Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
OPN4	94233	broad.mit.edu	36	10	88408376	88408376	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:88408376G>A	uc001kdp.1	+	c.613G>A	c.(613-615)GTT>ATT	p.V205I	OPN4_uc001kdq.1_Missense_Mutation_p.V194I|OPN4_uc009xsx.1_5'Flank	NM_001030015	NP_001025186	Q9UHM6	OPN4_HUMAN	opsin 4 isoform 2	194	Helical; Name=4; (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|rhythmic process|visual perception	integral to membrane|plasma membrane	11-cis retinal binding|G-protein coupled photoreceptor activity			ovary(1)	1														0.785714	212.19032	218.528882	66	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88408376	88408376	11288	10	G	A	A	40	40	OPN4	A	1	1
TMPRSS4	56649	broad.mit.edu	36	11	117491091	117491091	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:117491091G>A	uc009yzt.1	+	c.1038G>A	c.(1036-1038)GCG>GCA	p.A346A	TMPRSS4_uc001psd.2_Silent_p.A341A|TMPRSS4_uc009yzu.1_Intron|TMPRSS4_uc009yzv.1_Silent_p.A321A	NM_019894	NP_063947	Q9NRS4	TMPS4_HUMAN	transmembrane protease, serine 4 isoform 1	346	Extracellular (Potential).|Peptidase S1.				proteolysis	integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0431)|all_hematologic(192;0.164)|Breast(348;0.183)|all_neural(223;0.238)												0.482759	41.439638	41.447452	14	15	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;4.16e-05)|Epithelial(105;0.00204)	Silent	SNP	117491091	117491091	16790	11	G	A	A	40	40	TMPRSS4	A	1	1
MFRP	83552	broad.mit.edu	36	11	118721484	118721484	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:118721484G>C	uc001pwk.1	-	c.497C>G	c.(496-498)CCC>CGC	p.P166R	MFRP_uc001pwj.1_Non-coding_Transcript	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein	117	C1q.					collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)												0.422414	149.252775	149.862557	49	67	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)	Missense_Mutation	SNP	118721484	118721484	9916	11	G	C	C	43	43	MFRP	C	3	3
POU2F3	25833	broad.mit.edu	36	11	119674183	119674183	+	Splice_Site_SNP	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:119674183G>C	uc001pxc.2	+	c.133_splice	c.e4-1	p.I45_splice		NM_014352	NP_055167			POU transcription factor						negative regulation by host of viral transcription	cytoplasm	sequence-specific DNA binding			ovary(1)	1		Breast(109;0.0011)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_neural(223;0.112)												0.453125	1145.154007	1146.500974	319	385	GG		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;6.85e-06)	Splice_Site_SNP	SNP	119674183	119674183	12703	11	G	C	C	33	33	POU2F3	C	5	3
FOXRED1	55572	broad.mit.edu	36	11	125651501	125651501	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5299-01	TCGA-12-5299-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:125651501A>G	uc001qdi.1	+	c.974A>G	c.(973-975)TAT>TGT	p.Y325C	FOXRED1_uc001qdj.1_Missense_Mutation_p.Y114C|FOXRED1_uc001qdk.1_Missense_Mutation_p.Y114C	NM_017547	NP_060017	Q96CU9	FXRD1_HUMAN	FAD-dependent oxidoreductase domain containing	325					oxidation-reduction process	integral to membrane|mitochondrion	oxidoreductase activity|protein binding				0	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.224)												0.136752	13.093189	28.142811	16	101	AA		KEEP	---	---	---	---	capture		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0729)	Missense_Mutation	SNP	125651501	125651501	6279	11	A	G	G	16	16	FOXRED1	G	4	4
ACAD8	27034	broad.mit.edu	36	11	133633680	133633680	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:133633680C>T	uc001qhk.1	+	c.442C>T	c.(442-444)CCG>TCG	p.P148S	ACAD8_uc009zdc.1_Missense_Mutation_p.P50S|ACAD8_uc001qhl.1_Intron|ACAD8_uc009zdd.1_Non-coding_Transcript|ACAD8_uc009zde.1_Missense_Mutation_p.P21S	NM_014384	NP_055199	Q9UKU7	ACAD8_HUMAN	acyl-Coenzyme A dehydrogenase family, member 8	148					branched chain family amino acid catabolic process|lipid metabolic process|oxidation-reduction process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding				0	all_hematologic(175;0.127)	all_cancers(12;8e-23)|all_epithelial(12;2.59e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|all_neural(223;0.0189)|Medulloblastoma(222;0.0245)|Esophageal squamous(93;0.0559)				GBM(65;238 1125 33403 41853 48889)								0.333333	67.673558	69.446024	24	48	CC		KEEP	---	---	---	---	capture		Epithelial(10;1.92e-10)|all cancers(11;2.26e-09)|BRCA - Breast invasive adenocarcinoma(10;8.73e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00154)|Lung(977;0.21)	Missense_Mutation	SNP	133633680	133633680	111	11	C	T	T	18	18	ACAD8	T	2	2
