Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	MUTSIG_Significant_Genes	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
SLC6A5	9152	broad.mit.edu	37	11	20668427	20668428	+	Missense_Mutation	DNP	CC	GG	GG			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20668427_20668428CC>GG	uc001mqd.2	+	14	2290_2291	c.2017_2018CC>GG	c.(2017-2019)CCT>GGT	p.P673G	SLC6A5_uc009yic.2_Missense_Mutation_p.P438G	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	673					synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)													---	---	---	---	capture		Missense_Mutation	DNP	20668427	20668428	15184	11	CC	GG	GG	26	26	SLC6A5	GG	3	3
OR4Q3	441669	broad.mit.edu	37	14	20215703	20215704	+	Missense_Mutation	DNP	CC	AG	AG			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20215703_20215704CC>AG	uc010tkt.1	+	1	117_118	c.117_118CC>AG	c.(115-120)GTCCTG>GTAGTG	p.L40V		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	40	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.L40L(3)		breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)														---	---	---	---	capture		Missense_Mutation	DNP	20215703	20215704	11491	14	CC	AG	AG	30	30	OR4Q3	AG	2	2
NLRC3	197358	broad.mit.edu	37	16	3614540	3614541	+	Missense_Mutation	DNP	CG	TT	TT			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3614540_3614541CG>TT	uc010btn.2	-	5	808_809	c.397_398CG>AA	c.(397-399)CGG>AAG	p.R133K		NM_178844	NP_849172	Q7RTR2	NLRC3_HUMAN	NOD3 protein	133					I-kappaB kinase/NF-kappaB cascade|negative regulation of NF-kappaB transcription factor activity|T cell activation	cytoplasm	ATP binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6																		---	---	---	---	capture		Missense_Mutation	DNP	3614540	3614541	10871	16	CG	TT	TT	23	23	NLRC3	TT	1	1
RBL2	5934	broad.mit.edu	37	16	53499487	53499488	+	Nonsense_Mutation	DNP	TG	GT	GT			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53499487_53499488TG>GT	uc002ehi.3	+	13	1954_1955	c.1836_1837TG>GT	c.(1834-1839)AATGAA>AAGTAA	p.612_613NE>K*	RBL2_uc010vgv.1_Nonsense_Mutation_p.538_539NE>K*|RBL2_uc002ehj.2_Nonsense_Mutation_p.322_323NE>K*|RBL2_uc010vgw.1_Nonsense_Mutation_p.396_397NE>K*	NM_005611	NP_005602	Q08999	RBL2_HUMAN	retinoblastoma-like 2 (p130)	612_613	Domain A.|Pocket; binds E1A.				cell cycle|chromatin modification|regulation of cell cycle|regulation of lipid kinase activity|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(2)|lung(2)|upper_aerodigestive_tract(1)	5																		---	---	---	---	capture		Nonsense_Mutation	DNP	53499487	53499488	13571	16	TG	GT	GT	51	51	RBL2	GT	5	4
MYH1	4619	broad.mit.edu	37	17	10412856	10412857	+	Missense_Mutation	DNP	CC	AA	AA			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10412856_10412857CC>AA	uc002gmo.2	-	15	1626_1627	c.1532_1533GG>TT	c.(1531-1533)TGG>TTT	p.W511F	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	511	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21																		---	---	---	---	capture		Missense_Mutation	DNP	10412856	10412857	10424	17	CC	AA	AA	30	30	MYH1	AA	2	2
DSEL	92126	broad.mit.edu	37	18	65181344	65181345	+	Missense_Mutation	DNP	CC	AG	AG			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65181344_65181345CC>AG	uc002lke.1	-	2	1755_1756	c.531_532GG>CT	c.(529-534)GAGGTT>GACTTT	p.177_178EV>DF		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	167_168						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)																---	---	---	---	capture		Missense_Mutation	DNP	65181344	65181345	4959	18	CC	AG	AG	18	18	DSEL	AG	2	2
GPN1	11321	broad.mit.edu	37	2	27852009	27852010	+	Nonsense_Mutation	DNP	GG	TT	TT			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27852009_27852010GG>TT	uc010ymc.1	+	1	147_148	c.126_127GG>TT	c.(124-129)GCGGGA>GCTTGA	p.G43*	ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_5'UTR|GPN1_uc010yme.1_Nonsense_Mutation_p.G43*|GPN1_uc010ezg.1_5'Flank	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a	29	GTP (Pootential).					cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0																		---	---	---	---	capture		Nonsense_Mutation	DNP	27852009	27852010	6891	2	GG	TT	TT	39	39	GPN1	TT	5	1
CCDC158	339965	broad.mit.edu	37	4	77290776	77290777	+	Splice_Site	DNP	CC	AA	AA			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77290776_77290777CC>AA	uc003hkb.3	-	10	1303	c.1150_splice	c.e10-1	p.A384_splice		NM_001042784	NP_001036249			coiled-coil domain containing 158											skin(3)|ovary(2)|pancreas(1)	6																		---	---	---	---	capture		Splice_Site	DNP	77290776	77290777	2912	4	CC	AA	AA	26	26	CCDC158	AA	5	2
OR2G2	81470	broad.mit.edu	37	1	247751925	247751926	+	Frame_Shift_Ins	INS	-	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247751925_247751926insT	uc010pyy.1	+	1	264_265	c.264_265insT	c.(262-267)CTGTGGfs	p.L88fs		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	88_89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)															---	---	---	---	capture_indel		Frame_Shift_Ins	INS	247751925	247751926	11404	1	-	T	T	48	48	OR2G2	T	5	5
SLC35C1	55343	broad.mit.edu	37	11	45832809	45832810	+	Frame_Shift_Ins	INS	-	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45832809_45832810insT	uc001nbp.2	+	2	1730_1731	c.1018_1019insT	c.(1018-1020)GTCfs	p.V340fs	SLC35C1_uc001nbo.2_Frame_Shift_Ins_p.V327fs|SLC35C1_uc010rgm.1_Frame_Shift_Ins_p.V327fs	NM_018389	NP_060859	Q96A29	FUCT1_HUMAN	GDP-fucose transporter 1 isoform a	340						Golgi membrane|integral to membrane	GDP-fucose transmembrane transporter activity				0				GBM - Glioblastoma multiforme(35;0.227)														---	---	---	---	capture_indel		Frame_Shift_Ins	INS	45832809	45832810	15076	11	-	T	T	44	44	SLC35C1	T	5	5
GUCY1A2	2977	broad.mit.edu	37	11	106849403	106849403	+	Frame_Shift_Del	DEL	G	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106849403delG	uc001pjg.1	-	3	819	c.429delC	c.(427-429)TCCfs	p.S143fs	GUCY1A2_uc010rvo.1_Frame_Shift_Del_p.S143fs|GUCY1A2_uc009yxn.1_Frame_Shift_Del_p.S143fs	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	143					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)														---	---	---	---	capture_indel		Frame_Shift_Del	DEL	106849403	106849403	7173	11	G	-	-	47	47	GUCY1A2	-	5	5
H3F3C	440093	broad.mit.edu	37	12	31945016	31945016	+	Frame_Shift_Del	DEL	T	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31945016delT	uc001rkr.2	-	1	160	c.85delA	c.(85-87)AGCfs	p.S29fs		NM_001013699	NP_001013721	Q6NXT2	H3C_HUMAN	histone H3-like	29					nucleosome assembly	nucleosome|nucleus	DNA binding				0															HNSCC(67;0.2)			---	---	---	---	capture_indel		Frame_Shift_Del	DEL	31945016	31945016	7217	12	T	-	-	56	56	H3F3C	-	5	5
PCDH17	27253	broad.mit.edu	37	13	58208948	58208948	+	Frame_Shift_Del	DEL	G	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58208948delG	uc001vhq.1	+	1	3160	c.2268delG	c.(2266-2268)AAGfs	p.K756fs	PCDH17_uc010aec.1_Frame_Shift_Del_p.K756fs	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	756	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)														---	---	---	---	capture_indel		Frame_Shift_Del	DEL	58208948	58208948	11932	13	G	-	-	35	35	PCDH17	-	5	5
CYP1A1	1543	broad.mit.edu	37	15	75013955	75013974	+	Frame_Shift_Del	DEL	ATGTTAATGATCTTCTCATC	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75013955_75013974delATGTTAATGATCTTCTCATC	uc002ayp.3	-	3	1032_1051	c.910_929delGATGAGAAGATCATTAACAT	c.(910-930)GATGAGAAGATCATTAACATCfs	p.D304fs	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Frame_Shift_Del_p.D40fs|CYP1A1_uc010bjx.2_Frame_Shift_Del_p.D40fs|CYP1A1_uc002ayq.3_Frame_Shift_Del_p.D304fs|CYP1A1_uc010bjy.2_Frame_Shift_Del_p.D304fs|CYP1A1_uc010bjz.1_Frame_Shift_Del_p.D40fs	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	304_310					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				---	---	---	---	capture_indel		Frame_Shift_Del	DEL	75013955	75013974	4314	15	ATGTTAATGATCTTCTCATC	-	-	12	12	CYP1A1	-	5	5
IRGQ	126298	broad.mit.edu	37	19	44096824	44096826	+	In_Frame_Del	DEL	TCT	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44096824_44096826delTCT	uc002oww.2	-	2	1342_1344	c.1224_1226delAGA	c.(1222-1227)TCAGAG>TCG	p.E409del	IRGQ_uc010eiv.2_In_Frame_Del_p.E409del	NM_001007561	NP_001007562	Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	409							protein binding			ovary(1)|pancreas(1)	2		Prostate(69;0.0199)																---	---	---	---	capture_indel		In_Frame_Del	DEL	44096824	44096826	8143	19	TCT	-	-	54	54	IRGQ	-	5	5
CARD10	29775	broad.mit.edu	37	22	37890147	37890147	+	Frame_Shift_Del	DEL	C	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37890147delC	uc003asx.1	-	16	2425	c.2422delG	c.(2422-2424)GTGfs	p.V808fs	CARD10_uc003ast.1_RNA|CARD10_uc003asu.1_5'Flank|CARD10_uc003asv.1_5'UTR|CARD10_uc011ank.1_Frame_Shift_Del_p.V126fs|CARD10_uc003asw.1_Frame_Shift_Del_p.V522fs|CARD10_uc003asy.1_Frame_Shift_Del_p.V808fs	NM_014550	NP_055365	Q9BWT7	CAR10_HUMAN	caspase recruitment domain protein 10	808					activation of NF-kappaB-inducing kinase activity|protein complex assembly|regulation of apoptosis	CBM complex	receptor signaling complex scaffold activity			upper_aerodigestive_tract(1)|lung(1)|breast(1)|ovary(1)|prostate(1)|kidney(1)	6	Melanoma(58;0.0574)																	---	---	---	---	capture_indel		Frame_Shift_Del	DEL	37890147	37890147	2763	22	C	-	-	19	19	CARD10	-	5	5
MUC13	56667	broad.mit.edu	37	3	124641091	124641092	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124641091_124641092delTC	uc003ehq.1	-	4	717_718	c.693_694delGA	c.(691-696)GAGAAAfs	p.E231fs		NM_033049	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, epithelial transmembrane	231_232	SEA.|Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane					0																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	124641091	124641092	10365	3	TC	-	-	62	62	MUC13	-	5	5
CWC27	10283	broad.mit.edu	37	5	64082402	64082402	+	Frame_Shift_Del	DEL	A	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64082402delA	uc003jtn.1	+	6	766	c.547delA	c.(547-549)AAAfs	p.K183fs	CWC27_uc003jtl.2_Frame_Shift_Del_p.K183fs|CWC27_uc003jtm.2_Frame_Shift_Del_p.K183fs|CWC27_uc010iwt.1_Frame_Shift_Del_p.K183fs	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10	183					protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	64082402	64082402	4230	5	A	-	-	9	9	CWC27	-	5	5
AUTS2	26053	broad.mit.edu	37	7	70255577	70255579	+	In_Frame_Del	DEL	CCA	-	-	rs35604576		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70255577_70255579delCCA	uc003tvw.3	+	19	4118_4120	c.3375_3377delCCA	c.(3373-3378)AGCCAC>AGC	p.H1133del	AUTS2_uc003tvx.3_In_Frame_Del_p.H1109del|AUTS2_uc011keg.1_In_Frame_Del_p.H585del	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	1133	His-rich.									ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)														---	---	---	---	capture_indel		In_Frame_Del	DEL	70255577	70255579	1246	7	CCA	-	-	26	26	AUTS2	-	5	5
COL22A1	169044	broad.mit.edu	37	8	139890382	139890382	+	Frame_Shift_Del	DEL	A	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139890382delA	uc003yvd.2	-	3	716	c.269delT	c.(268-270)TTCfs	p.F90fs		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	90	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)												HNSCC(7;0.00092)			---	---	---	---	capture_indel		Frame_Shift_Del	DEL	139890382	139890382	3819	8	A	-	-	9	9	COL22A1	-	5	5
ARC	23237	broad.mit.edu	37	8	143694528	143694528	+	Frame_Shift_Del	DEL	G	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143694528delG	uc003ywn.1	-	1	1306	c.1105delC	c.(1105-1107)CACfs	p.H369fs		NM_015193	NP_056008	Q7LC44	ARC_HUMAN	activity-regulated cytoskeleton-associated	369					endocytosis	acrosomal vesicle|cell junction|dendritic spine|endosome|postsynaptic density|postsynaptic membrane				breast(1)	1	all_cancers(97;3.55e-12)|all_epithelial(106;1.03e-08)|Lung NSC(106;0.000353)|all_lung(105;0.00092)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.0279)																---	---	---	---	capture_indel		Frame_Shift_Del	DEL	143694528	143694528	852	8	G	-	-	47	47	ARC	-	5	5
SNAPC4	6621	broad.mit.edu	37	9	139277995	139277997	+	In_Frame_Del	DEL	GCT	-	-	rs35266724		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139277995_139277997delGCT	uc004chh.2	-	15	1633_1635	c.1624_1626delAGC	c.(1624-1626)AGCdel	p.S542del		NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,	542					snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)														---	---	---	---	capture_indel		In_Frame_Del	DEL	139277995	139277997	15337	9	GCT	-	-	38	38	SNAPC4	-	5	5
CYBB	1536	broad.mit.edu	37	X	37663222	37663222	+	Frame_Shift_Del	DEL	A	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37663222delA	uc004ddr.2	+	9	1051	c.990delA	c.(988-990)CCAfs	p.P330fs	CYBB_uc011mke.1_RNA|CYBB_uc011mkf.1_Frame_Shift_Del_p.P298fs|CYBB_uc011mkg.1_Frame_Shift_Del_p.P63fs	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide	330	Cytoplasmic (Potential).|FAD-binding FR-type.				electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	37663222	37663222	4298	23	A	-	-	5	5	CYBB	-	5	5
NXF3	56000	broad.mit.edu	37	X	102334777	102334778	+	Frame_Shift_Del	DEL	AG	-	-			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102334777_102334778delAG	uc004eju.2	-	13	1144_1145	c.1073_1074delCT	c.(1072-1074)TCTfs	p.S358fs	NXF3_uc010noi.1_Frame_Shift_Del_p.S208fs	NM_022052	NP_071335	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	358	NTF2.					cytoplasm|nuclear RNA export factor complex	nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3																		---	---	---	---	capture_indel		Frame_Shift_Del	DEL	102334777	102334778	11190	23	AG	-	-	7	7	NXF3	-	5	5
DFFB	1677	broad.mit.edu	37	1	3800177	3800177	+	Nonsense_Mutation	SNP	G	T	T	rs59649948		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3800177G>T	uc001alc.2	+	7	1212	c.889G>T	c.(889-891)GAG>TAG	p.E297*	DFFB_uc001ale.2_RNA|DFFB_uc009vlp.2_RNA|DFFB_uc001alb.2_RNA|DFFB_uc010nzn.1_Nonsense_Mutation_p.E321*|DFFB_uc009vlq.2_RNA|DFFB_uc009vlr.2_Nonsense_Mutation_p.E248*|DFFB_uc001ald.2_Nonsense_Mutation_p.E233*	NM_004402	NP_004393	O76075	DFFB_HUMAN	DNA fragmentation factor, 40 kD, beta	297					apoptotic chromosome condensation|DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction	cytosol|nucleoplasm	deoxyribonuclease activity|enzyme binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_cancers(23;2.05e-30)|all_epithelial(116;6.22e-21)|all_lung(118;2.65e-08)|Lung NSC(185;6.25e-06)|Breast(487;0.000659)|Renal(390;0.00121)|all_neural(13;0.0019)|Hepatocellular(190;0.00705)|Colorectal(325;0.0113)|all_hematologic(16;0.0194)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0548)|Medulloblastoma(700;0.211)		Epithelial(90;1.18e-39)|OV - Ovarian serous cystadenocarcinoma(86;7.28e-23)|GBM - Glioblastoma multiforme(42;2.95e-17)|Colorectal(212;1.23e-05)|COAD - Colon adenocarcinoma(227;5.94e-05)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00038)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)														---	---	---	---	capture		Nonsense_Mutation	SNP	3800177	3800177	4632	1	G	T	T	33	33	DFFB	T	5	2
ANGPTL7	10218	broad.mit.edu	37	1	11249665	11249665	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11249665C>A	uc001ase.2	+	1	268	c.29C>A	c.(28-30)ACC>AAC	p.T10N	MTOR_uc001asd.2_Intron	NM_021146	NP_066969	O43827	ANGL7_HUMAN	angiopoietin-like 7 precursor	10					response to oxidative stress|signal transduction	extracellular region	receptor binding				0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.000818)|all_lung(284;0.00105)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.39e-06)|COAD - Colon adenocarcinoma(227;0.000244)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0487)														---	---	---	---	capture		Missense_Mutation	SNP	11249665	11249665	622	1	C	A	A	18	18	ANGPTL7	A	2	2
MTHFR	4524	broad.mit.edu	37	1	11861293	11861293	+	Missense_Mutation	SNP	G	A	A	rs45550133		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11861293G>A	uc001atc.1	-	3	584	c.400C>T	c.(400-402)CGC>TGC	p.R134C	MTHFR_uc001atb.1_Missense_Mutation_p.R157C	NM_005957	NP_005948	P42898	MTHR_HUMAN	5,10-methylenetetrahydrofolate reductase	134					blood circulation|folic acid metabolic process	cytosol	methylenetetrahydrofolate reductase (NADPH) activity|protein binding				0	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Benazepril(DB00542)|Cyanocobalamin(DB00115)|Folic Acid(DB00158)|L-Methionine(DB00134)|Menadione(DB00170)|Methotrexate(DB00563)|Pyridoxal Phosphate(DB00114)|Pyridoxine(DB00165)|Raltitrexed(DB00293)|Riboflavin(DB00140)|S-Adenosylmethionine(DB00118)|Tetrahydrofolic acid(DB00116)													---	---	---	---	capture		Missense_Mutation	SNP	11861293	11861293	10324	1	G	A	A	38	38	MTHFR	A	1	1
PHC2	1912	broad.mit.edu	37	1	33790576	33790576	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33790576C>G	uc001bxg.1	-	14	2521	c.2467G>C	c.(2467-2469)GGG>CGG	p.G823R	PHC2_uc001bxh.1_Missense_Mutation_p.G795R|PHC2_uc009vuh.1_Missense_Mutation_p.G824R|PHC2_uc001bxe.1_Missense_Mutation_p.G288R|PHC2_uc001bxf.1_3'UTR	NM_198040	NP_932157	Q8IXK0	PHC2_HUMAN	polyhomeotic-like 2 isoform a	823	SAM.				multicellular organismal development	PcG protein complex	DNA binding|identical protein binding|zinc ion binding			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)																---	---	---	---	capture		Missense_Mutation	SNP	33790576	33790576	12240	1	C	G	G	23	23	PHC2	G	3	3
MACF1	23499	broad.mit.edu	37	1	39797468	39797468	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39797468G>T	uc010oiu.1	+	1	659	c.528G>T	c.(526-528)GGG>GGT	p.G176G	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	1741					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)															---	---	---	---	capture		Silent	SNP	39797468	39797468	9521	1	G	T	T	41	41	MACF1	T	2	2
PTPRF	5792	broad.mit.edu	37	1	44071241	44071241	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44071241G>T	uc001cjr.2	+	19	3771	c.3431G>T	c.(3430-3432)GGG>GTG	p.G1144V	PTPRF_uc001cjs.2_Missense_Mutation_p.G1135V|PTPRF_uc001cju.2_Missense_Mutation_p.G522V|PTPRF_uc009vwt.2_Missense_Mutation_p.G704V|PTPRF_uc001cjv.2_Missense_Mutation_p.G604V|PTPRF_uc001cjw.2_Missense_Mutation_p.G370V	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1144	Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)																---	---	---	---	capture		Missense_Mutation	SNP	44071241	44071241	13258	1	G	T	T	43	43	PTPRF	T	2	2
TAL1	6886	broad.mit.edu	37	1	47685806	47685806	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47685806G>T	uc001cqx.2	-	4	1159	c.582C>A	c.(580-582)AGC>AGA	p.S194R	TAL1_uc009vyq.2_5'UTR|TAL1_uc001cqy.2_Missense_Mutation_p.S194R	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1	194	Basic motif.				basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1								T	TRD@|SIL	lymphoblastic leukemia/biphasic								---	---	---	---	capture		Missense_Mutation	SNP	47685806	47685806	16062	1	G	T	T	42	42	TAL1	T	2	2
EPS8L3	79574	broad.mit.edu	37	1	110302413	110302413	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110302413C>A	uc001dyr.1	-	4	287	c.142G>T	c.(142-144)GAG>TAG	p.E48*	EPS8L3_uc001dys.1_Nonsense_Mutation_p.E48*|EPS8L3_uc001dyq.1_Nonsense_Mutation_p.E48*|EPS8L3_uc009wfm.1_Nonsense_Mutation_p.E14*|EPS8L3_uc009wfn.1_Nonsense_Mutation_p.E14*|EPS8L3_uc009wfo.1_Intron	NM_133181	NP_573444	Q8TE67	ES8L3_HUMAN	epidermal growth factor receptor pathway	48						cytoplasm	protein binding			ovary(2)|skin(1)	3		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Lung(183;0.0245)|Colorectal(144;0.0365)|all cancers(265;0.103)|Epithelial(280;0.109)|LUSC - Lung squamous cell carcinoma(189;0.137)|COAD - Colon adenocarcinoma(174;0.141)														---	---	---	---	capture		Nonsense_Mutation	SNP	110302413	110302413	5390	1	C	A	A	31	31	EPS8L3	A	5	1
OVGP1	5016	broad.mit.edu	37	1	111963989	111963989	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111963989T>A	uc001eba.2	-	8	868	c.812A>T	c.(811-813)AAA>ATA	p.K271I	OVGP1_uc001eaz.2_Missense_Mutation_p.K233I|OVGP1_uc010owb.1_Intron	NM_002557	NP_002548	Q12889	OVGP1_HUMAN	oviductal glycoprotein 1 precursor	271					chitin catabolic process|female pregnancy|single fertilization	transport vesicle	cation binding|chitinase activity	p.K271fs*4(1)		ovary(4)|large_intestine(1)	5		all_cancers(81;8.18e-06)|all_epithelial(167;5.64e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000302)		Lung(183;0.0253)|Colorectal(144;0.033)|all cancers(265;0.0552)|Epithelial(280;0.0802)|COAD - Colon adenocarcinoma(174;0.123)|LUSC - Lung squamous cell carcinoma(189;0.14)														---	---	---	---	capture		Missense_Mutation	SNP	111963989	111963989	11738	1	T	A	A	64	64	OVGP1	A	4	4
SYCP1	6847	broad.mit.edu	37	1	115524061	115524061	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115524061T>A	uc001efr.2	+	29	2696	c.2487T>A	c.(2485-2487)CAT>CAA	p.H829Q	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.H829Q|SYCP1_uc009wgw.2_Missense_Mutation_p.H804Q	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	829					cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)														---	---	---	---	capture		Missense_Mutation	SNP	115524061	115524061	15952	1	T	A	A	51	51	SYCP1	A	4	4
ITGA10	8515	broad.mit.edu	37	1	145534248	145534248	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145534248C>A	uc001eoa.2	+	14	1829	c.1753C>A	c.(1753-1755)CAT>AAT	p.H585N	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.H454N|ITGA10_uc009wiw.2_Missense_Mutation_p.H442N|ITGA10_uc010oyw.1_Missense_Mutation_p.H530N	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	585	Extracellular (Potential).|FG-GAP 6.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)																	---	---	---	---	capture		Missense_Mutation	SNP	145534248	145534248	8177	1	C	A	A	21	21	ITGA10	A	2	2
ITGA10	8515	broad.mit.edu	37	1	145534257	145534257	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145534257C>A	uc001eoa.2	+	14	1838	c.1762C>A	c.(1762-1764)CAG>AAG	p.Q588K	NBPF10_uc001emp.3_Intron|ITGA10_uc010oyv.1_Missense_Mutation_p.Q457K|ITGA10_uc009wiw.2_Missense_Mutation_p.Q445K|ITGA10_uc010oyw.1_Missense_Mutation_p.Q533K	NM_003637	NP_003628	O75578	ITA10_HUMAN	integrin, alpha 10 precursor	588	Extracellular (Potential).|FG-GAP 6.				cell-matrix adhesion|integrin-mediated signaling pathway	integrin complex	collagen binding|receptor activity			lung(2)|ovary(2)|kidney(2)|large_intestine(1)|skin(1)	8	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)																	---	---	---	---	capture		Missense_Mutation	SNP	145534257	145534257	8177	1	C	A	A	21	21	ITGA10	A	2	2
CD160	11126	broad.mit.edu	37	1	145706688	145706688	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145706688C>G	uc001eol.1	-	3	289	c.71G>C	c.(70-72)GGT>GCT	p.G24A	NBPF10_uc001emp.3_Intron|CD160_uc001eom.1_Missense_Mutation_p.G24A|CD160_uc010oyz.1_RNA	NM_007053	NP_008984	O95971	BY55_HUMAN	CD160 antigen precursor	24					cell proliferation|cell surface receptor linked signaling pathway|cellular defense response|regulation of immune response	anchored to plasma membrane	MHC class I receptor activity|receptor binding				0	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)															---	---	---	---	capture		Missense_Mutation	SNP	145706688	145706688	3093	1	C	G	G	18	18	CD160	G	3	3
PLEKHO1	51177	broad.mit.edu	37	1	150131357	150131357	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150131357G>T	uc001ett.2	+	6	1147	c.869G>T	c.(868-870)CGG>CTG	p.R290L	PLEKHO1_uc001etr.2_Missense_Mutation_p.R118L|PLEKHO1_uc001ets.2_Missense_Mutation_p.R107L|PLEKHO1_uc001etu.2_Missense_Mutation_p.R118L	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O	290	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)															---	---	---	---	capture		Missense_Mutation	SNP	150131357	150131357	12510	1	G	T	T	39	39	PLEKHO1	T	1	1
TCHHL1	126637	broad.mit.edu	37	1	152059147	152059147	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152059147T>C	uc001ezo.1	-	3	1076	c.1011A>G	c.(1009-1011)GGA>GGG	p.G337G		NM_001008536	NP_001008536	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	337							calcium ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)															---	---	---	---	capture		Silent	SNP	152059147	152059147	16227	1	T	C	C	62	62	TCHHL1	C	4	4
FLG2	388698	broad.mit.edu	37	1	152325410	152325410	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152325410C>A	uc001ezw.3	-	3	4925	c.4852G>T	c.(4852-4854)GGA>TGA	p.G1618*	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	1618	Filaggrin 6.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)															---	---	---	---	capture		Nonsense_Mutation	SNP	152325410	152325410	6161	1	C	A	A	23	23	FLG2	A	5	1
IQGAP3	128239	broad.mit.edu	37	1	156518177	156518177	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156518177G>T	uc001fpf.2	-	18	2171	c.2096C>A	c.(2095-2097)CCC>CAC	p.P699H		NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	699					small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)																	---	---	---	---	capture		Missense_Mutation	SNP	156518177	156518177	8119	1	G	T	T	43	43	IQGAP3	T	2	2
FCRL4	83417	broad.mit.edu	37	1	157548310	157548310	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157548310C>T	uc001fqw.2	-	10	1519	c.1383G>A	c.(1381-1383)TTG>TTA	p.L461L	FCRL4_uc010phy.1_RNA	NM_031282	NP_112572	Q96PJ5	FCRL4_HUMAN	Fc receptor-like 4 precursor	461	Cytoplasmic (Potential).|ITIM motif 2.					integral to membrane|plasma membrane	receptor activity			ovary(2)|kidney(1)|skin(1)	4	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.245)																---	---	---	---	capture		Silent	SNP	157548310	157548310	6034	1	C	T	T	21	21	FCRL4	T	2	2
OR10J1	26476	broad.mit.edu	37	1	159409849	159409849	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159409849C>T	uc010piv.1	+	1	301	c.301C>T	c.(301-303)CAG>TAG	p.Q101*	uc001fts.3_Intron	NM_012351	NP_036483	P30954	O10J1_HUMAN	olfactory receptor, family 10, subfamily J,	101	Extracellular (Potential).				sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0429)																	---	---	---	---	capture		Nonsense_Mutation	SNP	159409849	159409849	11316	1	C	T	T	21	21	OR10J1	T	5	2
KCNJ10	3766	broad.mit.edu	37	1	160012156	160012156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160012156C>T	uc001fuw.1	-	2	317	c.167G>A	c.(166-168)TGG>TAG	p.W56*		NM_002241	NP_002232	P78508	IRK10_HUMAN	potassium inwardly-rectifying channel, subfamily	56	Cytoplasmic (By similarity).					integral to plasma membrane	ATP binding|ATP-activated inward rectifier potassium channel activity			ovary(1)	1	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)															---	---	---	---	capture		Nonsense_Mutation	SNP	160012156	160012156	8349	1	C	T	T	21	21	KCNJ10	T	5	2
B4GALT3	8703	broad.mit.edu	37	1	161143746	161143746	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161143746C>T	uc001fyq.1	-	5	845	c.583G>A	c.(583-585)GAT>AAT	p.D195N	PPOX_uc010pkh.1_Intron|PPOX_uc001fyi.2_Intron|B4GALT3_uc001fyo.1_5'UTR|B4GALT3_uc001fyp.1_RNA|B4GALT3_uc001fyr.1_Missense_Mutation_p.D195N|B4GALT3_uc001fys.1_Missense_Mutation_p.D195N|B4GALT3_uc009wud.1_Missense_Mutation_p.D195N	NM_003779	NP_003770	O60512	B4GT3_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	195	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity|metal ion binding|N-acetyllactosamine synthase activity				0	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		N-Acetyl-D-glucosamine(DB00141)													---	---	---	---	capture		Missense_Mutation	SNP	161143746	161143746	1293	1	C	T	T	31	31	B4GALT3	T	1	1
TADA1	117143	broad.mit.edu	37	1	166829516	166829516	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:166829516C>T	uc001gdw.2	-	6	783	c.599G>A	c.(598-600)CGA>CAA	p.R200Q	TADA1_uc001gdv.2_Missense_Mutation_p.R58Q	NM_053053	NP_444281	Q96BN2	TADA1_HUMAN	transcriptional adaptor 1-like	200					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	166829516	166829516	16030	1	C	T	T	31	31	TADA1	T	1	1
SLC19A2	10560	broad.mit.edu	37	1	169439384	169439384	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169439384C>A	uc001gge.3	-	3	1052	c.848G>T	c.(847-849)TGG>TTG	p.W283L	SLC19A2_uc001ggf.3_Missense_Mutation_p.W82L	NM_006996	NP_008927	O60779	S19A2_HUMAN	solute carrier family 19, member 2	283	Cytoplasmic (Potential).				thiamine-containing compound metabolic process	integral to membrane|plasma membrane	folic acid binding|folic acid transporter activity|reduced folate carrier activity|thiamine uptake transmembrane transporter activity				0	all_hematologic(923;0.208)																	---	---	---	---	capture		Missense_Mutation	SNP	169439384	169439384	14925	1	C	A	A	21	21	SLC19A2	A	2	2
SCYL3	57147	broad.mit.edu	37	1	169823643	169823643	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169823643G>C	uc001ggs.2	-	13	2135	c.1937C>G	c.(1936-1938)CCC>CGC	p.P646R	SCYL3_uc010plw.1_Missense_Mutation_p.P238R|SCYL3_uc001ggt.2_Missense_Mutation_p.P592R|SCYL3_uc001ggu.2_RNA	NM_181093	NP_851607	Q8IZE3	PACE1_HUMAN	SCY1-like 3 isoform 2	646	Interaction with EZR.				cell migration	Golgi apparatus|lamellipodium	ATP binding|protein binding|protein kinase activity			ovary(1)|skin(1)	2	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)																	---	---	---	---	capture		Missense_Mutation	SNP	169823643	169823643	14434	1	G	C	C	43	43	SCYL3	C	3	3
BAT2L2	23215	broad.mit.edu	37	1	171510347	171510347	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171510347A>T	uc010pmg.1	+	16	4002	c.3736A>T	c.(3736-3738)AGT>TGT	p.S1246C	BAT2L2_uc010pmh.1_Missense_Mutation_p.S223C	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1246							protein C-terminus binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	171510347	171510347	1342	1	A	T	T	11	11	BAT2L2	T	4	4
BAT2L2	23215	broad.mit.edu	37	1	171511306	171511306	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171511306G>T	uc010pmg.1	+	16	4961	c.4695G>T	c.(4693-4695)AGG>AGT	p.R1565S	BAT2L2_uc010pmh.1_Missense_Mutation_p.R542S	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1565							protein C-terminus binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	171511306	171511306	1342	1	G	T	T	41	41	BAT2L2	T	2	2
PAPPA2	60676	broad.mit.edu	37	1	176564385	176564385	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564385C>A	uc001gkz.2	+	3	2809	c.1645C>A	c.(1645-1647)CTG>ATG	p.L549M	PAPPA2_uc001gky.1_Missense_Mutation_p.L549M|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	549	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---	capture		Missense_Mutation	SNP	176564385	176564385	11850	1	C	A	A	32	32	PAPPA2	A	2	2
PAPPA2	60676	broad.mit.edu	37	1	176564722	176564722	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564722C>A	uc001gkz.2	+	3	3146	c.1982C>A	c.(1981-1983)TCA>TAA	p.S661*	PAPPA2_uc001gky.1_Nonsense_Mutation_p.S661*|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	661	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---	capture		Nonsense_Mutation	SNP	176564722	176564722	11850	1	C	A	A	29	29	PAPPA2	A	5	2
PAPPA2	60676	broad.mit.edu	37	1	176769217	176769217	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176769217G>A	uc001gkz.2	+	21	6315	c.5151G>A	c.(5149-5151)CGG>CGA	p.R1717R	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1717	Sushi 5.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16																		---	---	---	---	capture		Silent	SNP	176769217	176769217	11850	1	G	A	A	42	42	PAPPA2	A	2	2
PRG4	10216	broad.mit.edu	37	1	186277488	186277488	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186277488G>A	uc001gru.3	+	7	2688	c.2637G>A	c.(2635-2637)GAG>GAA	p.E879E	PRG4_uc001grt.3_Silent_p.E838E|PRG4_uc009wyl.2_Silent_p.E786E|PRG4_uc009wym.2_Silent_p.E745E|PRG4_uc010poo.1_RNA	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	879					cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1																		---	---	---	---	capture		Silent	SNP	186277488	186277488	12924	1	G	A	A	34	34	PRG4	A	2	2
CFHR4	10877	broad.mit.edu	37	1	196881962	196881962	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196881962T>A	uc001gto.2	+	3	418	c.349T>A	c.(349-351)TGT>AGT	p.C117S	CFHR4_uc009wyy.2_Missense_Mutation_p.C363S|CFHR4_uc001gtp.2_Missense_Mutation_p.C364S	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	117	Sushi 2.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	196881962	196881962	3420	1	T	A	A	51	51	CFHR4	A	4	4
FAM58B	339521	broad.mit.edu	37	1	200183331	200183331	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200183331G>T	uc009wzi.1	+	1	676	c.640G>T	c.(640-642)GAG>TAG	p.E214*		NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN	family with sequence similarity 58 member B	214					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	Prostate(682;0.19)																	---	---	---	---	capture		Nonsense_Mutation	SNP	200183331	200183331	5813	1	G	T	T	37	37	FAM58B	T	5	1
CNTN2	6900	broad.mit.edu	37	1	205034927	205034927	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:205034927T>A	uc001hbr.2	+	14	1975	c.1706T>A	c.(1705-1707)ATT>AAT	p.I569N	CNTN2_uc001hbq.1_Missense_Mutation_p.I460N|CNTN2_uc001hbs.2_Missense_Mutation_p.I357N	NM_005076	NP_005067	Q02246	CNTN2_HUMAN	contactin 2 precursor	569	Ig-like C2-type 6.				axon guidance|clustering of voltage-gated potassium channels	anchored to membrane|juxtaparanode region of axon|myelin sheath|node of Ranvier|synapse part	identical protein binding			ovary(1)	1	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)															---	---	---	---	capture		Missense_Mutation	SNP	205034927	205034927	3779	1	T	A	A	52	52	CNTN2	A	4	4
IL20	50604	broad.mit.edu	37	1	207039881	207039881	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207039881G>T	uc001her.2	+	3	322	c.278G>T	c.(277-279)AGG>ATG	p.R93M	IL20_uc010pry.1_Missense_Mutation_p.R164M|IL20_uc009xby.2_Missense_Mutation_p.R93M	NM_018724	NP_061194	Q9NYY1	IL20_HUMAN	interleukin 20 precursor	93					positive regulation of keratinocyte differentiation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of inflammatory response	extracellular space	cytokine activity|interleukin-20 receptor binding				0	Breast(84;0.201)			OV - Ovarian serous cystadenocarcinoma(81;0.00459)														---	---	---	---	capture		Missense_Mutation	SNP	207039881	207039881	7968	1	G	T	T	35	35	IL20	T	2	2
PFKFB2	5208	broad.mit.edu	37	1	207241006	207241006	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207241006G>T	uc001hfg.2	+	9	904	c.795G>T	c.(793-795)TTG>TTT	p.L265F	PFKFB2_uc010psc.1_Missense_Mutation_p.L167F|PFKFB2_uc001hfh.2_Missense_Mutation_p.L265F|PFKFB2_uc009xcc.2_Missense_Mutation_p.L223F|PFKFB2_uc010psd.1_Missense_Mutation_p.L79F	NM_006212	NP_006203	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,	265	Fructose-2,6-bisphosphatase.				fructose 2,6-bisphosphate metabolic process|glycolysis	cytosol	6-phosphofructo-2-kinase activity|ATP binding|fructose-2,6-bisphosphate 2-phosphatase activity			ovary(1)	1	Prostate(682;0.19)																	---	---	---	---	capture		Missense_Mutation	SNP	207241006	207241006	12183	1	G	T	T	47	47	PFKFB2	T	2	2
