Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
PFKP	5214	broad.mit.edu	36	10	3139409	3139410	+	Missense_Mutation	DNP	CG	TT	TT			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:3139409_3139410CG>TT	uc001igp.1	+	c.778_779CG>TT	c.(778-780)CGT>TTT	p.R260F	PFKP_uc001igq.1_Missense_Mutation_p.R252F|PFKP_uc009xhr.1_Missense_Mutation_p.R222F|PFKP_uc009xhs.1_Missense_Mutation_p.R44F|PFKP_uc009xht.1_5'Flank	NM_002627	NP_002618	Q01813	K6PP_HUMAN	phosphofructokinase, platelet	260					glycolysis	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|metal ion binding|protein binding			ovary(1)|lung(1)	2				GBM - Glioblastoma multiforme(1;0.000975)|all cancers(11;0.00351)|Epithelial(11;0.142)										0.8	8.695297	9.107992	4	1	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	3139409	3139410	12188	10	CG	TT	TT	23	23	PFKP	TT	1	1
C10orf18	54906	broad.mit.edu	36	10	5829487	5829487	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:5829487C>G	uc001iij.2	+	c.4097C>G	c.(4096-4098)CCA>CGA	p.P1366R	C10orf18_uc001iik.2_Missense_Mutation_p.P210R	NM_017782	NP_060252	Q5VWN6	CJ018_HUMAN	hypothetical protein LOC54906	1366										ovary(1)|central_nervous_system(1)	2														0.241379	10.099387	11.881034	7	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5829487	5829487	1633	10	C	G	G	21	21	C10orf18	G	3	3
C10orf54	64115	broad.mit.edu	36	10	73203201	73203201	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:73203201A>T	uc001jsd.1	-	c.2T>A	c.(1-3)ATG>AAG	p.M1K	CDH23_uc001jrx.2_Intron|C10orf54_uc001jse.1_5'UTR|C10orf54_uc009xqm.1_Missense_Mutation_p.M1K|C10orf54_uc001jsf.1_Missense_Mutation_p.M1K	NM_022153	NP_071436	Q9H7M9	GI24_HUMAN	platelet receptor Gi24	1						integral to membrane	receptor activity			ovary(1)|breast(1)|central_nervous_system(1)	3														0.6	6.621103	6.664006	3	2	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73203201	73203201	1644	10	A	T	T	8	8	C10orf54	T	4	4
VCL	7414	broad.mit.edu	36	10	75544665	75544665	+	Splice_Site_SNP	SNP	T	A	A			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:75544665T>A	uc001jwd.1	+	c.e21_splice_site			VCL_uc009xrr.1_Splice_Site_SNP|VCL_uc001jwe.1_Splice_Site_SNP	NM_014000	NP_054706			vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)													0.555556	29.848973	29.897382	10	8	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	75544665	75544665	17704	10	T	A	A	57	57	VCL	A	5	4
MYST4	23522	broad.mit.edu	36	10	76450968	76450968	+	Silent	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:76450968T>G	uc001jwn.1	+	c.2940T>G	c.(2938-2940)CTT>CTG	p.L980L	MYST4_uc001jwm.1_Silent_p.L688L|MYST4_uc001jwo.1_Silent_p.L688L|MYST4_uc001jwp.1_Silent_p.L797L	NM_012330	NP_036462	Q8WYB5	MYST4_HUMAN	MYST histone acetyltransferase (monocytic	980	Catalytic.|Interaction with BRPF1.				histone H3 acetylation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription activator activity|transcription factor binding|transcription repressor activity|zinc ion binding			central_nervous_system(5)|ovary(3)|breast(1)	9	all_cancers(46;0.0347)|all_epithelial(25;0.00236)|Prostate(51;0.0112)|Ovarian(15;0.0964)									319				0.173913	8.765956	13.399352	8	38	TT		KEEP	---	---	---	---	capture			Silent	SNP	76450968	76450968	10500	10	T	G	G	63	63	MYST4	G	4	4
PHLDB1	23187	broad.mit.edu	36	11	118032692	118032692	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118032692G>T	uc001ptr.1	+	c.4083G>T	c.(4081-4083)TGG>TGT	p.W1361C	PHLDB1_uc001pts.1_Missense_Mutation_p.W1361C|PHLDB1_uc001ptt.1_Missense_Mutation_p.W1303C|PHLDB1_uc001ptu.1_Non-coding_Transcript|PHLDB1_uc001ptv.1_Missense_Mutation_p.W1165C|PHLDB1_uc001ptw.1_Missense_Mutation_p.W705C|PHLDB1_uc009zai.1_Missense_Mutation_p.W386C|PHLDB1_uc001ptx.1_Missense_Mutation_p.W386C	NM_015157	NP_055972	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B,	1361	PH.										0	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)										0.288889	21.336315	23.149278	13	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118032692	118032692	12275	11	G	T	T	41	41	PHLDB1	T	3	3
LGR4	55366	broad.mit.edu	36	11	27359029	27359029	+	Silent	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:27359029G>A	uc001mrj.2	-	c.819C>T	c.(817-819)CTC>CTT	p.L273L	LGR4_uc001mrk.2_Silent_p.L249L	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled	273	Extracellular (Potential).|LRR 10.					integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1														0.153846	7.05819	13.037098	8	44	GG		KEEP	---	---	---	---	capture			Silent	SNP	27359029	27359029	9082	11	G	A	A	33	33	LGR4	A	2	2
ZP1	22917	broad.mit.edu	36	11	60395154	60395155	+	Missense_Mutation	DNP	CT	GG	GG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:60395154_60395155CT>GG	uc001nqd.1	+	c.975_976CT>GG	c.(973-978)GTCTTC>GTGGTC	p.F326V	ZP1_uc001nqe.1_Missense_Mutation_p.F33V	NM_207341	NP_997224	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1	326	Extracellular (Potential).|ZP.				single fertilization	integral to membrane|plasma membrane|proteinaceous extracellular matrix					0														0.241379	13.508365	15.28076	7	22	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	60395154	60395155	18819	11	CT	GG	GG	32	32	ZP1	GG	3	3
FADS2	9415	broad.mit.edu	36	11	61352507	61352507	+	Nonsense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61352507G>A	uc001nsl.1	+	c.69G>A	c.(67-69)TGG>TGA	p.W23*	FADS2_uc001nsj.2_Intron|FADS2_uc001nsk.2_Nonsense_Mutation_p.W23*	NM_004265	NP_004256	O95864	FADS2_HUMAN	fatty acid desaturase 2	23	Cytoplasmic (Potential).|Cytochrome b5 heme-binding.				electron transport chain|transport|unsaturated fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	heme binding			ovary(1)|pancreas(1)	2					Alpha-Linolenic Acid(DB00132)									0.277778	7.762498	8.566928	5	13	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	61352507	61352507	5563	11	G	A	A	43	43	FADS2	A	5	2
DEAF1	10522	broad.mit.edu	36	11	664751	664751	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:664751G>A	uc001lqq.1	-	c.1288C>T	c.(1288-1290)CCC>TCC	p.P430S	DEAF1_uc009ycf.1_Non-coding_Transcript	NM_021008	NP_066288	O75398	DEAF1_HUMAN	deformed epidermal autoregulatory factor 1	430	Pro-rich.				embryonic skeletal system development|germ cell development|neural tube closure|regulation of mammary gland epithelial cell proliferation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|cytoplasm|extracellular region|nucleus	protein binding|zinc ion binding				0		all_cancers(49;1.24e-08)|all_epithelial(84;1.87e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;1.76e-27)|Epithelial(43;8.42e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.55e-21)|BRCA - Breast invasive adenocarcinoma(625;4.83e-05)|Lung(200;0.0259)|LUSC - Lung squamous cell carcinoma(625;0.075)										0.638591	1321.357435	1332.389147	417	236	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	664751	664751	4551	11	G	A	A	44	44	DEAF1	A	2	2
PPFIBP2	8495	broad.mit.edu	36	11	7626955	7626955	+	Silent	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:7626955G>A	uc001mfj.2	+	c.1911G>A	c.(1909-1911)AGG>AGA	p.R637R	PPFIBP2_uc001mfk.1_Intron|PPFIBP2_uc001mfl.2_Silent_p.R494R|PPFIBP2_uc009yfj.1_Silent_p.R281R	NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2	637	SAM 2.				cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)										0.2	13.378218	18.006654	11	44	GG		KEEP	---	---	---	---	capture			Silent	SNP	7626955	7626955	12744	11	G	A	A	44	44	PPFIBP2	A	2	2
FZD10	11211	broad.mit.edu	36	12	129214469	129214469	+	Silent	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129214469C>A	uc001uii.1	+	c.1029C>A	c.(1027-1029)GGC>GGA	p.G343G		NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10	343	Cytoplasmic (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|regulation of gene-specific transcription from RNA polymerase II promoter|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			central_nervous_system(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)										0.225806	9.514475	11.656749	7	24	CC		KEEP	---	---	---	---	capture			Silent	SNP	129214469	129214469	6380	12	C	A	A	26	26	FZD10	A	3	3
DCP1B	196513	broad.mit.edu	36	12	1983795	1983795	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:1983795G>T	uc001qjx.1	-	c.64C>A	c.(64-66)CAG>AAG	p.Q22K		NM_152640	NP_689853	Q8IZD4	DCP1B_HUMAN	decapping enzyme Dcp1b	22					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|nucleus	hydrolase activity|protein binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00193)											0.25	6.38764	7.301363	4	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1983795	1983795	4470	12	G	T	T	46	46	DCP1B	T	3	3
TUBA1B	10376	broad.mit.edu	36	12	47808854	47808854	+	Silent	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47808854G>A	uc001rtm.1	-	c.510C>T	c.(508-510)TCC>TCT	p.S170S	TUBA1B_uc001rto.1_Silent_p.S135S|TUBA1B_uc001rtk.1_Silent_p.S135S|TUBA1B_uc001rtl.1_Silent_p.S135S|TUBA1B_uc001rtn.1_Silent_p.S17S	NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous	170					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0														0.1875	9.326225	12.261166	6	26	GG		KEEP	---	---	---	---	capture			Silent	SNP	47808854	47808854	17299	12	G	A	A	47	47	TUBA1B	A	2	2
TUBA1B	10376	broad.mit.edu	36	12	47808968	47808968	+	Silent	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:47808968A>G	uc001rtm.1	-	c.396T>C	c.(394-396)CTT>CTC	p.L132L	TUBA1B_uc001rto.1_Silent_p.L97L|TUBA1B_uc001rtk.1_Silent_p.L97L|TUBA1B_uc001rtl.1_Silent_p.L97L|TUBA1B_uc001rtn.1_5'UTR	NM_006082	NP_006073	P68363	TBA1B_HUMAN	tubulin, alpha, ubiquitous	132					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding				0														0.28	12.408763	13.501438	7	18	AA		KEEP	---	---	---	---	capture			Silent	SNP	47808968	47808968	17299	12	A	G	G	9	9	TUBA1B	G	4	4
NAB2	4665	broad.mit.edu	36	12	55771649	55771649	+	Silent	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55771649A>G	uc001smz.1	+	c.558A>G	c.(556-558)CCA>CCG	p.P186P		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	186					cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription corepressor activity|transcription repressor activity			ovary(1)	1														0.277778	9.464018	10.266679	5	13	AA		KEEP	---	---	---	---	capture			Silent	SNP	55771649	55771649	10527	12	A	G	G	7	7	NAB2	G	4	4
CAND1	55832	broad.mit.edu	36	12	65985918	65985918	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:65985918C>A	uc001stn.2	+	c.2203C>A	c.(2203-2205)CTC>ATC	p.L735I	CAND1_uc001sto.2_Missense_Mutation_p.L245I	NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein	735	HEAT 17.				cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)	1			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)										0.092593	6.996534	34.074424	15	147	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65985918	65985918	2732	12	C	A	A	32	32	CAND1	A	3	3
RASA3	22821	broad.mit.edu	36	13	113794779	113794779	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr13:113794779C>G	uc001vui.1	-	c.1560G>C	c.(1558-1560)CAG>CAC	p.Q520H	RASA3_uc001vuj.1_Missense_Mutation_p.Q137H	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	520	Ras-GAP.				intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(1)|skin(1)	2	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)							4289				0.428571	6.61988	6.65169	3	4	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	113794779	113794779	13522	13	C	G	G	32	32	RASA3	G	3	3
BRF1	2972	broad.mit.edu	36	14	104810215	104810215	+	Silent	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:104810215G>A	uc001yqp.2	-	c.327C>T	c.(325-327)ACC>ACT	p.T109T	BRF1_uc010axg.1_Silent_p.T82T|BRF1_uc001yqr.1_Silent_p.T109T	NM_001519	NP_663718	Q92994	TF3B_HUMAN	transcription initiation factor IIIB isoform 1	109	1.				regulation of transcription, DNA-dependent|rRNA transcription|transcription initiation from RNA polymerase III promoter|tRNA transcription	transcription factor TFIIIB complex	RNA polymerase III transcription factor activity|transcription activator activity|translation initiation factor activity|zinc ion binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)										0.186047	7.274413	11.26443	8	35	GG		KEEP	---	---	---	---	capture			Silent	SNP	104810215	104810215	1541	14	G	A	A	39	39	BRF1	A	1	1
MBIP	51562	broad.mit.edu	36	14	35859538	35859538	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:35859538G>C	uc001wtm.1	-	c.8C>G	c.(7-9)GCT>GGT	p.A3G	MBIP_uc001wtn.1_Missense_Mutation_p.A3G|MBIP_uc001wto.1_Missense_Mutation_p.A3G	NM_016586	NP_057670	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1 isoform 1	3					histone H3 acetylation|inactivation of MAPK activity involved in osmosensory signaling pathway	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm|nucleolus	identical protein binding|protein kinase inhibitor activity				0	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)						91				0.172414	6.451303	9.409876	5	24	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35859538	35859538	9737	14	G	C	C	34	34	MBIP	C	3	3
CDKL1	8814	broad.mit.edu	36	14	49879439	49879439	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:49879439C>A	uc010anu.1	-	c.2314G>T	c.(2314-2316)GTG>TTG	p.V772L	CDKL1_uc001wxz.1_Intron	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	Error:Variant_position_missing_in_Q00532_after_alignment					protein phosphorylation	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)	1	all_epithelial(31;0.000746)|Breast(41;0.0102)									153				0.4	10.932899	11.067536	6	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49879439	49879439	3282	14	C	A	A	18	18	CDKL1	A	3	3
PTPN21	11099	broad.mit.edu	36	14	88015836	88015836	+	Silent	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:88015836C>G	uc001xwv.2	-	c.1692G>C	c.(1690-1692)CGG>CGC	p.R564R		NM_007039	NP_008970	Q16825	PTN21_HUMAN	protein tyrosine phosphatase, non-receptor type	564						cytoplasm|cytoskeleton	binding|protein tyrosine phosphatase activity			ovary(3)	3														0.333333	8.207414	8.49696	4	8	CC		KEEP	---	---	---	---	capture			Silent	SNP	88015836	88015836	13243	14	C	G	G	26	26	PTPN21	G	3	3
ATP10A	57194	broad.mit.edu	36	15	23498171	23498171	+	Silent	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:23498171C>A	uc010ayu.1	-	c.2745G>T	c.(2743-2745)CTG>CTT	p.L915L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	915	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)						877				0.165289	38.321198	51.191939	20	101	CC		KEEP	---	---	---	---	capture			Silent	SNP	23498171	23498171	1135	15	C	A	A	29	29	ATP10A	A	3	3
SHF	90525	broad.mit.edu	36	15	43254765	43254765	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43254765T>C	uc001zuy.1	-	c.596A>G	c.(595-597)GAG>GGG	p.E199G	SHF_uc001zuv.1_Missense_Mutation_p.E264G|SHF_uc001zuw.1_Missense_Mutation_p.E264G|SHF_uc010bef.1_Missense_Mutation_p.E264G|SHF_uc001zux.1_Missense_Mutation_p.E264G|SHF_uc001zuz.1_Missense_Mutation_p.E264G	NM_138356	NP_612365	B3KTY1	B3KTY1_HUMAN	Src homology 2 domain containing F	199										ovary(1)	1		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)										0.230769	10.233408	11.964971	6	20	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43254765	43254765	14769	15	T	C	C	54	54	SHF	C	4	4
DYX1C1	161582	broad.mit.edu	36	15	53518987	53518987	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:53518987G>A	uc002adc.1	-	c.868C>T	c.(868-870)CCA>TCA	p.P290S	CCPG1_uc002acy.2_5'UTR|DYX1C1_uc002adb.1_Missense_Mutation_p.P290S|DYX1C1_uc002add.1_Missense_Mutation_p.P290S	NM_130810	NP_570722	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1 isoform a	290	TPR 1.				neuron migration|regulation of estrogen receptor signaling pathway|regulation of proteasomal protein catabolic process	cytoplasm|nucleus	estrogen receptor binding				0				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)										0.16129	13.95243	24.139755	15	78	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53518987	53518987	5048	15	G	A	A	43	43	DYX1C1	A	2	2
ZNF205	7755	broad.mit.edu	36	16	3109641	3109641	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3109641C>G	uc002cub.1	+	c.979C>G	c.(979-981)CGG>GGG	p.R327G	ZNF205_uc002cua.1_Missense_Mutation_p.R327G	NM_001042428	NP_003447	O95201	ZN205_HUMAN	zinc finger protein 205	327	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding				0														0.2	6.556051	8.657139	5	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3109641	3109641	18355	16	C	G	G	23	23	ZNF205	G	3	3
