Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
MFRP	83552	broad.mit.edu	36	11	118717571	118717571	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118717571T>G	uc001pwk.1	-	c.1637A>C	c.(1636-1638)GAG>GCG	p.E546A	MFRP_uc001pwi.1_5'Flank|MFRP_uc001pwj.1_Non-coding_Transcript	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	Error:Variant_position_missing_in_Q9BXJ0_after_alignment						collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)												0.256098	57.835687	62.260097	21	61	TT		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)	Missense_Mutation	SNP	118717571	118717571	9916	11	T	G	G	54	54	MFRP	G	4	4
MS4A14	84689	broad.mit.edu	36	11	59920762	59920762	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:59920762G>T	uc001npj.1	+	c.135G>T	c.(133-135)TTG>TTT	p.L45F	MS4A14_uc001npi.1_Intron|MS4A14_uc001npn.1_5'UTR|MS4A14_uc001npk.1_Missense_Mutation_p.L45F|MS4A14_uc001npl.1_5'UTR|MS4A14_uc001npm.1_5'UTR	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	45						integral to membrane	receptor activity			breast(1)	1														0.396226	65.464319	65.96371	21	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59920762	59920762	10251	11	G	T	T	47	47	MS4A14	T	3	3
RRP8	23378	broad.mit.edu	36	11	6579211	6579211	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6579211C>G	uc001med.1	-	c.661G>C	c.(661-663)GAG>CAG	p.E221Q	ILK_uc001mee.1_5'Flank|ILK_uc001mef.1_5'Flank|ILK_uc001meg.1_5'Flank|ILK_uc001meh.1_5'Flank	NM_015324	NP_056139	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase,	221					chromatin modification|chromatin silencing at rDNA|rRNA processing|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	methylated histone residue binding|S-adenosylmethionine-dependent methyltransferase activity				0														0.2	21.592927	24.92882	8	32	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6579211	6579211	14170	11	C	G	G	32	32	RRP8	G	3	3
TPCN2	219931	broad.mit.edu	36	11	68578839	68578839	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:68578839A>G	uc001oos.2	+	c.249A>G	c.(247-249)CAA>CAG	p.Q83Q	TPCN2_uc009ysk.1_Non-coding_Transcript|TPCN2_uc001oor.2_Intron	NM_139075	NP_620714	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	83	Cytoplasmic (Potential).					integral to membrane|lysosomal membrane	calcium channel activity|voltage-gated ion channel activity				0														0.25	39.925437	43.105002	14	42	AA		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)		Silent	SNP	68578839	68578839	16940	11	A	G	G	2	2	TPCN2	G	4	4
PDE3A	5139	broad.mit.edu	36	12	20681414	20681414	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:20681414A>G	uc001reh.1	+	c.2115A>G	c.(2113-2115)AGA>AGG	p.R705R		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	705					lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)	3	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)									0.375	100.03313	101.129503	30	50	AA		KEEP	---	---	---	---	capture			Silent	SNP	20681414	20681414	12058	12	A	G	G	9	9	PDE3A	G	4	4
SACS	26278	broad.mit.edu	36	13	22810431	22810431	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:22810431T>C	uc001uon.2	-	c.5584A>G	c.(5584-5586)ACA>GCA	p.T1862A	SACS_uc001uoo.2_Missense_Mutation_p.T1715A|SACS_uc001uop.1_Intron|SACS_uc001uoq.1_Intron	NM_014363	NP_055178	Q9NZJ4	SACS_HUMAN	sacsin	1862					cell death|negative regulation of inclusion body assembly|protein folding	axon|cell body fiber|dendrite|mitochondrion|nucleus	ATP binding|chaperone binding|Hsp70 protein binding|proteasome binding			ovary(7)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)|skin(1)	11		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)								738				0.370968	156.425213	158.236511	46	78	TT		KEEP	---	---	---	---	capture		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)	Missense_Mutation	SNP	22810431	22810431	14284	13	T	C	C	58	58	SACS	C	4	4
PAN3	255967	broad.mit.edu	36	13	27749372	27749372	+	Splice_Site_SNP	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:27749372A>G	uc001urz.1	+	c.1612_splice	c.e14-2	p.Q538_splice	PAN3_uc001urx.1_Splice_Site_SNP_p.Q484_splice|PAN3_uc001ury.1_Splice_Site_SNP_p.Q372_splice	NM_175854	NP_787050			PABP1-dependent poly A-specific ribonuclease						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|protein phosphorylation	centrosome|cytosol	ATP binding|protein kinase activity			ovary(1)	1	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)												0.142857	19.242475	29.569024	12	72	AA		KEEP	---	---	---	---	capture	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)	Splice_Site_SNP	SNP	27749372	27749372	11832	13	A	G	G	7	7	PAN3	G	5	4
G2E3	55632	broad.mit.edu	36	14	30151223	30151223	+	Nonsense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:30151223C>G	uc001wqk.1	+	c.1560C>G	c.(1558-1560)TAC>TAG	p.Y520*	G2E3_uc001wql.1_Nonsense_Mutation_p.Y32*	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	520	HECT.				apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3														0.144928	63.02105	88.11968	30	177	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	30151223	30151223	6391	14	C	G	G	18	18	G2E3	G	5	3