CR2	1380	broad.mit.edu	37	1	207639950	207639950	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207639950G>A	uc001hfw.2	+	2	232	c.138G>A	c.(136-138)GTG>GTA	p.V46V	CR2_uc001hfv.2_Silent_p.V46V|CR2_uc009xch.2_Silent_p.V46V	NM_001877	NP_001868	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	46	Sushi 1.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(3)|skin(3)|urinary_tract(1)|ovary(1)	8																		---	---	---	---	capture		Silent	SNP	207639950	207639950	3981	1	G	A	A	45	45	CR2	A	2	2
CR1L	1379	broad.mit.edu	37	1	207867834	207867834	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207867834G>T	uc001hga.3	+	5	721	c.600G>T	c.(598-600)GTG>GTT	p.V200V	CR1L_uc001hfz.2_RNA|CR1L_uc001hgb.1_RNA	NM_175710	NP_783641	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	200	Sushi 3.					cytoplasm|extracellular region|membrane					0																		---	---	---	---	capture		Silent	SNP	207867834	207867834	3980	1	G	T	T	47	47	CR1L	T	2	2
EPRS	2058	broad.mit.edu	37	1	220153567	220153567	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220153567C>G	uc001hly.1	-	26	3841	c.3571G>C	c.(3571-3573)GAC>CAC	p.D1191H		NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	1191	Prolyl-tRNA synthetase.				glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)													---	---	---	---	capture		Missense_Mutation	SNP	220153567	220153567	5384	1	C	G	G	29	29	EPRS	G	3	3
HHIPL2	79802	broad.mit.edu	37	1	222717398	222717398	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222717398G>A	uc001hnh.1	-	2	513	c.455C>T	c.(454-456)ACC>ATC	p.T152I		NM_024746	NP_079022	Q6UWX4	HIPL2_HUMAN	HHIP-like 2 precursor	152					carbohydrate metabolic process	extracellular region	oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor|quinone binding			ovary(1)	1				GBM - Glioblastoma multiforme(131;0.0185)														---	---	---	---	capture		Missense_Mutation	SNP	222717398	222717398	7378	1	G	A	A	44	44	HHIPL2	A	2	2
MIA3	375056	broad.mit.edu	37	1	222835648	222835648	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222835648C>A	uc001hnl.2	+	26	5245	c.5236C>A	c.(5236-5238)CCT>ACT	p.P1746T	MIA3_uc001hnm.2_Missense_Mutation_p.P624T	NM_198551	NP_940953	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	1746	Pro-rich.|Cytoplasmic (Potential).				exocytosis|negative regulation of cell adhesion|negative regulation of cell migration|positive regulation of leukocyte migration|protein transport|wound healing	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(4)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(131;0.0199)														---	---	---	---	capture		Missense_Mutation	SNP	222835648	222835648	9955	1	C	A	A	22	22	MIA3	A	2	2
KIAA1383	54627	broad.mit.edu	37	1	232941899	232941899	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232941899G>T	uc001hvh.2	+	1	1262	c.1130G>T	c.(1129-1131)GGG>GTG	p.G377V		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	235										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)																---	---	---	---	capture		Missense_Mutation	SNP	232941899	232941899	8537	1	G	T	T	43	43	KIAA1383	T	2	2
VN1R5	317705	broad.mit.edu	37	1	247420126	247420126	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247420126T>A	uc010pyu.1	+	2	753	c.753T>A	c.(751-753)AGT>AGA	p.S251R		NM_173858	NP_776257	Q7Z5H4	VN1R5_HUMAN	vomeronasal 1 receptor 5	251	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity				0	all_cancers(71;5.7e-05)|all_epithelial(71;1.03e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)	all_cancers(173;0.0314)	OV - Ovarian serous cystadenocarcinoma(106;0.00854)															---	---	---	---	capture		Missense_Mutation	SNP	247420126	247420126	17748	1	T	A	A	59	59	VN1R5	A	4	4
OR2L3	391192	broad.mit.edu	37	1	248224841	248224841	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248224841C>A	uc001idx.1	+	1	858	c.858C>A	c.(856-858)CCC>CCA	p.P286P	OR2L13_uc001ids.2_Intron	NM_001004687	NP_001004687	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L,	286	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)															---	---	---	---	capture		Silent	SNP	248224841	248224841	11414	1	C	A	A	21	21	OR2L3	A	2	2
OR2T33	391195	broad.mit.edu	37	1	248436684	248436684	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248436684A>G	uc010pzi.1	-	1	433	c.433T>C	c.(433-435)TCG>CCG	p.S145P		NM_001004695	NP_001004695	Q8NG76	O2T33_HUMAN	olfactory receptor, family 2, subfamily T,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)															---	---	---	---	capture		Missense_Mutation	SNP	248436684	248436684	11430	1	A	G	G	10	10	OR2T33	G	4	4
OR14C36	127066	broad.mit.edu	37	1	248512734	248512734	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248512734T>A	uc010pzl.1	+	1	658	c.658T>A	c.(658-660)TTT>ATT	p.F220I		NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	248512734	248512734	11352	1	T	A	A	56	56	OR14C36	A	4	4
OR14I1	401994	broad.mit.edu	37	1	248845378	248845378	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248845378C>A	uc001ieu.1	-	1	228	c.228G>T	c.(226-228)GTG>GTT	p.V76V		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	76	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---	capture		Silent	SNP	248845378	248845378	11353	1	C	A	A	25	25	OR14I1	A	2	2
C10orf18	54906	broad.mit.edu	37	10	5799560	5799560	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5799560T>C	uc001iij.2	+	17	7435	c.6810T>C	c.(6808-6810)GAT>GAC	p.D2270D	C10orf18_uc001iik.2_Silent_p.D1114D	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	2270										ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Silent	SNP	5799560	5799560	1633	10	T	C	C	50	50	C10orf18	C	4	4
FAM107B	83641	broad.mit.edu	37	10	14816280	14816280	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14816280G>T	uc001ina.1	-	1	617	c.383C>A	c.(382-384)CCC>CAC	p.P128H	FAM107B_uc010qbu.1_RNA	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641	Error:Variant_position_missing_in_Q9H098_after_alignment										breast(4)	4																		---	---	---	---	capture		Missense_Mutation	SNP	14816280	14816280	5587	10	G	T	T	43	43	FAM107B	T	2	2
CUBN	8029	broad.mit.edu	37	10	17156039	17156039	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17156039C>A	uc001ioo.2	-	8	922	c.870G>T	c.(868-870)GGG>GGT	p.G290G		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	290	EGF-like 3; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)													---	---	---	---	capture		Silent	SNP	17156039	17156039	4211	10	C	A	A	22	22	CUBN	A	2	2
GPR158	57512	broad.mit.edu	37	10	25877957	25877957	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25877957G>T	uc001isj.2	+	8	1835	c.1775G>T	c.(1774-1776)TGG>TTG	p.W592L		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	592	Helical; Name=5; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8																		---	---	---	---	capture		Missense_Mutation	SNP	25877957	25877957	6938	10	G	T	T	47	47	GPR158	T	2	2
SVIL	6840	broad.mit.edu	37	10	29759236	29759236	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29759236C>A	uc001iut.1	-	32	6565	c.5812G>T	c.(5812-5814)GGA>TGA	p.G1938*	LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron|SVIL_uc010qdw.1_Nonsense_Mutation_p.G852*|SVIL_uc001iuu.1_Nonsense_Mutation_p.G1512*	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1938	Gelsolin-like 4.				cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)|upper_aerodigestive_tract(1)	6		Breast(68;0.103)																---	---	---	---	capture		Nonsense_Mutation	SNP	29759236	29759236	15941	10	C	A	A	23	23	SVIL	A	5	1
ZEB1	6935	broad.mit.edu	37	10	31810412	31810412	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31810412C>A	uc001ivs.3	+	7	2212	c.2149C>A	c.(2149-2151)CAG>AAG	p.Q717K	ZEB1_uc001ivr.3_Missense_Mutation_p.Q499K|ZEB1_uc010qee.1_Missense_Mutation_p.Q499K|ZEB1_uc010qef.1_Missense_Mutation_p.Q499K|ZEB1_uc009xlj.1_Missense_Mutation_p.Q643K|ZEB1_uc010qeg.1_Missense_Mutation_p.Q576K|ZEB1_uc009xlk.1_Missense_Mutation_p.Q499K|ZEB1_uc001ivt.3_Missense_Mutation_p.Q499K|ZEB1_uc001ivu.3_Missense_Mutation_p.Q718K|ZEB1_uc001ivv.3_Missense_Mutation_p.Q697K|ZEB1_uc010qeh.1_Missense_Mutation_p.Q650K|ZEB1_uc009xlo.1_Missense_Mutation_p.Q700K|ZEB1_uc009xlp.2_Missense_Mutation_p.Q701K	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	717					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)																---	---	---	---	capture		Missense_Mutation	SNP	31810412	31810412	18211	10	C	A	A	17	17	ZEB1	A	2	2
ZNF33A	7581	broad.mit.edu	37	10	38345348	38345348	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38345348G>C	uc001izh.2	+	5	2471	c.2293G>C	c.(2293-2295)GTA>CTA	p.V765L	ZNF33A_uc001izg.2_Missense_Mutation_p.V766L|ZNF33A_uc010qev.1_Missense_Mutation_p.V772L|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	765	C2H2-type 16.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	38345348	38345348	18446	10	G	C	C	48	48	ZNF33A	C	3	3
FRMPD2	143162	broad.mit.edu	37	10	49392662	49392662	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49392662C>G	uc001jgi.2	-	20	2638	c.2531G>C	c.(2530-2532)AGG>ACG	p.R844T	FRMPD2_uc001jgh.2_Missense_Mutation_p.R812T|FRMPD2_uc001jgj.2_Missense_Mutation_p.R822T	NM_001018071	NP_001018081	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2 isoform 3	844	PDZ 1.				tight junction assembly	basolateral plasma membrane|cytoplasm|cytoskeleton|tight junction	1-phosphatidylinositol binding|protein binding			large_intestine(1)	1				Kidney(211;0.201)														---	---	---	---	capture		Missense_Mutation	SNP	49392662	49392662	6308	10	C	G	G	24	24	FRMPD2	G	3	3
HK1	3098	broad.mit.edu	37	10	71158377	71158377	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71158377G>T	uc001jpl.3	+	17	2503	c.2402G>T	c.(2401-2403)CGG>CTG	p.R801L	HK1_uc001jpg.3_Missense_Mutation_p.R789L|HK1_uc001jph.3_Missense_Mutation_p.R805L|HK1_uc001jpi.3_Missense_Mutation_p.R805L|HK1_uc001jpj.3_Missense_Mutation_p.R836L|HK1_uc001jpk.3_Missense_Mutation_p.R800L	NM_000188	NP_000179	P19367	HXK1_HUMAN	hexokinase 1 isoform HKI	801	Catalytic.				glucose transport|glycolysis|transmembrane transport	cytosol|mitochondrial outer membrane|nucleus	ATP binding|glucokinase activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	71158377	71158377	7481	10	G	T	T	39	39	HK1	T	1	1
SAMD8	142891	broad.mit.edu	37	10	76910349	76910349	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76910349G>A	uc001jwx.1	+	2	166	c.63G>A	c.(61-63)CTG>CTA	p.L21L	SAMD8_uc001jwy.1_Silent_p.L21L	NM_144660	NP_653261	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	21	SAM.				sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)																	---	---	---	---	capture		Silent	SNP	76910349	76910349	14305	10	G	A	A	45	45	SAMD8	A	2	2
TBC1D12	23232	broad.mit.edu	37	10	96291033	96291033	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96291033G>T	uc001kjr.2	+	12	2260	c.2075G>T	c.(2074-2076)GGG>GTG	p.G692V		NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12	692	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)																---	---	---	---	capture		Missense_Mutation	SNP	96291033	96291033	16123	10	G	T	T	43	43	TBC1D12	T	2	2
C10orf12	26148	broad.mit.edu	37	10	98744221	98744221	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98744221C>A	uc001kmv.2	+	1	3181	c.3074C>A	c.(3073-3075)CCA>CAA	p.P1025Q		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	1025										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)														---	---	---	---	capture		Missense_Mutation	SNP	98744221	98744221	1624	10	C	A	A	21	21	C10orf12	A	2	2
GBF1	8729	broad.mit.edu	37	10	104135269	104135269	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104135269G>C	uc001kux.1	+	30	4051	c.3811G>C	c.(3811-3813)GAG>CAG	p.E1271Q	GBF1_uc001kuy.1_Missense_Mutation_p.E1271Q|GBF1_uc001kuz.1_Missense_Mutation_p.E1272Q	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1271					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)														---	---	---	---	capture		Missense_Mutation	SNP	104135269	104135269	6537	10	G	C	C	41	41	GBF1	C	3	3
SORCS3	22986	broad.mit.edu	37	10	106907389	106907389	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106907389C>T	uc001kyi.1	+	9	1544	c.1317C>T	c.(1315-1317)ATC>ATT	p.I439I		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	439	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)														---	---	---	---	capture		Silent	SNP	106907389	106907389	15432	10	C	T	T	29	29	SORCS3	T	2	2
ABLIM1	3983	broad.mit.edu	37	10	116232760	116232760	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116232760T>C	uc010qsg.1	-	10	1350	c.1251A>G	c.(1249-1251)AAA>AAG	p.K417K	ABLIM1_uc010qsh.1_Silent_p.K385K|ABLIM1_uc010qsi.1_Silent_p.K357K|ABLIM1_uc010qsk.1_Silent_p.K341K|ABLIM1_uc009xyp.2_Silent_p.K379K|ABLIM1_uc010qsf.1_Silent_p.K129K|ABLIM1_uc009xyn.2_Silent_p.K68K|ABLIM1_uc010qsj.1_Silent_p.K94K|ABLIM1_uc009xyo.2_Silent_p.K265K	NM_002313	NP_002304	O14639	ABLM1_HUMAN	actin-binding LIM protein 1 isoform a	417					axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)														---	---	---	---	capture		Silent	SNP	116232760	116232760	95	10	T	C	C	60	60	ABLIM1	C	4	4
TACC2	10579	broad.mit.edu	37	10	123842841	123842841	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123842841C>A	uc001lfv.2	+	4	1186	c.826C>A	c.(826-828)CCG>ACG	p.P276T	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Missense_Mutation_p.P276T|TACC2_uc010qtv.1_Missense_Mutation_p.P276T	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	276						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)																---	---	---	---	capture		Missense_Mutation	SNP	123842841	123842841	16023	10	C	A	A	22	22	TACC2	A	2	2
MKI67	4288	broad.mit.edu	37	10	129913759	129913759	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129913759C>G	uc001lke.2	-	7	1108	c.913G>C	c.(913-915)GAG>CAG	p.E305Q	MKI67_uc001lkf.2_Intron|MKI67_uc009yav.1_Intron|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	305					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)																---	---	---	---	capture		Missense_Mutation	SNP	129913759	129913759	9988	10	C	G	G	32	32	MKI67	G	3	3
TCERG1L	256536	broad.mit.edu	37	10	133106547	133106547	+	Silent	SNP	A	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133106547A>C	uc001lkp.2	-	3	683	c.597T>G	c.(595-597)GCT>GCG	p.A199A		NM_174937	NP_777597	Q5VWI1	TCRGL_HUMAN	transcription elongation regulator 1-like	199										large_intestine(2)|ovary(2)	4		all_cancers(35;1.22e-10)|all_epithelial(44;2.65e-09)|Lung NSC(174;0.00188)|all_lung(145;0.00307)|Melanoma(40;0.0179)|all_neural(114;0.0424)|Breast(234;0.0743)|Colorectal(57;0.09)		all cancers(32;0.000899)|OV - Ovarian serous cystadenocarcinoma(35;0.0021)|Epithelial(32;0.00276)														---	---	---	---	capture		Silent	SNP	133106547	133106547	16212	10	A	C	C	7	7	TCERG1L	C	4	4
MUC6	4588	broad.mit.edu	37	11	1020215	1020215	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1020215G>T	uc001lsw.2	-	29	3734	c.3683C>A	c.(3682-3684)ACC>AAC	p.T1228N		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1228					maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)														---	---	---	---	capture		Missense_Mutation	SNP	1020215	1020215	10374	11	G	T	T	44	44	MUC6	T	2	2
OR51M1	390059	broad.mit.edu	37	11	5411036	5411036	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5411036G>T	uc010qzc.1	+	1	408	c.408G>T	c.(406-408)GTG>GTT	p.V136V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001004756	NP_001004756	B2RNI9	B2RNI9_HUMAN	olfactory receptor, family 51, subfamily M,	136						integral to membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.98e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Silent	SNP	5411036	5411036	11513	11	G	T	T	47	47	OR51M1	T	2	2
OR52H1	390067	broad.mit.edu	37	11	5566079	5566079	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5566079G>T	uc010qzh.1	-	1	675	c.675C>A	c.(673-675)TCC>TCA	p.S225S	HBG2_uc001mak.1_Intron	NM_001005289	NP_001005289	Q8NGJ2	O52H1_HUMAN	olfactory receptor, family 52, subfamily H,	225	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;5.33e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)														---	---	---	---	capture		Silent	SNP	5566079	5566079	11529	11	G	T	T	35	35	OR52H1	T	2	2
SBF2	81846	broad.mit.edu	37	11	9834103	9834103	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9834103C>A	uc001mib.2	-	30	4269	c.4131G>T	c.(4129-4131)CTG>CTT	p.L1377L	SBF2_uc001mid.2_Silent_p.L21L	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	1377	Myotubularin phosphatase.				myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)														---	---	---	---	capture		Silent	SNP	9834103	9834103	14340	11	C	A	A	21	21	SBF2	A	2	2
FAR1	84188	broad.mit.edu	37	11	13729455	13729455	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13729455T>C	uc001mld.2	+	4	529	c.374T>C	c.(373-375)GTT>GCT	p.V125A	FAR1_uc009ygp.2_Missense_Mutation_p.V125A	NM_032228	NP_115604	Q8WVX9	FACR1_HUMAN	fatty acyl CoA reductase 1	125					ether lipid biosynthetic process	integral to membrane|peroxisomal matrix|peroxisomal membrane	protein binding			ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	13729455	13729455	5910	11	T	C	C	60	60	FAR1	C	4	4
SPON1	10418	broad.mit.edu	37	11	14280884	14280884	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14280884C>A	uc001mle.2	+	13	2089	c.1551C>A	c.(1549-1551)TGC>TGA	p.C517*		NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein	517	TSP type-1 2.				cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)														---	---	---	---	capture		Nonsense_Mutation	SNP	14280884	14280884	15595	11	C	A	A	27	27	SPON1	A	5	1
ANO3	63982	broad.mit.edu	37	11	26620410	26620410	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26620410A>T	uc001mqt.3	+	16	1681	c.1536A>T	c.(1534-1536)ACA>ACT	p.T512T	ANO3_uc010rdr.1_Silent_p.T496T|ANO3_uc010rds.1_Silent_p.T351T|ANO3_uc010rdt.1_Silent_p.T366T	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	512	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4																		---	---	---	---	capture		Silent	SNP	26620410	26620410	706	11	A	T	T	6	6	ANO3	T	4	4
OR4C6	219432	broad.mit.edu	37	11	55433025	55433025	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433025T>A	uc001nht.3	+	3	648	c.383T>A	c.(382-384)CTG>CAG	p.L128Q	OR4C6_uc010rik.1_Missense_Mutation_p.L128Q	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	128	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	55433025	55433025	11459	11	T	A	A	55	55	OR4C6	A	4	4
TMEM132A	54972	broad.mit.edu	37	11	60704035	60704035	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60704035G>C	uc001nqj.2	+	11	2921	c.2728G>C	c.(2728-2730)GAC>CAC	p.D910H	TMEM132A_uc001nqi.2_Missense_Mutation_p.D911H|TMEM132A_uc001nqm.2_Missense_Mutation_p.D120H	NM_178031	NP_821174	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform b	910	Binds to HSPA5/GRP78 (By similarity).|Cytoplasmic (Potential).|Confers cellular localization similar to full-length form (By similarity).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	60704035	60704035	16576	11	G	C	C	41	41	TMEM132A	C	3	3
INTS5	80789	broad.mit.edu	37	11	62416108	62416108	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62416108C>A	uc001nud.2	-	2	1497	c.1444G>T	c.(1444-1446)GGA>TGA	p.G482*	GANAB_uc001nua.2_5'Flank|GANAB_uc001nub.2_5'Flank|GANAB_uc001nuc.2_5'Flank|GANAB_uc010rma.1_5'Flank|GANAB_uc010rmb.1_5'Flank	NM_030628	NP_085131	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	482					snRNA processing	integral to membrane|integrator complex	protein binding			ovary(2)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	62416108	62416108	8082	11	C	A	A	21	21	INTS5	A	5	2
MRGPRF	116535	broad.mit.edu	37	11	68773711	68773711	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68773711C>A	uc001ooo.3	-	3	434	c.67G>T	c.(67-69)GAG>TAG	p.E23*	MRGPRF_uc001oop.3_Nonsense_Mutation_p.E23*	NM_001098515	NP_001091985	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F	23	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)															---	---	---	---	capture		Nonsense_Mutation	SNP	68773711	68773711	10157	11	C	A	A	31	31	MRGPRF	A	5	1
ANO1	55107	broad.mit.edu	37	11	70009436	70009436	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70009436G>A	uc001opj.2	+	19	2245	c.1940G>A	c.(1939-1941)CGA>CAA	p.R647Q	ANO1_uc001opk.1_Missense_Mutation_p.R589Q|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.R356Q	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	647	Extracellular (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	70009436	70009436	703	11	G	A	A	37	37	ANO1	A	1	1
DLG2	1740	broad.mit.edu	37	11	83344300	83344300	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83344300C>A	uc001paj.2	-	14	1882	c.1579G>T	c.(1579-1581)GGG>TGG	p.G527W	DLG2_uc001pai.2_Missense_Mutation_p.G424W|DLG2_uc010rsy.1_Missense_Mutation_p.G494W|DLG2_uc010rsz.1_Missense_Mutation_p.G527W|DLG2_uc010rta.1_Missense_Mutation_p.G527W|DLG2_uc001pak.2_Missense_Mutation_p.G632W|DLG2_uc010rtb.1_Missense_Mutation_p.G494W|DLG2_uc001pal.1_Missense_Mutation_p.G527W|DLG2_uc010rsw.1_Missense_Mutation_p.G9W|DLG2_uc010rsx.1_Missense_Mutation_p.G8W	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	527						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)																---	---	---	---	capture		Missense_Mutation	SNP	83344300	83344300	4735	11	C	A	A	23	23	DLG2	A	1	1
CNTN5	53942	broad.mit.edu	37	11	100061878	100061878	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100061878G>T	uc001pga.2	+	14	1940	c.1601G>T	c.(1600-1602)GGG>GTG	p.G534V	CNTN5_uc009ywv.1_Missense_Mutation_p.G534V|CNTN5_uc001pfz.2_Missense_Mutation_p.G534V|CNTN5_uc001pgb.2_Missense_Mutation_p.G460V|CNTN5_uc010ruk.1_5'UTR	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	534	Ig-like C2-type 5.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)														---	---	---	---	capture		Missense_Mutation	SNP	100061878	100061878	3782	11	G	T	T	43	43	CNTN5	T	2	2
GRIA4	2893	broad.mit.edu	37	11	105623843	105623843	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105623843C>G	uc001pix.2	+	4	830	c.384C>G	c.(382-384)AGC>AGG	p.S128R	GRIA4_uc001piu.1_Missense_Mutation_p.S128R|GRIA4_uc001piw.2_Missense_Mutation_p.S128R|GRIA4_uc001piv.2_Missense_Mutation_p.S128R|GRIA4_uc009yxk.1_Missense_Mutation_p.S128R	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	128	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	105623843	105623843	7048	11	C	G	G	26	26	GRIA4	G	3	3
GRIA4	2893	broad.mit.edu	37	11	105795143	105795143	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105795143G>T	uc001pix.2	+	12	1941	c.1495G>T	c.(1495-1497)GCC>TCC	p.A499S	GRIA4_uc001piw.2_Missense_Mutation_p.A499S	NM_000829	NP_000820	P48058	GRIA4_HUMAN	glutamate receptor, ionotrophic, AMPA 4 isoform	499	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	cell junction|endocytic vesicle membrane|integral to membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)	L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	105795143	105795143	7048	11	G	T	T	46	46	GRIA4	T	2	2
GUCY1A2	2977	broad.mit.edu	37	11	106680751	106680751	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106680751C>G	uc001pjg.1	-	5	2050	c.1660G>C	c.(1660-1662)GAC>CAC	p.D554H	GUCY1A2_uc010rvo.1_Missense_Mutation_p.D575H|GUCY1A2_uc009yxn.1_Missense_Mutation_p.D554H	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	554	Guanylate cyclase.				intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)														---	---	---	---	capture		Missense_Mutation	SNP	106680751	106680751	7173	11	C	G	G	29	29	GUCY1A2	G	3	3
EXPH5	23086	broad.mit.edu	37	11	108380315	108380315	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108380315G>T	uc001pkk.2	-	6	6030	c.5919C>A	c.(5917-5919)ACC>ACA	p.T1973T	EXPH5_uc010rvy.1_Silent_p.T1785T|EXPH5_uc010rvz.1_Silent_p.T1817T|EXPH5_uc010rwa.1_Silent_p.T1897T	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	1973					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)														---	---	---	---	capture		Silent	SNP	108380315	108380315	5516	11	G	T	T	47	47	EXPH5	T	2	2
BACE1	23621	broad.mit.edu	37	11	117160476	117160476	+	Silent	SNP	A	G	G	rs138594731	byFrequency	TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117160476A>G	uc001pqz.2	-	9	1773	c.1312T>C	c.(1312-1314)TTG>CTG	p.L438L	BACE1_uc001pqw.2_Silent_p.L413L|BACE1_uc001pqx.2_Silent_p.L369L|BACE1_uc001pqy.2_Silent_p.L394L|BACE1_uc010rxg.1_Silent_p.L313L|BACE1_uc010rxh.1_Silent_p.L338L|uc010rxi.1_5'Flank	NM_012104	NP_036236	P56817	BACE1_HUMAN	beta-site APP-cleaving enzyme 1 isoform A	438	Extracellular (Potential).				beta-amyloid metabolic process|membrane protein ectodomain proteolysis	cell surface|cytoplasmic vesicle membrane|endoplasmic reticulum|endosome|integral to plasma membrane|trans-Golgi network	aspartic-type endopeptidase activity|beta-aspartyl-peptidase activity|protein binding			ovary(1)	1	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.69e-05)|Epithelial(105;0.000563)|all cancers(92;0.0032)														---	---	---	---	capture		Silent	SNP	117160476	117160476	1302	11	A	G	G	3	3	BACE1	G	4	4
MLL	4297	broad.mit.edu	37	11	118377224	118377224	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118377224C>A	uc001pta.2	+	27	10631	c.10608C>A	c.(10606-10608)CCC>CCA	p.P3536P	MLL_uc001ptb.2_Silent_p.P3539P	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3536					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)				T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								---	---	---	---	capture		Silent	SNP	118377224	118377224	10010	11	C	A	A	21	21	MLL	A	2	2
OR8A1	390275	broad.mit.edu	37	11	124440879	124440879	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440879C>A	uc010san.1	+	1	915	c.915C>A	c.(913-915)ATC>ATA	p.I305I		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	305	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)														---	---	---	---	capture		Silent	SNP	124440879	124440879	11636	11	C	A	A	32	32	OR8A1	A	2	2
PATE1	160065	broad.mit.edu	37	11	125618497	125618497	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125618497G>T	uc001qct.2	+	5	262	c.250G>T	c.(250-252)GAT>TAT	p.D84Y	PATE1_uc009zbr.2_Missense_Mutation_p.D72Y	NM_138294	NP_612151	Q8WXA2	PATE1_HUMAN	expressed in prostate and testis precursor	84						extracellular region					0																		---	---	---	---	capture		Missense_Mutation	SNP	125618497	125618497	11890	11	G	T	T	41	41	PATE1	T	2	2
ZNF705A	440077	broad.mit.edu	37	12	8330139	8330139	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8330139T>A	uc001qud.1	+	5	935	c.863T>A	c.(862-864)CTA>CAA	p.L288Q	FAM66C_uc001que.3_5'Flank|FAM66C_uc001quf.3_5'Flank|FAM66C_uc009zgc.2_5'Flank|FAM66C_uc001qug.3_5'Flank	NM_001004328	NP_001004328	Q6ZN79	Z705A_HUMAN	zinc finger protein 705A	288					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				Kidney(36;0.0877)														---	---	---	---	capture		Missense_Mutation	SNP	8330139	8330139	18703	12	T	A	A	53	53	ZNF705A	A	4	4
CLEC4E	26253	broad.mit.edu	37	12	8689737	8689737	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8689737C>A	uc001quo.1	-	4	511	c.346G>T	c.(346-348)GTG>TTG	p.V116L		NM_014358	NP_055173	Q9ULY5	CLC4E_HUMAN	C-type lectin domain family 4, member E	116	C-type lectin.|Extracellular (Potential).					integral to membrane	sugar binding			central_nervous_system(1)	1	Lung SC(5;0.184)																	---	---	---	---	capture		Missense_Mutation	SNP	8689737	8689737	3653	12	C	A	A	18	18	CLEC4E	A	2	2
PZP	5858	broad.mit.edu	37	12	9317747	9317747	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9317747G>T	uc001qvl.2	-	19	2504	c.2475C>A	c.(2473-2475)CCC>CCA	p.P825P	PZP_uc009zgl.2_Silent_p.P694P|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Silent_p.P157P	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5																		---	---	---	---	capture		Silent	SNP	9317747	9317747	13327	12	G	T	T	47	47	PZP	T	2	2
CLEC1B	51266	broad.mit.edu	37	12	10149584	10149584	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10149584C>A	uc001qwu.2	-	4	499	c.299G>T	c.(298-300)AGC>ATC	p.S100I	CLEC1B_uc009zhd.2_Missense_Mutation_p.S67I	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform	100	Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	10149584	10149584	3643	12	C	A	A	28	28	CLEC1B	A	2	2
DDX47	51202	broad.mit.edu	37	12	12974228	12974228	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12974228C>A	uc001rav.2	+	6	866	c.268C>A	c.(268-270)CCG>ACG	p.P90T	DDX47_uc009zhw.1_Missense_Mutation_p.P90T|DDX47_uc001rax.2_Missense_Mutation_p.P90T|DDX47_uc001ray.2_Missense_Mutation_p.P90T|DDX47_uc010shn.1_Missense_Mutation_p.P90T	NM_016355	NP_057439	Q9H0S4	DDX47_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 47	90	Helicase ATP-binding.					nucleolus|nucleolus	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding				0		Prostate(47;0.0526)		BRCA - Breast invasive adenocarcinoma(232;0.0354)														---	---	---	---	capture		Missense_Mutation	SNP	12974228	12974228	4536	12	C	A	A	22	22	DDX47	A	2	2
ATF7IP	55729	broad.mit.edu	37	12	14633957	14633957	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14633957A>G	uc001rbw.2	+	13	3276	c.3118A>G	c.(3118-3120)ACA>GCA	p.T1040A	ATF7IP_uc001rbv.1_Missense_Mutation_p.T1039A|ATF7IP_uc001rbx.2_Missense_Mutation_p.T1039A|ATF7IP_uc001rby.3_Missense_Mutation_p.T1040A|ATF7IP_uc001rca.2_Missense_Mutation_p.T1040A	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	1040					DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	14633957	14633957	1106	12	A	G	G	2	2	ATF7IP	G	4	4
RASSF8	11228	broad.mit.edu	37	12	26220577	26220577	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26220577G>T	uc001rgx.2	+	4	1290	c.1069G>T	c.(1069-1071)GGG>TGG	p.G357W	RASSF8_uc001rgy.2_Missense_Mutation_p.G357W|RASSF8_uc001rgz.2_Missense_Mutation_p.G357W|RASSF8_uc009zjd.1_Missense_Mutation_p.G357W|RASSF8_uc009zje.1_Missense_Mutation_p.G357W	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family	357					signal transduction						0	Colorectal(261;0.0847)																	---	---	---	---	capture		Missense_Mutation	SNP	26220577	26220577	13553	12	G	T	T	35	35	RASSF8	T	2	2
OVCH1	341350	broad.mit.edu	37	12	29624887	29624887	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29624887G>T	uc001rix.1	-	16	1704	c.1704C>A	c.(1702-1704)CCC>CCA	p.P568P		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	568					proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)																	---	---	---	---	capture		Silent	SNP	29624887	29624887	11736	12	G	T	T	43	43	OVCH1	T	2	2
LRRK2	120892	broad.mit.edu	37	12	40692290	40692290	+	Missense_Mutation	SNP	A	T	T	rs35808389		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40692290A>T	uc001rmg.3	+	24	3463	c.3342A>T	c.(3340-3342)TTA>TTT	p.L1114F	LRRK2_uc001rmh.1_Missense_Mutation_p.L736F|LRRK2_uc009zjw.2_5'UTR	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1114	LRR 6.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)																---	---	---	---	capture		Missense_Mutation	SNP	40692290	40692290	9409	12	A	T	T	15	15	LRRK2	T	4	4
TUBA1B	10376	broad.mit.edu	37	12	49522122	49522122	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49522122G>T	uc001rtm.2	-	4	1196	c.975C>A	c.(973-975)CCC>CCA	p.P325P	TUBA1B_uc001rto.2_Silent_p.P290P|TUBA1B_uc001rtk.2_Silent_p.P290P|TUBA1B_uc001rtl.2_Silent_p.P290P|TUBA1B_uc001rtn.2_Silent_p.P172P|uc010smg.1_5'UTR	NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous	325					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0																		---	---	---	---	capture		Silent	SNP	49522122	49522122	17299	12	G	T	T	47	47	TUBA1B	T	2	2
KCNH3	23416	broad.mit.edu	37	12	49949466	49949466	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49949466G>C	uc001ruh.1	+	12	2460	c.2200G>C	c.(2200-2202)GAT>CAT	p.D734H	KCNH3_uc010smj.1_Missense_Mutation_p.D674H	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	734	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	49949466	49949466	8338	12	G	C	C	33	33	KCNH3	C	3	3
KRT84	3890	broad.mit.edu	37	12	52778981	52778981	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52778981C>A	uc001sah.1	-	1	437	c.389G>T	c.(388-390)GGA>GTA	p.G130V		NM_033045	NP_149034	Q9NSB2	KRT84_HUMAN	keratin, hair, basic, 4	130	Head.					keratin filament	structural constituent of epidermis			skin(1)	1	all_hematologic(5;0.12)			BRCA - Breast invasive adenocarcinoma(357;0.189)														---	---	---	---	capture		Missense_Mutation	SNP	52778981	52778981	8813	12	C	A	A	30	30	KRT84	A	2	2
KRT74	121391	broad.mit.edu	37	12	52962040	52962040	+	Missense_Mutation	SNP	C	G	G	rs139298074		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52962040C>G	uc001sap.1	-	7	1316	c.1268G>C	c.(1267-1269)CGC>CCC	p.R423P		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	423	Rod.|Coil 2.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)														---	---	---	---	capture		Missense_Mutation	SNP	52962040	52962040	8802	12	C	G	G	27	27	KRT74	G	3	3
KRT74	121391	broad.mit.edu	37	12	52967522	52967522	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52967522C>A	uc001sap.1	-	1	88	c.40G>T	c.(40-42)GGC>TGC	p.G14C		NM_175053	NP_778223	Q7RTS7	K2C74_HUMAN	keratin 6 irs4	14	Head.|Gly-rich.					keratin filament	structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.191)														---	---	---	---	capture		Missense_Mutation	SNP	52967522	52967522	8802	12	C	A	A	22	22	KRT74	A	2	2
KRT77	374454	broad.mit.edu	37	12	53091506	53091506	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53091506C>A	uc001saw.2	-	2	747	c.718G>T	c.(718-720)GTC>TTC	p.V240F	KRT77_uc009zmi.2_5'UTR	NM_175078	NP_778253	Q7Z794	K2C1B_HUMAN	keratin 77	240	Coil 1B.|Rod.					keratin filament	structural molecule activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	53091506	53091506	8805	12	C	A	A	18	18	KRT77	A	2	2
ESPL1	9700	broad.mit.edu	37	12	53670571	53670571	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53670571G>T	uc001sck.2	+	8	1959	c.1868G>T	c.(1867-1869)TGG>TTG	p.W623L	ESPL1_uc001scj.2_Missense_Mutation_p.W298L|ESPL1_uc010soe.1_5'Flank	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	623					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	53670571	53670571	5446	12	G	T	T	47	47	ESPL1	T	2	2
OR6C75	390323	broad.mit.edu	37	12	55759748	55759748	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55759748C>T	uc010spk.1	+	1	854	c.854C>T	c.(853-855)CCC>CTC	p.P285L		NM_001005497	NP_001005497	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	55759748	55759748	11609	12	C	T	T	22	22	OR6C75	T	2	2
ESYT1	23344	broad.mit.edu	37	12	56525301	56525301	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56525301G>T	uc001sjq.2	+	6	805	c.755G>T	c.(754-756)GGG>GTG	p.G252V	ESYT1_uc001sjr.2_Missense_Mutation_p.G252V	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	252	Helical; (Potential).					integral to membrane				ovary(4)|skin(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	56525301	56525301	5457	12	G	T	T	43	43	ESYT1	T	2	2
PIP4K2C	79837	broad.mit.edu	37	12	57988951	57988951	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57988951C>A	uc001sou.2	+	3	446	c.315C>A	c.(313-315)CCC>CCA	p.P105P	PIP4K2C_uc001sot.2_Silent_p.P105P|PIP4K2C_uc010srs.1_Silent_p.P87P|PIP4K2C_uc010srt.1_Silent_p.P105P	NM_001146258	NP_001139730	Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	105	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|identical protein binding			central_nervous_system(2)|lung(1)	3	Melanoma(17;0.122)																	---	---	---	---	capture		Silent	SNP	57988951	57988951	12362	12	C	A	A	22	22	PIP4K2C	A	2	2
