Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	MUTSIG_Significant_Genes	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
MUC17	140453	broad.mit.edu	37	7	100677564	100677565	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100677564_100677565CC>AA	uc003uxp.1	+	3	2920_2921	c.2867_2868CC>AA	c.(2866-2868)ACC>AAA	p.T956K	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	956	Extracellular (Potential).|Ser-rich.|59 X approximate tandem repeats.|14.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)																	---	---	---	---	capture		Missense_Mutation	DNP	100677564	100677565	10368	7	CC	AA	AA	18	18	MUC17	AA	2	2
SF3A2	8175	broad.mit.edu	37	19	2248165	2248185	+	In_Frame_Del	DEL	CCAGCCCCCGGGGTTCACCCA	-	-	rs144349304		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2248165_2248185delCCAGCCCCCGGGGTTCACCCA	uc002lvg.2	+	9	1137_1157	c.1015_1035delCCAGCCCCCGGGGTTCACCCA	c.(1015-1035)CCAGCCCCCGGGGTTCACCCAdel	p.PAPGVHP360del	AMH_uc002lvh.2_5'Flank|hsa-mir-4321|MI0015852_5'Flank	NM_007165	NP_009096	Q15428	SF3A2_HUMAN	splicing factor 3a, subunit 2	360_366	Pro-rich.				nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex	nucleic acid binding|zinc ion binding				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture_indel		In_Frame_Del	DEL	2248165	2248185	14636	19	CCAGCCCCCGGGGTTCACCCA	-	-	30	30	SF3A2	-	5	5
ACAP3	116983	broad.mit.edu	37	1	1235355	1235355	+	Missense_Mutation	SNP	C	T	T	rs12409951		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1235355C>T	uc001aeb.2	-	8	735	c.661G>A	c.(661-663)GAG>AAG	p.E221K	ACAP3_uc001ady.2_5'Flank|ACAP3_uc001aea.2_Missense_Mutation_p.E179K|ACAP3_uc001aec.1_Missense_Mutation_p.E179K	NM_030649	NP_085152	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH	221					filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	1235355	1235355	121	1	C	T	T	31	31	ACAP3	T	1	1
MORN1	79906	broad.mit.edu	37	1	2290142	2290142	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2290142C>A	uc001ajb.1	-	9	779	c.758G>T	c.(757-759)CGG>CTG	p.R253L	MORN1_uc009vld.2_Missense_Mutation_p.R229L|MORN1_uc001ajd.1_Missense_Mutation_p.R253L	NM_024848	NP_079124	Q5T089	MORN1_HUMAN	MORN repeat containing 1	253										ovary(2)|central_nervous_system(1)	3	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)														---	---	---	---	capture		Missense_Mutation	SNP	2290142	2290142	10099	1	C	A	A	23	23	MORN1	A	1	1
GRIK3	2899	broad.mit.edu	37	1	37324827	37324827	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37324827G>A	uc001caz.2	-	7	1121	c.986C>T	c.(985-987)GCC>GTC	p.A329V	GRIK3_uc001cba.1_Missense_Mutation_p.A329V	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	329	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	37324827	37324827	7054	1	G	A	A	42	42	GRIK3	A	2	2
MACF1	23499	broad.mit.edu	37	1	39797830	39797830	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797830G>A	uc010oiu.1	+	1	1021	c.890G>A	c.(889-891)GGA>GAA	p.G297E	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1862	Plectin 5.				cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---	capture		Missense_Mutation	SNP	39797830	39797830	9521	1	G	A	A	41	41	MACF1	A	2	2
C1orf168	199920	broad.mit.edu	37	1	57224416	57224416	+	Silent	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57224416A>G	uc001cym.3	-	6	1477	c.1071T>C	c.(1069-1071)TAT>TAC	p.Y357Y	C1orf168_uc009vzu.1_Intron|C1orf168_uc001cyl.2_RNA	NM_001004303	NP_001004303	Q5VWT5	CA168_HUMAN	hypothetical protein LOC199920	357										ovary(3)|skin(2)	5																		---	---	---	---	capture		Silent	SNP	57224416	57224416	2079	1	A	G	G	8	8	C1orf168	G	4	4
LRRIQ3	127255	broad.mit.edu	37	1	74648474	74648474	+	Silent	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74648474A>G	uc001dfy.3	-	3	513	c.321T>C	c.(319-321)AAT>AAC	p.N107N	LRRIQ3_uc001dfz.3_RNA	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	107	LRR 3.									ovary(2)	2																		---	---	---	---	capture		Silent	SNP	74648474	74648474	9406	1	A	G	G	8	8	LRRIQ3	G	4	4
TRIM46	80128	broad.mit.edu	37	1	155156413	155156413	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155156413G>T	uc001fhs.1	+	10	2110	c.2027G>T	c.(2026-2028)AGG>ATG	p.R676M	RAG1AP1_uc010pey.1_Intron|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.R550M|TRIM46_uc001fhu.1_Missense_Mutation_p.R653M|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	676	B30.2/SPRY.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)															---	---	---	---	capture		Missense_Mutation	SNP	155156413	155156413	17066	1	G	T	T	35	35	TRIM46	T	2	2
CD1D	912	broad.mit.edu	37	1	158151513	158151513	+	Splice_Site	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158151513T>C	uc001frr.2	+	3	827	c.328_splice	c.e3+2	p.Y110_splice	CD1D_uc009wsr.1_Splice_Site_p.Y110_splice|CD1D_uc009wss.2_Splice_Site_p.Y110_splice|CD1D_uc009wst.1_Splice_Site_p.Y6_splice	NM_001766	NP_001757			CD1D antigen precursor						antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)																	---	---	---	---	capture		Splice_Site	SNP	158151513	158151513	3104	1	T	C	C	59	59	CD1D	C	5	4
ADAMTS4	9507	broad.mit.edu	37	1	161168117	161168117	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161168117C>G	uc001fyt.3	-	1	729	c.301G>C	c.(301-303)GGT>CGT	p.G101R	ADAMTS4_uc001fyu.2_Missense_Mutation_p.G101R|NDUFS2_uc001fyv.2_5'Flank	NM_005099	NP_005090	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1	101					proteolysis|skeletal system development	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|protease binding|zinc ion binding			ovary(4)|central_nervous_system(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)															---	---	---	---	capture		Missense_Mutation	SNP	161168117	161168117	269	1	C	G	G	23	23	ADAMTS4	G	3	3
ABL2	27	broad.mit.edu	37	1	179084073	179084073	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179084073C>A	uc001gmj.3	-	9	1788	c.1501G>T	c.(1501-1503)GGA>TGA	p.G501*	ABL2_uc010pnf.1_Nonsense_Mutation_p.G501*|ABL2_uc010png.1_Nonsense_Mutation_p.G480*|ABL2_uc010pnh.1_Nonsense_Mutation_p.G480*|ABL2_uc009wxe.2_Nonsense_Mutation_p.G480*|ABL2_uc001gmg.3_Nonsense_Mutation_p.G486*|ABL2_uc001gmi.3_Nonsense_Mutation_p.G486*|ABL2_uc001gmh.3_Nonsense_Mutation_p.G465*|ABL2_uc010pne.1_Nonsense_Mutation_p.G465*	NM_007314	NP_009298	P42684	ABL2_HUMAN	arg tyrosine kinase isoform b	501	Protein kinase.				axon guidance|cell adhesion|peptidyl-tyrosine phosphorylation|positive regulation of oxidoreductase activity|signal transduction	cytoskeleton|cytosol	ATP binding|magnesium ion binding|manganese ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(8)|breast(3)|ovary(2)|central_nervous_system(1)	14					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)			T	ETV6	AML								---	---	---	---	capture		Nonsense_Mutation	SNP	179084073	179084073	94	1	C	A	A	24	24	ABL2	A	5	2
ESRRG	2104	broad.mit.edu	37	1	216850454	216850454	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850454C>T	uc001hkw.1	-	2	602	c.436G>A	c.(436-438)GAA>AAA	p.E146K	ESRRG_uc001hky.1_Missense_Mutation_p.E123K|ESRRG_uc009xdp.1_Missense_Mutation_p.E123K|ESRRG_uc001hkz.1_Missense_Mutation_p.E123K|ESRRG_uc010puc.1_Missense_Mutation_p.E123K|ESRRG_uc001hla.1_Missense_Mutation_p.E123K|ESRRG_uc001hlb.1_Missense_Mutation_p.E123K|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.E123K|ESRRG_uc001hld.1_Missense_Mutation_p.E123K|ESRRG_uc001hkx.1_Missense_Mutation_p.E151K|ESRRG_uc009xdo.1_Missense_Mutation_p.E123K|ESRRG_uc001hle.1_Missense_Mutation_p.E123K	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	146	Nuclear receptor.|NR C4-type.				positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)													---	---	---	---	capture		Missense_Mutation	SNP	216850454	216850454	5455	1	C	T	T	29	29	ESRRG	T	2	2
PLD5	200150	broad.mit.edu	37	1	242287914	242287914	+	Silent	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242287914T>C	uc001hzn.1	-	6	916	c.789A>G	c.(787-789)TTA>TTG	p.L263L	PLD5_uc001hzl.3_Silent_p.L201L|PLD5_uc001hzm.3_Silent_p.L53L|PLD5_uc001hzo.1_Silent_p.L171L			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	263						integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)															---	---	---	---	capture		Silent	SNP	242287914	242287914	12475	1	T	C	C	57	57	PLD5	C	4	4
ZNF496	84838	broad.mit.edu	37	1	247464506	247464506	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247464506G>C	uc001ico.2	-	9	1544	c.1079C>G	c.(1078-1080)TCT>TGT	p.S360C	ZNF496_uc009xgv.2_Missense_Mutation_p.S396C|ZNF496_uc001icp.2_Missense_Mutation_p.S360C	NM_032752	NP_116141	Q96IT1	ZN496_HUMAN	zinc finger protein 496	360					positive regulation of transcription, DNA-dependent|viral reproduction		DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)															---	---	---	---	capture		Missense_Mutation	SNP	247464506	247464506	18539	1	G	C	C	33	33	ZNF496	C	3	3
SLC39A12	221074	broad.mit.edu	37	10	18250558	18250558	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18250558G>T	uc001ipo.2	+	3	583	c.310G>T	c.(310-312)GAT>TAT	p.D104Y	SLC39A12_uc001ipn.2_Missense_Mutation_p.D104Y|SLC39A12_uc001ipp.2_Missense_Mutation_p.D104Y|SLC39A12_uc010qck.1_5'UTR	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	104	Extracellular (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	18250558	18250558	15112	10	G	T	T	33	33	SLC39A12	T	2	2
MYO3A	53904	broad.mit.edu	37	10	26377272	26377272	+	Silent	SNP	G	T	T	rs146797033	byFrequency;by1000genomes	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26377272G>T	uc001isn.2	+	15	1860	c.1500G>T	c.(1498-1500)GCG>GCT	p.A500A	MYO3A_uc009xko.1_Silent_p.A500A|MYO3A_uc009xkp.1_RNA|MYO3A_uc009xkq.1_Silent_p.A500A	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	500	Myosin head-like.				protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18																		---	---	---	---	capture		Silent	SNP	26377272	26377272	10471	10	G	T	T	39	39	MYO3A	T	1	1
ANKRD30A	91074	broad.mit.edu	37	10	37438704	37438704	+	Splice_Site	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37438704G>T	uc001iza.1	+	11	1504	c.1405_splice	c.e11-1	p.P469_splice		NM_052997	NP_443723			ankyrin repeat domain 30A							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9																		---	---	---	---	capture		Splice_Site	SNP	37438704	37438704	663	10	G	T	T	34	34	ANKRD30A	T	5	2
PPYR1	5540	broad.mit.edu	37	10	47086886	47086886	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47086886C>T	uc001jee.2	+	3	522	c.103C>T	c.(103-105)CAG>TAG	p.Q35*	ANXA8_uc001jed.3_Intron|PPYR1_uc009xna.2_Nonsense_Mutation_p.Q35*	NM_005972	NP_005963	P50391	NPY4R_HUMAN	pancreatic polypeptide receptor 1	35	Extracellular (Potential).				blood circulation|digestion|feeding behavior	integral to plasma membrane				ovary(1)|skin(1)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	47086886	47086886	12852	10	C	T	T	21	21	PPYR1	T	5	2
C10orf53	282966	broad.mit.edu	37	10	50916591	50916591	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50916591T>A	uc001jid.1	+	3	462	c.402T>A	c.(400-402)TGT>TGA	p.C134*		NM_182554	NP_872360	Q8N6V4	CJ053_HUMAN	chromosome 10 open reading frame 53 isoform a	Error:Variant_position_missing_in_Q8N6V4_after_alignment											0		all_neural(218;0.107)																---	---	---	---	capture		Nonsense_Mutation	SNP	50916591	50916591	1643	10	T	A	A	59	59	C10orf53	A	5	4
PCDH15	65217	broad.mit.edu	37	10	55582055	55582055	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582055G>C	uc001jju.1	-	33	5826	c.5431C>G	c.(5431-5433)CTA>GTA	p.L1811V	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.L1808V|PCDH15_uc010qhw.1_Missense_Mutation_p.L1771V|PCDH15_uc010qhx.1_Missense_Mutation_p.L1742V|PCDH15_uc010qhy.1_Missense_Mutation_p.L1818V|PCDH15_uc010qhz.1_Missense_Mutation_p.L1813V|PCDH15_uc010qia.1_Missense_Mutation_p.L1791V|PCDH15_uc010qib.1_Missense_Mutation_p.L1788V	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1811	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)													HNSCC(58;0.16)			---	---	---	---	capture		Missense_Mutation	SNP	55582055	55582055	11931	10	G	C	C	33	33	PCDH15	C	3	3
