Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
A1CF	29974	broad.mit.edu	36	10	52257916	52257916	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:52257916T>A	uc001jjj.1	-	c.750A>T	c.(748-750)GAA>GAT	p.E250D	A1CF_uc001jji.1_Missense_Mutation_p.E250D|A1CF_uc001jjh.1_Missense_Mutation_p.E258D|A1CF_uc009xov.1_Missense_Mutation_p.E250D	NM_138932	NP_620310	Q9NQ94	A1CF_HUMAN	apobec-1 complementation factor isoform 2	250	RRM 3.				cytidine to uridine editing|mRNA modification|mRNA processing|protein stabilization	apolipoprotein B mRNA editing enzyme complex|endoplasmic reticulum|nucleoplasm	nucleotide binding|protein binding|single-stranded RNA binding			central_nervous_system(1)	1														0.547368	174.910507	175.096251	52	43	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52257916	52257916	2	10	T	A	A	52	52	A1CF	A	4	4
PTEN	5728	broad.mit.edu	36	10	89682884	89682884	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89682884C>T	uc001kfb.1	+	c.388C>T	c.(388-390)CGA>TGA	p.R130*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(64)|p.R130*(60)|p.K128_R130del(3)|p.R130Q(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.R130R(1)|p.A121_F145del(1)|p.F56fs*2(1)|p.G129fs*50(1)|p.G129fs*51(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)					R130G(OV56_OVARY)|R130G(KMBC2_URINARY_TRACT)	31	p.R130G(OV56-Tumor)|p.KGR128del(A2780-Tumor)|p.R130G(KMBC2-Tumor)|p.G129fs(U937-Tumor)	264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.672566	249.435427	252.42009	76	37	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)	Nonsense_Mutation	SNP	89682884	89682884	13192	10	C	T	T	19	19	PTEN	T	5	1
CLDN25	644672	broad.mit.edu	36	11	113155806	113155806	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:113155806A>G	uc009yyw.1	+	c.79A>G	c.(79-81)ACC>GCC	p.T27A		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin-like	27	Helical; (Potential).					integral to membrane|tight junction	structural molecule activity				0														0.099548	17.822606	53.222365	22	199	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	113155806	113155806	3622	11	A	G	G	14	14	CLDN25	G	4	4
OR51G1	79324	broad.mit.edu	36	11	4901590	4901590	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:4901590T>A	uc001lzs.1	-	c.556A>T	c.(556-558)ATC>TTC	p.I186F		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	186	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)												0.64	151.128637	152.432735	48	27	TT		KEEP	---	---	---	---	capture		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)	Missense_Mutation	SNP	4901590	4901590	11508	11	T	A	A	50	50	OR51G1	A	4	4
FADS3	3995	broad.mit.edu	36	11	61402673	61402673	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61402673C>G	uc001nsm.1	-	c.634G>C	c.(634-636)GCC>CCC	p.A212P	FADS3_uc001nsn.1_Missense_Mutation_p.A88P	NM_021727	NP_068373	Q9Y5Q0	FADS3_HUMAN	fatty acid desaturase 3	212	Cytoplasmic (Potential).				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|membrane fraction	heme binding|oxidoreductase activity, acting on paired donors, with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water			ovary(1)|pancreas(1)	2														0.391892	93.288502	94.035397	29	45	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61402673	61402673	5564	11	C	G	G	27	27	FADS3	G	3	3
DNAJC4	3338	broad.mit.edu	36	11	63758008	63758008	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:63758008C>T	uc001nys.1	+	c.594C>T	c.(592-594)AAC>AAT	p.N198N	DNAJC4_uc001nyt.2_Silent_p.N199N|DNAJC4_uc001nyu.2_Silent_p.N198N|DNAJC4_uc009ypf.1_Silent_p.N198N|VEGFB_uc001nyw.1_5'Flank|VEGFB_uc001nyx.1_5'Flank	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	198					protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding				0														0.323944	189.405167	195.263174	69	144	CC		KEEP	---	---	---	---	capture			Silent	SNP	63758008	63758008	4832	11	C	T	T	19	19	DNAJC4	T	1	1
FAT3	120114	broad.mit.edu	36	11	92173454	92173454	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:92173454C>T	uc001pdj.2	+	c.7627C>T	c.(7627-7629)CGA>TGA	p.R2543*		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2543	Cadherin 23.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)									TCGA Ovarian(4;0.039)			0.342857	33.288277	34.052339	12	23	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	92173454	92173454	5927	11	C	T	T	31	31	FAT3	T	5	1
FAT3	120114	broad.mit.edu	36	11	92204524	92204524	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:92204524G>C	uc001pdj.2	+	c.9570G>C	c.(9568-9570)GAG>GAC	p.E3190D		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	3190	Cadherin 29.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)									TCGA Ovarian(4;0.039)			0.266667	7.389695	8.130375	4	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92204524	92204524	5927	11	G	C	C	34	34	FAT3	C	3	3
KIAA1467	57613	broad.mit.edu	36	12	13099902	13099902	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:13099902A>G	uc001rbi.1	+	c.188A>G	c.(187-189)GAT>GGT	p.D63G	KIAA1467_uc009zhx.1_Non-coding_Transcript	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	63						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)												0.403846	204.889931	206.151544	63	93	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(232;0.157)	Missense_Mutation	SNP	13099902	13099902	8544	12	A	G	G	12	12	KIAA1467	G	4	4
ACSM4	341392	broad.mit.edu	36	12	7367404	7367404	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7367404G>C	uc001qsx.1	+	c.1289G>C	c.(1288-1290)TGT>TCT	p.C430S		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member	430					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0														0.353535	115.516101	117.379432	35	64	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7367404	7367404	187	12	G	C	C	48	48	ACSM4	C	3	3
CD163	9332	broad.mit.edu	36	12	7527284	7527284	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:7527284G>A	uc001qsz.2	-	c.3034C>T	c.(3034-3036)CGC>TGC	p.R1012C	CD163_uc001qta.2_Missense_Mutation_p.R1012C|CD163_uc009zfw.1_Missense_Mutation_p.R1045C	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	1012	SRCR 9.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8														0.421569	125.899622	126.448484	43	59	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7527284	7527284	3094	12	G	A	A	40	40	CD163	A	1	1
SYT16	83851	broad.mit.edu	36	14	61606093	61606093	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:61606093C>T	uc001xfu.1	+	c.543C>T	c.(541-543)GAC>GAT	p.D181D		NM_031914	NP_114120	Q17RD7	SYT16_HUMAN	synaptotagmin XIV-like	181										central_nervous_system(1)	1														0.363636	282.457662	286.942577	100	175	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(108;0.0438)|BRCA - Breast invasive adenocarcinoma(234;0.118)	Silent	SNP	61606093	61606093	15993	14	C	T	T	19	19	SYT16	T	1	1
