Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
POLR3A	11128	broad.mit.edu	36	10	79413759	79413759	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:79413759T>A	uc001jzn.1	-	c.3354A>T	c.(3352-3354)GAA>GAT	p.E1118D		NM_007055	NP_008986	O14802	RPC1_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	1118					innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity|ribonucleoside binding|zinc ion binding				0	all_cancers(46;0.0356)|all_epithelial(25;0.00102)|Breast(12;0.00124)|Prostate(51;0.0095)		Epithelial(14;0.00161)|OV - Ovarian serous cystadenocarcinoma(4;0.00323)|all cancers(16;0.00646)											0.545455	13.442172	13.461214	6	5	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	79413759	79413759	12656	10	T	A	A	56	56	POLR3A	A	4	4
PTEN	5728	broad.mit.edu	36	10	89707695	89707695	+	Nonsense_Mutation	SNP	T	G	G			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89707695T>G	uc001kfb.1	+	c.740T>G	c.(739-741)TTA>TGA	p.L247*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	247	C2 tensin-type.				apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.L247*(3)|p.G165_K342del(1)|p.G165_*404del(1)|p.L247fs*4(1)|p.L247fs*5(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.683453	321.063665	325.224917	95	44	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	89707695	89707695	13192	10	T	G	G	61	61	PTEN	G	5	4
MMP12	4321	broad.mit.edu	36	11	102243314	102243314	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:102243314G>A	uc001phk.1	-	c.808C>T	c.(808-810)CGC>TGC	p.R270C		NM_002426	NP_002417	P39900	MMP12_HUMAN	matrix metalloproteinase 12 preproprotein	270					positive regulation of epithelial cell proliferation involved in wound healing|proteolysis|wound healing, spreading of epidermal cells	proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0		all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)		BRCA - Breast invasive adenocarcinoma(274;0.014)	Acetohydroxamic Acid(DB00551)									0.666667	57.555565	58.219395	18	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102243314	102243314	10041	11	G	A	A	40	40	MMP12	A	1	1
NAV2	89797	broad.mit.edu	36	11	19870687	19870687	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:19870687C>T	uc009yhw.1	+	c.971C>T	c.(970-972)CCA>CTA	p.P324L	NAV2_uc001mpp.1_Missense_Mutation_p.P237L|NAV2_uc001mpr.2_Missense_Mutation_p.P301L	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	324	Poly-Pro.					nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.310345	72.997185	75.782528	27	60	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19870687	19870687	10580	11	C	T	T	21	21	NAV2	T	2	2
STIM1	6786	broad.mit.edu	36	11	3945372	3945372	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:3945372G>C	uc001lyv.1	+	c.154G>C	c.(154-156)GAC>CAC	p.D52H	STIM1_uc009yef.1_Missense_Mutation_p.D52H	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	52	Extracellular (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)										0.333333	170.829004	175.262683	60	120	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3945372	3945372	15803	11	G	C	C	45	45	STIM1	C	3	3
ANO9	338440	broad.mit.edu	36	11	423459	423459	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:423459C>G	uc001lpi.2	-	c.205G>C	c.(205-207)GTG>CTG	p.V69L		NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	69	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4														0.375	7.322188	7.432193	3	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	423459	423459	712	11	C	G	G	18	18	ANO9	G	3	3
CHST1	8534	broad.mit.edu	36	11	45628317	45628317	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:45628317C>T	uc001mys.1	-	c.733G>A	c.(733-735)GAG>AAG	p.E245K	CHST1_uc009ykv.1_Missense_Mutation_p.E245K	NM_003654	NP_003645	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6)	245	Lumenal (Potential).				galactose metabolic process|inflammatory response|keratan sulfate metabolic process	Golgi membrane|integral to membrane	keratan sulfotransferase activity			pancreas(1)	1				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)										0.413793	33.975489	34.167659	12	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45628317	45628317	3531	11	C	T	T	31	31	CHST1	T	1	1
FOLH1	2346	broad.mit.edu	36	11	49164869	49164869	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:49164869C>T	uc001ngy.1	-	c.542G>A	c.(541-543)CGA>CAA	p.R181Q	FOLH1_uc001ngz.1_Missense_Mutation_p.R181Q|FOLH1_uc009yly.1_Missense_Mutation_p.R166Q|FOLH1_uc009ylz.1_Missense_Mutation_p.R166Q|FOLH1_uc009yma.1_Non-coding_Transcript	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	181	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)	1					Capromab(DB00089)|L-Glutamic Acid(DB00142)									0.486111	110.017437	110.029616	35	37	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49164869	49164869	6221	11	C	T	T	31	31	FOLH1	T	1	1
OR4P4	81300	broad.mit.edu	36	11	55162675	55162675	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55162675C>T	uc001nhr.1	+	c.266C>T	c.(265-267)ACC>ATC	p.T89I		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	89	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1														0.37963	228.097561	230.841682	82	134	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55162675	55162675	11490	11	C	T	T	18	18	OR4P4	T	2	2
C11orf9	745	broad.mit.edu	36	11	61309898	61309898	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61309898C>T	uc001nsc.1	+	c.3351C>T	c.(3349-3351)ACC>ACT	p.T1117T	C11orf9_uc001nse.1_Silent_p.T1077T	NM_001127392	NP_001120864	Q9Y2G1	MRF_HUMAN	hypothetical protein LOC745 isoform 2	1117					central nervous system myelination|positive regulation of myelination|positive regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1														0.545455	76.036693	76.109787	24	20	CC		KEEP	---	---	---	---	capture			Silent	SNP	61309898	61309898	1711	11	C	T	T	24	24	C11orf9	T	2	2
KSR2	283455	broad.mit.edu	36	12	116447209	116447209	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116447209G>A	uc001two.2	-	c.1963C>T	c.(1963-1965)CGC>TGC	p.R655C		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	684	Protein kinase.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.706522	205.603377	209.126131	65	27	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116447209	116447209	8905	12	G	A	A	39	39	KSR2	A	1	1
RARG	5916	broad.mit.edu	36	12	51891885	51891885	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51891885C>G	uc001sce.1	-	c.1207G>C	c.(1207-1209)GAG>CAG	p.E403Q	RARG_uc001scf.1_Missense_Mutation_p.E403Q|RARG_uc001scg.1_Missense_Mutation_p.E331Q|RARG_uc001scd.1_Missense_Mutation_p.E392Q	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	403	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)					80				0.369231	70.277175	71.256137	24	41	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	51891885	51891885	13514	12	C	G	G	30	30	RARG	G	3	3
ITGA7	3679	broad.mit.edu	36	12	54368913	54368913	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54368913C>G	uc001shh.1	-	c.2952G>C	c.(2950-2952)TGG>TGC	p.W984C	ITGA7_uc001shf.1_5'Flank|ITGA7_uc009znw.1_Missense_Mutation_p.W227C|ITGA7_uc009znx.1_Missense_Mutation_p.W861C|ITGA7_uc001shg.1_Missense_Mutation_p.W980C	NM_002206	NP_002197	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 2 precursor	1024	Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4										261				0.160377	32.613012	44.250757	17	89	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54368913	54368913	8185	12	C	G	G	30	30	ITGA7	G	3	3
RB1	5925	broad.mit.edu	36	13	47937506	47937506	+	Splice_Site_SNP	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:47937506G>A	uc001vcb.1	+	c.e23_splice_site				NM_000321	NP_000312			retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|transcription repressor activity|ubiquitin protein ligase binding			lung(93)|eye(89)|central_nervous_system(47)|bone(22)|breast(20)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|soft_tissue(8)|prostate(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	355		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)			6		568	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			0.470588	22.896977	22.909844	8	9	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	47937506	47937506	13559	13	G	A	A	44	44	RB1	A	5	2
GALNTL1	57452	broad.mit.edu	36	14	68875165	68875165	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:68875165G>A	uc010aqu.1	+	c.1012G>A	c.(1012-1014)GTC>ATC	p.V338I	GALNTL1_uc001xla.1_Missense_Mutation_p.V338I|GALNTL1_uc001xlb.1_Missense_Mutation_p.V338I	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	338	Catalytic subdomain B.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)										0.223529	89.792055	101.718033	38	132	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	68875165	68875165	6485	14	G	A	A	40	40	GALNTL1	A	1	1