ZNF500	26048	broad.mit.edu	36	16	4742629	4742629	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4742629T>G	uc002cxp.1	-	c.1192A>C	c.(1192-1194)ATC>CTC	p.I398L	ZNF500_uc002cxo.1_Missense_Mutation_p.I190L	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	398	C2H2-type 3.				regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2														0.384615	10.768848	10.921369	5	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4742629	4742629	18542	16	T	G	G	51	51	ZNF500	G	4	4
WDR24	84219	broad.mit.edu	36	16	679260	679260	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:679260A>C	uc002ciz.1	-	c.382T>G	c.(382-384)TTC>GTC	p.F128V		NM_032259	NP_115635	Q96S15	WDR24_HUMAN	WD repeat domain 24	190	WD 2.									ovary(1)|central_nervous_system(1)	2		Hepatocellular(780;0.0218)												0.307692	7.090317	7.521966	4	9	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	679260	679260	17854	16	A	C	C	3	3	WDR24	C	4	4
PHLPP2	23035	broad.mit.edu	36	16	70241018	70241018	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr16:70241018T>C	uc002fax.1	-	c.3248A>G	c.(3247-3249)GAG>GGG	p.E1083G	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.1_Missense_Mutation_p.E1016G	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	1083						cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			central_nervous_system(1)	1														0.214286	10.132131	12.247178	6	22	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70241018	70241018	12279	16	T	C	C	54	54	PHLPP2	C	4	4
MYH4	4622	broad.mit.edu	36	17	10296300	10296300	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:10296300A>C	uc002gmn.1	-	c.3421T>G	c.(3421-3423)TCT>GCT	p.S1141A		NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1141	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|central_nervous_system(1)	11														0.163934	10.10859	16.668997	10	51	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10296300	10296300	10432	17	A	C	C	11	11	MYH4	C	4	4
INPP5K	51763	broad.mit.edu	36	17	1366528	1366528	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:1366528G>T	uc002fsr.1	-	c.16C>A	c.(16-18)CTG>ATG	p.L6M	INPP5K_uc002fsq.1_De_novo_Start_OutOfFrame|INPP5K_uc002fss.1_De_novo_Start_InFrame|INPP5K_uc010cjr.1_De_novo_Start_OutOfFrame|INPP5K_uc010cjs.1_Missense_Mutation_p.L6M	NM_016532	NP_570122	Q9BT40	INP5K_HUMAN	inositol polyphosphate-5-phosphatase K isoform	6					actin cytoskeleton organization	cytosol|endoplasmic reticulum|membrane fraction|neuron projection|ruffle	inositol 1,3,4,5-tetrakisphosphate 5-phosphatase activity|inositol bisphosphate phosphatase activity|inositol bisphosphate phosphatase activity|inositol trisphosphate phosphatase activity|inositol-1,4,5-trisphosphate 5-phosphatase activity|inositol-polyphosphate 5-phosphatase activity|lipid phosphatase activity|protein binding				0														0.222222	9.200014	10.471147	4	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1366528	1366528	8061	17	G	T	T	34	34	INPP5K	T	3	3
LYZL6	57151	broad.mit.edu	36	17	31288885	31288885	+	Silent	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:31288885T>G	uc002hkj.1	-	c.288A>C	c.(286-288)GTA>GTC	p.V96V	LYZL6_uc002hkk.1_Silent_p.V96V	NM_020426	NP_065159	O75951	LYZL6_HUMAN	lysozyme-like 6	96					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0				UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)										0.148936	16.154327	32.894904	21	120	TT		KEEP	---	---	---	---	capture			Silent	SNP	31288885	31288885	9511	17	T	G	G	53	53	LYZL6	G	4	4
TTC25	83538	broad.mit.edu	36	17	37345048	37345048	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:37345048G>A	uc002hyj.2	+	c.167G>A	c.(166-168)TGC>TAC	p.C56Y	TTC25_uc010cxt.1_Non-coding_Transcript|TTC25_uc010cxs.1_Missense_Mutation_p.C56Y	NM_031421	NP_113609	Q96NG3	TTC25_HUMAN	tetratricopeptide repeat domain 25	56	TPR 2.					cytoplasm	protein binding			ovary(1)	1		all_cancers(22;8.16e-06)|Breast(137;0.000143)|all_epithelial(22;0.000236)												0.16	7.86204	13.382763	8	42	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37345048	37345048	17247	17	G	A	A	46	46	TTC25	A	2	2
PLCD3	113026	broad.mit.edu	36	17	40550912	40550913	+	Nonsense_Mutation	DNP	TG	CA	CA			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:40550912_40550913TG>CA	uc002iib.1	-	c.1234_1235CA>TG	c.(1234-1236)CAA>TGA	p.Q412*		NM_133373	NP_588614	Q8N3E9	PLCD3_HUMAN	phospholipase C delta 3	412	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process	cleavage furrow|cytoplasm|membrane	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			breast(2)|lung(1)	3					Phosphatidylserine(DB00144)									0.444444	19.995238	20.043721	8	10	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	DNP	40550912	40550913	12458	17	TG	CA	CA	63	63	PLCD3	CA	5	4
DHX40	79665	broad.mit.edu	36	17	55020187	55020187	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:55020187A>C	uc002ixn.1	+	c.1573A>C	c.(1573-1575)ATT>CTT	p.I525L		NM_024612	NP_078888	Q8IX18	DHX40_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 40	525							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)													0.164179	9.96887	17.175949	11	56	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55020187	55020187	4691	17	A	C	C	8	8	DHX40	C	4	4
CCDC40	55036	broad.mit.edu	36	17	75646984	75646984	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:75646984C>T	uc010dht.1	+	c.1256C>T	c.(1255-1257)ACA>ATA	p.T419I	CCDC40_uc002jxm.2_Missense_Mutation_p.T202I	NM_017950	NP_060420	Q4G0X9	CCD40_HUMAN	coiled-coil domain containing 40	419	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium|cytoplasm				ovary(3)	3	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.149)											0.086111	9.144962	71.654465	31	329	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75646984	75646984	2934	17	C	T	T	17	17	CCDC40	T	2	2
TCEB3B	51224	broad.mit.edu	36	18	42815620	42815620	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:42815620G>A	uc002lcr.1	-	c.14C>T	c.(13-15)TCC>TTC	p.S5F	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.1_Intron|KATNAL2_uc002lcp.2_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	5	TFIIS N-terminal.				transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding|transcription elongation regulator activity			ovary(2)|large_intestine(1)|pancreas(1)	4														0.222222	12.94148	14.854931	6	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42815620	42815620	16208	18	G	A	A	41	41	TCEB3B	A	2	2
SYCE2	256126	broad.mit.edu	36	19	12871825	12871825	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:12871825G>C	uc002mvr.2	-	c.605C>G	c.(604-606)ACT>AGT	p.T202S		NM_001105578	NP_001099048	Q6PIF2	SYCE2_HUMAN	synaptonemal complex central element protein 2	202					cell division|meiotic prophase I	central element					0														0.176471	6.521524	9.889891	6	28	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12871825	12871825	15950	19	G	C	C	36	36	SYCE2	C	3	3
CC2D1A	54862	broad.mit.edu	36	19	13891667	13891667	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:13891667C>G	uc002mxo.1	+	c.1259C>G	c.(1258-1260)CCC>CGC	p.P420R	CC2D1A_uc002mxp.1_Missense_Mutation_p.P420R|CC2D1A_uc010dzh.1_Intron|CC2D1A_uc002mxq.1_Missense_Mutation_p.P65R|CC2D1A_uc002mxn.1_Missense_Mutation_p.P319R	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	420					positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)											0.217391	14.419505	17.818001	10	36	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13891667	13891667	2846	19	C	G	G	22	22	CC2D1A	G	3	3
OCEL1	79629	broad.mit.edu	36	19	17199724	17199724	+	Silent	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:17199724C>T	uc002nfp.1	+	c.528C>T	c.(526-528)TTC>TTT	p.F176F		NM_024578	NP_078854	Q9H607	OCEL1_HUMAN	occludin/ELL domain containing 1	176										central_nervous_system(1)	1														0.578947	318.936804	319.868452	99	72	CC		KEEP	---	---	---	---	capture			Silent	SNP	17199724	17199724	11221	19	C	T	T	32	32	OCEL1	T	2	2
PIK3R2	5296	broad.mit.edu	36	19	18139048	18139048	+	Silent	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:18139048C>A	uc002nia.1	+	c.1668C>A	c.(1666-1668)ATC>ATA	p.I556I	PIK3R2_uc002nib.1_Non-coding_Transcript|PIK3R2_uc010ebi.1_Non-coding_Transcript	NM_005027	NP_005018	O00459	P85B_HUMAN	phosphoinositide-3-kinase, regulatory subunit 2	556					fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|negative regulation of anti-apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|T cell costimulation|T cell receptor signaling pathway	phosphatidylinositol 3-kinase complex	GTPase activator activity|phosphatidylinositol 3-kinase regulator activity|protein binding			lung(2)|central_nervous_system(1)|pancreas(1)	4										186				0.148362	123.569121	185.192511	77	442	CC		KEEP	---	---	---	---	capture			Silent	SNP	18139048	18139048	12343	19	C	A	A	31	31	PIK3R2	A	3	3
SGTA	6449	broad.mit.edu	36	19	2714742	2714742	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2714742T>G	uc002lwi.1	-	c.406A>C	c.(406-408)AGC>CGC	p.S136R		NM_003021	NP_003012	O43765	SGTA_HUMAN	small glutamine-rich tetratricopeptide	136	TPR 2.				interspecies interaction between organisms	cytoplasm	protein binding			ovary(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.363636	8.392284	8.573987	4	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2714742	2714742	14716	19	T	G	G	55	55	SGTA	G	4	4
TLE2	7089	broad.mit.edu	36	19	2953468	2953468	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:2953468A>T	uc010dth.1	-	c.1933T>A	c.(1933-1935)TGG>AGG	p.W645R	TLE2_uc002lww.1_Missense_Mutation_p.W644R|TLE2_uc010dti.1_Missense_Mutation_p.W658R	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1	644					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)										0.444444	8.293962	8.318727	4	5	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2953468	2953468	16469	19	A	T	T	7	7	TLE2	T	4	4
ZNF599	148103	broad.mit.edu	36	19	39950112	39950112	+	Nonsense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:39950112C>A	uc010edn.1	-	c.190G>T	c.(190-192)GGA>TGA	p.G64*	ZNF599_uc010edm.1_Nonsense_Mutation_p.G27*|ZNF599_uc010edo.1_Nonsense_Mutation_p.G64*	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	zinc finger protein 599	64	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)											0.186084	250.166293	307.255574	115	503	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	39950112	39950112	18624	19	C	A	A	21	21	ZNF599	A	5	3
MYH14	79784	broad.mit.edu	36	19	55418315	55418315	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:55418315G>A	uc010enu.1	+	c.e5_splice_site			MYH14_uc002prq.1_Splice_Site_SNP|MYH14_uc002prr.1_Splice_Site_SNP	NM_001077186	NP_001070654			myosin, heavy chain 14 isoform 1						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)										0.666667	6.951765	7.024685	2	1	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	55418315	55418315	10428	19	G	A	A	36	36	MYH14	A	5	2
TIMM44	10469	broad.mit.edu	36	19	7898117	7898117	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:7898117C>A	uc002miz.1	-	c.1314G>T	c.(1312-1314)TGG>TGT	p.W438C	CTXN1_uc002miy.2_5'Flank|CTXN1_uc010dvw.1_5'Flank|TIMM44_uc002mja.1_Missense_Mutation_p.W178C	NM_006351	NP_006342	O43615	TIM44_HUMAN	translocase of inner mitochondrial membrane 44	438					protein targeting to mitochondrion	mitochondrial inner membrane presequence translocase complex|mitochondrial matrix	ATP binding|P-P-bond-hydrolysis-driven protein transmembrane transporter activity			ovary(1)	1														0.277778	8.280994	9.073801	5	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7898117	7898117	16441	19	C	A	A	26	26	TIMM44	A	3	3
MUC16	94025	broad.mit.edu	36	19	8827706	8827706	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8827706C>T	uc002mkp.1	-	c.43247G>A	c.(43246-43248)CGG>CAG	p.R14416Q	MUC16_uc010dwh.1_Non-coding_Transcript|MUC16_uc010dwi.1_Non-coding_Transcript|MUC16_uc010dwj.1_Missense_Mutation_p.R1216Q	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	14514	SEA 16.|Extracellular (Potential).			Missing (in Ref. 3; AAK74120).	cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			ovary(15)|large_intestine(1)|pancreas(1)|breast(1)|skin(1)	19														0.421569	129.204881	129.752252	43	59	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8827706	8827706	10367	19	C	T	T	23	23	MUC16	T	1	1
ATP1A1	476	broad.mit.edu	36	1	116731457	116731457	+	Nonsense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:116731457G>T	uc001ege.1	+	c.208G>T	c.(208-210)GAG>TAG	p.E70*	ATP1A1_uc001egf.1_Nonsense_Mutation_p.E70*	NM_000701	NP_000692	P05023	AT1A1_HUMAN	Na+/K+ -ATPase alpha 1 subunit isoform a	70	Cytoplasmic (Potential).				ATP biosynthetic process	melanosome|sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|protein binding|sodium:potassium-exchanging ATPase activity			ovary(1)	1	Lung SC(450;0.225)	all_cancers(81;1.28e-06)|all_epithelial(167;3.48e-07)|all_lung(203;2.64e-06)|Lung NSC(69;1.98e-05)		Lung(183;0.0164)|LUSC - Lung squamous cell carcinoma(189;0.0548)|Colorectal(144;0.0825)|COAD - Colon adenocarcinoma(174;0.127)|all cancers(265;0.24)	Acetyldigitoxin(DB00511)|Almitrine(DB01430)|Aluminium(DB01370)|Bepridil(DB01244)|Bretylium(DB01158)|Captopril(DB01197)|Deslanoside(DB01078)|Diazoxide(DB01119)|Digitoxin(DB01396)|Digoxin(DB00390)|Esomeprazole(DB00736)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Ouabain(DB01092)|Pantoprazole(DB00213)|Trichlormethiazide(DB01021)									0.183333	11.072771	16.751768	11	49	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	116731457	116731457	1147	1	G	T	T	45	45	ATP1A1	T	5	3
CGN	57530	broad.mit.edu	36	1	149769715	149769715	+	Nonsense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:149769715C>T	uc009wmw.1	+	c.2440C>T	c.(2440-2442)CAG>TAG	p.Q814*		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	808	Glu-rich.|Potential.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)											0.307692	6.690086	7.121971	4	9	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	149769715	149769715	3436	1	C	T	T	25	25	CGN	T	5	2
LCE3D	84648	broad.mit.edu	36	1	150818936	150818936	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150818936G>A	uc001fab.1	-	c.101C>T	c.(100-102)TCC>TTC	p.S34F	LCE3D_uc009wni.1_Missense_Mutation_p.S34F	NM_032563	NP_115952	Q9BYE3	LCE3D_HUMAN	late cornified envelope 3D	34					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)|KIRC - Kidney renal clear cell carcinoma(4;0.0323)|Kidney(5;0.0378)										0.166667	7.363541	12.439544	8	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150818936	150818936	8995	1	G	A	A	41	41	LCE3D	A	2	2
VSIG8	391123	broad.mit.edu	36	1	158092377	158092377	+	Silent	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:158092377G>T	uc001fuh.1	-	c.891C>A	c.(889-891)GGC>GGA	p.G297G	C1orf204_uc001fuf.1_5'Flank|C1orf204_uc001fug.1_5'Flank	NM_001013661	NP_001013683	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	297	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(1)	1	all_hematologic(112;0.0597)													0.8	9.298429	9.712298	4	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	158092377	158092377	17794	1	G	T	T	38	38	VSIG8	T	3	3
ZBTB37	84614	broad.mit.edu	36	1	172106817	172106817	+	Silent	SNP	T	C	C			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:172106817T>C	uc009wwp.1	+	c.831T>C	c.(829-831)GAT>GAC	p.D277D	ZBTB37_uc001gjp.1_Silent_p.D277D|ZBTB37_uc001gjq.2_Silent_p.D277D|ZBTB37_uc001gjr.1_Silent_p.D277D	NM_001122770	NP_001116242	Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37 isoform	277					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.186047	10.471997	14.452973	8	35	TT		KEEP	---	---	---	---	capture			Silent	SNP	172106817	172106817	18124	1	T	C	C	49	49	ZBTB37	C	4	4
KISS1	3814	broad.mit.edu	36	1	202426449	202426449	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:202426449C>T	uc001har.1	-	c.203G>A	c.(202-204)GGG>GAG	p.G68E		NM_002256	NP_002247	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	68					cytoskeleton organization	extracellular region	protein binding			ovary(1)	1	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)										0.6	6.325791	6.371322	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	202426449	202426449	8639	1	C	T	T	22	22	KISS1	T	2	2