AVIL	10677	broad.mit.edu	37	12	58202206	58202206	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58202206C>A	uc001sqj.1	-	9	1094	c.1065G>T	c.(1063-1065)CTG>CTT	p.L355L	AVIL_uc009zqe.1_Silent_p.L348L|AVIL_uc001sqk.1_5'UTR|AVIL_uc001sql.3_Silent_p.L332L	NM_006576	NP_006567	O75366	AVIL_HUMAN	advillin	355	Core (By similarity).				actin filament capping|cilium morphogenesis|cytoskeleton organization|positive regulation of neuron projection development	actin cytoskeleton|axon|cytoplasm	actin binding			central_nervous_system(1)	1	Glioma(12;6.95e-05)|all_neural(12;0.00016)|Melanoma(17;0.122)																	---	---	---	---	capture		Silent	SNP	58202206	58202206	1248	12	C	A	A	21	21	AVIL	A	2	2
MON2	23041	broad.mit.edu	37	12	62894643	62894643	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62894643G>T	uc001sre.2	+	6	1037	c.646G>T	c.(646-648)GCA>TCA	p.A216S	MON2_uc009zqj.2_Missense_Mutation_p.A216S|MON2_uc010ssl.1_Missense_Mutation_p.A144S|MON2_uc010ssm.1_Missense_Mutation_p.A216S|MON2_uc010ssn.1_Missense_Mutation_p.A216S|MON2_uc001srf.2_5'Flank|MON2_uc001srd.1_Missense_Mutation_p.A108S	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	216					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)														---	---	---	---	capture		Missense_Mutation	SNP	62894643	62894643	10091	12	G	T	T	46	46	MON2	T	2	2
MON2	23041	broad.mit.edu	37	12	62894645	62894645	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62894645A>T	uc001sre.2	+	6	1039	c.648A>T	c.(646-648)GCA>GCT	p.A216A	MON2_uc009zqj.2_Silent_p.A216A|MON2_uc010ssl.1_Silent_p.A144A|MON2_uc010ssm.1_Silent_p.A216A|MON2_uc010ssn.1_Silent_p.A216A|MON2_uc001srf.2_5'Flank|MON2_uc001srd.1_Silent_p.A108A	NM_015026	NP_055841	Q7Z3U7	MON2_HUMAN	MON2 homolog	216					Golgi to endosome transport|protein transport	cytoplasm	ARF guanyl-nucleotide exchange factor activity|binding			central_nervous_system(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)														---	---	---	---	capture		Silent	SNP	62894645	62894645	10091	12	A	T	T	8	8	MON2	T	4	4
PTPRR	5801	broad.mit.edu	37	12	71095029	71095029	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71095029G>A	uc001swi.1	-	7	1498	c.1082C>T	c.(1081-1083)ACA>ATA	p.T361I	PTPRR_uc001swh.1_Missense_Mutation_p.T116I|PTPRR_uc009zrs.2_Missense_Mutation_p.T210I|PTPRR_uc010stq.1_Missense_Mutation_p.T249I|PTPRR_uc010str.1_Missense_Mutation_p.T210I	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	361	Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)														---	---	---	---	capture		Missense_Mutation	SNP	71095029	71095029	13268	12	G	A	A	48	48	PTPRR	A	2	2
E2F7	144455	broad.mit.edu	37	12	77419463	77419463	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77419463G>A	uc001sym.3	-	12	2676	c.2440C>T	c.(2440-2442)CCT>TCT	p.P814S	E2F7_uc009zse.2_Intron	NM_203394	NP_976328	Q96AV8	E2F7_HUMAN	E2F transcription factor 7	814					cell cycle	transcription factor complex	DNA binding|identical protein binding			upper_aerodigestive_tract(1)|ovary(1)|kidney(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	77419463	77419463	5058	12	G	A	A	43	43	E2F7	A	2	2
MGAT4C	25834	broad.mit.edu	37	12	86373490	86373490	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86373490A>T	uc001tai.3	-	8	2264	c.1014T>A	c.(1012-1014)CCT>CCA	p.P338P	MGAT4C_uc001tal.3_Silent_p.P338P|MGAT4C_uc001taj.3_Silent_p.P338P|MGAT4C_uc001tak.3_Silent_p.P338P|MGAT4C_uc010sum.1_Silent_p.P362P|MGAT4C_uc001tah.3_Silent_p.P338P	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein	338	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3																		---	---	---	---	capture		Silent	SNP	86373490	86373490	9937	12	A	T	T	7	7	MGAT4C	T	4	4
FGD6	55785	broad.mit.edu	37	12	95488424	95488424	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95488424T>A	uc001tdp.3	-	15	3768	c.3544A>T	c.(3544-3546)ATA>TTA	p.I1182L	FGD6_uc009zsx.2_Missense_Mutation_p.I315L|FGD6_uc001tdq.1_Missense_Mutation_p.I218L	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	1182	PH 1.				actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	95488424	95488424	6074	12	T	A	A	52	52	FGD6	A	4	4
NUP37	79023	broad.mit.edu	37	12	102492903	102492903	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102492903T>A	uc001tjc.2	-	4	495	c.430A>T	c.(430-432)AGT>TGT	p.S144C	NUP37_uc009zub.1_Missense_Mutation_p.S144C	NM_024057	NP_076962	Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	144	WD 2.				carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	102492903	102492903	11169	12	T	A	A	54	54	NUP37	A	4	4
KIAA1033	23325	broad.mit.edu	37	12	105551091	105551091	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105551091A>G	uc001tld.2	+	28	2990	c.2903A>G	c.(2902-2904)AAA>AGA	p.K968R	KIAA1033_uc010swr.1_Missense_Mutation_p.K969R|KIAA1033_uc010sws.1_Missense_Mutation_p.K780R	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	968					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	105551091	105551091	8513	12	A	G	G	1	1	KIAA1033	G	4	4
SSH1	54434	broad.mit.edu	37	12	109201450	109201450	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109201450C>A	uc001tnm.2	-	8	777	c.690G>T	c.(688-690)CTG>CTT	p.L230L	SSH1_uc001tnl.2_5'Flank|SSH1_uc010sxg.1_Silent_p.L241L|SSH1_uc001tnn.3_Silent_p.L230L|SSH1_uc001tno.1_Silent_p.L134L	NM_018984	NP_061857	Q8WYL5	SSH1_HUMAN	slingshot 1 isoform 1	230				L -> P (in Ref. 1; BAB84116).	actin cytoskeleton organization|cell morphogenesis|cellular response to ATP|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of cellular protein metabolic process|regulation of lamellipodium assembly	cleavage furrow|cytoplasm|cytoskeleton|lamellipodium|midbody|plasma membrane	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(4)	4																		---	---	---	---	capture		Silent	SNP	109201450	109201450	15700	12	C	A	A	21	21	SSH1	A	2	2
SDS	10993	broad.mit.edu	37	12	113837484	113837484	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113837484C>A	uc001tvg.2	-	2	152	c.30G>T	c.(28-30)AAG>AAT	p.K10N	SDS_uc001tvh.1_Missense_Mutation_p.K10N	NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	10					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)													---	---	---	---	capture		Missense_Mutation	SNP	113837484	113837484	14461	12	C	A	A	32	32	SDS	A	2	2
GCN1L1	10985	broad.mit.edu	37	12	120578772	120578772	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120578772G>T	uc001txo.2	-	45	5898	c.5885C>A	c.(5884-5886)CCC>CAC	p.P1962H		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1962	HEAT 16.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)																	---	---	---	---	capture		Missense_Mutation	SNP	120578772	120578772	6565	12	G	T	T	43	43	GCN1L1	T	2	2
P2RX7	5027	broad.mit.edu	37	12	121592748	121592748	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121592748C>A	uc001tzm.2	+	2	382	c.286C>A	c.(286-288)CCT>ACT	p.P96T	P2RX7_uc001tzn.2_5'UTR|P2RX7_uc001tzo.2_RNA|P2RX7_uc001tzp.2_5'UTR|P2RX7_uc001tzq.2_5'UTR	NM_002562	NP_002553	Q99572	P2RX7_HUMAN	purinergic receptor P2X7	96						integral to membrane	ATP binding|ion channel activity|receptor activity			large_intestine(2)|lung(1)|breast(1)|skin(1)	5	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)																	---	---	---	---	capture		Missense_Mutation	SNP	121592748	121592748	11758	12	C	A	A	22	22	P2RX7	A	2	2
WDR66	144406	broad.mit.edu	37	12	122372222	122372222	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122372222G>T	uc009zxk.2	+	5	1100	c.958G>T	c.(958-960)GGG>TGG	p.G320W		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	320	WD 1.						calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)														---	---	---	---	capture		Missense_Mutation	SNP	122372222	122372222	17890	12	G	T	T	35	35	WDR66	T	2	2
DNAH10	196385	broad.mit.edu	37	12	124317842	124317842	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124317842A>G	uc001uft.3	+	26	4398	c.4373A>G	c.(4372-4374)CAA>CGA	p.Q1458R		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1458	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)														---	---	---	---	capture		Missense_Mutation	SNP	124317842	124317842	4780	12	A	G	G	5	5	DNAH10	G	4	4
TMEM132D	121256	broad.mit.edu	37	12	129558710	129558710	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129558710G>T	uc009zyl.1	-	9	3338	c.3010C>A	c.(3010-3012)CTC>ATC	p.L1004I	TMEM132D_uc001uia.2_Missense_Mutation_p.L542I	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	1004	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)														---	---	---	---	capture		Missense_Mutation	SNP	129558710	129558710	16579	12	G	T	T	35	35	TMEM132D	T	2	2
SACS	26278	broad.mit.edu	37	13	23906110	23906110	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23906110G>A	uc001uon.2	-	10	12494	c.11905C>T	c.(11905-11907)CTT>TTT	p.L3969F	SACS_uc001uoo.2_Missense_Mutation_p.L3822F|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	3969					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|skin(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	12		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)														---	---	---	---	capture		Missense_Mutation	SNP	23906110	23906110	14284	13	G	A	A	36	36	SACS	A	2	2
MIPEP	4285	broad.mit.edu	37	13	24380178	24380178	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24380178G>T	uc001uox.3	-	16	1859	c.1759C>A	c.(1759-1761)CAT>AAT	p.H587N		NM_005932	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase precursor	587					protein processing involved in protein targeting to mitochondrion|proteolysis	mitochondrial matrix	metal ion binding|metalloendopeptidase activity			central_nervous_system(1)	1		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)														---	---	---	---	capture		Missense_Mutation	SNP	24380178	24380178	9982	13	G	T	T	47	47	MIPEP	T	2	2
PARP4	143	broad.mit.edu	37	13	25026687	25026687	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25026687G>C	uc001upl.2	-	24	2977	c.2871C>G	c.(2869-2871)CTC>CTG	p.L957L	PARP4_uc010tdc.1_Silent_p.L957L	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	957	VWFA.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)														---	---	---	---	capture		Silent	SNP	25026687	25026687	11880	13	G	C	C	41	41	PARP4	C	3	3
PAN3	255967	broad.mit.edu	37	13	28794441	28794441	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28794441C>A	uc001urz.2	+	5	496	c.488C>A	c.(487-489)TCA>TAA	p.S163*	PAN3_uc010tdo.1_Nonsense_Mutation_p.S309*|PAN3_uc001ury.2_5'UTR|PAN3_uc001urx.2_Nonsense_Mutation_p.S109*	NM_175854	NP_787050	Q58A45	PAN3_HUMAN	PABP1-dependent poly A-specific ribonuclease	309	Interaction with polyadenylate-binding protein.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)														---	---	---	---	capture		Nonsense_Mutation	SNP	28794441	28794441	11832	13	C	A	A	29	29	PAN3	A	5	2
KL	9365	broad.mit.edu	37	13	33638087	33638087	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33638087T>A	uc001uus.2	+	5	2811	c.2803T>A	c.(2803-2805)TTT>ATT	p.F935I		NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	935	Glycosyl hydrolase-1 2.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)														---	---	---	---	capture		Missense_Mutation	SNP	33638087	33638087	8643	13	T	A	A	60	60	KL	A	4	4
NBEA	26960	broad.mit.edu	37	13	35517158	35517158	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35517158C>T	uc001uvb.2	+	2	407	c.201C>T	c.(199-201)ATC>ATT	p.I67I		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	67						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)														---	---	---	---	capture		Silent	SNP	35517158	35517158	10583	13	C	T	T	30	30	NBEA	T	2	2
FREM2	341640	broad.mit.edu	37	13	39271908	39271908	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39271908T>C	uc001uwv.2	+	2	5556	c.5247T>C	c.(5245-5247)TTT>TTC	p.F1749F		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	1749	Extracellular (Potential).|CSPG 12.				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)														---	---	---	---	capture		Silent	SNP	39271908	39271908	6292	13	T	C	C	63	63	FREM2	C	4	4
KIAA0564	23078	broad.mit.edu	37	13	42385440	42385440	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42385440G>C	uc001uyj.2	-	17	2054	c.1984C>G	c.(1984-1986)CTG>GTG	p.L662V	KIAA0564_uc001uyk.2_Missense_Mutation_p.L662V	NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a	662						extracellular region	ATP binding|ATPase activity	p.L662L(1)		ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)														---	---	---	---	capture		Missense_Mutation	SNP	42385440	42385440	8492	13	G	C	C	36	36	KIAA0564	C	3	3
COG3	83548	broad.mit.edu	37	13	46085956	46085956	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46085956A>T	uc001vak.2	+	16	1877	c.1776A>T	c.(1774-1776)TTA>TTT	p.L592F	COG3_uc001vaj.1_Missense_Mutation_p.L592F|COG3_uc010tfv.1_Missense_Mutation_p.L429F|COG3_uc010aci.2_Missense_Mutation_p.L368F	NM_031431	NP_113619	Q96JB2	COG3_HUMAN	component of golgi transport complex 3	592					ER to Golgi vesicle-mediated transport|intra-Golgi vesicle-mediated transport|intracellular protein transport|protein glycosylation|protein localization to organelle|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	cis-Golgi network|Golgi cisterna membrane|Golgi transport complex	protein binding|protein transporter activity			breast(1)|skin(1)	2		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)														---	---	---	---	capture		Missense_Mutation	SNP	46085956	46085956	3797	13	A	T	T	14	14	COG3	T	4	4
LMO7	4008	broad.mit.edu	37	13	76382282	76382282	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76382282G>T	uc001vjv.2	+	7	1924	c.1164G>T	c.(1162-1164)GAG>GAT	p.E388D	LMO7_uc010thv.1_Intron|LMO7_uc001vjt.1_Intron|LMO7_uc010thw.1_Intron|LMO7_uc001vjw.1_Missense_Mutation_p.E294D	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	673						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)														---	---	---	---	capture		Missense_Mutation	SNP	76382282	76382282	9184	13	G	T	T	35	35	LMO7	T	2	2
LIG4	3981	broad.mit.edu	37	13	108861116	108861116	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108861116T>A	uc001vqn.2	-	2	2774	c.2501A>T	c.(2500-2502)GAG>GTG	p.E834V	LIG4_uc001vqo.2_Missense_Mutation_p.E834V|LIG4_uc010agg.1_Missense_Mutation_p.E767V|LIG4_uc010agf.2_Missense_Mutation_p.E834V|LIG4_uc001vqp.2_Missense_Mutation_p.E834V	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	834	BRCT 2.				cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)												NHEJ					---	---	---	---	capture		Missense_Mutation	SNP	108861116	108861116	9109	13	T	A	A	54	54	LIG4	A	4	4
AP4S1	11154	broad.mit.edu	37	14	31549788	31549788	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31549788G>T	uc001wqy.3	+	5	686	c.304G>T	c.(304-306)GAT>TAT	p.D102Y	AP4S1_uc001wqw.3_Missense_Mutation_p.D102Y|AP4S1_uc001wqx.3_Missense_Mutation_p.D102Y|AP4S1_uc010amh.2_Intron|AP4S1_uc001wqz.3_Intron	NM_001128126	NP_001121598	Q9Y587	AP4S1_HUMAN	adaptor-related protein complex 4, sigma 1	102						coated pit|Golgi apparatus	protein transporter activity				0	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.221)	GBM - Glioblastoma multiforme(265;0.00553)														---	---	---	---	capture		Missense_Mutation	SNP	31549788	31549788	764	14	G	T	T	33	33	AP4S1	T	2	2
SLC10A1	6554	broad.mit.edu	37	14	70245986	70245986	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70245986G>T	uc001xlr.2	-	3	793	c.659C>A	c.(658-660)CCA>CAA	p.P220Q		NM_003049	NP_003040	Q14973	NTCP_HUMAN	solute carrier family 10, member 1	220	Helical; (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(1)	1				all cancers(60;0.00228)|BRCA - Breast invasive adenocarcinoma(234;0.0137)|OV - Ovarian serous cystadenocarcinoma(108;0.0226)														---	---	---	---	capture		Missense_Mutation	SNP	70245986	70245986	14868	14	G	T	T	47	47	SLC10A1	T	2	2
TMEM63C	57156	broad.mit.edu	37	14	77686394	77686394	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77686394C>A	uc001xtf.2	+	5	488	c.276C>A	c.(274-276)CCC>CCA	p.P92P	TMEM63C_uc010asq.1_Silent_p.P92P	NM_020431	NP_065164	Q9P1W3	TM63C_HUMAN	transmembrane protein 63C	92						integral to membrane					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0342)														---	---	---	---	capture		Silent	SNP	77686394	77686394	16731	14	C	A	A	24	24	TMEM63C	A	2	2
ADCK1	57143	broad.mit.edu	37	14	78353520	78353520	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78353520G>C	uc001xui.2	+	5	609	c.510G>C	c.(508-510)GGG>GGC	p.G170G	ADCK1_uc010tvo.1_Intron|ADCK1_uc001xuj.2_Silent_p.G102G|ADCK1_uc001xuk.1_Silent_p.G44G	NM_020421	NP_065154	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1 isoform a	177	Protein kinase.					extracellular region	ATP binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)	3			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)														---	---	---	---	capture		Silent	SNP	78353520	78353520	289	14	G	C	C	42	42	ADCK1	C	3	3
NRXN3	9369	broad.mit.edu	37	14	80130287	80130287	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:80130287C>A	uc001xun.2	+	14	2983	c.2492C>A	c.(2491-2493)CCT>CAT	p.P831H	NRXN3_uc001xum.1_RNA|NRXN3_uc001xup.2_RNA|NRXN3_uc001xuq.2_Missense_Mutation_p.P199H|NRXN3_uc010asw.2_Missense_Mutation_p.P199H|NRXN3_uc001xur.3_Missense_Mutation_p.P199H	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	1204	Extracellular (Potential).|Laminin G-like 6.				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)														---	---	---	---	capture		Missense_Mutation	SNP	80130287	80130287	11072	14	C	A	A	24	24	NRXN3	A	2	2
CINP	51550	broad.mit.edu	37	14	102816311	102816311	+	Silent	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102816311A>G	uc001ylv.1	-	4	446	c.381T>C	c.(379-381)TAT>TAC	p.Y127Y	CINP_uc001ylu.1_RNA	NM_032630	NP_116019	Q9BW66	CINP_HUMAN	cyclin-dependent kinase 2-interacting protein	127					cell cycle|cell division|DNA repair|DNA replication	nucleus	protein binding			large_intestine(1)	1																		---	---	---	---	capture		Silent	SNP	102816311	102816311	3565	14	A	G	G	8	8	CINP	G	4	4
SPTBN5	51332	broad.mit.edu	37	15	42167727	42167727	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42167727G>T	uc001zos.2	-	22	4444	c.4111C>A	c.(4111-4113)CGC>AGC	p.R1371S		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1406	Spectrin 10.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)														---	---	---	---	capture		Missense_Mutation	SNP	42167727	42167727	15636	15	G	T	T	39	39	SPTBN5	T	1	1
VPS39	23339	broad.mit.edu	37	15	42459085	42459085	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42459085C>A	uc001zpd.2	-	15	1588	c.1437G>T	c.(1435-1437)TTG>TTT	p.L479F	VPS39_uc001zpc.2_Missense_Mutation_p.L468F|VPS39_uc001zpb.2_5'Flank	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	479					protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)														---	---	---	---	capture		Missense_Mutation	SNP	42459085	42459085	17776	15	C	A	A	25	25	VPS39	A	2	2
SLC30A4	7782	broad.mit.edu	37	15	45814396	45814396	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45814396C>A	uc001zvj.2	-	2	469	c.157G>T	c.(157-159)GAC>TAC	p.D53Y	C15orf21_uc010beg.1_Intron|C15orf21_uc010beh.1_Intron|C15orf21_uc010bei.1_Intron|C15orf21_uc010bej.1_Intron|C15orf21_uc001zvm.1_Intron|C15orf21_uc001zvn.1_Intron	NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	53	Cytoplasmic (Potential).|Asp-rich (acidic).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)														---	---	---	---	capture		Missense_Mutation	SNP	45814396	45814396	15054	15	C	A	A	29	29	SLC30A4	A	2	2
SEMA6D	80031	broad.mit.edu	37	15	48056121	48056121	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48056121G>C	uc010bek.2	+	10	1182	c.822G>C	c.(820-822)TGG>TGC	p.W274C	SEMA6D_uc001zvw.2_Missense_Mutation_p.W274C|SEMA6D_uc001zvx.1_Missense_Mutation_p.W274C|SEMA6D_uc001zvy.2_Missense_Mutation_p.W274C|SEMA6D_uc001zvz.2_Missense_Mutation_p.W274C|SEMA6D_uc001zwa.2_Missense_Mutation_p.W274C|SEMA6D_uc001zwb.2_Missense_Mutation_p.W274C|SEMA6D_uc001zwc.2_Missense_Mutation_p.W274C	NM_153618	NP_705871	Q8NFY4	SEM6D_HUMAN	semaphorin 6D isoform 4 precursor	274	Sema.|Extracellular (Potential).				axon guidance	cytoplasm|integral to membrane|plasma membrane	receptor activity			skin(3)|breast(1)	4		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)														---	---	---	---	capture		Missense_Mutation	SNP	48056121	48056121	14528	15	G	C	C	41	41	SEMA6D	C	3	3
ATP8B4	79895	broad.mit.edu	37	15	50190438	50190438	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50190438A>G	uc001zxu.2	-	22	2442	c.2300T>C	c.(2299-2301)CTA>CCA	p.L767P	ATP8B4_uc010ber.2_Missense_Mutation_p.L640P|ATP8B4_uc010ufd.1_Missense_Mutation_p.L577P|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxv.1_Missense_Mutation_p.L65P	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	767	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)														---	---	---	---	capture		Missense_Mutation	SNP	50190438	50190438	1216	15	A	G	G	15	15	ATP8B4	G	4	4
UNC13C	440279	broad.mit.edu	37	15	54305821	54305821	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305821G>A	uc002ack.2	+	1	721	c.721G>A	c.(721-723)GAT>AAT	p.D241N		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	241					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---	capture		Missense_Mutation	SNP	54305821	54305821	17544	15	G	A	A	45	45	UNC13C	A	2	2
UNC13C	440279	broad.mit.edu	37	15	54305932	54305932	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54305932T>A	uc002ack.2	+	1	832	c.832T>A	c.(832-834)TCC>ACC	p.S278T		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	278					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---	capture		Missense_Mutation	SNP	54305932	54305932	17544	15	T	A	A	54	54	UNC13C	A	4	4
UNC13C	440279	broad.mit.edu	37	15	54592473	54592473	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54592473G>C	uc002ack.2	+	11	4170	c.4170G>C	c.(4168-4170)GGG>GGC	p.G1390G	UNC13C_uc002acl.2_Silent_p.G220G	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1390					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)														---	---	---	---	capture		Silent	SNP	54592473	54592473	17544	15	G	C	C	43	43	UNC13C	C	3	3
SLTM	79811	broad.mit.edu	37	15	59225621	59225621	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59225621G>C	uc002afp.2	-	1	232	c.144C>G	c.(142-144)CTC>CTG	p.L48L	SLTM_uc002afo.2_Silent_p.L48L|SLTM_uc002afq.2_5'UTR|SLTM_uc010bgd.2_5'UTR|SLTM_uc002afr.1_Silent_p.L48L	NM_024755	NP_079031	Q9NWH9	SLTM_HUMAN	modulator of estrogen induced transcription	48	SAP.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	59225621	59225621	15252	15	G	C	C	45	45	SLTM	C	3	3
RORA	6095	broad.mit.edu	37	15	60803449	60803449	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60803449G>T	uc002agv.2	-	6	1051	c.895C>A	c.(895-897)CCA>ACA	p.P299T	uc002ags.1_Intron|RORA_uc002agt.3_Missense_Mutation_p.P211T|RORA_uc002agw.2_Missense_Mutation_p.P291T|RORA_uc002agx.2_Missense_Mutation_p.P266T	NM_134260	NP_599022	P35398	RORA_HUMAN	RAR-related orphan receptor A isoform b	299	Hinge.				positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			large_intestine(1)|ovary(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	60803449	60803449	14007	15	G	T	T	43	43	RORA	T	2	2
CILP	8483	broad.mit.edu	37	15	65499327	65499327	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65499327G>T	uc002aon.2	-	4	398	c.217C>A	c.(217-219)CGG>AGG	p.R73R		NM_003613	NP_003604	O75339	CILP1_HUMAN	cartilage intermediate layer protein	73					negative regulation of insulin-like growth factor receptor signaling pathway	extracellular matrix part|extracellular space|proteinaceous extracellular matrix		p.R73Q(1)		ovary(4)|pancreas(2)|skin(1)	7																		---	---	---	---	capture		Silent	SNP	65499327	65499327	3563	15	G	T	T	38	38	CILP	T	1	1
HEXA	3073	broad.mit.edu	37	15	72638941	72638941	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72638941G>T	uc002aun.3	-	11	1464	c.1257C>A	c.(1255-1257)CCC>CCA	p.P419P	uc002aug.2_RNA|CELF6_uc002auk.3_Intron|HEXA_uc010ukn.1_Silent_p.P430P|HEXA_uc002auo.3_Silent_p.P282P|HEXA_uc010bix.2_Silent_p.P419P|HEXA_uc010biy.2_Silent_p.P282P|HEXA_uc010uko.1_Silent_p.P245P|HEXA_uc010biz.1_RNA	NM_000520	NP_000511	P06865	HEXA_HUMAN	hexosaminidase A preproprotein	419					cell death	lysosome	beta-N-acetylhexosaminidase activity|cation binding|protein heterodimerization activity			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---	capture		Silent	SNP	72638941	72638941	7356	15	G	T	T	35	35	HEXA	T	2	2
BNC1	646	broad.mit.edu	37	15	83932832	83932832	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83932832C>A	uc002bjt.1	-	4	1259	c.1171G>T	c.(1171-1173)GGG>TGG	p.G391W	BNC1_uc010uos.1_Missense_Mutation_p.G379W	NM_001717	NP_001708	Q01954	BNC1_HUMAN	basonuclin 1	391	C2H2-type 2.				epidermis development|positive regulation of cell proliferation	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.G391R(1)		ovary(3)	3																		---	---	---	---	capture		Missense_Mutation	SNP	83932832	83932832	1499	15	C	A	A	24	24	BNC1	A	2	2
KLHL25	64410	broad.mit.edu	37	15	86312604	86312604	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86312604G>T	uc002bly.2	-	2	641	c.438C>A	c.(436-438)CCC>CCA	p.P146P		NM_022480	NP_071925	Q9H0H3	ENC2_HUMAN	BTB/POZ KELCH domain protein	146						cytoplasm				ovary(2)	2																		---	---	---	---	capture		Silent	SNP	86312604	86312604	8692	15	G	T	T	35	35	KLHL25	T	2	2
MSLNL	401827	broad.mit.edu	37	16	823224	823224	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:823224G>A	uc002cjz.1	-	10	2044	c.2044C>T	c.(2044-2046)CTG>TTG	p.L682L		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	331	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4																		---	---	---	---	capture		Silent	SNP	823224	823224	10275	16	G	A	A	35	35	MSLNL	A	2	2
TELO2	9894	broad.mit.edu	37	16	1557674	1557674	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1557674G>T	uc002cly.2	+	20	2655	c.2364G>T	c.(2362-2364)GAG>GAT	p.E788D		NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog	788						chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)																---	---	---	---	capture		Missense_Mutation	SNP	1557674	1557674	16284	16	G	T	T	35	35	TELO2	T	2	2
ABCA3	21	broad.mit.edu	37	16	2331382	2331382	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2331382C>A	uc002cpy.1	-	27	4876	c.4164G>T	c.(4162-4164)AAG>AAT	p.K1388N	ABCA3_uc010bsk.1_Missense_Mutation_p.K1330N	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	1388	ABC transporter 2.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)																---	---	---	---	capture		Missense_Mutation	SNP	2331382	2331382	34	16	C	A	A	24	24	ABCA3	A	2	2
ZNF213	7760	broad.mit.edu	37	16	3187644	3187644	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3187644G>A	uc010uws.1	+	2	810	c.363G>A	c.(361-363)GAG>GAA	p.E121E	ZNF213_uc002cud.2_RNA|ZNF213_uc010btf.2_Silent_p.E121E|ZNF213_uc010bth.2_Silent_p.E121E|ZNF213_uc010uwt.1_Silent_p.E121E	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213	121	SCAN box.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0																		---	---	---	---	capture		Silent	SNP	3187644	3187644	18360	16	G	A	A	35	35	ZNF213	A	2	2
ADCY9	115	broad.mit.edu	37	16	4163760	4163760	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4163760G>T	uc002cvx.2	-	2	2223	c.1684C>A	c.(1684-1686)CAG>AAG	p.Q562K		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	562	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)|central_nervous_system(1)	6																		---	---	---	---	capture		Missense_Mutation	SNP	4163760	4163760	302	16	G	T	T	47	47	ADCY9	T	2	2
GP2	2813	broad.mit.edu	37	16	20335151	20335151	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20335151C>A	uc002dgv.2	-	3	605	c.522G>T	c.(520-522)CTG>CTT	p.L174L	GP2_uc002dgw.2_Silent_p.L174L|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	174						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4																		---	---	---	---	capture		Silent	SNP	20335151	20335151	6856	16	C	A	A	29	29	GP2	A	2	2
COG7	91949	broad.mit.edu	37	16	23456434	23456434	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23456434A>T	uc002dlo.2	-	3	558	c.370T>A	c.(370-372)TCT>ACT	p.S124T		NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	124					intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)														---	---	---	---	capture		Missense_Mutation	SNP	23456434	23456434	3801	16	A	T	T	12	12	COG7	T	4	4
RBBP6	5930	broad.mit.edu	37	16	24583481	24583481	+	Silent	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24583481C>G	uc002dmh.2	+	18	6134	c.5094C>G	c.(5092-5094)GTC>GTG	p.V1698V	RBBP6_uc002dmi.2_Silent_p.V1664V|RBBP6_uc010bxr.2_Silent_p.V858V|RBBP6_uc002dmk.2_Silent_p.V1531V	NM_006910	NP_008841	Q7Z6E9	RBBP6_HUMAN	retinoblastoma-binding protein 6 isoform 1	1698					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	chromosome|nucleolus|ubiquitin ligase complex	nucleic acid binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|pancreas(1)	4				GBM - Glioblastoma multiforme(48;0.0518)														---	---	---	---	capture		Silent	SNP	24583481	24583481	13564	16	C	G	G	29	29	RBBP6	G	3	3
SLC5A11	115584	broad.mit.edu	37	16	24922792	24922792	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24922792C>A	uc002dmu.2	+	16	2198	c.1966C>A	c.(1966-1968)CTG>ATG	p.L656M	SLC5A11_uc002dms.2_Missense_Mutation_p.L592M|SLC5A11_uc010vcd.1_Missense_Mutation_p.L621M|SLC5A11_uc002dmt.2_Missense_Mutation_p.L500M|SLC5A11_uc010vce.1_Missense_Mutation_p.L586M|SLC5A11_uc010bxt.2_Missense_Mutation_p.L592M|SLC5A11_uc002dmv.2_Missense_Mutation_p.L279M	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	656	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)														---	---	---	---	capture		Missense_Mutation	SNP	24922792	24922792	15160	16	C	A	A	24	24	SLC5A11	A	2	2
ATXN2L	11273	broad.mit.edu	37	16	28847341	28847341	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28847341C>T	uc002drc.2	+	22	3151	c.2983C>T	c.(2983-2985)CAG>TAG	p.Q995*	uc010vct.1_Intron|ATXN2L_uc002drb.2_Nonsense_Mutation_p.Q995*|ATXN2L_uc002dqy.2_Nonsense_Mutation_p.Q995*|ATXN2L_uc002dra.2_Nonsense_Mutation_p.Q995*|ATXN2L_uc002dqz.2_Nonsense_Mutation_p.Q995*|ATXN2L_uc010vdb.1_Nonsense_Mutation_p.Q1001*|ATXN2L_uc002dre.2_Nonsense_Mutation_p.Q995*|ATXN2L_uc002drf.2_Nonsense_Mutation_p.Q404*|ATXN2L_uc002drg.2_Nonsense_Mutation_p.Q278*	NM_007245	NP_009176	Q8WWM7	ATX2L_HUMAN	ataxin 2 related protein isoform A	995						membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---	capture		Nonsense_Mutation	SNP	28847341	28847341	1232	16	C	T	T	21	21	ATXN2L	T	5	2
ZNF646	9726	broad.mit.edu	37	16	31089893	31089893	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31089893G>A	uc002eap.2	+	2	2537	c.2248G>A	c.(2248-2250)GGT>AGT	p.G750S		NM_014699	NP_055514	O15015	ZN646_HUMAN	zinc finger protein 646	750					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			breast(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	31089893	31089893	18657	16	G	A	A	43	43	ZNF646	A	2	2
ABCC12	94160	broad.mit.edu	37	16	48119595	48119595	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48119595A>G	uc002efc.1	-	27	4083	c.3737T>C	c.(3736-3738)TTA>TCA	p.L1246S	ABCC12_uc002eey.1_RNA|ABCC12_uc002eez.1_RNA|ABCC12_uc002efa.1_RNA|ABCC12_uc002efb.1_RNA|ABCC12_uc002efd.1_RNA	NM_033226	NP_150229	Q96J65	MRP9_HUMAN	ATP-binding cassette protein C12	1246	ABC transporter 2.					integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3		all_cancers(37;0.0474)|all_lung(18;0.047)																---	---	---	---	capture		Missense_Mutation	SNP	48119595	48119595	53	16	A	G	G	13	13	ABCC12	G	4	4
PMFBP1	83449	broad.mit.edu	37	16	72157488	72157488	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72157488C>G	uc002fcc.3	-	18	2837	c.2665G>C	c.(2665-2667)GAT>CAT	p.D889H	PMFBP1_uc002fcd.2_Missense_Mutation_p.D884H|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.D739H	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	889										ovary(2)	2		Ovarian(137;0.179)																---	---	---	---	capture		Missense_Mutation	SNP	72157488	72157488	12560	16	C	G	G	29	29	PMFBP1	G	3	3
MLYCD	23417	broad.mit.edu	37	16	83941731	83941731	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83941731G>T	uc002fgz.2	+	3	662	c.642G>T	c.(640-642)GAG>GAT	p.E214D		NM_012213	NP_036345	O95822	DCMC_HUMAN	malonyl-CoA decarboxylase precursor	214					acyl-CoA metabolic process|fatty acid biosynthetic process	mitochondrion|peroxisome	malonyl-CoA decarboxylase activity|methylmalonyl-CoA decarboxylase activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	83941731	83941731	10028	16	G	T	T	43	43	MLYCD	T	2	2
TAF1C	9013	broad.mit.edu	37	16	84218511	84218511	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84218511C>A	uc002fhn.2	-	2	312	c.84G>T	c.(82-84)ATG>ATT	p.M28I	TAF1C_uc002fhm.2_Intron|TAF1C_uc010vnx.1_Missense_Mutation_p.M28I|TAF1C_uc010vny.1_Intron|TAF1C_uc010vnz.1_Intron|TAF1C_uc002fho.2_Intron|TAF1C_uc010voa.1_Intron|TAF1C_uc002fhp.1_RNA|TAF1C_uc010vob.1_Missense_Mutation_p.M28I	NM_005679	NP_005670	Q15572	TAF1C_HUMAN	TBP-associated factor 1C isoform 1	28					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	84218511	84218511	16042	16	C	A	A	17	17	TAF1C	A	2	2
GAS8	2622	broad.mit.edu	37	16	90102917	90102917	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90102917G>T	uc002fqi.1	+	6	801	c.679G>T	c.(679-681)GAG>TAG	p.E227*	GAS8_uc010vps.1_Nonsense_Mutation_p.E202*|GAS8_uc002fqh.2_Nonsense_Mutation_p.E144*|GAS8_uc010vpt.1_3'UTR|GAS8_uc010vpu.1_Nonsense_Mutation_p.E144*|GAS8_uc010vpv.1_Nonsense_Mutation_p.E198*|GAS8_uc010cjc.1_Nonsense_Mutation_p.E144*|GAS8_uc010vpw.1_Nonsense_Mutation_p.E144*|GAS8_uc002fqj.1_Nonsense_Mutation_p.E35*	NM_001481	NP_001472	O95995	GAS8_HUMAN	growth arrest-specific 8	227	Microtubule-binding.				negative regulation of cell proliferation|sperm motility	cilium|Golgi apparatus|microtubule|microtubule basal body|microtubule-based flagellum	protein binding			ovary(1)	1		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)														---	---	---	---	capture		Nonsense_Mutation	SNP	90102917	90102917	6515	16	G	T	T	37	37	GAS8	T	5	1
SMG6	23293	broad.mit.edu	37	17	2075968	2075968	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2075968T>A	uc002fub.1	-	13	3396	c.3341A>T	c.(3340-3342)GAG>GTG	p.E1114V	SMG6_uc010vqv.1_Missense_Mutation_p.E206V	NM_017575	NP_060045	Q86US8	EST1A_HUMAN	Smg-6 homolog, nonsense mediated mRNA decay	1114					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation|telomere maintenance	chromosome, telomeric region|cytosol|nucleolus|telomerase holoenzyme complex	endoribonuclease activity|metal ion binding|protein binding|telomeric DNA binding			central_nervous_system(2)|lung(1)|kidney(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	2075968	2075968	15295	17	T	A	A	54	54	SMG6	A	4	4
OR1A2	26189	broad.mit.edu	37	17	3101073	3101073	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3101073G>T	uc002fvd.1	+	1	261	c.261G>T	c.(259-261)TTG>TTT	p.L87F		NM_012352	NP_036484	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A,	87	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	3101073	3101073	11356	17	G	T	T	47	47	OR1A2	T	2	2