SERPINA4	5267	broad.mit.edu	36	14	94099830	94099830	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:94099830C>T	uc010avd.1	+	c.369C>T	c.(367-369)TAC>TAT	p.Y123Y	SERPINA4_uc001ydk.1_Silent_p.Y86Y|SERPINA4_uc001ydl.1_Silent_p.Y86Y	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	86					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)	3				COAD - Colon adenocarcinoma(157;0.211)										0.371429	74.171372	75.171952	26	44	CC		KEEP	---	---	---	---	capture			Silent	SNP	94099830	94099830	14579	14	C	T	T	19	19	SERPINA4	T	1	1
BDKRB2	624	broad.mit.edu	36	14	95777341	95777341	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:95777341G>A	uc010avm.1	+	c.923G>A	c.(922-924)CGC>CAC	p.R308H	BDKRB2_uc010avl.1_3'UTR|BDKRB2_uc001yfg.2_Missense_Mutation_p.R308H	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2	308	Extracellular (Potential).				arachidonic acid secretion|elevation of cytosolic calcium ion concentration|inflammatory response|regulation of vascular permeability|regulation of vasoconstriction|smooth muscle contraction|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|kidney(1)	4		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)										0.518519	128.163329	128.188736	42	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95777341	95777341	1415	14	G	A	A	38	38	BDKRB2	A	1	1
TLN2	83660	broad.mit.edu	36	15	60820125	60820125	+	Missense_Mutation	SNP	A	C	C			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:60820125A>C	uc002alb.2	+	c.3890A>C	c.(3889-3891)AAA>ACA	p.K1297T	TLN2_uc002alc.2_5'UTR	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	1297					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cell-cell junction|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(4)|breast(2)	6														0.116466	11.999464	48.096885	29	220	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60820125	60820125	16478	15	A	C	C	1	1	TLN2	C	4	4
TLN2	83660	broad.mit.edu	36	15	60898854	60898854	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:60898854G>T	uc002alb.2	+	c.6858G>T	c.(6856-6858)CAG>CAT	p.Q2286H	TLN2_uc002alc.2_Missense_Mutation_p.Q679H	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2	2286					cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cell-cell junction|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(4)|breast(2)	6														0.424658	76.195457	76.559538	31	42	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60898854	60898854	16478	15	G	T	T	35	35	TLN2	T	3	3
RLBP1	6017	broad.mit.edu	36	15	87554606	87554606	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:87554606C>T	uc002bnl.1	-	c.868G>A	c.(868-870)GGG>AGG	p.G290R		NM_000326	NP_000317	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1	290	CRAL-TRIO.				response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity			central_nervous_system(1)	1	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)									0.46875	85.639063	85.693594	30	34	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87554606	87554606	13865	15	C	T	T	23	23	RLBP1	T	1	1
ITGAM	3684	broad.mit.edu	36	16	31216599	31216599	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31216599C>T	uc002ebr.1	+	c.1533C>T	c.(1531-1533)TAC>TAT	p.Y511Y	ITGAM_uc002ebq.1_Silent_p.Y510Y|ITGAM_uc010cam.1_Intron|ITGAM_uc010can.1_Intron	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M precursor	510	FG-GAP 6.|Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1														0.425439	287.266152	288.363239	97	131	CC		KEEP	---	---	---	---	capture			Silent	SNP	31216599	31216599	8191	16	C	T	T	19	19	ITGAM	T	1	1
ADCY9	115	broad.mit.edu	36	16	4104163	4104163	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4104163G>A	uc002cvx.1	-	c.1282C>T	c.(1282-1284)CGC>TGC	p.R428C		NM_001116	NP_001107	O60503	ADCY9_HUMAN	adenylate cyclase 9	428	Cytoplasmic (Potential).|Guanylate cyclase 1.				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)|large_intestine(1)	5														0.333333	9.564723	9.936374	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4104163	4104163	302	16	G	A	A	39	39	ADCY9	A	1	1
TOX3	27324	broad.mit.edu	36	16	51030758	51030758	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:51030758G>A	uc002egv.1	-	c.1611C>T	c.(1609-1611)GCC>GCT	p.A537A	TOX3_uc002egw.1_Silent_p.A499A	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	537	Gln-rich.				negative regulation of neuron apoptosis|positive regulation of anti-apoptosis	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity|transcription activator activity				0										182				0.203704	20.287623	24.702245	11	43	GG		KEEP	---	---	---	---	capture			Silent	SNP	51030758	51030758	16921	16	G	A	A	35	35	TOX3	A	2	2
RHBDF1	64285	broad.mit.edu	36	16	52558	52558	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:52558G>C	uc002cfl.2	-	c.931C>G	c.(931-933)CTT>GTT	p.L311V	RHBDF1_uc010bqo.1_Non-coding_Transcript	NM_022450	NP_071895	Q96CC6	RHDF1_HUMAN	rhomboid family 1	311	Cytoplasmic (Potential).				cell migration|cell proliferation|negative regulation of protein secretion|regulation of epidermal growth factor receptor signaling pathway|regulation of proteasomal protein catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)												0.366667	31.214892	31.684577	11	19	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	52558	52558	13794	16	G	C	C	34	34	RHBDF1	C	3	3
ZFP90	146198	broad.mit.edu	36	16	67155008	67155008	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:67155008C>T	uc010cff.1	+	c.817C>T	c.(817-819)CAG>TAG	p.Q273*	ZFP90_uc002ewb.1_Silent_p.I78I|ZFP90_uc002ewc.1_Silent_p.I78I|ZFP90_uc002ewd.1_Nonsense_Mutation_p.Q273*|ZFP90_uc002ewe.1_Nonsense_Mutation_p.Q273*	NM_133458	NP_597715	Q8TF47	ZFP90_HUMAN	zinc finger protein 90	273	C2H2-type 2.				transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00233)|Epithelial(162;0.0184)|all cancers(182;0.0946)										0.183246	72.613061	90.602718	35	156	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	67155008	67155008	18243	16	C	T	T	29	29	ZFP90	T	5	2
FAM83G	644815	broad.mit.edu	36	17	18832418	18832418	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18832418A>G	uc002guw.1	-	c.557T>C	c.(556-558)GTG>GCG	p.V186A	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002guv.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	186										ovary(1)	1														0.228571	11.87274	14.249228	8	27	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18832418	18832418	5865	17	A	G	G	6	6	FAM83G	G	4	4
KRT25	147183	broad.mit.edu	36	17	36161062	36161062	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36161062C>T	uc002hve.1	-	c.712G>A	c.(712-714)GTG>ATG	p.V238M		NM_181534	NP_853512	Q7Z3Z0	K1C25_HUMAN	keratin 25	238	Rod.|Linker 12.					cytoplasm|intermediate filament	structural molecule activity			ovary(2)	2		Breast(137;0.00526)												0.125	64.349017	118.179827	49	343	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36161062	36161062	8777	17	C	T	T	19	19	KRT25	T	1	1
FADS6	283985	broad.mit.edu	36	17	70386114	70386114	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:70386114G>A	uc002jmd.1	-	c.994C>T	c.(994-996)CGT>TGT	p.R332C		NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6	338					fatty acid biosynthetic process|oxidation-reduction process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)													0.211321	129.226085	149.601925	56	209	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70386114	70386114	5565	17	G	A	A	39	39	FADS6	A	1	1
FXR2	9513	broad.mit.edu	36	17	7448084	7448084	+	Missense_Mutation	SNP	A	C	C			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7448084A>C	uc002gia.1	-	c.268T>G	c.(268-270)TGG>GGG	p.W90G		NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related	90						cytosolic large ribosomal subunit	protein binding|RNA binding	p.0?(1)|p.?(1)			0				READ - Rectum adenocarcinoma(115;0.17)										0.5	7.245681	7.245681	4	4	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7448084	7448084	6367	17	A	C	C	6	6	FXR2	C	4	4
TP53	7157	broad.mit.edu	36	17	7518264	7518264	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518264G>A	uc002gim.2	-	c.742C>T	c.(742-744)CGG>TGG	p.R248W	TP53_uc002gig.1_Missense_Mutation_p.R248W|TP53_uc002gih.1_Missense_Mutation_p.R248W|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R116W|TP53_uc010cng.1_Missense_Mutation_p.R116W|TP53_uc002gii.1_Missense_Mutation_p.R116W|TP53_uc010cnh.1_Missense_Mutation_p.R248W|TP53_uc010cni.1_Missense_Mutation_p.R248W|TP53_uc002gij.2_Missense_Mutation_p.R248W|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.R155W|TP53_uc002gio.2_Missense_Mutation_p.R116W	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	248	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|NR -> IP (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R248W(438)|p.R248G(11)|p.0?(6)|p.R248Q(4)|p.R248R(2)|p.N247_R248delNR(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248_P250delRRP(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)	R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO680N_OESOPHAGUS)|R248W(SW837_LARGE_INTESTINE)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(RD_SOFT_TISSUE)|R248W(VCAP_PROSTATE)|R248W(JIMT1_BREAST)|R248W(GCT_SOFT_TISSUE)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(786O_KIDNEY)|R248W(COLO320_LARGE_INTESTINE)|R248W(LXF289_LUNG)|R248W(LUDLU1_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(HCC2157_BREAST)	111	p.R248W(SW837-Tumor)|p.R248W(786O-Tumor)|p.R248W(LUDLU1-Tumor)|p.R248W(VCAP-Tumor)|p.R248*(DB-Tumor)|p.R248W(MIAPACA2-Tumor)|p.R248W(HCC2157-Tumor)|p.R248W(LXF289-Tumor)|p.R248G(8505C-Tumor)|p.R248A(SF126-Tumor)|p.R248W(SET2-Tumor)|p.R248W(KO52-Tumor)|p.R248W(SNU1040-Tumor)|p.R248W(GCT-Tumor)|p.R248W(JIMT1-Tumor)|p.R248W(COLO320-Tumor)|p.R248W(CAS1-Tumor)|p.R248W(NCIH2106-Tumor)|p.R248W(SNUC5-Tumor)|p.R248W(COLO680N-Tumor)|p.R248W(RD-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.862694	1166.303643	1215.446577	333	53	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7518264	7518264	16923	17	G	A	A	39	39	TP53	A	1	1