WNT4	54361	broad.mit.edu	36	1	22319153	22319153	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:22319153C>G	uc001bfs.2	-	c.1033G>C	c.(1033-1035)GTG>CTG	p.V345L		NM_030761	NP_110388	P56705	WNT4_HUMAN	wingless-type MMTV integration site family,	345					adrenal gland development|androgen biosynthetic process|anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cellular response to transforming growth factor beta stimulus|dermatome development|endoderm development|epithelial to mesenchymal transition|establishment of protein localization in plasma membrane|female gonad development|female sex determination|liver development|male gonad development|mesonephric tubule development|metanephric mesenchymal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of fibroblast growth factor receptor signaling pathway|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of male gonad development|negative regulation of testicular blood vessel morphogenesis|negative regulation of testosterone biosynthetic process|oocyte development|paramesonephric duct development|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of collagen biosynthetic process|positive regulation of cortisol biosynthetic process|positive regulation of gene-specific transcription|positive regulation of osteoblast differentiation|protein palmitoylation|renal vesicle formation|smooth muscle cell differentiation|somatotropin secreting cell differentiation|tertiary branching involved in mammary gland duct morphogenesis|thyroid-stimulating hormone-secreting cell differentiation|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|extracellular space|Golgi apparatus|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|signal transducer activity|transcription activator activity|transcription corepressor activity			ovary(1)	1		Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;6.55e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;9.02e-26)|Colorectal(126;1.71e-07)|COAD - Colon adenocarcinoma(152;1.17e-05)|GBM - Glioblastoma multiforme(114;2.01e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000568)|KIRC - Kidney renal clear cell carcinoma(1967;0.00277)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)										0.173913	8.092964	10.395752	4	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22319153	22319153	17964	1	C	G	G	19	19	WNT4	G	3	3
EPHA8	2046	broad.mit.edu	36	1	22775377	22775378	+	Missense_Mutation	DNP	GA	TC	TC			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:22775377_22775378GA>TC	uc001bfx.1	+	c.240_241GA>TC	c.(238-243)CAGAAC>CATCAC	p.80_81QN>HH	EPHA8_uc001bfw.1_Missense_Mutation_p.80_81QN>HH	NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	80_81	Extracellular (Potential).				protein phosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|lung(2)|breast(2)|large_intestine(1)|stomach(1)|skin(1)	12		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)						520				0.271429	32.674992	35.989803	19	51	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	22775377	22775378	5366	1	GA	TC	TC	33	33	EPHA8	TC	3	3
ARID1A	8289	broad.mit.edu	36	1	26973424	26973424	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:26973424G>A	uc001bmv.1	+	c.4119G>A	c.(4117-4119)ATG>ATA	p.M1373I	ARID1A_uc001bmt.1_Missense_Mutation_p.M1372I|ARID1A_uc001bmu.1_Intron|ARID1A_uc001bmw.1_Missense_Mutation_p.M990I|ARID1A_uc001bmx.1_Missense_Mutation_p.M219I|ARID1A_uc009vsm.1_Intron|ARID1A_uc009vsn.1_5'UTR	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	1373	Gln-rich.				androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding|transcription activator activity			ovary(124)|endometrium(3)|kidney(3)|central_nervous_system(2)|pancreas(2)|lung(1)|skin(1)	136		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)						478				0.270386	497.439965	530.706574	189	510	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26973424	26973424	928	1	G	A	A	47	47	ARID1A	A	2	2
PTCH2	8643	broad.mit.edu	36	1	45065183	45065183	+	Silent	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:45065183G>A	uc001cms.1	-	c.2673C>T	c.(2671-2673)GAC>GAT	p.D891D		NM_003738	NP_003729	Q9Y6C5	PTC2_HUMAN	patched 2	891	Extracellular (Potential).				protein complex assembly|spermatogenesis	integral to plasma membrane	hedgehog receptor activity			lung(4)|breast(3)|central_nervous_system(3)|ovary(1)|skin(1)	12	Acute lymphoblastic leukemia(166;0.155)									193				0.36	205.343072	208.793962	72	128	GG		KEEP	---	---	---	---	capture			Silent	SNP	45065183	45065183	13185	1	G	A	A	48	48	PTCH2	A	2	2
CHD5	26038	broad.mit.edu	36	1	6119228	6119228	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:6119228G>A	uc001amb.1	-	c.2632C>T	c.(2632-2634)CCC>TCC	p.P878S	CHD5_uc001ama.1_Non-coding_Transcript|CHD5_uc001amc.1_Non-coding_Transcript|CHD5_uc009vlx.1_Non-coding_Transcript	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	878	Helicase ATP-binding.				chromatin assembly or disassembly|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|zinc ion binding			breast(3)|central_nervous_system(3)|ovary(1)|lung(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)						2304				0.123188	25.999837	45.154442	17	121	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6119228	6119228	3462	1	G	A	A	43	43	CHD5	A	2	2
INADL	10207	broad.mit.edu	36	1	62146637	62146637	+	Silent	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:62146637T>G	uc001dab.1	+	c.3387T>G	c.(3385-3387)TCT>TCG	p.S1129S	INADL_uc009waf.1_Silent_p.S1129S|INADL_uc001daa.2_Silent_p.S1129S|INADL_uc001dac.2_Non-coding_Transcript|INADL_uc001dad.2_Silent_p.S178S	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like	1129	PDZ 6.				intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)	3														0.162162	6.321325	10.350847	6	31	TT		KEEP	---	---	---	---	capture			Silent	SNP	62146637	62146637	8032	1	T	G	G	55	55	INADL	G	4	4
JAK1	3716	broad.mit.edu	36	1	65083105	65083105	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:65083105C>G	uc001dbu.1	-	c.2171G>C	c.(2170-2172)CGT>CCT	p.R724P	JAK1_uc009wam.1_Missense_Mutation_p.R724P|JAK1_uc009wal.1_5'UTR	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	724	Protein kinase 1.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity	p.R724H(5)|p.R724Q(1)		haematopoietic_and_lymphoid_tissue(30)|prostate(7)|soft_tissue(6)|lung(4)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|breast(1)|ovary(1)	55				BRCA - Breast invasive adenocarcinoma(111;0.0485)						1025				0.210526	15.863933	20.305045	12	45	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65083105	65083105	8241	1	C	G	G	19	19	JAK1	G	3	3
SYDE2	84144	broad.mit.edu	36	1	85421322	85421322	+	Missense_Mutation	SNP	T	C	C			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:85421322T>C	uc009wcm.1	-	c.1591A>G	c.(1591-1593)ATG>GTG	p.M531V	SYDE2_uc001dku.2_Missense_Mutation_p.M531V	NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	531					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)										0.393782	248.764617	250.668416	76	117	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85421322	85421322	15957	1	T	C	C	51	51	SYDE2	C	4	4
C1orf146	388649	broad.mit.edu	36	1	92482958	92482958	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:92482958C>A	uc001doq.1	+	c.364C>A	c.(364-366)CAC>AAC	p.H122N		NM_001012425	NP_001012425	Q5VVC0	CA146_HUMAN	hypothetical protein LOC388649	122										ovary(1)	1		all_lung(203;0.00528)|Lung NSC(277;0.0193)		all cancers(265;0.00846)|Epithelial(280;0.0952)										0.138889	16.90001	25.975243	10	62	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92482958	92482958	2070	1	C	A	A	17	17	C1orf146	A	3	3
TGM2	7052	broad.mit.edu	36	20	36201400	36201400	+	Silent	SNP	C	A	A	rs2229470	by-hapmap	TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:36201400C>A	uc002xhr.1	-	c.1170G>T	c.(1168-1170)GCG>GCT	p.A390A	TGM2_uc002xhs.1_Silent_p.A366A|TGM2_uc002xht.1_Silent_p.A390A	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	390					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)									0.138889	6.542859	20.217586	15	93	CC		KEEP	---	---	---	---	capture			Silent	SNP	36201400	36201400	16358	20	C	A	A	27	27	TGM2	A	3	3
PHACTR3	116154	broad.mit.edu	36	20	57763730	57763730	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:57763730C>G	uc002yau.1	+	c.457C>G	c.(457-459)CAG>GAG	p.Q153E	PHACTR3_uc002yat.1_Missense_Mutation_p.Q150E|PHACTR3_uc002yav.1_Missense_Mutation_p.Q112E|PHACTR3_uc002yaw.1_Missense_Mutation_p.Q112E|PHACTR3_uc002yax.1_Missense_Mutation_p.Q112E	NM_080672	NP_899067	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3 isoform 1	153						nuclear matrix	actin binding|protein phosphatase inhibitor activity			ovary(2)|pancreas(1)	3	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)											0.217391	6.555419	8.259555	5	18	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57763730	57763730	12234	20	C	G	G	21	21	PHACTR3	G	3	3
LAMA5	3911	broad.mit.edu	36	20	60336365	60336365	+	Silent	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:60336365G>C	uc002ycq.1	-	c.4749C>G	c.(4747-4749)GGC>GGG	p.G1583G		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5	1583	Laminin EGF-like 15.				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding|receptor activity|structural molecule activity			pancreas(1)	1	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.428571	12.540522	12.603881	6	8	GG		KEEP	---	---	---	---	capture			Silent	SNP	60336365	60336365	8932	20	G	C	C	46	46	LAMA5	C	3	3
OLIG1	116448	broad.mit.edu	36	21	33364851	33364851	+	Silent	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:33364851G>C	uc002yqz.1	+	c.381G>C	c.(379-381)GCG>GCC	p.A127A		NM_138983	NP_620450	Q8TAK6	OLIG1_HUMAN	oligodendrocyte transcription factor 1	143	Helix-loop-helix motif.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription regulator activity			central_nervous_system(1)	1														0.333333	8.995925	9.291173	4	8	GG		KEEP	---	---	---	---	capture			Silent	SNP	33364851	33364851	11265	21	G	C	C	38	38	OLIG1	C	3	3
CECR2	27443	broad.mit.edu	36	22	16362144	16362144	+	Silent	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:16362144C>G	uc010gqw.1	+	c.555C>G	c.(553-555)TCC>TCG	p.S185S	CECR2_uc010gqv.1_Silent_p.S64S|CECR2_uc002zml.2_Silent_p.S64S|CECR2_uc002zmm.1_Silent_p.S64S	NM_031413	NP_113601	Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	227					chromatin modification|cytokinesis|cytoskeleton organization|DNA fragmentation involved in apoptotic nuclear change|vesicle-mediated transport		protein binding			ovary(1)|skin(1)	2		all_epithelial(15;0.139)		Lung(27;0.146)										0.375	9.023761	9.133213	3	5	CC		KEEP	---	---	---	---	capture			Silent	SNP	16362144	16362144	3339	22	C	G	G	23	23	CECR2	G	3	3
MED15	51586	broad.mit.edu	36	22	19250818	19250819	+	Missense_Mutation	DNP	AG	TT	TT			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:19250818_19250819AG>TT	uc002zsp.1	+	c.755_756AG>TT	c.(754-756)CAG>CTT	p.Q252L	MED15_uc002zsq.1_Missense_Mutation_p.Q252L|MED15_uc010gso.1_Missense_Mutation_p.Q252L|MED15_uc002zsr.1_Missense_Mutation_p.Q226L|MED15_uc002zss.1_Missense_Mutation_p.Q171L	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a	252	Poly-Gln.			Missing (in Ref. 3; BAB85034).	regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding|RNA polymerase II transcription mediator activity				0	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)											0.75	6.924758	7.14775	3	1	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	19250818	19250819	9822	22	AG	TT	TT	7	7	MED15	TT	4	4
PISD	23761	broad.mit.edu	36	22	30345752	30345753	+	Missense_Mutation	DNP	TT	AA	AA			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:30345752_30345753TT>AA	uc003alm.2	-	c.1075_1076AA>TT	c.(1075-1077)AAT>TTT	p.N359F	PISD_uc003alk.1_Missense_Mutation_p.N325F|PISD_uc003all.1_3'UTR|PISD_uc003aln.2_Missense_Mutation_p.N321F	NM_014338	NP_055153	Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase	359					phospholipid biosynthetic process	mitochondrion	phosphatidylserine decarboxylase activity			ovary(1)|central_nervous_system(1)	2					Phosphatidylserine(DB00144)									0.294118	7.643289	8.305778	5	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	30345752	30345753	12370	22	TT	AA	AA	52	52	PISD	AA	4	4
MYH9	4627	broad.mit.edu	36	22	35048494	35048494	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:35048494G>C	uc003apg.1	-	c.631C>G	c.(631-633)CTG>GTG	p.L211V	MYH9_uc003aph.1_Missense_Mutation_p.L75V	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	211	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	10										1624				0.3	8.222347	8.57901	3	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35048494	35048494	10437	22	G	C	C	34	34	MYH9	C	3	3
SELO	83642	broad.mit.edu	36	22	48991336	48991336	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:48991336C>T	uc003bjx.1	+	c.1220C>T	c.(1219-1221)GCC>GTC	p.A407V	SELO_uc010hap.1_Missense_Mutation_p.A218V|SELO_uc003bjy.1_Missense_Mutation_p.A87V|SELO_uc003bjz.1_Missense_Mutation_p.A87V|SELO_uc010haq.1_5'Flank	NM_031454		Q9BVL4	SELO_HUMAN	selenoprotein O	407											0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)								OREG0026676	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.243243	13.148247	15.383146	9	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48991336	48991336	14504	22	C	T	T	26	26	SELO	T	2	2
HNMT	3176	broad.mit.edu	36	2	138444258	138444258	+	Splice_Site_SNP	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:138444258G>A	uc002tvc.1	+	c.e3_splice_site			HNMT_uc002tve.1_Splice_Site_SNP|HNMT_uc002tvf.1_Splice_Site_SNP	NM_006895	NP_008826			histamine N-methyltransferase isoform 1						respiratory gaseous exchange	cytoplasm	histamine N-methyltransferase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.125)	Amodiaquine(DB00613)|Histamine Phosphate(DB00667)|Quinacrine(DB01103)									0.2	10.700053	13.6378	7	28	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	138444258	138444258	7547	2	G	A	A	44	44	HNMT	A	5	2
HOXD8	3234	broad.mit.edu	36	2	176703683	176703683	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:176703683C>A	uc002uko.1	+	c.343C>A	c.(343-345)CCT>ACT	p.P115T	HOXD8_uc002ukn.1_Intron|HOXD8_uc002ukp.2_Missense_Mutation_p.P115T	NM_019558	NP_062458	P13378	HXD8_HUMAN	homeobox D8	115	Poly-Pro.				anterior/posterior axis specification, embryo	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)										0.233333	9.399317	11.365125	7	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	176703683	176703683	7617	2	C	A	A	30	30	HOXD8	A	3	3
TTN	7273	broad.mit.edu	36	2	179190183	179190183	+	Silent	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179190183A>G	uc002umr.1	-	c.40080T>C	c.(40078-40080)AAT>AAC	p.N13360N	TTN_uc002ums.1_Silent_p.N7055N|TTN_uc010frc.1_Silent_p.N6988N|TTN_uc010frd.1_Silent_p.N6863N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14287										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.428571	8.62387	8.655008	3	4	AA		KEEP	---	---	---	---	capture			Silent	SNP	179190183	179190183	17290	2	A	G	G	16	16	TTN	G	4	4
XDH	7498	broad.mit.edu	36	2	31456337	31456337	+	Missense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:31456337C>G	uc002rnv.1	-	c.1142G>C	c.(1141-1143)AGA>ACA	p.R381T		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	381	FAD-binding PCMH-type.				oxidation-reduction process|purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	Colon(66;682 1445 30109 40147)								0.162791	12.377688	21.714007	14	72	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31456337	31456337	18007	2	C	G	G	32	32	XDH	G	3	3
BIRC6	57448	broad.mit.edu	36	2	32458851	32458851	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:32458851A>G	uc010ezu.1	+	c.634A>G	c.(634-636)AAA>GAA	p.K212E		NM_016252	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat-containing 6	212					anti-apoptosis|apoptosis|post-translational protein modification	intracellular	acid-amino acid ligase activity|cysteine-type endopeptidase inhibitor activity|protein binding			ovary(5)|skin(4)|lung(2)|central_nervous_system(1)|breast(1)|pancreas(1)	14	Acute lymphoblastic leukemia(172;0.155)					Pancreas(94;175 1509 16028 18060 45422)				1555				0.393939	39.769083	40.09349	13	20	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32458851	32458851	1463	2	A	G	G	5	5	BIRC6	G	4	4
