (Potential).				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			kidney(1)	1		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)														---	---	---	---	capture		Missense_Mutation	SNP	14307905	14307905	6182	20	A	T	T	7	7	FLRT3	T	4	4
PCSK2	5126	broad.mit.edu	37	20	17341277	17341277	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17341277T>C	uc002wpm.2	+	4	817	c.497T>C	c.(496-498)ATG>ACG	p.M166T	PCSK2_uc002wpl.2_Missense_Mutation_p.M147T|PCSK2_uc010zrm.1_Missense_Mutation_p.M131T	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	166	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)													---	---	---	---	capture		Missense_Mutation	SNP	17341277	17341277	12022	20	T	C	C	51	51	PCSK2	C	4	4
ZNF341	84905	broad.mit.edu	37	20	32349741	32349741	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32349741C>G	uc002wzy.2	+	8	1122	c.1102C>G	c.(1102-1104)CAC>GAC	p.H368D	ZNF341_uc002wzx.2_Missense_Mutation_p.H361D|ZNF341_uc010geq.2_Missense_Mutation_p.H278D|ZNF341_uc010ger.2_RNA	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341	368	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	32349741	32349741	18449	20	C	G	G	17	17	ZNF341	G	3	3
CHMP4B	128866	broad.mit.edu	37	20	32438839	32438839	+	Silent	SNP	G	A	A	rs146262818	byFrequency	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32438839G>A	uc002xaa.2	+	3	606	c.450G>A	c.(448-450)TCG>TCA	p.S150S		NM_176812	NP_789782	Q9H444	CHM4B_HUMAN	chromatin modifying protein 4B	150	Potential.				cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Silent	SNP	32438839	32438839	3491	20	G	A	A	37	37	CHMP4B	A	1	1
FAM83C	128876	broad.mit.edu	37	20	33875407	33875407	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33875407G>T	uc010zux.1	-	4	1293	c.1175C>A	c.(1174-1176)CCC>CAC	p.P392H	EIF6_uc002xbv.1_5'Flank|EIF6_uc002xbx.1_5'Flank|EIF6_uc002xbz.1_5'Flank|EIF6_uc002xby.1_5'Flank|FAM83C_uc002xcb.1_Intron	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	392										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)															---	---	---	---	capture		Missense_Mutation	SNP	33875407	33875407	5861	20	G	T	T	43	43	FAM83C	T	2	2
CHD6	84181	broad.mit.edu	37	20	40050343	40050343	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40050343T>C	uc002xka.1	-	31	5110	c.4932A>G	c.(4930-4932)ACA>ACG	p.T1644T		NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1644					chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)																---	---	---	---	capture		Silent	SNP	40050343	40050343	3463	20	T	C	C	51	51	CHD6	C	4	4
LAMA5	3911	broad.mit.edu	37	20	60893579	60893579	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60893579C>A	uc002ycq.2	-	53	7237	c.7170G>T	c.(7168-7170)CGG>CGT	p.R2390R		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	2390	Domain II and I.|Potential.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---	capture		Silent	SNP	60893579	60893579	8932	20	C	A	A	22	22	LAMA5	A	2	2
TNFRSF6B	8771	broad.mit.edu	37	20	62329762	62329762	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62329762G>A	uc002yfy.2	+	7	1183	c.749G>A	c.(748-750)CGC>CAC	p.R250H	RTEL1_uc002yfw.2_RNA|TNFRSF6B_uc002yfz.2_Missense_Mutation_p.R250H	NM_032945	NP_116563	O95407	TNF6B_HUMAN	tumor necrosis factor receptor superfamily,	250					anti-apoptosis|apoptosis	extracellular region|soluble fraction	protein binding|receptor activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;4.66e-12)|all_epithelial(29;2.56e-13)|Lung NSC(23;1.06e-08)|all_lung(23;3.34e-08)		Epithelial(9;1.78e-08)|all cancers(9;7.89e-08)|OV - Ovarian serous cystadenocarcinoma(5;0.00504)															---	---	---	---	capture		Missense_Mutation	SNP	62329762	62329762	16839	20	G	A	A	38	38	TNFRSF6B	A	1	1
RNF160	26046	broad.mit.edu	37	21	30354687	30354687	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30354687G>A	uc002ymr.2	-	5	731	c.718C>T	c.(718-720)CTG>TTG	p.L240L	RNF160_uc010gll.1_RNA	NM_015565	NP_056380	O94822	LTN1_HUMAN	zinc finger protein 294	194							ligase activity|zinc ion binding				0																		---	---	---	---	capture		Silent	SNP	30354687	30354687	13932	21	G	A	A	34	34	RNF160	A	2	2
MKL1	57591	broad.mit.edu	37	22	40815102	40815102	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40815102G>A	uc003ayv.1	-	9	1547	c.1340C>T	c.(1339-1341)ACG>ATG	p.T447M	MKL1_uc003ayw.1_Missense_Mutation_p.T447M|MKL1_uc010gye.1_Missense_Mutation_p.T447M|MKL1_uc010gyf.1_Missense_Mutation_p.T397M	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein	447					positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5								T	RBM15	acute megakaryocytic leukemia								---	---	---	---	capture		Missense_Mutation	SNP	40815102	40815102	9991	22	G	A	A	40	40	MKL1	A	1	1
SETD5	55209	broad.mit.edu	37	3	9517717	9517717	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9517717A>T	uc003brt.2	+	23	4706	c.4271A>T	c.(4270-4272)CAG>CTG	p.Q1424L	SETD5_uc003bru.2_Missense_Mutation_p.Q1326L|SETD5_uc003brv.2_Missense_Mutation_p.Q1313L|SETD5_uc010hck.2_Missense_Mutation_p.Q906L|SETD5_uc003brx.2_Missense_Mutation_p.Q1093L	NM_001080517	NP_001073986	Q9C0A6	SETD5_HUMAN	SET domain containing 5	1424										ovary(2)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)														---	---	---	---	capture		Missense_Mutation	SNP	9517717	9517717	14623	3	A	T	T	7	7	SETD5	T	4	4
TOP2B	7155	broad.mit.edu	37	3	25648771	25648771	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:25648771C>G	uc003cdj.2	-	31	4174	c.4174G>C	c.(4174-4176)GTT>CTT	p.V1392L	TOP2B_uc011awm.1_Missense_Mutation_p.V249L|TOP2B_uc010hff.1_Missense_Mutation_p.V258L	NM_001068	NP_001059	Q02880	TOP2B_HUMAN	DNA topoisomerase II, beta isozyme	1397					DNA topological change|DNA-dependent DNA replication|mitotic cell cycle G2/M transition decatenation checkpoint|mitotic recombination|resolution of meiotic recombination intermediates|sister chromatid segregation	cytosol|DNA topoisomerase complex (ATP-hydrolyzing)|nucleolus|nucleoplasm|synaptonemal complex|WINAC complex	ATP binding|chromatin binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA-dependent ATPase activity|histone deacetylase binding|protein C-terminus binding|protein heterodimerization activity|protein kinase C binding|sequence-specific DNA binding transcription factor activity			breast(2)|ovary(1)|lung(1)|skin(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	25648771	25648771	16908	3	C	G	G	20	20	TOP2B	G	3	3
VILL	50853	broad.mit.edu	37	3	38044024	38044024	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38044024C>G	uc003chj.2	+	14	1903	c.1617C>G	c.(1615-1617)TTC>TTG	p.F539L	VILL_uc003chl.2_Missense_Mutation_p.F539L	NM_015873	NP_056957	O15195	VILL_HUMAN	villin-like protein	539	Gelsolin-like 5.				actin filament capping|cytoskeleton organization	actin cytoskeleton	actin binding|structural constituent of cytoskeleton				0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)														---	---	---	---	capture		Missense_Mutation	SNP	38044024	38044024	17732	3	C	G	G	32	32	VILL	G	3	3
C3orf39	84892	broad.mit.edu	37	3	43121436	43121436	+	Silent	SNP	G	T	T	rs35207939	byFrequency;by1000genomes	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:43121436G>T	uc003cmq.1	-	2	1629	c.1488C>A	c.(1486-1488)GGC>GGA	p.G496G	C3orf39_uc003cmr.1_Silent_p.G496G	NM_032806	NP_116195	Q8NAT1	AGO61_HUMAN	glycosyltransferase precursor	496						extracellular region	transferase activity, transferring glycosyl groups			ovary(1)|skin(1)	2				KIRC - Kidney renal clear cell carcinoma(284;0.0571)|Kidney(284;0.0718)														---	---	---	---	capture		Silent	SNP	43121436	43121436	2322	3	G	T	T	38	38	C3orf39	T	1	1
CCR1	1230	broad.mit.edu	37	3	46244914	46244914	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46244914G>A	uc003cph.1	-	2	962	c.891C>T	c.(889-891)AAC>AAT	p.N297N	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	297	Helical; Name=7; (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)														---	---	---	---	capture		Silent	SNP	46244914	46244914	3066	3	G	A	A	44	44	CCR1	A	2	2
MST1	4485	broad.mit.edu	37	3	49723334	49723334	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49723334G>A	uc003cxg.2	-	10	1281	c.1209C>T	c.(1207-1209)GTC>GTT	p.V403V	MST1_uc011bcs.1_Missense_Mutation_p.S442F	NM_020998	NP_066278	P26927	HGFL_HUMAN	macrophage stimulating 1 (hepatocyte growth	389	Kringle 4.				proteolysis	extracellular region	serine-type endopeptidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.47e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)														---	---	---	---	capture		Silent	SNP	49723334	49723334	10283	3	G	A	A	41	41	MST1	A	2	2