NFKBIA	4792	broad.mit.edu	36	14	34943526	34943526	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:34943526G>T	uc001wtf.2	-	c.76C>A	c.(76-78)CTG>ATG	p.L26M	NFKBIA_uc001wte.2_5'Flank|NFKBIA_uc001wtg.2_Missense_Mutation_p.L26M|NFKBIA_uc010amo.1_Non-coding_Transcript	NM_020529	NP_065390	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene	26					anti-apoptosis|apoptosis|cellular response to cold|cytoplasmic sequestering of NF-kappaB|innate immune response|interspecies interaction between organisms|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of DNA binding|negative regulation of lipid storage|negative regulation of macrophage derived foam cell differentiation|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|I-kappaB/NF-kappaB complex|nucleus|plasma membrane	identical protein binding|NF-kappaB binding|nuclear localization sequence binding|ubiquitin protein ligase binding			breast(2)	2	Breast(36;0.0484)|Hepatocellular(127;0.158)									105				0.428571	8.323639	8.354813	3	4	GG		KEEP	---	---	---	---	capture	Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Missense_Mutation	SNP	34943526	34943526	10777	14	G	T	T	36	36	NFKBIA	T	3	3
WDHD1	11169	broad.mit.edu	36	14	54521261	54521261	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:54521261T>G	uc001xbm.1	-	c.1836A>C	c.(1834-1836)CAA>CAC	p.Q612H	WDHD1_uc010aom.1_Missense_Mutation_p.Q129H|WDHD1_uc001xbn.1_Missense_Mutation_p.Q489H	NM_007086	NP_009017	O75717	WDHD1_HUMAN	WD repeat and HMG-box DNA binding protein 1	612				Q -> K (in Ref. 2; AAH43349/AAH00622).		cytoplasm|nucleoplasm	DNA binding				0										606				0.616162	220.998122	222.169639	61	38	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54521261	54521261	17844	14	T	G	G	64	64	WDHD1	G	4	4
TCF12	6938	broad.mit.edu	36	15	55342601	55342601	+	Splice_Site_SNP	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:55342601G>C	uc002aea.1	+	c.1583_splice	c.e18-1	p.G528_splice	TCF12_uc002aeb.1_Splice_Site_SNP_p.G528_splice|TCF12_uc002aec.1_Splice_Site_SNP_p.G504_splice|TCF12_uc002aed.1_Splice_Site_SNP_p.G504_splice|TCF12_uc010bfs.1_Intron|TCF12_uc002aee.1_Splice_Site_SNP_p.G334_splice|TCF12_uc010bft.1_Splice_Site_SNP_p.G358_splice|TCF12_uc010bfu.1_Splice_Site_SNP_p.G117_splice	NM_207036	NP_996920			transcription factor 12 isoform a						immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity	p.?(1)		central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)								335				0.377358	63.686624	64.386461	20	33	GG		KEEP	---	---	---	---	capture		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)	Splice_Site_SNP	SNP	55342601	55342601	16213	15	G	C	C	35	35	TCF12	C	5	3
SSTR5	6755	broad.mit.edu	36	16	1069389	1069389	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1069389C>A	uc002ckq.1	+	c.520C>A	c.(520-522)CTC>ATC	p.L174I		NM_001053	NP_001044	P35346	SSR5_HUMAN	somatostatin receptor 5	174	Helical; Name=4; (Potential).				negative regulation of cell proliferation	integral to plasma membrane	somatostatin receptor activity				0		Hepatocellular(780;0.00369)			Octreotide(DB00104)									0.521739	36.599762	36.609162	12	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1069389	1069389	15717	16	C	A	A	28	28	SSTR5	A	3	3
C16orf91	283951	broad.mit.edu	36	16	1410458	1410458	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:1410458C>T	uc002cls.1	-	c.660G>A	c.(658-660)TCG>TCA	p.S220S	C16orf91_uc002clr.2_Silent_p.S63S	NM_001010878	NP_001010878	Q4G0I0	CSMT1_HUMAN	hypothetical protein LOC283951	63	Extracellular (Potential).					integral to membrane					0														0.151261	34.379203	48.235014	18	101	CC		KEEP	---	---	---	---	capture			Silent	SNP	1410458	1410458	1897	16	C	T	T	23	23	C16orf91	T	1	1
HBZ	3050	broad.mit.edu	36	16	142974	142974	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:142974C>T	uc002cft.1	+	c.66C>T	c.(64-66)GCC>GCT	p.A22A		NM_005332	NP_005323	P02008	HBAZ_HUMAN	zeta globin	22						hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		all_cancers(16;4.28e-07)|all_epithelial(16;2.09e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)												0.258621	36.103827	39.16227	15	43	CC		KEEP	---	---	---	---	capture			Silent	SNP	142974	142974	7271	16	C	T	T	23	23	HBZ	T	1	1
PDILT	204474	broad.mit.edu	36	16	20278265	20278265	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20278265G>A	uc002dhc.1	-	c.1632C>T	c.(1630-1632)TAC>TAT	p.Y544Y		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	544					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1														0.360614	394.107925	400.818172	141	250	GG		KEEP	---	---	---	---	capture			Silent	SNP	20278265	20278265	12095	16	G	A	A	40	40	PDILT	A	1	1