EMILIN2	84034	broad.mit.edu	36	18	2882329	2882329	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:2882329G>A	uc002kln.1	+	c.2204G>A	c.(2203-2205)AGC>AAC	p.S735N		NM_032048	NP_114437	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	735					cell adhesion	collagen	extracellular matrix constituent conferring elasticity|protein binding			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.1)										0.305085	45.545714	47.535838	18	41	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2882329	2882329	5286	18	G	A	A	34	34	EMILIN2	A	2	2
LAMA1	284217	broad.mit.edu	36	18	6972546	6972546	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:6972546C>T	uc002knm.1	-	c.5840G>A	c.(5839-5841)CGC>CAC	p.R1947H		NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	1947	Domain II and I.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|breast(2)|pancreas(2)|central_nervous_system(1)	17		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)					1597				0.333333	209.931391	215.304247	73	146	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6972546	6972546	8928	18	C	T	T	27	27	LAMA1	T	1	1
GALR1	2587	broad.mit.edu	36	18	73091926	73091926	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:73091926C>A	uc002lms.2	+	c.434C>A	c.(433-435)TCC>TAC	p.S145Y		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	145	Cytoplasmic (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity				0		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)										0.6	6.52069	6.563568	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73091926	73091926	6491	18	C	A	A	30	30	GALR1	A	3	3
NPHS1	4868	broad.mit.edu	36	19	41024488	41024488	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:41024488C>T	uc002oby.2	-	c.2784G>A	c.(2782-2784)TCG>TCA	p.S928S	NPHS1_uc010eem.1_5'Flank	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	928	Ig-like C2-type 8.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)	4	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)											0.423913	120.715112	121.178095	39	53	CC		KEEP	---	---	---	---	capture			Silent	SNP	41024488	41024488	10986	19	C	T	T	23	23	NPHS1	T	1	1
EBI3	10148	broad.mit.edu	36	19	4187976	4187977	+	Missense_Mutation	DNP	GG	AC	AC			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:4187976_4187977GG>AC	uc002lzu.1	+	c.581_582GG>AC	c.(580-582)CGG>CAC	p.R194H		NM_005755	NP_005746	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3 precursor	194	Fibronectin type-III 2.				humoral immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of interferon-gamma biosynthetic process|T-helper 1 type immune response	extracellular space|plasma membrane	cytokine activity|cytokine receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)										0.15625	7.999027	15.249119	10	54	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	4187976	4187977	5070	19	GG	AC	AC	39	39	EBI3	AC	1	1
UHRF1	29128	broad.mit.edu	36	19	4883838	4883838	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:4883838G>A	uc002mbp.1	+	c.694G>A	c.(694-696)GTG>ATG	p.V232M	UHRF1_uc002mbo.1_Missense_Mutation_p.V219M|UHRF1_uc010duf.1_Non-coding_Transcript	NM_013282	NP_037414	Q96T88	UHRF1_HUMAN	ubiquitin-like with PHD and ring finger domains	219					cell cycle|cell proliferation|DNA repair|regulation of transcription from RNA polymerase II promoter	nucleus	acid-amino acid ligase activity|methyl-CpG binding|methylated histone residue binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity|zinc ion binding				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0276)										0.12963	71.951516	129.620776	56	376	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4883838	4883838	17525	19	G	A	A	44	44	UHRF1	A	2	2
ZNF611	81856	broad.mit.edu	36	19	57900095	57900095	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:57900095C>G	uc002pzz.1	-	c.2025G>C	c.(2023-2025)GAG>GAC	p.E675D	ZNF611_uc010eqc.1_Non-coding_Transcript|ZNF611_uc002qaa.2_Missense_Mutation_p.E605D	NM_030972	NP_112234	Q8N823	ZN611_HUMAN	zinc finger protein 611	675					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.0233)|GBM - Glioblastoma multiforme(134;0.04)										0.439655	319.11799	319.853631	102	130	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57900095	57900095	18632	19	C	G	G	32	32	ZNF611	G	3	3
SYT5	6861	broad.mit.edu	36	19	60381410	60381411	+	Missense_Mutation	DNP	TC	GG	GG			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:60381410_60381411TC>GG	uc002qjm.1	-	c.217_218GA>CC	c.(217-219)GAA>CCA	p.E73P	SYT5_uc002qjn.1_Missense_Mutation_p.E73P|SYT5_uc002qjo.1_Missense_Mutation_p.E73P|SYT5_uc002qjp.1_Intron	NM_003180	NP_003171	O00445	SYT5_HUMAN	synaptotagmin V	73	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion|synaptic transmission	cell junction|integral to membrane|recycling endosome membrane|synaptic vesicle membrane	metal ion binding|transporter activity				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)										0.375	11.134552	11.357855	6	10	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	60381410	60381411	15998	19	TC	GG	GG	62	62	SYT5	GG	4	4
COL11A1	1301	broad.mit.edu	36	1	103127706	103127706	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:103127706C>T	uc001dum.1	-	c.4393G>A	c.(4393-4395)GGA>AGA	p.G1465R	COL11A1_uc001duk.1_Missense_Mutation_p.G649R|COL11A1_uc001dul.1_Missense_Mutation_p.G1453R|COL11A1_uc001dun.1_Missense_Mutation_p.G1414R|COL11A1_uc009weh.1_Missense_Mutation_p.G1337R	NM_080629	NP_542196	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform B	1453	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|central_nervous_system(1)|pancreas(1)	11		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)										0.347826	43.484925	44.425579	16	30	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103127706	103127706	3805	1	C	T	T	22	22	COL11A1	T	2	2
POGK	57645	broad.mit.edu	36	1	165085176	165085176	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:165085176G>A	uc001gdt.1	+	c.736G>A	c.(736-738)GCC>ACC	p.A246T		NM_017542	NP_060012	Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	246					multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1						GBM(76;192 1530 30153 48742)								0.65625	71.985797	72.676918	21	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	165085176	165085176	12613	1	G	A	A	38	38	POGK	A	1	1
KIF14	9928	broad.mit.edu	36	1	198829422	198829422	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:198829422C>T	uc001gvh.1	-	c.2648G>A	c.(2647-2649)CGT>CAT	p.R883H		NM_014875	NP_055690	Q15058	KIF14_HUMAN	kinesin family member 14	883	FHA.				microtubule-based movement	cytoplasm|microtubule|nucleus|spindle	ATP binding|microtubule motor activity|protein binding			breast(3)|ovary(2)	5														0.294118	51.575286	54.154145	20	48	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	198829422	198829422	8587	1	C	T	T	19	19	KIF14	T	1	1
LEFTY2	7044	broad.mit.edu	36	1	224191917	224191917	+	Silent	SNP	A	G	G			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:224191917A>G	uc001hpt.1	-	c.948T>C	c.(946-948)TGT>TGC	p.C316C	LEFTY2_uc009xek.1_Non-coding_Transcript	NM_003240	NP_003231	O00292	LFTY2_HUMAN	endometrial bleeding associated factor	316					cell growth|multicellular organismal development|platelet activation|platelet degranulation|transforming growth factor beta receptor signaling pathway	extracellular space|platelet alpha granule lumen	cytokine activity|growth factor activity|transforming growth factor beta receptor binding				0	Breast(184;0.197)					Colon(172;116 2643 9098 43333)								0.478261	50.731858	50.751286	22	24	AA		KEEP	---	---	---	---	capture			Silent	SNP	224191917	224191917	9040	1	A	G	G	14	14	LEFTY2	G	4	4
KIAA1804	84451	broad.mit.edu	36	1	231574454	231574454	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:231574454C>T	uc001hvt.2	+	c.1600C>T	c.(1600-1602)CGG>TGG	p.R534W	KIAA1804_uc001hvs.1_Missense_Mutation_p.R534W	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	534					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)	7		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)								196				0.251497	98.265945	107.643658	42	125	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	231574454	231574454	8570	1	C	T	T	19	19	KIAA1804	T	1	1