SCUBE2	57758	broad.mit.edu	36	11	9031303	9031303	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:9031303G>A	uc001mhh.1	-	c.1366C>T	c.(1366-1368)CGT>TGT	p.R456C	SCUBE2_uc001mhi.1_Missense_Mutation_p.R456C|SCUBE2_uc001mhj.1_Intron	NM_020974	NP_066025	Q9NQ36	SCUB2_HUMAN	CEGP1 protein	456						extracellular region	calcium ion binding			ovary(1)	1														0.3	65.57691	68.43143	24	56	GG		KEEP	---	---	---	---	capture		all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)	Missense_Mutation	SNP	9031303	9031303	14428	11	G	A	A	39	39	SCUBE2	A	1	1
KSR2	283455	broad.mit.edu	36	12	116683367	116683367	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:116683367G>A	uc001two.2	-	c.731C>T	c.(730-732)CCG>CTG	p.P244L		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	273	Pro-rich.				intracellular signal transduction|protein phosphorylation	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(7)|central_nervous_system(2)|large_intestine(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)									623				0.45509	482.952806	483.525119	152	182	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	116683367	116683367	8905	12	G	A	A	39	39	KSR2	A	1	1
TMEM117	84216	broad.mit.edu	36	12	43068694	43068694	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:43068694C>T	uc001rod.1	+	c.1517C>T	c.(1516-1518)ACG>ATG	p.T506M	TMEM117_uc001roe.1_Missense_Mutation_p.T402M|TMEM117_uc009zkc.1_3'UTR	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	506						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)													0.384956	258.975483	261.596413	87	139	CC		KEEP	---	---	---	---	capture		GBM - Glioblastoma multiforme(48;0.124)	Missense_Mutation	SNP	43068694	43068694	16562	12	C	T	T	19	19	TMEM117	T	1	1
ITGAX	3687	broad.mit.edu	36	16	31292193	31292193	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31292193G>A	uc002ebt.2	+	c.2489G>A	c.(2488-2490)CGC>CAC	p.R830H	ITGAX_uc002ebu.1_Missense_Mutation_p.R830H	NM_000887	NP_000878	P20702	ITAX_HUMAN	integrin alpha X precursor	830	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration|organ morphogenesis	integrin complex	protein binding|receptor activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.427419	150.945242	151.516626	53	71	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31292193	31292193	8193	16	G	A	A	38	38	ITGAX	A	1	1
KRT23	25984	broad.mit.edu	36	17	36346233	36346233	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:36346233C>T	uc002hvm.1	-	c.149G>A	c.(148-150)CGG>CAG	p.R50Q	KRT23_uc010cxf.1_Intron|KRT23_uc010cxg.1_Missense_Mutation_p.R50Q|KRT23_uc002hvn.1_Missense_Mutation_p.R50Q	NM_015515	NP_056330	Q9C075	K1C23_HUMAN	keratin 23	50	Head.					intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)|Ovarian(249;0.15)												0.5	262.401999	262.401999	84	84	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36346233	36346233	8775	17	C	T	T	23	23	KRT23	T	1	1
CASKIN2	57513	broad.mit.edu	36	17	71010459	71010459	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71010459G>C	uc002joc.1	-	c.2291C>G	c.(2290-2292)TCT>TGT	p.S764C		NM_020753	NP_065804	Q8WXE0	CSKI2_HUMAN	cask-interacting protein 2 isoform a	764	Pro-rich.					cytoplasm				pancreas(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)													0.434211	108.060129	108.347534	33	43	GG		KEEP	---	---	---	---	capture	all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)		Missense_Mutation	SNP	71010459	71010459	2786	17	G	C	C	33	33	CASKIN2	C	3	3
EVPL	2125	broad.mit.edu	36	17	71529561	71529561	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:71529561G>A	uc002jqi.2	-	c.789C>T	c.(787-789)GGC>GGT	p.G263G		NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	263	Spectrin.|Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)	3														0.363636	10.69862	10.87785	4	7	GG		KEEP	---	---	---	---	capture			Silent	SNP	71529561	71529561	5485	17	G	A	A	38	38	EVPL	A	1	1
