Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
HSPB2	3316	broad.mit.edu	36	11	111289751	111289751	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:111289751C>T	uc001pmg.1	+	c.471C>T	c.(469-471)GTC>GTT	p.V157V	CRYAB_uc001pmf.1_5'Flank|HSPB2_uc009yyj.1_Non-coding_Transcript|C11orf52_uc001pmh.1_Intron	NM_001541	NP_001532	Q16082	HSPB2_HUMAN	heat shock 27kDa protein 2	157					response to heat|response to unfolded protein	cytosol|nucleus	enzyme activator activity|protein binding			ovary(1)|skin(1)	2		all_cancers(61;3.75e-11)|all_epithelial(67;2.33e-06)|Melanoma(852;9.42e-06)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Breast(348;0.0512)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)												0.157303	21.086826	31.066294	14	75	CC		KEEP	---	---	---	---	capture		Epithelial(105;3.57e-07)|BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|all cancers(92;6.57e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.051)	Silent	SNP	111289751	111289751	7719	11	C	T	T	29	29	HSPB2	T	2	2
SIK3	23387	broad.mit.edu	36	11	116474146	116474146	+	Missense_Mutation	SNP	A	T	T			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:116474146A>T	uc001ppy.1	-	c.22T>A	c.(22-24)TAC>AAC	p.Y8N	SIK3_uc001ppz.1_5'UTR|SIK3_uc001pqa.1_Missense_Mutation_p.Y8N	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	KIAA0999 protein	8	Protein kinase.				protein phosphorylation	cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(3)|breast(2)|lung(1)|kidney(1)|skin(1)	8										634				0.357143	6.564551	6.8599	5	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116474146	116474146	14814	11	A	T	T	15	15	SIK3	T	4	4
MUC5B	727897	broad.mit.edu	36	11	1224225	1224225	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:1224225C>T	uc001ltb.2	+	c.9548C>T	c.(9547-9549)ACG>ATG	p.T3183M		NM_002458	NP_002449	Q9HC84	MUC5B_HUMAN	mucin 5, subtype B, tracheobronchial	3180	7 X Cys-rich subdomain repeats.|Thr-rich.|17 X approximate tandem repeats, Ser/Thr- rich.			Missing (in Ref. 6; AAB61398).	cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)												0.116505	9.540715	24.444554	12	91	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)	Missense_Mutation	SNP	1224225	1224225	10373	11	C	T	T	19	19	MUC5B	T	1	1
LRRC55	219527	broad.mit.edu	36	11	56706298	56706298	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56706298C>T	uc001njl.1	+	c.355C>T	c.(355-357)CGC>TGC	p.R119C		NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	89	LRR 1.					integral to membrane					0														0.404762	93.107429	93.779413	34	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56706298	56706298	9386	11	C	T	T	23	23	LRRC55	T	1	1
AHNAK	79026	broad.mit.edu	36	11	62057829	62057829	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62057829C>T	uc001ntl.1	-	c.636G>A	c.(634-636)TCG>TCA	p.S212S	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	212					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)	14		Melanoma(852;0.155)												0.342342	90.541037	93.013823	38	73	CC		KEEP	---	---	---	---	capture			Silent	SNP	62057829	62057829	417	11	C	T	T	23	23	AHNAK	T	1	1
SNX15	29907	broad.mit.edu	36	11	64556584	64556584	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:64556584C>T	uc001oci.2	+	c.241C>T	c.(241-243)CGG>TGG	p.R81W	SNX15_uc009ypy.1_Missense_Mutation_p.R81W|SNX15_uc001ocj.1_Missense_Mutation_p.R81W|SNX15_uc001ock.1_Missense_Mutation_p.R81W	NM_013306	NP_037438	Q9NRS6	SNX15_HUMAN	sorting nexin 15 isoform A	81	PX.				cell communication|intracellular protein transport	cytoplasmic vesicle membrane|cytosol	phosphatidylinositol binding|protein transporter activity			ovary(1)	1						Esophageal Squamous(56;269 1304 3324 8253)								0.189474	37.995447	46.563579	18	77	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64556584	64556584	15386	11	C	T	T	23	23	SNX15	T	1	1
UNC119B	84747	broad.mit.edu	36	12	119638909	119638909	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119638909C>T	uc001tyz.1	+	c.454C>T	c.(454-456)CGG>TGG	p.R152W		NM_001080533	NP_001074002	A6NIH7	U119B_HUMAN	unc-119 homolog B	152											0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)													0.482759	454.860012	454.940385	154	165	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	119638909	119638909	17541	12	C	T	T	23	23	UNC119B	T	1	1
SLC6A13	6540	broad.mit.edu	36	12	203910	203910	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:203910C>T	uc001qic.1	-	c.1091G>A	c.(1090-1092)CGG>CAG	p.R364Q	SLC6A13_uc009zdj.1_Missense_Mutation_p.R354Q	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	364					neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)													0.459677	158.311674	158.491391	57	67	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)		Missense_Mutation	SNP	203910	203910	15173	12	C	T	T	23	23	SLC6A13	T	1	1
TMTC1	83857	broad.mit.edu	36	12	29677417	29677417	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:29677417C>T	uc001rjb.1	-	c.734G>A	c.(733-735)CGG>CAG	p.R245Q	TMTC1_uc001riz.1_Missense_Mutation_p.R2Q|TMTC1_uc001rja.1_Missense_Mutation_p.R89Q|TMTC1_uc001rjc.1_Missense_Mutation_p.R307Q	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	245						integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)													0.490196	232.222192	232.234863	75	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29677417	29677417	16801	12	C	T	T	23	23	TMTC1	T	1	1
ARHGAP9	64333	broad.mit.edu	36	12	56159249	56159249	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:56159249G>A	uc001sod.1	-	c.421C>T	c.(421-423)CCC>TCC	p.P141S	ARHGAP9_uc001snz.1_5'Flank|ARHGAP9_uc001soa.1_5'Flank|ARHGAP9_uc001sob.1_Missense_Mutation_p.P70S|ARHGAP9_uc001soc.1_Missense_Mutation_p.P70S|ARHGAP9_uc001soe.1_Missense_Mutation_p.P149S	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	70	SH3.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1														0.368421	206.906856	210.091069	77	132	GG		KEEP	---	---	---	---	capture	GBM - Glioblastoma multiforme(3;3.37e-34)		Missense_Mutation	SNP	56159249	56159249	903	12	G	A	A	41	41	ARHGAP9	A	2	2