TARBP1	6894	broad.mit.edu	36	1	232673565	232673565	+	Missense_Mutation	SNP	T	G	G			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:232673565T>G	uc001hwd.1	-	c.1091A>C	c.(1090-1092)GAG>GCG	p.E364A		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	364					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)	2	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)											0.210526	11.570135	14.528614	8	30	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	232673565	232673565	16076	1	T	G	G	54	54	TARBP1	G	4	4
RYR2	6262	broad.mit.edu	36	1	235844240	235844240	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:235844240C>T	uc001hyl.1	+	c.5189C>T	c.(5188-5190)ACG>ATG	p.T1730M		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1730	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)											0.328413	252.303713	259.367463	89	182	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	235844240	235844240	14249	1	C	T	T	19	19	RYR2	T	1	1
RYR2	6262	broad.mit.edu	36	1	235863521	235863521	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:235863521G>A	uc001hyl.1	+	c.6576G>A	c.(6574-6576)ATG>ATA	p.M2192I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2192	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)											0.298551	293.992869	306.505392	103	242	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	235863521	235863521	14249	1	G	A	A	47	47	RYR2	A	2	2
ZMYM1	79830	broad.mit.edu	36	1	35352789	35352789	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:35352789C>T	uc001bym.1	+	c.2771C>T	c.(2770-2772)ACC>ATC	p.T924I	ZMYM1_uc001byn.1_Missense_Mutation_p.T924I|ZMYM1_uc001byo.1_Missense_Mutation_p.T564I|ZMYM1_uc009vut.1_Missense_Mutation_p.T849I	NM_024772	NP_079048	Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM domain containing 1	924						nucleus	nucleic acid binding|protein dimerization activity|zinc ion binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)												0.333333	6.519811	6.742312	3	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35352789	35352789	18290	1	C	T	T	18	18	ZMYM1	T	2	2
TMC2	117532	broad.mit.edu	36	20	2545904	2545904	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:2545904G>A	uc002wgf.1	+	c.2127G>A	c.(2125-2127)CCG>CCA	p.P709P	TMC2_uc002wgg.1_Silent_p.P693P	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2	709	Helical; (Potential).					integral to membrane				ovary(3)	3														0.588	470.418838	472.105867	147	103	GG		KEEP	---	---	---	---	capture			Silent	SNP	2545904	2545904	16515	20	G	A	A	39	39	TMC2	A	1	1
ASXL1	171023	broad.mit.edu	36	20	30480878	30480878	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:30480878A>G	uc002wxs.1	+	c.548A>G	c.(547-549)CAC>CGC	p.H183R	ASXL1_uc010gea.1_Missense_Mutation_p.H183R|ASXL1_uc010geb.1_Missense_Mutation_p.H125R	NM_015338	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like 1	183					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	PR-DUB complex	metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(131)|large_intestine(6)|central_nervous_system(2)|ovary(1)	140														0.397727	204.602895	206.216068	70	106	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30480878	30480878	1085	20	A	G	G	6	6	ASXL1	G	4	4
BPIL3	128859	broad.mit.edu	36	20	31089120	31089120	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:31089120C>T	uc002wyk.1	+	c.761C>T	c.(760-762)TCG>TTG	p.S254L	BPIL3_uc002wyl.1_Missense_Mutation_p.S193L	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN	bactericidal/permeability-increasing	254						extracellular region	lipid binding			ovary(1)|pancreas(1)	2														0.31068	170.636117	177.20658	64	142	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31089120	31089120	1521	20	C	T	T	31	31	BPIL3	T	1	1
PRPF6	24148	broad.mit.edu	36	20	62129412	62129412	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:62129412C>A	uc002yho.1	+	c.2218C>A	c.(2218-2220)CCC>ACC	p.P740T	PRPF6_uc002yhp.1_Missense_Mutation_p.P700T	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog	740	HAT 8.				assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)													0.170732	6.828143	11.02236	7	34	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	62129412	62129412	13017	20	C	A	A	30	30	PRPF6	A	3	3
KCNJ6	3763	broad.mit.edu	36	21	38008856	38008856	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr21:38008856C>T	uc002ywo.1	-	c.474G>A	c.(472-474)CGG>CGA	p.R158R		NM_002240	NP_002231	P48051	IRK6_HUMAN	potassium inwardly-rectifying channel J6	158	Extracellular (By similarity).				synaptic transmission	Golgi apparatus|voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding				0					Halothane(DB01159)	Pancreas(48;379 1118 2936 19024 28214)								0.241379	10.502147	12.28148	7	22	CC		KEEP	---	---	---	---	capture			Silent	SNP	38008856	38008856	8360	21	C	T	T	22	22	KCNJ6	T	2	2
GGT5	2687	broad.mit.edu	36	22	22952120	22952120	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr22:22952120C>T	uc002zzp.2	-	c.1153G>A	c.(1153-1155)GGG>AGG	p.G385R	GGT5_uc002zzo.2_Missense_Mutation_p.G385R|GGT5_uc002zzr.2_Missense_Mutation_p.G353R|GGT5_uc002zzq.2_Missense_Mutation_p.G353R	NM_001099781	NP_001093251	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5 isoform a	385	Extracellular (Potential).				glutathione biosynthetic process|hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process	integral to membrane|plasma membrane	acyltransferase activity|gamma-glutamyltransferase activity			ovary(2)	2														0.333333	13.869837	14.238929	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22952120	22952120	6630	22	C	T	T	23	23	GGT5	T	1	1
MICALL1	85377	broad.mit.edu	36	22	36657769	36657769	+	Missense_Mutation	SNP	T	G	G			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr22:36657769T>G	uc003aui.1	+	c.1899T>G	c.(1897-1899)AAT>AAG	p.N633K		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	633	Pro-rich.					cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)													0.186047	9.265112	13.254601	8	35	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36657769	36657769	9963	22	T	G	G	50	50	MICALL1	G	4	4
IWS1	55677	broad.mit.edu	36	2	127979382	127979382	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:127979382T>A	uc002ton.1	-	c.567A>T	c.(565-567)GAA>GAT	p.E189D	IWS1_uc010fma.1_5'UTR	NM_017969	NP_060439	Q96ST2	IWS1_HUMAN	IWS1 homolog	189	Glu-rich.					nucleus	DNA binding|transcription regulator activity			ovary(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)										0.40411	169.138377	170.325342	59	87	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	127979382	127979382	8235	2	T	A	A	60	60	IWS1	A	4	4
LRP1B	53353	broad.mit.edu	36	2	140931585	140931585	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:140931585G>A	uc002tvj.1	-	c.9731C>T	c.(9730-9732)TCG>TTG	p.S3244L		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3244	Extracellular (Potential).|LDL-receptor class B 32.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|ovary(10)|pancreas(3)|central_nervous_system(2)|liver(1)|kidney(1)	34		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		Colon(99;50 2074 2507 20106)				2546	TSP Lung(27;0.18)			0.411765	279.799885	281.297719	91	130	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	140931585	140931585	9328	2	G	A	A	37	37	LRP1B	A	1	1
FIGN	55137	broad.mit.edu	36	2	164174485	164174485	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:164174485C>T	uc002uck.1	-	c.2103G>A	c.(2101-2103)GTG>GTA	p.V701V		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	701						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)	3														0.123596	14.368196	26.697655	11	78	CC		KEEP	---	---	---	---	capture			Silent	SNP	164174485	164174485	6129	2	C	T	T	21	21	FIGN	T	2	2
TTN	7273	broad.mit.edu	36	2	179144633	179144633	+	Silent	SNP	A	G	G			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:179144633A>G	uc002umr.1	-	c.66768T>C	c.(66766-66768)GAT>GAC	p.D22256D	TTN_uc002ums.1_Silent_p.D15951D|TTN_uc010frc.1_Silent_p.D15884D|TTN_uc010frd.1_Silent_p.D15759D	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23183										ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)							8722				0.479167	71.323789	71.341717	23	25	AA		KEEP	---	---	---	---	capture			Silent	SNP	179144633	179144633	17290	2	A	G	G	16	16	TTN	G	4	4
SLC11A1	6556	broad.mit.edu	36	2	218955981	218955981	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:218955981C>T	uc002vhv.1	+	c.62C>T	c.(61-63)CCG>CTG	p.P21L	SLC11A1_uc010fvp.1_Missense_Mutation_p.P21L|SLC11A1_uc010fvq.1_Intron|SLC11A1_uc002vhu.1_5'UTR|SLC11A1_uc002vhw.1_5'UTR	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein	21	Pro/Ser-rich.|Cytoplasmic (Potential).				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)										0.515152	53.674959	53.681598	17	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	218955981	218955981	14875	2	C	T	T	23	23	SLC11A1	T	1	1