WDR72	256764	broad.mit.edu	36	15	51781768	51781768	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:51781768G>A	uc002acj.2	-	c.1424C>T	c.(1423-1425)TCG>TTG	p.S475L	WDR72_uc010bfi.1_Missense_Mutation_p.S475L	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	475	WD 6.									lung(1)	1														0.625767	334.488715	336.753821	102	61	GG		KEEP	---	---	---	---	capture		all cancers(107;0.0511)	Missense_Mutation	SNP	51781768	51781768	17895	15	G	A	A	37	37	WDR72	A	1	1
HERC1	8925	broad.mit.edu	36	15	61735125	61735125	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:61735125C>T	uc002amp.1	-	c.9953G>A	c.(9952-9954)CGA>CAA	p.R3318Q		NM_003922	NP_003913	Q15751	HERC1_HUMAN	guanine nucleotide exchange factor p532	3318					protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(5)|central_nervous_system(2)|lung(1)|breast(1)	9														0.857143	60.463	63.043574	18	3	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61735125	61735125	7340	15	C	T	T	31	31	HERC1	T	1	1
ACSM2B	348158	broad.mit.edu	36	16	20456139	20456139	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:20456139T>C	uc002dhj.2	-	c.1676A>G	c.(1675-1677)CAA>CGA	p.Q559R	ACSM2B_uc002dhk.2_Missense_Mutation_p.Q559R	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	559					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			ovary(1)|central_nervous_system(1)	2														0.157058	142.532554	199.134898	79	424	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20456139	20456139	185	16	T	C	C	63	63	ACSM2B	C	4	4
IL21R	50615	broad.mit.edu	36	16	27348908	27348908	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:27348908G>A	uc002doq.1	+	c.15G>A	c.(13-15)TGG>TGA	p.W5*	IL21R_uc002dor.1_Nonsense_Mutation_p.W5*|IL21R_uc002dos.1_Nonsense_Mutation_p.W5*	NM_181078	NP_851565	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor precursor	5					natural killer cell activation	integral to membrane	interleukin-21 receptor activity			ovary(2)	2										423				0.30303	25.63646	26.779934	10	23	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	27348908	27348908	7972	16	G	A	A	43	43	IL21R	A	5	2
FANCA	2175	broad.mit.edu	36	16	88389926	88389926	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:88389926A>C	uc002fou.1	-	c.895T>G	c.(895-897)TTC>GTC	p.F299V		NM_000135	NP_000126	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A isoform	299					DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)								1099				0.2375	10.773743	16.596655	19	61	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(80;0.028)	Missense_Mutation	SNP	88389926	88389926	5898	16	A	C	C	2	2	FANCA	C	4	4
RILP	83547	broad.mit.edu	36	17	1498515	1498515	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:1498515G>T	uc002ftd.1	-	c.700C>A	c.(700-702)CGC>AGC	p.R234S	SCARF1_uc002fsy.1_5'Flank|SCARF1_uc002fsz.1_5'Flank|SCARF1_uc002fta.1_5'Flank|SCARF1_uc002ftb.1_5'Flank|SCARF1_uc010cjv.1_5'Flank	NM_031430	NP_113618	Q96NA2	RILP_HUMAN	Rab interacting lysosomal protein	234					endosome to lysosome transport|protein transport	late endosome membrane|lysosomal membrane|phagocytic vesicle membrane	Rab GTPase binding			ovary(1)	1														0.426667	98.61158	98.957404	32	43	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)	Missense_Mutation	SNP	1498515	1498515	13835	17	G	T	T	38	38	RILP	T	3	3
MAPK7	5598	broad.mit.edu	36	17	19224729	19224729	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:19224729G>C	uc002gvn.1	+	c.614G>C	c.(613-615)CGT>CCT	p.R205P	B9D1_uc010cqm.1_5'Flank|B9D1_uc002gvl.2_5'Flank|MAPK7_uc002gvo.1_Missense_Mutation_p.R66P|MAPK7_uc002gvp.1_Missense_Mutation_p.R205P|MAPK7_uc002gvq.1_Missense_Mutation_p.R205P	NM_139033	NP_620601	Q13164	MK07_HUMAN	mitogen-activated protein kinase 7 isoform 1	205	Necessary for oligomerization (By similarity).|Protein kinase.				cell cycle|cell differentiation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			central_nervous_system(3)|lung(1)|skin(1)	5	all_cancers(12;2.87e-05)|all_epithelial(12;0.00114)|Hepatocellular(7;0.00345)|Breast(13;0.206)								p.R205P(CALU3-Tumor)|p.R205P(NCIH1436-Tumor)|p.R205P(BL70-Tumor)|p.R205P(PCM6-Tumor)|p.R205P(HS895.T-Tumor)	176				0.16	8.188671	10.936551	4	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19224729	19224729	9665	17	G	C	C	40	40	MAPK7	C	3	3
GSDMA	284110	broad.mit.edu	36	17	35386811	35386811	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:35386811C>T	uc002htl.1	+	c.1312C>T	c.(1312-1314)CTT>TTT	p.L438F	GSDMA_uc002htm.1_Missense_Mutation_p.L438F	NM_178171	NP_835465	Q96QA5	GSDMA_HUMAN	gasdermin 1	438					apoptosis|induction of apoptosis	perinuclear region of cytoplasm					0														0.135484	38.565002	58.520645	21	134	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35386811	35386811	7096	17	C	T	T	24	24	GSDMA	T	2	2
MPO	4353	broad.mit.edu	36	17	53710274	53710274	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53710274C>T	uc002ivu.1	-	c.1117G>A	c.(1117-1119)GGC>AGC	p.G373S		NM_000250	NP_000241	P05164	PERM_HUMAN	myeloperoxidase	373					anti-apoptosis|hydrogen peroxide catabolic process|low-density lipoprotein particle remodeling|oxidation-reduction process	extracellular space|lysosome|nucleus|stored secretory granule	chromatin binding|heme binding|heparin binding|peroxidase activity			ovary(2)|large_intestine(1)|pancreas(1)	4					Cefdinir(DB00535)									0.419355	118.214631	118.740867	39	54	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53710274	53710274	10124	17	C	T	T	23	23	MPO	T	1	1
TP53	7157	broad.mit.edu	36	17	7517822	7517822	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7517822C>G	uc002gim.2	-	c.841G>C	c.(841-843)GAC>CAC	p.D281H	TP53_uc002gig.1_Intron|TP53_uc002gih.1_Missense_Mutation_p.D281H|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.D149H|TP53_uc010cng.1_Missense_Mutation_p.D149H|TP53_uc002gii.1_Missense_Mutation_p.D149H|TP53_uc010cnh.1_Missense_Mutation_p.D281H|TP53_uc010cni.1_Missense_Mutation_p.D281H|TP53_uc002gij.2_Missense_Mutation_p.D281H	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	281	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		D -> Y (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> A (in sporadic cancers; somatic mutation).|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.D281H(19)|p.D281N(18)|p.0?(6)|p.D281Y(5)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.D281R(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.?(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)				Pancreas(47;798 1329 9957 10801)		111	p.D281Y(KURAMOCHI-Tumor)|p.V274fs(SCC9-Tumor)|p.D281N(SNU201-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.666667	125.116568	126.44522	36	18	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Missense_Mutation	SNP	7517822	7517822	16923	17	C	G	G	32	32	TP53	G	3	3