HYAL1	3373	broad.mit.edu	37	3	50339528	50339528	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50339528A>T	uc003czp.2	-	2	992	c.860T>A	c.(859-861)GTC>GAC	p.V287D	HYAL3_uc003czd.1_5'Flank|HYAL3_uc003cze.1_5'Flank|HYAL3_uc003czf.1_5'Flank|HYAL3_uc003czg.1_5'Flank|NAT6_uc003czj.2_5'Flank|NAT6_uc003czk.3_5'Flank|NAT6_uc003czl.1_5'Flank|HYAL1_uc003czm.2_Missense_Mutation_p.V105D|HYAL1_uc003czo.2_Missense_Mutation_p.V28D|HYAL1_uc003czq.2_Missense_Mutation_p.V287D|HYAL1_uc003czr.2_Missense_Mutation_p.V287D|HYAL1_uc003czn.2_Intron|HYAL1_uc003czs.2_Missense_Mutation_p.V287D|HYAL1_uc003czt.2_Missense_Mutation_p.V287D	NM_033159	NP_149349	Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1 isoform 1	287						extracellular space|lysosome	hyalurononglucosaminidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	Hyaluronidase(DB00070)													---	---	---	---	capture		Missense_Mutation	SNP	50339528	50339528	7763	3	A	T	T	10	10	HYAL1	T	4	4
PLA1A	51365	broad.mit.edu	37	3	119325702	119325702	+	Missense_Mutation	SNP	A	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119325702A>C	uc003ecu.2	+	2	194	c.155A>C	c.(154-156)CAG>CCG	p.Q52P	PLA1A_uc003ecv.2_Missense_Mutation_p.Q52P|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Intron	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	52					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	119325702	119325702	12414	3	A	C	C	7	7	PLA1A	C	4	4
PARP15	165631	broad.mit.edu	37	3	122354719	122354719	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122354719C>A	uc003efm.2	+	12	1875	c.1809C>A	c.(1807-1809)ACC>ACA	p.T603T	PARP15_uc003efn.2_Silent_p.T408T|PARP15_uc003efo.1_Silent_p.T350T|PARP15_uc003efp.1_Silent_p.T369T|PARP15_uc011bjt.1_Silent_p.T300T	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	581	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)														---	---	---	---	capture		Silent	SNP	122354719	122354719	11876	3	C	A	A	24	24	PARP15	A	2	2
HEG1	57493	broad.mit.edu	37	3	124720847	124720847	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124720847G>A	uc003ehs.3	-	11	3434	c.3366C>T	c.(3364-3366)AAC>AAT	p.N1122N	HEG1_uc003ehr.3_Translation_Start_Site|HEG1_uc011bke.1_Silent_p.N1222N	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	1122	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2																		---	---	---	---	capture		Silent	SNP	124720847	124720847	7327	3	G	A	A	40	40	HEG1	A	1	1
GP9	2815	broad.mit.edu	37	3	128780998	128780998	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128780998T>A	uc003elm.2	+	3	603	c.416T>A	c.(415-417)CTG>CAG	p.L139Q		NM_000174	NP_000165	P14770	GPIX_HUMAN	glycoprotein IX (platelet) precursor	139	Extracellular (Potential).				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane	protein binding				0					Quinine(DB00468)													---	---	---	---	capture		Missense_Mutation	SNP	128780998	128780998	6859	3	T	A	A	55	55	GP9	A	4	4
IFT122	55764	broad.mit.edu	37	3	129225321	129225321	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129225321C>T	uc003emm.2	+	22	2926	c.2720C>T	c.(2719-2721)GCG>GTG	p.A907V	IFT122_uc003eml.2_Missense_Mutation_p.A958V|IFT122_uc003emn.2_Missense_Mutation_p.A848V|IFT122_uc003emo.2_Missense_Mutation_p.A796V|IFT122_uc003emp.2_Missense_Mutation_p.A757V|IFT122_uc010htc.2_Missense_Mutation_p.A899V|IFT122_uc011bky.1_Missense_Mutation_p.A698V|IFT122_uc003emq.2_Missense_Mutation_p.A747V|IFT122_uc003emr.2_Missense_Mutation_p.A659V|IFT122_uc011bla.1_Missense_Mutation_p.A680V|IFT122_uc010hte.2_Missense_Mutation_p.A233V|IFT122_uc003ems.2_Missense_Mutation_p.A288V|IFT122_uc011bkx.1_Missense_Mutation_p.A747V|IFT122_uc010htd.1_Missense_Mutation_p.A386V	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	907					camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	129225321	129225321	7856	3	C	T	T	27	27	IFT122	T	1	1
DZIP1L	199221	broad.mit.edu	37	3	137816615	137816615	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137816615C>T	uc003erq.2	-	3	939	c.576G>A	c.(574-576)GTG>GTA	p.V192V	DZIP1L_uc003err.1_Silent_p.V192V	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	192						intracellular	zinc ion binding			ovary(1)|pancreas(1)	2																OREG0015831	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Silent	SNP	137816615	137816615	5050	3	C	T	T	21	21	DZIP1L	T	2	2
TRIM42	287015	broad.mit.edu	37	3	140406900	140406900	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140406900C>A	uc003eto.1	+	3	1567	c.1376C>A	c.(1375-1377)ACC>AAC	p.T459N		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	459	COS.					intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	140406900	140406900	17061	3	C	A	A	18	18	TRIM42	A	2	2
CLDN11	5010	broad.mit.edu	37	3	170150353	170150353	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170150353G>A	uc003fgx.2	+	3	635	c.433G>A	c.(433-435)GCC>ACC	p.A145T	CLDN11_uc011bpt.1_Intron|CLDN11_uc003fgy.2_Missense_Mutation_p.A61T	NM_005602	NP_005593	O75508	CLD11_HUMAN	claudin 11	145	Extracellular (Potential).				calcium-independent cell-cell adhesion	integral to membrane|tight junction	identical protein binding|structural molecule activity			central_nervous_system(1)	1	all_cancers(22;5.62e-23)|all_epithelial(15;7.54e-28)|all_lung(20;2.51e-17)|Lung NSC(18;1.02e-16)|Ovarian(172;0.000567)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---	capture		Missense_Mutation	SNP	170150353	170150353	3609	3	G	A	A	38	38	CLDN11	A	1	1
SLC2A2	6514	broad.mit.edu	37	3	170744448	170744448	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170744448A>G	uc003fhe.1	-	1	321	c.12T>C	c.(10-12)GAT>GAC	p.D4D	SLC2A2_uc003fhf.1_5'UTR|SLC2A2_uc011bpu.1_5'UTR	NM_000340	NP_000331	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose	4	Cytoplasmic (Potential).				carbohydrate metabolic process|cellular lipid metabolic process|endocrine pancreas development|energy reserve metabolic process|regulation of insulin secretion	integral to plasma membrane|membrane fraction	D-glucose transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)															---	---	---	---	capture		Silent	SNP	170744448	170744448	15041	3	A	G	G	16	16	SLC2A2	G	4	4
FNDC3B	64778	broad.mit.edu	37	3	171969199	171969199	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171969199A>G	uc003fhy.2	+	6	830	c.658A>G	c.(658-660)ACA>GCA	p.T220A	FNDC3B_uc003fhz.3_Missense_Mutation_p.T220A|FNDC3B_uc003fia.2_Missense_Mutation_p.T151A	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	220						endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---	capture		Missense_Mutation	SNP	171969199	171969199	6212	3	A	G	G	2	2	FNDC3B	G	4	4
SPATA16	83893	broad.mit.edu	37	3	172834952	172834952	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172834952C>G	uc003fin.3	-	2	728	c.570G>C	c.(568-570)AAG>AAC	p.K190N		NM_031955	NP_114161	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	190					cell differentiation|multicellular organismal development|spermatogenesis	Golgi apparatus	binding			ovary(2)|skin(1)	3	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)															---	---	---	---	capture		Missense_Mutation	SNP	172834952	172834952	15509	3	C	G	G	32	32	SPATA16	G	3	3
MRPL47	57129	broad.mit.edu	37	3	179311590	179311590	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179311590C>G	uc003fjz.2	-	5	518	c.496G>C	c.(496-498)GGT>CGT	p.G166R	MRPL47_uc003fka.2_Missense_Mutation_p.G56R|MRPL47_uc003fkb.2_Missense_Mutation_p.G146R	NM_020409	NP_065142	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47 isoform a	166					translation	mitochondrial ribosome	structural constituent of ribosome				0	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)															---	---	---	---	capture		Missense_Mutation	SNP	179311590	179311590	10204	3	C	G	G	21	21	MRPL47	G	3	3
LAMP3	27074	broad.mit.edu	37	3	182841929	182841929	+	Missense_Mutation	SNP	C	A	A	rs113287351		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182841929C>A	uc003flh.3	-	6	1415	c.1191G>T	c.(1189-1191)ATG>ATT	p.M397I		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	397	Helical; (Potential).				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)															---	---	---	---	capture		Missense_Mutation	SNP	182841929	182841929	8942	3	C	A	A	21	21	LAMP3	A	2	2