MSH6	2956	broad.mit.edu	36	2	47863968	47863969	+	Missense_Mutation	DNP	GC	AG	AG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:47863968_47863969GC>AG	uc002rwd.2	+	c.92_93GC>AG	c.(91-93)GGC>GAG	p.G31E	MSH6_uc002rwc.2_Missense_Mutation_p.G31E|MSH6_uc010fbj.1_5'UTR	NM_000179	NP_000170	P52701	MSH6_HUMAN	mutS homolog 6	31					determination of adult lifespan|DNA damage response, signal transduction resulting in induction of apoptosis|isotype switching|meiotic mismatch repair|negative regulation of DNA recombination|positive regulation of helicase activity|reciprocal meiotic recombination|response to UV|somatic hypermutation of immunoglobulin genes	MutSalpha complex	ATP binding|DNA-dependent ATPase activity|protein binding			large_intestine(53)|endometrium(28)|central_nervous_system(27)|stomach(21)|haematopoietic_and_lymphoid_tissue(9)|skin(6)|urinary_tract(5)|lung(5)|ovary(3)|breast(2)|thyroid(1)	160		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)							517				0.333333	6.323854	6.544335	3	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	47863968	47863969	10267	2	GC	AG	AG	42	42	MSH6	AG	2	2
RAB11FIP5	26056	broad.mit.edu	36	2	73169278	73169279	+	Missense_Mutation	DNP	CC	TG	TG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:73169278_73169279CC>TG	uc002siu.2	-	c.975_976GG>CA	c.(973-978)CAGGGC>CACAGC	p.325_326QG>HS	RAB11FIP5_uc002sit.2_Missense_Mutation_p.247_248QG>HS	NM_015470	NP_056285	Q9BXF6	RFIP5_HUMAN	RAB11 family interacting protein 5 (class I)	325_326					protein transport	mitochondrial outer membrane|recycling endosome membrane	gamma-tubulin binding				0														0.238095	7.359712	8.681967	5	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	73169278	73169279	13356	2	CC	TG	TG	22	22	RAB11FIP5	TG	2	2
TET3	200424	broad.mit.edu	36	2	74181961	74181961	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:74181961G>C	uc002skb.2	+	c.4133G>C	c.(4132-4134)TGG>TCG	p.W1378S		NM_144993	NP_659430	O43151	TET3_HUMAN	tet oncogene family member 3	1378					oxidation-reduction process		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0														0.222222	7.617535	9.558222	6	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74181961	74181961	16298	2	G	C	C	47	47	TET3	C	3	3
C3orf20	84077	broad.mit.edu	36	3	14745188	14745188	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:14745188G>T	uc003byy.1	+	c.1929G>T	c.(1927-1929)AAG>AAT	p.K643N	C3orf20_uc003byz.1_Missense_Mutation_p.K521N|C3orf20_uc003bza.1_Missense_Mutation_p.K521N|C3orf20_uc003bzb.1_Missense_Mutation_p.K144N	NM_032137	NP_115513	Q8ND61	CC020_HUMAN	hypothetical protein LOC84077	643						cytoplasm|integral to membrane				ovary(3)	3														0.131429	33.603757	56.729228	23	152	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14745188	14745188	2306	3	G	T	T	35	35	C3orf20	T	3	3
PLXNB1	5364	broad.mit.edu	36	3	48426447	48426447	+	Silent	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:48426447G>C	uc003csv.1	-	c.5649C>G	c.(5647-5649)CCC>CCG	p.P1883P	PLXNB1_uc003cst.1_Silent_p.P333P|PLXNB1_uc003csu.1_Silent_p.P1700P|PLXNB1_uc003csw.1_Silent_p.P1883P|PLXNB1_uc003csx.1_Silent_p.P1883P	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1	1883	Cytoplasmic (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)										0.210526	6.384953	7.863798	4	15	GG		KEEP	---	---	---	---	capture			Silent	SNP	48426447	48426447	12549	3	G	C	C	35	35	PLXNB1	C	3	3
BSN	8927	broad.mit.edu	36	3	49664231	49664231	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49664231C>A	uc003cxe.2	+	c.2238C>A	c.(2236-2238)AGC>AGA	p.S746R		NM_003458	NP_003449	Q9UPA5	BSN_HUMAN	bassoon protein	746					synaptic transmission	cell junction|cytoplasm|cytoskeleton|nucleus|synaptosome	zinc ion binding			ovary(5)|central_nervous_system(1)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)										0.173913	7.488738	9.795135	4	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49664231	49664231	1561	3	C	A	A	25	25	BSN	A	3	3
ZMYND10	51364	broad.mit.edu	36	3	50354349	50354349	+	Silent	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:50354349C>T	uc003dag.1	-	c.1017G>A	c.(1015-1017)GAG>GAA	p.E339E	RASSF1_uc003dad.1_5'Flank|RASSF1_uc003dae.1_5'Flank|RASSF1_uc010hlk.1_5'Flank|RASSF1_uc003daf.1_5'Flank|ZMYND10_uc010hll.1_Silent_p.E334E|ZMYND10_uc003dah.1_Silent_p.E260E	NM_015896	NP_056980	O75800	ZMY10_HUMAN	zinc finger, MYND domain-containing 10	339						cytoplasm	protein binding|zinc ion binding			lung(4)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)						203	TSP Lung(30;0.18)			0.333333	8.857105	9.232589	5	10	CC		KEEP	---	---	---	---	capture			Silent	SNP	50354349	50354349	18296	3	C	T	T	28	28	ZMYND10	T	2	2
GPR27	2850	broad.mit.edu	36	3	71886071	71886071	+	Missense_Mutation	SNP	T	A	A			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr3:71886071T>A	uc003doy.1	+	c.181T>A	c.(181-183)TGC>AGC	p.C61S	EIF4E3_uc003dox.1_5'Flank|EIF4E3_uc010hoc.1_Intron	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	61	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)										0.3	10.834645	11.554564	6	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71886071	71886071	6960	3	T	A	A	59	59	GPR27	A	4	4
KIAA1109	84162	broad.mit.edu	36	4	123471991	123471991	+	Silent	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:123471991C>G	uc003ieh.1	+	c.11310C>G	c.(11308-11310)CGC>CGG	p.R3770R	KIAA1109_uc003iem.1_Silent_p.R161R	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	hypothetical protein LOC84162	3770					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(7)|central_nervous_system(1)|pancreas(1)	9														0.854922	607.200128	630.588684	165	28	CC		KEEP	---	---	---	---	capture			Silent	SNP	123471991	123471991	8516	4	C	G	G	28	28	KIAA1109	G	3	3
SPATA5	166378	broad.mit.edu	36	4	124454547	124454547	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:124454547G>T	uc003iez.2	+	c.2560G>T	c.(2560-2562)GCC>TCC	p.A854S		NM_145207	NP_660208	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	854					cell differentiation|multicellular organismal development|spermatogenesis	mitochondrion	ATP binding|nucleoside-triphosphatase activity				0														0.130178	27.433082	49.932519	22	147	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	124454547	124454547	15521	4	G	T	T	34	34	SPATA5	T	3	3
FGG	2266	broad.mit.edu	36	4	155747466	155747466	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:155747466C>A	uc003iok.1	-	c.994G>T	c.(994-996)GAT>TAT	p.D332Y	FGG_uc003iog.1_Missense_Mutation_p.D324Y|FGG_uc003ioh.1_Missense_Mutation_p.D332Y|FGG_uc010ipx.1_Missense_Mutation_p.D152Y|FGG_uc010ipy.1_Missense_Mutation_p.D35Y|FGG_uc003ioi.1_Missense_Mutation_p.D35Y|FGG_uc003ioj.1_Missense_Mutation_p.D324Y	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	324	Fibrinogen C-terminal.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)									0.142069	159.134312	248.737804	103	622	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155747466	155747466	6107	4	C	A	A	29	29	FGG	A	3	3
ADAMTS3	9508	broad.mit.edu	36	4	73395705	73395705	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:73395705A>C	uc003hgk.1	-	c.1979T>G	c.(1978-1980)ATG>AGG	p.M660R	ADAMTS3_uc003hgl.2_Missense_Mutation_p.M1R	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	660	Cys-rich.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			NSCLC(168;1941 2048 2918 13048 43078)								0.121212	6.322699	20.272486	12	87	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73395705	73395705	268	4	A	C	C	8	8	ADAMTS3	C	4	4
SH3TC1	54436	broad.mit.edu	36	4	8279742	8279742	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:8279742A>C	uc003gkv.2	+	c.1421A>C	c.(1420-1422)GAC>GCC	p.D474A	SH3TC1_uc003gkw.2_Missense_Mutation_p.D398A|SH3TC1_uc003gkx.2_Non-coding_Transcript|SH3TC1_uc003gky.1_5'Flank	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	474							binding			large_intestine(2)|pancreas(1)	3						NSCLC(145;2298 2623 35616 37297)								0.5	6.728359	6.728359	3	3	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8279742	8279742	14753	4	A	C	C	10	10	SH3TC1	C	4	4
NR3C1	2908	broad.mit.edu	36	5	142759992	142759992	+	Silent	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:142759992C>A	uc003lmy.1	-	c.606G>T	c.(604-606)GGG>GGT	p.G202G	NR3C1_uc003lmz.1_Silent_p.G202G|NR3C1_uc003lna.1_Silent_p.G202G|NR3C1_uc003lnb.1_Silent_p.G202G|NR3C1_uc003lnc.1_Silent_p.G202G|NR3C1_uc003lnd.1_Silent_p.G202G|NR3C1_uc003lne.1_Silent_p.G202G|NR3C1_uc003lnf.1_Silent_p.G202G|NR3C1_uc003lng.2_Silent_p.G202G|NR3C1_uc003lnh.2_Silent_p.G202G|NR3C1_uc003lni.2_Silent_p.G202G	NM_001024094	NP_001019265	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1	202	Modulating.				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)					285				0.193548	8.52764	11.252618	6	25	CC		KEEP	---	---	---	---	capture			Silent	SNP	142759992	142759992	11035	5	C	A	A	18	18	NR3C1	A	3	3
FAT2	2196	broad.mit.edu	36	5	150905169	150905169	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr5:150905169A>T	uc003lue.2	-	c.5712T>A	c.(5710-5712)AAT>AAA	p.N1904K		NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1904	Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)	4		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)											0.118012	6.589282	29.745676	19	142	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150905169	150905169	5926	5	A	T	T	4	4	FAT2	T	4	4
CANX	821	broad.mit.edu	36	5	179068631	179068631	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:179068631G>A	uc003mkk.1	+	c.493G>A	c.(493-495)GTG>ATG	p.V165M	CANX_uc010jlb.1_Missense_Mutation_p.V101M|CANX_uc003mkl.1_Missense_Mutation_p.V165M	NM_001746	NP_001737	P27824	CALX_HUMAN	calnexin precursor	165	Lumenal (Potential).				post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|protein secretion	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane|melanosome	calcium ion binding|sugar binding|unfolded protein binding				0	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.143939	36.532791	52.648399	19	113	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179068631	179068631	2735	5	G	A	A	48	48	CANX	A	2	2
PDZD2	23037	broad.mit.edu	36	5	32123895	32123895	+	Silent	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:32123895C>T	uc003jhl.1	+	c.4584C>T	c.(4582-4584)AGC>AGT	p.S1528S	PDZD2_uc003jhm.1_Silent_p.S1528S	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1528					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|large_intestine(1)	7														0.205128	9.962818	13.129925	8	31	CC		KEEP	---	---	---	---	capture			Silent	SNP	32123895	32123895	12122	5	C	T	T	25	25	PDZD2	T	2	2
NIPBL	25836	broad.mit.edu	36	5	37084447	37084448	+	Missense_Mutation	DNP	TC	CA	CA			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:37084447_37084448TC>CA	uc003jkl.2	+	c.6676_6677TC>CA	c.(6676-6678)TCA>CAA	p.S2226Q	NIPBL_uc003jkk.2_Missense_Mutation_p.S2226Q|NIPBL_uc003jkn.1_5'Flank	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	2226					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of gene-specific transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding|transcription repressor activity			ovary(3)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	8	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)							934				0.176471	10.131266	13.485622	6	28	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	37084447	37084448	10829	5	TC	CA	CA	54	54	NIPBL	CA	4	4
C7	730	broad.mit.edu	36	5	40993909	40993909	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:40993909G>C	uc003jmh.1	+	c.1278G>C	c.(1276-1278)GAG>GAC	p.E426D		NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor	426	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)												0.25	9.562922	10.701958	5	15	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40993909	40993909	2482	5	G	C	C	34	34	C7	C	3	3
HOMER1	9456	broad.mit.edu	36	5	78770613	78770613	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:78770613T>G	uc003kfy.1	-	c.503A>C	c.(502-504)CAG>CCG	p.Q168P	HOMER1_uc010jab.1_Missense_Mutation_p.Q168P|HOMER1_uc010jac.1_Intron|HOMER1_uc010jad.1_Intron	NM_004272	NP_004263	Q86YM7	HOME1_HUMAN	homer 1	168					activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic density|postsynaptic membrane					0		Lung NSC(167;0.00131)|all_lung(232;0.00151)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.87e-44)|Epithelial(54;7.07e-41)|all cancers(79;5.5e-36)										0.146341	17.440415	37.278861	24	140	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78770613	78770613	7570	5	T	G	G	55	55	HOMER1	G	4	4
MICAL1	64780	broad.mit.edu	36	6	109873664	109873665	+	Splice_Site_DNP	DNP	CA	AC	AC			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:109873664_109873665CA>AC	uc003ptj.1	-	c.e19_splice_site			MICAL1_uc003ptk.1_Splice_Site_DNP|MICAL1_uc010kdr.1_Splice_Site_DNP	NM_022765	NP_073602			microtubule associated monoxygenase, calponin						cytoskeleton organization|oxidation-reduction process|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)										0.375	6.619788	6.730597	3	5	CC		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	109873664	109873665	9959	6	CA	AC	AC	29	29	MICAL1	AC	5	3
TIAM2	26230	broad.mit.edu	36	6	155492969	155492969	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:155492969A>T	uc003qqb.1	+	c.920A>T	c.(919-921)AAC>ATC	p.N307I	TIAM2_uc003qqd.1_Missense_Mutation_p.N307I|TIAM2_uc003qqe.1_Missense_Mutation_p.N307I	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	307					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)										0.205882	8.300017	11.040562	7	27	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	155492969	155492969	16419	6	A	T	T	2	2	TIAM2	T	4	4
WDR27	253769	broad.mit.edu	36	6	169793955	169793955	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:169793955G>T	uc010kkw.1	-	c.1477C>A	c.(1477-1479)CCA>ACA	p.P493T	WDR27_uc003qwv.1_Non-coding_Transcript|WDR27_uc003qwx.2_Missense_Mutation_p.P493T|WDR27_uc003qwy.2_Missense_Mutation_p.P366T	NM_182552	NP_872358	A2RRH5	WDR27_HUMAN	WD repeat domain 27	463										pancreas(1)	1		Breast(66;1.53e-05)|Ovarian(120;0.216)		OV - Ovarian serous cystadenocarcinoma(33;6.48e-20)|BRCA - Breast invasive adenocarcinoma(81;3.56e-07)|GBM - Glioblastoma multiforme(31;0.00168)										0.545455	14.143352	14.162464	6	5	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	169793955	169793955	17857	6	G	T	T	44	44	WDR27	T	3	3
PDCD2	5134	broad.mit.edu	36	6	170734762	170734762	+	Splice_Site_SNP	SNP	T	A	A			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:170734762T>A	uc003qxw.1	-	c.e2_splice_site			PDCD2_uc003qxv.1_Splice_Site_SNP|PDCD2_uc003qxx.1_Splice_Site_SNP|PDCD2_uc003qxy.1_Splice_Site_SNP|PDCD2_uc003qxz.1_Splice_Site_SNP|PDCD2_uc003qya.1_Splice_Site_SNP|PDCD2_uc003qyb.1_Intron	NM_002598	NP_002589			programmed cell death 2 isoform 1						apoptosis	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding				0		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		Colon(60;1476 1726 39478)								0.235294	7.389536	8.481761	4	13	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	170734762	170734762	12040	6	T	A	A	53	53	PDCD2	A	5	4
HLA-DRB5	3127	broad.mit.edu	36	6	32594369	32594369	+	Silent	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:32594369A>G	uc003obj.1	-	c.705T>C	c.(703-705)TTT>TTC	p.F235F	HLA-DRB5_uc003obk.2_Silent_p.F235F	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR	235	Helical; (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0														0.222222	10.891571	12.16824	4	14	AA		KEEP	---	---	---	---	capture			Silent	SNP	32594369	32594369	7500	6	A	G	G	5	5	HLA-DRB5	G	4	4
LEMD2	221496	broad.mit.edu	36	6	33864746	33864747	+	Missense_Mutation	DNP	GG	CT	CT			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:33864746_33864747GG>CT	uc003ofd.1	-	c.125_126CC>AG	c.(124-126)GCC>GAG	p.A42E	LEMD2_uc003ofe.1_5'UTR	NM_181336	NP_851853	Q8NC56	LEMD2_HUMAN	LEM domain containing 2 isoform 1	42	LEM.					integral to nuclear inner membrane				central_nervous_system(1)	1														0.428571	7.723745	7.754831	3	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	33864746	33864747	9044	6	GG	CT	CT	43	43	LEMD2	CT	3	3