KDM6B	23135	broad.mit.edu	36	17	7693480	7693480	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7693480C>T	uc002giw.1	+	c.3149C>T	c.(3148-3150)CCA>CTA	p.P1050L	KDM6B_uc002gix.2_Missense_Mutation_p.P352L	NM_001080424	NP_001073893	O15054	KDM6B_HUMAN	jumonji domain containing 3, histone lysine	1050	Pro-rich.				inflammatory response|oxidation-reduction process	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			pancreas(1)	1														0.393939	35.767626	36.092447	13	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7693480	7693480	8444	17	C	T	T	21	21	KDM6B	T	2	2
ALOX15B	247	broad.mit.edu	36	17	7883539	7883539	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7883539C>T	uc002gju.1	+	c.258C>T	c.(256-258)GCC>GCT	p.A86A	ALOX15B_uc002gjv.1_Silent_p.A86A|ALOX15B_uc002gjw.1_Silent_p.A86A|ALOX15B_uc010cnp.1_5'UTR	NM_001141	NP_001132	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, second type	86	PLAT.				induction of apoptosis|leukotriene biosynthetic process|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of growth|oxidation-reduction process|prostate gland development|regulation of epithelial cell differentiation	cytoplasm	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			ovary(1)	1														0.75	10.437776	10.654886	3	1	CC		KEEP	---	---	---	---	capture			Silent	SNP	7883539	7883539	542	17	C	T	T	24	24	ALOX15B	T	2	2
TCF4	6925	broad.mit.edu	36	18	51072827	51072827	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:51072827C>T	uc002lga.2	-	c.1555G>A	c.(1555-1557)GAC>AAC	p.D519N	TCF4_uc002lfz.2_Missense_Mutation_p.D417N|TCF4_uc010dph.1_Missense_Mutation_p.D417N|TCF4_uc010dpi.1_Missense_Mutation_p.D423N|TCF4_uc002lfw.2_Missense_Mutation_p.D201N|TCF4_uc002lfx.2_Missense_Mutation_p.D346N|TCF4_uc002lfy.2_Missense_Mutation_p.D375N|TCF4_uc002lgb.1_Missense_Mutation_p.D257N|TCF4_uc002lfv.2_Missense_Mutation_p.D200N	NM_001083962	NP_001077431	P15884	ITF2_HUMAN	transcription factor 4 isoform a	417					protein-DNA complex assembly|transcription initiation from RNA polymerase II promoter	transcription factor complex	E-box binding|protein C-terminus binding|protein heterodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity|TFIIB-class binding transcription factor activity|TFIIB-class transcription factor binding|transcription initiation factor activity			ovary(1)	1														0.683333	133.420618	135.242498	41	19	CC		KEEP	---	---	---	---	capture		Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)	Missense_Mutation	SNP	51072827	51072827	16221	18	C	T	T	30	30	TCF4	T	2	2
SOCS6	9306	broad.mit.edu	36	18	66143050	66143050	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:66143050A>G	uc002lkr.1	+	c.166A>G	c.(166-168)ATC>GTC	p.I56V	SOCS6_uc010dqq.1_Missense_Mutation_p.I56V	NM_004232	NP_004223	O14544	SOCS6_HUMAN	suppressor of cytokine signaling 6	56					defense response|JAK-STAT cascade|negative regulation of signal transduction|regulation of growth	cytoplasm				large_intestine(1)	1		Esophageal squamous(42;0.129)|Colorectal(73;0.152)				Melanoma(84;1024 1361 24382 36583 42651)								0.382353	166.190885	167.832907	52	84	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66143050	66143050	15418	18	A	G	G	16	16	SOCS6	G	4	4
HMHA1	23526	broad.mit.edu	36	19	1034208	1034208	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:1034208G>A	uc002lqz.1	+	c.2811G>A	c.(2809-2811)ACG>ACA	p.T937T	HMHA1_uc002lra.1_Silent_p.T777T|HMHA1_uc002lrb.1_Silent_p.T820T|HMHA1_uc002lrc.1_Silent_p.T572T|HMHA1_uc002lrd.1_Silent_p.T13T|HMHA1_uc010dsd.1_Silent_p.T43T	NM_012292	NP_036424	Q92619	HMHA1_HUMAN	minor histocompatibility antigen HA-1	937	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding			lung(1)	1		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)												0.363636	22.004253	22.359634	8	14	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Silent	SNP	1034208	1034208	7532	19	G	A	A	38	38	HMHA1	A	1	1
CC2D1A	54862	broad.mit.edu	36	19	13901917	13901917	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13901917C>G	uc002mxo.1	+	c.2737C>G	c.(2737-2739)CTG>GTG	p.L913V	CC2D1A_uc002mxp.1_Missense_Mutation_p.L912V|CC2D1A_uc010dzh.1_Missense_Mutation_p.L482V	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	913					positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0														0.368421	12.127598	12.45135	7	12	CC		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)		Missense_Mutation	SNP	13901917	13901917	2846	19	C	G	G	28	28	CC2D1A	G	3	3
CD101	9398	broad.mit.edu	36	1	117354208	117354208	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117354208C>T	uc009whd.1	+	c.257C>T	c.(256-258)ACG>ATG	p.T86M		NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2	86	Extracellular (Potential).|Ig-like C2-type 1.				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			ovary(1)	1														0.411392	190.08194	191.15455	65	93	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117354208	117354208	3089	1	C	T	T	19	19	CD101	T	1	1
ACP6	51205	broad.mit.edu	36	1	145585982	145585982	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:145585982G>A	uc001epr.2	-	c.1154C>T	c.(1153-1155)CCG>CTG	p.P385L	NBPF11_uc009wjd.1_Intron|NBPF11_uc009wje.1_Intron	NM_016361	NP_057445	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	385					lipid metabolic process	extracellular region|mitochondrion	acid phosphatase activity|protein binding			ovary(4)	4	all_hematologic(923;0.0276)													0.378788	151.220708	152.921248	50	82	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	145585982	145585982	166	1	G	A	A	39	39	ACP6	A	1	1
AQP10	89872	broad.mit.edu	36	1	152562129	152562129	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152562129C>T	uc001feu.1	+	c.280C>T	c.(280-282)CGC>TGC	p.R94C	ATP8B2_uc001few.1_5'Flank|AQP10_uc001fev.2_Missense_Mutation_p.R94C	NM_080429	NP_536354	Q96PS8	AQP10_HUMAN	aquaporin 10	94	Cytoplasmic (Potential).				response to toxin|transmembrane transport|water transport	integral to membrane|plasma membrane	transporter activity			central_nervous_system(1)	1	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)													0.326271	207.593937	213.912778	77	159	CC		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(543;0.185)		Missense_Mutation	SNP	152562129	152562129	833	1	C	T	T	19	19	AQP10	T	1	1