OR1A2	26189	broad.mit.edu	37	17	3101463	3101463	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3101463T>C	uc002fvd.1	+	1	651	c.651T>C	c.(649-651)TAT>TAC	p.Y217Y		NM_012352	NP_036484	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2																		---	---	---	---	capture		Silent	SNP	3101463	3101463	11356	17	T	C	C	51	51	OR1A2	C	4	4
OR1E2	8388	broad.mit.edu	37	17	3337053	3337053	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3337053T>C	uc010vre.1	-	1	83	c.83A>G	c.(82-84)TAT>TGT	p.Y28C		NM_003554	NP_003545	P47887	OR1E2_HUMAN	olfactory receptor, family 1, subfamily E,	28	Helical; Name=1; (Potential).				sensory perception of smell	integral to plasma membrane	olfactory receptor activity			large_intestine(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	3337053	3337053	11361	17	T	C	C	49	49	OR1E2	C	4	4
C17orf74	201243	broad.mit.edu	37	17	7330592	7330592	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7330592C>A	uc002ggw.2	+	3	1355	c.1282C>A	c.(1282-1284)CAG>AAG	p.Q428K	FGF11_uc010vtw.1_Intron	NM_175734	NP_783861	Q0P670	CQ074_HUMAN	hypothetical protein LOC201243	428						integral to membrane					0		Prostate(122;0.157)																---	---	---	---	capture		Missense_Mutation	SNP	7330592	7330592	1937	17	C	A	A	21	21	C17orf74	A	2	2
TP53	7157	broad.mit.edu	37	17	7577538	7577538	+	Missense_Mutation	SNP	C	G	G	rs11540652		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577538C>G	uc002gim.2	-	7	937	c.743G>C	c.(742-744)CGG>CCG	p.R248P	TP53_uc002gig.1_Missense_Mutation_p.R248P|TP53_uc002gih.2_Missense_Mutation_p.R248P|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116P|TP53_uc010cng.1_Missense_Mutation_p.R116P|TP53_uc002gii.1_Missense_Mutation_p.R116P|TP53_uc010cnh.1_Missense_Mutation_p.R248P|TP53_uc010cni.1_Missense_Mutation_p.R248P|TP53_uc002gij.2_Missense_Mutation_p.R248P|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.R155P|TP53_uc002gio.2_Missense_Mutation_p.R116P	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.R248Q(523)|p.R248W(443)|p.R248L(63)|p.R248P(12)|p.R248G(11)|p.R248R(10)|p.0?(7)|p.R155Q(4)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*96(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		R248Q(KASUMI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HS683_CENTRAL_NERVOUS_SYSTEM)|R248Q(NAMALWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(HCC1143_BREAST)|R248Q(BL41_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SKUT1_SOFT_TISSUE)|R248Q(HSC4_UPPER_AERODIGESTIVE_TRACT)|R248Q(HEC1A_ENDOMETRIUM)|R248Q(SF295_CENTRAL_NERVOUS_SYSTEM)|R248Q(KOPN8_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NUDHL1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(WSUDLCL2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIN87_STOMACH)|R248Q(P12ICHIKAWA_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(RT112_URINARY_TRACT)|R248Q(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PANC0203_PANCREAS)|R248Q(EM2_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SEM_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(CI1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(MOLM6_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NIHOVCAR3_OVARY)|R248Q(CA46_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SUPT1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(SW1463_LARGE_INTESTINE)|R248Q(HCC70_BREAST)|R248Q(KYSE150_OESOPHAGUS)|R248Q(NB4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(NCIH211_LUNG)|R248Q(KYO1_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248Q(PC14_LUNG)	111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			---	---	---	---	capture		Missense_Mutation	SNP	7577538	7577538	16923	17	C	G	G	23	23	TP53	G	3	3
DNAH2	146754	broad.mit.edu	37	17	7710538	7710538	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7710538G>T	uc002giu.1	+	61	9527	c.9513G>T	c.(9511-9513)AAG>AAT	p.K3171N	DNAH2_uc010cnm.1_Missense_Mutation_p.K109N	NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	3171	Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)																---	---	---	---	capture		Missense_Mutation	SNP	7710538	7710538	4785	17	G	T	T	33	33	DNAH2	T	2	2
RICH2	9912	broad.mit.edu	37	17	12860030	12860030	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12860030A>G	uc002gnr.3	+	15	1636	c.1309A>G	c.(1309-1311)ATC>GTC	p.I437V	RICH2_uc010vvk.1_Missense_Mutation_p.I437V|RICH2_uc010vvl.1_Missense_Mutation_p.I437V|RICH2_uc002gns.3_Missense_Mutation_p.I237V|RICH2_uc010vvm.1_Missense_Mutation_p.I437V|RICH2_uc010vvn.1_RNA|RICH2_uc002gnt.1_Missense_Mutation_p.I160V	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	437	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	12860030	12860030	13832	17	A	G	G	16	16	RICH2	G	4	4
CYTSB	92521	broad.mit.edu	37	17	20108408	20108408	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20108408C>A	uc002gwq.2	+	4	1191	c.1046C>A	c.(1045-1047)CCC>CAC	p.P349H	CYTSB_uc010cqx.2_Missense_Mutation_p.P349H|CYTSB_uc002gwr.2_Missense_Mutation_p.P349H|CYTSB_uc002gws.2_Missense_Mutation_p.P349H|CYTSB_uc002gwv.2_Missense_Mutation_p.P268H|CYTSB_uc010vzf.1_Intron|CYTSB_uc002gww.2_Missense_Mutation_p.P125H|CYTSB_uc002gwt.2_Missense_Mutation_p.P268H|CYTSB_uc002gwu.2_Missense_Mutation_p.P268H	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b	349	Ser-rich.					nucleus					0																		---	---	---	---	capture		Missense_Mutation	SNP	20108408	20108408	4375	17	C	A	A	22	22	CYTSB	A	2	2
ZNF207	7756	broad.mit.edu	37	17	30696771	30696771	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30696771G>T	uc002hhh.3	+	11	1578	c.1430G>T	c.(1429-1431)CGT>CTT	p.R477L	ZNF207_uc002hhj.3_Missense_Mutation_p.R493L|ZNF207_uc002hhi.3_Missense_Mutation_p.R462L|ZNF207_uc010csz.2_Missense_Mutation_p.R496L|ZNF207_uc002hhk.1_Intron|ZNF207_uc002hhl.1_RNA	NM_003457	NP_003448	O43670	ZN207_HUMAN	zinc finger protein 207 isoform a	477						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)															---	---	---	---	capture		Missense_Mutation	SNP	30696771	30696771	18356	17	G	T	T	40	40	ZNF207	T	1	1
ACACA	31	broad.mit.edu	37	17	35486293	35486293	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35486293G>T	uc002hnm.2	-	47	6022	c.5831C>A	c.(5830-5832)CCA>CAA	p.P1944Q	ACACA_uc002hnk.2_Missense_Mutation_p.P1866Q|ACACA_uc002hnl.2_Missense_Mutation_p.P1886Q|ACACA_uc002hnn.2_Missense_Mutation_p.P1944Q|ACACA_uc002hno.2_Missense_Mutation_p.P1981Q|ACACA_uc010cuy.2_Missense_Mutation_p.P589Q|ACACA_uc010wdc.1_Missense_Mutation_p.P70Q	NM_198836	NP_942133	Q13085	ACACA_HUMAN	acetyl-Coenzyme A carboxylase alpha isoform 2	1944	Carboxyltransferase.				acetyl-CoA metabolic process|energy reserve metabolic process|fatty acid biosynthetic process|long-chain fatty-acyl-CoA biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|triglyceride biosynthetic process	cytosol	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			large_intestine(1)|ovary(1)	2		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)													---	---	---	---	capture		Missense_Mutation	SNP	35486293	35486293	107	17	G	T	T	47	47	ACACA	T	2	2
FBXO47	494188	broad.mit.edu	37	17	37099956	37099956	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37099956G>T	uc002hrc.2	-	8	1027	c.827C>A	c.(826-828)CCT>CAT	p.P276H		NM_001008777	NP_001008777	Q5MNV8	FBX47_HUMAN	F-box protein 47	276											0																		---	---	---	---	capture		Missense_Mutation	SNP	37099956	37099956	5993	17	G	T	T	35	35	FBXO47	T	2	2
PLCD3	113026	broad.mit.edu	37	17	43195803	43195803	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43195803C>A	uc002iib.2	-	6	1084	c.970G>T	c.(970-972)GAG>TAG	p.E324*		NM_133373	NP_588614	Q8N3E9	PLCD3_HUMAN	phospholipase C delta 3	324					intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)													---	---	---	---	capture		Nonsense_Mutation	SNP	43195803	43195803	12458	17	C	A	A	30	30	PLCD3	A	5	2
NFE2L1	4779	broad.mit.edu	37	17	46136635	46136635	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46136635C>A	uc002imz.3	+	6	2602	c.1951C>A	c.(1951-1953)CAG>AAG	p.Q651K	NFE2L1_uc002ina.3_Missense_Mutation_p.Q621K|NFE2L1_uc002inb.3_Missense_Mutation_p.Q621K|NFE2L1_uc010wle.1_Missense_Mutation_p.Q463K|NFE2L1_uc010wlf.1_Missense_Mutation_p.Q495K	NM_003204	NP_003195	Q14494	NF2L1_HUMAN	nuclear factor erythroid 2-like 1	651					anatomical structure morphogenesis|heme biosynthetic process|inflammatory response|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	46136635	46136635	10767	17	C	A	A	21	21	NFE2L1	A	2	2
HOXB7	3217	broad.mit.edu	37	17	46688189	46688189	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46688189G>A	uc002inv.2	-	1	195	c.92C>T	c.(91-93)TCT>TTT	p.S31F		NM_004502	NP_004493	P09629	HXB7_HUMAN	homeobox B7	31						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	46688189	46688189	7598	17	G	A	A	33	33	HOXB7	A	2	2
PRR11	55771	broad.mit.edu	37	17	57262807	57262807	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57262807G>A	uc002ixf.1	+	4	365	c.286G>A	c.(286-288)GAA>AAA	p.E96K	PRR11_uc002ixg.1_RNA	NM_018304	NP_060774	Q96HE9	PRR11_HUMAN	proline rich 11	96										ovary(2)	2	Medulloblastoma(34;0.0922)|all_neural(34;0.101)																	---	---	---	---	capture		Missense_Mutation	SNP	57262807	57262807	13026	17	G	A	A	33	33	PRR11	A	2	2
MED13	9969	broad.mit.edu	37	17	60028198	60028198	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60028198G>T	uc002izo.2	-	28	6356	c.6279C>A	c.(6277-6279)CCC>CCA	p.P2093P		NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13	2093					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2																		---	---	---	---	capture		Silent	SNP	60028198	60028198	9819	17	G	T	T	43	43	MED13	T	2	2
PRKCA	5578	broad.mit.edu	37	17	64302221	64302221	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64302221G>T	uc002jfp.1	+	2	225	c.181G>T	c.(181-183)GGG>TGG	p.G61W	PRKCA_uc002jfo.1_5'UTR	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	61	Phorbol-ester/DAG-type 1.				activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)													---	---	---	---	capture		Missense_Mutation	SNP	64302221	64302221	12950	17	G	T	T	47	47	PRKCA	T	2	2
CD300C	10871	broad.mit.edu	37	17	72539071	72539071	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72539071G>T	uc002jky.1	-	3	817	c.456C>A	c.(454-456)CCC>CCA	p.P152P		NM_006678	NP_006669	Q08708	CLM6_HUMAN	CD300C antigen precursor	152	Pro-rich.|Extracellular (Potential).				cellular defense response	integral to plasma membrane	transmembrane receptor activity				0																		---	---	---	---	capture		Silent	SNP	72539071	72539071	3125	17	G	T	T	47	47	CD300C	T	2	2
EVPL	2125	broad.mit.edu	37	17	74004924	74004924	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74004924G>T	uc002jqi.2	-	22	4590	c.4362C>A	c.(4360-4362)CCC>CCA	p.P1454P	EVPL_uc010wss.1_Silent_p.P1476P|EVPL_uc010wst.1_Silent_p.P924P	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1454	Central fibrous rod domain.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4																		---	---	---	---	capture		Silent	SNP	74004924	74004924	5485	17	G	T	T	47	47	EVPL	T	2	2
RNF213	57674	broad.mit.edu	37	17	78337588	78337588	+	Silent	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78337588C>G	uc002jyh.1	+	16	6190	c.5967C>G	c.(5965-5967)GTC>GTG	p.V1989V	uc002jyi.1_Intron|RNF213_uc010dhw.1_Silent_p.V371V	NM_020914	NP_065965	Q9HCF4	ALO17_HUMAN	ring finger protein 213	Error:Variant_position_missing_in_Q9HCF4_after_alignment										ovary(8)|lung(6)|breast(3)|large_intestine(2)|central_nervous_system(1)|pancreas(1)	21	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)															---	---	---	---	capture		Silent	SNP	78337588	78337588	13955	17	C	G	G	29	29	RNF213	G	3	3
KIAA0802	23255	broad.mit.edu	37	18	8783855	8783855	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8783855G>T	uc002knr.2	+	6	887	c.745G>T	c.(745-747)GAG>TAG	p.E249*	KIAA0802_uc002knq.2_Nonsense_Mutation_p.E249*|KIAA0802_uc010dkw.1_Nonsense_Mutation_p.E87*	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255	600	Potential.										0																		---	---	---	---	capture		Nonsense_Mutation	SNP	8783855	8783855	8501	18	G	T	T	41	41	KIAA0802	T	5	2
MC5R	4161	broad.mit.edu	37	18	13826055	13826055	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13826055C>T	uc010xaf.1	+	1	291	c.291C>T	c.(289-291)TAC>TAT	p.Y97Y		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	97	Helical; Name=2; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6																		---	---	---	---	capture		Silent	SNP	13826055	13826055	9756	18	C	T	T	18	18	MC5R	T	2	2
OSBPL1A	114876	broad.mit.edu	37	18	21758027	21758027	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21758027C>T	uc002kve.2	-	21	2217	c.2043G>A	c.(2041-2043)GGG>GGA	p.G681G	OSBPL1A_uc002kvd.2_Silent_p.G168G|OSBPL1A_uc010xbc.1_Silent_p.G299G	NM_080597	NP_542164	Q9BXW6	OSBL1_HUMAN	oxysterol-binding protein-like 1A isoform B	681					cholesterol metabolic process|lipid transport|vesicle-mediated transport		phospholipid binding			ovary(4)	4	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)																	---	---	---	---	capture		Silent	SNP	21758027	21758027	11688	18	C	T	T	30	30	OSBPL1A	T	2	2
ASXL3	80816	broad.mit.edu	37	18	31324435	31324435	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31324435T>C	uc010dmg.1	+	12	4678	c.4623T>C	c.(4621-4623)GCT>GCC	p.A1541A	ASXL3_uc002kxq.2_Silent_p.A1248A	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1541					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3																OREG0024911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Silent	SNP	31324435	31324435	1087	18	T	C	C	55	55	ASXL3	C	4	4
ASXL3	80816	broad.mit.edu	37	18	31325517	31325517	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31325517C>A	uc010dmg.1	+	12	5760	c.5705C>A	c.(5704-5706)CCC>CAC	p.P1902H	ASXL3_uc002kxq.2_Missense_Mutation_p.P1609H	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	1902					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	31325517	31325517	1087	18	C	A	A	22	22	ASXL3	A	2	2
RPRD1A	55197	broad.mit.edu	37	18	33613794	33613794	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:33613794G>A	uc002kzf.1	-	2	164	c.158C>T	c.(157-159)CCA>CTA	p.P53L	RPRD1A_uc002kze.1_Missense_Mutation_p.P17L|RPRD1A_uc002kzg.2_Missense_Mutation_p.P53L|RPRD1A_uc010dmw.2_Missense_Mutation_p.P17L|RPRD1A_uc010dmx.2_Missense_Mutation_p.P53L	NM_018170	NP_060640	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing	53	CID.									ovary(1)|breast(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	33613794	33613794	14094	18	G	A	A	47	47	RPRD1A	A	2	2
KIAA1632	57724	broad.mit.edu	37	18	43446904	43446904	+	Silent	SNP	C	A	A	rs142224776	by1000genomes	TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43446904C>A	uc002lbm.2	-	38	6580	c.6480G>T	c.(6478-6480)TCG>TCT	p.S2160S	KIAA1632_uc010xcq.1_Silent_p.S714S|KIAA1632_uc010xcr.1_RNA|KIAA1632_uc010xcs.1_RNA|KIAA1632_uc002lbn.2_Silent_p.S1035S	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	2160					autophagy						0																		---	---	---	---	capture		Silent	SNP	43446904	43446904	8558	18	C	A	A	19	19	KIAA1632	A	1	1
MADCAM1	8174	broad.mit.edu	37	19	498595	498595	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:498595C>T	uc002los.2	+	3	447	c.437C>T	c.(436-438)GCG>GTG	p.A146V	MADCAM1_uc002lot.2_Missense_Mutation_p.A146V|MADCAM1_uc010drq.2_Missense_Mutation_p.A51V	NM_130760	NP_570116	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion	146	Extracellular (Potential).|Ig-like 2.				cell adhesion|immune response|regulation of immune response|signal transduction	integral to membrane|membrane fraction|plasma membrane					0		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	498595	498595	9528	19	C	T	T	27	27	MADCAM1	T	1	1
DOT1L	84444	broad.mit.edu	37	19	2217007	2217007	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2217007G>C	uc002lvb.3	+	21	2498	c.2462G>C	c.(2461-2463)GGC>GCC	p.G821A	DOT1L_uc002lvc.1_Missense_Mutation_p.G115A|uc002lvd.1_5'Flank|DOT1L_uc002lve.1_Missense_Mutation_p.G115A	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	821						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	2217007	2217007	4893	19	G	C	C	42	42	DOT1L	C	3	3
ZNF556	80032	broad.mit.edu	37	19	2877439	2877439	+	Silent	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2877439C>G	uc002lwp.1	+	4	570	c.483C>G	c.(481-483)TCC>TCG	p.S161S	ZNF556_uc002lwq.2_Silent_p.S160S	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	161	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Silent	SNP	2877439	2877439	18582	19	C	G	G	22	22	ZNF556	G	3	3
ZNF556	80032	broad.mit.edu	37	19	2877512	2877512	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2877512C>T	uc002lwp.1	+	4	643	c.556C>T	c.(556-558)CGC>TGC	p.R186C	ZNF556_uc002lwq.2_Missense_Mutation_p.R185C	NM_024967	NP_079243	Q9HAH1	ZN556_HUMAN	zinc finger protein 556	186	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	2877512	2877512	18582	19	C	T	T	31	31	ZNF556	T	1	1
UBXN6	80700	broad.mit.edu	37	19	4447574	4447574	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4447574C>T	uc002man.1	-	6	684	c.588G>A	c.(586-588)AAG>AAA	p.K196K	UBXN6_uc010dty.1_Silent_p.K100K|UBXN6_uc002mam.1_Silent_p.K143K	NM_025241	NP_079517	Q9BZV1	UBXN6_HUMAN	UBX domain protein 6	196	PUB.					microtubule organizing center|nucleus	protein binding				0																		---	---	---	---	capture		Silent	SNP	4447574	4447574	17475	19	C	T	T	32	32	UBXN6	T	2	2
LRG1	116844	broad.mit.edu	37	19	4538248	4538248	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4538248T>A	uc002mau.2	-	2	759	c.748A>T	c.(748-750)AGG>TGG	p.R250W	PLIN5_uc002mat.1_Intron	NM_052972	NP_443204	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1 precursor	250	LRR 7.					extracellular region|membrane				ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	4538248	4538248	9315	19	T	A	A	55	55	LRG1	A	4	4
TICAM1	148022	broad.mit.edu	37	19	4817941	4817941	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4817941C>A	uc002mbi.2	-	2	700	c.449G>T	c.(448-450)GGG>GTG	p.G150V		NM_182919	NP_891549	Q8IUC6	TCAM1_HUMAN	toll-like receptor adaptor molecule 1	150				G -> W (in Ref. 6; AAO85488).	apoptosis|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	protein kinase binding|signal transducer activity			breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)														---	---	---	---	capture		Missense_Mutation	SNP	4817941	4817941	16420	19	C	A	A	22	22	TICAM1	A	2	2
PNPLA6	10908	broad.mit.edu	37	19	7605533	7605533	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7605533G>T	uc010xjq.1	+	8	954	c.759G>T	c.(757-759)GTG>GTT	p.V253V	PNPLA6_uc002mgq.1_Silent_p.V205V|PNPLA6_uc010xjp.1_Silent_p.V205V|PNPLA6_uc002mgr.1_Silent_p.V205V|PNPLA6_uc002mgs.2_Silent_p.V244V	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	244	cNMP 1.|Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3																		---	---	---	---	capture		Silent	SNP	7605533	7605533	12596	19	G	T	T	47	47	PNPLA6	T	2	2
MUC16	94025	broad.mit.edu	37	19	9090237	9090237	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9090237C>T	uc002mkp.2	-	1	1782	c.1578G>A	c.(1576-1578)CAG>CAA	p.Q526Q		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	526	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57																		---	---	---	---	capture		Silent	SNP	9090237	9090237	10367	19	C	T	T	28	28	MUC16	T	2	2
ZNF791	163049	broad.mit.edu	37	19	12739314	12739314	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12739314G>T	uc002mua.2	+	4	1133	c.971G>T	c.(970-972)GGA>GTA	p.G324V	ZNF791_uc010xml.1_Missense_Mutation_p.G292V|ZNF791_uc010dyu.1_Missense_Mutation_p.G215V|ZNF791_uc010xmm.1_Missense_Mutation_p.G215V	NM_153358	NP_699189	Q3KP31	ZN791_HUMAN	zinc finger protein 791	324					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	12739314	12739314	18761	19	G	T	T	41	41	ZNF791	T	2	2
CPAMD8	27151	broad.mit.edu	37	19	17091325	17091325	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17091325T>A	uc002nfb.2	-	14	1740	c.1708A>T	c.(1708-1710)ACA>TCA	p.T570S		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	523						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13																		---	---	---	---	capture		Missense_Mutation	SNP	17091325	17091325	3933	19	T	A	A	60	60	CPAMD8	A	4	4
FKBP8	23770	broad.mit.edu	37	19	18649073	18649073	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18649073G>A	uc002njk.1	-	5	835	c.722C>T	c.(721-723)GCC>GTC	p.A241V	FKBP8_uc002nji.1_Missense_Mutation_p.A79V|FKBP8_uc010xqi.1_Missense_Mutation_p.A270V|FKBP8_uc002njj.1_Missense_Mutation_p.A242V|FKBP8_uc002njl.1_Missense_Mutation_p.A242V|FKBP8_uc002njm.1_Missense_Mutation_p.A241V|FKBP8_uc010ebr.1_Missense_Mutation_p.A80V|FKBP8_uc002njn.2_RNA	NM_012181	NP_036313	Q14318	FKBP8_HUMAN	FK506-binding protein 8	241	TPR 1.				apoptosis|interspecies interaction between organisms|intracellular signal transduction|protein folding	integral to endoplasmic reticulum membrane|mitochondrial membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity|protein binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	18649073	18649073	6152	19	G	A	A	42	42	FKBP8	A	2	2
ZNF85	7639	broad.mit.edu	37	19	21131712	21131712	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21131712G>T	uc002npg.3	+	4	519	c.392G>T	c.(391-393)TGT>TTT	p.C131F	ZNF85_uc010ecn.2_Missense_Mutation_p.C66F|ZNF85_uc010eco.2_Missense_Mutation_p.C79F|ZNF85_uc002npi.2_Missense_Mutation_p.C72F	NM_003429	NP_003420	Q03923	ZNF85_HUMAN	zinc finger protein 85	131						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	21131712	21131712	18795	19	G	T	T	48	48	ZNF85	T	2	2
ZNF714	148206	broad.mit.edu	37	19	21300186	21300186	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21300186A>G	uc002npo.3	+	6	1079	c.719A>G	c.(718-720)CAT>CGT	p.H240R	ZNF714_uc002npl.2_Missense_Mutation_p.H85R|ZNF714_uc010ecp.1_Missense_Mutation_p.H191R|ZNF714_uc002npn.2_RNA	NM_182515	NP_872321	Q96N38	ZN714_HUMAN	zinc finger protein 714	240	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	21300186	21300186	18714	19	A	G	G	8	8	ZNF714	G	4	4
ZNF599	148103	broad.mit.edu	37	19	35250747	35250747	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35250747A>G	uc010edn.1	-	4	1347	c.959T>C	c.(958-960)TTT>TCT	p.F320S	ZNF599_uc010edm.1_Missense_Mutation_p.F283S	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	zinc finger protein 599	320	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)															---	---	---	---	capture		Missense_Mutation	SNP	35250747	35250747	18624	19	A	G	G	1	1	ZNF599	G	4	4
HKR1	284459	broad.mit.edu	37	19	37854631	37854631	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37854631G>C	uc002ogb.2	+	6	2203	c.1934G>C	c.(1933-1935)AGT>ACT	p.S645T	HKR1_uc002ofx.2_Missense_Mutation_p.S361T|HKR1_uc002ofy.2_Missense_Mutation_p.S361T|HKR1_uc002oga.2_Missense_Mutation_p.S627T|HKR1_uc010xto.1_Missense_Mutation_p.S627T|HKR1_uc002ogc.2_Missense_Mutation_p.S626T|HKR1_uc010xtp.1_Missense_Mutation_p.S584T|HKR1_uc002ogd.2_Missense_Mutation_p.S584T	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	645	C2H2-type 13.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)															---	---	---	---	capture		Missense_Mutation	SNP	37854631	37854631	7485	19	G	C	C	36	36	HKR1	C	3	3
CEACAM21	90273	broad.mit.edu	37	19	42085944	42085944	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42085944C>A	uc002ore.3	+	3	759	c.663C>A	c.(661-663)AGC>AGA	p.S221R	CEACAM21_uc002orc.1_RNA|CEACAM21_uc002ord.1_RNA|CEACAM21_uc002orf.2_RNA|CEACAM21_uc002org.3_Missense_Mutation_p.S221R	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion	221	Ig-like C2-type.|Extracellular (Potential).					integral to membrane				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	42085944	42085944	3325	19	C	A	A	28	28	CEACAM21	A	2	2
PSG6	5675	broad.mit.edu	37	19	43529139	43529139	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43529139A>T	uc002ovh.1	-	2	241	c.152T>A	c.(151-153)GTG>GAG	p.V51E	PSG11_uc002ouw.2_Missense_Mutation_p.V51E|PSG10_uc002ouv.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.V51E|PSG11_uc002ovm.1_Missense_Mutation_p.V45E|PSG11_uc002ovn.1_Missense_Mutation_p.V51E|PSG11_uc002ovo.1_Intron|PSG11_uc002ovp.1_Intron			Q00889	PSG6_HUMAN	SubName: Full=Putative uncharacterized protein PSG6;	45	Ig-like V-type.				female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00899)																---	---	---	---	capture		Missense_Mutation	SNP	43529139	43529139	13112	19	A	T	T	6	6	PSG6	T	4	4
CEACAM16	388551	broad.mit.edu	37	19	45211185	45211185	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45211185C>A	uc010xxd.1	+	6	1199	c.993C>A	c.(991-993)GGC>GGA	p.G331G	CEACAM16_uc002ozq.2_Silent_p.G390G	NM_001039213	NP_001034302	A7LI12	A7LI12_HUMAN	carcinoembryonic antigen-related cell adhesion	331										ovary(1)	1	Lung NSC(12;0.000698)|all_lung(12;0.002)	Prostate(69;0.0376)|Ovarian(192;0.231)																---	---	---	---	capture		Silent	SNP	45211185	45211185	3321	19	C	A	A	26	26	CEACAM16	A	2	2
FOSB	2354	broad.mit.edu	37	19	45975850	45975850	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45975850G>T	uc002pbx.3	+	4	1189	c.597G>T	c.(595-597)TCG>TCT	p.S199S	ERCC1_uc002pbu.1_Intron|FOSB_uc010eke.2_Silent_p.S124S|FOSB_uc002pby.3_Silent_p.S163S|FOSB_uc010eka.1_Silent_p.S160S|FOSB_uc010ekb.1_Silent_p.S199S|FOSB_uc010ekc.1_Silent_p.S56S|FOSB_uc010ekf.2_Silent_p.S160S|FOSB_uc010ekd.1_Silent_p.S163S|FOSB_uc010ekg.2_Silent_p.S56S|FOSB_uc002pca.3_Silent_p.S150S	NM_006732	NP_006723	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	199	Leucine-zipper.				behavior|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(2)|lung(1)	3		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)														---	---	---	---	capture		Silent	SNP	45975850	45975850	6228	19	G	T	T	39	39	FOSB	T	1	1
LIG1	3978	broad.mit.edu	37	19	48624466	48624466	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48624466G>T	uc002pia.1	-	24	2466	c.2346C>A	c.(2344-2346)TCC>TCA	p.S782S	LIG1_uc010xze.1_Silent_p.S475S|LIG1_uc002phz.1_RNA|LIG1_uc002pib.1_RNA|LIG1_uc010xzf.1_Silent_p.S714S|LIG1_uc010xzg.1_Silent_p.S751S	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I	782					anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)								NER					---	---	---	---	capture		Silent	SNP	48624466	48624466	9107	19	G	T	T	35	35	LIG1	T	2	2
CCDC155	147872	broad.mit.edu	37	19	49901368	49901368	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49901368G>T	uc002pnm.1	+	7	771	c.597G>T	c.(595-597)GAG>GAT	p.E199D	CCDC155_uc002pnl.1_Missense_Mutation_p.E199D|CCDC155_uc010emx.1_Missense_Mutation_p.E172D	NM_144688	NP_653289	Q8N6L0	CC155_HUMAN	coiled-coil domain containing 155	199	Potential.					integral to membrane	calcium ion binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	49901368	49901368	2910	19	G	T	T	35	35	CCDC155	T	2	2
PRR12	57479	broad.mit.edu	37	19	50099409	50099409	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50099409G>T	uc002poo.3	+	4	1817	c.1817G>T	c.(1816-1818)GGC>GTC	p.G606V		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)														---	---	---	---	capture		Missense_Mutation	SNP	50099409	50099409	13027	19	G	T	T	42	42	PRR12	T	2	2
SHANK1	50944	broad.mit.edu	37	19	51192460	51192460	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51192460C>A	uc002psx.1	-	15	2060	c.2041G>T	c.(2041-2043)GCC>TCC	p.A681S	SHANK1_uc002psw.1_Missense_Mutation_p.A65S	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	681	PDZ.				cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)														---	---	---	---	capture		Missense_Mutation	SNP	51192460	51192460	14756	19	C	A	A	26	26	SHANK1	A	2	2
ZNF701	55762	broad.mit.edu	37	19	53085781	53085781	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53085781G>A	uc002pzs.1	+	4	596	c.469G>A	c.(469-471)GAA>AAA	p.E157K	ZNF701_uc010ydn.1_Missense_Mutation_p.E223K	NM_018260	NP_060730	Q9NV72	ZN701_HUMAN	zinc finger protein 701	157					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)														---	---	---	---	capture		Missense_Mutation	SNP	53085781	53085781	18700	19	G	A	A	37	37	ZNF701	A	1	1
MBOAT7	79143	broad.mit.edu	37	19	54687471	54687471	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54687471C>T	uc002qdq.2	-	6	692	c.426G>A	c.(424-426)CTG>CTA	p.L142L	MBOAT7_uc010erg.2_5'UTR|MBOAT7_uc010yem.1_Silent_p.L124L|MBOAT7_uc002qdr.2_Silent_p.L142L|MBOAT7_uc002qds.2_Silent_p.L69L|MBOAT7_uc010yen.1_Silent_p.L69L|MBOAT7_uc002qdt.3_Silent_p.L142L	NM_024298	NP_077274	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain	142					phospholipid biosynthetic process	integral to membrane	acyltransferase activity				0	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)																	---	---	---	---	capture		Silent	SNP	54687471	54687471	9747	19	C	T	T	25	25	MBOAT7	T	2	2
PTPRH	5794	broad.mit.edu	37	19	55711656	55711656	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55711656C>A	uc002qjq.2	-	7	1441	c.1368G>T	c.(1366-1368)TGG>TGT	p.W456C	PTPRH_uc010esv.2_Missense_Mutation_p.W278C|PTPRH_uc002qjs.2_Missense_Mutation_p.W463C	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	456	Extracellular (Potential).|Fibronectin type-III 5.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)														---	---	---	---	capture		Missense_Mutation	SNP	55711656	55711656	13260	19	C	A	A	22	22	PTPRH	A	2	2
ZSCAN5B	342933	broad.mit.edu	37	19	56701730	56701730	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56701730C>A	uc010ygh.1	-	4	954	c.954G>T	c.(952-954)GTG>GTT	p.V318V		NM_001080456	NP_001073925	A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	318					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2																		---	---	---	---	capture		Silent	SNP	56701730	56701730	18843	19	C	A	A	21	21	ZSCAN5B	A	2	2
ZNF835	90485	broad.mit.edu	37	19	57175601	57175601	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57175601G>A	uc010ygo.1	-	2	1032	c.1032C>T	c.(1030-1032)GCC>GCT	p.A344A	ZNF835_uc010ygn.1_Silent_p.A322A	NM_001005850	NP_001005850			zinc finger protein 835									p.G334fs*26(1)		pancreas(3)|skin(1)	4																		---	---	---	---	capture		Silent	SNP	57175601	57175601	18785	19	G	A	A	39	39	ZNF835	A	1	1
ZNF586	54807	broad.mit.edu	37	19	58290273	58290273	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58290273C>T	uc002qqd.2	+	3	504	c.318C>T	c.(316-318)CCC>CCT	p.P106P	ZNF587_uc002qqb.2_Intron|ZNF586_uc002qqe.2_Missense_Mutation_p.P64L|ZNF586_uc010euh.2_Silent_p.P63P|ZNF586_uc002qqf.1_Intron	NM_017652	NP_060122	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	106	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)														---	---	---	---	capture		Silent	SNP	58290273	58290273	18614	19	C	T	T	21	21	ZNF586	T	2	2
ZNF544	27300	broad.mit.edu	37	19	58773968	58773968	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58773968G>T	uc010euo.2	+	7	2470	c.1996G>T	c.(1996-1998)GGG>TGG	p.G666W	ZNF544_uc010yhw.1_RNA|ZNF544_uc010yhx.1_Missense_Mutation_p.G638W|ZNF544_uc010yhy.1_Missense_Mutation_p.G638W|ZNF544_uc002qrt.3_Missense_Mutation_p.G524W|ZNF544_uc002qru.3_Missense_Mutation_p.G524W|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	666	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)														---	---	---	---	capture		Missense_Mutation	SNP	58773968	58773968	18572	19	G	T	T	47	47	ZNF544	T	2	2
ZNF446	55663	broad.mit.edu	37	19	58991863	58991863	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58991863C>T	uc002qsz.2	+	7	1240	c.1123C>T	c.(1123-1125)CCA>TCA	p.P375S	ZNF446_uc002qta.2_3'UTR|ZNF446_uc010eur.2_3'UTR|SLC27A5_uc002qtb.2_RNA	NM_017908	NP_060378	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	375					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)														---	---	---	---	capture		Missense_Mutation	SNP	58991863	58991863	18512	19	C	T	T	18	18	ZNF446	T	2	2
SMC6	79677	broad.mit.edu	37	2	17906556	17906556	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17906556T>C	uc002rco.2	-	9	990	c.694A>G	c.(694-696)AGA>GGA	p.R232G	SMC6_uc010exo.2_Missense_Mutation_p.R232G|SMC6_uc002rcn.2_Missense_Mutation_p.R232G|SMC6_uc002rcp.1_Missense_Mutation_p.R258G|SMC6_uc002rcq.2_Missense_Mutation_p.R258G|SMC6_uc002rcr.1_Missense_Mutation_p.R232G	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein	232	Potential.				DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)																	---	---	---	---	capture		Missense_Mutation	SNP	17906556	17906556	15285	2	T	C	C	56	56	SMC6	C	4	4
APOB	338	broad.mit.edu	37	2	21232746	21232746	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21232746C>T	uc002red.2	-	26	7122	c.6994G>A	c.(6994-6996)GAG>AAG	p.E2332K		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2332					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)													---	---	---	---	capture		Missense_Mutation	SNP	21232746	21232746	796	2	C	T	T	29	29	APOB	T	2	2
ITSN2	50618	broad.mit.edu	37	2	24480804	24480804	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24480804G>T	uc002rfe.2	-	23	3099	c.2841C>A	c.(2839-2841)CCC>CCA	p.P947P	ITSN2_uc002rff.2_Silent_p.P920P|ITSN2_uc002rfg.2_Silent_p.P947P|ITSN2_uc002rfh.1_RNA	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1	947	SH3 2.			WFPKSYV -> EFAAAST (in Ref. 7; AAC50593).	endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Silent	SNP	24480804	24480804	8231	2	G	T	T	47	47	ITSN2	T	2	2
DPYSL5	56896	broad.mit.edu	37	2	27121593	27121593	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27121593G>T	uc002rhu.3	+	2	384	c.226G>T	c.(226-228)GCC>TCC	p.A76S	DPYSL5_uc002rhv.3_Missense_Mutation_p.A76S	NM_020134	NP_064519	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	76					axon guidance|pyrimidine base catabolic process|signal transduction	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Missense_Mutation	SNP	27121593	27121593	4934	2	G	T	T	46	46	DPYSL5	T	2	2
ZNF513	130557	broad.mit.edu	37	2	27601613	27601613	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27601613C>A	uc002rkk.2	-	3	720	c.520G>T	c.(520-522)GGA>TGA	p.G174*	ZNF513_uc002rkj.2_Nonsense_Mutation_p.G112*	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	174					regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)																	---	---	---	---	capture		Nonsense_Mutation	SNP	27601613	27601613	18552	2	C	A	A	23	23	ZNF513	A	5	1
C2orf16	84226	broad.mit.edu	37	2	27800671	27800671	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27800671T>A	uc002rkz.3	+	1	1283	c.1232T>A	c.(1231-1233)CTA>CAA	p.L411Q		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	411										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---	capture		Missense_Mutation	SNP	27800671	27800671	2243	2	T	A	A	53	53	C2orf16	A	4	4
C2orf16	84226	broad.mit.edu	37	2	27801331	27801331	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27801331G>A	uc002rkz.3	+	1	1943	c.1892G>A	c.(1891-1893)TGT>TAT	p.C631Y		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	631										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---	capture		Missense_Mutation	SNP	27801331	27801331	2243	2	G	A	A	48	48	C2orf16	A	2	2