CD4	920	broad.mit.edu	36	12	6798325	6798325	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:6798325A>C	uc001qqv.1	+	c.1330A>C	c.(1330-1332)ACC>CCC	p.T444P	CD4_uc009zfc.1_Missense_Mutation_p.T265P|GPR162_uc001qqw.1_5'Flank|GPR162_uc001qqx.1_5'Flank|GPR162_uc009zfd.1_5'Flank	NM_000616	NP_000607	P01730	CD4_HUMAN	CD4 antigen precursor	444	Cytoplasmic (Potential).|HIV-1 Vpu-susceptibility domain.				cell adhesion|entry into host cell|immune response|induction by virus of host cell-cell fusion|initiation of viral infection|maintenance of protein location in cell|positive regulation of interleukin-2 biosynthetic process|positive regulation of protein kinase activity|protein palmitoleylation|regulation of defense response to virus by virus|T cell costimulation|T cell receptor signaling pathway|T cell selection|transmembrane receptor protein tyrosine kinase signaling pathway	early endosome|endoplasmic reticulum membrane|integral to membrane|T cell receptor complex	coreceptor activity|extracellular matrix structural constituent|glycoprotein binding|MHC class II protein binding|protein homodimerization activity|protein kinase binding|transmembrane receptor activity|zinc ion binding				0		Myeloproliferative disorder(1001;0.0122)												0.323529	10.175359	11.306767	11	23	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6798325	6798325	3142	12	A	C	C	10	10	CD4	C	4	4
CLEC14A	161198	broad.mit.edu	36	14	37794901	37794901	+	Silent	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:37794901G>T	uc001wum.1	-	c.78C>A	c.(76-78)GCC>GCA	p.A26A		NM_175060	NP_778230	Q86T13	CLC14_HUMAN	C-type lectin domain family 14, member A	26	Extracellular (Potential).					integral to membrane	sugar binding			ovary(3)	3	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)													0.666667	12.501474	12.648939	4	2	GG		KEEP	---	---	---	---	capture	Lung(238;3.93e-06)|LUAD - Lung adenocarcinoma(48;2.62e-05)|Epithelial(34;0.187)	GBM - Glioblastoma multiforme(112;0.00439)	Silent	SNP	37794901	37794901	3636	14	G	T	T	39	39	CLEC14A	T	3	3
TP53BP1	7158	broad.mit.edu	36	15	41560513	41560513	+	Splice_Site_SNP	SNP	C	G	G			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:41560513C>G	uc001zrr.2	-	c.372_splice	c.e5-1	p.S124_splice	TP53BP1_uc001zrq.2_Splice_Site_SNP_p.S124_splice|TP53BP1_uc001zrs.1_Splice_Site_SNP_p.S119_splice	NM_005657	NP_005648			tumor protein p53 binding protein 1 isoform 3						double-strand break repair via homologous recombination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed chromosome kinetochore|cytoplasm|nucleoplasm	protein binding|transcription activator activity			ovary(2)|large_intestine(1)|pancreas(1)|kidney(1)|skin(1)	6		all_cancers(109;6.94e-11)|all_epithelial(112;2.69e-09)|Lung NSC(122;7.86e-07)|all_lung(180;7.84e-06)|Melanoma(134;0.0728)								421				0.173333	65.85482	80.967383	26	124	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(94;1.59e-06)	Splice_Site_SNP	SNP	41560513	41560513	16925	15	C	G	G	20	20	TP53BP1	G	5	3
SH2D7	646892	broad.mit.edu	36	15	76173570	76173570	+	Missense_Mutation	SNP	C	G	G			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:76173570C>G	uc010blb.1	+	c.238C>G	c.(238-240)CGA>GGA	p.R80G		NM_001101404	NP_001094874	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	80	SH2.										0														0.363636	10.395848	10.576255	4	7	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	76173570	76173570	14730	15	C	G	G	23	23	SH2D7	G	3	3
MYH11	4629	broad.mit.edu	36	16	15726087	15726087	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:15726087C>T	uc002ddx.1	-	c.4055G>A	c.(4054-4056)CGG>CAG	p.R1352Q	MYH11_uc002ddv.1_Missense_Mutation_p.R1352Q|MYH11_uc002ddw.1_Missense_Mutation_p.R1345Q|MYH11_uc002ddy.1_Missense_Mutation_p.R1345Q|MYH11_uc010bvg.1_Missense_Mutation_p.R1177Q|NDE1_uc002dds.1_3'UTR|MYH11_uc010bvh.1_Missense_Mutation_p.R51Q|NDE1_uc002ddz.1_Non-coding_Transcript	NM_001040114	NP_001035203	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1345	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(4)|skin(2)|lung(1)	7										1257				0.336508	282.454471	289.901872	106	209	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15726087	15726087	10426	16	C	T	T	23	23	MYH11	T	1	1
PRKCB	5579	broad.mit.edu	36	16	24138810	24138810	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:24138810G>A	uc002dmd.1	+	c.1891G>A	c.(1891-1893)GAC>AAC	p.D631N	PRKCB_uc002dme.1_Non-coding_Transcript	NM_212535	NP_997700	P05771	KPCB_HUMAN	protein kinase C, beta isoform 1	631	AGC-kinase C-terminal.				apoptosis|B cell activation|B cell receptor signaling pathway|intracellular signal transduction|lipoprotein transport|platelet activation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|synaptic transmission|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|histone binding|histone kinase activity (H3-T6 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|zinc ion binding			ovary(3)|central_nervous_system(3)|lung(2)|large_intestine(1)	9					Vitamin E(DB00163)					395				0.512195	125.553314	125.564104	42	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24138810	24138810	12951	16	G	A	A	37	37	PRKCB	A	1	1