ARMC5	79798	broad.mit.edu	36	16	31378372	31378372	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31378372C>A	uc002ecc.1	+	c.26C>A	c.(25-27)ACG>AAG	p.T9K	ARMC5_uc002ecb.1_Missense_Mutation_p.T9K|ARMC5_uc002eca.2_Missense_Mutation_p.T9K	NM_001105247	NP_001098717	Q96C12	ARMC5_HUMAN	armadillo repeat containing 5 isoform a	9							binding			pancreas(1)	1														0.428571	18.093906	18.145081	6	8	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31378372	31378372	972	16	C	A	A	19	19	ARMC5	A	3	3
LRRC29	26231	broad.mit.edu	36	16	65799426	65799426	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:65799426C>A	uc002esd.1	-	c.354G>T	c.(352-354)TTG>TTT	p.L118F	LRRC29_uc002ese.1_Missense_Mutation_p.L118F|LRRC29_uc002esf.1_Missense_Mutation_p.L118F|LRRC29_uc002esg.2_Missense_Mutation_p.L118F	NM_012163	NP_036295	Q8WV35	LRC29_HUMAN	F-box and leucine-rich repeat protein 9	118	LRR 4.										0		Ovarian(137;0.0563)												0.307692	7.489634	7.921683	4	9	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)	Missense_Mutation	SNP	65799426	65799426	9358	16	C	A	A	21	21	LRRC29	A	3	3
MRM1	79922	broad.mit.edu	36	17	32032798	32032798	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:32032798T>C	uc002hne.1	+	c.446T>C	c.(445-447)GTC>GCC	p.V149A	MRM1_uc002hnf.1_Intron	NM_024864	NP_079140	Q6IN84	MRM1_HUMAN	mitochondrial rRNA methyltransferase 1 homolog	149					RNA processing	mitochondrion	RNA binding|RNA methyltransferase activity				0		Breast(25;0.00957)|Ovarian(249;0.17)												0.178571	6.547042	9.290346	5	23	TT		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)	Missense_Mutation	SNP	32032798	32032798	10164	17	T	C	C	58	58	MRM1	C	4	4
SPNS3	201305	broad.mit.edu	36	17	4284121	4284121	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:4284121G>A	uc002fxt.1	+	c.110G>A	c.(109-111)TGG>TAG	p.W37*	SPNS3_uc002fxu.1_5'UTR	NM_182538	NP_872344	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3	37					lipid transport|transmembrane transport	integral to membrane				large_intestine(1)	1														0.401575	141.302421	142.376807	51	76	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	4284121	4284121	15589	17	G	A	A	47	47	SPNS3	A	5	2
EVPL	2125	broad.mit.edu	36	17	71515690	71515690	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71515690G>A	uc002jqi.2	-	c.5191C>T	c.(5191-5193)CCC>TCC	p.P1731S		NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	1731	Globular 2.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)	3														0.486486	109.529846	109.539895	36	38	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71515690	71515690	5485	17	G	A	A	42	42	EVPL	A	2	2
FPR1	2357	broad.mit.edu	36	19	56941617	56941617	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56941617C>T	uc002pxq.1	-	c.443G>A	c.(442-444)GGG>GAG	p.G148E	FPR1_uc010epe.1_Missense_Mutation_p.G148E	NM_002029	NP_002020	P21462	FPR1_HUMAN	formyl peptide receptor 1	148	Helical; Name=4; (Potential).				activation of MAPK activity|cellular component movement|chemotaxis|G-protein signaling, coupled to cAMP nucleotide second messenger|nitric oxide mediated signal transduction	endosome|integral to membrane|plasma membrane	N-formyl peptide receptor activity			ovary(1)	1		all_neural(266;0.0189)|Medulloblastoma(540;0.146)			Nedocromil(DB00716)									0.090909	7.298221	25.825166	10	100	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(134;0.00106)|OV - Ovarian serous cystadenocarcinoma(262;0.018)	Missense_Mutation	SNP	56941617	56941617	6284	19	C	T	T	22	22	FPR1	T	2	2
ZNF586	54807	broad.mit.edu	36	19	62982543	62982543	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:62982543A>G	uc002qqd.1	+	c.776A>G	c.(775-777)GAA>GGA	p.E259G	ZNF587_uc002qqb.1_Intron|ZNF586_uc010euh.1_Missense_Mutation_p.E216G|ZNF586_uc002qqe.1_3'UTR|ZNF586_uc002qqf.1_Intron	NM_017652	NP_060122	Q9NXT0	ZN586_HUMAN	zinc finger protein 586	259					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)												0.417391	165.787762	166.471011	48	67	AA		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)	Missense_Mutation	SNP	62982543	62982543	18614	19	A	G	G	9	9	ZNF586	G	4	4
ANKRD35	148741	broad.mit.edu	36	1	144270216	144270216	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:144270216G>A	uc001eob.1	+	c.478G>A	c.(478-480)GCA>ACA	p.A160T		NM_144698	NP_653299	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	160	ANK 4.									ovary(4)	4	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					Melanoma(9;127 754 22988 51047)								0.420455	320.572202	322.030046	111	153	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144270216	144270216	672	1	G	A	A	38	38	ANKRD35	A	1	1
SLC45A3	85414	broad.mit.edu	36	1	203899292	203899292	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:203899292G>A	uc001hda.1	-	c.250C>T	c.(250-252)CGC>TGC	p.R84C		NM_033102	NP_149093	Q96JT2	S45A3_HUMAN	prostein	84					transmembrane transport	integral to membrane			SLC45A3/BRAF(2)	ovary(2)|prostate(2)	4	Breast(84;0.07)									123				0.4	74.137808	74.705733	26	39	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(75;0.0194)		Missense_Mutation	SNP	203899292	203899292	15139	1	G	A	A	39	39	SLC45A3	A	1	1