ATP1A4	480	broad.mit.edu	36	1	158392495	158392495	+	Missense_Mutation	SNP	G	A	A	rs61734683	unknown	TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:158392495G>A	uc001fve.2	+	c.448G>A	c.(448-450)GTC>ATC	p.V150I	ATP1A4_uc001fvf.2_Non-coding_Transcript	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	150	Helical; (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)	2	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)													0.390625	148.025881	149.365396	50	78	GG		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(70;0.111)		Missense_Mutation	SNP	158392495	158392495	1150	1	G	A	A	40	40	ATP1A4	A	1	1
CAMK1G	57172	broad.mit.edu	36	1	207840062	207840062	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:207840062G>A	uc001hhd.1	+	c.204G>A	c.(202-204)GAG>GAA	p.E68E	CAMK1G_uc001hhf.2_Silent_p.E68E|CAMK1G_uc001hhe.1_Silent_p.E68E	NM_020439	NP_065172	Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	68	Protein kinase.					Golgi membrane|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1						Ovarian(163;530 1939 9680 28669 48710)				224				0.103976	31.087278	82.147567	34	293	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(81;0.0475)	Silent	SNP	207840062	207840062	2715	1	G	A	A	33	33	CAMK1G	A	2	2
GJC2	57165	broad.mit.edu	36	1	226412418	226412418	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:226412418C>T	uc001hsk.1	+	c.336C>T	c.(334-336)CGC>CGT	p.R112R	GJC2_uc009xey.1_Silent_p.R112R	NM_020435	NP_065168	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	112	Cytoplasmic (Potential).				cell death	connexon complex|integral to membrane					0		Prostate(94;0.0405)												0.416667	14.975208	15.047294	5	7	CC		KEEP	---	---	---	---	capture			Silent	SNP	226412418	226412418	6683	1	C	T	T	27	27	GJC2	T	1	1
OR2L8	391190	broad.mit.edu	36	1	246179444	246179444	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:246179444T>C	uc001idt.1	+	c.662T>C	c.(661-663)CTC>CCC	p.L221P	OR2L13_uc001ids.1_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	221	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)													0.12037	17.287369	32.588143	13	95	TT		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(106;0.0152)		Missense_Mutation	SNP	246179444	246179444	11415	1	T	C	C	54	54	OR2L8	C	4	4
CYP4B1	1580	broad.mit.edu	36	1	47037511	47037511	+	Silent	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:47037511T>C	uc001cqn.2	+	c.171T>C	c.(169-171)CAT>CAC	p.H57H	CYP4B1_uc001cqm.2_Silent_p.H57H|CYP4B1_uc009vym.1_Silent_p.H57H|CYP4B1_uc009vyl.1_5'UTR	NM_001099772	NP_001093242	P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B,	57					oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)													0.6	34.70028	34.874726	12	8	TT		KEEP	---	---	---	---	capture			Silent	SNP	47037511	47037511	4350	1	T	C	C	51	51	CYP4B1	C	4	4
C1orf175	374977	broad.mit.edu	36	1	54939583	54939583	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:54939583C>T	uc001cxp.1	+	c.3276C>T	c.(3274-3276)GAC>GAT	p.D1092D	C1orf175_uc001cxq.1_Non-coding_Transcript|C1orf175_uc001cxr.1_Non-coding_Transcript|C1orf175_uc001cxs.1_Non-coding_Transcript|C1orf175_uc001cxt.1_Non-coding_Transcript|C1orf175_uc009vzq.1_Non-coding_Transcript|C1orf175_uc009vzr.1_Silent_p.D297D	NM_001039464	NP_001034553	Q68CQ1	HEAT8_HUMAN	hypothetical protein LOC374977	1095	HEAT 3.					integral to membrane	binding				0														0.307692	33.704243	34.979529	12	27	CC		KEEP	---	---	---	---	capture			Silent	SNP	54939583	54939583	2083	1	C	T	T	19	19	C1orf175	T	1	1
PCSK2	5126	broad.mit.edu	36	20	17382509	17382509	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:17382509C>T	uc002wpm.1	+	c.1008C>T	c.(1006-1008)AAC>AAT	p.N336N	PCSK2_uc002wpl.1_Silent_p.N317N	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	336	Catalytic.				enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)									0.354331	124.644531	127.01685	45	82	CC		KEEP	---	---	---	---	capture			Silent	SNP	17382509	17382509	12022	20	C	T	T	19	19	PCSK2	T	1	1
C20orf118	140711	broad.mit.edu	36	20	34939758	34939758	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:34939758G>T	uc002xgg.1	+	c.76G>T	c.(76-78)GAA>TAA	p.E26*		NM_080628	NP_542195	A0PJX2	CT118_HUMAN	hypothetical protein LOC140711	26	Poly-Glu.										0		Myeloproliferative disorder(115;0.00874)												0.383333	131.179142	132.588836	46	74	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	34939758	34939758	2160	20	G	T	T	37	37	C20orf118	T	5	3
PRIC285	85441	broad.mit.edu	36	20	61669077	61669077	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:61669077G>A	uc002yfm.2	-	c.2078C>T	c.(2077-2079)GCG>GTG	p.A693V	PRIC285_uc002yfl.1_Missense_Mutation_p.A124V	NM_001037335	NP_001032412	Q9BYK8	PR285_HUMAN	PPAR-alpha interacting complex protein 285	693					cellular lipid metabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|helicase activity|ribonuclease activity|RNA binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)	2	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)													0.444444	44.793246	44.890256	16	20	GG		KEEP	---	---	---	---	capture	Epithelial(9;1.27e-08)|all cancers(9;7.32e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)		Missense_Mutation	SNP	61669077	61669077	12928	20	G	A	A	38	38	PRIC285	A	1	1
C20orf54	113278	broad.mit.edu	36	20	692614	692614	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:692614C>T	uc002wed.2	-	c.601G>A	c.(601-603)GGA>AGA	p.G201R	C20orf54_uc002wee.2_Missense_Mutation_p.G201R	NM_033409	NP_212134	Q9NQ40	RFT2_HUMAN	hypothetical protein LOC113278	201					sensory perception of sound	integral to plasma membrane	riboflavin transporter activity			ovary(2)	2														0.333333	16.544638	16.98713	6	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	692614	692614	2194	20	C	T	T	23	23	C20orf54	T	1	1
SAMSN1	64092	broad.mit.edu	36	21	14780141	14780141	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr21:14780141A>T	uc002yjv.1	-	c.1289T>A	c.(1288-1290)ATG>AAG	p.M430K	SAMSN1_uc002yju.1_Missense_Mutation_p.M362K|SAMSN1_uc010gky.1_Missense_Mutation_p.M194K	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	362					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	nucleus	phosphotyrosine binding			ovary(3)|pancreas(1)	4														0.357401	311.956805	316.914285	99	178	AA		KEEP	---	---	---	---	capture		Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)	Missense_Mutation	SNP	14780141	14780141	14310	21	A	T	T	8	8	SAMSN1	T	4	4
TRPM2	7226	broad.mit.edu	36	21	44650974	44650974	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44650974G>C	uc010gpt.1	+	c.2860G>C	c.(2860-2862)GCC>CCC	p.A954P	TRPM2_uc002zet.1_Missense_Mutation_p.A954P|TRPM2_uc002zeu.1_Missense_Mutation_p.A954P|TRPM2_uc002zew.1_Missense_Mutation_p.A954P|TRPM2_uc002zex.1_Missense_Mutation_p.A740P|TRPM2_uc002zey.1_Missense_Mutation_p.A467P	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,	954	Helical; (Potential).					integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.235294	9.110804	10.187341	4	13	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44650974	44650974	17137	21	G	C	C	42	42	TRPM2	C	3	3