ZSCAN10	84891	broad.mit.edu	36	16	3080536	3080536	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3080536C>T	uc002ctv.1	-	c.735G>A	c.(733-735)CCG>CCA	p.P245P	ZSCAN10_uc002ctw.1_Silent_p.P163P|ZSCAN10_uc002ctx.1_Silent_p.P173P|ZSCAN10_uc002cty.1_5'UTR	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	245					regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription repressor activity|zinc ion binding			ovary(1)	1														0.48	212.478739	212.531377	72	78	CC		KEEP	---	---	---	---	capture			Silent	SNP	3080536	3080536	18831	16	C	T	T	23	23	ZSCAN10	T	1	1
SLC12A3	6559	broad.mit.edu	36	16	55470581	55470581	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:55470581A>G	uc002ekd.2	+	c.1276A>G	c.(1276-1278)AAC>GAC	p.N426D	SLC12A3_uc010ccm.1_Missense_Mutation_p.N426D|SLC12A3_uc010ccn.1_Missense_Mutation_p.N425D	NM_000339	NP_000330	P55017	S12A3_HUMAN	solute carrier family 12, member 3 isoform 1	426					sodium ion transport	apical plasma membrane|integral to plasma membrane|membrane fraction	sodium:chloride symporter activity			ovary(2)|breast(1)	3					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)									0.26087	7.877788	9.125789	6	17	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55470581	55470581	14879	16	A	G	G	9	9	SLC12A3	G	4	4
HYDIN	54768	broad.mit.edu	36	16	69744078	69744078	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:69744078C>T	uc002ezr.1	-	c.826G>A	c.(826-828)GTG>ATG	p.V276M	HYDIN_uc010cfz.1_Missense_Mutation_p.V21M|HYDIN_uc002ezv.1_Missense_Mutation_p.V276M|HYDIN_uc002ezw.2_Missense_Mutation_p.V293M|HYDIN_uc002ezx.1_Missense_Mutation_p.V21M	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	276										ovary(1)	1		Ovarian(137;0.0654)												0.204651	91.673667	109.081636	44	171	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69744078	69744078	7767	16	C	T	T	19	19	HYDIN	T	1	1
KIF19	124602	broad.mit.edu	36	17	69858514	69858514	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:69858514G>A	uc002jkm.2	+	c.1462G>A	c.(1462-1464)GAC>AAC	p.D488N	KIF19_uc002jkj.2_Missense_Mutation_p.D488N|KIF19_uc002jkk.2_Missense_Mutation_p.D446N|KIF19_uc002jkl.2_Missense_Mutation_p.D446N	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	488					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0														0.209459	65.855513	77.412179	31	117	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69858514	69858514	8593	17	G	A	A	37	37	KIF19	A	1	1
DSG3	1830	broad.mit.edu	36	18	27310160	27310160	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:27310160C>T	uc002kws.1	+	c.2939C>T	c.(2938-2940)ACG>ATG	p.T980M	DSG3_uc002kwt.1_Missense_Mutation_p.T262M	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	980	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			ovary(3)|lung(1)|central_nervous_system(1)	5														0.384	263.533368	266.484846	96	154	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(10;0.00504)		Missense_Mutation	SNP	27310160	27310160	4962	18	C	T	T	19	19	DSG3	T	1	1
ZBTB7C	201501	broad.mit.edu	36	18	43821450	43821450	+	Silent	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:43821450A>G	uc010dnv.1	-	c.93T>C	c.(91-93)ATT>ATC	p.I31I	ZBTB7C_uc010dnw.1_Silent_p.I9I|ZBTB7C_uc010dny.1_Silent_p.I9I|ZBTB7C_uc010dnz.1_Silent_p.I31I|ZBTB7C_uc010doa.1_Silent_p.I31I|ZBTB7C_uc010dob.1_Silent_p.I9I|ZBTB7C_uc010doc.1_Silent_p.I18I|ZBTB7C_uc010dod.1_Silent_p.I31I|ZBTB7C_uc010doe.1_Silent_p.I9I|ZBTB7C_uc010dof.1_Silent_p.I9I|ZBTB7C_uc010dog.1_Silent_p.I9I|ZBTB7C_uc010doh.1_Silent_p.I18I|ZBTB7C_uc010doi.1_Silent_p.I9I|ZBTB7C_uc010doj.1_Silent_p.I18I|ZBTB7C_uc010dok.1_Silent_p.I58I|ZBTB7C_uc010dol.1_Silent_p.I18I|ZBTB7C_uc010dom.1_Silent_p.I18I|ZBTB7C_uc010don.1_Silent_p.I17I|ZBTB7C_uc010doo.1_Silent_p.I9I|ZBTB7C_uc010dop.1_Silent_p.I9I|ZBTB7C_uc010doq.1_Silent_p.I18I|ZBTB7C_uc010dor.1_Silent_p.I31I|ZBTB7C_uc010dos.1_Silent_p.I9I|ZBTB7C_uc010dot.1_Silent_p.I9I|ZBTB7C_uc010dou.1_Silent_p.I18I|ZBTB7C_uc002ldb.1_Silent_p.I9I|ZBTB7C_uc010dnu.1_Silent_p.I18I|ZBTB7C_uc010dnx.1_Silent_p.I9I|ZBTB7C_uc002lda.1_Silent_p.I9I	NM_001039360	NP_001034449	A1YPR0	ZBT7C_HUMAN	zinc finger and BTB domain containing 7C	9						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1														0.317073	77.223628	79.661792	26	56	AA		KEEP	---	---	---	---	capture			Silent	SNP	43821450	43821450	18142	18	A	G	G	5	5	ZBTB7C	G	4	4
PAPL	390928	broad.mit.edu	36	19	44281108	44281108	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:44281108C>T	uc002oki.1	+	c.292C>T	c.(292-294)CTT>TTT	p.L98F	PAPL_uc010egl.1_Missense_Mutation_p.L98F	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	FLJ16165 protein	98						extracellular region	acid phosphatase activity|metal ion binding				0														0.32967	82.217825	84.558661	30	61	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44281108	44281108	11844	19	C	T	T	28	28	PAPL	T	2	2
CIC	23152	broad.mit.edu	36	19	47489093	47489093	+	Silent	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47489093G>C	uc002otf.1	+	c.3615G>C	c.(3613-3615)CGG>CGC	p.R1205R		NM_015125	NP_055940	Q96RK0	CIC_HUMAN	capicua homolog	1205	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(4)|breast(4)	8		Prostate(69;0.00682)								241				0.315789	6.467368	7.147628	6	13	GG		KEEP	---	---	---	---	capture			Silent	SNP	47489093	47489093	3558	19	G	C	C	42	42	CIC	C	3	3
SPHK2	56848	broad.mit.edu	36	19	53824646	53824646	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:53824646G>T	uc002pjw.2	+	c.1955G>T	c.(1954-1956)GGT>GTT	p.G652V	SPHK2_uc002pjr.1_Missense_Mutation_p.G590V|SPHK2_uc002pjs.1_Missense_Mutation_p.G590V|SPHK2_uc002pjt.1_Missense_Mutation_p.G384V|SPHK2_uc002pju.2_Intron|SPHK2_uc002pjv.1_Missense_Mutation_p.G554V	NM_020126	NP_064511	Q9NRA0	SPHK2_HUMAN	sphingosine kinase 2	590					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|anti-apoptosis|cell proliferation|sphinganine-1-phosphate biosynthetic process	cytosol|lysosomal membrane|membrane fraction	ATP binding|D-erythro-sphingosine kinase activity|diacylglycerol kinase activity|Ras GTPase binding|sphinganine kinase activity				0		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)												0.176471	6.318897	7.992405	3	14	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)	Missense_Mutation	SNP	53824646	53824646	15559	19	G	T	T	44	44	SPHK2	T	3	3