SLC4A1AP	22950	broad.mit.edu	37	2	27887973	27887973	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27887973G>T	uc002rlk.3	+	2	1114	c.832G>T	c.(832-834)GAG>TAG	p.E278*	SUPT7L_uc002rlh.1_5'Flank|SUPT7L_uc002rli.1_5'Flank|SUPT7L_uc010ymf.1_5'Flank|SUPT7L_uc002rlj.1_5'Flank|SUPT7L_uc010ezh.1_5'Flank	NM_018158	NP_060628	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger),	278						cytoplasm|nucleus	double-stranded RNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)																	---	---	---	---	capture		Nonsense_Mutation	SNP	27887973	27887973	15150	2	G	T	T	33	33	SLC4A1AP	T	5	2
PLEKHH2	130271	broad.mit.edu	37	2	43927638	43927638	+	Missense_Mutation	SNP	A	G	G	rs144437669		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43927638A>G	uc010yny.1	+	8	1624	c.1541A>G	c.(1540-1542)TAT>TGT	p.Y514C	PLEKHH2_uc002rte.3_Missense_Mutation_p.Y514C|PLEKHH2_uc002rtf.3_Missense_Mutation_p.Y513C	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	514						cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)																---	---	---	---	capture		Missense_Mutation	SNP	43927638	43927638	12503	2	A	G	G	16	16	PLEKHH2	G	4	4
MSH6	2956	broad.mit.edu	37	2	48027187	48027187	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48027187T>G	uc002rwd.3	+	4	2217	c.2065T>G	c.(2065-2067)TTC>GTC	p.F689V	MSH6_uc002rwc.2_Missense_Mutation_p.F689V|MSH6_uc010fbj.2_Missense_Mutation_p.F387V|MSH6_uc010yoi.1_Missense_Mutation_p.F559V|MSH6_uc010yoj.1_Missense_Mutation_p.F387V	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	689					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|central_nervous_system(28)|endometrium(28)|stomach(22)|haematopoietic_and_lymphoid_tissue(9)|lung(7)|skin(6)|urinary_tract(5)|breast(5)|ovary(3)|thyroid(1)|upper_aerodigestive_tract(1)	168		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)					Mis|N|F|S		colorectal	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				---	---	---	---	capture		Missense_Mutation	SNP	48027187	48027187	10267	2	T	G	G	56	56	MSH6	G	4	4
FANCL	55120	broad.mit.edu	37	2	58392929	58392929	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58392929G>T	uc002rzw.3	-	8	688	c.621C>A	c.(619-621)ATC>ATA	p.I207I	FANCL_uc002rzx.3_Silent_p.I212I|FANCL_uc010fce.2_Silent_p.I207I|FANCL_uc010fcf.1_Silent_p.I148I	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform	207					DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2													Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---	capture		Silent	SNP	58392929	58392929	5906	2	G	T	T	37	37	FANCL	T	1	1
C2orf86	51057	broad.mit.edu	37	2	63720003	63720003	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63720003G>T	uc002sch.2	-	2	593	c.147C>A	c.(145-147)ACC>ACA	p.T49T	C2orf86_uc002sci.1_Silent_p.T25T	NM_015910	NP_056994	O95876	FRITZ_HUMAN	hypothetical protein LOC51057 isoform 2	49					cilium morphogenesis|regulation of embryonic cell shape|regulation of protein localization|septin cytoskeleton organization	cilium axoneme|cytoplasm|cytoskeleton|plasma membrane					0																		---	---	---	---	capture		Silent	SNP	63720003	63720003	2293	2	G	T	T	35	35	C2orf86	T	2	2
DYSF	8291	broad.mit.edu	37	2	71883310	71883310	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71883310G>T	uc002sie.2	+	42	4904	c.4528G>T	c.(4528-4530)GAG>TAG	p.E1510*	DYSF_uc010feg.2_Nonsense_Mutation_p.E1541*|DYSF_uc010feh.2_Nonsense_Mutation_p.E1517*|DYSF_uc002sig.3_Nonsense_Mutation_p.E1496*|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Nonsense_Mutation_p.E1531*|DYSF_uc010fef.2_Nonsense_Mutation_p.E1548*|DYSF_uc010fei.2_Nonsense_Mutation_p.E1527*|DYSF_uc010fek.2_Nonsense_Mutation_p.E1528*|DYSF_uc010fej.2_Nonsense_Mutation_p.E1518*|DYSF_uc010fel.2_Nonsense_Mutation_p.E1497*|DYSF_uc010feo.2_Nonsense_Mutation_p.E1542*|DYSF_uc010fem.2_Nonsense_Mutation_p.E1532*|DYSF_uc010fen.2_Nonsense_Mutation_p.E1549*|DYSF_uc002sif.2_Nonsense_Mutation_p.E1511*|DYSF_uc010yqy.1_Nonsense_Mutation_p.E391*|DYSF_uc010yqz.1_Nonsense_Mutation_p.E271*	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	1510	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7																		---	---	---	---	capture		Nonsense_Mutation	SNP	71883310	71883310	5045	2	G	T	T	41	41	DYSF	T	5	2
ALMS1	7840	broad.mit.edu	37	2	73762076	73762076	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73762076G>T	uc002sje.1	+	14	10021	c.9910G>T	c.(9910-9912)GGA>TGA	p.G3304*	ALMS1_uc002sjf.1_Nonsense_Mutation_p.G3260*|ALMS1_uc002sjg.2_Nonsense_Mutation_p.G2690*|ALMS1_uc002sjh.1_Nonsense_Mutation_p.G2690*|ALMS1_uc010fev.1_Missense_Mutation_p.D119Y	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	3302					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9																		---	---	---	---	capture		Nonsense_Mutation	SNP	73762076	73762076	538	2	G	T	T	35	35	ALMS1	T	5	2
LRRTM4	80059	broad.mit.edu	37	2	77746050	77746050	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746050G>A	uc002snr.2	-	3	1360	c.945C>T	c.(943-945)TGC>TGT	p.C315C	LRRTM4_uc002snq.2_Silent_p.C315C|LRRTM4_uc002sns.2_Silent_p.C315C|LRRTM4_uc002snt.2_Silent_p.C316C	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	315	LRRCT.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---	capture		Silent	SNP	77746050	77746050	9418	2	G	A	A	46	46	LRRTM4	A	2	2
LRRTM4	80059	broad.mit.edu	37	2	77746622	77746622	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746622G>C	uc002snr.2	-	3	788	c.373C>G	c.(373-375)CAC>GAC	p.H125D	LRRTM4_uc002snq.2_Missense_Mutation_p.H125D|LRRTM4_uc002sns.2_Missense_Mutation_p.H125D|LRRTM4_uc002snt.2_Missense_Mutation_p.H126D	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	125	LRR 3.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)														---	---	---	---	capture		Missense_Mutation	SNP	77746622	77746622	9418	2	G	C	C	46	46	LRRTM4	C	3	3
TGOLN2	10618	broad.mit.edu	37	2	85554416	85554416	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85554416G>T	uc010fgd.1	-	2	728	c.439C>A	c.(439-441)CCA>ACA	p.P147T	TGOLN2_uc002soz.2_Missense_Mutation_p.P147T|TGOLN2_uc002spa.2_Intron|TGOLN2_uc002spb.2_Missense_Mutation_p.P147T|TGOLN2_uc002spc.1_Missense_Mutation_p.P147T	NM_006464	NP_006455	O43493	TGON2_HUMAN	trans-golgi network protein 2	147	Extracellular (Potential).|7.|14 X 14 AA tandem repeats.					integral to membrane|nucleus|plasma membrane|trans-Golgi network|transport vesicle	protein binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	85554416	85554416	16364	2	G	T	T	43	43	TGOLN2	T	2	2
TGOLN2	10618	broad.mit.edu	37	2	85554612	85554612	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85554612G>T	uc010fgd.1	-	2	532	c.243C>A	c.(241-243)CCC>CCA	p.P81P	TGOLN2_uc002soz.2_Silent_p.P81P|TGOLN2_uc002spa.2_Intron|TGOLN2_uc002spb.2_Silent_p.P81P|TGOLN2_uc002spc.1_Silent_p.P81P	NM_006464	NP_006455	O43493	TGON2_HUMAN	trans-golgi network protein 2	81	Extracellular (Potential).|14 X 14 AA tandem repeats.|2.					integral to membrane|nucleus|plasma membrane|trans-Golgi network|transport vesicle	protein binding				0																		---	---	---	---	capture		Silent	SNP	85554612	85554612	16364	2	G	T	T	47	47	TGOLN2	T	2	2
POLR1A	25885	broad.mit.edu	37	2	86292414	86292414	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86292414G>A	uc002sqs.2	-	14	2420	c.2041C>T	c.(2041-2043)CTG>TTG	p.L681L	POLR1A_uc010ytb.1_Silent_p.L47L	NM_015425	NP_056240	O95602	RPA1_HUMAN	DNA-directed RNA polymerase I A	681					termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription initiation from RNA polymerase I promoter	DNA-directed RNA polymerase I complex|nucleoplasm	DNA binding|DNA-directed RNA polymerase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3																		---	---	---	---	capture		Silent	SNP	86292414	86292414	12637	2	G	A	A	34	34	POLR1A	A	2	2
REEP1	65055	broad.mit.edu	37	2	86509349	86509349	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86509349G>T	uc002srh.3	-	2	193	c.49C>A	c.(49-51)CTT>ATT	p.L17I	REEP1_uc010ytg.1_5'UTR|REEP1_uc010yth.1_Intron|REEP1_uc010yti.1_Missense_Mutation_p.L17I	NM_022912	NP_075063	Q9H902	REEP1_HUMAN	receptor accessory protein 1 isoform 2	17	Helical; (Potential).				cell death|protein insertion into membrane	integral to membrane|mitochondrial membrane	olfactory receptor binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	86509349	86509349	13673	2	G	T	T	35	35	REEP1	T	2	2
RMND5A	64795	broad.mit.edu	37	2	86980655	86980655	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86980655G>T	uc010ytm.1	+	4	872	c.495G>T	c.(493-495)AAG>AAT	p.K165N	RMND5A_uc002srs.3_Intron|RMND5A_uc002srr.2_Missense_Mutation_p.K165N	NM_022780	NP_073617	Q9H871	RMD5A_HUMAN	required for meiotic nuclear division 5 homolog	165	CTLH.									ovary(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	86980655	86980655	13874	2	G	T	T	35	35	RMND5A	T	2	2
SMYD1	150572	broad.mit.edu	37	2	88396284	88396284	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88396284G>T	uc002ssr.2	+	6	871	c.869G>T	c.(868-870)GGG>GTG	p.G290V	SMYD1_uc002ssq.1_Intron|SMYD1_uc002sss.2_5'UTR	NM_198274	NP_938015	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	290					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	88396284	88396284	15321	2	G	T	T	43	43	SMYD1	T	2	2
FER1L5	90342	broad.mit.edu	37	2	97370014	97370014	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97370014G>T	uc010fia.2	+	51	5972	c.5972G>T	c.(5971-5973)TGG>TTG	p.W1991L	FER1L5_uc002sws.3_Missense_Mutation_p.W700L|FER1L5_uc002swt.3_Missense_Mutation_p.W700L|FER1L5_uc010yus.1_Missense_Mutation_p.W699L	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1991						integral to membrane				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	97370014	97370014	6051	2	G	T	T	47	47	FER1L5	T	2	2
CNNM4	26504	broad.mit.edu	37	2	97427870	97427870	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97427870C>A	uc002swx.2	+	1	1232	c.1134C>A	c.(1132-1134)ACC>ACA	p.T378T		NM_020184	NP_064569	Q6P4Q7	CNNM4_HUMAN	cyclin M4	378	CBS 1.				biomineral tissue development|ion transport|response to stimulus|visual perception	integral to membrane|plasma membrane				breast(2)|ovary(1)	3																		---	---	---	---	capture		Silent	SNP	97427870	97427870	3753	2	C	A	A	22	22	CNNM4	A	2	2
MAP4K4	9448	broad.mit.edu	37	2	102314986	102314986	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102314986G>T	uc002tbg.2	+	2	164	c.109G>T	c.(109-111)GGA>TGA	p.G37*	MAP4K4_uc002tbc.2_Nonsense_Mutation_p.G37*|MAP4K4_uc002tbd.2_Nonsense_Mutation_p.G37*|MAP4K4_uc002tbe.2_Nonsense_Mutation_p.G37*|MAP4K4_uc002tbf.2_Nonsense_Mutation_p.G37*|MAP4K4_uc010yvy.1_Nonsense_Mutation_p.G37*|MAP4K4_uc002tbh.2_Nonsense_Mutation_p.G37*|MAP4K4_uc002tbi.2_Nonsense_Mutation_p.G37*	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	37	Protein kinase.|ATP (By similarity).				intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4																		---	---	---	---	capture		Nonsense_Mutation	SNP	102314986	102314986	9645	2	G	T	T	47	47	MAP4K4	T	5	2
SLC9A4	389015	broad.mit.edu	37	2	103141605	103141605	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103141605G>T	uc002tbz.3	+	10	2398	c.1941G>T	c.(1939-1941)TGG>TGT	p.W647C		NM_001011552	NP_001011552	Q6AI14	SL9A4_HUMAN	solute carrier family 9 (sodium/hydrogen	647	Cytoplasmic (Potential).				regulation of pH	apical plasma membrane|basolateral plasma membrane|integral to membrane	sodium:hydrogen antiporter activity			skin(2)|central_nervous_system(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	103141605	103141605	15213	2	G	T	T	43	43	SLC9A4	T	2	2
TMEM182	130827	broad.mit.edu	37	2	103378725	103378725	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103378725G>T	uc010fjb.2	+	1	236	c.49G>T	c.(49-51)GGG>TGG	p.G17W	TMEM182_uc002tcc.3_Intron|TMEM182_uc002tcd.3_Intron	NM_144632	NP_653233	Q6ZP80	TM182_HUMAN	transmembrane protein 182 precursor	17						integral to membrane					0																		---	---	---	---	capture		Missense_Mutation	SNP	103378725	103378725	16635	2	G	T	T	43	43	TMEM182	T	2	2
RANBP2	5903	broad.mit.edu	37	2	109379712	109379712	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109379712A>G	uc002tem.3	+	20	2843	c.2717A>G	c.(2716-2718)AAT>AGT	p.N906S		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	906					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18																		---	---	---	---	capture		Missense_Mutation	SNP	109379712	109379712	13488	2	A	G	G	4	4	RANBP2	G	4	4
BUB1	699	broad.mit.edu	37	2	111399358	111399358	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111399358C>A	uc002tgc.2	-	21	2598	c.2486G>T	c.(2485-2487)TGG>TTG	p.W829L	BUB1_uc010yxh.1_Missense_Mutation_p.W809L|BUB1_uc010fkb.2_Missense_Mutation_p.W829L	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	829	Protein kinase.				apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)														---	---	---	---	capture		Missense_Mutation	SNP	111399358	111399358	1604	2	C	A	A	21	21	BUB1	A	2	2
IL1F6	27179	broad.mit.edu	37	2	113764235	113764235	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113764235C>A	uc010yxr.1	+	3	185	c.185C>A	c.(184-186)CCC>CAC	p.P62H		NM_014440	NP_055255	Q9UHA7	IL36A_HUMAN	interleukin 1 family, member 6 (epsilon)	62					immune response|inflammatory response	extracellular space	cytokine activity|interleukin-1 receptor binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	113764235	113764235	7955	2	C	A	A	22	22	IL1F6	A	2	2
SAP130	79595	broad.mit.edu	37	2	128767876	128767876	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128767876G>A	uc002tpp.2	-	7	1046	c.914C>T	c.(913-915)ACG>ATG	p.T305M	SAP130_uc002tpn.2_Missense_Mutation_p.T66M|SAP130_uc002tpo.2_Missense_Mutation_p.T50M|SAP130_uc010fmd.2_Missense_Mutation_p.T305M|SAP130_uc002tpq.1_Missense_Mutation_p.T279M	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	305					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)														---	---	---	---	capture		Missense_Mutation	SNP	128767876	128767876	14311	2	G	A	A	40	40	SAP130	A	1	1
TUBA3D	113457	broad.mit.edu	37	2	132237812	132237812	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132237812G>T	uc002tsu.3	+	4	653	c.546G>T	c.(544-546)GTG>GTT	p.V182V		NM_080386	NP_525125	Q13748	TBA3C_HUMAN	tubulin, alpha 3d	182					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(221;0.13)														---	---	---	---	capture		Silent	SNP	132237812	132237812	17302	2	G	T	T	47	47	TUBA3D	T	2	2
LRP1B	53353	broad.mit.edu	37	2	141055395	141055395	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055395C>A	uc002tvj.1	-	84	13921	c.12949G>T	c.(12949-12951)GGA>TGA	p.G4317*		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4317	Extracellular (Potential).|EGF-like 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)											TSP Lung(27;0.18)			---	---	---	---	capture		Nonsense_Mutation	SNP	141055395	141055395	9328	2	C	A	A	23	23	LRP1B	A	5	1
XIRP2	129446	broad.mit.edu	37	2	168107064	168107064	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107064C>A	uc002udx.2	+	8	9180	c.9162C>A	c.(9160-9162)TCC>TCA	p.S3054S	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.S2879S|XIRP2_uc010fpq.2_Silent_p.S2832S|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2879					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14																		---	---	---	---	capture		Silent	SNP	168107064	168107064	18011	2	C	A	A	21	21	XIRP2	A	2	2
HOXD10	3236	broad.mit.edu	37	2	176983941	176983941	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176983941C>A	uc002ukj.2	+	2	1075	c.1005C>A	c.(1003-1005)GCC>GCA	p.A335A		NM_002148	NP_002139	P28358	HXD10_HUMAN	homeobox D10	335						nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)														---	---	---	---	capture		Silent	SNP	176983941	176983941	7611	2	C	A	A	21	21	HOXD10	A	2	2
HOXD8	3234	broad.mit.edu	37	2	176995506	176995506	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176995506G>T	uc002uko.2	+	1	1030	c.412G>T	c.(412-414)GGA>TGA	p.G138*	uc002ukl.1_5'Flank|uc002ukm.1_5'Flank|HOXD8_uc002ukn.2_Intron|HOXD8_uc002ukp.2_Nonsense_Mutation_p.G138*	NM_019558	NP_062458	P13378	HXD8_HUMAN	homeobox D8	138					anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)														---	---	---	---	capture		Nonsense_Mutation	SNP	176995506	176995506	7617	2	G	T	T	39	39	HOXD8	T	5	1
NFE2L2	4780	broad.mit.edu	37	2	178098960	178098960	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098960C>G	uc002ulh.3	-	2	640	c.85G>C	c.(85-87)GAT>CAT	p.D29H	NFE2L2_uc002ulg.3_Missense_Mutation_p.D13H|NFE2L2_uc010zfa.1_Missense_Mutation_p.D13H|NFE2L2_uc002uli.3_Missense_Mutation_p.D13H|NFE2L2_uc010fra.2_Missense_Mutation_p.D13H|NFE2L2_uc010frb.2_Missense_Mutation_p.D13H	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	29					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)					Mis		NSCLC|HNSCC					HNSCC(56;0.16)			---	---	---	---	capture		Missense_Mutation	SNP	178098960	178098960	10768	2	C	G	G	32	32	NFE2L2	G	3	3
TTC30B	150737	broad.mit.edu	37	2	178415699	178415699	+	Nonsense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178415699G>C	uc002uln.2	-	1	1826	c.1793C>G	c.(1792-1794)TCA>TGA	p.S598*	TTC30B_uc010zfc.1_Nonsense_Mutation_p.S370*	NM_152517	NP_689730	Q8N4P2	TT30B_HUMAN	tetratricopeptide repeat domain 30B	598					cell projection organization	cilium	binding				0			OV - Ovarian serous cystadenocarcinoma(117;0.00151)|Epithelial(96;0.00931)|all cancers(119;0.0362)															---	---	---	---	capture		Nonsense_Mutation	SNP	178415699	178415699	17254	2	G	C	C	45	45	TTC30B	C	5	3
SLC39A10	57181	broad.mit.edu	37	2	196599664	196599664	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196599664G>T	uc002utg.3	+	10	2609	c.2395G>T	c.(2395-2397)GGG>TGG	p.G799W	SLC39A10_uc002uth.3_Missense_Mutation_p.G799W|SLC39A10_uc010zgp.1_Missense_Mutation_p.G349W	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	799					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)															---	---	---	---	capture		Missense_Mutation	SNP	196599664	196599664	15110	2	G	T	T	43	43	SLC39A10	T	2	2
HECW2	57520	broad.mit.edu	37	2	197157413	197157413	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197157413C>A	uc002utm.1	-	14	3059	c.2876G>T	c.(2875-2877)AGG>ATG	p.R959M	HECW2_uc002utl.1_Missense_Mutation_p.R603M	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	959	Interaction with TP73.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18																		---	---	---	---	capture		Missense_Mutation	SNP	197157413	197157413	7326	2	C	A	A	24	24	HECW2	A	2	2
PLCL1	5334	broad.mit.edu	37	2	198949015	198949015	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198949015T>C	uc010fsp.2	+	2	1065	c.774T>C	c.(772-774)ATT>ATC	p.I258I	PLCL1_uc002uuv.3_Silent_p.I179I	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	258					intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)													---	---	---	---	capture		Silent	SNP	198949015	198949015	12465	2	T	C	C	61	61	PLCL1	C	4	4
ANKZF1	55139	broad.mit.edu	37	2	220099610	220099610	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220099610G>T	uc002vkg.2	+	10	1441	c.1267G>T	c.(1267-1269)GGG>TGG	p.G423W	ANKZF1_uc010zkv.1_3'UTR|ANKZF1_uc010zkw.1_3'UTR|ANKZF1_uc002vkh.2_Missense_Mutation_p.G213W|ANKZF1_uc002vki.2_Missense_Mutation_p.G423W|ANKZF1_uc002vkj.1_3'UTR	NM_018089	NP_060559	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing	423						intracellular	zinc ion binding			ovary(2)	2		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)														---	---	---	---	capture		Missense_Mutation	SNP	220099610	220099610	701	2	G	T	T	43	43	ANKZF1	T	2	2
INHA	3623	broad.mit.edu	37	2	220439980	220439980	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220439980G>T	uc002vmk.1	+	2	977	c.833G>T	c.(832-834)CGG>CTG	p.R278L		NM_002191	NP_002182	P05111	INHA_HUMAN	inhibin alpha subunit precursor	278					cell cycle arrest|cell surface receptor linked signaling pathway|cell-cell signaling|erythrocyte differentiation|hemoglobin biosynthetic process|induction of apoptosis|negative regulation of B cell differentiation|negative regulation of follicle-stimulating hormone secretion|negative regulation of interferon-gamma biosynthetic process|negative regulation of macrophage differentiation|negative regulation of phosphorylation|nervous system development|ovarian follicle development|positive regulation of follicle-stimulating hormone secretion|regulation of cell proliferation|response to external stimulus|skeletal system development	inhibin A complex|inhibin-betaglycan-ActRII complex	cytokine activity|growth factor activity|hormone activity|signal transducer activity			ovary(1)	1		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)														---	---	---	---	capture		Missense_Mutation	SNP	220439980	220439980	8041	2	G	T	T	39	39	INHA	T	1	1
COL4A3	1285	broad.mit.edu	37	2	228148491	228148491	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228148491G>T	uc002vom.1	+	33	2827	c.2665G>T	c.(2665-2667)GGA>TGA	p.G889*	COL4A3_uc002von.1_Nonsense_Mutation_p.G889*|COL4A3_uc002voo.1_Nonsense_Mutation_p.G889*|COL4A3_uc002vop.1_Nonsense_Mutation_p.G889*|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	889	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)														---	---	---	---	capture		Nonsense_Mutation	SNP	228148491	228148491	3829	2	G	T	T	47	47	COL4A3	T	5	2
COL6A3	1293	broad.mit.edu	37	2	238267695	238267695	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238267695C>A	uc002vwl.2	-	20	6676	c.6391G>T	c.(6391-6393)GGG>TGG	p.G2131W	COL6A3_uc002vwo.2_Missense_Mutation_p.G1925W|COL6A3_uc010znj.1_Missense_Mutation_p.G1524W	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2131	Triple-helical region.|Collagen-like 2.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	18		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)														---	---	---	---	capture		Missense_Mutation	SNP	238267695	238267695	3839	2	C	A	A	24	24	COL6A3	A	2	2
SIRPD	128646	broad.mit.edu	37	20	1532596	1532596	+	Silent	SNP	G	T	T	rs144302855		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1532596G>T	uc002wfi.2	-	2	206	c.162C>A	c.(160-162)CCC>CCA	p.P54P		NM_178460	NP_848555	Q9H106	SIRPD_HUMAN	signal-regulatory protein delta precursor	54	Ig-like V-type.					extracellular region				ovary(1)|kidney(1)|skin(1)	3																		---	---	---	---	capture		Silent	SNP	1532596	1532596	14830	20	G	T	T	47	47	SIRPD	T	2	2
CPXM1	56265	broad.mit.edu	37	20	2778860	2778860	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2778860C>A	uc002wgu.2	-	4	592	c.528G>T	c.(526-528)GTG>GTT	p.V176V	CPXM1_uc010gas.2_Silent_p.V176V	NM_019609	NP_062555	Q96SM3	CPXM1_HUMAN	carboxypeptidase X, member 1 precursor	176	F5/8 type C.				cell adhesion|proteolysis		metallocarboxypeptidase activity|zinc ion binding			ovary(2)|skin(2)	4																		---	---	---	---	capture		Silent	SNP	2778860	2778860	3976	20	C	A	A	21	21	CPXM1	A	2	2
PLCB1	23236	broad.mit.edu	37	20	8769342	8769342	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:8769342A>T	uc002wnb.2	+	29	3254	c.3251A>T	c.(3250-3252)AAA>ATA	p.K1084I	PLCB1_uc002wna.2_Missense_Mutation_p.K1084I	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	1084					activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of monocyte extravasation|negative regulation of transcription, DNA-dependent|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|positive regulation of transcription, DNA-dependent|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity			ovary(4)|breast(3)|upper_aerodigestive_tract(2)|skin(2)|lung(1)	12																		---	---	---	---	capture		Missense_Mutation	SNP	8769342	8769342	12453	20	A	T	T	1	1	PLCB1	T	4	4
C20orf26	26074	broad.mit.edu	37	20	20079402	20079402	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20079402C>A	uc002wru.2	+	8	879	c.803C>A	c.(802-804)CCA>CAA	p.P268Q	C20orf26_uc010gcw.1_Missense_Mutation_p.P222Q|C20orf26_uc010zse.1_Missense_Mutation_p.P268Q|C20orf26_uc010zsf.1_Missense_Mutation_p.P268Q	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	268										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)														---	---	---	---	capture		Missense_Mutation	SNP	20079402	20079402	2186	20	C	A	A	21	21	C20orf26	A	2	2
PAX1	5075	broad.mit.edu	37	20	21687473	21687473	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21687473G>T	uc002wsj.2	+	2	738	c.684G>T	c.(682-684)CTG>CTT	p.L228L	PAX1_uc010zsl.1_Silent_p.L228L|PAX1_uc010zsm.1_Silent_p.L204L	NM_006192	NP_006183	P15863	PAX1_HUMAN	paired box 1	228					regulation of transcription, DNA-dependent|skeletal system development|transcription from RNA polymerase II promoter	nucleus	DNA binding			upper_aerodigestive_tract(1)|kidney(1)	2																		---	---	---	---	capture		Silent	SNP	21687473	21687473	11898	20	G	T	T	47	47	PAX1	T	2	2
MAPRE1	22919	broad.mit.edu	37	20	31421598	31421598	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31421598A>C	uc002wyh.2	+	3	336	c.197A>C	c.(196-198)AAG>ACG	p.K66T		NM_012325	NP_036457	Q15691	MARE1_HUMAN	microtubule-associated protein, RP/EB family,	66	CH.				cell division|cell proliferation|G2/M transition of mitotic cell cycle|mitotic prometaphase|negative regulation of microtubule polymerization|protein localization to microtubule	centrosome|cortical microtubule cytoskeleton|cytosol	microtubule plus-end binding|protein C-terminus binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	31421598	31421598	9677	20	A	C	C	3	3	MAPRE1	C	4	4
RALGAPB	57148	broad.mit.edu	37	20	37203488	37203488	+	Missense_Mutation	SNP	C	A	A	rs146626920		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37203488C>A	uc002xiw.2	+	30	4620	c.4363C>A	c.(4363-4365)CCC>ACC	p.P1455T	RALGAPB_uc002xix.2_Missense_Mutation_p.P1452T|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Missense_Mutation_p.P1234T	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	1455					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	37203488	37203488	13475	20	C	A	A	22	22	RALGAPB	A	2	2
SLC12A5	57468	broad.mit.edu	37	20	44663663	44663663	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44663663G>A	uc010zxl.1	+	2	274	c.198G>A	c.(196-198)AAG>AAA	p.K66K	SLC12A5_uc002xra.2_Silent_p.K43K|SLC12A5_uc010zxm.1_RNA|SLC12A5_uc002xrb.2_Silent_p.K43K	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	66	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)													---	---	---	---	capture		Silent	SNP	44663663	44663663	14881	20	G	A	A	33	33	SLC12A5	A	2	2
PTPN1	5770	broad.mit.edu	37	20	49177930	49177930	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49177930T>G	uc002xvl.2	+	2	268	c.94T>G	c.(94-96)TGT>GGT	p.C32G	PTPN1_uc010zys.1_Intron	NM_002827	NP_002818	P18031	PTN1_HUMAN	protein tyrosine phosphatase, non-receptor type	32	Tyrosine-protein phosphatase.				blood coagulation|interferon-gamma-mediated signaling pathway|negative regulation of insulin receptor signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytosol|endoplasmic reticulum membrane	protein tyrosine phosphatase activity|zinc ion binding				0		Lung NSC(126;0.163)			Clodronate(DB00720)|Tiludronate(DB01133)													---	---	---	---	capture		Missense_Mutation	SNP	49177930	49177930	13234	20	T	G	G	51	51	PTPN1	G	4	4
KRTAP13-1	140258	broad.mit.edu	37	21	31768868	31768868	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31768868G>A	uc002yoa.2	+	1	477	c.464G>A	c.(463-465)AGG>AAG	p.R155K		NM_181599	NP_853630	Q8IUC0	KR131_HUMAN	keratin associated protein 13-1	155						intermediate filament				ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	31768868	31768868	8837	21	G	A	A	35	35	KRTAP13-1	A	2	2
HMOX1	3162	broad.mit.edu	37	22	35789496	35789496	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35789496C>A	uc003ant.1	+	5	852	c.772C>A	c.(772-774)CCA>ACA	p.P258T		NM_002133	NP_002124	P09601	HMOX1_HUMAN	heme oxygenase (decyclizing) 1	258					angiogenesis|anti-apoptosis|cell death|cellular iron ion homeostasis|endothelial cell proliferation|erythrocyte homeostasis|heme catabolic process|heme oxidation|intracellular protein kinase cascade|low-density lipoprotein particle clearance|negative regulation of leukocyte migration|negative regulation of smooth muscle cell proliferation|positive regulation of chemokine biosynthetic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of smooth muscle cell proliferation|protein homooligomerization|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hydrogen peroxide|response to nicotine|smooth muscle hyperplasia|transmembrane transport|wound healing involved in inflammatory response	endoplasmic reticulum membrane|extracellular space|microsome	enzyme binding|heme binding|heme oxygenase (decyclizing) activity|protein homodimerization activity|signal transducer activity			ovary(1)	1					NADH(DB00157)													---	---	---	---	capture		Missense_Mutation	SNP	35789496	35789496	7535	22	C	A	A	22	22	HMOX1	A	2	2
APOL3	80833	broad.mit.edu	37	22	36538011	36538011	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36538011C>A	uc003aot.2	-	3	484	c.446G>T	c.(445-447)AGG>ATG	p.R149M	APOL3_uc003aoq.2_Missense_Mutation_p.R78M|APOL3_uc003aor.2_Missense_Mutation_p.R78M|APOL3_uc003aos.2_Missense_Mutation_p.R78M|APOL3_uc003aou.2_Translation_Start_Site|APOL3_uc003aov.2_Translation_Start_Site	NM_145640	NP_663615	O95236	APOL3_HUMAN	apolipoprotein L3 isoform 1	149					inflammatory response|lipoprotein metabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|extracellular region	lipid binding|lipid transporter activity|signal transducer activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	36538011	36538011	818	22	C	A	A	24	24	APOL3	A	2	2
CSF2RB	1439	broad.mit.edu	37	22	37333986	37333986	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37333986C>A	uc003aqa.3	+	14	2353	c.2136C>A	c.(2134-2136)GTC>GTA	p.V712V	CSF2RB_uc003aqc.3_Silent_p.V718V	NM_000395	NP_000386	P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta	712	Cytoplasmic (Potential).				respiratory gaseous exchange	granulocyte macrophage colony-stimulating factor receptor complex	cytokine receptor activity			skin(2)|pancreas(1)	3					Sargramostim(DB00020)													---	---	---	---	capture		Silent	SNP	37333986	37333986	4076	22	C	A	A	32	32	CSF2RB	A	2	2
SH3BP1	23616	broad.mit.edu	37	22	38061567	38061567	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38061567G>T	uc003atj.1	+	17	2394	c.1507G>T	c.(1507-1509)GGG>TGG	p.G503W	PDXP_uc003atm.1_Missense_Mutation_p.G194W			Q9Y3L3	3BP1_HUMAN	SubName: Full=cDNA FLJ44925 fis, clone BRAMY3014613, highly similar to Homo sapiens SH3-domain binding protein 1 (SH3BP1);	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					signal transduction	cytoplasm	GTPase activator activity|SH3 domain binding			central_nervous_system(1)	1	Melanoma(58;0.0574)																	---	---	---	---	capture		Missense_Mutation	SNP	38061567	38061567	14735	22	G	T	T	39	39	SH3BP1	T	1	1
JOSD1	9929	broad.mit.edu	37	22	39085044	39085044	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39085044G>C	uc003awf.2	-	3	872	c.405C>G	c.(403-405)CTC>CTG	p.L135L		NM_014876	NP_055691	Q15040	JOS1_HUMAN	Josephin domain containing 1	135	Josephin.						peptidase activity				0	Melanoma(58;0.04)																	---	---	---	---	capture		Silent	SNP	39085044	39085044	8262	22	G	C	C	45	45	JOSD1	C	3	3
PARVB	29780	broad.mit.edu	37	22	44532354	44532354	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44532354G>T	uc003ben.2	+	7	700	c.648G>T	c.(646-648)CTG>CTT	p.L216L	PARVB_uc003bem.2_Silent_p.L249L|PARVB_uc010gzn.2_Silent_p.L164L|PARVB_uc003beo.2_Silent_p.L179L	NM_013327	NP_037459	Q9HBI1	PARVB_HUMAN	parvin, beta isoform b	216					cell adhesion|cell junction assembly	cytoskeleton|cytosol|focal adhesion	actin binding				0		Ovarian(80;0.0246)|all_neural(38;0.0423)																---	---	---	---	capture		Silent	SNP	44532354	44532354	11886	22	G	T	T	46	46	PARVB	T	2	2
BTD	686	broad.mit.edu	37	3	15677003	15677003	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15677003C>T	uc003cah.2	+	2	220	c.117C>T	c.(115-117)GCC>GCT	p.A39A	BTD_uc011avv.1_Silent_p.A41A|BTD_uc011avw.1_Silent_p.A41A|BTD_uc011avx.1_Silent_p.A19A	NM_000060	NP_000051	P43251	BTD_HUMAN	biotinidase precursor	39					central nervous system development|epidermis development|nitrogen compound metabolic process	extracellular space	biotin carboxylase activity|biotinidase activity				0																		---	---	---	---	capture		Silent	SNP	15677003	15677003	1584	3	C	T	T	22	22	BTD	T	2	2
KCNH8	131096	broad.mit.edu	37	3	19554758	19554758	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19554758G>T	uc003cbk.1	+	13	2571	c.2376G>T	c.(2374-2376)AAG>AAT	p.K792N	KCNH8_uc010hex.1_Missense_Mutation_p.K253N	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	792	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5																		---	---	---	---	capture		Missense_Mutation	SNP	19554758	19554758	8343	3	G	T	T	33	33	KCNH8	T	2	2
COL7A1	1294	broad.mit.edu	37	3	48605182	48605182	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48605182G>T	uc003ctz.2	-	107	7945	c.7944C>A	c.(7942-7944)CCC>CCA	p.P2648P		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2648	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)														---	---	---	---	capture		Silent	SNP	48605182	48605182	3842	3	G	T	T	43	43	COL7A1	T	2	2
LAMB2	3913	broad.mit.edu	37	3	49161317	49161317	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49161317C>A	uc003cwe.2	-	24	3940	c.3641G>T	c.(3640-3642)CGG>CTG	p.R1214L		NM_002292	NP_002283	P55268	LAMB2_HUMAN	laminin, beta 2 precursor	1214	Domain II.				cell adhesion	laminin-11 complex|laminin-3 complex	structural molecule activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)														---	---	---	---	capture		Missense_Mutation	SNP	49161317	49161317	8934	3	C	A	A	23	23	LAMB2	A	1	1
BSN	8927	broad.mit.edu	37	3	49692819	49692819	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49692819C>T	uc003cxe.3	+	5	5944	c.5830C>T	c.(5830-5832)CCC>TCC	p.P1944S		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	1944					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	metal ion binding			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)														---	---	---	---	capture		Missense_Mutation	SNP	49692819	49692819	1561	3	C	T	T	30	30	BSN	T	2	2
PBRM1	55193	broad.mit.edu	37	3	52595832	52595832	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52595832C>A	uc003des.2	-	25	4251	c.4239G>T	c.(4237-4239)GTG>GTT	p.V1413V	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Silent_p.V1413V|PBRM1_uc003der.2_Silent_p.V1381V|PBRM1_uc003det.2_Silent_p.V1428V|PBRM1_uc003deu.2_Silent_p.V1428V|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Silent_p.V1413V|PBRM1_uc010hmk.1_Silent_p.V1388V|PBRM1_uc003dey.2_Silent_p.V1361V|PBRM1_uc003dez.1_Silent_p.V1412V	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	1413	HMG box.				chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)				Mis|N|F|S|D|O		clear cell renal carcinoma|breast								---	---	---	---	capture		Silent	SNP	52595832	52595832	11911	3	C	A	A	21	21	PBRM1	A	2	2
SLMAP	7871	broad.mit.edu	37	3	57908716	57908716	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57908716A>G	uc003dje.1	+	21	2565	c.2360A>G	c.(2359-2361)AAC>AGC	p.N787S	SLMAP_uc003djd.1_Missense_Mutation_p.N770S|SLMAP_uc003djf.1_Missense_Mutation_p.N749S|SLMAP_uc003djg.1_Missense_Mutation_p.N381S|SLMAP_uc011bez.1_Missense_Mutation_p.N255S|SLMAP_uc011bfa.1_Missense_Mutation_p.N321S|SLMAP_uc003dji.1_Missense_Mutation_p.N321S|SLMAP_uc011bfb.1_Missense_Mutation_p.N321S|SLMAP_uc011bfc.1_Missense_Mutation_p.N280S	NM_007159	NP_009090	Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	787	Cytoplasmic (Potential).|Potential.				muscle contraction|protein folding	integral to plasma membrane|microtubule organizing center|prefoldin complex|sarcolemma|smooth endoplasmic reticulum	unfolded protein binding				0				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)														---	---	---	---	capture		Missense_Mutation	SNP	57908716	57908716	15247	3	A	G	G	2	2	SLMAP	G	4	4