AP2M1	1173	broad.mit.edu	37	3	183899529	183899529	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183899529T>C	uc011bqx.1	+	8	910	c.753T>C	c.(751-753)TGT>TGC	p.C251C	AP2M1_uc003fmw.2_Silent_p.C249C|AP2M1_uc003fmx.2_Silent_p.C179C|AP2M1_uc003fmy.2_Silent_p.C249C|AP2M1_uc011bqy.1_Silent_p.C121C|AP2M1_uc011bqz.1_Silent_p.C67C	NM_004068	NP_004059	Q96CW1	AP2M1_HUMAN	adaptor-related protein complex 2, mu 1 subunit	251	MHD.				axon guidance|cellular membrane organization|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|clathrin coat of coated pit|cytosol|endocytic vesicle membrane|peroxisomal membrane	lipid binding|protein binding|transporter activity				0	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.92e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---	capture		Silent	SNP	183899529	183899529	752	3	T	C	C	59	59	AP2M1	C	4	4
FAM43A	131583	broad.mit.edu	37	3	194408707	194408707	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194408707C>A	uc003fuj.2	+	1	2086	c.1152C>A	c.(1150-1152)GGC>GGA	p.G384G		NM_153690	NP_710157	Q8N2R8	FA43A_HUMAN	hypothetical protein LOC131583	384										central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)														---	---	---	---	capture		Silent	SNP	194408707	194408707	5783	3	C	A	A	27	27	FAM43A	A	1	1
PAK2	5062	broad.mit.edu	37	3	196509561	196509561	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196509561C>A	uc003fwy.3	+	2	366	c.44C>A	c.(43-45)CCT>CAT	p.P15H		NM_002577	NP_002568	Q13177	PAK2_HUMAN	p21-activated kinase 2	15					axon guidance|cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of protein kinase activity|peptidyl-serine phosphorylation|positive regulation of peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of apoptosis|regulation of defense response to virus by virus|regulation of growth|T cell costimulation|T cell receptor signaling pathway|viral reproduction	cytosol|nucleus|perinuclear region of cytoplasm|plasma membrane	ATP binding|identical protein binding|protein kinase binding|protein serine/threonine kinase activity|protein tyrosine kinase activator activity			ovary(1)|lung(1)	2	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.07e-23)|all cancers(36;6.38e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00405)														---	---	---	---	capture		Missense_Mutation	SNP	196509561	196509561	11817	3	C	A	A	24	24	PAK2	A	2	2
WFS1	7466	broad.mit.edu	37	4	6303493	6303493	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6303493G>C	uc003giy.2	+	8	2137	c.1971G>C	c.(1969-1971)ATG>ATC	p.M657I	WFS1_uc003gix.2_Missense_Mutation_p.M657I|WFS1_uc003giz.2_Missense_Mutation_p.M475I	NM_001145853	NP_001139325	O76024	WFS1_HUMAN	wolframin	657					endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)														---	---	---	---	capture		Missense_Mutation	SNP	6303493	6303493	17934	4	G	C	C	45	45	WFS1	C	3	3
KLHL5	51088	broad.mit.edu	37	4	39064185	39064185	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39064185A>G	uc003gts.2	+	1	126	c.51A>G	c.(49-51)GCA>GCG	p.A17A	KLHL5_uc003gtp.2_5'UTR|KLHL5_uc003gtq.2_Intron|KLHL5_uc003gtr.1_Silent_p.A17A|KLHL5_uc003gtt.2_Silent_p.A17A	NM_015990	NP_057074	Q96PQ7	KLHL5_HUMAN	kelch-like 5 isoform 1	17						cytoplasm|cytoskeleton	actin binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	39064185	39064185	8706	4	A	G	G	8	8	KLHL5	G	4	4
LIMCH1	22998	broad.mit.edu	37	4	41640961	41640961	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41640961A>T	uc003gvu.3	+	9	1002	c.948A>T	c.(946-948)AGA>AGT	p.R316S	LIMCH1_uc003gvv.3_Missense_Mutation_p.R316S|LIMCH1_uc003gvw.3_Missense_Mutation_p.R316S|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Missense_Mutation_p.R316S|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Missense_Mutation_p.R157S|LIMCH1_uc003gvz.3_Missense_Mutation_p.R701S|LIMCH1_uc011byu.1_Intron|LIMCH1_uc003gwc.3_Missense_Mutation_p.R162S|LIMCH1_uc003gwd.3_Intron|LIMCH1_uc011byv.1_Missense_Mutation_p.R67S	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a	316					actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	41640961	41640961	9123	4	A	T	T	9	9	LIMCH1	T	4	4
GUF1	60558	broad.mit.edu	37	4	44685270	44685270	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44685270G>A	uc003gww.3	+	6	811	c.604G>A	c.(604-606)GAT>AAT	p.D202N	GUF1_uc010ifz.1_RNA	NM_021927	NP_068746	Q8N442	GUF1_HUMAN	GUF1 GTPase homolog	202					translation	mitochondrial inner membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	44685270	44685270	7179	4	G	A	A	45	45	GUF1	A	2	2
PKD2	5311	broad.mit.edu	37	4	88996004	88996004	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88996004A>G	uc003hre.2	+	14	2629	c.2563A>G	c.(2563-2565)AGC>GGC	p.S855G	PKD2_uc011cdf.1_Missense_Mutation_p.S273G|PKD2_uc011cdg.1_Missense_Mutation_p.S181G|PKD2_uc011cdh.1_Missense_Mutation_p.S78G	NM_000297	NP_000288	Q13563	PKD2_HUMAN	polycystin 2	855	Potential.|C-terminal coiled coil domain.|Cytoplasmic (Potential).					basal cortex|basal plasma membrane|endoplasmic reticulum|integral to membrane|lamellipodium|microtubule basal body	calcium ion binding|cytoskeletal protein binding|voltage-gated chloride channel activity|voltage-gated sodium channel activity			skin(1)	1		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)														---	---	---	---	capture		Missense_Mutation	SNP	88996004	88996004	12391	4	A	G	G	7	7	PKD2	G	4	4
ARHGEF38	54848	broad.mit.edu	37	4	106534585	106534585	+	Silent	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106534585C>G	uc003hxu.2	+	3	575	c.429C>G	c.(427-429)TCC>TCG	p.S143S		NM_017700	NP_060170	Q9NXL2	ARH38_HUMAN	hypothetical protein LOC54848	143	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|breast(1)	3																		---	---	---	---	capture		Silent	SNP	106534585	106534585	922	4	C	G	G	23	23	ARHGEF38	G	3	3
PRDM5	11107	broad.mit.edu	37	4	121702330	121702330	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121702330C>A	uc003idn.2	-	12	1661	c.1411G>T	c.(1411-1413)GTT>TTT	p.V471F	PRDM5_uc003ido.2_Missense_Mutation_p.V440F|PRDM5_uc010ine.2_Missense_Mutation_p.V440F	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	471	C2H2-type 11.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	121702330	121702330	12902	4	C	A	A	17	17	PRDM5	A	2	2
KIAA1109	84162	broad.mit.edu	37	4	123270434	123270434	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123270434G>T	uc003ieh.2	+	76	13447	c.13402G>T	c.(13402-13404)GGA>TGA	p.G4468*	KIAA1109_uc003iem.2_Nonsense_Mutation_p.G824*	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4468					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12																		---	---	---	---	capture		Nonsense_Mutation	SNP	123270434	123270434	8516	4	G	T	T	47	47	KIAA1109	T	5	2
NAF1	92345	broad.mit.edu	37	4	164050110	164050110	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164050110G>A	uc003iqj.2	-	8	1618	c.1424C>T	c.(1423-1425)CCA>CTA	p.P475L	NAF1_uc010iqw.1_Intron	NM_138386	NP_612395	Q96HR8	NAF1_HUMAN	nuclear assembly factor 1 homolog isoform a	475	Pro-rich.				rRNA processing|snRNA pseudouridine synthesis	cytoplasm|nucleus|small nucleolar ribonucleoprotein complex	protein binding|snoRNA binding			ovary(2)	2	all_hematologic(180;0.166)	Prostate(90;0.109)																---	---	---	---	capture		Missense_Mutation	SNP	164050110	164050110	10536	4	G	A	A	47	47	NAF1	A	2	2
FAT1	2195	broad.mit.edu	37	4	187628543	187628543	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187628543G>A	uc003izf.2	-	2	2627	c.2439C>T	c.(2437-2439)GTC>GTT	p.V813V	FAT1_uc010iso.1_Silent_p.V813V	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	813	Extracellular (Potential).|Cadherin 6.				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---	capture		Silent	SNP	187628543	187628543	5925	4	G	A	A	37	37	FAT1	A	1	1
PLEKHG4B	153478	broad.mit.edu	37	5	182161	182161	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:182161A>T	uc003jak.2	+	18	3589	c.3539A>T	c.(3538-3540)CAC>CTC	p.H1180L		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	1180	Ser-rich.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)														---	---	---	---	capture		Missense_Mutation	SNP	182161	182161	12498	5	A	T	T	6	6	PLEKHG4B	T	4	4
SLC6A18	348932	broad.mit.edu	37	5	1232415	1232415	+	Missense_Mutation	SNP	G	T	T	rs148359610		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1232415G>T	uc003jby.1	+	2	365	c.242G>T	c.(241-243)CGG>CTG	p.R81L		NM_182632	NP_872438	Q96N87	S6A18_HUMAN	solute carrier family 6, member 18	81	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(3;2.99e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.76e-10)		Epithelial(17;0.000356)|all cancers(22;0.00124)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)															---	---	---	---	capture		Missense_Mutation	SNP	1232415	1232415	15178	5	G	T	T	39	39	SLC6A18	T	1	1