NLRP5	126206	broad.mit.edu	36	19	61231611	61231611	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:61231611C>T	uc002qmj.1	+	c.2200C>T	c.(2200-2202)CGG>TGG	p.R734W	NLRP5_uc002qmi.1_Missense_Mutation_p.R715W	NM_153447	NP_703148	P59047	NALP5_HUMAN	NACHT, LRR and PYD containing protein 5	734	LRR 2.					mitochondrion|nucleolus	ATP binding			ovary(3)|skin(2)|kidney(1)	6		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)												0.263889	311.970771	337.364711	133	371	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(193;0.0326)	Missense_Mutation	SNP	61231611	61231611	10883	19	C	T	T	27	27	NLRP5	T	1	1
DDR2	4921	broad.mit.edu	36	1	161016536	161016536	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:161016536C>T	uc001gcf.1	+	c.2444C>T	c.(2443-2445)CCT>CTT	p.P815L	DDR2_uc001gcg.1_Missense_Mutation_p.P815L	NM_001014796	NP_006173	Q16832	DDR2_HUMAN	discoidin domain receptor family, member 2	815	Cytoplasmic (Potential).|Protein kinase.				cell adhesion|protein phosphorylation	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity	p.P815L(1)		lung(2)|central_nervous_system(2)|ovary(1)|kidney(1)	6	all_hematologic(112;0.115)					NSCLC(161;314 2006 8283 19651 23192)			p.P815I(HCC366-Tumor)	497				0.400697	355.69945	358.164019	115	172	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(70;0.113)		Missense_Mutation	SNP	161016536	161016536	4508	1	C	T	T	24	24	DDR2	T	2	2
HMCN1	83872	broad.mit.edu	36	1	184239598	184239598	+	Nonsense_Mutation	SNP	A	T	T			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:184239598A>T	uc001grq.1	+	c.4474A>T	c.(4474-4476)AAG>TAG	p.K1492*		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1	1492	Ig-like C2-type 12.				bioluminescence|protein-chromophore linkage|response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)	22														0.28972	78.294283	82.527533	31	76	AA		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	184239598	184239598	7511	1	A	T	T	5	5	HMCN1	T	5	4
USH2A	7399	broad.mit.edu	36	1	214439707	214439707	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:214439707C>T	uc001hku.1	-	c.3696G>A	c.(3694-3696)TTG>TTA	p.L1232L	USH2A_uc001hkv.1_Silent_p.L1232L	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1232	Extracellular (Potential).|Fibronectin type-III 2.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22														0.401639	130.785221	131.80572	49	73	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)	Silent	SNP	214439707	214439707	17598	1	C	T	T	25	25	USH2A	T	2	2
HOOK1	51361	broad.mit.edu	36	1	60071773	60071773	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:60071773G>A	uc009wad.1	+	c.382G>A	c.(382-384)GCG>ACG	p.A128T	HOOK1_uc001czo.1_Missense_Mutation_p.A128T|HOOK1_uc001czp.1_Non-coding_Transcript	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	128	Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)													0.423077	152.092823	152.76615	55	75	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60071773	60071773	7574	1	G	A	A	46	46	HOOK1	A	2	2
LBP	3929	broad.mit.edu	36	20	36422820	36422820	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:36422820C>T	uc002xic.1	+	c.637C>T	c.(637-639)CTC>TTC	p.L213F		NM_004139	NP_004130	P18428	LBP_HUMAN	lipopolysaccharide-binding protein precursor	213					acute-phase response|cellular defense response|cellular response to lipoteichoic acid|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|detection of molecule of bacterial origin|innate immune response|lipid transport|lipopolysaccharide transport|lipopolysaccharide-mediated signaling pathway|macrophage activation involved in immune response|negative regulation of tumor necrosis factor production|opsonization|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of macrophage activation|positive regulation of respiratory burst involved in inflammatory response|positive regulation of toll-like receptor 4 signaling pathway|positive regulation of tumor necrosis factor production|Toll signaling pathway	extracellular space	Gram-negative bacterial cell surface binding|Gram-positive bacterial cell surface binding|lipid binding|lipopolysaccharide binding|lipoteichoic acid binding|receptor binding			ovary(1)|central_nervous_system(1)	2		Myeloproliferative disorder(115;0.00878)												0.297297	277.078358	289.321854	99	234	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36422820	36422820	8974	20	C	T	T	32	32	LBP	T	2	2
ZNF831	128611	broad.mit.edu	36	20	57203118	57203118	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:57203118C>T	uc002yan.1	+	c.3649C>T	c.(3649-3651)CGA>TGA	p.R1217*		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1217						intracellular	nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2	all_lung(29;0.0085)													0.325	72.129698	74.299986	26	54	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	57203118	57203118	18784	20	C	T	T	23	23	ZNF831	T	5	1
PKNOX1	5316	broad.mit.edu	36	21	43310139	43310139	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:43310139C>T	uc002zcq.1	+	c.575C>T	c.(574-576)CCG>CTG	p.P192L	PKNOX1_uc002zcp.1_Missense_Mutation_p.P192L|PKNOX1_uc002zcr.2_Missense_Mutation_p.P192L	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1	192							sequence-specific DNA binding|specific RNA polymerase II transcription factor activity			large_intestine(2)	2														0.329412	73.673122	75.865797	28	57	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43310139	43310139	12407	21	C	T	T	23	23	PKNOX1	T	1	1