FLNB	2317	broad.mit.edu	37	3	58089694	58089694	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58089694G>T	uc003djj.2	+	10	1657	c.1492G>T	c.(1492-1494)GAG>TAG	p.E498*	FLNB_uc010hne.2_Nonsense_Mutation_p.E498*|FLNB_uc003djk.2_Nonsense_Mutation_p.E498*|FLNB_uc010hnf.2_Nonsense_Mutation_p.E498*|FLNB_uc003djl.2_Nonsense_Mutation_p.E329*|FLNB_uc003djm.2_Nonsense_Mutation_p.E329*	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	498	Filamin 3.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)														---	---	---	---	capture		Nonsense_Mutation	SNP	58089694	58089694	6176	3	G	T	T	41	41	FLNB	T	5	2
FLNB	2317	broad.mit.edu	37	3	58120367	58120367	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58120367C>A	uc003djj.2	+	27	4704	c.4539C>A	c.(4537-4539)CCC>CCA	p.P1513P	FLNB_uc010hne.2_Silent_p.P1544P|FLNB_uc003djk.2_Silent_p.P1513P|FLNB_uc010hnf.2_Silent_p.P1513P|FLNB_uc003djl.2_Silent_p.P1344P|FLNB_uc003djm.2_Silent_p.P1344P	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	1513	Filamin 14.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)														---	---	---	---	capture		Silent	SNP	58120367	58120367	6176	3	C	A	A	21	21	FLNB	A	2	2
MINA	84864	broad.mit.edu	37	3	97664061	97664061	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97664061G>T	uc003drz.1	-	10	1871	c.1365C>A	c.(1363-1365)TCC>TCA	p.S455S	MINA_uc003dry.1_Silent_p.S126S|MINA_uc003dsa.1_Silent_p.S454S|MINA_uc003dsb.1_Silent_p.S455S|MINA_uc003dsc.1_Silent_p.S454S	NM_001042533	NP_001035998	Q8IUF8	MINA_HUMAN	MYC induced nuclear antigen isoform a	455					ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1																		---	---	---	---	capture		Silent	SNP	97664061	97664061	9976	3	G	T	T	43	43	MINA	T	2	2
TMEM45A	55076	broad.mit.edu	37	3	100295772	100295772	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100295772G>T	uc003dtz.1	+	6	1051	c.738G>T	c.(736-738)TTG>TTT	p.L246F	TMEM45A_uc003dua.1_Missense_Mutation_p.L262F|TMEM45A_uc003dub.1_RNA	NM_018004	NP_060474	Q9NWC5	TM45A_HUMAN	transmembrane protein 45A	246						integral to membrane				skin(2)|ovary(1)	3																		---	---	---	---	capture		Missense_Mutation	SNP	100295772	100295772	16708	3	G	T	T	47	47	TMEM45A	T	2	2
CEP97	79598	broad.mit.edu	37	3	101476034	101476034	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101476034G>A	uc003dvk.1	+	8	1048	c.1021G>A	c.(1021-1023)GAA>AAA	p.E341K	CEP97_uc010hpm.1_Missense_Mutation_p.E307K|CEP97_uc011bhf.1_Missense_Mutation_p.E341K|CEP97_uc003dvl.1_Missense_Mutation_p.E37K|CEP97_uc003dvm.1_Missense_Mutation_p.E179K	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	341	CEP110 binding.					centrosome|nucleus	protein binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	101476034	101476034	3396	3	G	A	A	41	41	CEP97	A	2	2
MYH15	22989	broad.mit.edu	37	3	108175659	108175659	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108175659G>T	uc003dxa.1	-	20	2209	c.2152C>A	c.(2152-2154)CGT>AGT	p.R718S		NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15	718	Myosin head-like.					myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7																		---	---	---	---	capture		Missense_Mutation	SNP	108175659	108175659	10429	3	G	T	T	39	39	MYH15	T	1	1
SLC9A10	285335	broad.mit.edu	37	3	111993873	111993873	+	Splice_Site	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111993873C>A	uc003dyu.2	-	6	707	c.485_splice	c.e6-1	p.G162_splice	SLC9A10_uc011bhu.1_Splice_Site|SLC9A10_uc010hqc.2_Splice_Site_p.G162_splice	NM_183061	NP_898884			sperm-specific sodium proton exchanger						cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5																		---	---	---	---	capture		Splice_Site	SNP	111993873	111993873	15207	3	C	A	A	24	24	SLC9A10	A	5	2
BOC	91653	broad.mit.edu	37	3	112993496	112993496	+	Silent	SNP	G	C	C	rs139797362		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112993496G>C	uc003dzx.2	+	9	2130	c.1509G>C	c.(1507-1509)GCG>GCC	p.A503A	BOC_uc003dzy.2_Silent_p.A503A|BOC_uc003dzz.2_Silent_p.A503A|BOC_uc003eab.2_Silent_p.A204A	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	503	Fibronectin type-III 1.|Extracellular (Potential).				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)															---	---	---	---	capture		Silent	SNP	112993496	112993496	1506	3	G	C	C	38	38	BOC	C	3	3
DRD3	1814	broad.mit.edu	37	3	113858465	113858465	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113858465C>A	uc003ebd.2	-	6	1028	c.605G>T	c.(604-606)GGA>GTA	p.G202V	DRD3_uc010hqn.1_Missense_Mutation_p.G202V|DRD3_uc003ebb.1_Missense_Mutation_p.G202V|DRD3_uc003ebc.1_Missense_Mutation_p.G202V	NM_000796	NP_000787	P35462	DRD3_HUMAN	dopamine receptor D3 isoform a	202	Helical; Name=5.				activation of adenylate cyclase activity by dopamine receptor signaling pathway|arachidonic acid secretion|behavioral response to cocaine|cellular calcium ion homeostasis|circadian regulation of gene expression|G-protein coupled receptor internalization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|locomotory behavior|musculoskeletal movement, spinal reflex action|negative regulation of blood pressure|negative regulation of oligodendrocyte differentiation|negative regulation of protein kinase B signaling cascade|negative regulation of protein secretion|positive regulation of dopamine receptor signaling pathway|positive regulation of mitosis|prepulse inhibition|regulation of dopamine secretion|response to drug|response to histamine|response to morphine|social behavior|visual learning	integral to plasma membrane	dopamine D3 receptor activity|drug binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4					Apomorphine(DB00714)|Chlorprothixene(DB01239)|Cocaine(DB00907)|Methotrimeprazine(DB01403)|Olanzapine(DB00334)|Pramipexole(DB00413)|Ropinirole(DB00268)|Ziprasidone(DB00246)													---	---	---	---	capture		Missense_Mutation	SNP	113858465	113858465	4942	3	C	A	A	30	30	DRD3	A	2	2
GOLGB1	2804	broad.mit.edu	37	3	121410336	121410336	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121410336G>T	uc003eei.3	-	14	7986	c.7860C>A	c.(7858-7860)GCC>GCA	p.A2620A	GOLGB1_uc010hrc.2_Silent_p.A2625A|GOLGB1_uc003eej.3_Silent_p.A2586A	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	2620	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)														---	---	---	---	capture		Silent	SNP	121410336	121410336	6838	3	G	T	T	35	35	GOLGB1	T	2	2
CD86	942	broad.mit.edu	37	3	121825266	121825266	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121825266C>A	uc003eet.2	+	4	738	c.622C>A	c.(622-624)CCT>ACT	p.P208T	CD86_uc011bjo.1_Missense_Mutation_p.P126T|CD86_uc011bjp.1_Missense_Mutation_p.P96T|CD86_uc003eeu.2_Missense_Mutation_p.P202T	NM_175862	NP_787058	P42081	CD86_HUMAN	CD86 antigen isoform 1	208	Ig-like C2-type.|Extracellular (Potential).				interspecies interaction between organisms|positive regulation of cell proliferation|positive regulation of interleukin-2 biosynthetic process|positive regulation of interleukin-4 biosynthetic process|positive regulation of lymphotoxin A biosynthetic process|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription, DNA-dependent|T cell costimulation		coreceptor activity|protein binding			pancreas(1)|skin(1)	2				GBM - Glioblastoma multiforme(114;0.156)	Abatacept(DB01281)													---	---	---	---	capture		Missense_Mutation	SNP	121825266	121825266	3171	3	C	A	A	22	22	CD86	A	2	2
SLC12A8	84561	broad.mit.edu	37	3	124826529	124826529	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124826529G>T	uc003ehv.3	-	10	1612	c.1501C>A	c.(1501-1503)CTA>ATA	p.L501I	SLC12A8_uc003ehw.3_Missense_Mutation_p.L530I|SLC12A8_uc003eht.3_Missense_Mutation_p.L302I|SLC12A8_uc003ehu.3_Missense_Mutation_p.L254I|SLC12A8_uc010hry.2_Missense_Mutation_p.L254I	NM_024628	NP_078904	A0AV02	S12A8_HUMAN	solute carrier family 12, member 8	501					potassium ion transport	integral to membrane	symporter activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	124826529	124826529	14884	3	G	T	T	35	35	SLC12A8	T	2	2
MCM2	4171	broad.mit.edu	37	3	127337913	127337913	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127337913A>T	uc003ejp.2	+	13	2114	c.2057A>T	c.(2056-2058)CAC>CTC	p.H686L	MCM2_uc011bkm.1_Missense_Mutation_p.H556L|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Missense_Mutation_p.H639L	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	686					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	127337913	127337913	9775	3	A	T	T	6	6	MCM2	T	4	4
DNAJC13	23317	broad.mit.edu	37	3	132169490	132169490	+	Splice_Site	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132169490G>C	uc003eor.2	+	6	402	c.337_splice	c.e6-1	p.R113_splice	DNAJC13_uc010htq.1_Splice_Site_p.R113_splice	NM_015268	NP_056083			DnaJ (Hsp40) homolog, subfamily C, member 13								heat shock protein binding			ovary(1)|breast(1)	2																		---	---	---	---	capture		Splice_Site	SNP	132169490	132169490	4815	3	G	C	C	33	33	DNAJC13	C	5	3
A4GNT	51146	broad.mit.edu	37	3	137849890	137849890	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137849890G>T	uc003ers.2	-	2	411	c.209C>A	c.(208-210)TCC>TAC	p.S70Y		NM_016161	NP_057245	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	70	Lumenal (Potential).				protein O-linked glycosylation	Golgi membrane|Golgi stack|integral to membrane|membrane fraction	acetylglucosaminyltransferase activity|galactosyltransferase activity			central_nervous_system(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	137849890	137849890	8	3	G	T	T	41	41	A4GNT	T	2	2
SI	6476	broad.mit.edu	37	3	164760854	164760854	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164760854C>G	uc003fei.2	-	17	2059	c.1997G>C	c.(1996-1998)GGA>GCA	p.G666A		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	666	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)										HNSCC(35;0.089)			---	---	---	---	capture		Missense_Mutation	SNP	164760854	164760854	14792	3	C	G	G	30	30	SI	G	3	3
SI	6476	broad.mit.edu	37	3	164793766	164793766	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164793766G>C	uc003fei.2	-	2	97	c.35C>G	c.(34-36)TCT>TGT	p.S12C		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	12	Cytoplasmic.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)										HNSCC(35;0.089)			---	---	---	---	capture		Missense_Mutation	SNP	164793766	164793766	14792	3	G	C	C	33	33	SI	C	3	3
PHC3	80012	broad.mit.edu	37	3	169846536	169846536	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169846536G>C	uc010hws.1	-	8	1752	c.1688C>G	c.(1687-1689)CCT>CGT	p.P563R	PHC3_uc003fgl.2_Missense_Mutation_p.P575R|PHC3_uc011bpq.1_Missense_Mutation_p.P522R|PHC3_uc011bpr.1_Missense_Mutation_p.P489R	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	563	Pro-rich.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)															---	---	---	---	capture		Missense_Mutation	SNP	169846536	169846536	12241	3	G	C	C	35	35	PHC3	C	3	3
PHC3	80012	broad.mit.edu	37	3	169896648	169896648	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169896648G>T	uc010hws.1	-	2	121	c.57C>A	c.(55-57)ACC>ACA	p.T19T	PHC3_uc003fgl.2_Silent_p.T31T|PHC3_uc011bpq.1_Silent_p.T31T|PHC3_uc011bpr.1_Silent_p.T31T|PHC3_uc003fgm.2_Silent_p.T31T|PHC3_uc003fgo.1_Silent_p.T19T|PHC3_uc003fgp.3_Silent_p.T31T|PHC3_uc003fgq.3_Silent_p.T31T|PHC3_uc003fgr.1_RNA	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3	19	Poly-Thr.				multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)															---	---	---	---	capture		Silent	SNP	169896648	169896648	12241	3	G	T	T	47	47	PHC3	T	2	2
SKIL	6498	broad.mit.edu	37	3	170078995	170078995	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170078995G>T	uc003fgu.2	+	2	1588	c.876G>T	c.(874-876)CTG>CTT	p.L292L	SKIL_uc011bps.1_Silent_p.L272L|SKIL_uc003fgv.2_Silent_p.L292L|SKIL_uc003fgw.2_Silent_p.L292L	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	292					cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)															---	---	---	---	capture		Silent	SNP	170078995	170078995	14853	3	G	T	T	47	47	SKIL	T	2	2
FNDC3B	64778	broad.mit.edu	37	3	172065049	172065049	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172065049G>T	uc003fhy.2	+	21	2584	c.2412G>T	c.(2410-2412)TGG>TGT	p.W804C	FNDC3B_uc003fhz.3_Missense_Mutation_p.W804C	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	804	Fibronectin type-III 6.					endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)														---	---	---	---	capture		Missense_Mutation	SNP	172065049	172065049	6212	3	G	T	T	43	43	FNDC3B	T	2	2
GHSR	2693	broad.mit.edu	37	3	172165626	172165626	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165626C>A	uc003fib.1	-	1	578	c.578G>T	c.(577-579)TGG>TTG	p.W193L	GHSR_uc011bpv.1_Missense_Mutation_p.W193L	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	193	Extracellular (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)															---	---	---	---	capture		Missense_Mutation	SNP	172165626	172165626	6643	3	C	A	A	21	21	GHSR	A	2	2
NLGN1	22871	broad.mit.edu	37	3	173997089	173997089	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173997089G>T	uc003fio.1	+	6	1721	c.1298G>T	c.(1297-1299)AGA>ATA	p.R433I	NLGN1_uc010hww.1_Missense_Mutation_p.R473I|NLGN1_uc003fip.1_Missense_Mutation_p.R433I	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	450	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)															---	---	---	---	capture		Missense_Mutation	SNP	173997089	173997089	10864	3	G	T	T	33	33	NLGN1	T	2	2
ACTL6A	86	broad.mit.edu	37	3	179292177	179292177	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179292177G>T	uc003fjw.2	+	5	571	c.398G>T	c.(397-399)AGA>ATA	p.R133I	ACTL6A_uc003fjx.2_Missense_Mutation_p.R91I|ACTL6A_uc003fjy.2_Missense_Mutation_p.R91I	NM_004301	NP_004292	O96019	ACL6A_HUMAN	actin-like 6A isoform 1	133					chromatin remodeling|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|nervous system development|regulation of growth|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	Ino80 complex|npBAF complex|NuA4 histone acetyltransferase complex|plasma membrane|SWI/SNF complex	ATP binding|chromatin binding			ovary(1)	1	all_cancers(143;3.94e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---	capture		Missense_Mutation	SNP	179292177	179292177	199	3	G	T	T	33	33	ACTL6A	T	2	2
NDUFB5	4711	broad.mit.edu	37	3	179322691	179322691	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179322691G>T	uc003fkc.2	+	1	117	c.88G>T	c.(88-90)GGG>TGG	p.G30W	MRPL47_uc003fjz.2_5'Flank|MRPL47_uc003fka.2_5'Flank|MRPL47_uc003fkb.2_5'Flank|NDUFB5_uc003fkd.2_RNA|NDUFB5_uc003fke.2_Missense_Mutation_p.G30W	NM_002492	NP_002483	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	30					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			skin(1)	1	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)		NADH(DB00157)													---	---	---	---	capture		Missense_Mutation	SNP	179322691	179322691	10683	3	G	T	T	47	47	NDUFB5	T	2	2
USP13	8975	broad.mit.edu	37	3	179481915	179481915	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179481915G>T	uc003fkh.2	+	18	2299	c.2218G>T	c.(2218-2220)GGA>TGA	p.G740*		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	740	UBA 2.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)															---	---	---	---	capture		Nonsense_Mutation	SNP	179481915	179481915	17606	3	G	T	T	43	43	USP13	T	5	2
FXR1	8087	broad.mit.edu	37	3	180669251	180669251	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180669251G>T	uc003fkq.2	+	8	818	c.796G>T	c.(796-798)GGA>TGA	p.G266*	FXR1_uc003fkp.2_Nonsense_Mutation_p.G181*|FXR1_uc003fkr.2_Nonsense_Mutation_p.G266*|FXR1_uc011bqj.1_Nonsense_Mutation_p.G180*|FXR1_uc003fks.2_Nonsense_Mutation_p.G180*|FXR1_uc011bqk.1_Nonsense_Mutation_p.G217*|FXR1_uc011bql.1_Nonsense_Mutation_p.G253*	NM_005087	NP_005078	P51114	FXR1_HUMAN	fragile X mental retardation-related protein 1	266					apoptosis|cell differentiation|muscle organ development	nucleolus|polysome				breast(1)	1	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)															---	---	---	---	capture		Nonsense_Mutation	SNP	180669251	180669251	6366	3	G	T	T	39	39	FXR1	T	5	1
ATP11B	23200	broad.mit.edu	37	3	182554253	182554253	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182554253C>A	uc003flb.2	+	6	804	c.547C>A	c.(547-549)CTG>ATG	p.L183M	ATP11B_uc003fla.2_Missense_Mutation_p.L183M	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	183	Cytoplasmic (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)															---	---	---	---	capture		Missense_Mutation	SNP	182554253	182554253	1139	3	C	A	A	24	24	ATP11B	A	2	2
ATP11B	23200	broad.mit.edu	37	3	182615141	182615141	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182615141G>T	uc003flb.2	+	27	3356	c.3099G>T	c.(3097-3099)TGG>TGT	p.W1033C	ATP11B_uc003flc.2_Missense_Mutation_p.W617C|ATP11B_uc010hxf.1_Missense_Mutation_p.W195C|ATP11B_uc010hxg.2_RNA|ATP11B_uc010hxh.1_5'Flank	NM_014616	NP_055431	Q9Y2G3	AT11B_HUMAN	ATPase, class VI, type 11B	1033	Helical; (Potential).				aminophospholipid transport|ATP biosynthetic process	integral to membrane|nuclear inner membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3	all_cancers(143;9.04e-15)|Ovarian(172;0.0355)		all cancers(12;1.2e-42)|Epithelial(37;2.77e-36)|LUSC - Lung squamous cell carcinoma(7;7.58e-24)|Lung(8;4.66e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.35e-20)															---	---	---	---	capture		Missense_Mutation	SNP	182615141	182615141	1139	3	G	T	T	43	43	ATP11B	T	2	2
MCCC1	56922	broad.mit.edu	37	3	182733239	182733239	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182733239C>A	uc003fle.2	-	19	2302	c.2165G>T	c.(2164-2166)AGG>ATG	p.R722M	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.R605M|MCCC1_uc003flg.2_Missense_Mutation_p.R613M	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	722					biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)													---	---	---	---	capture		Missense_Mutation	SNP	182733239	182733239	9763	3	C	A	A	24	24	MCCC1	A	2	2
PARL	55486	broad.mit.edu	37	3	183551567	183551567	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183551567G>T	uc003fmd.2	-	8	934	c.875C>A	c.(874-876)CCA>CAA	p.P292Q	PARL_uc003fme.2_Missense_Mutation_p.P242Q	NM_018622	NP_061092	Q9H300	PARL_HUMAN	presenilin associated, rhomboid-like isoform 1	292	Mitochondrial intermembrane (Potential).				proteolysis	integral to membrane|mitochondrial inner membrane|nucleus	serine-type endopeptidase activity				0	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.21e-41)|Epithelial(37;1.34e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)															---	---	---	---	capture		Missense_Mutation	SNP	183551567	183551567	11868	3	G	T	T	47	47	PARL	T	2	2
HTR3E	285242	broad.mit.edu	37	3	183823091	183823091	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183823091G>T	uc010hxq.2	+	6	1062	c.596G>T	c.(595-597)TGG>TTG	p.W199L	HTR3E_uc003fml.3_Missense_Mutation_p.W184L|HTR3E_uc003fmm.2_Missense_Mutation_p.W214L|HTR3E_uc010hxr.2_Missense_Mutation_p.W225L|HTR3E_uc003fmn.2_Missense_Mutation_p.W199L	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	199	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)															---	---	---	---	capture		Missense_Mutation	SNP	183823091	183823091	7748	3	G	T	T	47	47	HTR3E	T	2	2
HTR3E	285242	broad.mit.edu	37	3	183823735	183823735	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183823735C>A	uc010hxq.2	+	7	1369	c.903C>A	c.(901-903)CCC>CCA	p.P301P	HTR3E_uc003fml.3_Silent_p.P286P|HTR3E_uc003fmm.2_Silent_p.P316P|HTR3E_uc010hxr.2_Silent_p.P327P|HTR3E_uc003fmn.2_Silent_p.P301P	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	301	Helical; Name=2; (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)															---	---	---	---	capture		Silent	SNP	183823735	183823735	7748	3	C	A	A	21	21	HTR3E	A	2	2
EIF2B5	8893	broad.mit.edu	37	3	183860854	183860854	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183860854G>A	uc003fmp.2	+	12	2033	c.1669G>A	c.(1669-1671)GTT>ATT	p.V557I	EIF2B5_uc003fmq.2_Missense_Mutation_p.V278I|EIF2B5_uc003fmr.2_5'Flank	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,	557	W2.				astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)															---	---	---	---	capture		Missense_Mutation	SNP	183860854	183860854	5193	3	G	A	A	36	36	EIF2B5	A	2	2
ABCF3	55324	broad.mit.edu	37	3	183911327	183911327	+	Splice_Site	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183911327G>T	uc003fmz.2	+	21	2105	c.1972_splice	c.e21-1	p.G658_splice	ABCF3_uc003fna.2_Splice_Site_p.G652_splice|ABCF3_uc003fnb.2_Splice_Site_p.G339_splice	NM_018358	NP_060828			ATP-binding cassette, sub-family F (GCN20),								ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---	capture		Splice_Site	SNP	183911327	183911327	68	3	G	T	T	35	35	ABCF3	T	5	2
ABCF3	55324	broad.mit.edu	37	3	183911349	183911349	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183911349C>A	uc003fmz.2	+	21	2126	c.1993C>A	c.(1993-1995)CAC>AAC	p.H665N	ABCF3_uc003fna.2_Missense_Mutation_p.H659N|ABCF3_uc003fnb.2_Missense_Mutation_p.H346N	NM_018358	NP_060828	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20),	665	ABC transporter 2.						ATP binding|ATPase activity			ovary(3)|lung(1)	4	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---	capture		Missense_Mutation	SNP	183911349	183911349	68	3	C	A	A	21	21	ABCF3	A	2	2
ECE2	9718	broad.mit.edu	37	3	184003289	184003289	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184003289G>T	uc003fni.3	+	10	1564	c.1526G>T	c.(1525-1527)TGG>TTG	p.W509L	ECE2_uc011brh.1_Missense_Mutation_p.W362L|ECE2_uc003fnl.3_Missense_Mutation_p.W437L|ECE2_uc003fnm.3_Missense_Mutation_p.W391L|ECE2_uc003fnk.3_Missense_Mutation_p.W362L|ECE2_uc011bri.1_Missense_Mutation_p.W424L|ECE2_uc010hxv.2_Missense_Mutation_p.W153L	NM_014693	NP_055508	O60344	ECE2_HUMAN	endothelin converting enzyme 2 isoform A	509	Lumenal (Potential).|Endothelin-converting enzyme 2 region.				brain development|cardioblast differentiation|cell-cell signaling|peptide hormone processing	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity|methyltransferase activity			ovary(2)|skin(2)	4	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)													OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	184003289	184003289	5077	3	G	T	T	47	47	ECE2	T	2	2
EIF4G1	1981	broad.mit.edu	37	3	184041204	184041204	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184041204G>T	uc003fnp.2	+	15	2295	c.2097G>T	c.(2095-2097)CTG>CTT	p.L699L	EIF4G1_uc003fno.1_Silent_p.L640L|EIF4G1_uc010hxw.1_Silent_p.L535L|EIF4G1_uc003fnt.2_Silent_p.L410L|EIF4G1_uc003fnq.2_Silent_p.L612L|EIF4G1_uc003fnr.2_Silent_p.L535L|EIF4G1_uc010hxx.2_Silent_p.L706L|EIF4G1_uc003fns.2_Silent_p.L659L|EIF4G1_uc010hxy.2_Silent_p.L706L|EIF4G1_uc003fnv.3_Silent_p.L700L|EIF4G1_uc003fnu.3_Silent_p.L699L|EIF4G1_uc003fnw.2_Silent_p.L706L|EIF4G1_uc003fnx.2_Silent_p.L504L|EIF4G1_uc003fny.3_Silent_p.L503L|SNORD66_uc003fnz.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	699	eIF3/EIF4A-binding.|MIF4G.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)															---	---	---	---	capture		Silent	SNP	184041204	184041204	5227	3	G	T	T	47	47	EIF4G1	T	2	2
EHHADH	1962	broad.mit.edu	37	3	184922262	184922262	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184922262G>T	uc003fpf.2	-	6	879	c.852C>A	c.(850-852)CCC>CCA	p.P284P	EHHADH_uc011brs.1_Silent_p.P188P	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	284	3-hydroxyacyl-CoA dehydrogenase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)													---	---	---	---	capture		Silent	SNP	184922262	184922262	5171	3	G	T	T	35	35	EHHADH	T	2	2
MAP3K13	9175	broad.mit.edu	37	3	185191005	185191005	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185191005C>A	uc010hyf.2	+	12	2152	c.1886C>A	c.(1885-1887)CCT>CAT	p.P629H	MAP3K13_uc011brt.1_Missense_Mutation_p.P422H|MAP3K13_uc011bru.1_Missense_Mutation_p.P485H|MAP3K13_uc003fpi.2_Missense_Mutation_p.P629H|MAP3K13_uc010hyg.2_Missense_Mutation_p.P319H	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	629					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)															---	---	---	---	capture		Missense_Mutation	SNP	185191005	185191005	9630	3	C	A	A	24	24	MAP3K13	A	2	2
SENP2	59343	broad.mit.edu	37	3	185316246	185316246	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185316246C>T	uc003fpn.2	+	3	375	c.204C>T	c.(202-204)AGC>AGT	p.S68S	SENP2_uc011brv.1_Silent_p.S58S|SENP2_uc011brw.1_5'UTR	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2	68					mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)															---	---	---	---	capture		Silent	SNP	185316246	185316246	14533	3	C	T	T	28	28	SENP2	T	2	2
FETUB	26998	broad.mit.edu	37	3	186364038	186364038	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186364038G>T	uc010hyq.2	+	6	857	c.596G>T	c.(595-597)TGG>TTG	p.W199L	FETUB_uc011brz.1_Missense_Mutation_p.W51L|FETUB_uc003fqn.2_Missense_Mutation_p.W199L|FETUB_uc003fqo.2_Missense_Mutation_p.W94L|FETUB_uc010hyr.2_Missense_Mutation_p.W162L|FETUB_uc010hys.2_Missense_Mutation_p.W51L|FETUB_uc003fqp.3_Missense_Mutation_p.W134L	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	199	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)														---	---	---	---	capture		Missense_Mutation	SNP	186364038	186364038	6058	3	G	T	T	47	47	FETUB	T	2	2
MASP1	5648	broad.mit.edu	37	3	186980345	186980345	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186980345T>A	uc003frh.1	-	3	733	c.401A>T	c.(400-402)CAC>CTC	p.H134L	MASP1_uc003fri.2_Missense_Mutation_p.H134L|MASP1_uc003frj.2_Missense_Mutation_p.H103L|MASP1_uc003frk.1_Missense_Mutation_p.H134L|MASP1_uc011bse.1_Missense_Mutation_p.H108L	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform	134	Interaction with FCN2.|Interaction with MBL2.|Homodimerization (By similarity).|CUB 1.				complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)														---	---	---	---	capture		Missense_Mutation	SNP	186980345	186980345	9706	3	T	A	A	59	59	MASP1	A	4	4
CPN2	1370	broad.mit.edu	37	3	194062480	194062480	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194062480G>T	uc003fts.2	-	2	1042	c.952C>A	c.(952-954)CTC>ATC	p.L318I		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	318	LRR 10.				protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)														---	---	---	---	capture		Missense_Mutation	SNP	194062480	194062480	3948	3	G	T	T	35	35	CPN2	T	2	2
ATP13A3	79572	broad.mit.edu	37	3	194151920	194151920	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194151920C>T	uc003fty.3	-	22	2859	c.2457G>A	c.(2455-2457)GAG>GAA	p.E819E	ATP13A3_uc003ftz.1_Silent_p.E525E	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	819					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)														---	---	---	---	capture		Silent	SNP	194151920	194151920	1144	3	C	T	T	24	24	ATP13A3	T	2	2
MUC4	4585	broad.mit.edu	37	3	195516761	195516761	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195516761G>T	uc011bto.1	-	2	2150	c.1690C>A	c.(1690-1692)CAG>AAG	p.Q564K	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.Q446K	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	569					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)														---	---	---	---	capture		Missense_Mutation	SNP	195516761	195516761	10372	3	G	T	T	47	47	MUC4	T	2	2
LRCH3	84859	broad.mit.edu	37	3	197598320	197598320	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197598320C>A	uc011bul.1	+	19	2122	c.2117C>A	c.(2116-2118)CCC>CAC	p.P706H	LRCH3_uc003fyj.1_Missense_Mutation_p.P706H|LRCH3_uc011bum.1_Missense_Mutation_p.P654H|LRCH3_uc011bun.1_Missense_Mutation_p.P552H|LRCH3_uc003fyk.2_Missense_Mutation_p.P301H	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	706	CH.					extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)														---	---	---	---	capture		Missense_Mutation	SNP	197598320	197598320	9307	3	C	A	A	22	22	LRCH3	A	2	2
HGFAC	3083	broad.mit.edu	37	4	3444543	3444543	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3444543C>A	uc003ghc.2	+	2	205	c.202C>A	c.(202-204)CCA>ACA	p.P68T	HGFAC_uc010icw.2_Missense_Mutation_p.P68T	NM_001528	NP_001519	Q04756	HGFA_HUMAN	HGF activator preproprotein	68					proteolysis	extracellular space	protein binding|serine-type endopeptidase activity			central_nervous_system(2)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)														---	---	---	---	capture		Missense_Mutation	SNP	3444543	3444543	7370	4	C	A	A	22	22	HGFAC	A	2	2
ZNF518B	85460	broad.mit.edu	37	4	10445265	10445265	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10445265T>A	uc003gmn.2	-	3	3175	c.2688A>T	c.(2686-2688)TTA>TTT	p.L896F		NM_053042	NP_444270	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	896					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	10445265	10445265	18557	4	T	A	A	49	49	ZNF518B	A	4	4
MED28	80306	broad.mit.edu	37	4	17623283	17623283	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17623283G>T	uc003gpi.1	+	3	312	c.300G>T	c.(298-300)TTG>TTT	p.L100F	MED28_uc003gpj.2_RNA	NM_025205	NP_079481	Q9H204	MED28_HUMAN	mediator complex subunit 28	100					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|membrane|nucleus	actin binding				0																		---	---	---	---	capture		Missense_Mutation	SNP	17623283	17623283	9835	4	G	T	T	46	46	MED28	T	2	2
KIT	3815	broad.mit.edu	37	4	55564640	55564640	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55564640A>T	uc010igr.2	+	3	615	c.528A>T	c.(526-528)AAA>AAT	p.K176N	KIT_uc010igs.2_Missense_Mutation_p.K176N	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	176	Extracellular (Potential).|Ig-like C2-type 2.				male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity			soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				---	---	---	---	capture		Missense_Mutation	SNP	55564640	55564640	8641	4	A	T	T	2	2	KIT	T	4	4
KDR	3791	broad.mit.edu	37	4	55964865	55964865	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55964865C>G	uc003has.2	-	16	2674	c.2372G>C	c.(2371-2373)CGG>CCG	p.R791P	KDR_uc003hat.1_Missense_Mutation_p.R791P	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	791	Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			---	---	---	---	capture		Missense_Mutation	SNP	55964865	55964865	8445	4	C	G	G	23	23	KDR	G	3	3
REST	5978	broad.mit.edu	37	4	57796520	57796520	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57796520T>A	uc003hch.2	+	4	1843	c.1496T>A	c.(1495-1497)GTG>GAG	p.V499E	REST_uc003hci.2_Missense_Mutation_p.V499E|REST_uc010ihf.2_Missense_Mutation_p.V173E	NM_005612	NP_005603	Q13127	REST_HUMAN	RE1-silencing transcription factor	499	Lys-rich.				cardiac muscle cell myoblast differentiation|cellular response to drug|cellular response to electrical stimulus|cellular response to glucocorticoid stimulus|histone H4 deacetylation|negative regulation by host of viral transcription|negative regulation of aldosterone biosynthetic process|negative regulation of calcium ion-dependent exocytosis|negative regulation of cell proliferation|negative regulation of cortisol biosynthetic process|negative regulation of dense core granule biogenesis|negative regulation of insulin secretion|negative regulation of mesenchymal stem cell differentiation|negative regulation of neurogenesis|negative regulation of neuron differentiation|positive regulation of apoptosis|positive regulation of caspase activity|positive regulation of transcription, DNA-dependent	cytoplasm|transcriptional repressor complex	calcium channel activity|chromatin binding|core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|outward rectifier potassium channel activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|zinc ion binding			skin(5)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	9	Glioma(25;0.08)|all_neural(26;0.181)																	---	---	---	---	capture		Missense_Mutation	SNP	57796520	57796520	13704	4	T	A	A	59	59	REST	A	4	4
LPHN3	23284	broad.mit.edu	37	4	62775359	62775359	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62775359A>G	uc010ihh.2	+	9	1938	c.1765A>G	c.(1765-1767)ACC>GCC	p.T589A	LPHN3_uc003hcq.3_Missense_Mutation_p.T589A|LPHN3_uc003hct.2_5'UTR|LPHN3_uc003hcs.1_Missense_Mutation_p.T418A	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	589	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18																		---	---	---	---	capture		Missense_Mutation	SNP	62775359	62775359	9290	4	A	G	G	6	6	LPHN3	G	4	4
ENAM	10117	broad.mit.edu	37	4	71508091	71508091	+	Missense_Mutation	SNP	T	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71508091T>G	uc011caw.1	+	9	1229	c.948T>G	c.(946-948)ATT>ATG	p.I316M		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	316					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)															---	---	---	---	capture		Missense_Mutation	SNP	71508091	71508091	5305	4	T	G	G	62	62	ENAM	G	4	4
DDX60	55601	broad.mit.edu	37	4	169197228	169197228	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169197228T>C	uc003irp.2	-	15	2375	c.2083A>G	c.(2083-2085)ATA>GTA	p.I695V		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	695							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)														---	---	---	---	capture		Missense_Mutation	SNP	169197228	169197228	4549	4	T	C	C	51	51	DDX60	C	4	4
FAT1	2195	broad.mit.edu	37	4	187510198	187510198	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187510198G>T	uc003izf.2	-	27	13503	c.13315C>A	c.(13315-13317)CCA>ACA	p.P4439T	FAT1_uc010isn.2_Missense_Mutation_p.P86T|FAT1_uc003ize.2_Missense_Mutation_p.P330T	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	4439	Cytoplasmic (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12															HNSCC(5;0.00058)			---	---	---	---	capture		Missense_Mutation	SNP	187510198	187510198	5925	4	G	T	T	43	43	FAT1	T	2	2
DNAH5	1767	broad.mit.edu	37	5	13793634	13793634	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13793634G>T	uc003jfd.2	-	49	8256	c.8214C>A	c.(8212-8214)GAC>GAA	p.D2738E		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2738	AAA 3 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)													Kartagener_syndrome				---	---	---	---	capture		Missense_Mutation	SNP	13793634	13793634	4787	5	G	T	T	48	48	DNAH5	T	2	2
TRIO	7204	broad.mit.edu	37	5	14507302	14507302	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14507302A>T	uc003jff.2	+	56	8690	c.8684A>T	c.(8683-8685)CAC>CTC	p.H2895L	TRIO_uc003jfg.2_RNA	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)	2895	Protein kinase.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)																	---	---	---	---	capture		Missense_Mutation	SNP	14507302	14507302	17102	5	A	T	T	6	6	TRIO	T	4	4