ADAMTS16	170690	broad.mit.edu	37	5	5306799	5306799	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5306799G>A	uc003jdl.2	+	21	3507	c.3369G>A	c.(3367-3369)GCG>GCA	p.A1123A		NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1123					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---	capture		Silent	SNP	5306799	5306799	262	5	G	A	A	39	39	ADAMTS16	A	1	1
NSUN2	54888	broad.mit.edu	37	5	6607388	6607388	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6607388C>A	uc003jdu.2	-	13	1498	c.1433G>T	c.(1432-1434)GGA>GTA	p.G478V	NSUN2_uc003jds.2_5'Flank|NSUN2_uc003jdt.2_Missense_Mutation_p.G242V|NSUN2_uc011cmk.1_Missense_Mutation_p.G443V|NSUN2_uc003jdv.2_Missense_Mutation_p.G242V	NM_017755	NP_060225	Q08J23	NSUN2_HUMAN	NOL1/NOP2/Sun domain family, member 2	478						cytoplasm|nucleolus	tRNA (cytosine-5-)-methyltransferase activity|tRNA binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	6607388	6607388	11083	5	C	A	A	30	30	NSUN2	A	2	2
CDH18	1016	broad.mit.edu	37	5	19591263	19591263	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19591263G>A	uc003jgc.2	-	6	1279	c.902C>T	c.(901-903)GCT>GTT	p.A301V	CDH18_uc003jgd.2_Missense_Mutation_p.A301V|CDH18_uc011cnm.1_Missense_Mutation_p.A301V	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	301	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---	capture		Missense_Mutation	SNP	19591263	19591263	3232	5	G	A	A	34	34	CDH18	A	2	2
CDH6	1004	broad.mit.edu	37	5	31323238	31323238	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31323238C>T	uc003jhe.1	+	12	2522	c.2196C>T	c.(2194-2196)TAC>TAT	p.Y732Y		NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein	732	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7																		---	---	---	---	capture		Silent	SNP	31323238	31323238	3243	5	C	T	T	19	19	CDH6	T	1	1
SLC1A3	6507	broad.mit.edu	37	5	36684019	36684019	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36684019T>A	uc003jkj.3	+	9	1819	c.1343T>A	c.(1342-1344)CTG>CAG	p.L448Q	SLC1A3_uc011cox.1_Missense_Mutation_p.L341Q|SLC1A3_uc010iuy.2_Intron	NM_004172	NP_004163	P43003	EAA1_HUMAN	solute carrier family 1 (glial high affinity	448					D-aspartate import|L-glutamate import|neurotransmitter uptake	integral to membrane|membrane fraction	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity				0	all_lung(31;0.000245)		Epithelial(62;0.0444)|Lung(74;0.111)|all cancers(62;0.128)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)		L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	36684019	36684019	14929	5	T	A	A	55	55	SLC1A3	A	4	4
HEATR7B2	133558	broad.mit.edu	37	5	41008872	41008872	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41008872C>A	uc003jmj.3	-	33	3934	c.3444G>T	c.(3442-3444)GTG>GTT	p.V1148V	HEATR7B2_uc003jmi.3_Silent_p.V703V	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1148	HEAT 12.						binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---	capture		Silent	SNP	41008872	41008872	7318	5	C	A	A	29	29	HEATR7B2	A	2	2
C5orf34	375444	broad.mit.edu	37	5	43506365	43506365	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43506365A>G	uc003jnz.1	-	5	734	c.417T>C	c.(415-417)TCT>TCC	p.S139S	C5orf34_uc011cpx.1_Silent_p.S25S	NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	139										breast(1)	1	Lung NSC(6;2.07e-05)																	---	---	---	---	capture		Silent	SNP	43506365	43506365	2391	5	A	G	G	11	11	C5orf34	G	4	4
EDIL3	10085	broad.mit.edu	37	5	83360518	83360518	+	Splice_Site	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:83360518C>T	uc003kio.1	-	8	1371	c.952_splice	c.e8+1	p.G318_splice	EDIL3_uc003kip.1_Splice_Site_p.G308_splice|EDIL3_uc011ctt.1_Splice_Site_p.G95_splice	NM_005711	NP_005702			EGF-like repeats and discoidin I-like						cell adhesion|multicellular organismal development	extracellular region	calcium ion binding|integrin binding			skin(2)	2		Lung NSC(167;0.000121)|all_lung(232;0.000154)|Ovarian(174;0.0425)		OV - Ovarian serous cystadenocarcinoma(54;4.3e-40)|Epithelial(54;4.79e-32)|all cancers(79;1.54e-26)														---	---	---	---	capture		Splice_Site	SNP	83360518	83360518	5102	5	C	T	T	18	18	EDIL3	T	5	2
HSPA4	3308	broad.mit.edu	37	5	132409706	132409706	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132409706A>G	uc003kyj.2	+	6	832	c.551A>G	c.(550-552)TAT>TGT	p.Y184C		NM_002154	NP_002145	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	184					cellular chaperone-mediated protein complex assembly|protein import into mitochondrial outer membrane|response to unfolded protein	cytoplasm|nucleus	ATP binding			lung(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---	capture		Missense_Mutation	SNP	132409706	132409706	7711	5	A	G	G	16	16	HSPA4	G	4	4
FAM53C	51307	broad.mit.edu	37	5	137680859	137680859	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137680859A>G	uc003lcv.2	+	4	952	c.482A>G	c.(481-483)CAG>CGG	p.Q161R	FAM53C_uc003lcw.2_Missense_Mutation_p.Q161R|FAM53C_uc011cyq.1_Intron|FAM53C_uc011cyr.1_Intron	NM_001135647	NP_001129119	Q9NYF3	FA53C_HUMAN	hypothetical protein LOC51307	161										ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)															---	---	---	---	capture		Missense_Mutation	SNP	137680859	137680859	5803	5	A	G	G	7	7	FAM53C	G	4	4
ADAM19	8728	broad.mit.edu	37	5	156957872	156957872	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156957872C>A	uc003lwz.2	-	5	414	c.350G>T	c.(349-351)GGC>GTC	p.G117V	ADAM19_uc003lww.1_5'UTR|ADAM19_uc011ddr.1_Missense_Mutation_p.G48V	NM_033274	NP_150377	Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19 preproprotein	117					proteolysis	integral to membrane	metalloendopeptidase activity|SH3 domain binding|zinc ion binding			ovary(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)															---	---	---	---	capture		Missense_Mutation	SNP	156957872	156957872	241	5	C	A	A	26	26	ADAM19	A	2	2
F13A1	2162	broad.mit.edu	37	6	6318807	6318807	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6318807C>A	uc003mwv.2	-	2	214	c.91G>T	c.(91-93)GAG>TAG	p.E31*	F13A1_uc011dib.1_Nonsense_Mutation_p.E31*	NM_000129	NP_000120	P00488	F13A_HUMAN	coagulation factor XIII A1 subunit precursor	31					peptide cross-linking|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)|skin(1)	6	Ovarian(93;0.0816)	all_hematologic(90;0.152)			L-Glutamine(DB00130)													---	---	---	---	capture		Nonsense_Mutation	SNP	6318807	6318807	5534	6	C	A	A	30	30	F13A1	A	5	2
HIST1H3I	8354	broad.mit.edu	37	6	27839938	27839938	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27839938G>A	uc003njy.2	-	1	162	c.156C>T	c.(154-156)ATC>ATT	p.I52I		NM_003533	NP_003524	P68431	H31_HUMAN	histone cluster 1, H3i	52					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	27839938	27839938	7448	6	G	A	A	41	41	HIST1H3I	A	2	2
TRIM26	7726	broad.mit.edu	37	6	30166457	30166457	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30166457C>T	uc003npr.2	-	3	633	c.424G>A	c.(424-426)GCC>ACC	p.A142T	TRIM26_uc003nps.2_Missense_Mutation_p.A142T|TRIM26_uc010jry.2_5'UTR|TRIM26_uc003npt.2_Missense_Mutation_p.A142T|TRIM26_uc003npu.1_Missense_Mutation_p.A142T	NM_003449	NP_003440	Q12899	TRI26_HUMAN	tripartite motif-containing 26	142							DNA binding|zinc ion binding			ovary(2)|lung(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	30166457	30166457	17044	6	C	T	T	27	27	TRIM26	T	1	1
KCNK17	89822	broad.mit.edu	37	6	39272395	39272395	+	Missense_Mutation	SNP	C	A	A	rs142227833		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39272395C>A	uc003ooo.2	-	3	529	c.389G>T	c.(388-390)CGC>CTC	p.R130L	KCNK17_uc003oop.2_Missense_Mutation_p.R130L	NM_031460	NP_113648	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	130	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	39272395	39272395	8369	6	C	A	A	27	27	KCNK17	A	1	1
APOBEC2	10930	broad.mit.edu	37	6	41029512	41029512	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41029512G>T	uc003opl.2	+	2	724	c.577G>T	c.(577-579)GAG>TAG	p.E193*	UNC5CL_uc010jxe.1_Intron|APOBEC2_uc010jxf.2_RNA	NM_006789	NP_006780	Q9Y235	ABEC2_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic	193					DNA demethylation|mRNA processing		cytidine deaminase activity|RNA binding|zinc ion binding				0	Ovarian(28;0.0418)|Colorectal(47;0.196)																	---	---	---	---	capture		Nonsense_Mutation	SNP	41029512	41029512	799	6	G	T	T	41	41	APOBEC2	T	5	2