TTN	7273	broad.mit.edu	36	2	179163599	179163599	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179163599G>A	uc002umr.1	-	c.53395C>T	c.(53395-53397)CGG>TGG	p.R17799W	TTN_uc002ums.1_Missense_Mutation_p.R11494W|TTN_uc010frc.1_Missense_Mutation_p.R11427W|TTN_uc010frd.1_Missense_Mutation_p.R11302W	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18726										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153									p.R17799W(OC316-Tumor)|p.R17799W(BICR16-Tumor)	8722				0.380117	189.131209	191.287674	65	106	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)		Missense_Mutation	SNP	179163599	179163599	17290	2	G	A	A	39	39	TTN	A	1	1
STAT1	6772	broad.mit.edu	36	2	191571219	191571219	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:191571219T>A	uc002usj.2	-	c.602A>T	c.(601-603)AAG>ATG	p.K201M	STAT1_uc010fse.1_Missense_Mutation_p.K201M|STAT1_uc002usk.2_Missense_Mutation_p.K201M|STAT1_uc002usl.2_Missense_Mutation_p.K203M|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	201					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of transcription, DNA-dependent|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity	p.K201M(1)		breast(2)|central_nervous_system(2)|ovary(1)	5					Fludarabine(DB01073)					350				0.294393	158.429606	166.532429	63	151	TT		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Missense_Mutation	SNP	191571219	191571219	15784	2	T	A	A	56	56	STAT1	A	4	4
COL6A3	1293	broad.mit.edu	36	2	237948272	237948272	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237948272C>T	uc002vwl.2	-	c.3201G>A	c.(3199-3201)GTG>GTA	p.V1067V	COL6A3_uc002vwk.2_Silent_p.V1067V|COL6A3_uc002vwm.2_Silent_p.V866V|COL6A3_uc002vwn.2_Silent_p.V867V|COL6A3_uc002vwo.2_Silent_p.V861V|COL6A3_uc002vwq.2_Silent_p.V861V|COL6A3_uc002vwr.2_Silent_p.V660V	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	1067	Nonhelical region.|VWFA 6.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)												0.111111	10.577398	25.36021	11	88	CC		KEEP	---	---	---	---	capture		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)	Silent	SNP	237948272	237948272	3839	2	C	T	T	21	21	COL6A3	T	2	2
PLB1	151056	broad.mit.edu	36	2	28618135	28618135	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:28618135G>A	uc002rmb.1	+	c.832G>A	c.(832-834)GTG>ATG	p.V278M	PLB1_uc010ezj.1_Missense_Mutation_p.V289M	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1	278	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity	p.V278M(1)		ovary(4)|large_intestine(2)|breast(1)	7	Acute lymphoblastic leukemia(172;0.155)													0.344828	106.207305	108.654354	40	76	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	28618135	28618135	12450	2	G	A	A	40	40	PLB1	A	1	1
AMOTL2	51421	broad.mit.edu	36	3	135563253	135563253	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:135563253C>T	uc003eqg.1	-	c.1366G>A	c.(1366-1368)GAG>AAG	p.E456K	AMOTL2_uc003eqe.1_Missense_Mutation_p.E81K|AMOTL2_uc003eqf.1_Missense_Mutation_p.E456K|AMOTL2_uc003eqh.1_Missense_Mutation_p.E456K	NM_016201	NP_057285	Q9Y2J4	AMOL2_HUMAN	angiomotin like 2	456	Potential.									large_intestine(1)	1														0.433333	31.855841	31.972936	13	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135563253	135563253	587	3	C	T	T	31	31	AMOTL2	T	1	1
EPHB1	2047	broad.mit.edu	36	3	136403133	136403133	+	Missense_Mutation	SNP	A	G	G			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:136403133A>G	uc003eqt.1	+	c.2258A>G	c.(2257-2259)AAC>AGC	p.N753S	EPHB1_uc003equ.1_Missense_Mutation_p.N314S	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	753	Cytoplasmic (Potential).|Protein kinase.				transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding	p.N753S(1)		lung(7)|ovary(4)|stomach(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	18										376				0.46383	371.287268	371.550797	109	126	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	136403133	136403133	5367	3	A	G	G	2	2	EPHB1	G	4	4
TRIM59	286827	broad.mit.edu	36	3	161638855	161638855	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:161638855C>T	uc003fdm.1	-	c.811G>A	c.(811-813)GAG>AAG	p.E271K	IFT80_uc003fda.2_Non-coding_Transcript|TRIM59_uc010hwe.1_Missense_Mutation_p.E271K	NM_173084	NP_775107	Q8IWR1	TRI59_HUMAN	tripartite motif-containing 59	271						integral to membrane|intracellular	zinc ion binding				0														0.407801	321.251352	323.351129	115	167	CC		KEEP	---	---	---	---	capture	Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)		Missense_Mutation	SNP	161638855	161638855	17078	3	C	T	T	29	29	TRIM59	T	2	2
C3orf67	200844	broad.mit.edu	36	3	58824463	58824463	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:58824463C>T	uc003dkt.1	-	c.1079G>A	c.(1078-1080)CGA>CAA	p.R360Q	C3orf67_uc003dks.1_Missense_Mutation_p.R175Q|C3orf67_uc003dkv.1_Missense_Mutation_p.R175Q|C3orf67_uc003dkw.2_Missense_Mutation_p.R255Q	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	360											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)												0.423358	167.232357	167.932832	58	79	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)	Missense_Mutation	SNP	58824463	58824463	2334	3	C	T	T	31	31	C3orf67	T	1	1
TMEM155	132332	broad.mit.edu	36	4	122900921	122900921	+	Missense_Mutation	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:122900921G>T	uc003idx.1	-	c.371C>A	c.(370-372)ACT>AAT	p.T124N	TMEM155_uc003idy.1_Missense_Mutation_p.T124N	NM_152399	NP_689612	Q4W5P6	TM155_HUMAN	transmembrane protein 155	124						extracellular region					0														0.176471	8.737277	12.089596	6	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	122900921	122900921	16605	4	G	T	T	36	36	TMEM155	T	3	3