EXO1	9156	broad.mit.edu	36	1	240115415	240115415	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:240115415A>G	uc001hzh.1	+	c.2388A>G	c.(2386-2388)AAA>AAG	p.K796K	EXO1_uc001hzi.1_Silent_p.K796K|EXO1_uc001hzj.1_Silent_p.K796K|EXO1_uc009xgq.1_Silent_p.K795K	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	796	Interaction with MLH1.|Interaction with MSH2.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.0555)												0.430894	186.761593	187.272903	53	70	AA		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(106;0.0107)		Silent	SNP	240115415	240115415	5493	1	A	G	G	1	1	EXO1	G	4	4
COL9A2	1298	broad.mit.edu	36	1	40539561	40539561	+	Silent	SNP	A	C	C			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:40539561A>C	uc001cfh.1	-	c.1950T>G	c.(1948-1950)GGT>GGG	p.G650G	COL9A2_uc001cfi.1_Silent_p.G469G	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen	650	Triple-helical region 1 (COL1).				axon guidance|skeletal system development	collagen type IX	extracellular matrix structural constituent conferring tensile strength			ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)												0.192308	7.358296	9.662805	5	21	AA		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)		Silent	SNP	40539561	40539561	3846	1	A	C	C	10	10	COL9A2	C	4	4
SLC45A1	50651	broad.mit.edu	36	1	8326515	8326515	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:8326515C>T	uc001apb.1	+	c.2102C>T	c.(2101-2103)GCC>GTC	p.A701V	SLC45A1_uc001apc.1_Missense_Mutation_p.A399V	NM_001080397	NP_001073866	Q9Y2W3	S45A1_HUMAN	DNB5	701	Helical; (Potential).				carbohydrate transport	integral to membrane	symporter activity	p.A701V(1)		central_nervous_system(2)|pancreas(1)	3	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;1.22e-15)|all_lung(118;0.000147)|Lung NSC(185;0.000251)|Renal(390;0.000469)|Colorectal(325;0.00578)|Breast(348;0.00686)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)												0.164948	26.844737	37.184325	16	81	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;3.95e-66)|GBM - Glioblastoma multiforme(8;5.93e-33)|Colorectal(212;2.86e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00199)|READ - Rectum adenocarcinoma(331;0.0649)	Missense_Mutation	SNP	8326515	8326515	15137	1	C	T	T	26	26	SLC45A1	T	2	2
ZNF644	84146	broad.mit.edu	36	1	91177759	91177759	+	Silent	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:91177759G>C	uc001dnw.1	-	c.1740C>G	c.(1738-1740)TCC>TCG	p.S580S	ZNF644_uc001dnv.1_Intron|ZNF644_uc001dnx.1_Intron|ZNF644_uc001dny.1_Silent_p.S580S	NM_201269	NP_958357	Q9H582	ZN644_HUMAN	zinc finger protein 644 isoform 1	580					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)												0.379603	407.651555	412.145405	134	219	GG		KEEP	---	---	---	---	capture		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)	Silent	SNP	91177759	91177759	18655	1	G	C	C	47	47	ZNF644	C	3	3
SULF2	55959	broad.mit.edu	36	20	45740873	45740873	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:45740873C>T	uc002xto.1	-	c.1147G>A	c.(1147-1149)GGG>AGG	p.G383R	SULF2_uc002xtp.1_Missense_Mutation_p.G383R|SULF2_uc002xtq.1_Missense_Mutation_p.G383R|SULF2_uc002xtr.1_Missense_Mutation_p.G383R	NM_018837	NP_061325	Q8IWU5	SULF2_HUMAN	sulfatase 2 isoform a precursor	383					bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			ovary(2)|breast(2)|pancreas(1)	5										709				0.434783	307.478542	308.328565	100	130	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45740873	45740873	15891	20	C	T	T	23	23	SULF2	T	1	1
MYO18B	84700	broad.mit.edu	36	22	24621213	24621213	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:24621213C>T	uc003abz.1	+	c.4634C>T	c.(4633-4635)TCG>TTG	p.S1545L	MYO18B_uc003aca.1_Missense_Mutation_p.S1426L|MYO18B_uc010guy.1_Missense_Mutation_p.S1427L|MYO18B_uc010guz.1_Missense_Mutation_p.S1425L	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	1545	Potential.|Tail.					nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12										968				0.444444	23.097656	23.145971	8	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24621213	24621213	10461	22	C	T	T	31	31	MYO18B	T	1	1
SF3A1	10291	broad.mit.edu	36	22	29068811	29068811	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29068811G>A	uc003ahl.1	-	c.709C>T	c.(709-711)CGA>TGA	p.R237*		NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1	237					nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5														0.113924	19.939593	43.171134	18	140	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	29068811	29068811	14635	22	G	A	A	39	39	SF3A1	A	5	1