OIT3	170392	broad.mit.edu	37	10	74684033	74684033	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74684033C>A	uc001jte.1	+	7	1216	c.998C>A	c.(997-999)CCC>CAC	p.P333H	OIT3_uc009xqs.1_Intron	NM_152635	NP_689848	Q8WWZ8	OIT3_HUMAN	oncoprotein-induced transcript 3 precursor	333	ZP.					nuclear envelope	calcium ion binding			ovary(2)	2	Prostate(51;0.0198)																	---	---	---	---	capture		Missense_Mutation	SNP	74684033	74684033	11254	10	C	A	A	22	22	OIT3	A	2	2
PSD	5662	broad.mit.edu	37	10	104174911	104174911	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104174911C>A	uc001kvg.1	-	4	1360	c.833G>T	c.(832-834)GGG>GTG	p.G278V	PSD_uc001kvh.1_5'UTR|PSD_uc009xxd.1_Missense_Mutation_p.G278V	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	278					regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)														---	---	---	---	capture		Missense_Mutation	SNP	104174911	104174911	13099	10	C	A	A	22	22	PSD	A	2	2
BCCIP	56647	broad.mit.edu	37	10	127524721	127524721	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127524721T>A	uc001ljb.3	+	7	846	c.823T>A	c.(823-825)TGT>AGT	p.C275S	BCCIP_uc001ljd.3_Intron|BCCIP_uc010qui.1_Intron|BCCIP_uc001ljc.3_Intron|BCCIP_uc010quj.1_Intron	NM_078468	NP_510868	Q9P287	BCCIP_HUMAN	BRCA2 and CDKN1A-interacting protein isoform	275					cell cycle|DNA repair|neuroendocrine cell differentiation|regulation of cyclin-dependent protein kinase activity	nuclear cyclin-dependent protein kinase holoenzyme complex	kinase regulator activity|protein binding			ovary(1)|breast(1)	2		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)																---	---	---	---	capture		Missense_Mutation	SNP	127524721	127524721	1377	10	T	A	A	63	63	BCCIP	A	4	4
MKI67	4288	broad.mit.edu	37	10	129905711	129905711	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129905711C>G	uc001lke.2	-	13	4588	c.4393G>C	c.(4393-4395)GAA>CAA	p.E1465Q	MKI67_uc001lkf.2_Missense_Mutation_p.E1105Q|MKI67_uc009yav.1_Missense_Mutation_p.E1040Q|MKI67_uc009yaw.1_Missense_Mutation_p.E615Q	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	1465	16 X 122 AA approximate repeats.|4.				cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)																---	---	---	---	capture		Missense_Mutation	SNP	129905711	129905711	9988	10	C	G	G	32	32	MKI67	G	3	3
OR52A1	23538	broad.mit.edu	37	11	5173278	5173278	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5173278T>C	uc010qyy.1	-	1	322	c.322A>G	c.(322-324)ACA>GCA	p.T108A		NM_012375	NP_036507	Q9UKL2	O52A1_HUMAN	olfactory receptor, family 52, subfamily A,	108	Helical; Name=3; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.00106)|Breast(177;0.0155)|all_neural(188;0.0189)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Missense_Mutation	SNP	5173278	5173278	11518	11	T	C	C	59	59	OR52A1	C	4	4
TRIM22	10346	broad.mit.edu	37	11	5730645	5730645	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5730645G>C	uc001mbr.2	+	8	1541	c.1264G>C	c.(1264-1266)GAG>CAG	p.E422Q	TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Missense_Mutation_p.E418Q|TRIM22_uc010qzm.1_Missense_Mutation_p.E250Q|TRIM22_uc009yeu.2_Missense_Mutation_p.E233Q|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22	422	B30.2/SPRY.				immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)														---	---	---	---	capture		Missense_Mutation	SNP	5730645	5730645	17040	11	G	C	C	45	45	TRIM22	C	3	3
OR56A1	120796	broad.mit.edu	37	11	6048128	6048128	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048128G>A	uc010qzw.1	-	1	807	c.807C>T	c.(805-807)AAC>AAT	p.N269N		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Silent	SNP	6048128	6048128	11543	11	G	A	A	40	40	OR56A1	A	1	1
DENND5A	23258	broad.mit.edu	37	11	9200611	9200611	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9200611G>A	uc001mhl.2	-	7	1720	c.1465C>T	c.(1465-1467)CGT>TGT	p.R489C	DENND5A_uc010rbw.1_Missense_Mutation_p.R489C|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	489										liver(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	9200611	9200611	4615	11	G	A	A	38	38	DENND5A	A	1	1
MRGPRX4	117196	broad.mit.edu	37	11	18194896	18194896	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18194896G>A	uc001mnv.1	+	1	513	c.93G>A	c.(91-93)ACG>ACA	p.T31T		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	31	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1																		---	---	---	---	capture		Silent	SNP	18194896	18194896	10162	11	G	A	A	39	39	MRGPRX4	A	1	1
LGR4	55366	broad.mit.edu	37	11	27395522	27395522	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27395522A>C	uc001mrj.3	-	14	1738	c.1253T>G	c.(1252-1254)CTA>CGA	p.L418R	LGR4_uc001mrk.3_Missense_Mutation_p.L394R	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	418	LRR 15.|Extracellular (Potential).					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	27395522	27395522	9082	11	A	C	C	7	7	LGR4	C	4	4
OR4B1	119765	broad.mit.edu	37	11	48238741	48238741	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48238741C>T	uc010rhs.1	+	1	380	c.380C>T	c.(379-381)CCT>CTT	p.P127L		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	127	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	48238741	48238741	11450	11	C	T	T	24	24	OR4B1	T	2	2
OR8H2	390151	broad.mit.edu	37	11	55872975	55872975	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55872975T>C	uc010riy.1	+	1	457	c.457T>C	c.(457-459)TTT>CTT	p.F153L		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	153	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)														HNSCC(53;0.14)			---	---	---	---	capture		Missense_Mutation	SNP	55872975	55872975	11649	11	T	C	C	56	56	OR8H2	C	4	4
OR5R1	219479	broad.mit.edu	37	11	56184866	56184866	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184866C>T	uc010rji.1	-	1	843	c.843G>A	c.(841-843)GTG>GTA	p.V281V		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	281	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)																	---	---	---	---	capture		Silent	SNP	56184866	56184866	11590	11	C	T	T	29	29	OR5R1	T	2	2
AHNAK	79026	broad.mit.edu	37	11	62287374	62287374	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62287374T>C	uc001ntl.2	-	5	14815	c.14515A>G	c.(14515-14517)ATG>GTG	p.M4839V	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4839					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)																---	---	---	---	capture		Missense_Mutation	SNP	62287374	62287374	417	11	T	C	C	50	50	AHNAK	C	4	4
DHCR7	1717	broad.mit.edu	37	11	71152283	71152283	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71152283C>T	uc001oqk.2	-	6	866	c.616G>A	c.(616-618)GCC>ACC	p.A206T	DHCR7_uc001oql.2_Missense_Mutation_p.A206T	NM_001163817	NP_001157289	Q9UBM7	DHCR7_HUMAN	7-dehydrocholesterol reductase	206					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)									Smith-Lemli-Opitz_syndrome				---	---	---	---	capture		Missense_Mutation	SNP	71152283	71152283	4656	11	C	T	T	27	27	DHCR7	T	1	1
ROBO4	54538	broad.mit.edu	37	11	124756583	124756583	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124756583C>T	uc001qbg.2	-	16	2711	c.2571G>A	c.(2569-2571)CTG>CTA	p.L857L	ROBO4_uc010sas.1_Silent_p.L712L|ROBO4_uc001qbh.2_3'UTR|ROBO4_uc001qbi.2_Silent_p.L415L	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	857					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)														---	---	---	---	capture		Silent	SNP	124756583	124756583	13995	11	C	T	T	17	17	ROBO4	T	2	2
FLI1	2313	broad.mit.edu	37	11	128680570	128680570	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128680570C>T	uc010sbu.1	+	9	1387	c.1046C>T	c.(1045-1047)ACC>ATC	p.T349I	FLI1_uc010sbt.1_Missense_Mutation_p.T156I|FLI1_uc010sbv.1_Missense_Mutation_p.T316I|FLI1_uc009zci.2_Missense_Mutation_p.T283I	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	349	ETS.				hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)				T	EWSR1	Ewing sarcoma								---	---	---	---	capture		Missense_Mutation	SNP	128680570	128680570	6162	11	C	T	T	18	18	FLI1	T	2	2
MRPS35	60488	broad.mit.edu	37	12	27863870	27863870	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27863870G>T	uc001rih.2	+	1	142	c.94G>T	c.(94-96)GTC>TTC	p.V32F	MRPS35_uc001rii.2_Missense_Mutation_p.V32F	NM_021821	NP_068593	P82673	RT35_HUMAN	mitochondrial ribosomal protein S35 precursor	32					DNA damage response, detection of DNA damage	mitochondrial small ribosomal subunit					0	Lung SC(9;0.0873)																	---	---	---	---	capture		Missense_Mutation	SNP	27863870	27863870	10237	12	G	T	T	44	44	MRPS35	T	2	2
FGD4	121512	broad.mit.edu	37	12	32764098	32764098	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32764098T>A	uc001rkz.2	+	10	1696	c.1219T>A	c.(1219-1221)TAT>AAT	p.Y407N	FGD4_uc001rlc.2_Missense_Mutation_p.Y492N|FGD4_uc001rky.2_Missense_Mutation_p.Y159N|FGD4_uc001rla.2_Missense_Mutation_p.Y63N|FGD4_uc010ske.1_Missense_Mutation_p.Y519N|FGD4_uc001rlb.1_RNA	NM_139241	NP_640334	Q96M96	FGD4_HUMAN	FYVE, RhoGEF and PH domain containing 4	407					actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|filopodium|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)																	---	---	---	---	capture		Missense_Mutation	SNP	32764098	32764098	6072	12	T	A	A	61	61	FGD4	A	4	4
SDR9C7	121214	broad.mit.edu	37	12	57324196	57324196	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57324196T>A	uc010sqw.1	-	2	374	c.374A>T	c.(373-375)GAC>GTC	p.D125V		NM_148897	NP_683695	Q8NEX9	DR9C7_HUMAN	short chain dehydrogenase/reductase family 9C,	125						cytoplasm	binding|oxidoreductase activity			central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	57324196	57324196	14460	12	T	A	A	58	58	SDR9C7	A	4	4
TBC1D15	64786	broad.mit.edu	37	12	72274315	72274315	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72274315C>G	uc001swu.2	+	4	346	c.337C>G	c.(337-339)CTG>GTG	p.L113V	TBC1D15_uc009zrv.2_Translation_Start_Site|TBC1D15_uc010stt.1_Missense_Mutation_p.L99V|TBC1D15_uc001swv.2_Missense_Mutation_p.L113V|TBC1D15_uc001sww.2_Translation_Start_Site	NM_022771	NP_073608	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15 isoform 1	91							protein binding|Rab GTPase activator activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	72274315	72274315	16126	12	C	G	G	32	32	TBC1D15	G	3	3
PARP4	143	broad.mit.edu	37	13	25029274	25029274	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25029274C>A	uc001upl.2	-	22	2745	c.2639G>T	c.(2638-2640)TGT>TTT	p.C880F	PARP4_uc010tdc.1_Missense_Mutation_p.C880F	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	880	VWFA.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---	capture		Missense_Mutation	SNP	25029274	25029274	11880	13	C	A	A	17	17	PARP4	A	2	2
HMGB1	3146	broad.mit.edu	37	13	31036834	31036834	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31036834G>T	uc001usw.2	-	4	496	c.312C>A	c.(310-312)CTC>CTA	p.L104L	HMGB1_uc001usz.2_Silent_p.L104L|HMGB1_uc001usv.2_Silent_p.L104L|HMGB1_uc001usx.2_Silent_p.L104L|HMGB1_uc001usy.2_Silent_p.L65L|HMGB1_uc001uta.1_Silent_p.L104L	NM_002128	NP_002119	P09429	HMGB1_HUMAN	high-mobility group box 1	104	HMG box 2.				base-excision repair, DNA ligation|dendritic cell chemotaxis|DNA fragmentation involved in apoptotic nuclear change|DNA topological change|inflammatory response to antigenic stimulus|innate immune response|myeloid dendritic cell activation|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly|neuron projection development|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of DNA binding|positive regulation of transcription from RNA polymerase II promoter|V(D)J recombination	cell surface|condensed chromosome|extracellular space|nucleolus|nucleoplasm	chemoattractant activity|cytokine activity|damaged DNA binding|DNA bending activity|double-stranded DNA binding|RAGE receptor binding|repressing transcription factor binding|sequence-specific DNA binding transcription factor activity|single-stranded DNA binding			ovary(1)	1		Lung SC(185;0.0257)		all cancers(112;0.072)|OV - Ovarian serous cystadenocarcinoma(117;0.177)|Lung(94;0.216)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---	capture		Silent	SNP	31036834	31036834	7516	13	G	T	T	33	33	HMGB1	T	2	2