MYO1B	4430	broad.mit.edu	36	2	191973386	191973386	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:191973386A>G	uc010fsg.1	+	c.2329A>G	c.(2329-2331)AAG>GAG	p.K777E	MYO1B_uc002usq.1_Missense_Mutation_p.K777E|MYO1B_uc002usr.1_Missense_Mutation_p.K777E|MYO1B_uc002usu.1_Missense_Mutation_p.K51E|MYO1B_uc002usv.1_5'Flank	NM_012223	NP_036355	O43795	MYO1B_HUMAN	myosin IB isoform 2	777	IQ 3.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(5)|large_intestine(2)|ovary(1)	8														0.313187	177.10334	182.760719	57	125	AA		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.104)|all cancers(119;0.236)		Missense_Mutation	SNP	191973386	191973386	10464	2	A	G	G	1	1	MYO1B	G	4	4
CXCR1	3577	broad.mit.edu	36	2	218737342	218737342	+	Missense_Mutation	SNP	G	A	A	rs61755739	unknown	TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:218737342G>A	uc002vhc.1	-	c.838C>T	c.(838-840)CGC>TGC	p.R280C	CXCR1_uc010fvn.1_Missense_Mutation_p.R280C	NM_000634	NP_000625	P25024	CXCR1_HUMAN	interleukin 8 receptor alpha	280	Extracellular (Potential).				dendritic cell chemotaxis|inflammatory response	integral to membrane|plasma membrane	interleukin-8 receptor activity				0									p.R280C(COLO829-Tumor)	31				0.338235	131.504789	134.653462	46	90	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	218737342	218737342	4250	2	G	A	A	39	39	CXCR1	A	1	1
TRIP12	9320	broad.mit.edu	36	2	230432450	230432450	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:230432450C>T	uc002vpx.1	-	c.309G>A	c.(307-309)GGG>GGA	p.G103G	TRIP12_uc002vpw.1_Silent_p.G61G|TRIP12_uc002vpy.1_Intron|TRIP12_uc010fxh.1_Silent_p.G61G	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	61					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|breast(1)|central_nervous_system(1)	6		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)												0.361419	458.575086	466.208579	163	288	CC		KEEP	---	---	---	---	capture		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)	Silent	SNP	230432450	230432450	17106	2	C	T	T	26	26	TRIP12	T	2	2
TTC15	51112	broad.mit.edu	36	2	3461701	3461701	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:3461701G>T	uc002qxm.1	+	c.1955G>T	c.(1954-1956)AGA>ATA	p.R652I	TTC15_uc002qxn.1_Missense_Mutation_p.R652I|TTC15_uc010ewm.1_Missense_Mutation_p.R658I	NM_016030	NP_057114	Q8WVT3	TTC15_HUMAN	tetratricopeptide repeat domain 15	652	TPR 3.						binding			ovary(2)|breast(1)|pancreas(1)	4	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.214)												0.360656	53.614039	54.664128	22	39	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(76;0.0402)|Epithelial(75;0.0986)|all cancers(51;0.149)	Missense_Mutation	SNP	3461701	3461701	17236	2	G	T	T	33	33	TTC15	T	3	3
THADA	63892	broad.mit.edu	36	2	43655640	43655640	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43655640C>T	uc002rsw.2	-	c.1068G>A	c.(1066-1068)CTG>CTA	p.L356L	THADA_uc002rsx.2_Silent_p.L356L|THADA_uc002rsy.2_Non-coding_Transcript|THADA_uc010fas.1_Non-coding_Transcript|THADA_uc002rsz.2_Silent_p.L66L|THADA_uc002rta.2_Silent_p.L66L|THADA_uc002rtb.1_Silent_p.L356L|THADA_uc002rtc.2_Silent_p.L356L|THADA_uc002rtd.2_Silent_p.L356L	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	356							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)												0.352332	176.818048	180.540001	68	125	CC		KEEP	---	---	---	---	capture			Silent	SNP	43655640	43655640	16368	2	C	T	T	17	17	THADA	T	2	2
NFU1	27247	broad.mit.edu	36	2	69518008	69518008	+	Silent	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:69518008C>G	uc002sfk.1	-	c.51G>C	c.(49-51)GGG>GGC	p.G17G	NFU1_uc002sfj.1_5'UTR|NFU1_uc002sfl.1_5'UTR|NFU1_uc002sfm.1_5'UTR|NFU1_uc010fdi.1_Non-coding_Transcript|NFU1_uc002sfn.1_Silent_p.G17G	NM_001002755	NP_056515	Q9UMS0	NFU1_HUMAN	HIRA interacting protein 5 isoform 2	17					iron-sulfur cluster assembly	cytosol|mitochondrion|nucleus	4 iron, 4 sulfur cluster binding|iron ion binding|protein binding				0												OREG0014671	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.263158	14.26609	15.230113	5	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	69518008	69518008	10786	2	C	G	G	26	26	NFU1	G	3	3
HTR3E	285242	broad.mit.edu	36	3	185307009	185307009	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:185307009G>T	uc010hxr.1	+	c.1283G>T	c.(1282-1284)GGG>GTG	p.G428V	HTR3E_uc010hxq.1_Missense_Mutation_p.G402V|HTR3E_uc003fml.2_Missense_Mutation_p.G387V|HTR3E_uc003fmm.1_Missense_Mutation_p.G417V|HTR3E_uc003fmn.1_Missense_Mutation_p.G402V	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	402	Cytoplasmic (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)	2	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)					Melanoma(7;227 727 6634 44770)								0.362319	61.339786	62.496918	25	44	GG		KEEP	---	---	---	---	capture	Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Missense_Mutation	SNP	185307009	185307009	7748	3	G	T	T	43	43	HTR3E	T	3	3
RBMS3	27303	broad.mit.edu	36	3	30007583	30007583	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:30007583G>T	uc003cel.1	+	c.1186G>T	c.(1186-1188)GTT>TTT	p.V396F	RBMS3_uc003cek.1_Missense_Mutation_p.V380F|RBMS3_uc010hfq.1_Missense_Mutation_p.V393F|RBMS3_uc003cem.1_Missense_Mutation_p.V378F|RBMS3_uc010hfr.1_Missense_Mutation_p.V380F	NM_001003793	NP_001003793	Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting	396						cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)	1		Ovarian(412;0.0956)												0.298851	71.111599	74.260335	26	61	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30007583	30007583	13612	3	G	T	T	48	48	RBMS3	T	3	3
FAM116A	201627	broad.mit.edu	36	3	57621581	57621581	+	Silent	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:57621581A>G	uc003dja.1	-	c.645T>C	c.(643-645)CCT>CCC	p.P215P		NM_152678	NP_689891	Q8IWF6	F116A_HUMAN	hypothetical protein LOC201627	215										pancreas(1)	1														0.384615	73.399007	74.176556	25	40	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(55;0.000621)|KIRC - Kidney renal clear cell carcinoma(284;0.0485)|Kidney(284;0.0607)	Silent	SNP	57621581	57621581	5604	3	A	G	G	7	7	FAM116A	G	4	4
C3orf67	200844	broad.mit.edu	36	3	58714568	58714568	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:58714568C>T	uc003dkt.1	-	c.1547G>A	c.(1546-1548)CGT>CAT	p.R516H	C3orf67_uc003dkr.1_Non-coding_Transcript|C3orf67_uc003dks.1_Missense_Mutation_p.R457H	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	508											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)												0.355372	119.685299	121.91778	43	78	CC		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)	Missense_Mutation	SNP	58714568	58714568	2334	3	C	T	T	19	19	C3orf67	T	1	1