SPATA5	166378	broad.mit.edu	36	4	124088056	124088056	+	Silent	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:124088056C>T	uc003iez.2	+	c.1677C>T	c.(1675-1677)TAC>TAT	p.Y559Y	SPATA5_uc003iey.2_Silent_p.Y558Y	NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	559					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0														0.130952	25.739496	47.98978	22	146	CC		KEEP	---	---	---	---	capture			Silent	SNP	124088056	124088056	15521	4	C	T	T	19	19	SPATA5	T	1	1
PHF17	79960	broad.mit.edu	36	4	129989736	129989736	+	Missense_Mutation	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:129989736T>A	uc003igk.1	+	c.448T>A	c.(448-450)TGG>AGG	p.W150R	PHF17_uc003igj.1_Missense_Mutation_p.W150R|PHF17_uc003igl.1_Missense_Mutation_p.W138R|PHF17_uc003igm.1_Missense_Mutation_p.W150R	NM_199320	NP_955352	Q6IE81	JADE1_HUMAN	PHD finger protein 17 long isoform	150					apoptosis|histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation|negative regulation of cell growth|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	histone acetyltransferase complex|mitochondrion	protein binding|zinc ion binding				0														0.485714	110.850604	110.86287	34	36	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129989736	129989736	12251	4	T	A	A	51	51	PHF17	A	4	4
UNC5A	90249	broad.mit.edu	36	5	176236875	176236875	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176236875G>A	uc003mey.1	+	c.1455G>A	c.(1453-1455)CCG>CCA	p.P485P		NM_133369	NP_588610	Q6ZN44	UNC5A_HUMAN	netrin receptor Unc5h1	485	ZU5.|Cytoplasmic (Potential).				apoptosis|axon guidance|regulation of apoptosis	integral to membrane|plasma membrane					0	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)												0.3	87.629085	91.562324	33	77	GG		KEEP	---	---	---	---	capture	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Silent	SNP	176236875	176236875	17549	5	G	A	A	39	39	UNC5A	A	1	1
HEATR7B2	133558	broad.mit.edu	36	5	41088385	41088385	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41088385C>T	uc003jmj.2	-	c.1169G>A	c.(1168-1170)CGG>CAG	p.R390Q	HEATR7B2_uc003jmi.2_Intron	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	390							binding			ovary(6)|central_nervous_system(2)	8														0.404959	140.545838	141.502181	49	72	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41088385	41088385	7318	5	C	T	T	23	23	HEATR7B2	T	1	1
SYTL3	94120	broad.mit.edu	36	6	159098388	159098388	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:159098388C>T	uc003qrp.1	+	c.1295C>T	c.(1294-1296)CCG>CTG	p.P432L	SYTL3_uc003qro.1_Missense_Mutation_p.P364L|SYTL3_uc003qrq.1_Missense_Mutation_p.P364L|SYTL3_uc003qrr.1_Missense_Mutation_p.P432L|SYTL3_uc003qrs.1_Missense_Mutation_p.P364L	NM_001009991	NP_001009991	Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	432					intracellular protein transport	endomembrane system|membrane	Rab GTPase binding|zinc ion binding				0		Breast(66;0.000776)|Ovarian(120;0.0303)												0.387387	124.399753	125.63303	43	68	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)	Missense_Mutation	SNP	159098388	159098388	16005	6	C	T	T	23	23	SYTL3	T	1	1
ATXN1	6310	broad.mit.edu	36	6	16414871	16414871	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:16414871C>T	uc003nbt.1	-	c.2116G>A	c.(2116-2118)GTC>ATC	p.V706I	ATXN1_uc010jpi.1_Missense_Mutation_p.V706I|ATXN1_uc010jpj.1_Non-coding_Transcript	NM_000332	NP_001121636	P54253	ATX1_HUMAN	ataxin 1	706	Interaction with USP7.|RNA-binding.				cell death|negative regulation of transcription, DNA-dependent|nuclear export|RNA processing	cytoplasm|nuclear inclusion body|nuclear matrix|nucleoplasm	identical protein binding|poly(G) RNA binding|poly(U) RNA binding|protein binding|protein C-terminus binding|protein self-association|transcription repressor activity			central_nervous_system(1)	1	Breast(50;0.063)|Ovarian(93;0.0733)	all_hematologic(90;0.000682)|Ovarian(999;0.00973)												0.370968	121.915095	123.729774	46	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	16414871	16414871	1228	6	C	T	T	19	19	ATXN1	T	1	1
MLLT4	4301	broad.mit.edu	36	6	168105979	168105979	+	Silent	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:168105979G>C	uc003qwd.1	+	c.4860G>C	c.(4858-4860)CGG>CGC	p.R1620R	MLLT4_uc003qwc.1_Silent_p.R1608R|MLLT4_uc003qwg.1_Silent_p.R919R	NM_001040001	NP_001035090	E9PHS7	E9PHS7_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1608					signal transduction					ovary(2)|kidney(1)|central_nervous_system(1)	4		Breast(66;1.07e-05)|Ovarian(120;0.024)								1250				0.352113	77.279697	78.637533	25	46	GG		KEEP	---	---	---	---	capture		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	Silent	SNP	168105979	168105979	10019	6	G	C	C	41	41	MLLT4	C	3	3
MLLT4	4301	broad.mit.edu	36	6	168106040	168106040	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:168106040G>C	uc003qwd.1	+	c.4921G>C	c.(4921-4923)GAG>CAG	p.E1641Q	MLLT4_uc003qwc.1_Missense_Mutation_p.E1629Q|MLLT4_uc003qwg.1_Missense_Mutation_p.E940Q	NM_001040001	NP_001035090	E9PHS7	E9PHS7_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1629					signal transduction					ovary(2)|kidney(1)|central_nervous_system(1)	4		Breast(66;1.07e-05)|Ovarian(120;0.024)								1250				0.338542	199.209642	203.638544	65	127	GG		KEEP	---	---	---	---	capture		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)	Missense_Mutation	SNP	168106040	168106040	10019	6	G	C	C	33	33	MLLT4	C	3	3