FNDC3A	22862	broad.mit.edu	37	13	49710725	49710725	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49710725A>G	uc001vcm.2	+	6	1053	c.748A>G	c.(748-750)ACA>GCA	p.T250A	FNDC3A_uc001vcl.1_Missense_Mutation_p.T250A|FNDC3A_uc001vcn.2_Missense_Mutation_p.T250A|FNDC3A_uc001vco.2_RNA|FNDC3A_uc001vcp.1_Missense_Mutation_p.T194A|FNDC3A_uc001vcq.2_Missense_Mutation_p.T194A	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A	250						Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)														---	---	---	---	capture		Missense_Mutation	SNP	49710725	49710725	6211	13	A	G	G	14	14	FNDC3A	G	4	4
PRKD1	5587	broad.mit.edu	37	14	30066893	30066893	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30066893G>A	uc001wqh.2	-	16	2419	c.2238C>T	c.(2236-2238)ACC>ACT	p.T746T		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	746	Protein kinase.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)														---	---	---	---	capture		Silent	SNP	30066893	30066893	12961	14	G	A	A	43	43	PRKD1	A	2	2
SYNE2	23224	broad.mit.edu	37	14	64522939	64522939	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64522939C>G	uc001xgm.2	+	49	10252	c.10022C>G	c.(10021-10023)TCA>TGA	p.S3341*	SYNE2_uc001xgl.2_Nonsense_Mutation_p.S3341*|SYNE2_uc010apw.1_Nonsense_Mutation_p.S47*	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3341	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---	capture		Nonsense_Mutation	SNP	64522939	64522939	15967	14	C	G	G	29	29	SYNE2	G	5	3
SYNE2	23224	broad.mit.edu	37	14	64608107	64608107	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64608107A>G	uc001xgm.2	+	81	15255	c.15025A>G	c.(15025-15027)ATC>GTC	p.I5009V	SYNE2_uc001xgl.2_Missense_Mutation_p.I5009V|SYNE2_uc010apy.2_Missense_Mutation_p.I1394V|SYNE2_uc001xgn.2_5'UTR|SYNE2_uc001xgo.2_RNA	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5009	Spectrin 1.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---	capture		Missense_Mutation	SNP	64608107	64608107	15967	14	A	G	G	16	16	SYNE2	G	4	4
SYNE2	23224	broad.mit.edu	37	14	64625421	64625421	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64625421A>G	uc001xgm.2	+	86	16101	c.15871A>G	c.(15871-15873)ATG>GTG	p.M5291V	SYNE2_uc001xgl.2_Missense_Mutation_p.M5291V|SYNE2_uc010apy.2_Missense_Mutation_p.M1676V|SYNE2_uc001xgn.2_Missense_Mutation_p.M253V|SYNE2_uc001xgo.2_RNA|SYNE2_uc001xgp.2_Missense_Mutation_p.M20V	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	5291	Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)														---	---	---	---	capture		Missense_Mutation	SNP	64625421	64625421	15967	14	A	G	G	16	16	SYNE2	G	4	4
IFI27L2	83982	broad.mit.edu	37	14	94594942	94594942	+	Silent	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94594942G>C	uc001ycq.2	-	3	164	c.108C>G	c.(106-108)TCC>TCG	p.S36S		NM_032036	NP_114425	Q9H2X8	I27L2_HUMAN	TLH29 protein precursor	36						integral to membrane					0																		---	---	---	---	capture		Silent	SNP	94594942	94594942	7815	14	G	C	C	35	35	IFI27L2	C	3	3
SERPINA6	866	broad.mit.edu	37	14	94770791	94770791	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94770791G>T	uc001ycv.2	-	5	1286	c.1182C>A	c.(1180-1182)AGC>AGA	p.S394R	SERPINA6_uc010auv.2_RNA	NM_001756	NP_001747	P08185	CBG_HUMAN	corticosteroid binding globulin precursor	394					regulation of proteolysis|transport	extracellular space	serine-type endopeptidase inhibitor activity|steroid binding			skin(3)|ovary(1)|central_nervous_system(1)	5		all_cancers(154;0.0482)|all_epithelial(191;0.166)		COAD - Colon adenocarcinoma(157;0.211)	Alclometasone(DB00240)|Beclomethasone(DB00394)|Ciclesonide(DB01410)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Medrysone(DB00253)|Mitotane(DB00648)|Paramethasone(DB01384)|Prednisolone(DB00860)|Rimexolone(DB00896)|Triamcinolone(DB00620)													---	---	---	---	capture		Missense_Mutation	SNP	94770791	94770791	14581	14	G	T	T	46	46	SERPINA6	T	2	2
HHIPL1	84439	broad.mit.edu	37	14	100129256	100129256	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100129256C>A	uc010avs.2	+	6	1611	c.1546C>A	c.(1546-1548)CAG>AAG	p.Q516K	HHIPL1_uc001ygl.1_Missense_Mutation_p.Q516K	NM_001127258	NP_001120730	Q96JK4	HIPL1_HUMAN	HHIP-like protein 1 isoform a	516					carbohydrate metabolic process	extracellular region|membrane	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding|scavenger receptor activity			skin(2)	2		Melanoma(154;0.128)																---	---	---	---	capture		Missense_Mutation	SNP	100129256	100129256	7377	14	C	A	A	25	25	HHIPL1	A	2	2
CHP	11261	broad.mit.edu	37	15	41523623	41523623	+	Missense_Mutation	SNP	G	C	C	rs139642745		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41523623G>C	uc001znl.2	+	1	187	c.43G>C	c.(43-45)GAG>CAG	p.E15Q	EXD1_uc001znk.2_5'Flank|EXD1_uc010ucv.1_5'Flank	NM_007236	NP_009167	Q99653	CHP1_HUMAN	calcium binding protein P22	15					potassium ion transport|small GTPase mediated signal transduction		potassium channel regulator activity			ovary(1)	1		all_cancers(109;1.19e-18)|all_epithelial(112;5.87e-16)|Lung NSC(122;8.86e-12)|all_lung(180;2.47e-10)|Melanoma(134;0.0574)|Colorectal(260;0.0946)|Ovarian(310;0.143)		GBM - Glioblastoma multiforme(113;1.68e-06)|LUSC - Lung squamous cell carcinoma(244;0.008)|Lung(196;0.00802)|BRCA - Breast invasive adenocarcinoma(123;0.169)														---	---	---	---	capture		Missense_Mutation	SNP	41523623	41523623	3500	15	G	C	C	37	37	CHP	C	3	3
CGNL1	84952	broad.mit.edu	37	15	57730751	57730751	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:57730751A>G	uc002aeg.2	+	2	630	c.554A>G	c.(553-555)AAT>AGT	p.N185S	CGNL1_uc010bfw.2_Missense_Mutation_p.N185S	NM_032866	NP_116255	Q0VF96	CGNL1_HUMAN	cingulin-like 1	185	Head.					myosin complex|tight junction	motor activity			skin(6)|ovary(4)|central_nervous_system(1)	11				all cancers(107;0.121)|GBM - Glioblastoma multiforme(80;0.186)														---	---	---	---	capture		Missense_Mutation	SNP	57730751	57730751	3437	15	A	G	G	4	4	CGNL1	G	4	4
C15orf27	123591	broad.mit.edu	37	15	76496130	76496130	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76496130T>C	uc002bbq.2	+	11	1225	c.1070T>C	c.(1069-1071)ATA>ACA	p.I357T	C15orf27_uc010bkp.2_Missense_Mutation_p.I173T|C15orf27_uc002bbr.2_Missense_Mutation_p.I173T|C15orf27_uc002bbs.2_Missense_Mutation_p.I35T	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	357						integral to membrane					0																		---	---	---	---	capture		Missense_Mutation	SNP	76496130	76496130	1838	15	T	C	C	49	49	C15orf27	C	4	4
AKAP13	11214	broad.mit.edu	37	15	86262404	86262404	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86262404G>T	uc002blv.1	+	23	6269	c.6099G>T	c.(6097-6099)CAG>CAT	p.Q2033H	AKAP13_uc002blu.1_Missense_Mutation_p.Q2037H|AKAP13_uc010bnf.1_Missense_Mutation_p.Q654H|AKAP13_uc002blw.1_Missense_Mutation_p.Q498H|AKAP13_uc002blx.1_Missense_Mutation_p.Q278H	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	2033	Interaction with ESR1.|DH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9																		---	---	---	---	capture		Missense_Mutation	SNP	86262404	86262404	452	15	G	T	T	33	33	AKAP13	T	2	2
NME3	4832	broad.mit.edu	37	16	1820909	1820909	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1820909C>T	uc002cmm.2	-	4	540	c.365G>A	c.(364-366)CGC>CAC	p.R122H	NME3_uc010brv.2_RNA|EME2_uc002cmq.1_5'Flank|EME2_uc010brw.1_5'Flank	NM_002513	NP_002504	Q13232	NDK3_HUMAN	nucleoside diphosphate kinase 3	122		ATP (By similarity).			apoptosis|CTP biosynthetic process|GTP biosynthetic process|induction of apoptosis|UTP biosynthetic process		ATP binding|metal ion binding|nucleoside diphosphate kinase activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	1820909	1820909	10895	16	C	T	T	27	27	NME3	T	1	1
SMG1	23049	broad.mit.edu	37	16	18846334	18846334	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18846334A>G	uc002dfm.2	-	49	8573	c.8210T>C	c.(8209-8211)GTT>GCT	p.V2737A	SMG1_uc010bwb.2_Missense_Mutation_p.V2597A|SMG1_uc010bwa.2_Missense_Mutation_p.V1468A	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2737					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---	capture		Missense_Mutation	SNP	18846334	18846334	15293	16	A	G	G	2	2	SMG1	G	4	4
SMG1	23049	broad.mit.edu	37	16	18870957	18870957	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18870957G>A	uc002dfm.2	-	27	4237	c.3874C>T	c.(3874-3876)CAA>TAA	p.Q1292*	SMG1_uc010bwb.2_Nonsense_Mutation_p.Q1152*|SMG1_uc010bwa.2_Nonsense_Mutation_p.Q23*	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1292	FAT.|Interaction with SMG8 and SMG9.		Q -> P.		DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16																		---	---	---	---	capture		Nonsense_Mutation	SNP	18870957	18870957	15293	16	G	A	A	45	45	SMG1	A	5	2
TMC7	79905	broad.mit.edu	37	16	19027840	19027840	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19027840C>G	uc002dfq.2	+	3	510	c.380C>G	c.(379-381)TCT>TGT	p.S127C	TMC7_uc010vao.1_Missense_Mutation_p.S127C|TMC7_uc002dfp.2_Missense_Mutation_p.S127C|TMC7_uc010vap.1_Missense_Mutation_p.S17C	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	127	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	19027840	19027840	16520	16	C	G	G	32	32	TMC7	G	3	3
DNAH3	55567	broad.mit.edu	37	16	20996734	20996734	+	Missense_Mutation	SNP	C	T	T	rs146558827		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20996734C>T	uc010vbe.1	-	48	7330	c.7330G>A	c.(7330-7332)GCC>ACC	p.A2444T	DNAH3_uc010vbd.1_5'Flank	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2444	AAA 4 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)														---	---	---	---	capture		Missense_Mutation	SNP	20996734	20996734	4786	16	C	T	T	27	27	DNAH3	T	1	1
ALDOA	226	broad.mit.edu	37	16	30080950	30080950	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30080950C>T	uc002dvw.2	+	10	1883	c.755C>T	c.(754-756)GCG>GTG	p.A252V	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|ALDOA_uc002dvx.2_Missense_Mutation_p.A252V|ALDOA_uc002dvy.2_Missense_Mutation_p.A252V|ALDOA_uc002dvz.2_Missense_Mutation_p.A252V|ALDOA_uc002dwa.3_Missense_Mutation_p.A252V|ALDOA_uc002dwb.1_Missense_Mutation_p.A252V|ALDOA_uc002dwc.2_Missense_Mutation_p.A252V|ALDOA_uc010veg.1_Missense_Mutation_p.A306V|ALDOA_uc002dwd.2_Missense_Mutation_p.A256V	NM_184043	NP_908932	P04075	ALDOA_HUMAN	fructose-bisphosphate aldolase A	252					actin filament organization|ATP biosynthetic process|fructose 1,6-bisphosphate metabolic process|gluconeogenesis|glycolysis|muscle cell homeostasis|platelet activation|platelet degranulation|protein homotetramerization|regulation of cell shape|striated muscle contraction	actin cytoskeleton|cytosol|extracellular vesicular exosome|I band|platelet alpha granule lumen	actin binding|fructose binding|fructose-bisphosphate aldolase activity|identical protein binding|tubulin binding			lung(1)	1																OREG0023729	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	30080950	30080950	510	16	C	T	T	27	27	ALDOA	T	1	1