KIAA0240	23506	broad.mit.edu	37	6	42821415	42821415	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42821415G>C	uc003osn.1	+	8	2136	c.1985G>C	c.(1984-1986)GGA>GCA	p.G662A	KIAA0240_uc011duw.1_Missense_Mutation_p.G662A|KIAA0240_uc003osp.1_Missense_Mutation_p.G662A	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506	662										ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)															---	---	---	---	capture		Missense_Mutation	SNP	42821415	42821415	8471	6	G	C	C	41	41	KIAA0240	C	3	3
TINAG	27283	broad.mit.edu	37	6	54173458	54173458	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54173458G>A	uc003pcj.2	+	1	256	c.110G>A	c.(109-111)AGG>AAG	p.R37K	TINAG_uc003pci.2_Missense_Mutation_p.R37K|TINAG_uc010jzt.2_RNA	NM_014464	NP_055279	Q9UJW2	TINAG_HUMAN	tubulointerstitial nephritis antigen	37					cell adhesion|immune response|Malpighian tubule morphogenesis|proteolysis	basement membrane	cysteine-type endopeptidase activity|nucleotide binding|polysaccharide binding|scavenger receptor activity			ovary(3)|central_nervous_system(1)	4	Lung NSC(77;0.0518)		LUSC - Lung squamous cell carcinoma(124;0.246)															---	---	---	---	capture		Missense_Mutation	SNP	54173458	54173458	16450	6	G	A	A	35	35	TINAG	A	2	2
GFRAL	389400	broad.mit.edu	37	6	55264052	55264052	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55264052G>T	uc003pcm.1	+	7	1113	c.1027G>T	c.(1027-1029)GGA>TGA	p.G343*		NM_207410	NP_997293	Q6UXV0	GFRAL_HUMAN	GDNF family receptor alpha like precursor	343	Extracellular (Potential).					integral to membrane	receptor activity			ovary(1)|breast(1)	2	Lung NSC(77;0.0875)|Renal(3;0.122)		LUSC - Lung squamous cell carcinoma(124;0.23)															---	---	---	---	capture		Nonsense_Mutation	SNP	55264052	55264052	6619	6	G	T	T	47	47	GFRAL	T	5	2
TTK	7272	broad.mit.edu	37	6	80744784	80744784	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80744784A>G	uc003pjc.2	+	15	1771	c.1697A>G	c.(1696-1698)GAT>GGT	p.D566G	TTK_uc003pjb.3_Missense_Mutation_p.D565G	NM_003318	NP_003309	P33981	TTK_HUMAN	TTK protein kinase	566	Protein kinase.				mitotic cell cycle spindle assembly checkpoint|mitotic spindle organization|positive regulation of cell proliferation|positive regulation of pathway-restricted SMAD protein phosphorylation	spindle	ATP binding|identical protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(4)|stomach(2)|lung(2)|large_intestine(2)|pancreas(1)	11		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)														---	---	---	---	capture		Missense_Mutation	SNP	80744784	80744784	17275	6	A	G	G	12	12	TTK	G	4	4
CNR1	1268	broad.mit.edu	37	6	88853833	88853833	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88853833C>T	uc011dzq.1	-	2	4724	c.1161G>A	c.(1159-1161)CTG>CTA	p.L387L	CNR1_uc010kbz.2_Silent_p.L387L|CNR1_uc011dzr.1_Silent_p.L387L|CNR1_uc011dzs.1_Silent_p.L387L|CNR1_uc003pmq.3_Silent_p.L387L|CNR1_uc011dzt.1_Silent_p.L387L|CNR1_uc010kca.2_Silent_p.L354L	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	387	Helical; Name=7; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)													---	---	---	---	capture		Silent	SNP	88853833	88853833	3769	6	C	T	T	25	25	CNR1	T	2	2
MDN1	23195	broad.mit.edu	37	6	90450019	90450019	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90450019C>T	uc003pnn.1	-	32	4643	c.4527G>A	c.(4525-4527)TTG>TTA	p.L1509L		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	1509					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---	capture		Silent	SNP	90450019	90450019	9804	6	C	T	T	29	29	MDN1	T	2	2
ZBTB24	9841	broad.mit.edu	37	6	109797403	109797403	+	Silent	SNP	T	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109797403T>C	uc003ptl.1	-	4	1347	c.1179A>G	c.(1177-1179)CTA>CTG	p.L393L	ZBTB24_uc011ear.1_RNA|ZBTB24_uc010kds.1_Silent_p.L337L|ZBTB24_uc010kdt.1_RNA	NM_014797	NP_055612	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24 isoform	393	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)														---	---	---	---	capture		Silent	SNP	109797403	109797403	18117	6	T	C	C	61	61	ZBTB24	C	4	4
STXBP5	134957	broad.mit.edu	37	6	147581765	147581765	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147581765A>T	uc003qlz.2	+	5	607	c.446A>T	c.(445-447)CAT>CTT	p.H149L	STXBP5_uc010khz.1_Missense_Mutation_p.H149L|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_5'UTR	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	149	WD 3.				exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)														---	---	---	---	capture		Missense_Mutation	SNP	147581765	147581765	15876	6	A	T	T	8	8	STXBP5	T	4	4
ULBP1	80329	broad.mit.edu	37	6	150289920	150289920	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150289920A>T	uc003qnp.2	+	2	306	c.263A>T	c.(262-264)GAA>GTA	p.E88V		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1 precursor	88	MHC class I alpha-1 like.				antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)														---	---	---	---	capture		Missense_Mutation	SNP	150289920	150289920	17530	6	A	T	T	9	9	ULBP1	T	4	4
VIP	7432	broad.mit.edu	37	6	153076434	153076434	+	Silent	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153076434C>A	uc003qpe.2	+	4	433	c.261C>A	c.(259-261)ACC>ACA	p.T87T	VIP_uc003qpf.2_Silent_p.T87T|VIP_uc010kjd.2_Silent_p.T87T	NM_003381	NP_003372	P01282	VIP_HUMAN	vasoactive intestinal peptide isoform 1	87					body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity				0		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)														---	---	---	---	capture		Silent	SNP	153076434	153076434	17734	6	C	A	A	21	21	VIP	A	2	2
SOD2	6648	broad.mit.edu	37	6	160105988	160105988	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160105988C>A	uc003qsg.2	-	4	575	c.421G>T	c.(421-423)GGT>TGT	p.G141C	SOD2_uc003qsh.2_Missense_Mutation_p.G102C|SOD2_uc003qsi.1_Missense_Mutation_p.G141C|SOD2_uc011efu.1_Intron|SOD2_uc011efv.1_Missense_Mutation_p.G102C	NM_001024465	NP_001019636	P04179	SODM_HUMAN	manganese superoxide dismutase isoform A	141					age-dependent response to reactive oxygen species|negative regulation of neuron apoptosis|oxygen homeostasis|protein homotetramerization|regulation of transcription from RNA polymerase II promoter|release of cytochrome c from mitochondria|removal of superoxide radicals|vasodilation by acetylcholine involved in regulation of systemic arterial blood pressure		manganese ion binding|superoxide dismutase activity				0		Breast(66;0.000776)|Ovarian(120;0.0303)|Prostate(117;0.103)		OV - Ovarian serous cystadenocarcinoma(65;1.4e-18)|BRCA - Breast invasive adenocarcinoma(81;5.77e-06)														---	---	---	---	capture		Missense_Mutation	SNP	160105988	160105988	15421	6	C	A	A	21	21	SOD2	A	2	2
PACRG	135138	broad.mit.edu	37	6	163510295	163510295	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163510295C>T	uc003qua.2	+	5	692	c.468C>T	c.(466-468)GCC>GCT	p.A156A	PACRG_uc003qub.2_Silent_p.A156A|PACRG_uc003quc.2_Silent_p.A156A	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1	156											0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)														---	---	---	---	capture		Silent	SNP	163510295	163510295	11786	6	C	T	T	24	24	PACRG	T	2	2
T	6862	broad.mit.edu	37	6	166580194	166580194	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166580194C>T	uc003quu.1	-	3	850	c.357G>A	c.(355-357)GCG>GCA	p.A119A	T_uc003qut.1_Silent_p.A119A|T_uc003quv.1_Silent_p.A119A	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	119	T-box.				anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)										Chordoma_Familial_Clustering_of				---	---	---	---	capture		Silent	SNP	166580194	166580194	16009	6	C	T	T	27	27	T	T	1	1
GPR31	2853	broad.mit.edu	37	6	167570777	167570777	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167570777G>C	uc011egq.1	-	1	543	c.543C>G	c.(541-543)CTC>CTG	p.L181L		NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31	181	Helical; Name=5; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)														---	---	---	---	capture		Silent	SNP	167570777	167570777	6962	6	G	C	C	33	33	GPR31	C	3	3