MICB	4277	broad.mit.edu	36	6	31582844	31582844	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:31582844C>T	uc003ntn.2	+	c.680C>T	c.(679-681)GCT>GTT	p.A227V	MICB_uc003nto.2_Missense_Mutation_p.A184V	NM_005931	NP_005922	Q29980	MICB_HUMAN	MHC class I polypeptide-related sequence B	227	Ig-like C1-type.|Extracellular (Potential).				antigen processing and presentation|cytolysis|gamma-delta T cell activation|immune response|immune response-activating cell surface receptor signaling pathway|interspecies interaction between organisms|negative regulation of defense response to virus by host|response to heat|response to oxidative stress|response to retinoic acid	integral to plasma membrane|MHC class I protein complex	natural killer cell lectin-like receptor binding				0														0.306667	123.610287	128.600832	46	104	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31582844	31582844	9965	6	C	T	T	28	28	MICB	T	2	2
BRAF	673	broad.mit.edu	36	7	140099617	140099617	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:140099617C>T	uc003vwc.2	-	c.1787G>A	c.(1786-1788)GGT>GAT	p.G596D		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	596	Protein kinase.		G -> R (in a colorectal adenocarcinoma sample; somatic mutation).|G -> V (in CFC syndrome).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.G596D(2)|p.D594_T599del(1)|p.G596S(1)	KIAA1549/BRAF(211)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(7681)|large_intestine(4665)|skin(3221)|NS(366)|central_nervous_system(264)|ovary(219)|lung(77)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(27)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(16)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	16798	Melanoma(164;0.00956)				Sorafenib(DB00398)	Colon(40;35 892 2973 5743 27438)		61		451				0.102326	15.693418	49.583842	22	193	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140099617	140099617	1527	7	C	T	T	18	18	BRAF	T	2	2
ABCB5	340273	broad.mit.edu	36	7	20656249	20656249	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:20656249C>T	uc010kuh.1	+	c.1286C>T	c.(1285-1287)ACG>ATG	p.T429M	ABCB5_uc003suw.2_De_novo_Start_InFrame|ABCB5_uc010kui.1_De_novo_Start_InFrame|ABCB5_uc003suv.2_De_novo_Start_InFrame	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	613	Cytoplasmic (Potential).|ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			large_intestine(1)|ovary(1)|pancreas(1)	3														0.133858	19.385288	35.91196	17	110	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20656249	20656249	45	7	C	T	T	19	19	ABCB5	T	1	1
SEPT14	346288	broad.mit.edu	36	7	55842282	55842282	+	Silent	SNP	T	A	A			TCGA-06-0185-01	TCGA-06-0185-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55842282T>A	uc003tqz.2	-	c.981A>T	c.(979-981)CCA>CCT	p.P327P		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	327					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)													0.30102	159.345932	166.279032	59	137	TT		KEEP	---	---	---	---	capture	Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)		Silent	SNP	55842282	55842282	14549	7	T	A	A	55	55	SEPT14	A	4	4
DYNC1I1	1780	broad.mit.edu	36	7	95337153	95337153	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:95337153G>A	uc003uoc.2	+	c.448G>A	c.(448-450)GTG>ATG	p.V150M	DYNC1I1_uc003uob.1_Missense_Mutation_p.V113M|DYNC1I1_uc003uod.2_Missense_Mutation_p.V133M|DYNC1I1_uc003uoe.2_Missense_Mutation_p.V130M|DYNC1I1_uc010lfl.1_Missense_Mutation_p.V139M	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	150					vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)													0.321321	275.99727	285.446074	107	226	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(171;0.0957)		Missense_Mutation	SNP	95337153	95337153	5028	7	G	A	A	40	40	DYNC1I1	A	1	1
COL22A1	169044	broad.mit.edu	36	8	139925566	139925566	+	Missense_Mutation	SNP	C	T	T			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:139925566C>T	uc003yvd.1	-	c.676G>A	c.(676-678)GTT>ATT	p.V226I		NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	226					cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(10)|pancreas(1)	11	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)													0.430712	327.182388	328.299747	115	152	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(115;0.0517)		Missense_Mutation	SNP	139925566	139925566	3819	8	C	T	T	19	19	COL22A1	T	1	1
ADAM9	8754	broad.mit.edu	36	8	38992811	38992811	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:38992811G>A	uc003xmr.1	+	c.351G>A	c.(349-351)CGG>CGA	p.R117R	ADAM9_uc003xmq.1_Silent_p.R117R|ADAM9_uc010lwr.1_Non-coding_Transcript	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	117	Extracellular (Potential).			Missing (in Ref. 2; no nucleotide entry).|R -> Q (in Ref. 4; BAA03499).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|integrin-mediated signaling pathway|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway|visual perception	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)												0.381579	258.624457	261.408753	87	141	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(45;2.74e-07)		Silent	SNP	38992811	38992811	254	8	G	A	A	43	43	ADAM9	A	2	2
RALYL	138046	broad.mit.edu	36	8	85937145	85937145	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:85937145G>A	uc003yct.2	+	c.512G>A	c.(511-513)CGT>CAT	p.R171H	RALYL_uc003ycq.2_Missense_Mutation_p.R158H|RALYL_uc003ycr.2_Missense_Mutation_p.R158H|RALYL_uc003ycs.2_Missense_Mutation_p.R158H|RALYL_uc010lzy.1_Missense_Mutation_p.R147H|RALYL_uc003ycu.2_Missense_Mutation_p.R85H|RALYL_uc003ycv.2_Missense_Mutation_p.R70H	NM_001100391	NP_001093861	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 1	158							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1														0.526316	85.854314	85.889202	30	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85937145	85937145	13480	8	G	A	A	40	40	RALYL	A	1	1