BMP6	654	broad.mit.edu	36	6	7807712	7807712	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7807712C>T	uc003mxu.2	+	c.1186C>T	c.(1186-1188)CGG>TGG	p.R396W		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	396					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)													0.754386	297.794895	304.508959	86	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7807712	7807712	1489	6	C	T	T	27	27	BMP6	T	1	1
ME1	4199	broad.mit.edu	36	6	84004180	84004180	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:84004180A>C	uc003pjy.1	-	c.1001T>G	c.(1000-1002)GTT>GGT	p.V334G		NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1	334					carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|oxidation-reduction process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			ovary(1)	1		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)									0.173913	6.593965	8.897133	4	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	84004180	84004180	9806	6	A	C	C	2	2	ME1	C	4	4
PLOD3	8985	broad.mit.edu	36	7	100640403	100640403	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100640403G>C	uc003uyd.1	-	c.1543C>G	c.(1543-1545)CTC>GTC	p.L515V	PLOD3_uc010lhs.1_Missense_Mutation_p.L80V	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	515					oxidation-reduction process|protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)									0.259259	11.102453	12.529048	7	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100640403	100640403	12529	7	G	C	C	34	34	PLOD3	C	3	3
BRAF	673	broad.mit.edu	36	7	140099605	140099605	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:140099605A>T	uc003vwc.2	-	c.1799T>A	c.(1798-1800)GTG>GAG	p.V600E		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	600	Protein kinase.		V -> D (in a melanoma cell line; requires 2 nucleotide substitutions).|V -> E (in sarcoma, colorectal adenocarcinoma, metastatic melanoma, ovarian serous carcinoma, pilocytic astrocytoma; somatic mutation; most common mutation; constitutive and elevated kinase activity; efficiently induces cell transformation; suppression of mutation in melanoma causes growth arrest and promotes apoptosis).		activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding	p.V600E(15573)|p.V600?(188)|p.V600K(165)|p.V600R(36)|p.V600A(23)|p.V600D(21)|p.V600G(11)|p.V600_K601>E(8)|p.T599_R603>I(2)|p.V600_W604del(1)|p.V600L(1)|p.V600_S605>DV(1)|p.V600_S605>D(1)|p.T599_V600insV(1)|p.T599_V600insT(1)|p.T599_V600insDFGLAT(1)	KIAA1549/BRAF(211)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(7681)|large_intestine(4665)|skin(3221)|NS(366)|central_nervous_system(264)|ovary(219)|lung(77)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(27)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(16)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	16798	Melanoma(164;0.00956)				Sorafenib(DB00398)	Colon(40;35 892 2973 5743 27438)	V600E(UACC257_SKIN)|V600D(K029AX_SKIN)|V600E(HS695T_SKIN)|V600E(COLO679_SKIN)|V600E(BT474_BREAST)|V600E(IGR39_SKIN)|V600E(A101D_SKIN)|V600E(COLO783_SKIN)|V600E(IGR37_SKIN)|V600E(A375_SKIN)|V600E(WM793_SKIN)|V600E(COLO818_SKIN)|V600E(HS294T_SKIN)|V600E(SKMEL28_SKIN)|V600E(DU4475_BREAST)|V600E(SIGM5_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|V600E(IGR1_SKIN)|V600E(SKHEP1_LIVER)|V600E(WM983B_SKIN)|V600E(GCT_SOFT_TISSUE)|V600E(RVH421_SKIN)|V600D(WM2664_SKIN)|V600E(CL34_LARGE_INTESTINE)|V600E(SKMEL24_SKIN)|V600D(WM115_SKIN)|V600E(MALME3M_SKIN)|V600E(A673_BONE)|V600E(C32_SKIN)|V600E(DBTRG05MG_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO800_SKIN)|V600E(COLO741_SKIN)|V600E(HS939T_SKIN)|V600E(COLO205_LARGE_INTESTINE)|V600E(K029AX_SKIN)|V600E(AM38_CENTRAL_NERVOUS_SYSTEM)|V600E(SH4_SKIN)|V600E(WM88_SKIN)|V600E(KG1C_CENTRAL_NERVOUS_SYSTEM)|V600E(COLO849_SKIN)|V600E(MELHO_SKIN)|V600E(BHT101_THYROID)|V600E(G361_SKIN)|V600E(UACC62_SKIN)|V600E(BCPAP_THYROID)|V600E(8505C_THYROID)|V600E(SW1417_LARGE_INTESTINE)|V600E(COLO829_SKIN)|V600E(RKO_LARGE_INTESTINE)|V600E(A2058_SKIN)|V600E(RPMI7951_SKIN)|V600E(OUMS23_LARGE_INTESTINE)|V600E(SKMEL5_SKIN)|V600E(ES2_OVARY)|V600E(LOXIMVI_SKIN)	61	p.V600E(G361-Tumor)|p.V600E(HT144-Tumor)|p.V600E(MDAMB361-Tumor)|p.V600E(COLO783-Tumor)|p.V600E(COLO201-Tumor)|p.V600E(8505C-Tumor)|p.V600E(COLO205-Tumor)|p.V600E(A673-Tumor)|p.V600E(WM88-Tumor)|p.V600E(LOXIMVI-Tumor)|p.V600D(WM2664-Tumor)|p.V600K(MDST8-Tumor)|p.V600E(HT29-Tumor)|p.V600E(CL34-Tumor)|p.V600E(COLO818-Tumor)|p.V600E(COLO741-Tumor)|p.V600E(LS411N-Tumor)|p.V600E(SKMEL28-Tumor)|p.V600E(NMCG1-Tumor)|p.V600E(MELHO-Tumor)|p.V600E(WM983B-Tumor)|p.V600E(OUMS23-Tumor)|p.V600E(NCIH854-Tumor)|p.V600E(IGR39-Tumor)|p.V600E(SKHEP1-Tumor)|p.V600E(COLO679-Tumor)|p.V600E(SKMEL5-Tumor)|p.V600E(UACC257-Tumor)|p.V600E(HS695T-Tumor)|p.V600E(A375-Tumor)|p.V600E(MALME3M-Tumor)|p.V600E(AM38-Tumor)|p.V600E(SIGM5-Tumor)|p.V600E(DBTRG05MG-Tumor)|p.V600E(8305C-Tumor)|p.V600E(SKMEL24-Tumor)|p.V600E(WM793-Tumor)|p.V600E(BCPAP-Tumor)|p.V600D(WM115-Tumor)|p.V600E(SNUC5-Tumor)|p.V600E(GCT-Tumor)|p.V600E(ES2-Tumor)|p.V600E(SW1417-Tumor)|p.V600E(MDAMB435S-Tumor)|p.V600E(HS294T-Tumor)|p.V600E(DU4475-Tumor)|p.V600E(C32-Tumor)|p.V600E(A101D-Tumor)|p.V600E(COLO829-Tumor)|p.V600E(SKMEL3-Tumor)|p.V600E(SKMEL1-Tumor)|p.V600E(WM1799-Tumor)|p.V600E(RKO-Tumor)|p.V600E(IGR37-Tumor)|p.V600E(K029AX-Tumor)|p.V600E(JHOM2B-Tumor)|p.V600E(SH4-Tumor)	451				0.688742	355.323696	360.10858	104	47	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140099605	140099605	1527	7	A	T	T	6	6	BRAF	T	4	4
LMBR1	64327	broad.mit.edu	36	7	156173574	156173574	+	Missense_Mutation	SNP	G	C	C			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:156173574G>C	uc010lqn.1	-	c.1421C>G	c.(1420-1422)TCC>TGC	p.S474C	LMBR1_uc003wmv.2_Intron|LMBR1_uc003wmw.2_Missense_Mutation_p.S433C|LMBR1_uc003wmx.2_Missense_Mutation_p.S281C	NM_022458	NP_071903	Q8WVP7	LMBR1_HUMAN	limb region 1 protein	433	Helical; (Potential).					integral to membrane	receptor activity				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.208)										0.178571	11.404411	16.872774	10	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156173574	156173574	9169	7	G	C	C	41	41	LMBR1	C	3	3
NUPL2	11097	broad.mit.edu	36	7	23191219	23191219	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:23191219A>T	uc003svu.1	+	c.127A>T	c.(127-129)AAT>TAT	p.N43Y	NUPL2_uc003svv.1_Non-coding_Transcript|NUPL2_uc003svw.1_Intron|NUPL2_uc003svx.1_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	43					carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2														0.194444	7.797608	10.949697	7	29	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23191219	23191219	11180	7	A	T	T	13	13	NUPL2	T	4	4
FAM188B	84182	broad.mit.edu	36	7	30878427	30878427	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:30878427C>T	uc003tbt.1	+	c.1790C>T	c.(1789-1791)GCA>GTA	p.A597V	FAM188B_uc010kwe.1_Missense_Mutation_p.A568V|FAM188B_uc003tbu.1_Missense_Mutation_p.A117V	NM_032222	NP_115598	Q4G0A6	F188B_HUMAN	hypothetical protein LOC84182	597											0														0.173077	10.635738	15.899206	9	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30878427	30878427	5725	7	C	T	T	25	25	FAM188B	T	2	2
GET4	51608	broad.mit.edu	36	7	892220	892220	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:892220T>G	uc003sjl.1	+	c.157T>G	c.(157-159)TAC>GAC	p.Y53D	GET4_uc003sjj.1_Non-coding_Transcript	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608	53					tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0														0.238095	9.755279	11.083571	5	16	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	892220	892220	6604	7	T	G	G	57	57	GET4	G	4	4
LMTK2	22853	broad.mit.edu	36	7	97608731	97608731	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:97608731C>A	uc003upd.1	+	c.318C>A	c.(316-318)TTC>TTA	p.F106L		NM_014916	NP_055731	Q8IWU2	LMTK2_HUMAN	lemur tyrosine kinase 2	106					early endosome to late endosome transport|endocytic recycling|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation|receptor recycling|transferrin transport	early endosome|Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|recycling endosome	ATP binding|myosin VI binding|protein phosphatase inhibitor activity|protein serine/threonine kinase activity|protein tyrosine kinase activity			lung(8)|pancreas(2)|large_intestine(1)	11	all_cancers(62;3.23e-09)|all_epithelial(64;7.65e-10)|Lung NSC(181;0.00902)|all_lung(186;0.0104)|Esophageal squamous(72;0.0125)									547				0.131387	64.231949	118.637053	54	357	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97608731	97608731	9188	7	C	A	A	29	29	LMTK2	A	3	3
VPS13B	157680	broad.mit.edu	36	8	100583182	100583182	+	Missense_Mutation	SNP	G	A	A			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:100583182G>A	uc003yiv.1	+	c.3962G>A	c.(3961-3963)CGT>CAT	p.R1321H	VPS13B_uc003yiw.1_Missense_Mutation_p.R1321H|VPS13B_uc003yiu.1_Missense_Mutation_p.R1321H|VPS13B_uc003yix.1_Missense_Mutation_p.R791H	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	1321					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			Colon(161;2205 2542 7338 31318)			p.R1321H(NUGC3-Tumor)	1116				0.233766	96.023818	106.013221	36	118	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100583182	100583182	17757	8	G	A	A	40	40	VPS13B	A	1	1
EFR3A	23167	broad.mit.edu	36	8	133031396	133031396	+	Splice_Site_SNP	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:133031396A>T	uc003yte.1	+	c.e5_splice_site				NM_015137	NP_055952			EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)											0.263158	9.464179	10.430525	5	14	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	133031396	133031396	5146	8	A	T	T	15	15	EFR3A	T	5	4
ASAH1	427	broad.mit.edu	36	8	17964155	17964155	+	Silent	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:17964155C>T	uc003wyn.2	-	c.609G>A	c.(607-609)GTG>GTA	p.V203V	ASAH1_uc003wyl.2_Silent_p.V187V|ASAH1_uc010ltb.1_Non-coding_Transcript|ASAH1_uc003wym.2_Silent_p.V162V|ASAH1_uc003wyo.2_Silent_p.V181V	NM_004315	NP_004306	Q13510	ASAH1_HUMAN	N-acylsphingosine amidohydrolase 1 isoform b	187					ceramide metabolic process	lysosome	ceramidase activity				0				Colorectal(111;0.0646)|COAD - Colon adenocarcinoma(73;0.228)										0.139394	18.606073	39.380849	23	142	CC		KEEP	---	---	---	---	capture			Silent	SNP	17964155	17964155	1024	8	C	T	T	29	29	ASAH1	T	2	2
WHSC1L1	54904	broad.mit.edu	36	8	38255046	38255046	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr8:38255046T>G	uc003xli.1	-	c.3802A>C	c.(3802-3804)AAC>CAC	p.N1268H	WHSC1L1_uc010lwe.1_Missense_Mutation_p.N1219H|WHSC1L1_uc003xlh.1_Missense_Mutation_p.N47H	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	1268					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	histone-lysine N-methyltransferase activity|zinc ion binding				0	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)							521				0.30303	17.422426	18.575074	10	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38255046	38255046	17937	8	T	G	G	63	63	WHSC1L1	G	4	4
SLC20A2	6575	broad.mit.edu	36	8	42421359	42421360	+	Missense_Mutation	DNP	CA	GG	GG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:42421359_42421360CA>GG	uc010lxl.1	-	c.691_692TG>CC	c.(691-693)TGG>CCG	p.W231P	SLC20A2_uc010lxm.1_Missense_Mutation_p.W231P|SLC20A2_uc003xpe.1_Missense_Mutation_p.W231P	NM_006749	NP_006740	Q08357	S20A2_HUMAN	solute carrier family 20, member 2	231	Helical; (Potential).				interspecies interaction between organisms	integral to plasma membrane|membrane fraction	inorganic phosphate transmembrane transporter activity|receptor activity|sodium-dependent phosphate transmembrane transporter activity|sodium:phosphate symporter activity			ovary(2)	2	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)											0.184211	8.59659	12.163592	7	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	42421359	42421360	14935	8	CA	GG	GG	21	21	SLC20A2	GG	3	3
OTUD6B	51633	broad.mit.edu	36	8	92159938	92159938	+	Missense_Mutation	SNP	A	C	C			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:92159938A>C	uc003yeu.2	+	c.584A>C	c.(583-585)GAT>GCT	p.D195A		NM_016023	NP_057107	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	165	OTU.									ovary(1)	1			BRCA - Breast invasive adenocarcinoma(11;0.0187)											0.333333	7.390186	7.688304	4	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	92159938	92159938	11730	8	A	C	C	12	12	OTUD6B	C	4	4
ACTL7B	10880	broad.mit.edu	36	9	110657085	110657085	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:110657085G>T	uc004bdi.1	-	c.947C>A	c.(946-948)CCG>CAG	p.P316Q		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	316						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1														0.227273	6.356477	7.868854	5	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	110657085	110657085	202	9	G	T	T	39	39	ACTL7B	T	3	3
NEK6	10783	broad.mit.edu	36	9	126114691	126114691	+	Missense_Mutation	SNP	A	T	T			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:126114691A>T	uc004boh.1	+	c.275A>T	c.(274-276)GAG>GTG	p.E92V	NEK6_uc004bof.1_Missense_Mutation_p.E76V|NEK6_uc004bog.1_Missense_Mutation_p.E58V|NEK6_uc010mwj.1_Intron|NEK6_uc010mwk.1_Missense_Mutation_p.E58V|NEK6_uc004boi.1_Missense_Mutation_p.E58V	NM_014397	NP_055212	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6 isoform 2	58	ATP (By similarity).|Protein kinase.				apoptosis|cell division|chromosome segregation|mitosis|peptidyl-serine phosphorylation|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of mitotic metaphase/anaphase transition	cytoplasm|nucleus	ATP binding|kinesin binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity|signal transducer activity			ovary(2)|kidney(1)	3						NSCLC(122;934 1785 18647 44295 45571)				350				0.333333	24.076096	24.967678	12	24	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	126114691	126114691	10727	9	A	T	T	11	11	NEK6	T	4	4
LRSAM1	90678	broad.mit.edu	36	9	129298123	129298123	+	Nonsense_Mutation	SNP	C	G	G			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129298123C>G	uc004brb.1	+	c.1758C>G	c.(1756-1758)TAC>TAG	p.Y586*	LRSAM1_uc010mxk.1_Nonsense_Mutation_p.Y559*|LRSAM1_uc004brc.1_Nonsense_Mutation_p.Y586*|LRSAM1_uc004brd.1_Nonsense_Mutation_p.Y586*|LRSAM1_uc004bre.1_Nonsense_Mutation_p.Y166*|LRSAM1_uc004brg.1_Nonsense_Mutation_p.Y17*	NM_001005373	NP_612370	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif	586	SAM.				negative regulation of endocytosis|non-lytic virus budding|protein autoubiquitination|protein catabolic process|protein polyubiquitination|protein transport|ubiquitin-dependent endocytosis	cytoplasm|extracellular region|membrane part	hormone activity|ubiquitin-protein ligase activity|zinc ion binding				0														0.25	7.556132	8.703724	5	15	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	129298123	129298123	9419	9	C	G	G	18	18	LRSAM1	G	5	3
LAMC3	10319	broad.mit.edu	36	9	132917812	132917812	+	Missense_Mutation	SNP	T	G	G			TCGA-06-2566-01	TCGA-06-2566-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:132917812T>G	uc004caa.1	+	c.1744T>G	c.(1744-1746)TTG>GTG	p.L582V		NM_006059	NP_006050	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3 precursor	582	Laminin IV type A.				cell adhesion	basement membrane|membrane	structural molecule activity			ovary(2)|pancreas(1)	3	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)								OREG0019556	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.2	7.730391	10.249262	6	24	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	132917812	132917812	8939	9	T	G	G	56	56	LAMC3	G	4	4