GPT2	84706	broad.mit.edu	37	16	46943685	46943685	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46943685C>T	uc002eel.2	+	6	760	c.666C>T	c.(664-666)GTC>GTT	p.V222V	GPT2_uc002eem.2_Silent_p.V122V	NM_133443	NP_597700	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase 2 isoform 1	222					2-oxoglutarate metabolic process|cellular amino acid biosynthetic process|L-alanine metabolic process	mitochondrial matrix	L-alanine:2-oxoglutarate aminotransferase activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)													---	---	---	---	capture		Silent	SNP	46943685	46943685	7014	16	C	T	T	29	29	GPT2	T	2	2
GFOD2	81577	broad.mit.edu	37	16	67709234	67709234	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67709234C>T	uc002eub.2	-	3	1277	c.982G>A	c.(982-984)GAC>AAC	p.D328N	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_Missense_Mutation_p.D223N	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	328						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)														---	---	---	---	capture		Missense_Mutation	SNP	67709234	67709234	6612	16	C	T	T	30	30	GFOD2	T	2	2
TP53	7157	broad.mit.edu	37	17	7578212	7578212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578212G>A	uc002gim.2	-	6	831	c.637C>T	c.(637-639)CGA>TGA	p.R213*	TP53_uc002gig.1_Nonsense_Mutation_p.R213*|TP53_uc002gih.2_Nonsense_Mutation_p.R213*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.R81*|TP53_uc010cng.1_Nonsense_Mutation_p.R81*|TP53_uc002gii.1_Nonsense_Mutation_p.R81*|TP53_uc010cnh.1_Nonsense_Mutation_p.R213*|TP53_uc010cni.1_Nonsense_Mutation_p.R213*|TP53_uc002gij.2_Nonsense_Mutation_p.R213*|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Nonsense_Mutation_p.R120*|TP53_uc002gio.2_Nonsense_Mutation_p.R81*|TP53_uc010vug.1_Nonsense_Mutation_p.R174*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	213	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> L (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> P (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R213*(186)|p.R213L(25)|p.R213Q(22)|p.R213fs*34(10)|p.0?(7)|p.R213P(5)|p.R81*(2)|p.R120*(2)|p.R213G(2)|p.K164_P219del(1)|p.D208_V216delDRNTFRHSV(1)|p.D207_R213delDDRNTFR(1)|p.T211_S215delTFRHS(1)|p.R213*33(1)|p.D208fs*1(1)|p.R213>L(1)|p.R209_R213delRNTFR(1)|p.R213fs*2(1)|p.T211fs*28(1)|p.R213_S215>X(1)|p.D207_V216del10(1)|p.R213R(1)|p.R213fs*32(1)|p.R209fs*6(1)|p.R213W(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)			111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---	capture		Nonsense_Mutation	SNP	7578212	7578212	16923	17	G	A	A	37	37	TP53	A	5	1
NOS2	4843	broad.mit.edu	37	17	26099414	26099414	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26099414G>T	uc002gzu.2	-	14	1888	c.1624C>A	c.(1624-1626)CTC>ATC	p.L542I	NOS2_uc010crh.1_Missense_Mutation_p.L542I|NOS2_uc010wab.1_Missense_Mutation_p.L542I	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A	542	Flavodoxin-like.				arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)													---	---	---	---	capture		Missense_Mutation	SNP	26099414	26099414	10946	17	G	T	T	35	35	NOS2	T	2	2
TMEM132E	124842	broad.mit.edu	37	17	32963126	32963126	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32963126G>A	uc002hif.2	+	9	2136	c.1808G>A	c.(1807-1809)AGC>AAC	p.S603N		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	603	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)														---	---	---	---	capture		Missense_Mutation	SNP	32963126	32963126	16580	17	G	A	A	34	34	TMEM132E	A	2	2
NXPH3	11248	broad.mit.edu	37	17	47656181	47656181	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47656181C>T	uc002ipa.2	+	2	562	c.278C>T	c.(277-279)TCA>TTA	p.S93L	NXPH3_uc010wlw.1_Missense_Mutation_p.S93L	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor	93	III.				neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)																	---	---	---	---	capture		Missense_Mutation	SNP	47656181	47656181	11197	17	C	T	T	29	29	NXPH3	T	2	2
DGKE	8526	broad.mit.edu	37	17	54926589	54926589	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54926589C>T	uc002iur.2	+	7	1274	c.1094C>T	c.(1093-1095)CCC>CTC	p.P365L	DGKE_uc002ius.1_Missense_Mutation_p.P365L	NM_003647	NP_003638	P52429	DGKE_HUMAN	diacylglycerol kinase epsilon	365					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|phospholipid biosynthetic process|platelet activation	integral to membrane|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding|protein binding			breast(2)	2	Breast(9;3.59e-07)																	---	---	---	---	capture		Missense_Mutation	SNP	54926589	54926589	4647	17	C	T	T	22	22	DGKE	T	2	2
UNK	85451	broad.mit.edu	37	17	73811302	73811302	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73811302G>T	uc002jpm.2	+	8	1157	c.1157G>T	c.(1156-1158)CGA>CTA	p.R386L		NM_001080419	NP_001073888	Q9C0B0	UNK_HUMAN	zinc finger CCCH-type domain containing 5	310	C3H1-type 5.						nucleic acid binding|zinc ion binding				0			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)															---	---	---	---	capture		Missense_Mutation	SNP	73811302	73811302	17559	17	G	T	T	37	37	UNK	T	1	1
SEPT9	10801	broad.mit.edu	37	17	75398373	75398373	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:75398373G>T	uc002jts.3	+	3	435	c.309G>T	c.(307-309)CCG>CCT	p.P103P	SEPT9_uc010wtk.1_Silent_p.P84P|SEPT9_uc002jtt.3_5'UTR|SEPT9_uc002jtu.3_Silent_p.P85P|SEPT9_uc002jtv.2_Silent_p.P96P|SEPT9_uc002jtw.2_5'UTR|SEPT9_uc002jtx.1_5'UTR|SEPT9_uc010wtl.1_5'Flank	NM_001113491	NP_001106963	Q9UHD8	SEPT9_HUMAN	septin 9 isoform a	103					cell cycle|cell division|protein heterooligomerization	microtubule|perinuclear region of cytoplasm|stress fiber	GTP binding|GTPase activity|protein binding|protein binding			breast(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(99;0.153)															---	---	---	---	capture		Silent	SNP	75398373	75398373	14557	17	G	T	T	39	39	SEPT9	T	1	1
ADCYAP1	116	broad.mit.edu	37	18	909481	909481	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:909481G>A	uc010dkg.2	+	5	495	c.376G>A	c.(376-378)GAG>AAG	p.E126K	ADCYAP1_uc010dkh.2_Missense_Mutation_p.E126K	NM_001099733	NP_001093203	P18509	PACA_HUMAN	adenylate cyclase activating polypeptide	126					activation of adenylate cyclase activity|cell-cell signaling|female pregnancy|nerve growth factor receptor signaling pathway|regulation of G-protein coupled receptor protein signaling pathway	extracellular region|soluble fraction	neuropeptide hormone activity|peptide hormone receptor binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	909481	909481	303	18	G	A	A	41	41	ADCYAP1	A	2	2
PIK3C3	5289	broad.mit.edu	37	18	39593460	39593460	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:39593460G>A	uc002lap.2	+	11	1283	c.1225G>A	c.(1225-1227)GAT>AAT	p.D409N	PIK3C3_uc010xcl.1_Missense_Mutation_p.D346N	NM_002647	NP_002638	Q8NEB9	PK3C3_HUMAN	catalytic phosphatidylinositol 3-kinase 3	409					cell cycle|cytokinesis|fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	midbody|phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|protein binding			lung(8)|ovary(1)|breast(1)	10															TSP Lung(28;0.18)			---	---	---	---	capture		Missense_Mutation	SNP	39593460	39593460	12336	18	G	A	A	45	45	PIK3C3	A	2	2
CCDC11	220136	broad.mit.edu	37	18	47792749	47792749	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47792749A>G	uc002lee.2	-	1	117	c.26T>C	c.(25-27)GTA>GCA	p.V9A		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	9										ovary(1)|pancreas(1)|skin(1)	3				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)														---	---	---	---	capture		Missense_Mutation	SNP	47792749	47792749	2866	18	A	G	G	14	14	CCDC11	G	4	4
ALPK2	115701	broad.mit.edu	37	18	56274624	56274624	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56274624C>T	uc002lhj.3	-	3	371	c.157G>A	c.(157-159)GAT>AAT	p.D53N		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	53	Ig-like 1.						ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14																		---	---	---	---	capture		Missense_Mutation	SNP	56274624	56274624	548	18	C	T	T	31	31	ALPK2	T	1	1
PRTN3	5657	broad.mit.edu	37	19	847957	847957	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:847957G>A	uc002lqa.1	+	5	783	c.759G>A	c.(757-759)AAG>AAA	p.K253K		NM_002777	NP_002768	P24158	PRTN3_HUMAN	myeloblastin	253					collagen catabolic process|positive regulation of cell proliferation|proteolysis		protein binding|serine-type endopeptidase activity			ovary(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Silent	SNP	847957	847957	13090	19	G	A	A	35	35	PRTN3	A	2	2
RGL3	57139	broad.mit.edu	37	19	11527689	11527689	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11527689G>A	uc002mrp.2	-	3	256	c.192C>T	c.(190-192)AGC>AGT	p.S64S	RGL3_uc002mrn.2_5'UTR|RGL3_uc002mrm.2_5'UTR|RGL3_uc002mro.2_Silent_p.S64S|RGL3_uc002mrq.2_Silent_p.S64S	NM_001035223	NP_001030300	Q3MIN7	RGL3_HUMAN	ral guanine nucleotide dissociation	64					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1																		---	---	---	---	capture		Silent	SNP	11527689	11527689	13751	19	G	A	A	46	46	RGL3	A	2	2
CACNA1A	773	broad.mit.edu	37	19	13616887	13616887	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13616887G>T	uc010dze.2	-	1	388	c.152C>A	c.(151-153)TCA>TAA	p.S51*	CACNA1A_uc002mwy.3_Nonsense_Mutation_p.S51*	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	51	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)													---	---	---	---	capture		Nonsense_Mutation	SNP	13616887	13616887	2654	19	G	T	T	45	45	CACNA1A	T	5	2
PIK3R2	5296	broad.mit.edu	37	19	18277041	18277041	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18277041G>C	uc002nia.1	+	12	2000	c.1488G>C	c.(1486-1488)CAG>CAC	p.Q496H	PIK3R2_uc002nib.1_RNA|PIK3R2_uc010ebi.1_RNA	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	496					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|stomach(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	18277041	18277041	12343	19	G	C	C	33	33	PIK3R2	C	3	3
LRP3	4037	broad.mit.edu	37	19	33698458	33698458	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33698458G>T	uc010edh.2	+	7	2383	c.2290G>T	c.(2290-2292)GAT>TAT	p.D764Y	LRP3_uc002nuk.3_Missense_Mutation_p.D638Y	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	764	Cytoplasmic (Potential).				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)																	---	---	---	---	capture		Missense_Mutation	SNP	33698458	33698458	9331	19	G	T	T	45	45	LRP3	T	2	2
ZNF546	339327	broad.mit.edu	37	19	40519754	40519754	+	Missense_Mutation	SNP	G	A	A	rs144973655		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40519754G>A	uc002oms.2	+	7	833	c.577G>A	c.(577-579)GTT>ATT	p.V193I	ZNF546_uc002omt.2_Missense_Mutation_p.V167I	NM_178544	NP_848639	Q86UE3	ZN546_HUMAN	zinc finger protein 546	193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)																	---	---	---	---	capture		Missense_Mutation	SNP	40519754	40519754	18573	19	G	A	A	40	40	ZNF546	A	1	1
SYT3	84258	broad.mit.edu	37	19	51132654	51132654	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132654G>A	uc002pst.2	-	4	1812	c.1178C>T	c.(1177-1179)TCG>TTG	p.S393L	SYT3_uc002psv.2_Missense_Mutation_p.S393L|SYT3_uc010ycd.1_Missense_Mutation_p.S393L	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	393	C2 1.|Cytoplasmic (Potential).	Calcium 3 (By similarity).				cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)														---	---	---	---	capture		Missense_Mutation	SNP	51132654	51132654	15996	19	G	A	A	37	37	SYT3	A	1	1
ZNF71	58491	broad.mit.edu	37	19	57133481	57133481	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57133481G>T	uc002qnm.3	+	3	1064	c.826G>T	c.(826-828)GGG>TGG	p.G276W		NM_021216	NP_067039	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	276	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	57133481	57133481	18710	19	G	T	T	39	39	ZNF71	T	1	1