FIBCD1	84929	broad.mit.edu	36	9	132794941	132794941	+	Missense_Mutation	SNP	A	C	C			TCGA-06-0185-01	TCGA-06-0185-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:132794941A>C	uc004bzz.1	-	c.386T>G	c.(385-387)GTG>GGG	p.V129G		NM_032843	NP_116232	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	129	Extracellular (Potential).				signal transduction	extracellular space|integral to membrane	chitin binding|metal ion binding|receptor binding				0	all_hematologic(7;0.0028)													0.5	7.357047	7.357047	5	5	AA		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)	Missense_Mutation	SNP	132794941	132794941	6122	9	A	C	C	6	6	FIBCD1	C	4	4
ABCA2	20	broad.mit.edu	36	9	139035074	139035074	+	Silent	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:139035074G>A	uc004ckm.1	-	c.1248C>T	c.(1246-1248)GGC>GGT	p.G416G	ABCA2_uc010nby.1_Silent_p.G316G|ABCA2_uc010nbz.1_Silent_p.G386G|ABCA2_uc004ckl.1_Silent_p.G316G|ABCA2_uc004ckn.1_5'Flank|ABCA2_uc004cko.1_Silent_p.G162G|ABCA2_uc010nca.1_Silent_p.G316G	NM_212533	NP_997698	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	385					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|lysosomal membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)												0.45	20.458794	20.503864	9	11	GG		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)	Silent	SNP	139035074	139035074	33	9	G	A	A	38	38	ABCA2	A	1	1
C9orf131	138724	broad.mit.edu	36	9	35033416	35033416	+	Missense_Mutation	SNP	G	A	A			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35033416G>A	uc003zvw.1	+	c.790G>A	c.(790-792)GAA>AAA	p.E264K	C9orf131_uc003zvu.1_Missense_Mutation_p.E216K|C9orf131_uc003zvv.1_Missense_Mutation_p.E191K|C9orf131_uc003zvx.1_Missense_Mutation_p.E229K	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	264											0	all_epithelial(49;0.22)													0.223077	136.220589	154.552719	58	202	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		Missense_Mutation	SNP	35033416	35033416	2570	9	G	A	A	33	33	C9orf131	A	2	2
C9orf131	138724	broad.mit.edu	36	9	35033985	35033985	+	Missense_Mutation	SNP	G	C	C			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35033985G>C	uc003zvw.1	+	c.1359G>C	c.(1357-1359)TGG>TGC	p.W453C	C9orf131_uc003zvu.1_Missense_Mutation_p.W405C|C9orf131_uc003zvv.1_Missense_Mutation_p.W380C|C9orf131_uc003zvx.1_Missense_Mutation_p.W418C	NM_203299	NP_976044	Q5VYM1	CI131_HUMAN	hypothetical protein LOC138724 isoform A	453											0	all_epithelial(49;0.22)													0.223022	169.898051	189.514187	62	216	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)		Missense_Mutation	SNP	35033985	35033985	2570	9	G	C	C	41	41	C9orf131	C	3	3
RUSC2	9853	broad.mit.edu	36	9	35538294	35538294	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-0185-01	TCGA-06-0185-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:35538294C>A	uc003zww.1	+	c.1776C>A	c.(1774-1776)TGC>TGA	p.C592*	RUSC2_uc010mkq.1_Intron|RUSC2_uc003zwx.2_Nonsense_Mutation_p.C592*	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	592						cytosol				ovary(1)	1														0.493506	107.413975	107.417119	38	39	CC		KEEP	---	---	---	---	capture	Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)		Nonsense_Mutation	SNP	35538294	35538294	14231	9	C	A	A	28	28	RUSC2	A	5	3
EXOSC3	51010	broad.mit.edu	36	9	37775036	37775036	+	Silent	SNP	G	T	T			TCGA-06-0185-01	TCGA-06-0185-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:37775036G>T	uc004aal.2	-	c.6C>A	c.(4-6)GCC>GCA	p.A2A	EXOSC3_uc010mly.1_Silent_p.A2A|EXOSC3_uc004aam.2_Silent_p.A2A	NM_016042	NP_057126	Q9NQT5	EXOS3_HUMAN	exosome component 3 isoform 1	2					CUT catabolic process|DNA deamination|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|isotype switching|rRNA processing	cytoplasmic exosome (RNase complex)|cytosol|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5'-exoribonuclease activity|protein binding|RNA binding			breast(2)	2														0.409091	48.734091	49.053496	18	26	GG		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(29;0.00771)|Lung(182;0.221)	Silent	SNP	37775036	37775036	5509	9	G	T	T	39	39	EXOSC3	T	3	3
ACAP3	116983	broad.mit.edu	36	1	1219063	1219064	+	Splice_Site_Del	DEL	CA	-	-			TCGA-06-0185-01	TCGA-06-0185-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:1219063_1219064delCA	uc001aeb.1	-	c.e23_splice_site			ACAP3_uc001ady.1_Splice_Site_Del|ACAP3_uc001adz.1_Splice_Site_Del|ACAP3_uc001aea.1_Splice_Site_Del	NM_030649	NP_085152			ArfGAP with coiled-coil, ankyrin repeat and PH						filopodium assembly|regulation of ARF GTPase activity|signal transduction		ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding				0														0.40			19	29				---	---	---	---	capture_indel			Splice_Site_Del	DEL	1219063	1219064	121	1	CA	-	-	29	29	ACAP3	-	5	5
SPTA1	6708	broad.mit.edu	36	1	156888900	156888900	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-0185-01	TCGA-06-0185-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:156888900_156888900delT	uc001fst.1	-	c.3356_3356delA	c.(3355-3357)AAGfs	p.K1119fs		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1119	Spectrin 11.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|breast(1)	5	all_hematologic(112;0.0378)													0.40			109	164				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	156888900	156888900	15630	1	T	-	-	56	56	SPTA1	-	5	5
RAB11FIP5	26056	broad.mit.edu	36	2	73169030	73169052	+	Frame_Shift_Del	DEL	AGCACTCAGCTCCTCCTGTCCAA	-	-			TCGA-06-0185-01	TCGA-06-0185-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:73169030_73169052delAGCACTCAGCTCCTCCTGTCCAA	uc002siu.2	-	c.1202_1224delTTGGACAGGAGGAGCTGAGTGCT	c.(1201-1224)CTTGGACAGGAGGAGCTGAGTGCTfs	p.L401fs	RAB11FIP5_uc002sit.2_Frame_Shift_Del_p.L323fs	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	401_408					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0														0.37			37	64				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	73169030	73169052	13356	2	AGCACTCAGCTCCTCCTGTCCAA	-	-	11	11	RAB11FIP5	-	5	5