PPP4R2	151987	broad.mit.edu	36	3	73196796	73196796	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:73196796C>T	uc003dph.1	+	c.742C>T	c.(742-744)CTC>TTC	p.L248F	PPP4R2_uc003dpi.1_Missense_Mutation_p.L191F	NM_174907	NP_777567	Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	248					mRNA processing|protein modification process|RNA splicing	centrosome|nucleus	protein binding			lung(1)	1		Prostate(10;0.0187)|Lung SC(41;0.236)												0.377049	137.617785	139.237281	46	76	CC		KEEP	---	---	---	---	capture		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)	Missense_Mutation	SNP	73196796	73196796	12840	3	C	T	T	20	20	PPP4R2	T	2	2
CLNK	116449	broad.mit.edu	36	4	10176869	10176869	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:10176869T>C	uc003gmo.2	-	c.154A>G	c.(154-156)AGA>GGA	p.R52G	CLNK_uc003gmp.2_Missense_Mutation_p.R10G	NM_052964	NP_443196	Q7Z7G1	CLNK_HUMAN	mast cell immunoreceptor signal transducer	52					immune response|intracellular signal transduction	intracellular	SH3/SH2 adaptor activity			ovary(1)	1						GBM(87;402 1286 6949 13902 35851)								0.403175	437.955431	440.539572	127	188	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10176869	10176869	3685	4	T	C	C	56	56	CLNK	C	4	4
ENPEP	2028	broad.mit.edu	36	4	111683675	111683675	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:111683675G>T	uc003iab.2	+	c.2000G>T	c.(1999-2001)AGA>ATA	p.R667I		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	667	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(203;0.217)			L-Glutamic Acid(DB00142)									0.375969	287.632159	291.108044	97	161	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	Missense_Mutation	SNP	111683675	111683675	5321	4	G	T	T	35	35	ENPEP	T	3	3
OTOP1	133060	broad.mit.edu	36	4	4279319	4279319	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:4279319G>A	uc003ghp.1	-	c.174C>T	c.(172-174)GCC>GCT	p.A58A		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	58					biomineral tissue development	extracellular space|integral to membrane				ovary(2)	2														0.235294	10.191126	11.280645	4	13	GG		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (64;0.168)	Silent	SNP	4279319	4279319	11717	4	G	A	A	39	39	OTOP1	A	1	1
CHSY3	337876	broad.mit.edu	36	5	129271914	129271914	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:129271914C>T	uc003kvd.1	+	c.1048C>T	c.(1048-1050)CGC>TGC	p.R350C		NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	350	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)												0.414894	117.57035	118.147645	39	55	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)	Missense_Mutation	SNP	129271914	129271914	3547	5	C	T	T	31	31	CHSY3	T	1	1
CSNK1A1	1452	broad.mit.edu	36	5	148909923	148909923	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:148909923C>T	uc003lqw.1	-	c.138G>A	c.(136-138)AAG>AAA	p.K46K	CSNK1A1_uc003lqv.1_5'UTR|CSNK1A1_uc003lqx.1_Silent_p.K46K|CSNK1A1_uc010jha.1_Silent_p.K46K|CSNK1A1_uc003lqy.1_Silent_p.K46K	NM_001025105	NP_001020276	P48729	KC1A_HUMAN	casein kinase 1, alpha 1 isoform 1	46	Protein kinase.	ATP (By similarity).			cell division|mitosis|protein phosphorylation|Wnt receptor signaling pathway	condensed chromosome kinetochore|cytosol|microtubule organizing center|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1						Colon(5;64 69 1309 10383)				149				0.308571	144.279709	149.998046	54	121	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)	Silent	SNP	148909923	148909923	4091	5	C	T	T	28	28	CSNK1A1	T	2	2
BRIX1	55299	broad.mit.edu	36	5	34960748	34960748	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:34960748C>G	uc003jja.1	+	c.703C>G	c.(703-705)CGT>GGT	p.R235G		NM_018321	NP_060791	Q8TDN6	BRX1_HUMAN	BRIX	235	Brix.				ribosome biogenesis|translation	nucleolus	aminoacyl-tRNA ligase activity|ATP binding|protein binding				0														0.369369	142.364352	144.021827	41	70	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34960748	34960748	1546	5	C	G	G	31	31	BRIX1	G	3	3
SYNE1	23345	broad.mit.edu	36	6	152693744	152693744	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:152693744T>C	uc010kiw.1	-	c.13769A>G	c.(13768-13770)AAC>AGC	p.N4590S	SYNE1_uc003qot.2_Missense_Mutation_p.N4519S|SYNE1_uc003qou.2_Missense_Mutation_p.N4590S|SYNE1_uc010kiz.1_Missense_Mutation_p.N345S	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4590	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|ovary(8)|large_intestine(5)|pancreas(2)	30		Ovarian(120;0.0955)												0.361582	433.916773	439.880808	128	226	TT		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)	Missense_Mutation	SNP	152693744	152693744	15966	6	T	C	C	60	60	SYNE1	C	4	4
SRPK1	6732	broad.mit.edu	36	6	35963807	35963807	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:35963807G>C	uc003olj.1	-	c.362C>G	c.(361-363)GCA>GGA	p.A121G	SRPK1_uc003olh.1_Missense_Mutation_p.A14G|SRPK1_uc003oli.1_Missense_Mutation_p.A14G	NM_003137	NP_003128	Q96SB4	SRPK1_HUMAN	SFRS protein kinase 1	121	Protein kinase.				cell differentiation|chromosome segregation|innate immune response|interspecies interaction between organisms|intracellular protein kinase cascade|mRNA processing|negative regulation of viral genome replication|positive regulation of viral genome replication|protein phosphorylation|regulation of mRNA processing|RNA splicing	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						NSCLC(31;67 978 16289 24856 26454)				211				0.363636	41.391914	41.931499	12	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35963807	35963807	15673	6	G	C	C	46	46	SRPK1	C	3	3
CDKN1A	1026	broad.mit.edu	36	6	36760115	36760115	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:36760115G>A	uc003omm.2	+	c.259G>A	c.(259-261)GAT>AAT	p.D87N	CDKN1A_uc003oml.2_Missense_Mutation_p.D87N|CDKN1A_uc003omn.1_Missense_Mutation_p.D87N	NM_000389	NP_510867	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A	87					cell cycle arrest|cellular response to extracellular stimulus|cellular response to ionizing radiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|induction of apoptosis by intracellular signals|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of fibroblast proliferation|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|S phase of mitotic cell cycle|stress-induced premature senescence	cyclin-dependent protein kinase holoenzyme complex|cytosol|nucleoplasm|PCNA-p21 complex	cyclin-dependent protein kinase inhibitor activity|metal ion binding			ovary(1)	1										54				0.386364	47.656526	48.157015	17	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36760115	36760115	3287	6	G	A	A	41	41	CDKN1A	A	2	2