HADHA	3030	broad.mit.edu	37	2	26418042	26418042	+	Silent	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26418042C>G	uc002rgy.2	-	15	1669	c.1539G>C	c.(1537-1539)ACG>ACC	p.T513T	HADHA_uc010yks.1_Silent_p.T426T	NM_000182	NP_000173	P40939	ECHA_HUMAN	mitochondrial trifunctional protein, alpha	513					fatty acid beta-oxidation	fatty acid beta-oxidation multienzyme complex|mitochondrial nucleoid|nucleolus	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acetyltransferase activity|coenzyme binding|enoyl-CoA hydratase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity|protein binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				NADH(DB00157)													---	---	---	---	capture		Silent	SNP	26418042	26418042	7225	2	C	G	G	31	31	HADHA	G	3	3
SLC30A3	7781	broad.mit.edu	37	2	27480855	27480855	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27480855C>T	uc002rjk.2	-	4	682	c.496G>A	c.(496-498)GTC>ATC	p.V166I	SLC30A3_uc002rjj.2_5'UTR|SLC30A3_uc010ylh.1_Missense_Mutation_p.V161I	NM_003459	NP_003450	Q99726	ZNT3_HUMAN	solute carrier family 30 (zinc transporter),	166	Helical; (Potential).				regulation of sequestering of zinc ion	cell junction|integral to plasma membrane|late endosome|membrane fraction|synaptic vesicle membrane	zinc transporting ATPase activity				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Missense_Mutation	SNP	27480855	27480855	15053	2	C	T	T	19	19	SLC30A3	T	1	1
IFT172	26160	broad.mit.edu	37	2	27672642	27672642	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27672642T>C	uc002rku.2	-	37	4127	c.4076A>G	c.(4075-4077)GAC>GGC	p.D1359G	IFT172_uc010ezb.2_RNA	NM_015662	NP_056477	Q9UG01	IF172_HUMAN	selective LIM binding factor homolog	1359	TPR 11.				cilium assembly	cilium	binding			large_intestine(1)|ovary(1)	2	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---	capture		Missense_Mutation	SNP	27672642	27672642	7858	2	T	C	C	58	58	IFT172	C	4	4
SLC8A1	6546	broad.mit.edu	37	2	40401975	40401975	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40401975G>T	uc002rrx.2	-	4	1968	c.1944C>A	c.(1942-1944)TTC>TTA	p.F648L	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Missense_Mutation_p.F648L|SLC8A1_uc002rrz.2_Missense_Mutation_p.F640L|SLC8A1_uc002rsa.2_Missense_Mutation_p.F640L|SLC8A1_uc002rsd.3_Missense_Mutation_p.F640L|SLC8A1_uc002rsb.1_Missense_Mutation_p.F640L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	648	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)													---	---	---	---	capture		Missense_Mutation	SNP	40401975	40401975	15203	2	G	T	T	45	45	SLC8A1	T	2	2
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48898756	48898756	+	Silent	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48898756T>A	uc010yol.1	+	7	3284	c.3237T>A	c.(3235-3237)GTT>GTA	p.V1079V	STON1-GTF2A1L_uc002rwp.1_Silent_p.V1126V|GTF2A1L_uc002rws.1_Silent_p.V422V|GTF2A1L_uc010yom.1_Silent_p.V388V|GTF2A1L_uc002rwt.2_Silent_p.V422V	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	1079					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)															---	---	---	---	capture		Silent	SNP	48898756	48898756	15837	2	T	A	A	61	61	STON1-GTF2A1L	A	4	4
SLC1A4	6509	broad.mit.edu	37	2	65217264	65217264	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65217264G>A	uc010yqa.1	+	1	809	c.487G>A	c.(487-489)GTC>ATC	p.V163I	SLC1A4_uc010ypy.1_Intron|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Missense_Mutation_p.V163I	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	163	Extracellular (Potential).				cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)													---	---	---	---	capture		Missense_Mutation	SNP	65217264	65217264	14930	2	G	A	A	48	48	SLC1A4	A	2	2
LONRF2	164832	broad.mit.edu	37	2	100938034	100938034	+	Silent	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100938034C>A	uc002tal.3	-	1	1162	c.522G>T	c.(520-522)CCG>CCT	p.P174P		NM_198461	NP_940863	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger	174					proteolysis		ATP-dependent peptidase activity|zinc ion binding			large_intestine(1)|skin(1)	2																		---	---	---	---	capture		Silent	SNP	100938034	100938034	9267	2	C	A	A	27	27	LONRF2	A	1	1
GPR45	11250	broad.mit.edu	37	2	105858749	105858749	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105858749C>T	uc002tco.1	+	1	550	c.434C>T	c.(433-435)CCG>CTG	p.P145L		NM_007227	NP_009158	Q9Y5Y3	GPR45_HUMAN	G protein-coupled receptor 45	145	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	105858749	105858749	6971	2	C	T	T	23	23	GPR45	T	1	1
GCC2	9648	broad.mit.edu	37	2	109100746	109100746	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109100746G>C	uc002tec.2	+	13	3746	c.3592G>C	c.(3592-3594)GAA>CAA	p.E1198Q	GCC2_uc002ted.2_Missense_Mutation_p.E1097Q	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1198	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	109100746	109100746	6552	2	G	C	C	33	33	GCC2	C	3	3
CNTNAP5	129684	broad.mit.edu	37	2	125281905	125281905	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125281905G>C	uc002tno.2	+	9	1714	c.1350G>C	c.(1348-1350)TGG>TGC	p.W450C	CNTNAP5_uc010flu.2_Missense_Mutation_p.W451C	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	450	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)														---	---	---	---	capture		Missense_Mutation	SNP	125281905	125281905	3788	2	G	C	C	42	42	CNTNAP5	C	3	3
LRP1B	53353	broad.mit.edu	37	2	141356255	141356255	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141356255G>A	uc002tvj.1	-	43	8111	c.7139C>T	c.(7138-7140)TCA>TTA	p.S2380L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2380	Extracellular (Potential).|LDL-receptor class B 26.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---	capture		Missense_Mutation	SNP	141356255	141356255	9328	2	G	A	A	45	45	LRP1B	A	2	2
NEB	4703	broad.mit.edu	37	2	152522861	152522861	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152522861T>G	uc010fnx.2	-	41	4965	c.4774A>C	c.(4774-4776)AGT>CGT	p.S1592R		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1592	Nebulin 41.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)														---	---	---	---	capture		Missense_Mutation	SNP	152522861	152522861	10701	2	T	G	G	55	55	NEB	G	4	4
TTN	7273	broad.mit.edu	37	2	179499896	179499896	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179499896G>T	uc010zfg.1	-	177	34540	c.34316C>A	c.(34315-34317)TCA>TAA	p.S11439*	TTN_uc010zfh.1_Nonsense_Mutation_p.S5134*|TTN_uc010zfi.1_Nonsense_Mutation_p.S5067*|TTN_uc010zfj.1_Nonsense_Mutation_p.S4942*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	12366							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---	capture		Nonsense_Mutation	SNP	179499896	179499896	17290	2	G	T	T	45	45	TTN	T	5	2
TTN	7273	broad.mit.edu	37	2	179642226	179642226	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179642226G>A	uc010zfg.1	-	26	4790	c.4566C>T	c.(4564-4566)CCC>CCT	p.P1522P	TTN_uc010zfh.1_Silent_p.P1476P|TTN_uc010zfi.1_Silent_p.P1476P|TTN_uc010zfj.1_Silent_p.P1476P|TTN_uc002unb.2_Silent_p.P1522P|uc002unc.1_RNA	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1522							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---	capture		Silent	SNP	179642226	179642226	17290	2	G	A	A	47	47	TTN	A	2	2
TTN	7273	broad.mit.edu	37	2	179648821	179648821	+	Silent	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179648821T>C	uc010zfg.1	-	16	2975	c.2751A>G	c.(2749-2751)GAA>GAG	p.E917E	TTN_uc010zfh.1_Silent_p.E871E|TTN_uc010zfi.1_Silent_p.E871E|TTN_uc010zfj.1_Silent_p.E871E|TTN_uc002unb.2_Silent_p.E917E	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	917							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)															---	---	---	---	capture		Silent	SNP	179648821	179648821	17290	2	T	C	C	56	56	TTN	C	4	4
PLCD4	84812	broad.mit.edu	37	2	219499248	219499248	+	Silent	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219499248C>A	uc002vij.1	+	13	1986	c.1791C>A	c.(1789-1791)GGC>GGA	p.G597G		NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	597	PI-PLC Y-box.				intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)														---	---	---	---	capture		Silent	SNP	219499248	219499248	12459	2	C	A	A	27	27	PLCD4	A	1	1
COL6A3	1293	broad.mit.edu	37	2	238283095	238283095	+	Silent	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238283095C>G	uc002vwl.2	-	8	3924	c.3639G>C	c.(3637-3639)CTG>CTC	p.L1213L	COL6A3_uc002vwo.2_Silent_p.L1007L|COL6A3_uc010znj.1_Silent_p.L606L|COL6A3_uc002vwq.2_Silent_p.L1007L|COL6A3_uc002vwr.2_Silent_p.L806L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1213	Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---	capture		Silent	SNP	238283095	238283095	3839	2	C	G	G	29	29	COL6A3	G	3	3
MTERFD2	130916	broad.mit.edu	37	2	242036818	242036818	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242036818C>G	uc002wan.1	-	2	1125	c.632G>C	c.(631-633)TGT>TCT	p.C211S	MTERFD2_uc010zoj.1_5'UTR|MTERFD2_uc010zok.1_Missense_Mutation_p.C182S	NM_182501	NP_872307	Q7Z6M4	MTER2_HUMAN	MTERF domain containing 2	182										ovary(1)	1		all_cancers(19;4.67e-31)|all_epithelial(40;8.67e-13)|Breast(86;0.000141)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;2.47e-32)|all cancers(36;1.79e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-14)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;2.81e-06)|Lung(119;0.000509)|LUSC - Lung squamous cell carcinoma(224;0.00442)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0886)														---	---	---	---	capture		Missense_Mutation	SNP	242036818	242036818	10313	2	C	G	G	17	17	MTERFD2	G	3	3
JAG1	182	broad.mit.edu	37	20	10622443	10622443	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10622443G>A	uc002wnw.2	-	22	3186	c.2670C>T	c.(2668-2670)ATC>ATT	p.I890I	JAG1_uc010gcd.1_Silent_p.I448I	NM_000214	NP_000205	P78504	JAG1_HUMAN	jagged 1 precursor	890	Extracellular (Potential).				angiogenesis|cell communication|cell fate determination|endothelial cell differentiation|hemopoiesis|keratinocyte differentiation|myoblast differentiation|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation	extracellular region|integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding|structural molecule activity			lung(3)|ovary(2)|central_nervous_system(2)|breast(1)|pancreas(1)	9														Alagille_Syndrome				---	---	---	---	capture		Silent	SNP	10622443	10622443	8238	20	G	A	A	37	37	JAG1	A	1	1
C20orf7	79133	broad.mit.edu	37	20	13782282	13782282	+	Missense_Mutation	SNP	G	A	A	rs149637004		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13782282G>A	uc002wom.2	+	7	703	c.670G>A	c.(670-672)GAC>AAC	p.D224N	C20orf7_uc002wol.1_3'UTR|C20orf7_uc002won.2_Missense_Mutation_p.D196N|C20orf7_uc002woo.2_RNA	NM_024120	NP_077025	Q5TEU4	CT007_HUMAN	hypothetical protein LOC79133 isoform 1	224					mitochondrial respiratory chain complex I assembly	extrinsic to mitochondrial inner membrane	methyltransferase activity				0		Myeloproliferative disorder(85;0.00878)																---	---	---	---	capture		Missense_Mutation	SNP	13782282	13782282	2195	20	G	A	A	45	45	C20orf7	A	2	2
C20orf160	140706	broad.mit.edu	37	20	30616874	30616874	+	Silent	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30616874G>C	uc002wxf.2	+	7	1159	c.1146G>C	c.(1144-1146)GCG>GCC	p.A382A	C20orf160_uc002wxg.2_5'UTR	NM_080625	NP_542192	Q9NUG4	CT160_HUMAN	hypothetical protein LOC140706	Error:Variant_position_missing_in_Q9NUG4_after_alignment										central_nervous_system(3)|ovary(1)	4																		---	---	---	---	capture		Silent	SNP	30616874	30616874	2170	20	G	C	C	39	39	C20orf160	C	3	3
CEBPB	1051	broad.mit.edu	37	20	48808476	48808476	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48808476G>A	uc002xvi.1	+	1	1101	c.906G>A	c.(904-906)AAG>AAA	p.K302K	CEBPB_uc002xvh.2_RNA	NM_005194	NP_005185	P17676	CEBPB_HUMAN	CCAAT/enhancer binding protein beta	302					acute-phase response|immune response		sequence-specific enhancer binding RNA polymerase II transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(9;5.72e-08)|STAD - Stomach adenocarcinoma(23;0.19)															---	---	---	---	capture		Silent	SNP	48808476	48808476	3333	20	G	A	A	35	35	CEBPB	A	2	2