TRPM3	80036	broad.mit.edu	36	9	72342102	72342102	+	Missense_Mutation	SNP	C	A	A			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:72342102C>A	uc004aid.1	-	c.3711G>T	c.(3709-3711)GAG>GAT	p.E1237D	TRPM3_uc004ahu.1_Missense_Mutation_p.E1079D|TRPM3_uc004ahv.1_Missense_Mutation_p.E1039D|TRPM3_uc004ahw.1_Missense_Mutation_p.E1109D|TRPM3_uc004ahx.1_Missense_Mutation_p.E1096D|TRPM3_uc004ahy.1_Missense_Mutation_p.E1099D|TRPM3_uc004ahz.1_Missense_Mutation_p.E1086D|TRPM3_uc004aia.1_Missense_Mutation_p.E1084D|TRPM3_uc004aib.1_Missense_Mutation_p.E1074D|TRPM3_uc004aic.2_Missense_Mutation_p.E1237D	NM_001007471	NP_066003	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1262	Cytoplasmic (Potential).|Potential.					integral to membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(2)	7														0.25	17.457268	20.20453	12	36	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72342102	72342102	17138	9	C	A	A	32	32	TRPM3	A	3	3
HCCS	3052	broad.mit.edu	36	X	11046556	11046556	+	Missense_Mutation	SNP	A	G	G			TCGA-06-2566-01	TCGA-06-2566-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:11046556A>G	uc004cuk.2	+	c.416A>G	c.(415-417)GAT>GGT	p.D139G	HCCS_uc004cuj.2_Missense_Mutation_p.D139G|HCCS_uc004cul.1_Missense_Mutation_p.D139G	NM_005333	NP_005324	P53701	CCHL_HUMAN	holocytochrome c synthase (cytochrome c	139					organ morphogenesis|oxidation-reduction process	mitochondrial inner membrane	holocytochrome-c synthase activity|metal ion binding				0						Ovarian(86;1338 1347 1462 10340 37882)								0.146067	8.908203	19.667253	13	76	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11046556	11046556	7272	23	A	G	G	12	12	HCCS	G	4	4
PGRMC1	10857	broad.mit.edu	36	X	118254440	118254440	+	Missense_Mutation	SNP	C	T	T			TCGA-06-2566-01	TCGA-06-2566-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:118254440C>T	uc004erb.1	+	c.86C>T	c.(85-87)CCG>CTG	p.P29L		NM_006667	NP_006658	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	29	Helical; (Potential).					cell surface|endoplasmic reticulum membrane|integral to membrane|microsome|nucleolus	heme binding|protein binding|receptor activity|steroid binding				0														0.206897	7.828183	10.146822	6	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	118254440	118254440	12229	23	C	T	T	23	23	PGRMC1	T	1	1
HCFC1	3054	broad.mit.edu	36	X	152876532	152876533	+	Splice_Site_DNP	DNP	CT	AA	AA			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:152876532_152876533CT>AA	uc004fjp.1	-	c.e12_splice_site				NM_005334	NP_005325			host cell factor 1						cell cycle|interspecies interaction between organisms|positive regulation of cell cycle|positive regulation of gene expression|protein stabilization|reactivation of latent virus|regulation of protein complex assembly|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	mitochondrion|MLL1 complex|MLL5-L complex|Set1C/COMPASS complex	chromatin binding|identical protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)	2	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.444444	34.273645	34.37302	16	20	CC		KEEP	---	---	---	---	capture			Splice_Site_DNP	DNP	152876532	152876533	7273	23	CT	AA	AA	32	32	HCFC1	AA	5	3
FLNA	2316	broad.mit.edu	36	X	153230559	153230559	+	Missense_Mutation	SNP	G	T	T			TCGA-06-2566-01	TCGA-06-2566-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:153230559G>T	uc004fkk.2	-	c.7796C>A	c.(7795-7797)ACC>AAC	p.T2599N	FLNA_uc004fki.2_Missense_Mutation_p.T639N|FLNA_uc010nuu.1_Missense_Mutation_p.T2591N	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	2599	Self-association site, tail.|Filamin 24.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	actin cytoskeleton|cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)									518				0.5	6.823434	6.823434	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	153230559	153230559	6175	23	G	T	T	44	44	FLNA	T	3	3
DIP2C	22982	broad.mit.edu	36	10	400351	400357	+	Frame_Shift_Del	DEL	GCGCAGT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:400351_400357delGCGCAGT	uc001ifp.1	-	c.2434_2440delACTGCGC	c.(2434-2442)ACTGCGCTGfs	p.T812fs	DIP2C_uc009xhi.1_Frame_Shift_Del_p.T198fs	NM_014974	NP_055789	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C	812_814						nucleus	catalytic activity|transcription factor binding			breast(4)|ovary(2)|large_intestine(1)	7		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)					p.A813V(SW48-Tumor)|p.A813A(PANC10.05-Tumor)	1018				0.64			69	39				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	400351	400357	4708	10	GCGCAGT	-	-	34	34	DIP2C	-	5	5
LRIT1	26103	broad.mit.edu	36	10	85984044	85984060	+	Frame_Shift_Del	DEL	GGCCCAGCCATCCAAAA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:85984044_85984060delGGCCCAGCCATCCAAAA	uc001kcz.1	-	c.644_660delTTTTGGATGGCTGGGCC	c.(643-660)CTTTTGGATGGCTGGGCCfs	p.L215fs		NM_015613	NP_056428	Q9P2V4	LRIT1_HUMAN	retina specific protein PAL	215_220	LRRCT.|Lumenal (Potential).					integral to endoplasmic reticulum membrane					0														0.41			22	32				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	85984044	85984060	9320	10	GGCCCAGCCATCCAAAA	-	-	43	43	LRIT1	-	5	5
WAPAL	23063	broad.mit.edu	36	10	88267364	88267378	+	In_Frame_Del	DEL	TTTGTGCTCTTTTCT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:88267364_88267378delTTTGTGCTCTTTTCT	uc001kdn.1	-	c.558_572delAGAAAAGAGCACAAA	c.(556-573)AAAGAAAAGAGCACAAAC>AAC	p.KEKST186del	WAPAL_uc001kdo.1_In_Frame_Del_p.KEKST143del|WAPAL_uc009xsw.1_In_Frame_Del_p.KEKST143del	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	143_147	Mediates interaction with the cohesin complex.				cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1														0.41			31	44				---	---	---	---	capture_indel			In_Frame_Del	DEL	88267364	88267378	17820	10	TTTGTGCTCTTTTCT	-	-	60	60	WAPAL	-	5	5
H2AFX	3014	broad.mit.edu	36	11	118470916	118470918	+	In_Frame_Del	DEL	GCC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:118470916_118470918delGCC	uc001pvg.1	-	c.397_399delGGC	c.(397-399)GGCdel	p.G133del	H2AFX_uc001pvh.1_Non-coding_Transcript	NM_002105	NP_002096	P16104	H2AX_HUMAN	H2A histone family, member X	133					DNA damage checkpoint|double-strand break repair via homologous recombination|meiosis|nucleosome assembly|positive regulation of DNA repair|response to ionizing radiation	nucleoplasm|nucleosome	DNA binding|enzyme binding|histone binding				0	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.47e-05)								OREG0021395	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.51			49	48				---	---	---	---	capture_indel			In_Frame_Del	DEL	118470916	118470918	7209	11	GCC	-	-	46	46	H2AFX	-	5	5
AGBL2	79841	broad.mit.edu	36	11	47692405	47692412	+	Splice_Site_Del	DEL	GTATTACC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:47692405_47692412delGTATTACC	uc001ngg.1	-	c.e2_splice_site			AGBL2_uc001ngh.1_Splice_Site_Del	NM_024783	NP_079059			carboxypeptidase 2, cytosolic						proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2														0.56			115	91				---	---	---	---	capture_indel			Splice_Site_Del	DEL	47692405	47692412	378	11	GTATTACC	-	-	44	44	AGBL2	-	5	5
UNC93B1	81622	broad.mit.edu	36	11	67523702	67523702	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:67523702_67523702delC	uc001omw.1	-	c.417_417delG	c.(415-417)ATGfs	p.M139fs		NM_030930	NP_112192	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1	139	Helical; (Potential).				innate immune response|intracellular protein transport|response to virus|toll-like receptor 3 signaling pathway|toll-like receptor 7 signaling pathway|toll-like receptor 9 signaling pathway	early phagosome|endoplasmic reticulum membrane|endosome|integral to membrane|lysosome					0														0.32			7	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	67523702	67523702	17556	11	C	-	-	17	17	UNC93B1	-	5	5
DHCR7	1717	broad.mit.edu	36	11	70833545	70833547	+	Splice_Site_Del	DEL	TTA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:70833545_70833547delTTA	uc001oqk.1	-	c.e3_splice_site			DHCR7_uc001oql.1_Splice_Site_Del	NM_001360	NP_001351			7-dehydrocholesterol reductase						cholesterol biosynthetic process|oxidation-reduction process	endoplasmic reticulum membrane|integral to membrane|nuclear outer membrane	7-dehydrocholesterol reductase activity|protein binding			ovary(1)|liver(1)	2					NADH(DB00157)									0.40			195	297				---	---	---	---	capture_indel			Splice_Site_Del	DEL	70833545	70833547	4656	11	TTA	-	-	56	56	DHCR7	-	5	5
HNF1A	6927	broad.mit.edu	36	12	119916499	119916500	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:119916499_119916500insC	uc001tzg.1	+	c.863_864insC	c.(862-864)GGGfs	p.G288fs	HNF1A_uc001tze.1_Frame_Shift_Ins_p.G288fs|HNF1A_uc001tzf.2_Frame_Shift_Ins_p.G288fs	NM_000545	NP_000536	P20823	HNF1A_HUMAN	transcription factor 1, hepatic	288					glucose homeostasis|glucose import|insulin secretion|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|nucleus|protein complex	DNA binding|promoter binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription activator activity			liver(91)|large_intestine(15)|endometrium(6)|breast(2)	114	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)								p.G288fs(SKCO1-Tumor)|p.G288fs(AN3CA-Tumor)|p.G288fs(HS852.T-Tumor)	239				0.31			4	9				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	119916499	119916500	7543	12	-	C	C	43	43	HNF1A	C	5	5
TMTC1	83857	broad.mit.edu	36	12	29558696	29558697	+	Frame_Shift_Del	DEL	CG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:29558696_29558697delCG	uc001rjb.1	-	c.2091_2092delCG	c.(2089-2094)CTCGACfs	p.L697fs	TMTC1_uc001riz.1_Frame_Shift_Del_p.L454fs|TMTC1_uc001rja.1_Frame_Shift_Del_p.L541fs|TMTC1_uc001riy.1_Frame_Shift_Del_p.L150fs	NM_175861	NP_787057	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat	697_698	TPR 9.					integral to membrane	binding				0	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)													0.62			25	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	29558696	29558697	16801	12	CG	-	-	31	31	TMTC1	-	5	5
NR4A1	3164	broad.mit.edu	36	12	50738920	50738924	+	Frame_Shift_Del	DEL	CTACC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:50738920_50738924delCTACC	uc001rzq.1	+	c.1884_1888delCTACC	c.(1882-1890)TTCTACCTCfs	p.F628fs	NR4A1_uc001rzs.1_Frame_Shift_Del_p.F574fs|NR4A1_uc001rzt.1_Frame_Shift_Del_p.F574fs|NR4A1_uc009zmc.1_3'UTR	NM_173157	NP_775180	P22736	NR4A1_HUMAN	nuclear receptor subfamily 4, group A, member 1	574_576					nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(357;0.0967)										0.69			83	37				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	50738920	50738924	11037	12	CTACC	-	-	32	32	NR4A1	-	5	5
TNFSF13B	10673	broad.mit.edu	36	13	107720550	107720551	+	Frame_Shift_Ins	INS	-	GT	GT			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:107720550_107720551insGT	uc001vqr.1	+	c.306_307insGT	c.(304-309)CTGGAGfs	p.L102fs	TNFSF13B_uc010agj.1_Frame_Shift_Ins_p.L102fs	NM_006573	NP_006564	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily,	102_103	Extracellular (Potential).				cell proliferation|immune response|signal transduction	extracellular space|integral to membrane|plasma membrane|soluble fraction	cytokine activity|tumor necrosis factor receptor binding				0	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)											0.57			8	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	107720550	107720551	16847	13	-	GT	GT	47	47	TNFSF13B	GT	5	5
TUBGCP3	10426	broad.mit.edu	36	13	112206424	112206426	+	In_Frame_Del	DEL	AAT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:112206424_112206426delAAT	uc001vse.1	-	c.2228_2230delATT	c.(2227-2232)GATTTG>GTG	p.743_744DL>V	TUBGCP3_uc001vsf.2_In_Frame_Del_p.743_744DL>V	NM_006322	NP_006313	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	743_744					G2/M transition of mitotic cell cycle|microtubule nucleation|single fertilization	centriole|cytosol|polar microtubule	gamma-tubulin binding|structural constituent of cytoskeleton			central_nervous_system(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)													0.52			91	85				---	---	---	---	capture_indel			In_Frame_Del	DEL	112206424	112206426	17322	13	AAT	-	-	1	1	TUBGCP3	-	5	5
SPATA13	221178	broad.mit.edu	36	13	23761191	23761191	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:23761191_23761191delG	uc001upd.1	+	c.2602_2602delG	c.(2602-2604)GCCfs	p.A868fs	C1QTNF9_uc001upe.1_Non-coding_Transcript|SPATA13_uc001upg.1_Frame_Shift_Del_p.A283fs|SPATA13_uc001uph.1_Frame_Shift_Del_p.A205fs|SPATA13_uc009zzz.1_Frame_Shift_Del_p.A8fs	NM_153023	NP_694568	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	283	DH.				cell migration|filopodium assembly|lamellipodium assembly|regulation of cell migration|regulation of Rho protein signal transduction	cytoplasm|filopodium|lamellipodium|ruffle membrane	protein binding|Rac guanyl-nucleotide exchange factor activity			skin(2)|ovary(1)	3		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)										0.33			4	8				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	23761191	23761191	15508	13	G	-	-	34	34	SPATA13	-	5	5
PCDH17	27253	broad.mit.edu	36	13	57107122	57107134	+	Frame_Shift_Del	DEL	TGTATCTCAAACC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:57107122_57107134delTGTATCTCAAACC	uc001vhq.1	+	c.2441_2453delTGTATCTCAAACC	c.(2440-2454)ATGTATCTCAAACCGfs	p.M814fs	PCDH17_uc010aec.1_Frame_Shift_Del_p.M814fs	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	814_818	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)|pancreas(2)	4		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		Melanoma(72;952 1291 1619 12849 33676)								0.70			26	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	57107122	57107134	11932	13	TGTATCTCAAACC	-	-	51	51	PCDH17	-	5	5
CDC42BPB	9578	broad.mit.edu	36	14	102517040	102517058	+	Frame_Shift_Del	DEL	GATCAGTCTCTGGATGAGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:102517040_102517058delGATCAGTCTCTGGATGAGG	uc001ymi.1	-	c.945_963delCCTCATCCAGAGACTGATC	c.(943-963)GACCTCATCCAGAGACTGATCfs	p.D315fs		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	315_321	Protein kinase.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction|protein phosphorylation	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|lung(2)|ovary(1)|breast(1)|skin(1)	8		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)						1085				0.43			49	64				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	102517040	102517058	3201	14	GATCAGTCTCTGGATGAGG	-	-	33	33	CDC42BPB	-	5	5
SUPT16H	11198	broad.mit.edu	36	14	20891770	20891771	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:20891770_20891771insC	uc001wao.1	-	c.2851_2852insG	c.(2851-2853)TCAfs	p.S951fs	SUPT16H_uc001wan.1_Frame_Shift_Ins_p.S95fs	NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	951	Glu-rich (acidic).				DNA repair|DNA replication|nucleosome disassembly|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding|positive transcription elongation factor activity				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)										0.49			107	113				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	20891770	20891771	15916	14	-	C	C	45	45	SUPT16H	C	5	5
ZBTB25	7597	broad.mit.edu	36	14	64024309	64024310	+	Frame_Shift_Del	DEL	AA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:64024309_64024310delAA	uc001xhf.1	-	c.392_393delTT	c.(391-393)ATTfs	p.I131fs	ZBTB25_uc001xhc.2_Intron|ZBTB25_uc001xhg.1_Frame_Shift_Del_p.I131fs	NM_006977	NP_008908	P24278	ZBT25_HUMAN	zinc finger protein 46	131					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				all cancers(60;0.00865)|OV - Ovarian serous cystadenocarcinoma(108;0.0102)|BRCA - Breast invasive adenocarcinoma(234;0.0469)										0.34			72	140				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	64024309	64024310	18118	14	AA	-	-	9	9	ZBTB25	-	5	5
RPAP1	26015	broad.mit.edu	36	15	39607817	39607833	+	Splice_Site_Del	DEL	ACCCCGCTCTCTGGGGC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:39607817_39607833delACCCCGCTCTCTGGGGC	uc001zod.1	-	c.e10_splice_site				NM_015540	NP_056355			RNA polymerase II associated protein 1							nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)										0.45			29	35				---	---	---	---	capture_indel			Splice_Site_Del	DEL	39607817	39607833	14020	15	ACCCCGCTCTCTGGGGC	-	-	14	14	RPAP1	-	5	5
NEO1	4756	broad.mit.edu	36	15	71362447	71362465	+	Frame_Shift_Del	DEL	GTGGTGGTTGTGATTATCG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:71362447_71362465delGTGGTGGTTGTGATTATCG	uc002avm.2	+	c.3352_3370delGTGGTGGTTGTGATTATCG	c.(3352-3372)GTGGTGGTTGTGATTATCGCTfs	p.V1118fs	NEO1_uc002avn.2_Frame_Shift_Del_p.V756fs	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1	1118_1124	Helical; (Potential).				axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1														0.34			89	173				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	71362447	71362465	10735	15	GTGGTGGTTGTGATTATCG	-	-	40	40	NEO1	-	5	5