GGA1	26088	broad.mit.edu	36	22	36346796	36346796	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36346796A>G	uc003atc.1	+	c.458A>G	c.(457-459)GAT>GGT	p.D153G	GGA1_uc003atd.1_Missense_Mutation_p.D153G|GGA1_uc003ate.1_Missense_Mutation_p.D153G|GGA1_uc003atf.1_Missense_Mutation_p.D80G	NM_013365	NP_037497	Q9UJY5	GGA1_HUMAN	golgi associated, gamma adaptin ear containing,	153	Interaction with ARF3.				intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|endosome membrane|Golgi apparatus part	protein binding			breast(2)|ovary(1)	3	Melanoma(58;0.0574)													0.307692	167.496554	173.519026	56	126	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36346796	36346796	6620	22	A	G	G	12	12	GGA1	G	4	4
ACVR1	90	broad.mit.edu	36	2	158335217	158335217	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:158335217G>A	uc002tzm.2	-	c.699C>T	c.(697-699)GCC>GCT	p.A233A	ACVR1_uc002tzn.2_Silent_p.A233A|ACVR1_uc010fog.1_Silent_p.A233A	NM_001111067	NP_001104537	Q04771	ACVR1_HUMAN	activin A type I receptor precursor	233	Cytoplasmic (Potential).|Protein kinase.				BMP signaling pathway|G1/S transition of mitotic cell cycle|negative regulation of activin receptor signaling pathway|negative regulation of apoptosis|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of transcription, DNA-dependent|protein phosphorylation|transforming growth factor beta receptor signaling pathway	activin receptor complex	activin binding|ATP binding|follistatin binding|metal ion binding|protein homodimerization activity|SMAD binding|transforming growth factor beta binding			ovary(2)|skin(1)	3					Adenosine triphosphate(DB00171)				p.A233A(HCC1569-Tumor)	185				0.448276	289.702609	290.175075	91	112	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(221;0.104)	Silent	SNP	158335217	158335217	221	2	G	A	A	39	39	ACVR1	A	1	1
TTN	7273	broad.mit.edu	36	2	179284131	179284131	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179284131A>C	uc002umr.1	-	c.24345T>G	c.(24343-24345)AAT>AAG	p.N8115K	TTN_uc002ums.1_Intron|TTN_uc010frc.1_Intron|TTN_uc010frd.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.N4776K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	9042										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153										8722				0.081911	12.988018	65.096334	24	269	AA		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179284131	179284131	17290	2	A	C	C	16	16	TTN	C	4	4
NCKAP1	10787	broad.mit.edu	36	2	183568766	183568766	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:183568766T>C	uc002upb.1	-	c.667A>G	c.(667-669)AGG>GGG	p.R223G	NCKAP1_uc002upc.1_Missense_Mutation_p.R217G	NM_205842	NP_995314	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 2	217					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2														0.381579	201.717147	203.58573	58	94	TT		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)		Missense_Mutation	SNP	183568766	183568766	10620	2	T	C	C	56	56	NCKAP1	C	4	4
IDH1	3417	broad.mit.edu	36	2	208821357	208821357	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:208821357C>T	uc002vcs.1	-	c.395G>A	c.(394-396)CGT>CAT	p.R132H	IDH1_uc002vct.1_Missense_Mutation_p.R132H|IDH1_uc002vcu.1_Missense_Mutation_p.R132H	NM_005896	NP_005887	O75874	IDHC_HUMAN	isocitrate dehydrogenase 1 (NADP+), soluble	132		Substrate.	R -> G (in a glioma sample; glioblastoma multiforme; somatic mutation).|R -> L (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> S (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> H (in a glioma sample; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha-ketoglutarate but instead alpha-ketoglutarate is converted to R(-)-2-hydroxyglutarate).|R -> C (in colorectal cancer and glioma samples; glioblastoma multiforme; somatic mutation; abolishes magnesium binding and alters enzyme activity so that isocitrate is no longer converted to alpha- ketoglutarate but instead alpha- ketoglutarate is converted to R(-)-2- hydroxyglutarate).		2-oxoglutarate metabolic process|cellular lipid metabolic process|glyoxylate cycle|isocitrate metabolic process|NADPH regeneration|tricarboxylic acid cycle	cytosol|peroxisomal matrix	isocitrate dehydrogenase (NADP+) activity|magnesium ion binding|NAD binding|protein homodimerization activity	p.R132H(1725)|p.R132?(210)|p.R132C(92)|p.R132L(48)|p.R132G(26)|p.R132S(11)|p.R132V(1)|p.G131_R132>VL(1)		central_nervous_system(1848)|haematopoietic_and_lymphoid_tissue(593)|large_intestine(4)|skin(2)|prostate(2)|autonomic_ganglia(1)|soft_tissue(1)	2451						Pancreas(158;264 1958 3300 35450 36047)				134				0.422222	165.657529	166.368501	57	78	CC		KEEP	---	---	---	---	capture		Epithelial(149;0.0322)|LUSC - Lung squamous cell carcinoma(261;0.0711)|Lung(261;0.136)	Missense_Mutation	SNP	208821357	208821357	7794	2	C	T	T	19	19	IDH1	T	1	1
ANO7	50636	broad.mit.edu	36	2	241795741	241795741	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:241795741G>A	uc002wax.2	+	c.1222G>A	c.(1222-1224)GCC>ACC	p.A408T		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	408	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3														0.291925	115.752185	122.001	47	114	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	241795741	241795741	710	2	G	A	A	38	38	ANO7	A	1	1