KRTAP13-1	140258	broad.mit.edu	37	21	31768611	31768611	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768611C>T	uc002yoa.2	+	1	220	c.207C>T	c.(205-207)TCC>TCT	p.S69S		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	69	3.|5 X 10 AA approximate repeats.					intermediate filament				ovary(1)	1																		---	---	---	---	capture		Silent	SNP	31768611	31768611	8837	21	C	T	T	24	24	KRTAP13-1	T	2	2
KRTAP13-1	140258	broad.mit.edu	37	21	31768915	31768915	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768915T>C	uc002yoa.2	+	1	524	c.511T>C	c.(511-513)TAC>CAC	p.Y171H		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	171						intermediate filament				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	31768915	31768915	8837	21	T	C	C	53	53	KRTAP13-1	C	4	4
SIK1	150094	broad.mit.edu	37	21	44837498	44837498	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44837498C>T	uc002zdf.2	-	13	2028	c.1901G>A	c.(1900-1902)AGC>AAC	p.S634N		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	634					anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	44837498	44837498	14812	21	C	T	T	28	28	SIK1	T	2	2
RRP1	8568	broad.mit.edu	37	21	45217800	45217800	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45217800G>T	uc002zds.2	+	8	723	c.630G>T	c.(628-630)TTG>TTT	p.L210F	RRP1_uc011aez.1_Missense_Mutation_p.L210F|RRP1_uc010gpk.1_Missense_Mutation_p.L60F|RRP1_uc010gpl.1_Missense_Mutation_p.L108F|RRP1_uc010gpm.1_Missense_Mutation_p.L77F	NM_003683	NP_003674	P56182	RRP1_HUMAN	ribosomal RNA processing 1 homolog	210					rRNA processing	nucleolus|preribosome, small subunit precursor					0				COAD - Colon adenocarcinoma(84;0.00753)|Colorectal(79;0.0157)|STAD - Stomach adenocarcinoma(101;0.171)														---	---	---	---	capture		Missense_Mutation	SNP	45217800	45217800	14165	21	G	T	T	45	45	RRP1	T	2	2
PCNT	5116	broad.mit.edu	37	21	47783431	47783431	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47783431C>G	uc002zji.3	+	14	2298	c.2191C>G	c.(2191-2193)CTA>GTA	p.L731V	PCNT_uc002zjj.2_Missense_Mutation_p.L613V	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	731	Glu-rich.|Potential.				cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)																	---	---	---	---	capture		Missense_Mutation	SNP	47783431	47783431	12010	21	C	G	G	20	20	PCNT	G	3	3
MYO18B	84700	broad.mit.edu	37	22	26304368	26304368	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26304368T>C	uc003abz.1	+	32	5478	c.5228T>C	c.(5227-5229)CTG>CCG	p.L1743P	MYO18B_uc003aca.1_Missense_Mutation_p.L1624P|MYO18B_uc010guy.1_Missense_Mutation_p.L1625P|MYO18B_uc010guz.1_Missense_Mutation_p.L1623P|MYO18B_uc011aka.1_Missense_Mutation_p.L897P|MYO18B_uc011akb.1_Missense_Mutation_p.L1256P	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1743	Potential.|Tail.|Gln-rich.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12																		---	---	---	---	capture		Missense_Mutation	SNP	26304368	26304368	10461	22	T	C	C	55	55	MYO18B	C	4	4
MEI1	150365	broad.mit.edu	37	22	42166741	42166741	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42166741C>A	uc003baz.1	+	20	2345	c.2320C>A	c.(2320-2322)CTA>ATA	p.L774I	WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_RNA|MEI1_uc003bbb.1_Missense_Mutation_p.L160I|MEI1_uc003bbc.1_Missense_Mutation_p.L142I|MEI1_uc010gym.1_Missense_Mutation_p.L142I|MEI1_uc003bbd.1_Missense_Mutation_p.L17I	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	774							binding			central_nervous_system(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	42166741	42166741	9854	22	C	A	A	28	28	MEI1	A	2	2
SRGAP3	9901	broad.mit.edu	37	3	9036101	9036101	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9036101C>T	uc003brf.1	-	19	3010	c.2334G>A	c.(2332-2334)TCG>TCA	p.S778S	SRGAP3_uc003brg.1_Silent_p.S754S	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	778	SH3.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)				T	RAF1	pilocytic astrocytoma								---	---	---	---	capture		Silent	SNP	9036101	9036101	15661	3	C	T	T	23	23	SRGAP3	T	1	1
ACY1	95	broad.mit.edu	37	3	52019412	52019412	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52019412G>A	uc003dcp.2	+	4	256	c.195G>A	c.(193-195)TGG>TGA	p.W65*	ABHD14B_uc003dcn.2_5'Flank|ACY1_uc011bea.1_Nonsense_Mutation_p.W155*|ACY1_uc011beb.1_Nonsense_Mutation_p.W65*|ACY1_uc003dcq.2_Nonsense_Mutation_p.W65*	NM_000666	NP_000657	Q03154	ACY1_HUMAN	aminoacylase 1	65					cellular amino acid metabolic process|proteolysis	cytosol	aminoacylase activity|metal ion binding|metallopeptidase activity			breast(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000534)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	L-Aspartic Acid(DB00128)													---	---	---	---	capture		Nonsense_Mutation	SNP	52019412	52019412	227	3	G	A	A	42	42	ACY1	A	5	2
ATG3	64422	broad.mit.edu	37	3	112267419	112267419	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112267419C>T	uc003dzd.2	-	5	414	c.304G>A	c.(304-306)GAT>AAT	p.D102N	ATG3_uc003dzc.2_Missense_Mutation_p.D102N|ATG3_uc010hqe.2_Missense_Mutation_p.D102N	NM_022488	NP_071933	Q9NT62	ATG3_HUMAN	Apg3p	102					autophagic vacuole assembly|mitochondrial fragmentation involved in apoptosis|protein targeting to membrane|protein ubiquitination	cytoplasmic ubiquitin ligase complex|cytosol	Atg12 ligase activity|Atg8 ligase activity|enzyme binding			ovary(3)	3																		---	---	---	---	capture		Missense_Mutation	SNP	112267419	112267419	1114	3	C	T	T	29	29	ATG3	T	2	2
UPK1B	7348	broad.mit.edu	37	3	118917955	118917955	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118917955G>T	uc003ecc.2	+	7	789	c.700G>T	c.(700-702)GCC>TCC	p.A234S	UPK1B_uc011bix.1_Missense_Mutation_p.A154S|UPK1B_uc003ecd.2_Missense_Mutation_p.A226S	NM_006952	NP_008883	O75841	UPK1B_HUMAN	uroplakin 1B	234	Helical; (Potential).				epithelial cell differentiation	integral to membrane	structural molecule activity				0				GBM - Glioblastoma multiforme(114;0.222)														---	---	---	---	capture		Missense_Mutation	SNP	118917955	118917955	17568	3	G	T	T	46	46	UPK1B	T	2	2
COL6A6	131873	broad.mit.edu	37	3	130290112	130290112	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130290112C>A	uc010htl.2	+	6	2883	c.2852C>A	c.(2851-2853)GCC>GAC	p.A951D		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	951	VWFA 5.|Nonhelical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	130290112	130290112	3841	3	C	A	A	26	26	COL6A6	A	2	2
DNAJC13	23317	broad.mit.edu	37	3	132235581	132235581	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132235581A>G	uc003eor.2	+	48	5659	c.5594A>G	c.(5593-5595)AAT>AGT	p.N1865S		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1865							heat shock protein binding			ovary(1)|breast(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	132235581	132235581	4815	3	A	G	G	4	4	DNAJC13	G	4	4
NPHP3	27031	broad.mit.edu	37	3	132419237	132419237	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132419237C>A	uc003epe.1	-	11	1761	c.1684G>T	c.(1684-1686)GGA>TGA	p.G562*	NPHP3_uc003epd.1_5'UTR|NPHP3_uc003epf.1_Nonsense_Mutation_p.G317*	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	562					maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1																		---	---	---	---	capture		Nonsense_Mutation	SNP	132419237	132419237	10984	3	C	A	A	22	22	NPHP3	A	5	2
KIT	3815	broad.mit.edu	37	4	55602936	55602936	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55602936G>A	uc010igr.2	+	19	2733	c.2646G>A	c.(2644-2646)ATG>ATA	p.M882I	KIT_uc010igs.2_Missense_Mutation_p.M878I	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	882	Protein kinase.|Cytoplasmic (Potential).				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				---	---	---	---	capture		Missense_Mutation	SNP	55602936	55602936	8641	4	G	A	A	45	45	KIT	A	2	2
PDCL2	132954	broad.mit.edu	37	4	56448312	56448312	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56448312C>G	uc003hbb.2	-	2	202	c.99G>C	c.(97-99)ATG>ATC	p.M33I		NM_152401	NP_689614	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	33											0	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)															---	---	---	---	capture		Missense_Mutation	SNP	56448312	56448312	12048	4	C	G	G	21	21	PDCL2	G	3	3
HELQ	113510	broad.mit.edu	37	4	84358185	84358185	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84358185T>C	uc003hom.2	-	9	2053	c.1874A>G	c.(1873-1875)AAT>AGT	p.N625S	HELQ_uc010ikb.2_Missense_Mutation_p.N558S|HELQ_uc003hol.3_RNA|HELQ_uc010ikc.2_RNA	NM_133636	NP_598375	Q8TDG4	HELQ_HUMAN	DNA helicase HEL308	625	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(1)|breast(1)|skin(1)	3													Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					---	---	---	---	capture		Missense_Mutation	SNP	84358185	84358185	7330	4	T	C	C	52	52	HELQ	C	4	4
PTPN13	5783	broad.mit.edu	37	4	87684053	87684053	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:87684053A>C	uc003hpz.2	+	24	4207	c.3727A>C	c.(3727-3729)AGC>CGC	p.S1243R	PTPN13_uc003hpy.2_Missense_Mutation_p.S1243R|PTPN13_uc003hqa.2_Missense_Mutation_p.S1224R|PTPN13_uc003hqb.2_Missense_Mutation_p.S1052R	NM_080683	NP_542414	Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type	1243						cytoplasm|cytoskeleton|plasma membrane	protein binding|protein binding|protein tyrosine phosphatase activity			ovary(4)|breast(1)|kidney(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)														---	---	---	---	capture		Missense_Mutation	SNP	87684053	87684053	13237	4	A	C	C	3	3	PTPN13	C	4	4
HERC5	51191	broad.mit.edu	37	4	89385004	89385004	+	Splice_Site	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89385004A>G	uc003hrt.2	+	6	934	c.781_splice	c.e6-2	p.D261_splice		NM_016323	NP_057407			hect domain and RLD 5						innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)														---	---	---	---	capture		Splice_Site	SNP	89385004	89385004	7344	4	A	G	G	15	15	HERC5	G	5	4
PRSS12	8492	broad.mit.edu	37	4	119273413	119273413	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119273413G>T	uc003ica.1	-	1	510	c.463C>A	c.(463-465)CGT>AGT	p.R155S		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	155	Kringle.					membrane	scavenger receptor activity			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	119273413	119273413	13065	4	G	T	T	39	39	PRSS12	T	1	1
ADAMTS16	170690	broad.mit.edu	37	5	5146420	5146420	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5146420T>C	uc003jdl.2	+	3	491	c.353T>C	c.(352-354)CTA>CCA	p.L118P	ADAMTS16_uc003jdk.1_Missense_Mutation_p.L118P|ADAMTS16_uc003jdj.1_Missense_Mutation_p.L118P	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	118					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	5146420	5146420	262	5	T	C	C	53	53	ADAMTS16	C	4	4
CMBL	134147	broad.mit.edu	37	5	10286472	10286472	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10286472C>T	uc003jes.2	-	4	911	c.460G>A	c.(460-462)GTC>ATC	p.V154I		NM_138809	NP_620164	Q96DG6	CMBL_HUMAN	carboxymethylenebutenolidase	154						cytosol	hydrolase activity|protein binding			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	10286472	10286472	3714	5	C	T	T	19	19	CMBL	T	1	1
TRIM36	55521	broad.mit.edu	37	5	114469806	114469806	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:114469806C>A	uc003kqs.2	-	8	1794	c.1285G>T	c.(1285-1287)GTT>TTT	p.V429F	TRIM36_uc011cwc.1_Missense_Mutation_p.V417F|TRIM36_uc003kqt.2_Missense_Mutation_p.V274F	NM_018700	NP_061170	Q9NQ86	TRI36_HUMAN	tripartite motif-containing 36 isoform 1	429	Fibronectin type-III.					acrosomal vesicle|cytoskeleton	ligase activity|zinc ion binding	p.V429I(1)		ovary(4)|lung(2)|breast(2)	8		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)														---	---	---	---	capture		Missense_Mutation	SNP	114469806	114469806	17054	5	C	A	A	20	20	TRIM36	A	2	2