IQCE	23288	broad.mit.edu	37	7	2617950	2617950	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2617950G>T	uc003smo.3	+	7	724	c.540G>T	c.(538-540)AGG>AGT	p.R180S	IQCE_uc010ksm.1_Missense_Mutation_p.R180S|IQCE_uc003sml.1_Missense_Mutation_p.R180S|IQCE_uc011jvy.1_Missense_Mutation_p.R164S|IQCE_uc011jvz.1_Missense_Mutation_p.R115S|IQCE_uc003smk.3_Missense_Mutation_p.R164S|IQCE_uc003smn.3_Missense_Mutation_p.R115S	NM_152558	NP_689771	Q6IPM2	IQCE_HUMAN	IQ motif containing E isoform 1	180	Potential.										0		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.23e-13)														---	---	---	---	capture		Missense_Mutation	SNP	2617950	2617950	8107	7	G	T	T	41	41	IQCE	T	2	2
RADIL	55698	broad.mit.edu	37	7	4856057	4856057	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4856057G>T	uc003snj.1	-	8	1941	c.1768C>A	c.(1768-1770)CCA>ACA	p.P590T	RADIL_uc003sng.1_RNA|RADIL_uc003sni.1_Missense_Mutation_p.P95T|RADIL_uc011jwc.1_Missense_Mutation_p.P350T|RADIL_uc011jwd.1_RNA	NM_018059	NP_060529	Q96JH8	RADIL_HUMAN	Rap GTPase interactor	590	Dilute.				cell adhesion|multicellular organismal development|signal transduction		protein binding			lung(2)|central_nervous_system(2)|pancreas(2)|breast(1)	7		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)|OV - Ovarian serous cystadenocarcinoma(56;7.41e-15)														---	---	---	---	capture		Missense_Mutation	SNP	4856057	4856057	13457	7	G	T	T	42	42	RADIL	T	2	2
ZNRF2	223082	broad.mit.edu	37	7	30363339	30363339	+	Missense_Mutation	SNP	G	T	T	rs142290977		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30363339G>T	uc003tat.2	+	2	1602	c.551G>T	c.(550-552)CGA>CTA	p.R184L		NM_147128	NP_667339	Q8NHG8	ZNRF2_HUMAN	zinc finger/RING finger 2	184						cell junction|endosome membrane|lysosomal membrane|presynaptic membrane	ligase activity|zinc ion binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	30363339	30363339	18816	7	G	T	T	37	37	ZNRF2	T	1	1
CRCP	27297	broad.mit.edu	37	7	65599298	65599298	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65599298G>A	uc003tus.2	+	4	321	c.176G>A	c.(175-177)AGG>AAG	p.R59K	CRCP_uc003tuv.2_RNA|CRCP_uc011kdw.1_Missense_Mutation_p.R52K|CRCP_uc003tut.2_Missense_Mutation_p.R26K|CRCP_uc003tuu.2_Intron	NM_014478	NP_055293	O75575	RPC9_HUMAN	calcitonin gene-related peptide-receptor	59					acrosome reaction|innate immune response|response to virus|transcription from RNA polymerase III promoter	DNA polymerase III complex|nucleus|plasma membrane	calcitonin receptor activity|DNA-directed RNA polymerase activity|nucleotide binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	65599298	65599298	3991	7	G	A	A	35	35	CRCP	A	2	2
CALN1	83698	broad.mit.edu	37	7	71488709	71488709	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71488709G>T	uc003twa.3	-	4	835	c.308C>A	c.(307-309)CCC>CAC	p.P103H	CALN1_uc003twb.3_Missense_Mutation_p.P145H|CALN1_uc003twc.3_Missense_Mutation_p.P103H	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2	103	EF-hand 2.|Cytoplasmic (Potential).					Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)																---	---	---	---	capture		Missense_Mutation	SNP	71488709	71488709	2708	7	G	T	T	43	43	CALN1	T	2	2
COL1A2	1278	broad.mit.edu	37	7	94053664	94053664	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94053664C>T	uc003ung.1	+	41	3053	c.2582C>T	c.(2581-2583)CCA>CTA	p.P861L	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_RNA	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	861					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)										HNSCC(75;0.22)			---	---	---	---	capture		Missense_Mutation	SNP	94053664	94053664	3816	7	C	T	T	21	21	COL1A2	T	2	2
MUC17	140453	broad.mit.edu	37	7	100686302	100686302	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686302A>T	uc003uxp.1	+	3	11658	c.11605A>T	c.(11605-11607)ACC>TCC	p.T3869S	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3869	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---	capture		Missense_Mutation	SNP	100686302	100686302	10368	7	A	T	T	14	14	MUC17	T	4	4
RELN	5649	broad.mit.edu	37	7	103270438	103270438	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103270438C>G	uc003vca.2	-	20	2811	c.2651G>C	c.(2650-2652)GGA>GCA	p.G884A	RELN_uc010liz.2_Missense_Mutation_p.G884A	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	884					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)														---	---	---	---	capture		Missense_Mutation	SNP	103270438	103270438	13689	7	C	G	G	30	30	RELN	G	3	3
ZNF277	11179	broad.mit.edu	37	7	111846793	111846793	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111846793G>T	uc003vge.2	+	1	151	c.22G>T	c.(22-24)GGG>TGG	p.G8W	DOCK4_uc003vfx.2_5'Flank|DOCK4_uc003vfy.2_5'Flank|DOCK4_uc003vga.1_5'Flank|DOCK4_uc010ljt.1_5'Flank|ZNF277_uc003vgd.2_Missense_Mutation_p.G8W|ZNF277_uc003vgf.2_5'UTR|ZNF277_uc003vgc.2_Missense_Mutation_p.G8W	NM_021994	NP_068834	Q9NRM2	ZN277_HUMAN	zinc finger protein (C2H2 type) 277	8						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4																		---	---	---	---	capture		Missense_Mutation	SNP	111846793	111846793	18404	7	G	T	T	43	43	ZNF277	T	2	2
PLXNA4	91584	broad.mit.edu	37	7	131831444	131831444	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131831444T>A	uc003vra.3	-	28	5109	c.4880A>T	c.(4879-4881)TAC>TTC	p.Y1627F	PLXNA4_uc003vqz.3_5'Flank	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1627	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	131831444	131831444	12548	7	T	A	A	57	57	PLXNA4	A	4	4
CHRM2	1129	broad.mit.edu	37	7	136700215	136700215	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700215C>G	uc003vtf.1	+	4	1226	c.603C>G	c.(601-603)ATC>ATG	p.I201M	CHRM2_uc003vtg.1_Missense_Mutation_p.I201M|CHRM2_uc003vtj.1_Missense_Mutation_p.I201M|CHRM2_uc003vtk.1_Missense_Mutation_p.I201M|CHRM2_uc003vtl.1_Missense_Mutation_p.I201M|CHRM2_uc003vtm.1_Missense_Mutation_p.I201M|CHRM2_uc003vti.1_Missense_Mutation_p.I201M|CHRM2_uc003vto.1_Missense_Mutation_p.I201M|CHRM2_uc003vtn.1_Missense_Mutation_p.I201M|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	201	Helical; Name=5; (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)													---	---	---	---	capture		Missense_Mutation	SNP	136700215	136700215	3511	7	C	G	G	29	29	CHRM2	G	3	3
KIAA1549	57670	broad.mit.edu	37	7	138522834	138522834	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138522834C>T	uc011kql.1	-	20	5719	c.5670G>A	c.(5668-5670)GAG>GAA	p.E1890E	KIAA1549_uc011kqi.1_Silent_p.E658E|KIAA1549_uc003vuk.3_Silent_p.E1824E|KIAA1549_uc011kqj.1_Silent_p.E1874E|KIAA1549_uc011kqk.1_Silent_p.E674E	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1890						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230								O	BRAF	pilocytic astrocytoma								---	---	---	---	capture		Silent	SNP	138522834	138522834	8553	7	C	T	T	28	28	KIAA1549	T	2	2
EPHA1	2041	broad.mit.edu	37	7	143096796	143096796	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143096796C>T	uc003wcz.2	-	4	870	c.783G>A	c.(781-783)CGG>CGA	p.R261R		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	261	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)																---	---	---	---	capture		Silent	SNP	143096796	143096796	5358	7	C	T	T	18	18	EPHA1	T	2	2
OR2A14	135941	broad.mit.edu	37	7	143826379	143826379	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143826379G>C	uc011kua.1	+	1	174	c.174G>C	c.(172-174)ATG>ATC	p.M58I		NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)																	---	---	---	---	capture		Missense_Mutation	SNP	143826379	143826379	11382	7	G	C	C	48	48	OR2A14	C	3	3
GIMAP4	55303	broad.mit.edu	37	7	150269350	150269350	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150269350C>T	uc003whl.2	+	3	274	c.192C>T	c.(190-192)TCC>TCT	p.S64S	GIMAP4_uc011kuu.1_5'UTR|GIMAP4_uc011kuv.1_Silent_p.S78S	NM_018326	NP_060796	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	64							GTP binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)														---	---	---	---	capture		Silent	SNP	150269350	150269350	6649	7	C	T	T	21	21	GIMAP4	T	2	2
SPAG11A	653423	broad.mit.edu	37	8	7721034	7721034	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7721034C>T	uc003wsa.2	+	3	393	c.358C>T	c.(358-360)CAG>TAG	p.Q120*	SPAG11A_uc003wrz.2_Nonsense_Mutation_p.Q102*|SPAG11A_uc003wsb.2_RNA	NM_058202	NP_478109	Q6PDA7	SG11A_HUMAN	sperm associated antigen 11B isoform H	Error:Variant_position_missing_in_Q6PDA7_after_alignment						extracellular region					0				COAD - Colon adenocarcinoma(149;0.0162)|READ - Rectum adenocarcinoma(644;0.236)														---	---	---	---	capture		Nonsense_Mutation	SNP	7721034	7721034	15479	8	C	T	T	25	25	SPAG11A	T	5	2