PKHD1	5314	broad.mit.edu	36	6	52018807	52018807	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:52018807G>T	uc003pah.1	-	c.2546C>A	c.(2545-2547)ACC>AAC	p.T849N	PKHD1_uc003pai.1_Missense_Mutation_p.T849N	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	849	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			ovary(12)|large_intestine(5)|central_nervous_system(3)	20	Lung NSC(77;0.0605)									1537				0.102804	7.64941	24.467209	11	96	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52018807	52018807	12396	6	G	T	T	44	44	PKHD1	T	3	3
DSP	1832	broad.mit.edu	36	6	7514462	7514462	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7514462C>T	uc003mxp.1	+	c.1464C>T	c.(1462-1464)AAC>AAT	p.N488N	DSP_uc003mxq.1_Silent_p.N488N	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	488	Globular 1.|Interacts with plakophilin 1 and junction plakoglobin.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)	8	Ovarian(93;0.0584)	all_hematologic(90;0.236)												0.3	109.96638	114.989459	42	98	CC		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(45;0.000508)	Silent	SNP	7514462	7514462	4965	6	C	T	T	19	19	DSP	T	1	1
HECW1	23072	broad.mit.edu	36	7	43451648	43451648	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:43451648G>A	uc003tid.1	+	c.2352G>A	c.(2350-2352)CCG>CCA	p.P784P		NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	784					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(7)|breast(2)|skin(2)|pancreas(1)|lung(1)	13										944				0.153846	11.023446	15.492653	6	33	GG		KEEP	---	---	---	---	capture			Silent	SNP	43451648	43451648	7325	7	G	A	A	39	39	HECW1	A	1	1
GNAT3	346562	broad.mit.edu	36	7	79929763	79929763	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:79929763G>A	uc010leb.1	-	c.711C>T	c.(709-711)GAC>GAT	p.D237D	CD36_uc003uhc.1_Intron	NM_001102386	NP_001095856	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha	237					detection of chemical stimulus involved in sensory perception of bitter taste|G-protein signaling, coupled to cAMP nucleotide second messenger|rhodopsin mediated phototransduction|sensory perception of sweet taste|sensory perception of umami taste	cytoplasm|heterotrimeric G-protein complex|photoreceptor inner segment|photoreceptor outer segment	G-protein beta/gamma-subunit complex binding|G-protein-coupled receptor binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1														0.248996	158.884705	173.114335	62	187	GG		KEEP	---	---	---	---	capture			Silent	SNP	79929763	79929763	6782	7	G	A	A	40	40	GNAT3	A	1	1
SEMA3C	10512	broad.mit.edu	36	7	80216190	80216190	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:80216190A>G	uc003uhj.1	-	c.1802T>C	c.(1801-1803)ATC>ACC	p.I601T		NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C	601	Ig-like C2-type.				immune response|response to drug	membrane	receptor activity			ovary(1)	1														0.314286	277.813421	286.398007	88	192	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80216190	80216190	14512	7	A	G	G	12	12	SEMA3C	G	4	4
CACNA2D1	781	broad.mit.edu	36	7	81473054	81473054	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:81473054G>C	uc003uhr.1	-	c.1478C>G	c.(1477-1479)TCT>TGT	p.S493C		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	493	Extracellular (Potential).|Cache.					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)									0.294118	141.507828	147.315818	45	108	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	81473054	81473054	2664	7	G	C	C	33	33	CACNA2D1	C	3	3
RGS22	26166	broad.mit.edu	36	8	101128916	101128916	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:101128916G>A	uc003yjb.1	-	c.1774C>T	c.(1774-1776)CGG>TGG	p.R592W	RGS22_uc003yja.1_Missense_Mutation_p.R411W|RGS22_uc003yjc.1_Missense_Mutation_p.R580W|RGS22_uc010mbo.1_Non-coding_Transcript	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	592					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|breast(1)|central_nervous_system(1)	5										790				0.414634	199.681161	200.721404	68	96	GG		KEEP	---	---	---	---	capture	Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)		Missense_Mutation	SNP	101128916	101128916	13779	8	G	A	A	38	38	RGS22	A	1	1
FAM83A	84985	broad.mit.edu	36	8	124275504	124275504	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:124275504C>T	uc003ypv.1	+	c.708C>T	c.(706-708)TTC>TTT	p.F236F	FAM83A_uc003ypw.1_Silent_p.F236F|FAM83A_uc003ypy.2_Silent_p.F180F|FAM83A_uc003ypx.1_Silent_p.F236F|FAM83A_uc003ypz.1_Silent_p.F236F	NM_032899	NP_116288	Q86UY5	FA83A_HUMAN	hypothetical protein LOC84985 isoform a	236										ovary(3)|skin(1)	4	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)													0.423077	132.143745	132.688169	44	60	CC		KEEP	---	---	---	---	capture	STAD - Stomach adenocarcinoma(47;0.00527)		Silent	SNP	124275504	124275504	5859	8	C	T	T	31	31	FAM83A	T	1	1
WRN	7486	broad.mit.edu	36	8	31097310	31097310	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:31097310G>C	uc003xio.2	+	c.2458G>C	c.(2458-2460)GCT>CCT	p.A820P	WRN_uc010lvk.1_Missense_Mutation_p.A287P	NM_000553	NP_000544	Q14191	WRN_HUMAN	Werner syndrome protein	820	Helicase C-terminal.				base-excision repair|cellular response to starvation|DNA recombination|DNA synthesis involved in DNA repair|multicellular organismal aging|nucleolus to nucleoplasm transport|positive regulation of hydrolase activity|regulation of apoptosis|replication fork processing|response to oxidative stress|response to UV-C|telomere maintenance	centrosome|nucleolus|nucleoplasm	3'-5' exonuclease activity|ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|four-way junction helicase activity|G-quadruplex DNA binding|magnesium ion binding|manganese ion binding|protein complex binding|protein homodimerization activity|Y-form DNA binding			ovary(2)|kidney(2)|large_intestine(1)	5		Breast(100;0.195)				Ovarian(18;161 598 2706 14834 27543)				832				0.384	468.02138	472.43884	144	231	GG		KEEP	---	---	---	---	capture		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)	Missense_Mutation	SNP	31097310	31097310	17976	8	G	C	C	34	34	WRN	C	3	3
SDC2	6383	broad.mit.edu	36	8	97683906	97683906	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:97683906C>G	uc003yhv.1	+	c.280C>G	c.(280-282)CAG>GAG	p.Q94E		NM_002998	NP_002989	P34741	SDC2_HUMAN	syndecan 2 precursor	94	Extracellular (Potential).					integral to plasma membrane	cytoskeletal protein binding|PDZ domain binding			ovary(2)	2	Breast(36;3.41e-05)				Sargramostim(DB00020)									0.3125	164.492838	169.499428	50	110	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97683906	97683906	14437	8	C	G	G	17	17	SDC2	G	3	3