SLC27A6	28965	broad.mit.edu	37	5	128362850	128362850	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128362850G>C	uc003kuy.2	+	8	1676	c.1280G>C	c.(1279-1281)CGA>CCA	p.R427P	SLC27A6_uc003kuz.2_Missense_Mutation_p.R427P	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	427					long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)														---	---	---	---	capture		Missense_Mutation	SNP	128362850	128362850	15027	5	G	C	C	37	37	SLC27A6	C	3	3
PCDHB7	56129	broad.mit.edu	37	5	140553062	140553062	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140553062G>A	uc003lit.2	+	1	820	c.646G>A	c.(646-648)GAC>AAC	p.D216N		NM_018940	NP_061763	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7 precursor	216	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|central_nervous_system(1)|skin(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)															---	---	---	---	capture		Missense_Mutation	SNP	140553062	140553062	11967	5	G	A	A	33	33	PCDHB7	A	2	2
PCDHGA9	56107	broad.mit.edu	37	5	140783976	140783976	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140783976G>A	uc003lkh.1	+	1	1457	c.1457G>A	c.(1456-1458)AGA>AAA	p.R486K	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Missense_Mutation_p.R486K	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	486	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)															---	---	---	---	capture		Missense_Mutation	SNP	140783976	140783976	11981	5	G	A	A	33	33	PCDHGA9	A	2	2
UNC5A	90249	broad.mit.edu	37	5	176304243	176304243	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176304243G>A	uc003mey.2	+	9	1621	c.1429G>A	c.(1429-1431)GAG>AAG	p.E477K		NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1 precursor	477	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane				skin(1)	1	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)															---	---	---	---	capture		Missense_Mutation	SNP	176304243	176304243	17549	5	G	A	A	45	45	UNC5A	A	2	2
TUBB2A	7280	broad.mit.edu	37	6	3155931	3155931	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3155931C>T	uc003mvc.2	-	3	291	c.205G>A	c.(205-207)GAG>AAG	p.E69K	TUBB2A_uc003mvb.2_Missense_Mutation_p.E62K|TUBB2A_uc003mvd.2_Intron	NM_001069	NP_001060	Q13885	TBB2A_HUMAN	tubulin, beta 2	69					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			skin(1)	1	Ovarian(93;0.0386)	all_hematologic(90;0.0895)																---	---	---	---	capture		Missense_Mutation	SNP	3155931	3155931	17309	6	C	T	T	30	30	TUBB2A	T	2	2
IP6K3	117283	broad.mit.edu	37	6	33695967	33695967	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33695967C>A	uc010jvf.2	-	4	846	c.310G>T	c.(310-312)GTG>TTG	p.V104L	IP6K3_uc003ofb.2_Missense_Mutation_p.V104L	NM_001142883	NP_001136355	Q96PC2	IP6K3_HUMAN	inositol hexakisphosphate kinase 3	104					inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|protein phosphorylation	cytoplasm	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol hexakisphosphate 6-kinase activity|inositol trisphosphate 3-kinase activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	33695967	33695967	8091	6	C	A	A	18	18	IP6K3	A	2	2
TNFRSF21	27242	broad.mit.edu	37	6	47253871	47253871	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47253871C>A	uc003oyv.2	-	2	990	c.557G>T	c.(556-558)TGC>TTC	p.C186F		NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,	186	Extracellular (Potential).|TNFR-Cys 4.				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)															---	---	---	---	capture		Missense_Mutation	SNP	47253871	47253871	16836	6	C	A	A	25	25	TNFRSF21	A	2	2
PKHD1	5314	broad.mit.edu	37	6	51918945	51918945	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51918945C>T	uc003pah.1	-	20	2131	c.1855G>A	c.(1855-1857)GGC>AGC	p.G619S	PKHD1_uc003pai.2_Missense_Mutation_p.G619S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	619	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)																	---	---	---	---	capture		Missense_Mutation	SNP	51918945	51918945	12396	6	C	T	T	24	24	PKHD1	T	2	2
C6orf142	90523	broad.mit.edu	37	6	54025338	54025338	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54025338C>A	uc003pcg.3	+	6	888	c.775C>A	c.(775-777)CAG>AAG	p.Q259K	C6orf142_uc003pcf.2_Missense_Mutation_p.Q783K|C6orf142_uc003pch.3_Intron|C6orf142_uc011dxa.1_Missense_Mutation_p.Q794K	NM_138569	NP_612636	Q5VWP3	MLIP_HUMAN	hypothetical protein LOC90523	259						nuclear envelope|PML body	protein binding				0	Lung NSC(77;0.0317)																	---	---	---	---	capture		Missense_Mutation	SNP	54025338	54025338	2437	6	C	A	A	25	25	C6orf142	A	2	2
NDUFAF4	29078	broad.mit.edu	37	6	97339016	97339016	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97339016G>A	uc003pow.2	-	3	582	c.492C>T	c.(490-492)TTC>TTT	p.F164F	NDUFAF4_uc003pov.2_RNA	NM_014165	NP_054884	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	164					mitochondrial respiratory chain complex I assembly	mitochondrial membrane	calmodulin binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	97339016	97339016	10676	6	G	A	A	41	41	NDUFAF4	A	2	2
MAP3K4	4216	broad.mit.edu	37	6	161510413	161510413	+	Silent	SNP	T	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161510413T>G	uc003qtn.2	+	11	3025	c.2883T>G	c.(2881-2883)GCT>GCG	p.A961A	MAP3K4_uc010kkc.1_Silent_p.A961A|MAP3K4_uc003qto.2_Silent_p.A961A|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_Silent_p.A414A|MAP3K4_uc003qtp.2_5'Flank	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	961					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---	capture		Silent	SNP	161510413	161510413	9635	6	T	G	G	56	56	MAP3K4	G	4	4
STARD3NL	83930	broad.mit.edu	37	7	38254705	38254705	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38254705C>T	uc003tfr.2	+	4	528	c.380C>T	c.(379-381)GCG>GTG	p.A127V	STARD3NL_uc003tfs.2_Missense_Mutation_p.A127V|STARD3NL_uc003tft.2_Missense_Mutation_p.A127V	NM_032016	NP_114405	O95772	MENTO_HUMAN	MLN64 N-terminal homolog	127	MENTAL.|Helical; (Potential).					integral to membrane|late endosome membrane				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	38254705	38254705	15777	7	C	T	T	27	27	STARD3NL	T	1	1
BLVRA	644	broad.mit.edu	37	7	43840098	43840098	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43840098G>C	uc003tir.2	+	6	470	c.387G>C	c.(385-387)TTG>TTC	p.L129F	BLVRA_uc010kxv.2_Missense_Mutation_p.L129F	NM_000712	NP_000703	P53004	BIEA_HUMAN	biliverdin reductase A precursor	129					heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)													---	---	---	---	capture		Missense_Mutation	SNP	43840098	43840098	1476	7	G	C	C	45	45	BLVRA	C	3	3
WBSCR22	114049	broad.mit.edu	37	7	73111966	73111966	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73111966G>A	uc003tyt.2	+	11	791	c.733G>A	c.(733-735)GTG>ATG	p.V245M	WBSCR22_uc003tyu.2_Missense_Mutation_p.V262M|WBSCR22_uc003tyv.2_Missense_Mutation_p.V207M|WBSCR22_uc003tyw.1_Missense_Mutation_p.V108M	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	245						nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)																---	---	---	---	capture		Missense_Mutation	SNP	73111966	73111966	17837	7	G	A	A	44	44	WBSCR22	A	2	2
CCDC132	55610	broad.mit.edu	37	7	92905597	92905597	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92905597C>T	uc003umo.2	+	12	1050	c.922C>T	c.(922-924)CAA>TAA	p.Q308*	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Nonsense_Mutation_p.Q278*|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Intron|CCDC132_uc003umn.2_Nonsense_Mutation_p.Q308*	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	308											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)															---	---	---	---	capture		Nonsense_Mutation	SNP	92905597	92905597	2887	7	C	T	T	25	25	CCDC132	T	5	2
ZAN	7455	broad.mit.edu	37	7	100377230	100377230	+	Silent	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100377230G>T	uc003uwj.2	+	36	6645	c.6480G>T	c.(6478-6480)ACG>ACT	p.T2160T	ZAN_uc003uwk.2_Silent_p.T2160T|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Silent_p.T247T	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2160	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)															---	---	---	---	capture		Silent	SNP	100377230	100377230	18096	7	G	T	T	38	38	ZAN	T	1	1
CUX1	1523	broad.mit.edu	37	7	101747623	101747623	+	Silent	SNP	G	C	C	rs143157780	byFrequency	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101747623G>C	uc003uyx.3	+	6	452	c.414G>C	c.(412-414)ACG>ACC	p.T138T	CUX1_uc003uys.3_Silent_p.T149T|CUX1_uc003uyt.2_Silent_p.T149T|CUX1_uc011kkn.1_Silent_p.T112T|CUX1_uc003uyw.2_Silent_p.T103T|CUX1_uc003uyv.2_Silent_p.T133T|CUX1_uc003uyu.2_Silent_p.T149T	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	138	Potential.				negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8																		---	---	---	---	capture		Silent	SNP	101747623	101747623	4224	7	G	C	C	37	37	CUX1	C	3	3
LAMB1	3912	broad.mit.edu	37	7	107599895	107599895	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107599895T>C	uc003vew.2	-	20	2824	c.2489A>G	c.(2488-2490)AAT>AGT	p.N830S	LAMB1_uc003vev.2_Missense_Mutation_p.N854S	NM_002291	NP_002282	P07942	LAMB1_HUMAN	laminin, beta 1 precursor	830	Laminin EGF-like 7.				axon guidance|odontogenesis|positive regulation of cell migration|positive regulation of epithelial cell proliferation|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-2 complex|laminin-8 complex|perinuclear region of cytoplasm	extracellular matrix structural constituent			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	8					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)													---	---	---	---	capture		Missense_Mutation	SNP	107599895	107599895	8933	7	T	C	C	52	52	LAMB1	C	4	4
C7orf60	154743	broad.mit.edu	37	7	112535725	112535725	+	Silent	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112535725T>A	uc003vgo.1	-	3	499	c.372A>T	c.(370-372)GTA>GTT	p.V124V	C7orf60_uc011kms.1_Silent_p.V150V	NM_152556	NP_689769	Q1RMZ1	CG060_HUMAN	hypothetical protein LOC154743	124										ovary(2)|skin(1)	3																		---	---	---	---	capture		Silent	SNP	112535725	112535725	2514	7	T	A	A	57	57	C7orf60	A	4	4
ANKRD7	56311	broad.mit.edu	37	7	117874559	117874559	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117874559T>C	uc003vji.2	+	2	427	c.254T>C	c.(253-255)ATA>ACA	p.I85T		NM_019644	NP_062618	Q92527	ANKR7_HUMAN	ankyrin repeat domain 7	85	ANK 1.				male gonad development						0																		---	---	---	---	capture		Missense_Mutation	SNP	117874559	117874559	694	7	T	C	C	49	49	ANKRD7	C	4	4
SPAM1	6677	broad.mit.edu	37	7	123593967	123593967	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123593967C>T	uc003vld.2	+	4	745	c.343C>T	c.(343-345)CCC>TCC	p.P115S	SPAM1_uc003vle.2_Missense_Mutation_p.P115S|SPAM1_uc011koa.1_5'Flank|SPAM1_uc003vlf.3_Missense_Mutation_p.P115S|SPAM1_uc010lku.2_Missense_Mutation_p.P115S	NM_153189	NP_694859	P38567	HYALP_HUMAN	sperm adhesion molecule 1 isoform 2	115					binding of sperm to zona pellucida|carbohydrate metabolic process|cell adhesion|fusion of sperm to egg plasma membrane	anchored to membrane|plasma membrane	hyalurononglucosaminidase activity			ovary(3)|kidney(1)	4					Hyaluronidase(DB00070)													---	---	---	---	capture		Missense_Mutation	SNP	123593967	123593967	15489	7	C	T	T	22	22	SPAM1	T	2	2
CREB3L2	64764	broad.mit.edu	37	7	137590525	137590525	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137590525G>A	uc003vtw.2	-	6	1233	c.838C>T	c.(838-840)CCC>TCC	p.P280S	CREB3L2_uc003vtx.1_Missense_Mutation_p.P280S|CREB3L2_uc003vtv.2_Missense_Mutation_p.P217S	NM_194071	NP_919047	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like	280	Cytoplasmic (Potential).				chondrocyte differentiation|positive regulation of transcription, DNA-dependent|response to endoplasmic reticulum stress|response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	cAMP response element binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		FUS/CREB3L2(158)	soft_tissue(158)|upper_aerodigestive_tract(1)|ovary(1)	160								T	FUS	fibromyxoid sarcoma								---	---	---	---	capture		Missense_Mutation	SNP	137590525	137590525	3996	7	G	A	A	41	41	CREB3L2	A	2	2