WDR43	23160	broad.mit.edu	36	2	29011964	29011964	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:29011964C>T	uc002rmo.2	+	c.1511C>T	c.(1510-1512)CCG>CTG	p.P504L		NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43	504						nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)													0.216	67.359062	76.659074	27	98	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29011964	29011964	17868	2	C	T	T	23	23	WDR43	T	1	1
SLC3A1	6519	broad.mit.edu	36	2	44381738	44381738	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:44381738G>C	uc002ruc.2	+	c.1104G>C	c.(1102-1104)ATG>ATC	p.M368I	SLC3A1_uc002rty.2_Missense_Mutation_p.M368I|SLC3A1_uc002rtz.2_Missense_Mutation_p.M368I|SLC3A1_uc002rua.2_Missense_Mutation_p.M368I|SLC3A1_uc002rub.2_Missense_Mutation_p.M368I|SLC3A1_uc002rud.2_Missense_Mutation_p.M90I|SLC3A1_uc002rue.2_5'Flank	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	368	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)									0.103448	7.706277	21.333019	9	78	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44381738	44381738	15123	2	G	C	C	47	47	SLC3A1	C	3	3
ATR	545	broad.mit.edu	36	3	143670962	143670962	+	Silent	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:143670962G>A	uc003eux.2	-	c.6459C>T	c.(6457-6459)CAC>CAT	p.H2153H	ATR_uc003euy.1_Silent_p.H39H	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2153	FAT.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|breast(4)|ovary(3)|skin(2)|stomach(1)|central_nervous_system(1)|liver(1)	17										936				0.207921	94.739286	110.701068	42	160	GG		KEEP	---	---	---	---	capture			Silent	SNP	143670962	143670962	1223	3	G	A	A	40	40	ATR	A	1	1
ABCC5	10057	broad.mit.edu	36	3	185183326	185183326	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185183326C>G	uc003fmg.1	-	c.755G>C	c.(754-756)GGG>GCG	p.G252A	ABCC5_uc010hxl.1_Missense_Mutation_p.G252A|ABCC5_uc003fmf.1_5'Flank	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5	252	ABC transmembrane type-1 1.					integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)													0.350877	114.071804	116.305316	40	74	CC		KEEP	---	---	---	---	capture	Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Missense_Mutation	SNP	185183326	185183326	57	3	C	G	G	22	22	ABCC5	G	3	3
CACNA2D3	55799	broad.mit.edu	36	3	54395789	54395789	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:54395789T>G	uc003dhf.1	+	c.329T>G	c.(328-330)GTG>GGG	p.V110G	CACNA2D3_uc003dhg.1_Missense_Mutation_p.V16G|CACNA2D3_uc003dhh.1_Non-coding_Transcript|CACNA2D3_uc010hmv.1_5'UTR	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha	110	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7														0.294118	9.464833	10.112408	5	12	TT		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Missense_Mutation	SNP	54395789	54395789	2666	3	T	G	G	59	59	CACNA2D3	G	4	4
ADAM29	11086	broad.mit.edu	36	4	176133963	176133963	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:176133963G>C	uc003iuc.1	+	c.712G>C	c.(712-714)GTC>CTC	p.V238L	ADAM29_uc003iud.1_Missense_Mutation_p.V238L|ADAM29_uc003iue.1_Missense_Mutation_p.V238L|ADAM29_uc010irr.1_Missense_Mutation_p.V238L	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	238	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(1)	10		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)				Ovarian(140;1727 1835 21805 25838 41440)				106				0.1	26.949762	63.709919	23	207	GG		KEEP	---	---	---	---	capture		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)	Missense_Mutation	SNP	176133963	176133963	248	4	G	C	C	48	48	ADAM29	C	3	3
SLIT2	9353	broad.mit.edu	36	4	20156799	20156799	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:20156799A>G	uc003gpr.1	+	c.2324A>G	c.(2323-2325)AAC>AGC	p.N775S	SLIT2_uc003gps.1_Missense_Mutation_p.N767S	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2	775	LRR 17.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|initiation of Roundabout signal transduction|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding	p.N775S(1)		central_nervous_system(4)|ovary(3)	7														0.247312	69.381533	74.783198	23	70	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20156799	20156799	15238	4	A	G	G	2	2	SLIT2	G	4	4
TMPRSS11A	339967	broad.mit.edu	36	4	68467391	68467391	+	Missense_Mutation	SNP	T	G	G			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:68467391T>G	uc003hdr.1	-	c.856A>C	c.(856-858)ACC>CCC	p.T286P	LOC550112_uc003hdl.2_Intron|TMPRSS11A_uc003hds.1_Missense_Mutation_p.T283P	NM_182606	NP_872412	Q6ZMR5	TM11A_HUMAN	transmembrane protease, serine 11A isoform 1	286	Peptidase S1.|Extracellular (Potential).				cell cycle|proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity				0						NSCLC(26;2 894 10941 14480 22546)								0.124424	40.870201	71.071786	27	190	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68467391	68467391	16779	4	T	G	G	59	59	TMPRSS11A	G	4	4