PLCD4	84812	broad.mit.edu	36	2	219191718	219191718	+	Silent	SNP	G	T	T			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:219191718G>T	uc002vij.1	+	c.354G>T	c.(352-354)GGG>GGT	p.G118G	PLCD4_uc002vik.1_5'Flank	NM_032726	NP_116115	Q9BRC7	PLCD4_HUMAN	phospholipase C, delta 4	118	PH.				intracellular signal transduction|lipid catabolic process	endoplasmic reticulum|membrane|nucleus	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)	3		Renal(207;0.0915)		Epithelial(149;5.11e-07)|all cancers(144;0.000104)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)										0.2	6.932303	9.452071	6	24	GG		KEEP	---	---	---	---	capture			Silent	SNP	219191718	219191718	12459	2	G	T	T	42	42	PLCD4	T	3	3
KIAA1486	57624	broad.mit.edu	36	2	226086515	226086515	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:226086515C>T	uc002voe.2	+	c.406C>T	c.(406-408)CGG>TGG	p.R136W	KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	136										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)										0.381818	180.854413	182.848949	63	102	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	226086515	226086515	8546	2	C	T	T	19	19	KIAA1486	T	1	1
MLPH	79083	broad.mit.edu	36	2	238084136	238084136	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:238084136G>A	uc002vwt.1	+	c.291G>A	c.(289-291)CCG>CCA	p.P97P	MLPH_uc002vws.1_Silent_p.P97P|MLPH_uc010fyt.1_Silent_p.P97P|MLPH_uc002vwu.1_Silent_p.P97P|MLPH_uc002vwv.1_Silent_p.P97P|MLPH_uc002vww.1_Silent_p.P73P	NM_024101	NP_077006	Q9BV36	MELPH_HUMAN	melanophilin isoform 1	97	FYVE-type.|RabBD.						zinc ion binding			ovary(1)	1		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)										0.16	35.926103	49.684758	20	105	GG		KEEP	---	---	---	---	capture			Silent	SNP	238084136	238084136	10023	2	G	A	A	39	39	MLPH	A	1	1
TRAF3IP1	26146	broad.mit.edu	36	2	238899314	238899314	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:238899314G>A	uc002vye.1	+	c.318G>A	c.(316-318)GAG>GAA	p.E106E	TRAF3IP1_uc002vyf.1_Silent_p.E106E	NM_015650	NP_056465	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting	106	Abolishes microtubules-binding when missing.					cytoplasm|cytoskeleton	protein binding			ovary(1)	1		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)										0.192308	12.107476	16.72705	10	42	GG		KEEP	---	---	---	---	capture			Silent	SNP	238899314	238899314	16984	2	G	A	A	34	34	TRAF3IP1	A	2	2
C2orf7	84279	broad.mit.edu	36	2	73310815	73310815	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73310815C>T	uc002siy.1	-	c.102G>A	c.(100-102)GTG>GTA	p.V34V		NM_032319	NP_115695	Q9BSG0	PADC1_HUMAN	chromosome 2 open reading frame 7	34						extracellular region					0														0.153846	13.665053	19.624569	8	44	CC		KEEP	---	---	---	---	capture			Silent	SNP	73310815	73310815	2277	2	C	T	T	25	25	C2orf7	T	2	2
ITPR1	3708	broad.mit.edu	36	3	4749885	4749885	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:4749885C>T	uc003bqa.2	+	c.5190C>T	c.(5188-5190)CCC>CCT	p.P1730P	ITPR1_uc010hca.1_Silent_p.P1715P|ITPR1_uc003bqc.2_Silent_p.P700P	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	1778	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			ovary(4)|breast(2)|large_intestine(1)|kidney(1)|liver(1)|skin(1)|pancreas(1)	11				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)						2114				0.451327	477.761011	478.454775	153	186	CC		KEEP	---	---	---	---	capture			Silent	SNP	4749885	4749885	8224	3	C	T	T	23	23	ITPR1	T	1	1
APEH	327	broad.mit.edu	36	3	49693059	49693059	+	Missense_Mutation	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:49693059C>T	uc010hkw.1	+	c.1292C>T	c.(1291-1293)CCA>CTA	p.P431L	APEH_uc003cxf.1_Missense_Mutation_p.P431L	NM_001640	NP_001631	P13798	ACPH_HUMAN	N-acylaminoacyl-peptide hydrolase	431					proteolysis	cytoplasm|nuclear membrane	serine-type endopeptidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)										0.151515	9.154276	12.991447	5	28	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49693059	49693059	778	3	C	T	T	21	21	APEH	T	2	2
AIMP1	9255	broad.mit.edu	36	4	107468061	107468061	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:107468061G>A	uc003hyg.1	+	c.114G>A	c.(112-114)TTG>TTA	p.L38L	AIMP1_uc003hyh.1_Silent_p.L38L	NM_004757	NP_004748	Q12904	AIMP1_HUMAN	small inducible cytokine subfamily E, member 1	38	Required for fibroblast proliferation.				angiogenesis|apoptosis|cell adhesion|cell-cell signaling|chemotaxis|glucose metabolic process|inflammatory response|leukocyte migration|negative regulation of endothelial cell proliferation|signal transduction|tRNA aminoacylation for protein translation	aminoacyl-tRNA synthetase multienzyme complex|cytosol|endoplasmic reticulum|extracellular space|Golgi apparatus|nucleus|transport vesicle	cell surface binding|cytokine activity|protein homodimerization activity|tRNA binding				0														0.2	7.116039	8.371829	3	12	GG		KEEP	---	---	---	---	capture			Silent	SNP	107468061	107468061	436	4	G	A	A	46	46	AIMP1	A	2	2
CRMP1	1400	broad.mit.edu	36	4	5888681	5888681	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:5888681G>A	uc003gis.1	-	c.1485C>T	c.(1483-1485)GTC>GTT	p.V495V	CRMP1_uc003gin.1_Silent_p.V293V|CRMP1_uc003gip.1_Silent_p.V381V|CRMP1_uc003giq.1_Silent_p.V381V|CRMP1_uc003gir.1_Silent_p.V376V	NM_001014809	NP_001014809	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 1	381					axon guidance|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(1)	1				Colorectal(103;0.0721)										0.283019	41.002031	43.24392	15	38	GG		KEEP	---	---	---	---	capture			Silent	SNP	5888681	5888681	4029	4	G	A	A	37	37	CRMP1	A	1	1
WFS1	7466	broad.mit.edu	36	4	6354201	6354201	+	Missense_Mutation	SNP	A	G	G			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:6354201A>G	uc003gix.1	+	c.1778A>G	c.(1777-1779)GAG>GGG	p.E593G	WFS1_uc003giy.1_Missense_Mutation_p.E593G|WFS1_uc003giz.1_Missense_Mutation_p.E411G	NM_006005	NP_005996	O76024	WFS1_HUMAN	wolframin	593	Helical; (Potential).				endoplasmic reticulum calcium ion homeostasis|endoplasmic reticulum unfolded protein response|ER overload response|ER-associated protein catabolic process|glucose homeostasis|kidney development|negative regulation of neuron apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|polyubiquitinated misfolded protein transport|positive regulation of calcium ion transport|positive regulation of growth|positive regulation of protein ubiquitination|positive regulation of proteolysis|protein maturation by protein folding|protein stabilization|renal water homeostasis|sensory perception of sound|visual perception	dendrite|integral to endoplasmic reticulum membrane	activating transcription factor binding|ATPase binding|transporter activity|ubiquitin protein ligase binding			central_nervous_system(2)	2				Colorectal(103;0.0512)										0.294118	8.661441	9.311194	5	12	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6354201	6354201	17934	4	A	G	G	11	11	WFS1	G	4	4
RASSF6	166824	broad.mit.edu	36	4	74660874	74660874	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:74660874G>A	uc003hhd.1	-	c.1052C>T	c.(1051-1053)GCG>GTG	p.A351V	RASSF6_uc003hhc.1_Missense_Mutation_p.A319V|RASSF6_uc010iik.1_Missense_Mutation_p.A285V|RASSF6_uc010iil.1_Missense_Mutation_p.A307V	NM_201431	NP_803876	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6	351	SARAH.				apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)											0.869565	69.015744	72.071486	20	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74660874	74660874	13551	4	G	A	A	38	38	RASSF6	A	1	1
FRAS1	80144	broad.mit.edu	36	4	79426659	79426659	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:79426659C>T	uc003hkx.2	+	c.1476C>T	c.(1474-1476)CAC>CAT	p.H492H	FRAS1_uc003hkw.2_Silent_p.H492H|FRAS1_uc003hky.1_Silent_p.H196H|FRAS1_uc003hkz.2_Silent_p.H196H|FRAS1_uc003hla.1_Silent_p.H3H	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1	492	FU 2.|Extracellular (Potential).				cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5														0.727848	378.78556	386.19776	115	43	CC		KEEP	---	---	---	---	capture			Silent	SNP	79426659	79426659	6288	4	C	T	T	19	19	FRAS1	T	1	1
FAM170A	340069	broad.mit.edu	36	5	118998188	118998188	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:118998188G>A	uc003ksm.1	+	c.846G>A	c.(844-846)GAG>GAA	p.E282E	FAM170A_uc003ksl.1_Intron|FAM170A_uc003ksn.1_Silent_p.E282E|FAM170A_uc003kso.1_Silent_p.E235E	NM_182761	NP_877438	A1A519	F170A_HUMAN	family with sequence similarity 170, member A	282	Glu-rich.					intracellular	zinc ion binding				0														0.288136	255.801241	270.0568	102	252	GG		KEEP	---	---	---	---	capture			Silent	SNP	118998188	118998188	5693	5	G	A	A	35	35	FAM170A	A	2	2