CDH18	1016	broad.mit.edu	37	5	19544111	19544111	+	Nonsense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19544111G>C	uc003jgc.2	-	8	1634	c.1257C>G	c.(1255-1257)TAC>TAG	p.Y419*	CDH18_uc003jgd.2_Nonsense_Mutation_p.Y419*|CDH18_uc011cnm.1_Nonsense_Mutation_p.Y419*	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	419	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)																	---	---	---	---	capture		Nonsense_Mutation	SNP	19544111	19544111	3232	5	G	C	C	36	36	CDH18	C	5	3
CDH12	1010	broad.mit.edu	37	5	21760696	21760696	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21760696T>A	uc010iuc.2	-	10	2062	c.1604A>T	c.(1603-1605)AAA>ATA	p.K535I	CDH12_uc011cno.1_Missense_Mutation_p.K495I|CDH12_uc003jgk.2_Missense_Mutation_p.K535I|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	535	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2															HNSCC(59;0.17)			---	---	---	---	capture		Missense_Mutation	SNP	21760696	21760696	3227	5	T	A	A	64	64	CDH12	A	4	4
CDH9	1007	broad.mit.edu	37	5	26885766	26885766	+	Silent	SNP	C	A	A	rs145328141	byFrequency	TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26885766C>A	uc003jgs.1	-	11	2008	c.1839G>T	c.(1837-1839)ACG>ACT	p.T613T	CDH9_uc011cnv.1_Silent_p.T206T	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	613	Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9																		---	---	---	---	capture		Silent	SNP	26885766	26885766	3246	5	C	A	A	23	23	CDH9	A	1	1
PDZD2	23037	broad.mit.edu	37	5	31983601	31983601	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31983601C>G	uc003jhl.2	+	3	1205	c.817C>G	c.(817-819)CTC>GTC	p.L273V	PDZD2_uc003jhm.2_Missense_Mutation_p.L273V|PDZD2_uc011cnx.1_Missense_Mutation_p.L99V	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	273					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---	capture		Missense_Mutation	SNP	31983601	31983601	12122	5	C	G	G	32	32	PDZD2	G	3	3
PDZD2	23037	broad.mit.edu	37	5	32090546	32090546	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32090546C>A	uc003jhl.2	+	20	7380	c.6992C>A	c.(6991-6993)TCA>TAA	p.S2331*	PDZD2_uc003jhm.2_Nonsense_Mutation_p.S2331*	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	2331					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9																		---	---	---	---	capture		Nonsense_Mutation	SNP	32090546	32090546	12122	5	C	A	A	29	29	PDZD2	A	5	2
NIPBL	25836	broad.mit.edu	37	5	36984825	36984825	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36984825G>T	uc003jkl.3	+	10	2042	c.1543G>T	c.(1543-1545)GGG>TGG	p.G515W	NIPBL_uc003jkk.3_Missense_Mutation_p.G515W|NIPBL_uc003jkm.1_Missense_Mutation_p.G394W	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	515					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)															---	---	---	---	capture		Missense_Mutation	SNP	36984825	36984825	10829	5	G	T	T	47	47	NIPBL	T	2	2
HEATR7B2	133558	broad.mit.edu	37	5	40998243	40998243	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40998243G>T	uc003jmj.3	-	42	5159	c.4669C>A	c.(4669-4671)CAA>AAA	p.Q1557K	HEATR7B2_uc003jmi.3_Missense_Mutation_p.Q1112K	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1557							binding			ovary(6)|central_nervous_system(2)	8																		---	---	---	---	capture		Missense_Mutation	SNP	40998243	40998243	7318	5	G	T	T	45	45	HEATR7B2	T	2	2
HCN1	348980	broad.mit.edu	37	5	45262468	45262468	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262468G>T	uc003jok.2	-	8	2253	c.2228C>A	c.(2227-2229)CCG>CAG	p.P743Q		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	743	Gln-rich.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	45262468	45262468	7278	5	G	T	T	39	39	HCN1	T	1	1
HCN1	348980	broad.mit.edu	37	5	45262722	45262722	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262722G>C	uc003jok.2	-	8	1999	c.1974C>G	c.(1972-1974)TCC>TCG	p.S658S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	658	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	45262722	45262722	7278	5	G	C	C	43	43	HCN1	C	3	3
HCN1	348980	broad.mit.edu	37	5	45267206	45267206	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45267206G>A	uc003jok.2	-	7	1793	c.1768C>T	c.(1768-1770)CGA>TGA	p.R590*		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	590	cAMP.|Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1																		---	---	---	---	capture		Nonsense_Mutation	SNP	45267206	45267206	7278	5	G	A	A	39	39	HCN1	A	5	1
IL6ST	3572	broad.mit.edu	37	5	55247854	55247854	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55247854T>A	uc003jqq.2	-	13	1857	c.1602A>T	c.(1600-1602)GAA>GAT	p.E534D	IL6ST_uc010iwb.2_Missense_Mutation_p.E473D|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Missense_Mutation_p.E245D|IL6ST_uc003jqr.2_3'UTR|IL6ST_uc010iwe.1_5'Flank	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1	534	Extracellular (Potential).|Fibronectin type-III 5.				interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)						O		hepatocellular ca								---	---	---	---	capture		Missense_Mutation	SNP	55247854	55247854	8004	5	T	A	A	56	56	IL6ST	A	4	4
PIK3R1	5295	broad.mit.edu	37	5	67593336	67593336	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67593336G>T	uc003jva.2	+	16	2642	c.2082G>T	c.(2080-2082)CTG>CTT	p.L694L	PIK3R1_uc003jvb.2_Silent_p.L694L|PIK3R1_uc003jvc.2_Silent_p.L394L|PIK3R1_uc003jvd.2_Silent_p.L424L|PIK3R1_uc003jve.2_Silent_p.L373L	NM_181523	NP_852664	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1	694	SH2 2.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|growth hormone receptor signaling pathway|insulin receptor signaling pathway|insulin-like growth factor receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|T cell costimulation|T cell receptor signaling pathway	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex	1-phosphatidylinositol binding|ErbB-3 class receptor binding|insulin binding|insulin receptor binding|insulin receptor substrate binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase regulator activity|protein phosphatase binding	p.?(1)		endometrium(34)|central_nervous_system(27)|large_intestine(20)|breast(7)|ovary(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|urinary_tract(1)|skin(1)|pancreas(1)	101		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoproterenol(DB01064)			Mis|F|O		gliobastoma|ovarian|colorectal					TCGA GBM(4;<1E-08)			---	---	---	---	capture		Silent	SNP	67593336	67593336	12342	5	G	T	T	47	47	PIK3R1	T	2	2
CMYA5	202333	broad.mit.edu	37	5	79031807	79031807	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79031807C>T	uc003kgc.2	+	2	7291	c.7219C>T	c.(7219-7221)CCA>TCA	p.P2407S		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	2407						perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)														---	---	---	---	capture		Missense_Mutation	SNP	79031807	79031807	3728	5	C	T	T	18	18	CMYA5	T	2	2
FBN2	2201	broad.mit.edu	37	5	127800548	127800548	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127800548A>T	uc003kuu.2	-	6	1134	c.695T>A	c.(694-696)ATT>AAT	p.I232N	FBN2_uc003kuv.2_Missense_Mutation_p.I199N|FBN2_uc003kuw.3_Missense_Mutation_p.I232N|FBN2_uc003kux.1_Missense_Mutation_p.I232N	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	232	TB 1.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)														---	---	---	---	capture		Missense_Mutation	SNP	127800548	127800548	5939	5	A	T	T	4	4	FBN2	T	4	4
HSPA4	3308	broad.mit.edu	37	5	132424810	132424810	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132424810C>T	uc003kyj.2	+	10	1482	c.1201C>T	c.(1201-1203)CCA>TCA	p.P401S		NM_002154	NP_002145	P34932	HSP74_HUMAN	heat shock 70kDa protein 4	401					cellular chaperone-mediated protein complex assembly|protein import into mitochondrial outer membrane|response to unfolded protein	cytoplasm|nucleus	ATP binding			lung(1)|breast(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)															---	---	---	---	capture		Missense_Mutation	SNP	132424810	132424810	7711	5	C	T	T	30	30	HSPA4	T	2	2
C5orf24	134553	broad.mit.edu	37	5	134191148	134191148	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134191148C>A	uc003kzx.2	+	2	619	c.558C>A	c.(556-558)CCC>CCA	p.P186P	C5orf24_uc003kzy.3_Intron|C5orf24_uc003kzz.2_Silent_p.P186P	NM_152409	NP_689622	Q7Z6I8	CE024_HUMAN	hypothetical protein LOC134553	186											0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---	capture		Silent	SNP	134191148	134191148	2385	5	C	A	A	21	21	C5orf24	A	2	2
TRPC7	57113	broad.mit.edu	37	5	135692600	135692600	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135692600G>A	uc003lbn.1	-	1	476	c.473C>T	c.(472-474)ACG>ATG	p.T158M	TRPC7_uc010jef.1_Missense_Mutation_p.T150M|TRPC7_uc010jeg.1_RNA|TRPC7_uc010jeh.1_Missense_Mutation_p.T150M|TRPC7_uc010jei.1_Missense_Mutation_p.T150M|TRPC7_uc010jej.1_Translation_Start_Site	NM_020389	NP_065122	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel,	159	Cytoplasmic (Potential).				axon guidance|platelet activation	integral to membrane|plasma membrane	calcium channel activity|protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)															---	---	---	---	capture		Missense_Mutation	SNP	135692600	135692600	17135	5	G	A	A	40	40	TRPC7	A	1	1
FLT4	2324	broad.mit.edu	37	5	180048825	180048825	+	Silent	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180048825T>C	uc003mma.3	-	13	1816	c.1737A>G	c.(1735-1737)CAA>CAG	p.Q579Q	FLT4_uc003mlz.3_Silent_p.Q579Q|FLT4_uc003mmb.1_Silent_p.Q112Q|FLT4_uc011dgy.1_Silent_p.Q579Q	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2	579	Ig-like C2-type 6.|Extracellular (Potential).				positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)									Congenital_Hereditary_Lymphedema				---	---	---	---	capture		Silent	SNP	180048825	180048825	6186	5	T	C	C	56	56	FLT4	C	4	4
C6orf145	221749	broad.mit.edu	37	6	3737340	3737340	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:3737340T>A	uc003mvt.2	-	3	920	c.439A>T	c.(439-441)AGC>TGC	p.S147C		NM_183373	NP_899229	Q5TGL8	CF145_HUMAN	hypothetical protein LOC221749	147					cell communication		phosphatidylinositol binding			breast(1)	1	Ovarian(93;0.0925)	all_hematologic(90;0.108)																---	---	---	---	capture		Missense_Mutation	SNP	3737340	3737340	2438	6	T	A	A	55	55	C6orf145	A	4	4
BTN3A1	11119	broad.mit.edu	37	6	26413559	26413559	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26413559G>T	uc003nhv.2	+	10	1549	c.1181G>T	c.(1180-1182)AGA>ATA	p.R394I	BTN3A1_uc011dkj.1_3'UTR|BTN3A1_uc011dkk.1_Missense_Mutation_p.R342I|BTN3A1_uc010jqj.2_3'UTR	NM_007048	NP_008979	O00481	BT3A1_HUMAN	butyrophilin, subfamily 3, member A1 isoform a	394	Cytoplasmic (Potential).|B30.2/SPRY.				lipid metabolic process	integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2																		---	---	---	---	capture		Missense_Mutation	SNP	26413559	26413559	1596	6	G	T	T	33	33	BTN3A1	T	2	2
OR2B2	81697	broad.mit.edu	37	6	27879772	27879772	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27879772G>T	uc011dkw.1	-	1	326	c.326C>A	c.(325-327)TCC>TAC	p.S109Y		NM_033057	NP_149046	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B,	109	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	27879772	27879772	11395	6	G	T	T	41	41	OR2B2	T	2	2
GABBR1	2550	broad.mit.edu	37	6	29574776	29574776	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29574776C>A	uc003nmt.3	-	18	2451	c.2115G>T	c.(2113-2115)CTG>CTT	p.L705L	GABBR1_uc003nmp.3_Silent_p.L588L|GABBR1_uc003nms.3_Silent_p.L588L|GABBR1_uc003nmu.3_Silent_p.L643L|GABBR1_uc011dlr.1_Silent_p.L528L	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	705	Cytoplasmic (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)													---	---	---	---	capture		Silent	SNP	29574776	29574776	6406	6	C	A	A	21	21	GABBR1	A	2	2
FLOT1	10211	broad.mit.edu	37	6	30708458	30708458	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30708458G>T	uc003nrm.2	-	6	636	c.472C>A	c.(472-474)CAG>AAG	p.Q158K	FLOT1_uc011dmr.1_Missense_Mutation_p.Q110K	NM_005803	NP_005794	O75955	FLOT1_HUMAN	flotillin 1	158						centriolar satellite|endosome|integral to membrane|melanosome|membrane fraction					0																		---	---	---	---	capture		Missense_Mutation	SNP	30708458	30708458	6178	6	G	T	T	47	47	FLOT1	T	2	2
LY6G5C	80741	broad.mit.edu	37	6	31644735	31644735	+	Nonstop_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31644735T>A	uc003nvu.1	-	3	443	c.443A>T	c.(442-444)TAG>TTG	p.*148L	LY6G5C_uc003nvw.1_RNA|LY6G5C_uc010jtb.1_RNA	NM_025262	NP_079538	Q5SRR4	LY65C_HUMAN	lymphocyte antigen 6 complex G5C	148	UPAR/Ly6.					extracellular region					0																		---	---	---	---	capture		Nonstop_Mutation	SNP	31644735	31644735	9470	6	T	A	A	53	53	LY6G5C	A	5	4
TNFRSF21	27242	broad.mit.edu	37	6	47200539	47200539	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:47200539G>T	uc003oyv.2	-	6	2363	c.1930C>A	c.(1930-1932)CTG>ATG	p.L644M		NM_014452	NP_055267	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily,	644	Cytoplasmic (Potential).				cellular lipid metabolic process	cytoplasm|integral to membrane	protein binding|receptor activity				0			Lung(136;0.189)															---	---	---	---	capture		Missense_Mutation	SNP	47200539	47200539	16836	6	G	T	T	35	35	TNFRSF21	T	2	2
PAQR8	85315	broad.mit.edu	37	6	52268753	52268753	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268753C>A	uc003pao.3	+	2	916	c.742C>A	c.(742-744)CAC>AAC	p.H248N		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	248	Helical; Name=5; (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)																	---	---	---	---	capture		Missense_Mutation	SNP	52268753	52268753	11858	6	C	A	A	21	21	PAQR8	A	2	2
GCLC	2729	broad.mit.edu	37	6	53385711	53385711	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53385711C>A	uc003pbw.1	-	3	699	c.311G>T	c.(310-312)GGG>GTG	p.G104V	GCLC_uc003pbx.2_Missense_Mutation_p.G104V	NM_001498	NP_001489	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	104					anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding			ovary(1)|central_nervous_system(1)	2	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)													---	---	---	---	capture		Missense_Mutation	SNP	53385711	53385711	6561	6	C	A	A	22	22	GCLC	A	2	2
LRRC1	55227	broad.mit.edu	37	6	53784346	53784346	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53784346G>T	uc003pcd.1	+	12	1434	c.1157G>T	c.(1156-1158)TGG>TTG	p.W386L		NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1	386	LRR 17.					cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)														---	---	---	---	capture		Missense_Mutation	SNP	53784346	53784346	9339	6	G	T	T	47	47	LRRC1	T	2	2
CD109	135228	broad.mit.edu	37	6	74476673	74476673	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74476673G>T	uc003php.2	+	13	1862	c.1437G>T	c.(1435-1437)GTG>GTT	p.V479V	CD109_uc010kaz.2_Silent_p.V479V|CD109_uc003phq.2_Silent_p.V479V|CD109_uc010kba.2_Silent_p.V402V	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	479						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4																		---	---	---	---	capture		Silent	SNP	74476673	74476673	3090	6	G	T	T	47	47	CD109	T	2	2
IBTK	25998	broad.mit.edu	37	6	82950160	82950160	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82950160A>C	uc003pjl.1	-	2	571	c.44T>G	c.(43-45)CTG>CGG	p.L15R	IBTK_uc011dyv.1_Missense_Mutation_p.L15R|IBTK_uc011dyw.1_Missense_Mutation_p.L15R|IBTK_uc010kbi.1_5'UTR|IBTK_uc003pjm.2_Missense_Mutation_p.L15R	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	15					negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)														---	---	---	---	capture		Missense_Mutation	SNP	82950160	82950160	7776	6	A	C	C	7	7	IBTK	C	4	4
MDN1	23195	broad.mit.edu	37	6	90418237	90418237	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90418237G>T	uc003pnn.1	-	51	7992	c.7876C>A	c.(7876-7878)CTT>ATT	p.L2626I		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	2626					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)														---	---	---	---	capture		Missense_Mutation	SNP	90418237	90418237	9804	6	G	T	T	35	35	MDN1	T	2	2
CASP8AP2	9994	broad.mit.edu	37	6	90572028	90572028	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90572028G>T	uc003pnr.2	+	7	796	c.600G>T	c.(598-600)AAG>AAT	p.K200N	CASP8AP2_uc003pns.2_Intron|CASP8AP2_uc003pnt.2_Missense_Mutation_p.K200N|CASP8AP2_uc011dzz.1_Missense_Mutation_p.K200N	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	200					cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)														---	---	---	---	capture		Missense_Mutation	SNP	90572028	90572028	2797	6	G	T	T	35	35	CASP8AP2	T	2	2
C6orf167	253714	broad.mit.edu	37	6	97679333	97679333	+	Missense_Mutation	SNP	C	A	A	rs138260692		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97679333C>A	uc003ppb.2	-	13	1764	c.1498G>T	c.(1498-1500)GGC>TGC	p.G500C	C6orf167_uc011eaf.1_Missense_Mutation_p.G460C|C6orf167_uc010kcn.1_Missense_Mutation_p.G274C	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714	500					double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)														---	---	---	---	capture		Missense_Mutation	SNP	97679333	97679333	2447	6	C	A	A	21	21	C6orf167	A	2	2
PRDM13	59336	broad.mit.edu	37	6	100062259	100062259	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100062259C>A	uc003pqg.1	+	4	2009	c.1748C>A	c.(1747-1749)TCG>TAG	p.S583*		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	583	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)														---	---	---	---	capture		Nonsense_Mutation	SNP	100062259	100062259	12896	6	C	A	A	31	31	PRDM13	A	5	1
SIM1	6492	broad.mit.edu	37	6	100896428	100896428	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100896428C>T	uc003pqj.3	-	6	877	c.670G>A	c.(670-672)GAG>AAG	p.E224K	SIM1_uc010kcu.2_Missense_Mutation_p.E224K	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	224	PAS 2.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)														---	---	---	---	capture		Missense_Mutation	SNP	100896428	100896428	14818	6	C	T	T	30	30	SIM1	T	2	2
LAMA4	3910	broad.mit.edu	37	6	112486384	112486384	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112486384G>T	uc003pvu.2	-	13	1955	c.1646C>A	c.(1645-1647)TCA>TAA	p.S549*	LAMA4_uc003pvv.2_Nonsense_Mutation_p.S542*|LAMA4_uc003pvt.2_Nonsense_Mutation_p.S542*	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	549	Domain II and I.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)														---	---	---	---	capture		Nonsense_Mutation	SNP	112486384	112486384	8931	6	G	T	T	45	45	LAMA4	T	5	2
FRK	2444	broad.mit.edu	37	6	116381198	116381198	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116381198T>C	uc003pwi.1	-	1	724	c.277A>G	c.(277-279)AGT>GGT	p.S93G		NM_002031	NP_002022	P42685	FRK_HUMAN	fyn-related kinase	93	SH3.				negative regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			ovary(3)|lung(3)	6		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)														---	---	---	---	capture		Missense_Mutation	SNP	116381198	116381198	6298	6	T	C	C	55	55	FRK	C	4	4
KPNA5	3841	broad.mit.edu	37	6	117043288	117043288	+	Splice_Site	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117043288G>T	uc003pxh.2	+	9	888	c.757_splice	c.e9-1	p.V253_splice		NM_002269	NP_002260			karyopherin alpha 5						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding|protein transporter activity			breast(3)|skin(1)	4		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0298)|all cancers(137;0.0461)|OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.212)														---	---	---	---	capture		Splice_Site	SNP	117043288	117043288	8747	6	G	T	T	35	35	KPNA5	T	5	2
THEMIS	387357	broad.mit.edu	37	6	128222064	128222064	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128222064A>G	uc003qbi.2	-	2	333	c.14T>C	c.(13-15)CTG>CCG	p.L5P	THEMIS_uc011ebt.1_Missense_Mutation_p.L5P|THEMIS_uc010kfb.2_Intron	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	5	CABIT 1.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4																		---	---	---	---	capture		Missense_Mutation	SNP	128222064	128222064	16388	6	A	G	G	7	7	THEMIS	G	4	4
LAMA2	3908	broad.mit.edu	37	6	129712691	129712691	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129712691C>T	uc003qbn.2	+	36	5232	c.5127C>T	c.(5125-5127)GCC>GCT	p.A1709A	LAMA2_uc003qbo.2_Silent_p.A1709A	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	1709	Domain II and I.|Potential.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)														---	---	---	---	capture		Silent	SNP	129712691	129712691	8929	6	C	T	T	24	24	LAMA2	T	2	2
SYNE1	23345	broad.mit.edu	37	6	152734570	152734570	+	Silent	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152734570A>G	uc010kiw.2	-	42	6749	c.6147T>C	c.(6145-6147)GAT>GAC	p.D2049D	SYNE1_uc003qot.3_Silent_p.D2056D|SYNE1_uc003qou.3_Silent_p.D2049D|SYNE1_uc010kjb.1_Silent_p.D2032D	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2049	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)											HNSCC(10;0.0054)			---	---	---	---	capture		Silent	SNP	152734570	152734570	15966	6	A	G	G	8	8	SYNE1	G	4	4
TULP4	56995	broad.mit.edu	37	6	158923577	158923577	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158923577A>G	uc003qrf.2	+	13	4239	c.2882A>G	c.(2881-2883)TAT>TGT	p.Y961C	TULP4_uc003qrg.2_Intron	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	961					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)														---	---	---	---	capture		Missense_Mutation	SNP	158923577	158923577	17331	6	A	G	G	16	16	TULP4	G	4	4
MAP3K4	4216	broad.mit.edu	37	6	161470015	161470015	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161470015A>T	uc003qtn.2	+	3	853	c.711A>T	c.(709-711)TCA>TCT	p.S237S	MAP3K4_uc010kkc.1_Silent_p.S237S|MAP3K4_uc003qto.2_Silent_p.S237S|MAP3K4_uc011efz.1_RNA|MAP3K4_uc011ega.1_5'UTR	NM_005922	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	237					activation of MAPKK activity|JNK cascade|positive regulation of JUN kinase activity	perinuclear region of cytoplasm	ATP binding|MAP kinase kinase kinase activity|metal ion binding|protein binding			ovary(3)|lung(3)|skin(2)|stomach(1)	9		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)														---	---	---	---	capture		Silent	SNP	161470015	161470015	9635	6	A	T	T	7	7	MAP3K4	T	4	4
KIAA0415	9907	broad.mit.edu	37	7	4820834	4820834	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4820834T>A	uc003sne.2	+	2	153	c.70T>A	c.(70-72)TTC>ATC	p.F24I	KIAA0415_uc010ksp.2_RNA	NM_014855	NP_055670	O43299	K0415_HUMAN	hypothetical protein LOC9907	24					cell death|double-strand break repair via homologous recombination	cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.091)|OV - Ovarian serous cystadenocarcinoma(56;8.35e-15)														---	---	---	---	capture		Missense_Mutation	SNP	4820834	4820834	8482	7	T	A	A	60	60	KIAA0415	A	4	4
SP4	6671	broad.mit.edu	37	7	21521591	21521591	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21521591G>A	uc003sva.2	+	5	2138	c.1957G>A	c.(1957-1959)GGA>AGA	p.G653R	SP4_uc003svb.2_Missense_Mutation_p.G340R	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	653	C2H2-type 1.				regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5																		---	---	---	---	capture		Missense_Mutation	SNP	21521591	21521591	15466	7	G	A	A	35	35	SP4	A	2	2
KLHL7	55975	broad.mit.edu	37	7	23207573	23207573	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23207573C>G	uc003svs.3	+	9	1589	c.1296C>G	c.(1294-1296)ATC>ATG	p.I432M	KLHL7_uc003svr.3_Missense_Mutation_p.I410M|KLHL7_uc011jys.1_Missense_Mutation_p.I356M|KLHL7_uc011jyt.1_Missense_Mutation_p.I207M|KLHL7_uc003svt.2_Missense_Mutation_p.I384M|KLHL7_uc011jyv.1_Intron	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	432	Kelch 4.					Golgi apparatus|nucleolus|plasma membrane					0																		---	---	---	---	capture		Missense_Mutation	SNP	23207573	23207573	8708	7	C	G	G	32	32	KLHL7	G	3	3
HOXA2	3199	broad.mit.edu	37	7	27141032	27141032	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27141032A>T	uc003syh.2	-	2	719	c.444T>A	c.(442-444)ACT>ACA	p.T148T		NM_006735	NP_006726	O43364	HXA2_HUMAN	homeobox A2	148	Homeobox.					nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2																		---	---	---	---	capture		Silent	SNP	27141032	27141032	7584	7	A	T	T	7	7	HOXA2	T	4	4
C7orf16	10842	broad.mit.edu	37	7	31736665	31736665	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31736665G>C	uc003tcl.2	+	4	480	c.322G>C	c.(322-324)GAC>CAC	p.D108H	C7orf16_uc011kaf.1_Missense_Mutation_p.D57H	NM_006658	NP_006649	O96001	GSUB_HUMAN	G-substrate isoform 1	108					behavior|central nervous system development|intracellular protein kinase cascade|protein phosphorylation	soluble fraction				ovary(2)|central_nervous_system(1)	3			GBM - Glioblastoma multiforme(11;0.216)															---	---	---	---	capture		Missense_Mutation	SNP	31736665	31736665	2485	7	G	C	C	45	45	C7orf16	C	3	3
PKD1L1	168507	broad.mit.edu	37	7	47979871	47979871	+	Silent	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47979871A>G	uc003tny.1	-	3	204	c.204T>C	c.(202-204)TGT>TGC	p.C68C		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	68	Extracellular (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11																		---	---	---	---	capture		Silent	SNP	47979871	47979871	12388	7	A	G	G	6	6	PKD1L1	G	4	4
FKBP6	8468	broad.mit.edu	37	7	72756882	72756882	+	Silent	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72756882A>T	uc003tya.2	+	8	1101	c.969A>T	c.(967-969)ACA>ACT	p.T323T	FKBP6_uc003twz.2_Silent_p.T293T|FKBP6_uc011kew.1_Silent_p.T318T	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	323					protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)														OREG0018106	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Silent	SNP	72756882	72756882	6150	7	A	T	T	7	7	FKBP6	T	4	4
PHTF2	57157	broad.mit.edu	37	7	77539631	77539631	+	Silent	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77539631A>G	uc003ugs.3	+	8	807	c.681A>G	c.(679-681)ACA>ACG	p.T227T	PHTF2_uc003ugo.3_Silent_p.T189T|PHTF2_uc003ugp.2_Silent_p.T189T|PHTF2_uc003ugq.3_Silent_p.T189T|PHTF2_uc010ldv.2_Silent_p.T189T|PHTF2_uc003ugr.3_Silent_p.T193T|PHTF2_uc003ugt.3_Silent_p.T193T|PHTF2_uc003ugu.3_Silent_p.T189T|PHTF2_uc003ugv.2_Silent_p.T52T|PHTF2_uc010ldw.1_Silent_p.T52T	NM_001127357	NP_001120829	Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	227					regulation of transcription, DNA-dependent|transcription, DNA-dependent	endoplasmic reticulum|nucleus	DNA binding			ovary(1)	1																		---	---	---	---	capture		Silent	SNP	77539631	77539631	12287	7	A	G	G	6	6	PHTF2	G	4	4
PCLO	27445	broad.mit.edu	37	7	82578965	82578965	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82578965G>T	uc003uhx.2	-	6	11228	c.10939C>A	c.(10939-10941)CTC>ATC	p.L3647I	PCLO_uc003uhv.2_Missense_Mutation_p.L3647I|PCLO_uc010lec.2_Missense_Mutation_p.L612I	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	3578					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7																		---	---	---	---	capture		Missense_Mutation	SNP	82578965	82578965	12003	7	G	T	T	35	35	PCLO	T	2	2
ABCB1	5243	broad.mit.edu	37	7	87196249	87196249	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87196249C>A	uc003uiz.1	-	7	800	c.382G>T	c.(382-384)GCT>TCT	p.A128S	ABCB1_uc011khc.1_Intron	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	128	ABC transmembrane type-1 1.|Helical; (Potential).				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)													---	---	---	---	capture		Missense_Mutation	SNP	87196249	87196249	41	7	C	A	A	25	25	ABCB1	A	2	2
CLDN12	9069	broad.mit.edu	37	7	90042424	90042424	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90042424C>G	uc003ukp.2	+	5	1070	c.434C>G	c.(433-435)ACT>AGT	p.T145S	CLDN12_uc003ukq.2_Missense_Mutation_p.T145S|CLDN12_uc010leq.2_Missense_Mutation_p.T145S|CLDN12_uc003ukr.2_Missense_Mutation_p.T145S|CLDN12_uc003uks.2_Missense_Mutation_p.T145S	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12	145	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0																		---	---	---	---	capture		Missense_Mutation	SNP	90042424	90042424	3610	7	C	G	G	20	20	CLDN12	G	3	3
CASD1	64921	broad.mit.edu	37	7	94174935	94174935	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94174935C>T	uc003uni.3	+	12	1782	c.1555C>T	c.(1555-1557)CCC>TCC	p.P519S	CASD1_uc003unj.3_Missense_Mutation_p.P519S	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	519	Helical; (Potential).					integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)															---	---	---	---	capture		Missense_Mutation	SNP	94174935	94174935	2783	7	C	T	T	22	22	CASD1	T	2	2
ZKSCAN5	23660	broad.mit.edu	37	7	99129070	99129070	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99129070G>T	uc003uqv.2	+	7	1842	c.1718G>T	c.(1717-1719)GGG>GTG	p.G573V	ZKSCAN5_uc010lfx.2_Missense_Mutation_p.G573V|ZKSCAN5_uc003uqw.2_Missense_Mutation_p.G573V|ZKSCAN5_uc003uqx.2_Missense_Mutation_p.G500V|ZKSCAN5_uc003uqy.2_Missense_Mutation_p.G309V	NM_145102	NP_659570	Q9Y2L8	ZKSC5_HUMAN	zinc finger with KRAB and SCAN domains 5	573					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)																	---	---	---	---	capture		Missense_Mutation	SNP	99129070	99129070	18281	7	G	T	T	43	43	ZKSCAN5	T	2	2
ZNHIT1	10467	broad.mit.edu	37	7	100866982	100866982	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100866982A>G	uc003uye.2	+	4	794	c.302A>G	c.(301-303)TAC>TGC	p.Y101C	ZNHIT1_uc003uyf.2_RNA	NM_006349	NP_006340	O43257	ZNHI1_HUMAN	zinc finger, HIT domain containing 1	101							metal ion binding|protein binding			large_intestine(1)	1	Lung NSC(181;0.168)|all_lung(186;0.215)																	---	---	---	---	capture		Missense_Mutation	SNP	100866982	100866982	18810	7	A	G	G	14	14	ZNHIT1	G	4	4
SLC26A4	5172	broad.mit.edu	37	7	107323902	107323902	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107323902G>C	uc003vep.2	+	8	1145	c.921G>C	c.(919-921)ACG>ACC	p.T307T		NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin	307	Helical; (Potential).				regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7														Pendred_syndrome				---	---	---	---	capture		Silent	SNP	107323902	107323902	15016	7	G	C	C	37	37	SLC26A4	C	3	3
PPP1R3A	5506	broad.mit.edu	37	7	113519573	113519573	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113519573C>T	uc010ljy.1	-	4	1605	c.1574G>A	c.(1573-1575)GGT>GAT	p.G525D		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	525					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34																		---	---	---	---	capture		Missense_Mutation	SNP	113519573	113519573	12806	7	C	T	T	18	18	PPP1R3A	T	2	2
FOXP2	93986	broad.mit.edu	37	7	114271687	114271687	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114271687C>T	uc003vhb.2	+	6	1076	c.702C>T	c.(700-702)CTC>CTT	p.L234L	FOXP2_uc003vgu.2_RNA|FOXP2_uc003vgz.2_Silent_p.L259L|FOXP2_uc003vha.2_Silent_p.L142L|FOXP2_uc011kmu.1_Silent_p.L251L|FOXP2_uc011kmv.1_Silent_p.L233L|FOXP2_uc010ljz.1_Silent_p.L142L|FOXP2_uc003vgt.1_RNA|FOXP2_uc003vgv.1_Silent_p.L234L|FOXP2_uc003vgx.2_Silent_p.L234L|FOXP2_uc003vhd.2_Silent_p.L234L|FOXP2_uc003vhc.2_Silent_p.L259L	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I	234	Gln-rich.				camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8																		---	---	---	---	capture		Silent	SNP	114271687	114271687	6273	7	C	T	T	29	29	FOXP2	T	2	2
TES	26136	broad.mit.edu	37	7	115892000	115892000	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115892000G>T	uc003vho.2	+	5	1070	c.889G>T	c.(889-891)GAG>TAG	p.E297*	TES_uc011kmy.1_Nonsense_Mutation_p.E55*|TES_uc003vhp.2_Nonsense_Mutation_p.E288*|uc003vhq.1_5'Flank	NM_015641	NP_056456	Q9UGI8	TES_HUMAN	testin isoform 1	297	LIM zinc-binding 1.				negative regulation of cell proliferation	cytoplasm|focal adhesion|nucleus|protein complex	zinc ion binding				0	Lung NSC(10;0.0137)|all_lung(10;0.0148)	Breast(660;0.0602)	STAD - Stomach adenocarcinoma(10;0.00878)															---	---	---	---	capture		Nonsense_Mutation	SNP	115892000	115892000	16292	7	G	T	T	37	37	TES	T	5	1
AASS	10157	broad.mit.edu	37	7	121753271	121753271	+	Silent	SNP	C	G	G	rs139733515		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121753271C>G	uc003vka.2	-	10	1275	c.1179G>C	c.(1177-1179)TCG>TCC	p.S393S	AASS_uc011knu.1_RNA|AASS_uc011knv.1_RNA|AASS_uc003vkb.2_Silent_p.S393S|AASS_uc011knw.1_Intron	NM_005763	NP_005754	Q9UDR5	AASS_HUMAN	aminoadipate-semialdehyde synthase precursor	393	Lysine-ketoglutarate reductase.				protein tetramerization	mitochondrial matrix	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity|saccharopine dehydrogenase (NADP+, L-lysine-forming) activity			upper_aerodigestive_tract(1)|ovary(1)	2					L-Glutamic Acid(DB00142)|NADH(DB00157)													---	---	---	---	capture		Silent	SNP	121753271	121753271	25	7	C	G	G	23	23	AASS	G	3	3
CCDC136	64753	broad.mit.edu	37	7	128457894	128457894	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128457894G>T	uc003vnv.1	+	17	3813	c.3446G>T	c.(3445-3447)TGG>TTG	p.W1149L	CCDC136_uc003vnu.1_Missense_Mutation_p.W429L|CCDC136_uc003vnw.1_Missense_Mutation_p.W510L|CCDC136_uc003vnx.1_Intron|CCDC136_uc010llq.1_Intron|CCDC136_uc003vny.1_Intron	NM_022742	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	1149	Helical; (Potential).					integral to membrane	protein binding			ovary(2)	2																		---	---	---	---	capture		Missense_Mutation	SNP	128457894	128457894	2890	7	G	T	T	47	47	CCDC136	T	2	2
LUC7L2	51631	broad.mit.edu	37	7	139030286	139030286	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139030286C>T	uc011kqt.1	+	2	412	c.178C>T	c.(178-180)CAT>TAT	p.H60Y	LUC7L2_uc011kqs.1_Intron|C7orf55_uc003vuw.3_Missense_Mutation_p.H60Y	NM_016019	NP_057103	Q9Y383	LC7L2_HUMAN	LUC7-like 2	Error:Variant_position_missing_in_Q9Y383_after_alignment							enzyme binding|metal ion binding				0	Melanoma(164;0.242)																	---	---	---	---	capture		Missense_Mutation	SNP	139030286	139030286	9459	7	C	T	T	29	29	LUC7L2	T	2	2
DENND2A	27147	broad.mit.edu	37	7	140301390	140301390	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140301390G>A	uc010lnj.2	-	1	953	c.808C>T	c.(808-810)CGG>TGG	p.R270W	DENND2A_uc011kre.1_RNA|DENND2A_uc010lnk.2_Missense_Mutation_p.R270W|DENND2A_uc003vvw.2_Missense_Mutation_p.R270W|DENND2A_uc003vvx.2_Missense_Mutation_p.R270W	NM_015689	NP_056504	Q9ULE3	DEN2A_HUMAN	DENN/MADD domain containing 2A	270										ovary(3)|breast(1)	4	Melanoma(164;0.00956)																	---	---	---	---	capture		Missense_Mutation	SNP	140301390	140301390	4608	7	G	A	A	39	39	DENND2A	A	1	1
TAS2R38	5726	broad.mit.edu	37	7	141673168	141673168	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141673168A>T	uc003vwx.1	-	1	406	c.322T>A	c.(322-324)TGG>AGG	p.W108R		NM_176817	NP_789787	P59533	T2R38_HUMAN	taste receptor, type 2, member 38	108	Helical; Name=3; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			kidney(1)|skin(1)	2	Melanoma(164;0.0171)																	---	---	---	---	capture		Missense_Mutation	SNP	141673168	141673168	16097	7	A	T	T	7	7	TAS2R38	T	4	4
MGAM	8972	broad.mit.edu	37	7	141800656	141800656	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141800656G>A	uc003vwy.2	+	45	5295	c.5241G>A	c.(5239-5241)GGG>GGA	p.G1747G		NM_004668	NP_004659	O43451	MGA_HUMAN	maltase-glucoamylase	1747	Glucoamylase.|Lumenal (Potential).				polysaccharide digestion|starch catabolic process	apical plasma membrane|integral to membrane	carbohydrate binding|glucan 1,4-alpha-glucosidase activity|maltose alpha-glucosidase activity			ovary(2)	2	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)													---	---	---	---	capture		Silent	SNP	141800656	141800656	9931	7	G	A	A	43	43	MGAM	A	2	2