PCDHA8	56140	broad.mit.edu	36	5	140202595	140202595	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140202595G>A	uc003lhs.1	+	c.1505G>A	c.(1504-1506)CGC>CAC	p.R502H	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.R502H	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	502	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding				0														0.142857	15.876663	25.3399	11	66	GG		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Missense_Mutation	SNP	140202595	140202595	11950	5	G	A	A	38	38	PCDHA8	A	1	1
PPIL6	285755	broad.mit.edu	36	6	109859184	109859184	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-0128-01	TCGA-06-0128-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:109859184G>A	uc010kdp.1	-	c.289C>T	c.(289-291)CAG>TAG	p.Q97*	PPIL6_uc003ptg.2_Nonsense_Mutation_p.Q97*|PPIL6_uc010kdo.1_Nonsense_Mutation_p.Q65*	NM_173672	NP_775943	Q8IXY8	PPIL6_HUMAN	peptidylprolyl isomerase-like 6 isoform 1	97					protein folding		peptidyl-prolyl cis-trans isomerase activity				0		all_cancers(87;1.1e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000144)|all_lung(197;0.0221)|Colorectal(196;0.0488)|Lung SC(18;0.0548)												0.09589	7.9311	31.854187	14	132	GG		KEEP	---	---	---	---	capture		Epithelial(106;0.00684)|BRCA - Breast invasive adenocarcinoma(108;0.00889)|all cancers(137;0.0106)|OV - Ovarian serous cystadenocarcinoma(136;0.0259)	Nonsense_Mutation	SNP	109859184	109859184	12766	6	G	A	A	45	45	PPIL6	A	5	2
PPP1R3A	5506	broad.mit.edu	36	7	113306521	113306521	+	Missense_Mutation	SNP	C	A	A			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:113306521C>A	uc010ljy.1	-	c.1862G>T	c.(1861-1863)AGA>ATA	p.R621I		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	621					glycogen metabolic process	integral to membrane				ovary(9)|pancreas(7)|skin(2)|breast(2)|lung(1)	21										235				0.269962	171.497056	184.062405	71	192	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	113306521	113306521	12806	7	C	A	A	32	32	PPP1R3A	A	3	3
HOXA2	3199	broad.mit.edu	36	7	27108556	27108556	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:27108556T>A	uc003syh.1	-	c.89A>T	c.(88-90)GAT>GTT	p.D30V		NM_006735	NP_006726	O43364	HXA2_HUMAN	homeobox A2	30						nucleus	sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)	1														0.12749	50.929937	84.882283	32	219	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27108556	27108556	7584	7	T	A	A	50	50	HOXA2	A	4	4
MAGI2	9863	broad.mit.edu	36	7	77635308	77635308	+	Silent	SNP	A	T	T			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:77635308A>T	uc003ugx.1	-	c.2457T>A	c.(2455-2457)CTT>CTA	p.L819L	MAGI2_uc003ugy.1_Silent_p.L805L|MAGI2_uc010ldx.1_Silent_p.L412L	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	819	PDZ 4.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)	5		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)												0.335079	163.357494	167.946399	64	127	AA		KEEP	---	---	---	---	capture			Silent	SNP	77635308	77635308	9574	7	A	T	T	9	9	MAGI2	T	4	4
ZNF706	51123	broad.mit.edu	36	8	102283137	102283137	+	Silent	SNP	A	G	G			TCGA-06-0128-01	TCGA-06-0128-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:102283137A>G	uc003yka.1	-	c.9T>C	c.(7-9)CGT>CGC	p.R3R	ZNF706_uc003ykb.1_Silent_p.R3R	NM_001042510	NP_057180	Q9Y5V0	ZN706_HUMAN	HSPC038 protein	3						intracellular	zinc ion binding			ovary(2)	2	all_cancers(14;3.3e-07)|all_epithelial(15;3.47e-09)|Lung NSC(17;3.44e-05)|all_lung(17;0.000117)													0.117647	6.751001	16.528482	8	60	AA		KEEP	---	---	---	---	capture	Epithelial(11;8.57e-11)|all cancers(13;1.43e-08)|OV - Ovarian serous cystadenocarcinoma(57;1.43e-05)		Silent	SNP	102283137	102283137	18706	8	A	G	G	6	6	ZNF706	G	4	4
TUSC3	7991	broad.mit.edu	36	8	15564045	15564045	+	Missense_Mutation	SNP	T	C	C			TCGA-06-0128-01	TCGA-06-0128-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:15564045T>C	uc003wwt.1	+	c.577T>C	c.(577-579)TTC>CTC	p.F193L	TUSC3_uc003wwr.1_Missense_Mutation_p.F193L|TUSC3_uc003wws.1_Missense_Mutation_p.F193L|TUSC3_uc003wwu.1_Missense_Mutation_p.F193L|TUSC3_uc003wwv.1_Missense_Mutation_p.F193L|TUSC3_uc003www.1_Missense_Mutation_p.F193L|TUSC3_uc003wwx.1_Non-coding_Transcript|TUSC3_uc003wwy.1_Missense_Mutation_p.F193L	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	193					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex		p.F193L(1)		ovary(2)|central_nervous_system(1)	3														0.390323	409.519905	412.781788	121	189	TT		KEEP	---	---	---	---	capture		Colorectal(111;0.113)	Missense_Mutation	SNP	15564045	15564045	17334	8	T	C	C	64	64	TUSC3	C	4	4