SLC34A1	6569	broad.mit.edu	36	5	176746126	176746126	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176746126G>A	uc003mgk.2	+	c.485G>A	c.(484-486)AGC>AAC	p.S162N		NM_003052	NP_003043	Q06495	NPT2A_HUMAN	solute carrier family 34 (sodium phosphate),	162	Helical; Name=M2; (Potential).				phosphate ion homeostasis|response to cadmium ion|response to lead ion|response to mercury ion|sodium ion transport	brush border membrane|integral to plasma membrane	protein binding|sodium-dependent phosphate transmembrane transporter activity|symporter activity			ovary(1)	1	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.246377	42.649469	46.684843	17	52	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	176746126	176746126	15064	5	G	A	A	34	34	SLC34A1	A	2	2
TBC1D9B	23061	broad.mit.edu	36	5	179229994	179229994	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:179229994G>T	uc003mlh.1	-	c.2592C>A	c.(2590-2592)TTC>TTA	p.F864L	TBC1D9B_uc003mlg.1_Missense_Mutation_p.F40L|TBC1D9B_uc003mli.1_Missense_Mutation_p.F864L|TBC1D9B_uc003mlj.1_Missense_Mutation_p.F864L|TBC1D9B_uc003mlk.1_Missense_Mutation_p.F22L	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	864						integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)	1	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)											0.473684	25.871592	25.883147	9	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	179229994	179229994	16154	5	G	T	T	41	41	TBC1D9B	T	3	3
CDH10	1008	broad.mit.edu	36	5	24545661	24545661	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:24545661G>T	uc003jgr.1	-	c.1027C>A	c.(1027-1029)CTT>ATT	p.L343I		NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	343	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)										0.384615	61.990088	62.596164	20	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24545661	24545661	3225	5	G	T	T	36	36	CDH10	T	3	3
TRDN	10345	broad.mit.edu	36	6	123860079	123860079	+	Nonsense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:123860079G>A	uc003pzj.1	-	c.811C>T	c.(811-813)CGA>TGA	p.R271*	TRDN_uc003pzk.1_Nonsense_Mutation_p.R271*|TRDN_uc003pzl.1_Nonsense_Mutation_p.R271*|TRDN_uc010ken.1_Intron	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	271	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)										0.875	24.947603	26.029728	7	1	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	123860079	123860079	17012	6	G	A	A	37	37	TRDN	A	5	1
DHX16	8449	broad.mit.edu	36	6	30740559	30740559	+	Nonsense_Mutation	SNP	C	A	A			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:30740559C>A	uc003nqz.1	-	c.1315G>T	c.(1315-1317)GAG>TAG	p.E439*	DHX16_uc003nqy.1_5'Flank	NM_003587	NP_003578	O60231	DHX16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 16	439	Helicase ATP-binding.				mRNA processing|RNA splicing	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|RNA helicase activity			ovary(2)|kidney(2)	4														0.12628	46.971075	86.920667	37	256	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	30740559	30740559	4681	6	C	A	A	30	30	DHX16	A	5	3
GRM4	2914	broad.mit.edu	36	6	34112026	34112026	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:34112026G>A	uc003oir.2	-	c.1839C>T	c.(1837-1839)AAC>AAT	p.N613N	GRM4_uc010jvh.1_Silent_p.N613N|GRM4_uc010jvi.1_Silent_p.N305N|GRM4_uc010jvj.1_Silent_p.N497N|GRM4_uc003oio.1_Silent_p.N305N|GRM4_uc003oip.1_Non-coding_Transcript|GRM4_uc003oiq.1_Silent_p.N480N	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	613	Cytoplasmic (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			ovary(1)	1					L-Glutamic Acid(DB00142)									0.56	45.053931	45.132759	14	11	GG		KEEP	---	---	---	---	capture			Silent	SNP	34112026	34112026	7078	6	G	A	A	40	40	GRM4	A	1	1
C6orf222	389384	broad.mit.edu	36	6	36395150	36395150	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:36395150G>A	uc003oly.1	-	c.1884C>T	c.(1882-1884)CAC>CAT	p.H628H		NM_001010903	NP_001010903	P0C671	CF222_HUMAN	hypothetical protein LOC389384	628										ovary(1)|breast(1)	2														0.130435	18.05915	48.735607	30	200	GG		KEEP	---	---	---	---	capture			Silent	SNP	36395150	36395150	2461	6	G	A	A	36	36	C6orf222	A	2	2
TDRD6	221400	broad.mit.edu	36	6	46767825	46767825	+	Missense_Mutation	SNP	T	C	C			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:46767825T>C	uc003oyj.1	+	c.4001T>C	c.(4000-4002)CTT>CCT	p.L1334P	TDRD6_uc010jze.1_Missense_Mutation_p.L1328P	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1334					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)	5			Lung(136;0.192)											0.377778	93.919733	95.10189	34	56	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46767825	46767825	16261	6	T	C	C	56	56	TDRD6	C	4	4
ZAN	7455	broad.mit.edu	36	7	100193858	100193858	+	Missense_Mutation	SNP	C	A	A			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100193858C>A	uc003uwj.1	+	c.3407C>A	c.(3406-3408)ACC>AAC	p.T1136N	ZAN_uc003uwk.1_Missense_Mutation_p.T1136N|ZAN_uc003uwl.1_Non-coding_Transcript|ZAN_uc010lhh.1_Non-coding_Transcript|ZAN_uc010lhi.1_Non-coding_Transcript	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	1136	VWFC 1.|Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)											0.3	46.43694	48.575744	18	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100193858	100193858	18096	7	C	A	A	18	18	ZAN	A	3	3
TAS2R39	259285	broad.mit.edu	36	7	142591554	142591554	+	Silent	SNP	C	T	T			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:142591554C>T	uc003wcg.1	+	c.921C>T	c.(919-921)CAC>CAT	p.H307H		NM_176881	NP_795362	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	307	Helical; Name=7; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity				0	Melanoma(164;0.059)													0.459091	311.653674	311.973557	101	119	CC		KEEP	---	---	---	---	capture			Silent	SNP	142591554	142591554	16098	7	C	T	T	20	20	TAS2R39	T	2	2
SEMA3E	9723	broad.mit.edu	36	7	82854269	82854269	+	Missense_Mutation	SNP	A	T	T			TCGA-12-3644-01	TCGA-12-3644-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:82854269A>T	uc003uhy.1	-	c.1701T>A	c.(1699-1701)AAT>AAA	p.N567K		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E	567					axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)												0.363636	87.077656	88.337939	28	49	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	82854269	82854269	14514	7	A	T	T	8	8	SEMA3E	T	4	4
EIF3E	3646	broad.mit.edu	36	8	109309752	109309752	+	Silent	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:109309752G>A	uc003ymu.1	-	c.642C>T	c.(640-642)CTC>CTT	p.L214L	EIF3E_uc003ymt.1_Silent_p.L165L|EIF3E_uc003ymv.1_Silent_p.L121L|EIF3E_uc010mci.1_Silent_p.L214L	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	214					negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding|translation initiation factor activity			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GBM(15;360 410 8460 34179 52246)								0.14554	53.479267	79.225602	31	182	GG		KEEP	---	---	---	---	capture			Silent	SNP	109309752	109309752	5206	8	G	A	A	45	45	EIF3E	A	2	2
MYOM2	9172	broad.mit.edu	36	8	2036086	2036086	+	Missense_Mutation	SNP	C	G	G			TCGA-12-3644-01	TCGA-12-3644-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:2036086C>G	uc003wpx.2	+	c.2454C>G	c.(2452-2454)GAC>GAG	p.D818E		NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	818	Fibronectin type-III 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)	5		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)										0.185185	11.206456	16.246774	10	44	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	2036086	2036086	10487	8	C	G	G	20	20	MYOM2	G	3	3
DBH	1621	broad.mit.edu	36	9	135491539	135491539	+	Missense_Mutation	SNP	G	T	T			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135491539G>T	uc004cel.1	+	c.225G>T	c.(223-225)CAG>CAT	p.Q75H		NM_000787	NP_000778	P09172	DOPO_HUMAN	dopamine beta-hydroxylase precursor	75	DOMON.|Intragranular (Potential).				hormone biosynthetic process|oxidation-reduction process	chromaffin granule lumen|chromaffin granule membrane|extracellular region|integral to membrane|membrane fraction|soluble fraction|transport vesicle membrane	dopamine beta-monooxygenase activity|L-ascorbic acid binding			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Dopamine(DB00988)|Vitamin C(DB00126)									0.416667	14.571907	14.644827	5	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	135491539	135491539	4421	9	G	T	T	34	34	DBH	T	3	3
PNPLA7	375775	broad.mit.edu	36	9	139537042	139537043	+	Missense_Mutation	DNP	AC	TG	TG			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:139537042_139537043AC>TG	uc010ncj.1	-	c.835_836GT>CA	c.(835-837)GTT>CAT	p.V279H	PNPLA7_uc004cnf.2_Missense_Mutation_p.V254H	NM_001098537	NP_001092007	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	254	cNMP 1.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity				0	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)										0.238095	8.361687	9.681584	5	16	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	139537042	139537043	12597	9	AC	TG	TG	2	2	PNPLA7	TG	4	4