OR9A2	135924	broad.mit.edu	37	7	142723686	142723686	+	Silent	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142723686C>G	uc003wcc.1	-	1	534	c.534G>C	c.(532-534)GGG>GGC	p.G178G		NM_001001658	NP_001001658	Q8NGT5	OR9A2_HUMAN	olfactory receptor, family 9, subfamily A,	178	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	Melanoma(164;0.059)																	---	---	---	---	capture		Silent	SNP	142723686	142723686	11659	7	C	G	G	26	26	OR9A2	G	3	3
OR2A14	135941	broad.mit.edu	37	7	143826946	143826946	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143826946G>T	uc011kua.1	+	1	741	c.741G>T	c.(739-741)GTG>GTT	p.V247V		NM_001001659	NP_001001659	Q96R47	O2A14_HUMAN	olfactory receptor, family 2, subfamily A,	247	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)																	---	---	---	---	capture		Silent	SNP	143826946	143826946	11382	7	G	T	T	47	47	OR2A14	T	2	2
MLL3	58508	broad.mit.edu	37	7	151878701	151878701	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151878701T>C	uc003wla.2	-	36	6463	c.6244A>G	c.(6244-6246)ATA>GTA	p.I2082V	MLL3_uc003wkz.2_Missense_Mutation_p.I1143V	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2082	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)				N		medulloblastoma								---	---	---	---	capture		Missense_Mutation	SNP	151878701	151878701	10012	7	T	C	C	49	49	MLL3	C	4	4
VIPR2	7434	broad.mit.edu	37	7	158827336	158827336	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158827336C>A	uc003woh.2	-	9	1001	c.815G>T	c.(814-816)TGG>TTG	p.W272L	VIPR2_uc010lqx.2_RNA|VIPR2_uc010lqy.2_RNA	NM_003382	NP_003373	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	272	Extracellular (Potential).				cell-cell signaling	integral to plasma membrane				lung(1)|central_nervous_system(1)	2	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)														---	---	---	---	capture		Missense_Mutation	SNP	158827336	158827336	17737	7	C	A	A	21	21	VIPR2	A	2	2
CSMD1	64478	broad.mit.edu	37	8	2876056	2876056	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2876056G>T	uc011kwk.1	-	52	8365	c.7975C>A	c.(7975-7977)CAT>AAT	p.H2659N	CSMD1_uc011kwj.1_Missense_Mutation_p.H1988N|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2659	Extracellular (Potential).|Sushi 17.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---	capture		Missense_Mutation	SNP	2876056	2876056	4085	8	G	T	T	45	45	CSMD1	T	2	2
CSMD1	64478	broad.mit.edu	37	8	3245035	3245035	+	Silent	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3245035G>A	uc011kwk.1	-	18	3156	c.2766C>T	c.(2764-2766)CAC>CAT	p.H922H	CSMD1_uc011kwj.1_Silent_p.H314H|CSMD1_uc003wqe.2_Silent_p.H78H	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	922	Extracellular (Potential).|Sushi 5.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)														---	---	---	---	capture		Silent	SNP	3245035	3245035	4085	8	G	A	A	40	40	CSMD1	A	1	1
DLC1	10395	broad.mit.edu	37	8	12957525	12957525	+	Missense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12957525A>T	uc003wwm.2	-	9	2765	c.2321T>A	c.(2320-2322)ATG>AAG	p.M774K	DLC1_uc003wwk.1_Missense_Mutation_p.M337K|DLC1_uc003wwl.1_Missense_Mutation_p.M371K|DLC1_uc011kxx.1_Missense_Mutation_p.M263K	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	774					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	12957525	12957525	4730	8	A	T	T	8	8	DLC1	T	4	4
ADAMDEC1	27299	broad.mit.edu	37	8	24254965	24254965	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24254965C>A	uc003xdz.2	+	6	843	c.623C>A	c.(622-624)CCA>CAA	p.P208Q	ADAMDEC1_uc010lub.2_Missense_Mutation_p.P129Q|ADAMDEC1_uc011lab.1_Missense_Mutation_p.P129Q	NM_014479	NP_055294	O15204	ADEC1_HUMAN	ADAM-like, decysin 1 isoform 1	208					integrin-mediated signaling pathway|negative regulation of cell adhesion|proteolysis	extracellular region|integral to membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)	2		Prostate(55;0.0181)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)|BRCA - Breast invasive adenocarcinoma(99;0.168)														---	---	---	---	capture		Missense_Mutation	SNP	24254965	24254965	255	8	C	A	A	21	21	ADAMDEC1	A	2	2
CLU	1191	broad.mit.edu	37	8	27468014	27468014	+	Silent	SNP	C	A	A	rs141237968	byFrequency	TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27468014C>A	uc003xfw.1	-	1	133	c.75G>T	c.(73-75)ACG>ACT	p.T25T	CLU_uc010lux.1_5'UTR|CLU_uc003xfx.1_Silent_p.T25T|CLU_uc003xfy.1_Silent_p.T36T|CLU_uc003xfz.1_Silent_p.T77T	NM_203339	NP_976084	P10909	CLUS_HUMAN	clusterin isoform 2	25					chaperone-mediated protein folding|complement activation, classical pathway|innate immune response|lipid metabolic process|negative regulation of apoptosis|negative regulation of protein homooligomerization|platelet activation|platelet degranulation|positive regulation of NF-kappaB transcription factor activity|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|response to misfolded protein|response to virus|reverse cholesterol transport	chromaffin granule|cytosol|endoplasmic reticulum|microsome|mitochondrial membrane|nucleus|perinuclear region of cytoplasm|platelet alpha granule lumen|spherical high-density lipoprotein particle	misfolded protein binding|ubiquitin protein ligase binding			ovary(2)	2		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)														---	---	---	---	capture		Silent	SNP	27468014	27468014	3706	8	C	A	A	23	23	CLU	A	1	1
TEX15	56154	broad.mit.edu	37	8	30703523	30703523	+	Nonsense_Mutation	SNP	A	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30703523A>T	uc003xil.2	-	1	3011	c.3011T>A	c.(3010-3012)TTA>TAA	p.L1004*		NM_031271	NP_112561	Q9BXT5	TEX15_HUMAN	testis expressed 15	1004										ovary(3)|upper_aerodigestive_tract(2)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)														---	---	---	---	capture		Nonsense_Mutation	SNP	30703523	30703523	16306	8	A	T	T	13	13	TEX15	T	5	4
HTRA4	203100	broad.mit.edu	37	8	38832580	38832580	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38832580A>G	uc003xmj.2	+	2	612	c.497A>G	c.(496-498)AAT>AGT	p.N166S		NM_153692	NP_710159	P83105	HTRA4_HUMAN	HtrA serine peptidase 4 precursor	166					proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)															---	---	---	---	capture		Missense_Mutation	SNP	38832580	38832580	7756	8	A	G	G	4	4	HTRA4	G	4	4
PCMTD1	115294	broad.mit.edu	37	8	52733199	52733199	+	Silent	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52733199C>T	uc003xqx.3	-	6	1127	c.786G>A	c.(784-786)GAG>GAA	p.E262E	PCMTD1_uc011ldm.1_Silent_p.E132E|PCMTD1_uc003xqw.3_Silent_p.E262E|PCMTD1_uc011ldn.1_Silent_p.E74E|PCMTD1_uc010lya.2_Silent_p.E186E	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	262						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)																---	---	---	---	capture		Silent	SNP	52733199	52733199	12006	8	C	T	T	32	32	PCMTD1	T	2	2
RP1	6101	broad.mit.edu	37	8	55534821	55534821	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55534821G>T	uc003xsd.1	+	3	908	c.760G>T	c.(760-762)GGA>TGA	p.G254*	RP1_uc011ldy.1_Nonsense_Mutation_p.G254*	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	254					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---	capture		Nonsense_Mutation	SNP	55534821	55534821	14011	8	G	T	T	43	43	RP1	T	5	2
RP1	6101	broad.mit.edu	37	8	55542223	55542223	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55542223C>A	uc003xsd.1	+	4	5929	c.5781C>A	c.(5779-5781)CCC>CCA	p.P1927P	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1927					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)															---	---	---	---	capture		Silent	SNP	55542223	55542223	14011	8	C	A	A	21	21	RP1	A	2	2
ZFHX4	79776	broad.mit.edu	37	8	77616390	77616390	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77616390G>T	uc003yav.2	+	2	454	c.67G>T	c.(67-69)GGA>TGA	p.G23*	ZFHX4_uc003yat.1_Nonsense_Mutation_p.G23*|ZFHX4_uc003yau.1_Nonsense_Mutation_p.G23*|ZFHX4_uc003yaw.1_Nonsense_Mutation_p.G23*	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	23						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---	capture		Nonsense_Mutation	SNP	77616390	77616390	18223	8	G	T	T	47	47	ZFHX4	T	5	2
ZFHX4	79776	broad.mit.edu	37	8	77775461	77775461	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77775461C>A	uc003yav.2	+	11	9763	c.9376C>A	c.(9376-9378)CCT>ACT	p.P3126T		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3122	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)												HNSCC(33;0.089)			---	---	---	---	capture		Missense_Mutation	SNP	77775461	77775461	18223	8	C	A	A	30	30	ZFHX4	A	2	2
RALYL	138046	broad.mit.edu	37	8	85799928	85799928	+	Missense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85799928G>A	uc003ycq.3	+	9	1191	c.775G>A	c.(775-777)GCT>ACT	p.A259T	RALYL_uc003ycr.3_Missense_Mutation_p.A259T|RALYL_uc003ycs.3_Missense_Mutation_p.A259T|RALYL_uc010lzy.2_Missense_Mutation_p.A248T|RALYL_uc003yct.3_Missense_Mutation_p.A272T|RALYL_uc003ycu.3_Missense_Mutation_p.A186T|RALYL_uc003ycv.3_Intron	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	259							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	85799928	85799928	13480	8	G	A	A	46	46	RALYL	A	2	2
PSKH2	85481	broad.mit.edu	37	8	87076376	87076376	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076376C>A	uc011lfy.1	-	2	670	c.670G>T	c.(670-672)GGG>TGG	p.G224W		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	224	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)															---	---	---	---	capture		Missense_Mutation	SNP	87076376	87076376	13118	8	C	A	A	21	21	PSKH2	A	2	2
CTHRC1	115908	broad.mit.edu	37	8	104390442	104390442	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104390442C>T	uc003ylk.2	+	3	659	c.560C>T	c.(559-561)TCA>TTA	p.S187L		NM_138455	NP_612464	Q96CG8	CTHR1_HUMAN	collagen triple helix repeat containing 1	187						collagen				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)															---	---	---	---	capture		Missense_Mutation	SNP	104390442	104390442	4169	8	C	T	T	29	29	CTHRC1	T	2	2
ZFPM2	23414	broad.mit.edu	37	8	106815050	106815050	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815050A>G	uc003ymd.2	+	8	2763	c.2740A>G	c.(2740-2742)ATA>GTA	p.I914V	ZFPM2_uc011lhs.1_Missense_Mutation_p.I645V	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	914					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)															---	---	---	---	capture		Missense_Mutation	SNP	106815050	106815050	18248	8	A	G	G	4	4	ZFPM2	G	4	4
TAF2	6873	broad.mit.edu	37	8	120759010	120759010	+	Missense_Mutation	SNP	C	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120759010C>G	uc003you.2	-	23	3313	c.3043G>C	c.(3043-3045)GCA>CCA	p.A1015P		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	1015					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)															---	---	---	---	capture		Missense_Mutation	SNP	120759010	120759010	16045	8	C	G	G	28	28	TAF2	G	3	3
ZNF34	80778	broad.mit.edu	37	8	145999031	145999031	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145999031C>A	uc003zdy.3	-	6	1405	c.1303G>T	c.(1303-1305)GTG>TTG	p.V435L	ZNF34_uc010mgb.2_Missense_Mutation_p.V332L|ZNF34_uc003zdx.3_Missense_Mutation_p.V414L	NM_030580	NP_085057	Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	435	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)														---	---	---	---	capture		Missense_Mutation	SNP	145999031	145999031	18448	8	C	A	A	19	19	ZNF34	A	1	1
RPL8	6132	broad.mit.edu	37	8	146015274	146015274	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146015274G>T	uc003zeb.2	-	6	800	c.689C>A	c.(688-690)CCT>CAT	p.P230H	RPL8_uc003zdz.2_RNA|RPL8_uc003zea.2_Missense_Mutation_p.P194H|RPL8_uc003zec.2_Missense_Mutation_p.P230H	NM_033301	NP_150644	P62917	RL8_HUMAN	ribosomal protein L8	230					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	rRNA binding|structural constituent of ribosome				0	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)														---	---	---	---	capture		Missense_Mutation	SNP	146015274	146015274	14081	8	G	T	T	35	35	RPL8	T	2	2
ZNF7	7553	broad.mit.edu	37	8	146068311	146068311	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146068311C>A	uc003zeg.3	+	5	1956	c.1819C>A	c.(1819-1821)CAG>AAG	p.Q607K	ZNF7_uc010mge.2_Missense_Mutation_p.Q618K|ZNF7_uc011lln.1_Missense_Mutation_p.Q511K|ZNF7_uc003zeh.2_Intron|ZNF7_uc003zek.3_Missense_Mutation_p.Q511K|COMMD5_uc003zel.1_Intron	NM_003416	NP_003407	P17097	ZNF7_HUMAN	zinc finger protein 7	607					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)														---	---	---	---	capture		Missense_Mutation	SNP	146068311	146068311	18697	8	C	A	A	21	21	ZNF7	A	2	2
DMRT1	1761	broad.mit.edu	37	9	893917	893917	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:893917C>T	uc003zgv.2	+	3	693	c.544C>T	c.(544-546)CGT>TGT	p.R182C	DMRT1_uc003zgu.1_Missense_Mutation_p.R182C	NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	182					cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)												OREG0019071	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	---	---	---	---	capture		Missense_Mutation	SNP	893917	893917	4765	9	C	T	T	19	19	DMRT1	T	1	1
C9orf68	55064	broad.mit.edu	37	9	4605351	4605351	+	Missense_Mutation	SNP	T	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4605351T>C	uc011llz.1	-	9	1149	c.911A>G	c.(910-912)AAC>AGC	p.N304S	C9orf68_uc003zik.2_RNA|C9orf68_uc003zil.2_RNA|C9orf68_uc010mhj.2_Missense_Mutation_p.N362S|C9orf68_uc011lly.1_Missense_Mutation_p.N239S	NM_001039395	NP_001034484	B4DIY4	B4DIY4_HUMAN	hypothetical protein LOC55064	304											0		Breast(48;0.0456)		GBM - Glioblastoma multiforme(50;0.0222)														---	---	---	---	capture		Missense_Mutation	SNP	4605351	4605351	2607	9	T	C	C	60	60	C9orf68	C	4	4
C9orf72	203228	broad.mit.edu	37	9	27556758	27556758	+	Missense_Mutation	SNP	C	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27556758C>T	uc003zqq.2	-	8	989	c.892G>A	c.(892-894)GTC>ATC	p.V298I		NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a	298										ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)														---	---	---	---	capture		Missense_Mutation	SNP	27556758	27556758	2611	9	C	T	T	20	20	C9orf72	T	2	2
UBAP1	51271	broad.mit.edu	37	9	34241647	34241647	+	Silent	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34241647G>C	uc003ztx.2	+	4	859	c.624G>C	c.(622-624)GTG>GTC	p.V208V	UBAP1_uc010mka.1_Silent_p.V244V|UBAP1_uc003zty.2_Silent_p.V208V|UBAP1_uc011loi.1_Silent_p.V244V|UBAP1_uc011loj.1_Silent_p.V272V|KIF24_uc010mkb.2_Intron|UBAP1_uc003ztz.2_Silent_p.V208V	NM_016525	NP_057609	Q9NZ09	UBAP1_HUMAN	ubiquitin associated protein 1	208						cytoplasm					0			LUSC - Lung squamous cell carcinoma(29;0.00272)															---	---	---	---	capture		Silent	SNP	34241647	34241647	17393	9	G	C	C	48	48	UBAP1	C	3	3
KIF24	347240	broad.mit.edu	37	9	34257596	34257596	+	Missense_Mutation	SNP	G	T	T	rs10972026		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34257596G>T	uc003zua.3	-	11	2129	c.2009C>A	c.(2008-2010)TCT>TAT	p.S670Y	KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	670					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)															---	---	---	---	capture		Missense_Mutation	SNP	34257596	34257596	8603	9	G	T	T	33	33	KIF24	T	2	2
KIF24	347240	broad.mit.edu	37	9	34306367	34306367	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34306367G>T	uc003zua.3	-	3	816	c.696C>A	c.(694-696)CCC>CCA	p.P232P	KIF24_uc010mkb.2_Silent_p.P263P	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	232	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)															---	---	---	---	capture		Silent	SNP	34306367	34306367	8603	9	G	T	T	43	43	KIF24	T	2	2
C9orf131	138724	broad.mit.edu	37	9	35044224	35044224	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35044224G>T	uc003zvw.2	+	2	1627	c.1598G>T	c.(1597-1599)GGG>GTG	p.G533V	C9orf131_uc003zvu.2_Missense_Mutation_p.G485V|C9orf131_uc003zvv.2_Missense_Mutation_p.G460V|C9orf131_uc003zvx.2_Missense_Mutation_p.G498V	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	533											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)															---	---	---	---	capture		Missense_Mutation	SNP	35044224	35044224	2570	9	G	T	T	43	43	C9orf131	T	2	2
C9orf131	138724	broad.mit.edu	37	9	35044322	35044322	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35044322C>A	uc003zvw.2	+	2	1725	c.1696C>A	c.(1696-1698)CCA>ACA	p.P566T	C9orf131_uc003zvu.2_Missense_Mutation_p.P518T|C9orf131_uc003zvv.2_Missense_Mutation_p.P493T|C9orf131_uc003zvx.2_Missense_Mutation_p.P531T	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	566											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)															---	---	---	---	capture		Missense_Mutation	SNP	35044322	35044322	2570	9	C	A	A	22	22	C9orf131	A	2	2
C9orf131	138724	broad.mit.edu	37	9	35045262	35045262	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35045262G>T	uc003zvw.2	+	2	2665	c.2636G>T	c.(2635-2637)AGG>ATG	p.R879M	C9orf131_uc003zvu.2_Missense_Mutation_p.R831M|C9orf131_uc003zvv.2_Missense_Mutation_p.R806M|C9orf131_uc003zvx.2_Missense_Mutation_p.R844M	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	879											0	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)															---	---	---	---	capture		Missense_Mutation	SNP	35045262	35045262	2570	9	G	T	T	35	35	C9orf131	T	2	2
VCP	7415	broad.mit.edu	37	9	35061053	35061053	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35061053C>A	uc003zvy.2	-	11	1707	c.1318G>T	c.(1318-1320)GAG>TAG	p.E440*	VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_Nonsense_Mutation_p.E109*|VCP_uc010mki.1_Nonsense_Mutation_p.E395*	NM_007126	NP_009057	P55072	TERA_HUMAN	valosin-containing protein	440					activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding			upper_aerodigestive_tract(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)															---	---	---	---	capture		Nonsense_Mutation	SNP	35061053	35061053	17705	9	C	A	A	31	31	VCP	A	5	1
PIGO	84720	broad.mit.edu	37	9	35092461	35092461	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35092461G>T	uc003zwd.2	-	7	1819	c.1423C>A	c.(1423-1425)CCA>ACA	p.P475T	PIGO_uc003zwc.1_3'UTR|PIGO_uc003zwe.2_Intron|PIGO_uc003zwf.2_Intron|PIGO_uc003zwg.1_Missense_Mutation_p.P38T	NM_032634	NP_116023	Q8TEQ8	PIGO_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	475	Helical; (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	transferase activity			large_intestine(1)|ovary(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)															---	---	---	---	capture		Missense_Mutation	SNP	35092461	35092461	12318	9	G	T	T	43	43	PIGO	T	2	2
STOML2	30968	broad.mit.edu	37	9	35100631	35100631	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35100631G>T	uc003zwi.2	-	9	960	c.897C>A	c.(895-897)CCC>CCA	p.P299P	STOML2_uc003zwh.2_Silent_p.P190P|STOML2_uc003zwj.2_Silent_p.P190P|STOML2_uc011lou.1_Silent_p.P254P|STOML2_uc003zwk.2_Silent_p.P248P	NM_013442	NP_038470	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	299						cytoskeleton	receptor binding				0			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)															---	---	---	---	capture		Silent	SNP	35100631	35100631	15834	9	G	T	T	35	35	STOML2	T	2	2
STOML2	30968	broad.mit.edu	37	9	35101545	35101545	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35101545G>T	uc003zwi.2	-	6	520	c.457C>A	c.(457-459)CTG>ATG	p.L153M	STOML2_uc003zwh.2_Missense_Mutation_p.L44M|STOML2_uc003zwj.2_Missense_Mutation_p.L44M|STOML2_uc011lou.1_Intron|STOML2_uc003zwk.2_Missense_Mutation_p.L102M	NM_013442	NP_038470	Q9UJZ1	STML2_HUMAN	stomatin (EPB72)-like 2	153						cytoskeleton	receptor binding				0			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)															---	---	---	---	capture		Missense_Mutation	SNP	35101545	35101545	15834	9	G	T	T	35	35	STOML2	T	2	2
RUSC2	9853	broad.mit.edu	37	9	35547746	35547746	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35547746C>A	uc003zww.2	+	2	1483	c.1228C>A	c.(1228-1230)CCA>ACA	p.P410T	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.P410T	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	410						cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---	capture		Missense_Mutation	SNP	35547746	35547746	14231	9	C	A	A	22	22	RUSC2	A	2	2
FAM166B	730112	broad.mit.edu	37	9	35563227	35563227	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35563227C>A	uc010mkr.2	-	2	293	c.222G>T	c.(220-222)AGG>AGT	p.R74S	FAM166B_uc011lov.1_Missense_Mutation_p.R74S|FAM166B_uc011low.1_Missense_Mutation_p.R74S|FAM166B_uc003zwy.2_Missense_Mutation_p.R74S	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	74											0																		---	---	---	---	capture		Missense_Mutation	SNP	35563227	35563227	5686	9	C	A	A	22	22	FAM166B	A	2	2
TLN1	7094	broad.mit.edu	37	9	35724653	35724653	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35724653C>A	uc003zxt.2	-	5	781	c.427G>T	c.(427-429)GGG>TGG	p.G143W	TLN1_uc003zxu.3_Missense_Mutation_p.G143W	NM_006289	NP_006280	Q9Y490	TLN1_HUMAN	talin 1	143	FERM.				axon guidance|cell adhesion|cell-cell junction assembly|cellular component movement|cytoskeletal anchoring at plasma membrane|muscle contraction|platelet activation|platelet degranulation	actin cytoskeleton|centrosome|cytosol|extracellular region|focal adhesion|intracellular membrane-bounded organelle|ruffle membrane	actin binding|insulin receptor binding|LIM domain binding|structural constituent of cytoskeleton|vinculin binding			lung(7)|breast(3)|ovary(2)|central_nervous_system(1)	13	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---	capture		Missense_Mutation	SNP	35724653	35724653	16477	9	C	A	A	24	24	TLN1	A	2	2
MSMP	692094	broad.mit.edu	37	9	35753243	35753243	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35753243C>A	uc003zyb.1	-	3	420	c.274G>T	c.(274-276)GAG>TAG	p.E92*		NM_001044264	NP_001037729	Q1L6U9	MSMP_HUMAN	PC3-secreted microprotein precursor	92						extracellular region					0																		---	---	---	---	capture		Nonsense_Mutation	SNP	35753243	35753243	10277	9	C	A	A	29	29	MSMP	A	5	2
MSMP	692094	broad.mit.edu	37	9	35754074	35754074	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35754074C>A	uc003zyb.1	-	1	199	c.53G>T	c.(52-54)TGG>TTG	p.W18L		NM_001044264	NP_001037729	Q1L6U9	MSMP_HUMAN	PC3-secreted microprotein precursor	18						extracellular region					0																		---	---	---	---	capture		Missense_Mutation	SNP	35754074	35754074	10277	9	C	A	A	21	21	MSMP	A	2	2
NPR2	4882	broad.mit.edu	37	9	35793970	35793970	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35793970G>T	uc003zyd.2	+	2	743	c.743G>T	c.(742-744)GGG>GTG	p.G248V	NPR2_uc010mlb.2_Missense_Mutation_p.G248V	NM_003995	NP_003986	P20594	ANPRB_HUMAN	natriuretic peptide receptor B precursor	248	Extracellular (Potential).				intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)													---	---	---	---	capture		Missense_Mutation	SNP	35793970	35793970	11000	9	G	T	T	43	43	NPR2	T	2	2
NPR2	4882	broad.mit.edu	37	9	35807326	35807326	+	Splice_Site	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35807326G>T	uc003zyd.2	+	18	2644	c.2644_splice	c.e18-1	p.V882_splice	NPR2_uc010mlb.2_Splice_Site_p.V858_splice	NM_003995	NP_003986			natriuretic peptide receptor B precursor						intracellular signal transduction|ossification|receptor guanylyl cyclase signaling pathway|regulation of blood pressure	integral to membrane|plasma membrane	GTP binding|guanylate cyclase activity|natriuretic peptide receptor activity|protein kinase activity|transmembrane receptor activity			ovary(2)|stomach(1)	3	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)													---	---	---	---	capture		Splice_Site	SNP	35807326	35807326	11000	9	G	T	T	35	35	NPR2	T	5	2
TMEM8B	51754	broad.mit.edu	37	9	35853137	35853137	+	Splice_Site	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35853137G>T	uc003zym.2	+	13	1982	c.967_splice	c.e13-1	p.V323_splice	TMEM8B_uc003zyo.2_Splice_Site_p.V323_splice	NM_001042589	NP_001036054			transmembrane protein 8B isoform a						cell-matrix adhesion|regulation of growth|regulation of mitotic cell cycle	cell surface|endoplasmic reticulum|integral to membrane|mitochondrion|nucleus|plasma membrane	protein binding			ovary(1)	1																		---	---	---	---	capture		Splice_Site	SNP	35853137	35853137	16755	9	G	T	T	35	35	TMEM8B	T	5	2
OR13J1	392309	broad.mit.edu	37	9	35869964	35869964	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35869964C>A	uc011lph.1	-	1	435	c.435G>T	c.(433-435)ATG>ATT	p.M145I		NM_001004487	NP_001004487	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J,	145	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)															---	---	---	---	capture		Missense_Mutation	SNP	35869964	35869964	11350	9	C	A	A	21	21	OR13J1	A	2	2
TRPM3	80036	broad.mit.edu	37	9	73235238	73235238	+	Missense_Mutation	SNP	C	A	A	rs145000157		TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73235238C>A	uc004aid.2	-	15	2091	c.1847G>T	c.(1846-1848)CGT>CTT	p.R616L	TRPM3_uc004ahu.2_Missense_Mutation_p.R446L|TRPM3_uc004ahv.2_Missense_Mutation_p.R418L|TRPM3_uc004ahw.2_Missense_Mutation_p.R488L|TRPM3_uc004ahx.2_Missense_Mutation_p.R475L|TRPM3_uc004ahy.2_Missense_Mutation_p.R478L|TRPM3_uc004ahz.2_Missense_Mutation_p.R465L|TRPM3_uc004aia.2_Missense_Mutation_p.R463L|TRPM3_uc004aib.2_Missense_Mutation_p.R453L|TRPM3_uc004aic.2_Missense_Mutation_p.R616L	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	641	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9																		---	---	---	---	capture		Missense_Mutation	SNP	73235238	73235238	17138	9	C	A	A	19	19	TRPM3	A	1	1
PRUNE2	158471	broad.mit.edu	37	9	79324805	79324805	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79324805C>A	uc010mpk.2	-	8	2509	c.2385G>T	c.(2383-2385)GCG>GCT	p.A795A		NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	795					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0																		---	---	---	---	capture		Silent	SNP	79324805	79324805	13092	9	C	A	A	27	27	PRUNE2	A	1	1
FLJ46321	389763	broad.mit.edu	37	9	84609904	84609904	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84609904G>T	uc004amn.2	+	4	4566	c.4519G>T	c.(4519-4521)GGG>TGG	p.G1507W		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1507						integral to membrane					0																		---	---	---	---	capture		Missense_Mutation	SNP	84609904	84609904	6174	9	G	T	T	43	43	FLJ46321	T	2	2
GKAP1	80318	broad.mit.edu	37	9	86403544	86403544	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86403544C>A	uc004amy.2	-	5	906	c.410G>T	c.(409-411)AGT>ATT	p.S137I	GKAP1_uc004amz.2_Missense_Mutation_p.S137I|GKAP1_uc011lsu.1_RNA	NM_025211	NP_079487	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1 isoform a	137	Potential.				signal transduction	Golgi apparatus					0																		---	---	---	---	capture		Missense_Mutation	SNP	86403544	86403544	6691	9	C	A	A	20	20	GKAP1	A	2	2
C9orf79	286234	broad.mit.edu	37	9	90500668	90500668	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90500668C>A	uc004app.3	+	4	1301	c.1266C>A	c.(1264-1266)GTC>GTA	p.V422V	C9orf79_uc004apo.1_Silent_p.V234V	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	422						integral to membrane				ovary(3)	3																		---	---	---	---	capture		Silent	SNP	90500668	90500668	2613	9	C	A	A	32	32	C9orf79	A	2	2
FANCC	2176	broad.mit.edu	37	9	97864116	97864116	+	Missense_Mutation	SNP	T	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97864116T>A	uc004avh.2	-	15	1812	c.1550A>T	c.(1549-1551)GAG>GTG	p.E517V		NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C	517					protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)						D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				---	---	---	---	capture		Missense_Mutation	SNP	97864116	97864116	5900	9	T	A	A	54	54	FANCC	A	4	4
IKBKAP	8518	broad.mit.edu	37	9	111640903	111640903	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111640903C>A	uc004bdm.3	-	34	4220	c.3700G>T	c.(3700-3702)GAT>TAT	p.D1234Y	IKBKAP_uc004bdl.2_Missense_Mutation_p.D885Y|IKBKAP_uc011lwc.1_Missense_Mutation_p.D1120Y|IKBKAP_uc010mtq.2_Missense_Mutation_p.D885Y|IKBKAP_uc004bdk.2_Missense_Mutation_p.D238Y|IKBKAP_uc010mtp.2_RNA	NM_003640	NP_003631	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene	1234					immune response|protein complex assembly|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|nucleolus|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding|signal transducer activity			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|kidney(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	111640903	111640903	7911	9	C	A	A	24	24	IKBKAP	A	2	2
ZNF483	158399	broad.mit.edu	37	9	114296103	114296103	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114296103A>C	uc004bff.2	+	4	810	c.586A>C	c.(586-588)AAG>CAG	p.K196Q	ZNF483_uc011lwq.1_Missense_Mutation_p.K196Q|ZNF483_uc004bfg.2_Missense_Mutation_p.K196Q	NM_133464	NP_597721	Q8TF39	ZN483_HUMAN	zinc finger protein 483 isoform a	196	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	114296103	114296103	18530	9	A	C	C	13	13	ZNF483	C	4	4
TNC	3371	broad.mit.edu	37	9	117808802	117808802	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117808802G>T	uc004bjj.3	-	17	5374	c.5012C>A	c.(5011-5013)CCC>CAC	p.P1671H	TNC_uc010mvf.2_Intron	NM_002160	NP_002151	P24821	TENA_HUMAN	tenascin C precursor	1671	Fibronectin type-III 12.				cell adhesion|response to wounding|signal transduction	extracellular space	receptor binding|syndecan binding			central_nervous_system(4)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	7																		---	---	---	---	capture		Missense_Mutation	SNP	117808802	117808802	16811	9	G	T	T	43	43	TNC	T	2	2
FAM48B1	100130302	broad.mit.edu	37	X	24382817	24382817	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24382817A>G	uc011mjx.1	+	1	1940	c.1940A>G	c.(1939-1941)GAC>GGC	p.D647G		NM_001136234	NP_001129706			hypothetical protein LOC100130302											kidney(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	24382817	24382817	5795	23	A	G	G	10	10	FAM48B1	G	4	4
POLA1	5422	broad.mit.edu	37	X	24753605	24753605	+	Silent	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24753605G>T	uc004dbl.2	+	18	1928	c.1905G>T	c.(1903-1905)GTG>GTT	p.V635V		NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	635					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)													---	---	---	---	capture		Silent	SNP	24753605	24753605	12615	23	G	T	T	47	47	POLA1	T	2	2
MAGEB6	158809	broad.mit.edu	37	X	26213027	26213027	+	Missense_Mutation	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26213027A>G	uc004dbr.2	+	2	1213	c.1064A>G	c.(1063-1065)TAT>TGT	p.Y355C	MAGEB6_uc010ngc.1_Missense_Mutation_p.Y135C	NM_173523	NP_775794	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	355	MAGE.									ovary(3)	3																		---	---	---	---	capture		Missense_Mutation	SNP	26213027	26213027	9560	23	A	G	G	16	16	MAGEB6	G	4	4
BCOR	54880	broad.mit.edu	37	X	39934379	39934379	+	Missense_Mutation	SNP	G	T	T			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39934379G>T	uc004den.3	-	4	512	c.220C>A	c.(220-222)CGC>AGC	p.R74S	BCOR_uc004dep.3_Missense_Mutation_p.R74S|BCOR_uc004deo.3_Missense_Mutation_p.R74S|BCOR_uc004dem.3_Missense_Mutation_p.R74S|BCOR_uc004deq.3_Missense_Mutation_p.R74S	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	74					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4																		---	---	---	---	capture		Missense_Mutation	SNP	39934379	39934379	1407	23	G	T	T	39	39	BCOR	T	1	1
UBA1	7317	broad.mit.edu	37	X	47070573	47070573	+	Missense_Mutation	SNP	G	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47070573G>C	uc004dhj.3	+	20	2564	c.2413G>C	c.(2413-2415)GTC>CTC	p.V805L	UBA1_uc004dhk.3_Missense_Mutation_p.V805L|UBA1_uc004dhm.2_Missense_Mutation_p.V253L	NM_153280	NP_695012	P22314	UBA1_HUMAN	ubiquitin-activating enzyme E1	805					cell death|protein modification process		ATP binding|ligase activity|protein binding|small protein activating enzyme activity			ovary(1)	1																		---	---	---	---	capture		Missense_Mutation	SNP	47070573	47070573	17384	23	G	C	C	40	40	UBA1	C	3	3
MAGED1	9500	broad.mit.edu	37	X	51638459	51638459	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51638459C>A	uc004dpm.2	+	3	451	c.356C>A	c.(355-357)CCA>CAA	p.P119Q	MAGED1_uc004dpn.2_Missense_Mutation_p.P175Q|MAGED1_uc004dpo.2_Missense_Mutation_p.P119Q|MAGED1_uc011mnx.1_Intron	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b	119				P -> S (in Ref. 1; AAG09704).	apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)														Multiple Myeloma(10;0.10)			---	---	---	---	capture		Missense_Mutation	SNP	51638459	51638459	9564	23	C	A	A	21	21	MAGED1	A	2	2
GPRASP1	9737	broad.mit.edu	37	X	101908955	101908955	+	Silent	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101908955C>A	uc004ejj.3	+	5	915	c.114C>A	c.(112-114)CCC>CCA	p.P38P	GPRASP1_uc004eji.3_Silent_p.P38P|GPRASP1_uc010nod.2_Silent_p.P38P	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	38						cytoplasm	protein binding			ovary(1)|lung(1)	2																		---	---	---	---	capture		Silent	SNP	101908955	101908955	6998	23	C	A	A	21	21	GPRASP1	A	2	2
NKRF	55922	broad.mit.edu	37	X	118724197	118724197	+	Silent	SNP	A	G	G			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118724197A>G	uc004erq.2	-	2	1844	c.1191T>C	c.(1189-1191)AGT>AGC	p.S397S	NKRF_uc004err.2_Silent_p.S397S	NM_017544	NP_060014	O15226	NKRF_HUMAN	transcription factor NRF	397					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|double-stranded RNA binding			ovary(1)|central_nervous_system(1)	2																		---	---	---	---	capture		Silent	SNP	118724197	118724197	10848	23	A	G	G	14	14	NKRF	G	4	4
CXorf66	347487	broad.mit.edu	37	X	139038229	139038229	+	Missense_Mutation	SNP	C	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139038229C>A	uc004fbb.2	-	3	934	c.912G>T	c.(910-912)AAG>AAT	p.K304N		NM_001013403	NP_001013421	Q5JRM2	CX066_HUMAN	hypothetical protein LOC347487 precursor	304	Cytoplasmic (Potential).					integral to membrane					0																		---	---	---	---	capture		Missense_Mutation	SNP	139038229	139038229	4283	23	C	A	A	20	20	CXorf66	A	2	2
UBE2NL	389898	broad.mit.edu	37	X	142967551	142967551	+	Missense_Mutation	SNP	A	C	C			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142967551A>C	uc004fca.2	+	1	379	c.349A>C	c.(349-351)AAT>CAT	p.N117H		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	117							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)																	---	---	---	---	capture		Missense_Mutation	SNP	142967551	142967551	17424	23	A	C	C	5	5	UBE2NL	C	4	4
GDI1	2664	broad.mit.edu	37	X	153667172	153667172	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-3768-01	TCGA-46-3768-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153667172G>A	uc004fli.3	+	3	557	c.215G>A	c.(214-216)TGG>TAG	p.W72*	GDI1_uc011mzo.1_Nonsense_Mutation_p.W72*	NM_001493	NP_001484	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	72					protein transport|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|midbody	GTPase activator activity|protein binding				0	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)																	---	---	---	---	capture		Nonsense_Mutation	SNP	153667172	153667172	6588	23	G	A	A	47	47	GDI1	A	5	2