SYNM	23336	broad.mit.edu	36	15	97489249	97489253	+	Frame_Shift_Del	DEL	GTGGA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:97489249_97489253delGTGGA	uc002bup.1	+	c.3161_3165delGTGGA	c.(3160-3165)GGTGGAfs	p.G1054fs	SYNM_uc002buo.1_Frame_Shift_Del_p.G1054fs|SYNM_uc002buq.1_Intron	NM_145728	NP_663780	O15061	SYNEM_HUMAN	desmuslin isoform A	1054_1055	Tail.				intermediate filament cytoskeleton organization	adherens junction|costamere|intermediate filament|neurofilament cytoskeleton	intermediate filament binding|structural constituent of cytoskeleton|structural constituent of muscle|vinculin binding			ovary(3)|central_nervous_system(1)	4						Pancreas(125;1071 1762 21750 40003 40381)								0.32			15	32				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	97489249	97489253	15976	15	GTGGA	-	-	44	44	SYNM	-	5	5
E4F1	1877	broad.mit.edu	36	16	2218433	2218434	+	Frame_Shift_Ins	INS	-	TA	TA			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2218433_2218434insTA	uc002cpm.1	+	c.217_218insTA	c.(217-219)TTTfs	p.F73fs	E4F1_uc010bsi.1_Frame_Shift_Ins_p.F73fs|E4F1_uc010bsj.1_Frame_Shift_Ins_p.F73fs	NM_004424	NP_004415	Q66K89	E4F1_HUMAN	p120E4F	73	Required for ubiquitin ligase activity.				cell division|cell proliferation|interspecies interaction between organisms|mitosis|regulation of growth|regulation of transcription, DNA-dependent	cytoplasm|nucleoplasm	DNA binding|ligase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1														0.78			39	11				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	2218433	2218434	5060	16	-	TA	TA	64	64	E4F1	TA	5	5
ZNF821	55565	broad.mit.edu	36	16	70451511	70451530	+	Frame_Shift_Del	DEL	AGAAGTTCATTTCAGCTGCT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:70451511_70451530delAGAAGTTCATTTCAGCTGCT	uc002fbf.1	-	c.1005_1024delAGCAGCTGAAATGAACTTCT	c.(1003-1026)TTAGCAGCTGAAATGAACTTCTTCfs	p.L335fs	ZNF821_uc002fbe.1_Frame_Shift_Del_p.L227fs|ZNF821_uc002fbg.2_Frame_Shift_Del_p.L227fs|ZNF821_uc002fbh.2_Frame_Shift_Del_p.L335fs|ZNF821_uc002fbi.2_Frame_Shift_Del_p.L174fs	NM_017530	NP_060000	O75541	ZN821_HUMAN	zinc finger protein 821	377_384					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1														0.34			123	240				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	70451511	70451530	18776	16	AGAAGTTCATTTCAGCTGCT	-	-	3	3	ZNF821	-	5	5
FBXO31	79791	broad.mit.edu	36	16	85951449	85951470	+	Frame_Shift_Del	DEL	CGCAAGTTTTCGCAAACACCAT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:85951449_85951470delCGCAAGTTTTCGCAAACACCAT	uc002fjw.1	-	c.344_365delATGGTGTTTGCGAAAACTTGCG	c.(343-366)TATGGTGTTTGCGAAAACTTGCGGfs	p.Y115fs	FBXO31_uc002fjv.1_Frame_Shift_Del_p.Y7fs	NM_024735	NP_079011	Q5XUX0	FBX31_HUMAN	F-box protein 31	115_122					cell cycle|cyclin catabolic process|mitotic cell cycle G1/S transition DNA damage checkpoint|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	SCF ubiquitin ligase complex	cyclin binding			lung(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0272)										0.74			58	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	85951449	85951470	5978	16	CGCAAGTTTTCGCAAACACCAT	-	-	23	23	FBXO31	-	5	5
GIT1	28964	broad.mit.edu	36	17	24933138	24933138	+	Frame_Shift_Del	DEL	G	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:24933138_24933138delG	uc002heg.2	-	c.556_556delC	c.(556-558)CTTfs	p.L186fs	GIT1_uc002hef.2_Frame_Shift_Del_p.L186fs|GIT1_uc010csb.1_Frame_Shift_Del_p.L186fs	NM_001085454	NP_001078923	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interactor 1	186	ANK 2.				regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|focal adhesion	ARF GTPase activator activity|protein binding|zinc ion binding				0				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		Colon(81;41 1719 20078 35068)								0.32			7	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	24933138	24933138	6664	17	G	-	-	34	34	GIT1	-	5	5
MPP3	4356	broad.mit.edu	36	17	39246987	39246990	+	Splice_Site_Del	DEL	TGGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:39246987_39246990delTGGG	uc002ieh.1	-	c.e14_splice_site			MPP3_uc002iei.2_Splice_Site_Del|MPP3_uc002iej.1_Splice_Site_Del	NM_001932	NP_001923			palmitoylated membrane protein 3						signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)	1		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)										0.51			99	94				---	---	---	---	capture_indel			Splice_Site_Del	DEL	39246987	39246990	10127	17	TGGG	-	-	55	55	MPP3	-	5	5
BZRAP1	9256	broad.mit.edu	36	17	53738001	53738002	+	Frame_Shift_Ins	INS	-	A	A			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:53738001_53738002insA	uc002ivx.2	-	c.5259_5260insT	c.(5257-5262)GGCCCCfs	p.G1753fs	BZRAP1_uc010dcs.1_Frame_Shift_Ins_p.G1693fs|BZRAP1_uc002ivv.1_5'Flank|BZRAP1_uc002ivw.1_5'UTR	NM_004758	NP_004749	O95153	RIMB1_HUMAN	peripheral benzodiazepine receptor-associated	1753_1754						mitochondrion	benzodiazepine receptor binding				0	Medulloblastoma(34;0.127)|all_neural(34;0.237)													0.38			8	13				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	53738001	53738002	1611	17	-	A	A	43	43	BZRAP1	A	5	5
RPTOR	57521	broad.mit.edu	36	17	76534127	76534128	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:76534127_76534128delTT	uc002jyt.1	+	c.3091_3092delTT	c.(3091-3093)TTCfs	p.F1031fs		NM_020761	NP_065812	Q8N122	RPTOR_HUMAN	raptor	1031	WD 1.				cell cycle arrest|cell growth|cellular response to amino acid stimulus|cellular response to nutrient levels|insulin receptor signaling pathway|positive regulation of protein serine/threonine kinase activity|positive regulation of TOR signaling cascade|TOR signaling cascade	cytosol|lysosome|TORC1 complex	protein complex binding			lung(4)|urinary_tract(1)	5										1368				0.58			221	158				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	76534127	76534128	14145	17	TT	-	-	52	52	RPTOR	-	5	5
CDKN2D	1032	broad.mit.edu	36	19	10538759	10538759	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:10538759_10538759delT	uc002mpa.1	-	c.476_476delA	c.(475-477)CAGfs	p.Q159fs	KRI1_uc002mox.1_5'Flank|KRI1_uc002moy.1_5'Flank|CDKN2D_uc002mpb.1_Frame_Shift_Del_p.Q159fs	NM_001800	NP_524145	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D	159	ANK 4.			Q -> P (in Ref. 2; AAA85436).	anti-apoptosis|autophagic cell death|cell cycle arrest|DNA synthesis involved in DNA repair|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|negative regulation of caspase activity|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity|response to retinoic acid|response to UV|response to vitamin D	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding				0			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)							14				0.52			66	61				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	10538759	10538759	3295	19	T	-	-	55	55	CDKN2D	-	5	5
C19orf44	84167	broad.mit.edu	36	19	16481771	16481779	+	In_Frame_Del	DEL	TCCTGCCTT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:16481771_16481779delTCCTGCCTT	uc002neh.1	+	c.1611_1619delTCCTGCCTT	c.(1609-1620)GATCCTGCCTTC>GAC	p.PAF538del	MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_In_Frame_Del_p.PAF538del|C19orf44_uc002neg.2_In_Frame_Del_p.PAF538del|C19orf44_uc010eai.1_Non-coding_Transcript	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167	538_540											0														0.53			123	109				---	---	---	---	capture_indel			In_Frame_Del	DEL	16481771	16481779	1991	19	TCCTGCCTT	-	-	50	50	C19orf44	-	5	5
CHERP	10523	broad.mit.edu	36	19	16492288	16492292	+	Frame_Shift_Del	DEL	CTTGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:16492288_16492292delCTTGG	uc002nei.1	-	c.2228_2232delCCAAG	c.(2227-2232)TCCAAGfs	p.S743fs	MED26_uc002nee.2_Intron|C19orf44_uc002neh.1_3'UTR|C19orf44_uc010eai.1_Non-coding_Transcript	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum	743_744	Arg-rich.				cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2														0.33			45	92				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	16492288	16492292	3470	19	CTTGG	-	-	32	32	CHERP	-	5	5
GMIP	51291	broad.mit.edu	36	19	19605653	19605654	+	In_Frame_Ins	INS	-	ACC	ACC			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:19605653_19605654insACC	uc002nnd.1	-	c.2430_2431insGGT	c.(2428-2433)insGGT	p.810_811insG		NM_016573	NP_057657	Q9P107	GMIP_HUMAN	GEM interacting protein	810_811	Pro-rich.				negative regulation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	metal ion binding|protein binding|Rho GTPase activator activity			ovary(1)	1														0.32			9	19				---	---	---	---	capture_indel			In_Frame_Ins	INS	19605653	19605654	6760	19	-	ACC	ACC	47	47	GMIP	ACC	5	5
PLIN4	729359	broad.mit.edu	36	19	4464164	4464164	+	Frame_Shift_Del	DEL	T	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4464164_4464164delT	uc002mar.1	-	c.766_766delA	c.(766-768)ACCfs	p.T256fs	PLIN4_uc010dub.1_5'Flank	NM_001080400	NP_001073869	Q96Q06	PLIN4_HUMAN	plasma membrane associated protein, S3-12	256	27 X 33 AA approximate tandem repeat.|5.					lipid particle|plasma membrane					0														0.42			33	46				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	4464164	4464164	12518	19	T	-	-	59	59	PLIN4	-	5	5
AKT2	208	broad.mit.edu	36	19	45453013	45453016	+	Frame_Shift_Del	DEL	CATT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:45453013_45453016delCATT	uc002onf.1	-	c.176_179delAATG	c.(175-180)GAATGCfs	p.E59fs	AKT2_uc010egt.1_5'UTR|AKT2_uc010egu.1_5'UTR|AKT2_uc010egs.1_Frame_Shift_Del_p.E59fs	NM_001626	NP_001617	P31751	AKT2_HUMAN	AKT2 kinase	59_60	PH.				insulin receptor signaling pathway|negative regulation of plasma membrane long-chain fatty acid transport|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process	cytosol|nucleus	ATP binding|protein binding|protein serine/threonine kinase activity				0			Lung(22;0.000499)							232				0.44			99	128				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	45453013	45453016	483	19	CATT	-	-	25	25	AKT2	-	5	5
LYPD3	27076	broad.mit.edu	36	19	48660367	48660367	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:48660367_48660367delC	uc002owl.1	-	c.161_161delG	c.(160-162)TGCfs	p.C54fs	LYPD3_uc002owm.1_Frame_Shift_Del_p.C54fs	NM_014400	NP_055215	O95274	LYPD3_HUMAN	GPI-anchored metastasis-associated protein	54	UPAR/Ly6 1.					anchored to plasma membrane				pancreas(1)	1		Prostate(69;0.0153)												0.63			32	19				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48660367	48660367	9488	19	C	-	-	25	25	LYPD3	-	5	5
LIG1	3978	broad.mit.edu	36	19	53311020	53311045	+	Splice_Site_Del	DEL	CTTGTCACTATCCACCTGCGGAAGCG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53311020_53311045delCTTGTCACTATCCACCTGCGGAAGCG	uc002pia.1	-	c.e27_splice_site			LIG1_uc002phz.1_Splice_Site_Del|LIG1_uc002pib.1_Splice_Site_Del	NM_000234	NP_000225			DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)	2		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)									0.73			58	21				---	---	---	---	capture_indel			Splice_Site_Del	DEL	53311020	53311045	9107	19	CTTGTCACTATCCACCTGCGGAAGCG	-	-	24	24	LIG1	-	5	5
CLEC4G	339390	broad.mit.edu	36	19	7700888	7700903	+	Splice_Site_Del	DEL	CCCCTCCCCCTGCGCA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:7700888_7700903delCCCCTCCCCCTGCGCA	uc002mhp.2	-	c.e7_splice_site				NM_198492	NP_940894			C-type lectin domain family 4, member G							integral to membrane	protein binding|sugar binding				0						Esophageal Squamous(146;540 1807 3349 19438 30853)								0.64			9	5				---	---	---	---	capture_indel			Splice_Site_Del	DEL	7700888	7700903	3655	19	CCCCTCCCCCTGCGCA	-	-	22	22	CLEC4G	-	5	5
PYGO2	90780	broad.mit.edu	36	1	153198421	153198424	+	Frame_Shift_Del	DEL	GAGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:153198421_153198424delGAGG	uc001fft.1	-	c.676_679delCCTC	c.(676-681)CCTCTCfs	p.P226fs		NM_138300	NP_612157	Q9BRQ0	PYGO2_HUMAN	pygopus homolog 2	226_227	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding|zinc ion binding				0	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			NSCLC(87;357 1460 1955 21029 23522)								0.35			14	26				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	153198421	153198424	13322	1	GAGG	-	-	33	33	PYGO2	-	5	5
VSIG8	391123	broad.mit.edu	36	1	158093039	158093042	+	Frame_Shift_Del	DEL	AGGT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:158093039_158093042delAGGT	uc001fuh.1	-	c.668_671delACCT	c.(667-672)GACCTGfs	p.D223fs	C1orf204_uc001fuf.1_5'Flank|C1orf204_uc001fug.1_5'Flank	NM_001013661	NP_001013683	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	223_224	Extracellular (Potential).|Ig-like V-type 2.					integral to membrane				central_nervous_system(1)	1	all_hematologic(112;0.0597)													0.43			62	82				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	158093039	158093042	17794	1	AGGT	-	-	7	7	VSIG8	-	5	5
BAT2L2	23215	broad.mit.edu	36	1	169777371	169777372	+	In_Frame_Ins	INS	-	TAG	TAG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:169777371_169777372insTAG	uc001ghs.1	+	c.4136_4137insTAG	c.(4135-4137)CAG>CATAGG	p.1379_1379Q>HR	BAT2L2_uc009wwa.1_Non-coding_Transcript	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	1379	Arg-rich.						protein C-terminus binding				0														0.30			17	39				---	---	---	---	capture_indel			In_Frame_Ins	INS	169777371	169777372	1342	1	-	TAG	TAG	7	7	BAT2L2	TAG	5	5
PADI2	11240	broad.mit.edu	36	1	17292680	17292685	+	In_Frame_Del	DEL	GTCCTC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:17292680_17292685delGTCCTC	uc001baf.1	-	c.493_498delGAGGAC	c.(493-498)GAGGACdel	p.ED165del	PADI2_uc001bag.1_In_Frame_Del_p.ED165del	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	165_166					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)									0.59			218	153				---	---	---	---	capture_indel			In_Frame_Del	DEL	17292680	17292685	11794	1	GTCCTC	-	-	36	36	PADI2	-	5	5
IGFN1	91156	broad.mit.edu	36	1	199461577	199461580	+	Frame_Shift_Del	DEL	TGCC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:199461577_199461580delTGCC	uc001gwc.1	+	c.1969_1972delTGCC	c.(1969-1974)TGCCCGfs	p.C657fs	IGFN1_uc001gwb.1_Non-coding_Transcript	NM_178275	NP_840059			immunoglobulin-like and fibronectin type III											ovary(2)|pancreas(1)	3														0.37			21	36				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	199461577	199461580	7891	1	TGCC	-	-	51	51	IGFN1	-	5	5
SRGAP2	23380	broad.mit.edu	36	1	204701081	204701091	+	Frame_Shift_Del	DEL	CTGACGTGGTT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:204701081_204701091delCTGACGTGGTT	uc001hdy.1	+	c.2648_2658delCTGACGTGGTT	c.(2647-2658)CCTGACGTGGTTfs	p.P883fs		NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	970_973					axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)													0.42			31	42				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	204701081	204701091	15660	1	CTGACGTGGTT	-	-	24	24	SRGAP2	-	5	5
DISP1	84976	broad.mit.edu	36	1	221242721	221242734	+	Frame_Shift_Del	DEL	GCTCTTCTCTCCCA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:221242721_221242734delGCTCTTCTCTCCCA	uc001hnu.1	+	c.1359_1372delGCTCTTCTCTCCCA	c.(1357-1374)ATGCTCTTCTCTCCCACAfs	p.M453fs		NM_032890	NP_116279	Q96F81	DISP1_HUMAN	dispatched A	453_458					diaphragm development|protein homotrimerization|regulation of protein secretion|smoothened signaling pathway	basolateral plasma membrane|integral to membrane	hedgehog receptor activity|peptide transporter activity				0				GBM - Glioblastoma multiforme(131;0.102)										0.33			14	29				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	221242721	221242734	4718	1	GCTCTTCTCTCCCA	-	-	46	46	DISP1	-	5	5
FBXO28	23219	broad.mit.edu	36	1	222384900	222384901	+	Frame_Shift_Ins	INS	-	C	C			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:222384900_222384901insC	uc001hoh.1	+	c.371_372insC	c.(370-372)CTCfs	p.L124fs	FBXO28_uc009xef.1_Frame_Shift_Ins_p.L124fs	NM_015176	NP_055991	Q9NVF7	FBX28_HUMAN	F-box protein 28 isoform a	124										ovary(2)|kidney(2)	4	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.0363)										0.61			118	74				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	222384900	222384901	5975	1	-	C	C	54	54	FBXO28	C	5	5