STAG2	10735	broad.mit.edu	36	X	123024513	123024513	+	Missense_Mutation	SNP	G	C	C			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:123024513G>C	uc004eua.1	+	c.1719G>C	c.(1717-1719)CAG>CAC	p.Q573H	STAG2_uc004etz.2_Missense_Mutation_p.Q573H|STAG2_uc004eub.1_Missense_Mutation_p.Q573H|STAG2_uc004euc.1_Missense_Mutation_p.Q573H|STAG2_uc004eud.1_Missense_Mutation_p.Q573H|STAG2_uc004eue.1_Missense_Mutation_p.Q573H	NM_001042749	NP_001036215	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform a	573					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5														0.344828	90.431335	92.27768	30	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	123024513	123024513	15761	23	G	C	C	36	36	STAG2	C	3	3
ARSF	416	broad.mit.edu	36	X	3031884	3031884	+	Missense_Mutation	SNP	G	A	A			TCGA-12-3644-01	TCGA-12-3644-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:3031884G>A	uc004cre.1	+	c.1184G>A	c.(1183-1185)CGG>CAG	p.R395Q	ARSF_uc004crf.1_Missense_Mutation_p.R395Q	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	395						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)												0.527027	242.45836	242.553554	78	70	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3031884	3031884	1009	23	G	A	A	39	39	ARSF	A	1	1
SLC7A3	84889	broad.mit.edu	36	X	70065049	70065049	+	Missense_Mutation	SNP	T	A	A			TCGA-12-3644-01	TCGA-12-3644-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:70065049T>A	uc004dyn.1	-	c.689A>T	c.(688-690)GAA>GTA	p.E230V	SLC7A3_uc004dyo.1_Missense_Mutation_p.E230V	NM_032803	NP_116192	Q8WY07	CTR3_HUMAN	solute carrier family 7 (cationic amino acid	230	Extracellular (Potential).				cellular nitrogen compound metabolic process	integral to membrane|plasma membrane				ovary(1)|kidney(1)	2	Renal(35;0.156)				L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)									0.333333	24.76591	25.430172	9	18	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70065049	70065049	15195	23	T	A	A	62	62	SLC7A3	A	4	4
HDX	139324	broad.mit.edu	36	X	83610766	83610767	+	Missense_Mutation	DNP	CA	TT	TT			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:83610766_83610767CA>TT	uc004eek.1	-	c.620_621TG>AA	c.(619-621)ATG>AAA	p.M207K	HDX_uc004eel.1_Missense_Mutation_p.M149K	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	207					regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						Pancreas(53;231 1169 36156 43751 51139)								0.410853	314.592143	316.384761	106	152	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	83610766	83610767	7309	23	CA	TT	TT	29	29	HDX	TT	2	2
HECTD2	143279	broad.mit.edu	36	10	93248666	93248666	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:93248666_93248666delA	uc001khl.2	+	c.1813_1813delA	c.(1813-1815)AAAfs	p.K605fs	LOC100188947_uc001khj.2_Intron|HECTD2_uc001khm.2_Non-coding_Transcript|HECTD2_uc009xty.1_Frame_Shift_Del_p.K194fs|HECTD2_uc001khn.1_Frame_Shift_Del_p.K255fs	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	605	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						NSCLC(12;376 469 1699 39910 41417)								0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	93248666	93248666	7323	10	A	-	-	13	13	HECTD2	-	5	5
EP400	57634	broad.mit.edu	36	12	131068135	131068136	+	Frame_Shift_Ins	INS	-	GG	GG			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:131068135_131068136insGG	uc001ujn.1	+	c.4026_4027insGG	c.(4024-4029)CACCCAfs	p.H1342fs	EP400_uc001ujl.1_Frame_Shift_Ins_p.H1341fs|EP400_uc001ujm.1_Frame_Shift_Ins_p.H1342fs	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	1378_1379					histone H2A acetylation|histone H4 acetylation	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)										0.37			11	19				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	131068135	131068136	5342	12	-	GG	GG	18	18	EP400	GG	5	5
SLC48A1	55652	broad.mit.edu	36	12	46460600	46460603	+	Frame_Shift_Del	DEL	TTTC	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:46460600_46460603delTTTC	uc001rqd.1	+	c.325_328delTTTC	c.(325-330)TTTCTTfs	p.F109fs	SLC48A1_uc001rqc.2_Intron|SLC48A1_uc009zkt.1_Frame_Shift_Del_p.F109fs	NM_017842	NP_060312	Q6P1K1	HRG1_HUMAN	heme-responsive gene 1	117_118	Helical; (Potential).				transport	endosome membrane|integral to membrane|lysosomal membrane					0														0.50			6	6				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46460600	46460603	15146	12	TTTC	-	-	64	64	SLC48A1	-	5	5
F10	2159	broad.mit.edu	36	13	112846288	112846301	+	Frame_Shift_Del	DEL	GACCCCACCGAGAA	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:112846288_112846301delGACCCCACCGAGAA	uc001vsx.1	+	c.625_638delGACCCCACCGAGAA	c.(625-639)GACCCCACCGAGAACfs	p.D209fs	F10_uc010agq.1_Non-coding_Transcript|F10_uc001vsy.1_Frame_Shift_Del_p.D209fs|F10_uc001vsz.1_Frame_Shift_Del_p.D209fs	NM_000504	NP_000495	P00742	FA10_HUMAN	coagulation factor X preproprotein	209_213					blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of cell migration|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|intrinsic to external side of plasma membrane	calcium ion binding|phospholipid binding|protein binding|serine-type endopeptidase activity			pancreas(1)	1	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.113)|all_lung(25;0.0364)|all_epithelial(44;0.0373)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0805)|Epithelial(84;0.231)		Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Enoxaparin(DB01225)|Heparin(DB01109)|Menadione(DB00170)|Reteplase(DB00015)|Tenecteplase(DB00031)									0.66			45	23				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	112846288	112846301	5530	13	GACCCCACCGAGAA	-	-	41	41	F10	-	5	5
MTA1	9112	broad.mit.edu	36	14	104998206	104998207	+	Frame_Shift_Ins	INS	-	AC	AC			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:104998206_104998207insAC	uc001yqx.1	+	c.813_814insAC	c.(811-816)GCGCTGfs	p.A271fs	MTA1_uc001yqy.1_Non-coding_Transcript|MTA1_uc001yqz.1_Frame_Shift_Ins_p.A185fs|MTA1_uc001yra.1_Frame_Shift_Ins_p.A185fs|MTA1_uc001yrb.1_Frame_Shift_Ins_p.A32fs	NM_004689	NP_004680	Q13330	MTA1_HUMAN	metastasis associated protein	271_272	ELM2.				regulation of transcription, DNA-dependent|signal transduction	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)										0.40			4	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	104998206	104998207	10301	14	-	AC	AC	38	38	MTA1	AC	5	5
RPAP1	26015	broad.mit.edu	36	15	39604578	39604580	+	In_Frame_Del	DEL	GTT	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:39604578_39604580delGTT	uc001zod.1	-	c.1976_1978delAAC	c.(1975-1980)GAACTG>GTG	p.659_660EL>V	RPAP1_uc001zoc.1_5'Flank|RPAP1_uc010bch.1_5'Flank	NM_015540	NP_056355	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	659_660						nucleus	DNA binding|DNA-directed RNA polymerase activity			large_intestine(1)	1		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)										0.35			51	95				---	---	---	---	capture_indel			In_Frame_Del	DEL	39604578	39604580	14020	15	GTT	-	-	36	36	RPAP1	-	5	5
TGM7	116179	broad.mit.edu	36	15	41359291	41359295	+	Frame_Shift_Del	DEL	TCGGG	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:41359291_41359295delTCGGG	uc001zrf.1	-	c.1498_1502delCCCGA	c.(1498-1503)CCCGAGfs	p.P500fs		NM_052955	NP_443187	Q96PF1	TGM7_HUMAN	transglutaminase 7	500_501					peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(2)	2		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)									0.31			71	161				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	41359291	41359295	16363	15	TCGGG	-	-	54	54	TGM7	-	5	5
ABCC6	368	broad.mit.edu	36	16	16184177	16184177	+	Frame_Shift_Del	DEL	C	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:16184177_16184177delC	uc002den.2	-	c.2055_2055delG	c.(2053-2055)GGGfs	p.G685fs	ABCC6_uc010bvo.1_Non-coding_Transcript	NM_001171	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C, member 6	685	ABC transporter 1.|Cytoplasmic (By similarity).				response to drug|visual perception	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)										0.41			98	140				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	16184177	16184177	58	16	C	-	-	18	18	ABCC6	-	5	5
TMC7	79905	broad.mit.edu	36	16	18978337	18978347	+	Frame_Shift_Del	DEL	GAGGGTCATGG	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:18978337_18978347delGAGGGTCATGG	uc002dfp.1	+	c.2126_2136delGAGGGTCATGG	c.(2125-2136)AGAGGGTCATGGfs	p.R709fs	TMC7_uc002dfq.1_Intron	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	Error:Variant_position_missing_in_Q7Z402_after_alignment						integral to membrane				ovary(1)	1														0.53			55	49				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	18978337	18978347	16520	16	GAGGGTCATGG	-	-	33	33	TMC7	-	5	5
NTN3	4917	broad.mit.edu	36	16	2462490	2462491	+	Frame_Shift_Ins	INS	-	A	A			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:2462490_2462491insA	uc002cqj.1	+	c.787_788insA	c.(787-789)CGGfs	p.R263fs	TBC1D24_uc002cqk.1_5'Flank|TBC1D24_uc002cql.1_5'Flank	NM_006181	NP_006172	O00634	NET3_HUMAN	netrin 3	263	Laminin EGF-like 1.				axon guidance|muscle cell differentiation|positive regulation of muscle cell differentiation	proteinaceous extracellular matrix				central_nervous_system(1)	1														0.72			21	8				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	2462490	2462491	11106	16	-	A	A	19	19	NTN3	A	5	5