FAM70A	55026	broad.mit.edu	36	X	119294903	119294903	+	Silent	SNP	G	A	A			TCGA-06-2558-01	TCGA-06-2558-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:119294903G>A	uc004eso.2	-	c.612C>T	c.(610-612)TAC>TAT	p.Y204Y	FAM70A_uc004esp.2_Silent_p.Y180Y|FAM70A_uc010nqo.1_Intron	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	204						integral to membrane				lung(1)|breast(1)	2														0.307393	206.753653	215.240079	79	178	GG		KEEP	---	---	---	---	capture			Silent	SNP	119294903	119294903	5828	23	G	A	A	40	40	FAM70A	A	1	1
PIR	8544	broad.mit.edu	36	X	15419236	15419236	+	Silent	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:15419236C>T	uc004cwu.1	-	c.66G>A	c.(64-66)GCG>GCA	p.A22A	PIR_uc004cwv.1_Silent_p.A22A|BMX_uc004cww.1_Intron	NM_003662	NP_003653	O00625	PIR_HUMAN	pirin	22					oxidation-reduction process|transcription from RNA polymerase II promoter	cytoplasm|nucleus	metal ion binding|protein binding|quercetin 2,3-dioxygenase activity|transcription cofactor activity			ovary(1)	1	Hepatocellular(33;0.183)					Ovarian(180;1587 2015 10555 34192 51653)								0.365039	408.8371	415.072382	142	247	CC		KEEP	---	---	---	---	capture			Silent	SNP	15419236	15419236	12368	23	C	T	T	31	31	PIR	T	1	1
KLHL34	257240	broad.mit.edu	36	X	21585122	21585122	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:21585122C>T	uc004czz.1	-	c.706G>A	c.(706-708)GTG>ATG	p.V236M		NM_153270	NP_695002	Q8N239	KLH34_HUMAN	kelch-like 34	236	BACK.									ovary(1)	1														0.382353	34.96408	35.377496	13	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	21585122	21585122	8701	23	C	T	T	19	19	KLHL34	T	1	1
FAM47B	170062	broad.mit.edu	36	X	34872359	34872359	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:34872359A>T	uc004ddi.1	+	c.1490A>T	c.(1489-1491)AAG>ATG	p.K497M		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	497										ovary(3)|breast(1)	4														0.386598	219.777529	221.964907	75	119	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	34872359	34872359	5791	23	A	T	T	3	3	FAM47B	T	4	4
CXorf27	25763	broad.mit.edu	36	X	37735089	37735089	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:37735089A>T	uc004ddt.2	+	c.53A>T	c.(52-54)CAA>CTA	p.Q18L		NM_012274	NP_036406	O75409	HYPM_HUMAN	Huntingtin interacting protein M	18							DNA binding			central_nervous_system(1)	1														0.131148	10.45178	18.536268	8	53	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37735089	37735089	4265	23	A	T	T	5	5	CXorf27	T	4	4
BCOR	54880	broad.mit.edu	36	X	39806570	39806570	+	Silent	SNP	T	C	C			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:39806570T>C	uc004den.2	-	c.4194A>G	c.(4192-4194)AGA>AGG	p.R1398R	BCOR_uc004dep.2_Silent_p.R1364R|BCOR_uc004deo.2_Silent_p.R1346R|BCOR_uc010nhb.1_Silent_p.R106R|BCOR_uc004dem.2_Silent_p.R1364R	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	1398					chromatin modification|heart development|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|odontogenesis|palate development|protein ubiquitination|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|promoter binding|transcription corepressor activity|transcription factor binding			ovary(2)|kidney(1)|central_nervous_system(1)	4														0.294118	12.377001	13.016938	5	12	TT		KEEP	---	---	---	---	capture			Silent	SNP	39806570	39806570	1407	23	T	C	C	62	62	BCOR	C	4	4
DGKK	139189	broad.mit.edu	36	X	50151225	50151225	+	Silent	SNP	A	C	C			TCGA-06-2558-01	TCGA-06-2558-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:50151225A>C	uc010njr.1	-	c.1794T>G	c.(1792-1794)CCT>CCG	p.P598P		NM_001013742	NP_001013764	Q5KSL6	DGKK_HUMAN	diacylglycerol kinase kappa	598	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|diacylglycerol metabolic process|intracellular signal transduction|platelet activation|response to oxidative stress	cytoplasm|plasma membrane	ATP binding|diacylglycerol kinase activity|metal ion binding			ovary(1)|kidney(1)	2	Ovarian(276;0.236)													0.366366	340.117469	345.362915	122	211	AA		KEEP	---	---	---	---	capture			Silent	SNP	50151225	50151225	4651	23	A	C	C	11	11	DGKK	C	4	4
NAP1L2	4674	broad.mit.edu	36	X	72350255	72350255	+	Nonsense_Mutation	SNP	T	A	A			TCGA-06-2558-01	TCGA-06-2558-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:72350255T>A	uc004ebi.1	-	c.799A>T	c.(799-801)AAG>TAG	p.K267*		NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	267					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)													0.294521	107.142353	112.676361	43	103	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	72350255	72350255	10553	23	T	A	A	62	62	NAP1L2	A	5	4
PCDH11X	27328	broad.mit.edu	36	X	91019352	91019352	+	Missense_Mutation	SNP	C	T	T	rs62621113	unknown	TCGA-06-2558-01	TCGA-06-2558-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:91019352C>T	uc004efk.1	+	c.1457C>T	c.(1456-1458)ACG>ATG	p.T486M	PCDH11X_uc004efl.1_Missense_Mutation_p.T486M|PCDH11X_uc004efn.1_Missense_Mutation_p.T486M|PCDH11X_uc004efo.1_Missense_Mutation_p.T486M|PCDH11X_uc010nmv.1_Missense_Mutation_p.T486M|PCDH11X_uc004efm.1_Missense_Mutation_p.T486M|PCDH11X_uc004efh.1_Missense_Mutation_p.T486M|PCDH11X_uc004efj.1_Missense_Mutation_p.T486M	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	486	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						NSCLC(38;925 1092 2571 38200 45895)								0.174863	66.796802	85.038362	32	151	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	91019352	91019352	11928	23	C	T	T	19	19	PCDH11X	T	1	1
FMN2	56776	broad.mit.edu	36	1	238438174	238438206	+	In_Frame_Del	DEL	CCCAGAGTGGGCATACCCCCTCCGCCCCCACTT	-	-			TCGA-06-2558-01	TCGA-06-2558-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:238438174_238438206delCCCAGAGTGGGCATACCCCCTCCGCCCCCACTT	uc009xgl.1	+	c.3880_3912delCCCAGAGTGGGCATACCCCCTCCGCCCCCACTT	c.(3880-3912)CCCAGAGTGGGCATACCCCCTCCGCCCCCACTTdel	p.PRVGIPPPPPL1294del		NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1147_1157	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|large_intestine(1)|central_nervous_system(1)	9	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)							1289				0.40			4	6				---	---	---	---	capture_indel			In_Frame_Del	DEL	238438174	238438206	6192	1	CCCAGAGTGGGCATACCCCCTCCGCCCCCACTT	-	-	18	18	FMN2	-	5	5
FAM58A	92002	broad.mit.edu	36	X	152517671	152517672	+	Splice_Site_Ins	INS	-	C	C			TCGA-06-2558-01	TCGA-06-2558-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:152517671_152517672insC	uc004fhw.1	-	c.e2_splice_site			FAM58A_uc004fhv.1_5'Flank|FAM58A_uc010nug.1_Frame_Shift_Ins_p.A18fs	NM_152274	NP_689487			family with sequence similarity 58, member A								protein binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.50			6	6				---	---	---	---	capture_indel			Splice_Site_Ins	INS	152517671	152517672	5812	23	-	C	C	46	46	FAM58A	C	5	5