HR	55806	broad.mit.edu	37	8	21978727	21978727	+	Missense_Mutation	SNP	C	A	A	rs139027208		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:21978727C>A	uc003xas.2	-	10	2883	c.2218G>T	c.(2218-2220)GCT>TCT	p.A740S	HR_uc003xat.2_Missense_Mutation_p.A740S	NM_005144	NP_005135	O43593	HAIR_HUMAN	hairless protein isoform a	740							DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)|ovary(1)	2		Breast(100;0.000162)|Acute lymphoblastic leukemia(644;0.0775)|Prostate(55;0.116)		KIRC - Kidney renal clear cell carcinoma(542;1.19e-05)|BRCA - Breast invasive adenocarcinoma(99;3.56e-05)|Colorectal(74;0.00191)|COAD - Colon adenocarcinoma(73;0.0615)|READ - Rectum adenocarcinoma(644;0.1)														---	---	---	---	capture		Missense_Mutation	SNP	21978727	21978727	7639	8	C	A	A	27	27	HR	A	1	1
DCTN6	10671	broad.mit.edu	37	8	30040645	30040645	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30040645C>T	uc003xhy.2	+	7	616	c.529C>T	c.(529-531)CTA>TTA	p.L177L		NM_006571	NP_006562	O00399	DCTN6_HUMAN	dynactin 6	177						centrosome	transferase activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(542;0.099)|Kidney(114;0.119)														---	---	---	---	capture		Silent	SNP	30040645	30040645	4482	8	C	T	T	24	24	DCTN6	T	2	2
ZFHX4	79776	broad.mit.edu	37	8	77763722	77763722	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763722C>A	uc003yav.2	+	10	4817	c.4430C>A	c.(4429-4431)CCT>CAT	p.P1477H	ZFHX4_uc003yau.1_Missense_Mutation_p.P1522H|ZFHX4_uc003yaw.1_Missense_Mutation_p.P1477H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1477						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---	capture		Missense_Mutation	SNP	77763722	77763722	18223	8	C	A	A	24	24	ZFHX4	A	2	2
PEX2	5828	broad.mit.edu	37	8	77895774	77895774	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77895774T>A	uc003yax.2	-	4	1099	c.641A>T	c.(640-642)CAG>CTG	p.Q214L	PEX2_uc003yay.2_Missense_Mutation_p.Q214L|PEX2_uc003yaz.2_Missense_Mutation_p.Q214L	NM_000318	NP_000309	P28328	PEX2_HUMAN	peroxin 2	214					peroxisome organization	integral to peroxisomal membrane	protein binding|zinc ion binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	77895774	77895774	12167	8	T	A	A	55	55	PEX2	A	4	4
CNGB3	54714	broad.mit.edu	37	8	87588225	87588225	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87588225G>T	uc003ydx.2	-	18	2283	c.2237C>A	c.(2236-2238)CCA>CAA	p.P746Q	CNGB3_uc010maj.2_Missense_Mutation_p.P603Q	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	746	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	87588225	87588225	3739	8	G	T	T	47	47	CNGB3	T	2	2
CCNE2	9134	broad.mit.edu	37	8	95897363	95897363	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95897363C>A	uc003yhc.2	-	9	872	c.763G>T	c.(763-765)GCT>TCT	p.A255S	CCNE2_uc003yhd.2_Missense_Mutation_p.A255S	NM_057749	NP_477097	O96020	CCNE2_HUMAN	cyclin E2	255					cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|regulation of cyclin-dependent protein kinase activity	cytosol|nucleoplasm	protein kinase binding				0	Breast(36;8.75e-07)																	---	---	---	---	capture		Missense_Mutation	SNP	95897363	95897363	3048	8	C	A	A	25	25	CCNE2	A	2	2
EPPK1	83481	broad.mit.edu	37	8	144941086	144941086	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144941086C>T	uc003zaa.1	-	1	6349	c.6336G>A	c.(6334-6336)GTG>GTA	p.V2112V		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	2112						cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)															---	---	---	---	capture		Silent	SNP	144941086	144941086	5383	8	C	T	T	21	21	EPPK1	T	2	2
OPLAH	26873	broad.mit.edu	37	8	145108014	145108014	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145108014C>T	uc003zar.3	-	21	2972	c.2890G>A	c.(2890-2892)GTG>ATG	p.V964M		NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	964							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	145108014	145108014	11282	8	C	T	T	19	19	OPLAH	T	1	1
DMRT3	58524	broad.mit.edu	37	9	990075	990075	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:990075G>C	uc003zgw.1	+	2	527	c.489G>C	c.(487-489)TCG>TCC	p.S163S		NM_021240	NP_067063	Q9NQL9	DMRT3_HUMAN	doublesex and mab-3 related transcription factor	163					cell differentiation|multicellular organismal development|sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(2)|central_nervous_system(1)	3		all_lung(10;1.39e-08)|Lung NSC(10;1.42e-08)		Lung(218;0.0196)														---	---	---	---	capture		Silent	SNP	990075	990075	4767	9	G	C	C	39	39	DMRT3	C	3	3
FREM1	158326	broad.mit.edu	37	9	14842532	14842532	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14842532C>T	uc003zlm.2	-	9	2110	c.1520G>A	c.(1519-1521)CGT>CAT	p.R507H	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	507	CSPG 3.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)														---	---	---	---	capture		Missense_Mutation	SNP	14842532	14842532	6291	9	C	T	T	19	19	FREM1	T	1	1
CDKN2A	1029	broad.mit.edu	37	9	21971199	21971199	+	Missense_Mutation	SNP	C	G	G	rs104894095		TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971199C>G	uc003zpk.2	-	2	371	c.159G>C	c.(157-159)ATG>ATC	p.M53I	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.D109H	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	53	ANK 2.		M -> I (in CMM2).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.?(14)|p.M53_R58del(3)|p.M53*(1)|p.V28_V51del(1)|p.M53T(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)			17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			---	---	---	---	capture		Missense_Mutation	SNP	21971199	21971199	3290	9	C	G	G	29	29	CDKN2A	G	3	3
AUH	549	broad.mit.edu	37	9	93979600	93979600	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93979600C>A	uc004arf.3	-	8	888	c.853G>T	c.(853-855)GCA>TCA	p.A285S	AUH_uc004arg.3_Missense_Mutation_p.A256S	NM_001698	NP_001689	Q13825	AUHM_HUMAN	AU RNA binding protein/enoyl-Coenzyme A	285					branched chain family amino acid catabolic process|mRNA catabolic process	mitochondrial matrix	enoyl-CoA hydratase activity|methylglutaconyl-CoA hydratase activity|mRNA 3'-UTR binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	93979600	93979600	1240	9	C	A	A	25	25	AUH	A	2	2
DBC1	1620	broad.mit.edu	37	9	121971069	121971069	+	Missense_Mutation	SNP	C	G	G	rs17476783	byFrequency;by1000genomes	TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:121971069C>G	uc004bkc.2	-	7	1529	c.1073G>C	c.(1072-1074)CGC>CCC	p.R358P		NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	358					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	121971069	121971069	4418	9	C	G	G	27	27	DBC1	G	3	3
LRSAM1	90678	broad.mit.edu	37	9	130258289	130258289	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130258289C>A	uc004brb.1	+	23	2090	c.1745C>A	c.(1744-1746)TCG>TAG	p.S582*	LRSAM1_uc010mxk.1_Nonsense_Mutation_p.S555*|LRSAM1_uc004brc.1_Nonsense_Mutation_p.S582*|LRSAM1_uc004brd.1_Nonsense_Mutation_p.S582*|LRSAM1_uc004bre.1_Nonsense_Mutation_p.S162*|uc004brf.1_5'Flank|LRSAM1_uc004brg.1_Nonsense_Mutation_p.S13*	NM_001005373	NP_001005373	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif	582	SAM.				negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0																		---	---	---	---	capture		Nonsense_Mutation	SNP	130258289	130258289	9419	9	C	A	A	31	31	LRSAM1	A	5	1
FUBP3	8939	broad.mit.edu	37	9	133507353	133507353	+	Silent	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:133507353G>T	uc004bzr.1	+	15	1485	c.1377G>T	c.(1375-1377)GGG>GGT	p.G459G	FUBP3_uc004bzs.1_Silent_p.G372G	NM_003934	NP_003925	Q96I24	FUBP3_HUMAN	far upstream element (FUSE) binding protein 3	459					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;0.000279)														---	---	---	---	capture		Silent	SNP	133507353	133507353	6344	9	G	T	T	44	44	FUBP3	T	2	2
PRPS2	5634	broad.mit.edu	37	X	12827451	12827451	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12827451G>A	uc004cvb.2	+	3	529	c.405G>A	c.(403-405)CAG>CAA	p.Q135Q	PRPS2_uc004cva.2_Silent_p.Q138Q|PRPS2_uc010nec.2_Silent_p.Q71Q	NM_002765	NP_002756	P11908	PRPS2_HUMAN	phosphoribosyl pyrophosphate synthetase 2	135					nucleoside metabolic process|ribonucleoside monophosphate biosynthetic process		ATP binding|kinase activity|magnesium ion binding|protein homodimerization activity|ribose phosphate diphosphokinase activity				0																		---	---	---	---	capture		Silent	SNP	12827451	12827451	13023	23	G	A	A	35	35	PRPS2	A	2	2