ITGAL	3683	broad.mit.edu	36	16	30418302	30418312	+	Splice_Site_Del	DEL	TCATTTCCCGG	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:30418302_30418312delTCATTTCCCGG	uc002dyi.2	+	c.e17_splice_site			ITGAL_uc002dyj.2_Splice_Site_Del	NM_002209	NP_002200			integrin alpha L isoform a precursor						blood coagulation|heterophilic cell-cell adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell	integrin complex	cell adhesion molecule binding|receptor activity			ovary(3)|central_nervous_system(3)|breast(1)	7					Efalizumab(DB00095)	NSCLC(110;1462 1641 3311 33990 49495)								0.42			88	123				---	---	---	---	capture_indel			Splice_Site_Del	DEL	30418302	30418312	8190	16	TCATTTCCCGG	-	-	62	62	ITGAL	-	5	5
COG4	25839	broad.mit.edu	36	16	69114841	69114842	+	Frame_Shift_Ins	INS	-	T	T			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:69114841_69114842insT	uc002ezc.1	-	c.106_107insA	c.(106-108)CTCfs	p.L36fs	COG4_uc010cfu.1_Non-coding_Transcript|COG4_uc002ezd.1_Frame_Shift_Ins_p.L36fs|COG4_uc002eze.1_5'UTR|SF3B3_uc002ezf.1_5'Flank	NM_015386	NP_056201	Q9H9E3	COG4_HUMAN	component of oligomeric golgi complex 4	32	Interacts with SCFD1.				Golgi organization|Golgi vesicle prefusion complex stabilization|protein transport|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0		Ovarian(137;0.0694)												0.43			78	105				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	69114841	69114842	3798	16	-	T	T	11	11	COG4	T	5	5
FANCA	2175	broad.mit.edu	36	16	88336707	88336709	+	Splice_Site_Del	DEL	GCC	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:88336707_88336709delGCC	uc002fou.1	-	c.e37_splice_site				NM_000135	NP_000126			Fanconi anemia, complementation group A isoform						DNA repair|protein complex assembly	cytoplasm|nucleoplasm	protein binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)					(L363-Tumor)	1099				0.66			78	40				---	---	---	---	capture_indel			Splice_Site_Del	DEL	88336707	88336709	5898	16	GCC	-	-	46	46	FANCA	-	5	5
TOM1L2	146691	broad.mit.edu	36	17	17737722	17737722	+	Frame_Shift_Del	DEL	T	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:17737722_17737722delT	uc002grz.2	-	c.344_344delA	c.(343-345)GACfs	p.D115fs	TOM1L2_uc002gry.2_Intron|TOM1L2_uc010cpr.1_Frame_Shift_Del_p.D115fs	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3	115	VHS.				intracellular protein transport	intracellular					0	all_neural(463;0.228)					Melanoma(192;2505 2909 14455 25269)								0.30			84	193				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	17737722	17737722	16894	17	T	-	-	58	58	TOM1L2	-	5	5
KRT23	25984	broad.mit.edu	36	17	36346162	36346168	+	Frame_Shift_Del	DEL	CCTTCCC	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:36346162_36346168delCCTTCCC	uc002hvm.1	-	c.214_220delGGGAAGG	c.(214-222)GGGAAGGCCfs	p.G72fs	KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.1_Frame_Shift_Del_p.G72fs|KRT23_uc002hvn.1_Frame_Shift_Del_p.G72fs	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23	72_74	Rod.|Coil 1A.					intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)												0.58			315	227				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	36346162	36346168	8775	17	CCTTCCC	-	-	26	26	KRT23	-	5	5
DNAH2	146754	broad.mit.edu	36	17	7649111	7649130	+	Splice_Site_Del	DEL	CATGCGGGTACCAGGGGCGG	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:7649111_7649130delCATGCGGGTACCAGGGGCGG	uc002giu.1	+	c.e59_splice_site			DNAH2_uc010cnm.1_Intron	NM_020877	NP_065928			dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|central_nervous_system(1)	7		all_cancers(10;4.66e-07)|Prostate(122;0.081)												0.56			117	91				---	---	---	---	capture_indel			Splice_Site_Del	DEL	7649111	7649130	4785	17	CATGCGGGTACCAGGGGCGG	-	-	21	21	DNAH2	-	5	5
CALR3	125972	broad.mit.edu	36	19	16462321	16462329	+	In_Frame_Del	DEL	CTGAACGGT	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:16462321_16462329delCTGAACGGT	uc002ned.2	-	c.246_254delACCGTTCAG	c.(244-255)AAACCGTTCAGC>AAC	p.82_85KPFS>N	MED26_uc002nee.2_Intron	NM_145046	NP_659483	Q96L12	CALR3_HUMAN	calreticulin 3	82_85	N-domain.				protein folding	endoplasmic reticulum lumen	calcium ion binding|sugar binding|unfolded protein binding				0														0.69			221	100				---	---	---	---	capture_indel			In_Frame_Del	DEL	16462321	16462329	2710	19	CTGAACGGT	-	-	28	28	CALR3	-	5	5
CADM4	199731	broad.mit.edu	36	19	48823680	48823680	+	Frame_Shift_Del	DEL	A	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:48823680_48823680delA	uc002oxc.1	-	c.167_167delT	c.(166-168)ATCfs	p.I56fs		NM_145296	NP_660339	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4	56	Ig-like V-type.|Extracellular (Potential).				cell adhesion	integral to membrane					0		Prostate(69;0.0199)												0.44			104	135				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	48823680	48823680	2685	19	A	-	-	12	12	CADM4	-	5	5
GBA	2629	broad.mit.edu	36	1	153473902	153473911	+	Frame_Shift_Del	DEL	AGGGGTATCC	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:153473902_153473911delAGGGGTATCC	uc001fjh.1	-	c.844_853delGGATACCCCT	c.(844-855)GGATACCCCTTCfs	p.G282fs	GBA_uc001fji.1_Frame_Shift_Del_p.G282fs|GBA_uc001fjj.1_Frame_Shift_Del_p.G282fs|GBA_uc001fjk.1_Frame_Shift_Del_p.G282fs|GBA_uc001fjl.1_Frame_Shift_Del_p.G282fs|GBA_uc009wqk.1_Frame_Shift_Del_p.G195fs	NM_000157	NP_001005750	P04062	GLCM_HUMAN	glucocerebrosidase precursor	282_285					carbohydrate metabolic process|cell death|lysosome organization|sphingolipid metabolic process	lysosomal membrane	cation binding|glucosylceramidase activity|protein binding			ovary(1)	1	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)									0.55			11	9				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	153473902	153473911	6532	1	AGGGGTATCC	-	-	3	3	GBA	-	5	5
ERCC3	2071	broad.mit.edu	36	2	127745489	127745490	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:127745489_127745490insGC	uc002toh.1	-	c.1837_1838insGC	c.(1837-1839)ACTfs	p.T613fs	ERCC3_uc002toe.1_Frame_Shift_Ins_p.T368fs|ERCC3_uc002tof.1_Frame_Shift_Ins_p.T549fs|ERCC3_uc002tog.1_Frame_Shift_Ins_p.T549fs	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent	613	Helicase C-terminal.				cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(1)|lung(1)|breast(1)|kidney(1)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)						281				0.51			265	252				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	127745489	127745490	5407	2	-	GC	GC	36	36	ERCC3	GC	5	5
TSEN2	80746	broad.mit.edu	36	3	12506421	12506430	+	Frame_Shift_Del	DEL	GTGCTGAAAT	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:12506421_12506430delGTGCTGAAAT	uc003bxb.1	+	c.122_131delGTGCTGAAAT	c.(121-132)CGTGCTGAAATGfs	p.R41fs	TSEN2_uc003bwy.1_Frame_Shift_Del_p.R41fs|TSEN2_uc003bwz.1_Frame_Shift_Del_p.R41fs|TSEN2_uc003bxa.1_Frame_Shift_Del_p.R41fs|TSEN2_uc003bxc.1_Frame_Shift_Del_p.R41fs	NM_025265	NP_079541	Q8NCE0	SEN2_HUMAN	tRNA-intron nuclease 2 isoform 1	41_44					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	cytoplasm|nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity			central_nervous_system(1)	1														0.34			124	242				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	12506421	12506430	17163	3	GTGCTGAAAT	-	-	40	40	TSEN2	-	5	5
MFSD7	84179	broad.mit.edu	36	4	670040	670043	+	Frame_Shift_Del	DEL	GCAC	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:670040_670043delGCAC	uc003gay.1	-	c.343_346delGTGC	c.(343-348)GTGCCCfs	p.V115fs	MFSD7_uc003gaw.1_5'Flank|MFSD7_uc003gax.1_Frame_Shift_Del_p.V115fs|MFSD7_uc003gaz.1_Intron|MFSD7_uc003gba.1_Intron|MFSD7_uc003gbb.1_Frame_Shift_Del_p.V51fs	NM_032219	NP_115595	Q6UXD7	MFSD7_HUMAN	major facilitator superfamily domain containing	115_116	Helical; (Potential).				transmembrane transport	integral to membrane					0														0.48			14	15				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	670040	670043	9927	4	GCAC	-	-	42	42	MFSD7	-	5	5
EIF3B	8662	broad.mit.edu	36	7	2369264	2369277	+	Frame_Shift_Del	DEL	AGAGAAACAGCCTT	-	-			TCGA-12-3644-01	TCGA-12-3644-01										Phase_I	Unspecified				Illumina GAIIx	g.chr7:2369264_2369277delAGAGAAACAGCCTT	uc003slx.1	+	c.846_859delAGAGAAACAGCCTT	c.(844-861)CCAGAGAAACAGCCTTTCfs	p.P282fs	EIF3B_uc003sly.1_Frame_Shift_Del_p.P282fs|EIF3B_uc003slz.1_Frame_Shift_Del_p.P243fs|EIF3B_uc003sma.2_Frame_Shift_Del_p.P10fs	NM_003751	NP_003742	P55884	EIF3B_HUMAN	eukaryotic translation initiation factor 3,	282_287	Sufficient for interaction with EIF3E.				regulation of translational initiation	cytosol|eukaryotic translation initiation factor 3 complex	nucleotide binding|protein complex scaffold|translation initiation factor activity				0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)										0.36			137	244				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	2369264	2369277	5202	7	AGAGAAACAGCCTT	-	-	7	7	EIF3B	-	5	5