MLL3	58508	broad.mit.edu	37	7	151878809	151878809	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151878809G>T	uc003wla.2	-	36	6355	c.6136C>A	c.(6136-6138)CCA>ACA	p.P2046T	MLL3_uc003wkz.2_Missense_Mutation_p.P1107T	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2046	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---	capture		Missense_Mutation	SNP	151878809	151878809	10012	7	G	T	T	41	41	MLL3	T	2	2
CSMD1	64478	broad.mit.edu	37	8	3165292	3165292	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3165292G>T	uc011kwk.1	-	25	4268	c.3878C>A	c.(3877-3879)CCT>CAT	p.P1293H	CSMD1_uc011kwj.1_Missense_Mutation_p.P685H|CSMD1_uc003wqe.2_Missense_Mutation_p.P449H	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1293	Extracellular (Potential).|CUB 8.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---	capture		Missense_Mutation	SNP	3165292	3165292	4085	8	G	T	T	35	35	CSMD1	T	2	2
ADAM9	8754	broad.mit.edu	37	8	38913123	38913123	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38913123G>A	uc003xmr.2	+	14	1501	c.1423G>A	c.(1423-1425)GGA>AGA	p.G475R	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	475	Extracellular (Potential).|Disintegrin.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)															---	---	---	---	capture		Missense_Mutation	SNP	38913123	38913123	254	8	G	A	A	35	35	ADAM9	A	2	2
RB1CC1	9821	broad.mit.edu	37	8	53586413	53586413	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53586413T>A	uc003xre.3	-	7	1552	c.994A>T	c.(994-996)ATG>TTG	p.M332L	RB1CC1_uc003xrf.3_Missense_Mutation_p.M332L	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	332					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)																---	---	---	---	capture		Missense_Mutation	SNP	53586413	53586413	13560	8	T	A	A	49	49	RB1CC1	A	4	4
MTBP	27085	broad.mit.edu	37	8	121483082	121483082	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121483082C>T	uc003ypc.1	+	11	1115	c.1070C>T	c.(1069-1071)CCA>CTA	p.P357L	MTBP_uc011lie.1_RNA	NM_022045	NP_071328	Q96DY7	MTBP_HUMAN	Mdm2, transformed 3T3 cell double minute 2, p53	357					cell cycle arrest					skin(2)|ovary(1)	3	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)															---	---	---	---	capture		Missense_Mutation	SNP	121483082	121483082	10305	8	C	T	T	21	21	MTBP	T	2	2
KLHL38	340359	broad.mit.edu	37	8	124664915	124664915	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124664915G>A	uc003yqs.1	-	1	276	c.252C>T	c.(250-252)ACC>ACT	p.T84T		NM_001081675	NP_001075144	Q2WGJ6	KLH38_HUMAN	kelch-like 38	84	BTB.										0																		---	---	---	---	capture		Silent	SNP	124664915	124664915	8704	8	G	A	A	43	43	KLHL38	A	2	2
KIFC2	90990	broad.mit.edu	37	8	145697332	145697332	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145697332G>C	uc003zcz.2	+	13	1453	c.1388G>C	c.(1387-1389)AGA>ACA	p.R463T	KIFC2_uc003zda.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	463	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)															---	---	---	---	capture		Missense_Mutation	SNP	145697332	145697332	8624	8	G	C	C	33	33	KIFC2	C	3	3
KIFC2	90990	broad.mit.edu	37	8	145697404	145697404	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145697404G>A	uc003zcz.2	+	13	1525	c.1460G>A	c.(1459-1461)GGC>GAC	p.G487D	KIFC2_uc003zda.2_5'Flank	NM_145754	NP_665697	Q96AC6	KIFC2_HUMAN	kinesin family member C2	487	ATP (By similarity).|Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			ovary(2)|central_nervous_system(1)	3	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)															---	---	---	---	capture		Missense_Mutation	SNP	145697404	145697404	8624	8	G	A	A	42	42	KIFC2	A	2	2
ARHGAP39	80728	broad.mit.edu	37	8	145773748	145773748	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145773748C>T	uc003zdt.1	-	6	1277	c.722G>A	c.(721-723)CGC>CAC	p.R241H	ARHGAP39_uc011llk.1_Missense_Mutation_p.R241H|ARHGAP39_uc003zds.1_Missense_Mutation_p.R241H	NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein	241	Pro-rich.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	145773748	145773748	896	8	C	T	T	27	27	ARHGAP39	T	1	1
LPPR1	54886	broad.mit.edu	37	9	104048410	104048410	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104048410T>C	uc004bbb.2	+	4	676	c.277T>C	c.(277-279)TAT>CAT	p.Y93H	LPPR1_uc011lvi.1_Missense_Mutation_p.Y69H|LPPR1_uc004bbc.2_Missense_Mutation_p.Y93H|LPPR1_uc010mtc.2_Missense_Mutation_p.Y77H	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3	93						integral to membrane	catalytic activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	104048410	104048410	9297	9	T	C	C	57	57	LPPR1	C	4	4
LPPR1	54886	broad.mit.edu	37	9	104048506	104048506	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104048506A>G	uc004bbb.2	+	4	772	c.373A>G	c.(373-375)ATA>GTA	p.I125V	LPPR1_uc011lvi.1_Missense_Mutation_p.I101V|LPPR1_uc004bbc.2_Missense_Mutation_p.I125V|LPPR1_uc010mtc.2_Missense_Mutation_p.I109V	NM_207299	NP_997182	Q8TBJ4	LPPR1_HUMAN	plasticity related gene 3	125						integral to membrane	catalytic activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	104048506	104048506	9297	9	A	G	G	8	8	LPPR1	G	4	4
PRPF4	9128	broad.mit.edu	37	9	116049074	116049074	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116049074G>A	uc004bgx.2	+	9	951	c.901G>A	c.(901-903)GCT>ACT	p.A301T	PRPF4_uc004bgy.2_Missense_Mutation_p.A300T	NM_004697	NP_004688	O43172	PRP4_HUMAN	PRP4 pre-mRNA processing factor 4 homolog	301	WD 2.					Cajal body|nuclear speck|spliceosomal complex|U4/U6 snRNP	protein binding			ovary(2)|pancreas(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	116049074	116049074	13013	9	G	A	A	42	42	PRPF4	A	2	2
DENND1A	57706	broad.mit.edu	37	9	126429330	126429330	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126429330C>A	uc004bnz.1	-	8	715	c.482G>T	c.(481-483)AGA>ATA	p.R161I	DENND1A_uc004bny.1_5'UTR|DENND1A_uc011lzm.1_Missense_Mutation_p.R129I|DENND1A_uc004boa.1_Missense_Mutation_p.R161I|DENND1A_uc004bob.1_Missense_Mutation_p.R131I|DENND1A_uc004boc.2_Missense_Mutation_p.R129I	NM_020946	NP_065997	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A isoform 1	161	DENN.					cell junction|clathrin coated vesicle membrane|presynaptic membrane	guanyl-nucleotide exchange factor activity			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	126429330	126429330	4605	9	C	A	A	32	32	DENND1A	A	2	2
GOLGA2	2801	broad.mit.edu	37	9	131030746	131030746	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131030746C>A	uc011maw.1	-	3	278	c.265G>T	c.(265-267)GGT>TGT	p.G89C	GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004bul.1_5'UTR|GOLGA2_uc004bum.1_5'UTR	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2	89	Potential.					Golgi cisterna membrane	protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	131030746	131030746	6821	9	C	A	A	23	23	GOLGA2	A	1	1
DMD	1756	broad.mit.edu	37	X	31341742	31341742	+	Missense_Mutation	SNP	G	A	A	rs128626254		TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31341742G>A	uc004dda.1	-	62	9441	c.9197C>T	c.(9196-9198)TCG>TTG	p.S3066L	DMD_uc004dcq.1_Missense_Mutation_p.S337L|DMD_uc004dcr.1_Missense_Mutation_p.S606L|DMD_uc004dcs.1_Missense_Mutation_p.S606L|DMD_uc004dct.1_Missense_Mutation_p.S606L|DMD_uc004dcu.1_Missense_Mutation_p.S606L|DMD_uc004dcv.1_Missense_Mutation_p.S606L|DMD_uc004dcw.2_Missense_Mutation_p.S1722L|DMD_uc004dcx.2_Missense_Mutation_p.S1725L|DMD_uc004dcz.2_Missense_Mutation_p.S2943L|DMD_uc004dcy.1_Missense_Mutation_p.S3062L|DMD_uc004ddb.1_Missense_Mutation_p.S3058L	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3066	Interaction with SYNM (By similarity).|WW.				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)																---	---	---	---	capture		Missense_Mutation	SNP	31341742	31341742	4760	23	G	A	A	37	37	DMD	A	1	1
PIM2	11040	broad.mit.edu	37	X	48775922	48775922	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48775922C>A	uc004dls.2	-	2	364	c.62G>T	c.(61-63)GGA>GTA	p.G21V		NM_006875	NP_006866	Q9P1W9	PIM2_HUMAN	serine/threonine protein kinase pim-2	21					anti-apoptosis|cell proliferation|male meiosis|positive regulation of autophagy|positive regulation of I-kappaB kinase/NF-kappaB cascade|response to virus		ATP binding|protein serine/threonine kinase activity			lung(3)|stomach(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	48775922	48775922	12352	23	C	A	A	30	30	PIM2	A	2	2
AR	367	broad.mit.edu	37	X	66943546	66943546	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66943546C>A	uc004dwu.1	+	8	3741	c.2626C>A	c.(2626-2628)CAG>AAG	p.Q876K	AR_uc004dwv.1_Missense_Mutation_p.Q344K	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	875	Ligand-binding.|Interaction with MYST2.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)									Androgen_Insensitivity_Syndrome				---	---	---	---	capture		Missense_Mutation	SNP	66943546	66943546	847	23	C	A	A	29	29	AR	A	2	2
PHKA1	5255	broad.mit.edu	37	X	71932781	71932781	+	Splice_Site	SNP	T	C	C			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71932781T>C	uc004eax.3	-	2	380	c.79_splice	c.e2-1	p.N27_splice	PHKA1_uc004eay.3_Splice_Site_p.N27_splice|PHKA1_uc011mqi.1_Splice_Site_p.N27_splice	NM_002637	NP_002628			phosphorylase kinase, alpha 1 (muscle) isoform						glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)																	---	---	---	---	capture		Splice_Site	SNP	71932781	71932781	12267	23	T	C	C	55	55	PHKA1	C	5	4
MAGEE2	139599	broad.mit.edu	37	X	75003366	75003366	+	Missense_Mutation	SNP	C	A	A	rs150153753	byFrequency	TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75003366C>A	uc004ecj.1	-	1	1706	c.1521G>T	c.(1519-1521)GAG>GAT	p.E507D		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	507										ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	75003366	75003366	9569	23	C	A	A	24	24	MAGEE2	A	2	2
ARHGEF6	9459	broad.mit.edu	37	X	135758808	135758808	+	Silent	SNP	C	T	T			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135758808C>T	uc004fab.2	-	18	2382	c.1920G>A	c.(1918-1920)TCG>TCA	p.S640S	ARHGEF6_uc011mwd.1_Silent_p.S513S|ARHGEF6_uc011mwe.1_Silent_p.S486S	NM_004840	NP_004831	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor 6	640					apoptosis|cell junction assembly|induction of apoptosis by extracellular signals|JNK cascade|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity				0	Acute lymphoblastic leukemia(192;0.000127)																	---	---	---	---	capture		Silent	SNP	135758808	135758808	925	23	C	T	T	23	23	ARHGEF6	T	1	1
SPANXN2	494119	broad.mit.edu	37	X	142795447	142795447	+	Silent	SNP	G	A	A			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142795447G>A	uc004fbz.2	-	2	985	c.231C>T	c.(229-231)TCC>TCT	p.S77S		NM_001009615	NP_001009615	Q5MJ10	SPXN2_HUMAN	SPANX-N2 protein	77										ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---	capture		Silent	SNP	142795447	142795447	15499	23	G	A	A	47	47	SPANXN2	A	2	2
TSPY2	64591	broad.mit.edu	37	Y	6115610	6115610	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5029-01	TCGA-39-5029-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:6115610A>G	uc004fqr.1	+	3	618	c.572A>G	c.(571-573)GAA>GGA	p.E191G	TSPY2_uc004fqs.1_Missense_Mutation_p.E191G	NM_022573	NP_072095	A6NKD2	TSPY2_HUMAN	testis specific protein, Y-linked 2	191					cell differentiation|gonadal mesoderm development|nucleosome assembly|spermatogenesis	cytoplasm|nucleus					0																		---	---	---	---	capture		Missense_Mutation	SNP	6115610	6115610	17209	24	A	G	G	9	9	TSPY2	G	4	4