CTPS2	56474	broad.mit.edu	37	X	16685639	16685639	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:16685639G>C	uc004cxk.2	-	13	2038	c.1294C>G	c.(1294-1296)CTG>GTG	p.L432V	CTPS2_uc004cxl.2_Missense_Mutation_p.L432V|CTPS2_uc004cxm.2_Missense_Mutation_p.L432V	NM_001144002	NP_001137474	Q9NRF8	PYRG2_HUMAN	cytidine triphosphate synthase II	432	Glutamine amidotransferase type-1.				glutamine metabolic process|nucleobase, nucleoside and nucleotide interconversion|pyrimidine nucleotide biosynthetic process	cytosol	ATP binding|CTP synthase activity			ovary(1)	1	Hepatocellular(33;0.0997)																	---	---	---	---	capture		Missense_Mutation	SNP	16685639	16685639	4182	23	G	C	C	33	33	CTPS2	C	3	3
CNKSR2	22866	broad.mit.edu	37	X	21627350	21627350	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21627350G>C	uc004czx.1	+	20	2343	c.2307G>C	c.(2305-2307)CAG>CAC	p.Q769H	CNKSR2_uc004czw.2_Missense_Mutation_p.Q769H|CNKSR2_uc011mjn.1_Missense_Mutation_p.Q720H|CNKSR2_uc011mjo.1_Missense_Mutation_p.Q739H|CNKSR2_uc004czy.2_Missense_Mutation_p.Q361H	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	769					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	21627350	21627350	3745	23	G	C	C	35	35	CNKSR2	C	3	3
CYBB	1536	broad.mit.edu	37	X	37663199	37663199	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37663199C>A	uc004ddr.2	+	9	1028	c.967C>A	c.(967-969)CAA>AAA	p.Q323K	CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Missense_Mutation_p.Q291K|CYBB_uc011mkg.1_Missense_Mutation_p.Q56K	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	323	Cytoplasmic (Potential).|FAD-binding FR-type.				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	37663199	37663199	4298	23	C	A	A	17	17	CYBB	A	2	2
BCOR	54880	broad.mit.edu	37	X	39933862	39933862	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39933862T>G	uc004den.3	-	4	1029	c.737A>C	c.(736-738)TAC>TCC	p.Y246S	BCOR_uc004dep.3_Missense_Mutation_p.Y246S|BCOR_uc004deo.3_Missense_Mutation_p.Y246S|BCOR_uc004dem.3_Missense_Mutation_p.Y246S|BCOR_uc004deq.3_Missense_Mutation_p.Y246S	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	246					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	39933862	39933862	1407	23	T	G	G	57	57	BCOR	G	4	4
DGKK	139189	broad.mit.edu	37	X	50129357	50129357	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50129357T>A	uc010njr.1	-	15	2406	c.2346A>T	c.(2344-2346)CAA>CAT	p.Q782H		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	782					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)																	---	---	---	---	capture		Missense_Mutation	SNP	50129357	50129357	4651	23	T	A	A	56	56	DGKK	A	4	4
MED12	9968	broad.mit.edu	37	X	70343465	70343465	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70343465G>C	uc004dyy.2	+	12	1838	c.1639G>C	c.(1639-1641)GCA>CCA	p.A547P	MED12_uc011mpq.1_Missense_Mutation_p.A547P|MED12_uc004dyz.2_Missense_Mutation_p.A547P|MED12_uc004dza.2_Missense_Mutation_p.A394P	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	547					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)																	---	---	---	---	capture		Missense_Mutation	SNP	70343465	70343465	9817	23	G	C	C	38	38	MED12	C	3	3
TBX22	50945	broad.mit.edu	37	X	79277824	79277824	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79277824C>A	uc010nmg.1	+	2	190	c.56C>A	c.(55-57)CCC>CAC	p.P19H	TBX22_uc004edi.1_5'UTR|TBX22_uc004edj.1_Missense_Mutation_p.P19H	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	19					multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15																		---	---	---	---	capture		Missense_Mutation	SNP	79277824	79277824	16184	23	C	A	A	22	22	TBX22	A	2	2
TBX22	50945	broad.mit.edu	37	X	79281106	79281106	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79281106G>C	uc010nmg.1	+	5	597	c.463G>C	c.(463-465)GTC>CTC	p.V155L	TBX22_uc004edi.1_Missense_Mutation_p.V35L|TBX22_uc004edj.1_Missense_Mutation_p.V155L	NM_001109878	NP_001103348	Q9Y458	TBX22_HUMAN	T-box 22 isoform 1	155	T-box.				multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			lung(7)|large_intestine(3)|central_nervous_system(2)|breast(1)|skin(1)|ovary(1)	15																		---	---	---	---	capture		Missense_Mutation	SNP	79281106	79281106	16184	23	G	C	C	40	40	TBX22	C	3	3
TRPC5	7224	broad.mit.edu	37	X	111024417	111024417	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111024417G>T	uc004epl.1	-	9	3037	c.2118C>A	c.(2116-2118)AGC>AGA	p.S706R	TRPC5_uc004epm.1_Missense_Mutation_p.S706R	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	706	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	111024417	111024417	17133	23	G	T	T	42	42	TRPC5	T	2	2
ENOX2	10495	broad.mit.edu	37	X	129801610	129801610	+	Silent	SNP	G	C	C			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129801610G>C	uc004evw.2	-	9	1306	c.888C>G	c.(886-888)GCC>GCG	p.A296A	ENOX2_uc004evx.2_Silent_p.A267A|ENOX2_uc004evy.2_Silent_p.A267A|ENOX2_uc004evv.2_Silent_p.A123A	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b	296	Potential.				cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	129801610	129801610	5320	23	G	C	C	47	47	ENOX2	C	3	3
HTATSF1	27336	broad.mit.edu	37	X	135593704	135593704	+	Silent	SNP	C	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135593704C>T	uc004ezw.2	+	10	2222	c.1800C>T	c.(1798-1800)TCC>TCT	p.S600S	HTATSF1_uc004ezx.2_Silent_p.S600S	NM_001163280	NP_001156752	O43719	HTSF1_HUMAN	HIV-1 Tat specific factor 1	600	Asp/Glu-rich (acidic).|Mediates interaction with the P-TEFb complex.				regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent|viral genome replication	nucleus	nucleotide binding|protein binding|RNA binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---	capture		Silent	SNP	135593704	135593704	7733	23	C	T	T	23	23	HTATSF1	T	1	1
MAGEA11	4110	broad.mit.edu	37	X	148797850	148797850	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148797850G>T	uc004fdq.2	+	5	806	c.704G>T	c.(703-705)CGC>CTC	p.R235L	HSFX2_uc004fdl.2_Intron|HSFX1_uc004fdm.2_Intron|MAGEA11_uc004fdr.2_Missense_Mutation_p.R206L	NM_005366	NP_005357	P43364	MAGAB_HUMAN	melanoma antigen family A, 11 isoform a	235	MAGE.					cytoplasm|nucleus	protein binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)																	---	---	---	---	capture		Missense_Mutation	SNP	148797850	148797850	9542	23	G	T	T	38	38	MAGEA11	T	1	1
GABRA3	2556	broad.mit.edu	37	X	151366222	151366222	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151366222T>G	uc010ntk.1	-	8	1054	c.814A>C	c.(814-816)AAG>CAG	p.K272Q		NM_000808	NP_000799	P34903	GBRA3_HUMAN	gamma-aminobutyric acid A receptor, alpha 3	272	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)				Alprazolam(DB00404)|Diazepam(DB00829)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)													---	---	---	---	capture		Missense_Mutation	SNP	151366222	151366222	6413	23	T	G	G	63	63	GABRA3	G	4	4
BCAP31	10134	broad.mit.edu	37	X	152981080	152981080	+	Silent	SNP	G	A	A			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152981080G>A	uc011myz.1	-	4	414	c.258C>T	c.(256-258)CCC>CCT	p.P86P	BCAP31_uc011myy.1_5'UTR|BCAP31_uc004fid.2_Silent_p.P153P|BCAP31_uc011mza.1_Silent_p.P86P|BCAP31_uc004fie.2_Silent_p.P86P	NM_001139441	NP_001132913	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31 isoform b	86	Lumenal (Potential).				cellular component disassembly involved in apoptosis|immune response|intracellular protein transport|vesicle-mediated transport	cytosol|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to plasma membrane	receptor binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---	capture		Silent	SNP	152981080	152981080	1368	23	G	A	A	39	39	BCAP31	A	1	1
SPRY3	10251	broad.mit.edu	37	X	155003858	155003858	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155003858G>T	uc004fnq.1	+	2	779	c.325G>T	c.(325-327)GGC>TGC	p.G109C	SPRY3_uc010nvl.1_Intron	NM_005840	NP_005831	O43610	SPY3_HUMAN	sprouty homolog 3	109					multicellular organismal development|regulation of signal transduction	cytoplasm|membrane					0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)																	---	---	---	---	capture		Missense_Mutation	SNP	155003858	155003858	15621	23	G	T	T	35	35	SPRY3	T	2	2
AMELY	266	broad.mit.edu	37	Y	6736492	6736492	+	Silent	SNP	A	G	G			TCGA-37-4135-01	TCGA-37-4135-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6736492A>G	uc004fra.1	-	5	213	c.201T>C	c.(199-201)TAT>TAC	p.Y67Y	AMELY_uc004fqz.2_Silent_p.Y53Y	NM_001143	NP_001134	Q99218	AMELY_HUMAN	amelogenin, Y-linked precursor	67					biomineral tissue development	proteinaceous extracellular matrix	structural constituent of tooth enamel				0																		---	---	---	---	capture		Silent	SNP	6736492	6736492	573	24	A	G	G	8	8	AMELY	G	4	4