TRIM32	22954	broad.mit.edu	36	9	118501420	118501420	+	Silent	SNP	C	T	T			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:118501420C>T	uc004bjx.2	+	c.1578C>T	c.(1576-1578)ACC>ACT	p.T526T	ASTN2_uc004bjr.1_Intron|ASTN2_uc004bjs.1_Intron|ASTN2_uc004bjt.1_Intron|TRIM32_uc004bjw.2_Silent_p.T526T|TRIM32_uc010mvg.1_Silent_p.T526T	NM_001099679	NP_036342	Q13049	TRI32_HUMAN	TAT-interactive protein, 72-KD	526					fat cell differentiation|innate immune response|negative regulation of apoptosis|negative regulation of fibroblast proliferation|positive regulation of cell cycle|positive regulation of cell growth|positive regulation of cell migration|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of NF-kappaB transcription factor activity|positive regulation of protein catabolic process|positive regulation of proteolysis|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to tumor necrosis factor|response to UV	nucleus	myosin binding|protein self-association|RNA binding|Tat protein binding|transcription coactivator activity|translation initiation factor binding|ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding	p.T526T(1)		central_nervous_system(2)|kidney(1)	3						Esophageal Squamous(92;212 1916 19711 26951)								0.340426	95.373199	97.48797	32	62	CC		KEEP	---	---	---	---	capture			Silent	SNP	118501420	118501420	17050	9	C	T	T	23	23	TRIM32	T	1	1
C9orf86	55684	broad.mit.edu	36	9	138853337	138853337	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0128-01	TCGA-06-0128-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:138853337C>G	uc004cjj.1	+	c.1439C>G	c.(1438-1440)GCT>GGT	p.A480G	C9orf86_uc004cjk.1_Intron|C9orf86_uc004cji.1_Missense_Mutation_p.A479G|C9orf86_uc010nbr.1_Intron|C9orf86_uc004cjl.1_Non-coding_Transcript|C9orf86_uc010nbs.1_Missense_Mutation_p.A364G|C9orf86_uc004cjn.1_Missense_Mutation_p.A273G	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1	479					small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)												0.4	6.364964	6.460841	4	6	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)	Missense_Mutation	SNP	138853337	138853337	2618	9	C	G	G	28	28	C9orf86	G	3	3
KRT1	3848	broad.mit.edu	36	12	51355503	51355523	+	In_Frame_Del	DEL	TAGCTGCTACCTCCGGAGCCA	-	-			TCGA-06-0128-01	TCGA-06-0128-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:51355503_51355523delTAGCTGCTACCTCCGGAGCCA	uc001sau.1	-	c.1656_1676delTGGCTCCGGAGGTAGCAGCTA	c.(1654-1677)TATGGCTCCGGAGGTAGCAGCTAC>TAC	p.552_559YGSGGSSY>Y	KRT1_uc001sav.1_Splice_Site_Del	NM_006121	NP_006112	P04264	K2C1_HUMAN	keratin 1	552_559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway|epidermis development|fibrinolysis|regulation of angiogenesis|response to oxidative stress	plasma membrane	protein binding|receptor activity|structural constituent of cytoskeleton|sugar binding			ovary(1)	1														0.91			10	1				---	---	---	---	capture_indel			In_Frame_Del	DEL	51355503	51355523	8762	12	TAGCTGCTACCTCCGGAGCCA	-	-	57	57	KRT1	-	5	5
TCF12	6938	broad.mit.edu	36	15	55341604	55341605	+	Frame_Shift_Del	DEL	CT	-	-			TCGA-06-0128-01	TCGA-06-0128-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:55341604_55341605delCT	uc002aea.1	+	c.1488_1489delCT	c.(1486-1491)GACTCTfs	p.D496fs	TCF12_uc002aeb.1_Frame_Shift_Del_p.D496fs|TCF12_uc002aec.1_Frame_Shift_Del_p.D472fs|TCF12_uc002aed.1_Frame_Shift_Del_p.D472fs|TCF12_uc010bfs.1_Intron|TCF12_uc002aee.1_Frame_Shift_Del_p.D302fs|TCF12_uc010bft.1_Frame_Shift_Del_p.D326fs|TCF12_uc010bfu.1_Frame_Shift_Del_p.D85fs	NM_207036	NP_996920	Q99081	HTF4_HUMAN	transcription factor 12 isoform a	472_473					immune response|muscle organ development|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity			central_nervous_system(5)|ovary(2)|lung(1)	8		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)						335				0.39			37	57				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	55341604	55341605	16213	15	CT	-	-	20	20	TCF12	-	5	5
TP53	7157	broad.mit.edu	36	17	7517635	7517635	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-0128-01	TCGA-06-0128-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7517635_7517635delG	uc002gim.2	-	c.936_936delC	c.(934-936)ACCfs	p.T312fs	TP53_uc002gig.1_Intron|TP53_uc002gih.1_Frame_Shift_Del_p.T312fs|TP53_uc010cne.1_Non-coding_Transcript|TP53_uc010cnf.1_Frame_Shift_Del_p.T180fs|TP53_uc010cng.1_Frame_Shift_Del_p.T180fs|TP53_uc002gii.1_Frame_Shift_Del_p.T180fs|TP53_uc010cnh.1_Frame_Shift_Del_p.T312fs|TP53_uc010cni.1_Frame_Shift_Del_p.T312fs|TP53_uc002gij.2_Frame_Shift_Del_p.T312fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	312	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		T -> I (in sporadic cancers; somatic mutation).|T -> S (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.0?(6)|p.T312T(2)|p.S313fs*24(2)|p.?(1)|p.E180G(1)|p.L308fs*15(1)|p.L308fs*31(1)|p.S313fs*32(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)		111		690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.78			131	38				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	7517635	7517635	16923	17	G	-	-	47	47	TP53	-	5	5