WDR8	49856	broad.mit.edu	36	1	3541614	3541625	+	In_Frame_Del	DEL	CTGACTGCTGGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:3541614_3541625delCTGACTGCTGGG	uc001ako.1	-	c.697_708delCCCAGCAGTCAG	c.(697-708)CCCAGCAGTCAGdel	p.PSSQ233del	WDR8_uc001akn.2_In_Frame_Del_p.PSSQ233del	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8 protein	233_236	WD 4.					cytoplasm	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)										0.69			40	18				---	---	---	---	capture_indel			In_Frame_Del	DEL	3541614	3541625	17902	1	CTGACTGCTGGG	-	-	20	20	WDR8	-	5	5
HHLA3	11147	broad.mit.edu	36	1	70593322	70593328	+	Frame_Shift_Del	DEL	ACCGAGA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:70593322_70593328delACCGAGA	uc001dfc.1	+	c.100_106delACCGAGA	c.(100-108)ACCGAGATGfs	p.T34fs	ANKRD13C_uc001dex.2_5'Flank|ANKRD13C_uc009wbk.1_5'Flank|ANKRD13C_uc001dey.2_5'Flank|HHLA3_uc001dez.1_Frame_Shift_Del_p.T34fs|HHLA3_uc001dfb.1_Frame_Shift_Del_p.T34fs|HHLA3_uc001dfa.1_Frame_Shift_Del_p.T34fs	NM_001031693	NP_001026863	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3 isoform 1	34_36							protein binding				0														0.54			29	25				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	70593322	70593328	7381	1	ACCGAGA	-	-	6	6	HHLA3	-	5	5
SPSB1	80176	broad.mit.edu	36	1	9338630	9338647	+	In_Frame_Del	DEL	CTGCAAGCCCACCCGGCT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:9338630_9338647delCTGCAAGCCCACCCGGCT	uc001apu.1	+	c.93_110delCTGCAAGCCCACCCGGCT	c.(91-111)TACTGCAAGCCCACCCGGCTG>TAG	p.31_37YCKPTRL>*	SPSB1_uc001apv.1_In_Frame_Del_p.31_37YCKPTRL>*	NM_025106	NP_079382	Q96BD6	SPSB1_HUMAN	splA/ryanodine receptor domain and SOCS box	31_37	B30.2/SPRY.				intracellular signal transduction	cytoplasm					0	all_lung(157;0.194)	all_epithelial(116;4.38e-15)|all_lung(118;0.000156)|Lung NSC(185;0.000446)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.72e-07)|COAD - Colon adenocarcinoma(227;9.12e-05)|Kidney(185;0.000296)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00193)|BRCA - Breast invasive adenocarcinoma(304;0.00202)|READ - Rectum adenocarcinoma(331;0.0419)										0.56			24	19				---	---	---	---	capture_indel			In_Frame_Del	DEL	9338630	9338647	15626	1	CTGCAAGCCCACCCGGCT	-	-	20	20	SPSB1	-	5	5
ELMO2	63916	broad.mit.edu	36	20	44436469	44436470	+	Frame_Shift_Ins	INS	-	G	G			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:44436469_44436470insG	uc002xrt.1	-	c.1187_1188insC	c.(1186-1188)AGTfs	p.S396fs	ELMO2_uc002xrs.1_Frame_Shift_Ins_p.S143fs|ELMO2_uc002xru.1_Frame_Shift_Ins_p.S396fs|ELMO2_uc002xrv.1_Frame_Shift_Ins_p.S115fs|ELMO2_uc002xrw.2_Frame_Shift_Ins_p.S213fs	NM_133171	NP_877496	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	396	ELMO.				apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)												0.39			128	198				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	44436469	44436470	5258	20	-	G	G	14	14	ELMO2	G	5	5
SFI1	9814	broad.mit.edu	36	22	30328689	30328700	+	In_Frame_Del	DEL	GTGGCCTGTGCC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr22:30328689_30328700delGTGGCCTGTGCC	uc003ale.1	+	c.1723_1734delGTGGCCTGTGCC	c.(1723-1734)GTGGCCTGTGCCdel	p.VACA575del	SFI1_uc003ald.1_In_Frame_Del_p.VACA551del|SFI1_uc003alf.1_In_Frame_Del_p.VACA544del|SFI1_uc003alg.1_In_Frame_Del_p.VACA493del|SFI1_uc003alh.1_Non-coding_Transcript|SFI1_uc010gwi.1_Non-coding_Transcript	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform	575_578					G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1														0.73			185	67				---	---	---	---	capture_indel			In_Frame_Del	DEL	30328689	30328700	14645	22	GTGGCCTGTGCC	-	-	36	36	SFI1	-	5	5
LCT	3938	broad.mit.edu	36	2	136292051	136292055	+	Frame_Shift_Del	DEL	TGCTG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:136292051_136292055delTGCTG	uc002tuu.1	-	c.1033_1037delCAGCA	c.(1033-1038)CAGCAGfs	p.Q345fs		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	345_346	Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|lung(1)|pancreas(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.169)										0.45			45	54				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	136292051	136292055	9017	2	TGCTG	-	-	55	55	LCT	-	5	5
COL3A1	1281	broad.mit.edu	36	2	189567803	189567821	+	Splice_Site_Del	DEL	GTACGTTTTCCATGGGGCA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:189567803_189567821delGTACGTTTTCCATGGGGCA	uc002uqj.1	+	c.e20_splice_site				NM_000090	NP_000081			collagen type III alpha 1 preproprotein						axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)				(NCIH2444-Tumor)	1079				0.44			70	90				---	---	---	---	capture_indel			Splice_Site_Del	DEL	189567803	189567821	3826	2	GTACGTTTTCCATGGGGCA	-	-	44	44	COL3A1	-	5	5
ZDBF2	57683	broad.mit.edu	36	2	206883984	206883985	+	Frame_Shift_Ins	INS	-	CT	CT			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:206883984_206883985insCT	uc002vbp.2	+	c.6487_6488insCT	c.(6487-6489)GTTfs	p.V2163fs		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2163							nucleic acid binding|zinc ion binding			ovary(3)	3														0.36			8	14				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	206883984	206883985	18187	2	-	CT	CT	36	36	ZDBF2	CT	5	5
ABCB6	10058	broad.mit.edu	36	2	219784013	219784018	+	In_Frame_Del	DEL	TTAAAG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:219784013_219784018delTTAAAG	uc002vkc.1	-	c.2025_2030delCTTTAA	c.(2023-2031)CTCTTTAAT>CTT	p.FN676del	ABCB6_uc010fwe.1_In_Frame_Del_p.FN630del	NM_005689	NP_005680	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B, member 6	676_677	ABC transporter.				cellular iron ion homeostasis|detoxification of cadmium ion|porphyrin biosynthetic process	ATP-binding cassette (ABC) transporter complex|Golgi apparatus|integral to mitochondrial outer membrane|plasma membrane|vacuolar membrane	ATP binding|cadmium ion transmembrane transporter activity|efflux transmembrane transporter activity|heme binding|heme-transporting ATPase activity			breast(1)|central_nervous_system(1)	2		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.46			241	283				---	---	---	---	capture_indel			In_Frame_Del	DEL	219784013	219784018	46	2	TTAAAG	-	-	52	52	ABCB6	-	5	5
SCAP	22937	broad.mit.edu	36	3	47443669	47443685	+	Frame_Shift_Del	DEL	AAGACCAGGGTGATGGT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:47443669_47443685delAAGACCAGGGTGATGGT	uc003crh.1	-	c.703_719delACCATCACCCTGGTCTT	c.(703-720)ACCATCACCCTGGTCTTCfs	p.T235fs	SCAP_uc003crg.2_Intron	NM_012235	NP_036367	Q12770	SCAP_HUMAN	SREBF chaperone protein	235_240	Lumenal (By similarity).				cholesterol metabolic process|negative regulation of cholesterol biosynthetic process|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of transcription via sterol regulatory element binding involved in ER-nuclear sterol response pathway	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane	unfolded protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000278)|KIRC - Kidney renal clear cell carcinoma(197;0.00592)|Kidney(197;0.00679)		Pancreas(149;978 1908 29304 37806 46700)								0.36			519	938				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	47443669	47443685	14358	3	AAGACCAGGGTGATGGT	-	-	9	9	SCAP	-	5	5
CELSR3	1951	broad.mit.edu	36	3	48659238	48659260	+	Frame_Shift_Del	DEL	CAGTCCCCCTAAGGTGCGGTAAA	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48659238_48659260delCAGTCCCCCTAAGGTGCGGTAAA	uc003cuf.1	-	c.7445_7467delTTTACCGCACCTTAGGGGGACTG	c.(7444-7467)GTTTACCGCACCTTAGGGGGACTGfs	p.V2482fs	CELSR3_uc010hkf.1_5'Flank|CELSR3_uc010hkg.1_Frame_Shift_Del_p.V395fs|CELSR3_uc003cul.1_Frame_Shift_Del_p.V2412fs	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	2412_2419	Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|central_nervous_system(2)|skin(1)	7				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)										0.40			4	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48659238	48659260	3356	3	CAGTCCCCCTAAGGTGCGGTAAA	-	-	25	25	CELSR3	-	5	5
FLNB	2317	broad.mit.edu	36	3	58110671	58110675	+	Frame_Shift_Del	DEL	CGGAG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:58110671_58110675delCGGAG	uc010hne.1	+	c.6239_6243delCGGAG	c.(6238-6243)ACGGAGfs	p.T2080fs	FLNB_uc003djj.1_Frame_Shift_Del_p.T2049fs|FLNB_uc003djk.1_Frame_Shift_Del_p.T2038fs|FLNB_uc010hnf.1_Frame_Shift_Del_p.T2025fs|FLNB_uc003djl.1_Frame_Shift_Del_p.T1869fs|FLNB_uc003djm.1_Frame_Shift_Del_p.T1856fs|FLNB_uc010hng.1_Non-coding_Transcript	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B, beta (actin binding protein 278)	2049_2050	Filamin 19.|Interaction with the cytoplasmic tail of GP1BA.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(6)|ovary(3)	9				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)						676				0.67			193	96				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	58110671	58110675	6176	3	CGGAG	-	-	19	19	FLNB	-	5	5
DUSP22	56940	broad.mit.edu	36	6	293197	293201	+	Frame_Shift_Del	DEL	GCTGG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:293197_293201delGCTGG	uc003msx.1	+	c.358_362delGCTGG	c.(358-363)GCTGGGfs	p.A120fs	DUSP22_uc003msy.1_Frame_Shift_Del_p.A77fs	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	120_121	Tyrosine-protein phosphatase.				apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)										0.31			48	109				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	293197	293201	5006	6	GCTGG	-	-	46	46	DUSP22	-	5	5
BAZ1B	9031	broad.mit.edu	36	7	72494726	72494728	+	In_Frame_Del	DEL	CCC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:72494726_72494728delCCC	uc003tyc.1	-	c.4186_4188delGGG	c.(4186-4188)GGGdel	p.G1396del		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	1396	Bromo.				ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|transcription regulator activity|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|breast(1)	5		Lung NSC(55;0.0659)|all_lung(88;0.152)				Esophageal Squamous(112;1167 1561 21085 43672 48228)								0.38			148	238				---	---	---	---	capture_indel			In_Frame_Del	DEL	72494726	72494728	1351	7	CCC	-	-	30	30	BAZ1B	-	5	5
CLIP2	7461	broad.mit.edu	36	7	73441466	73441480	+	In_Frame_Del	DEL	GACCCATGACGCCTC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:73441466_73441480delGACCCATGACGCCTC	uc003uam.1	+	c.2661_2675delGACCCATGACGCCTC	c.(2659-2676)AAGACCCATGACGCCTCG>AAG	p.THDAS888del	CLIP2_uc003uan.1_In_Frame_Del_p.THDAS853del	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	888_892	Potential.					microtubule associated complex					0														0.76			51	16				---	---	---	---	capture_indel			In_Frame_Del	DEL	73441466	73441480	3671	7	GACCCATGACGCCTC	-	-	33	33	CLIP2	-	5	5
GLI4	2738	broad.mit.edu	36	8	144422980	144422992	+	Frame_Shift_Del	DEL	CCCGTCCCCTGTC	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:144422980_144422992delCCCGTCCCCTGTC	uc003yxx.1	+	c.39_51delCCCGTCCCCTGTC	c.(37-51)GTCCCGTCCCCTGTCfs	p.V13fs	ZFP41_uc003yxv.1_Intron	NM_138465	NP_612474	P10075	GLI4_HUMAN	GLI-Kruppel family member GLI4	13_17						nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)											0.62			80	48				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	144422980	144422992	6708	8	CCCGTCCCCTGTC	-	-	30	30	GLI4	-	5	5
ZNF7	7553	broad.mit.edu	36	8	146038662	146038664	+	In_Frame_Del	DEL	CTT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:146038662_146038664delCTT	uc010mge.1	+	c.1399_1401delCTT	c.(1399-1401)CTTdel	p.L467del	ZNF7_uc003zeg.2_In_Frame_Del_p.L456del|ZNF7_uc003zeh.2_Intron|ZNF7_uc003zek.2_In_Frame_Del_p.L360del|COMMD5_uc003zel.1_Intron	NM_003416	NP_003407	P17097	ZNF7_HUMAN	zinc finger protein 7	456	C2H2-type 8.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.0812)|Ovarian(118;0.0822)|Acute lymphoblastic leukemia(644;0.143)	Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;2.11e-07)										0.39			163	256				---	---	---	---	capture_indel			In_Frame_Del	DEL	146038662	146038664	18697	8	CTT	-	-	28	28	ZNF7	-	5	5
PDP1	54704	broad.mit.edu	36	8	95003962	95003974	+	Frame_Shift_Del	DEL	TTGTTACCCCATG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:95003962_95003974delTTGTTACCCCATG	uc003ygf.1	+	c.574_586delTTGTTACCCCATG	c.(574-588)TTGTTACCCCATGAGfs	p.L192fs	PDP1_uc003yge.1_Frame_Shift_Del_p.L167fs|PDP1_uc003ygg.1_Frame_Shift_Del_p.L192fs|PDP1_uc010max.1_Frame_Shift_Del_p.L167fs	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehydrogenase phosphatase precursor	167_171					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3														0.74			31	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	95003962	95003974	12106	8	TTGTTACCCCATG	-	-	64	64	PDP1	-	5	5
RXRA	6256	broad.mit.edu	36	9	136468253	136468254	+	Frame_Shift_Ins	INS	-	AG	AG			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:136468253_136468254insAG	uc004cfb.1	+	c.1361_1362insAG	c.(1360-1362)ATGfs	p.M454fs	RXRA_uc004cfc.1_Frame_Shift_Ins_p.M357fs	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	454	Ligand-binding.				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of gene-specific transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)					303				0.49			88	93				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	136468253	136468254	14243	9	-	AG	AG	51	51	RXRA	AG	5	5
CCDC107	203260	broad.mit.edu	36	9	35650375	35650397	+	Splice_Site_Del	DEL	GCCCTTTCCTTCTTCCACAACAG	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:35650375_35650397delGCCCTTTCCTTCTTCCACAACAG	uc003zxi.1	+	c.e3_splice_site			C9orf100_uc003zxl.2_Non-coding_Transcript|C9orf100_uc003zxm.1_3'UTR|RMRP_uc003zxh.1_5'Flank|CCDC107_uc010mky.1_Splice_Site_Del|CCDC107_uc003zxj.1_Splice_Site_Del|CCDC107_uc003zxk.1_Splice_Site_Del	NM_174923	NP_777583			coiled-coil domain containing 107							integral to membrane					0	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)											0.32			18	38				---	---	---	---	capture_indel			Splice_Site_Del	DEL	35650375	35650397	2862	9	GCCCTTTCCTTCTTCCACAACAG	-	-	46	46	CCDC107	-	5	5
TLR8	51311	broad.mit.edu	36	X	12849418	12849427	+	Frame_Shift_Del	DEL	ATTGGAGATT	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:12849418_12849427delATTGGAGATT	uc004cvd.1	+	c.2392_2401delATTGGAGATT	c.(2392-2403)ATTGGAGATTTCfs	p.I798fs	TLR8_uc004cve.1_Frame_Shift_Del_p.I780fs	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8	780_783	Extracellular (Potential).|LRRCT.				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane|integral to membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|large_intestine(1)	5														0.37			71	121				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	12849418	12849427	16487	23	ATTGGAGATT	-	-	8	8	TLR8	-	5	5
ZNF449	203523	broad.mit.edu	36	X	134308884	134308885	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:134308884_134308885insT	uc004eys.1	+	c.175_176insT	c.(175-177)CTGfs	p.L59fs	ZNF449_uc004eyq.1_Frame_Shift_Ins_p.L59fs|ZNF449_uc004eyr.2_Frame_Shift_Ins_p.L59fs|ZNF449_uc004eyt.1_5'UTR	NM_152695	NP_689908	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	59	SCAN box.				regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.34			40	76				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	134308884	134308885	18513	23	-	T	T	28	28	ZNF449	T	5	5
CXorf58	254158	broad.mit.edu	36	X	23839806	23839807	+	Frame_Shift_Ins	INS	-	T	T			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:23839806_23839807insT	uc004daz.1	+	c.128_129insT	c.(127-129)GACfs	p.D43fs		NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	43											0														0.35			53	97				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	23839806	23839807	4278	23	-	T	T	10	10	CXorf58	T	5	5
OTUD6A	139562	broad.mit.edu	36	X	69199901	69199901	+	Frame_Shift_Del	DEL	C	-	-			TCGA-06-2566-01	TCGA-06-2566-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:69199901_69199901delC	uc004dxu.1	+	c.802_802delC	c.(802-804)CACfs	p.H268fs		NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A	268	OTU.										0														0.43			15	20				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	69199901	69199901	11729	23	C	-	-	25	25	OTUD6A	-	5	5