SLC25A10	1468	broad.mit.edu	36	17	77292936	77292936	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:77292936C>T	uc010dif.1	+	c.237C>T	c.(235-237)TTC>TTT	p.F79F	SLC25A10_uc002kbi.1_Silent_p.F79F	NM_012140	NP_036272	Q9UBX3	DIC_HUMAN	solute carrier family 25 (mitochondrial carrier;	79	Solcar 1.|Helical; Name=2; (Potential).				gluconeogenesis|mitochondrial transport	integral to membrane|mitochondrial inner membrane|nucleus	protein binding				0	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.23)				Succinic acid(DB00139)									0.485777	661.900849	661.981557	222	235	CC		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(99;0.0117)|OV - Ovarian serous cystadenocarcinoma(97;0.0955)		Silent	SNP	77292936	77292936	14969	17	C	T	T	31	31	SLC25A10	T	1	1
MEGF8	1954	broad.mit.edu	36	19	47547530	47547530	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:47547530G>A	uc002otl.2	+	c.2764G>A	c.(2764-2766)GGC>AGC	p.G922S	MEGF8_uc002otm.2_Missense_Mutation_p.G530S	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	989	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)												0.47619	32.75621	32.765908	10	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47547530	47547530	9852	19	G	A	A	43	43	MEGF8	A	2	2
FAM131C	348487	broad.mit.edu	36	1	16262629	16262629	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:16262629C>T	uc001axz.2	-	c.112G>A	c.(112-114)GTG>ATG	p.V38M		NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	38											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)												0.295455	67.815831	71.109573	26	62	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)	Missense_Mutation	SNP	16262629	16262629	5638	1	C	T	T	19	19	FAM131C	T	1	1
NID1	4811	broad.mit.edu	36	1	234255902	234255902	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:234255902G>A	uc001hxo.1	-	c.1901C>T	c.(1900-1902)TCG>TTG	p.S634L	NID1_uc009xgd.1_Missense_Mutation_p.S634L	NM_002508	NP_002499	P14543	NID1_HUMAN	nidogen 1 precursor	634	Nidogen G2 beta-barrel.				bioluminescence|cell-matrix adhesion|protein-chromophore linkage	basement membrane|membrane	calcium ion binding			large_intestine(1)|pancreas(1)	2	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)			Becaplermin(DB00102)|Urokinase(DB00013)									0.418803	440.168396	442.186752	147	204	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Missense_Mutation	SNP	234255902	234255902	10815	1	G	A	A	37	37	NID1	A	1	1
RCAN3	11123	broad.mit.edu	36	1	24730409	24730409	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:24730409C>T	uc001bjj.1	+	c.310C>T	c.(310-312)CGA>TGA	p.R104*	RCAN3_uc009vrd.1_Nonsense_Mutation_p.R104*|RCAN3_uc009vre.1_Intron|RCAN3_uc009vrf.1_Nonsense_Mutation_p.R104*|RCAN3_uc009vrg.1_Intron	NM_013441	NP_038469	Q9UKA8	RCAN3_HUMAN	Down syndrome critical region gene 1-like 2	104					anatomical structure morphogenesis|calcium-mediated signaling		nucleotide binding|RNA binding|troponin I binding				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)												0.363636	125.080416	127.054106	44	77	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)	Nonsense_Mutation	SNP	24730409	24730409	13639	1	C	T	T	27	27	RCAN3	T	5	1
SLC44A5	204962	broad.mit.edu	36	1	75452036	75452036	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:75452036C>G	uc001dgu.1	-	c.1904G>C	c.(1903-1905)AGA>ACA	p.R635T	SLC44A5_uc001dgr.1_Missense_Mutation_p.R593T|SLC44A5_uc001dgs.1_Missense_Mutation_p.R593T|SLC44A5_uc001dgt.1_Missense_Mutation_p.R635T	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A	635	Extracellular (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)	2														0.420354	330.190371	331.441288	95	131	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	75452036	75452036	15136	1	C	G	G	32	32	SLC44A5	G	3	3
GNAS	2778	broad.mit.edu	36	20	56862963	56862963	+	Silent	SNP	A	C	C			TCGA-12-5299-01	TCGA-12-5299-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr20:56862963A>C	uc002xzw.1	+	c.1248A>C	c.(1246-1248)GCA>GCC	p.A416A	GNAS_uc002xzt.1_Intron|GNAS_uc002xzu.2_Intron|GNAS_uc010gjq.1_Intron|GNAS_uc002xzv.1_Non-coding_Transcript	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|large_intestine(5)|parathyroid(5)|kidney(5)|lung(2)|testis(1)|autonomic_ganglia(1)	279	all_lung(29;0.0104)					Colon(117;935 1597 6045 8307 46442)				461	TSP Lung(22;0.16)			0.5	8.593427	8.593427	4	4	AA		KEEP	---	---	---	---	capture	BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)		Silent	SNP	56862963	56862963	6779	20	A	C	C	6	6	GNAS	C	4	4
AIRE	326	broad.mit.edu	36	21	44531333	44531333	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44531333G>A	uc002zei.1	+	c.352G>A	c.(352-354)GTC>ATC	p.V118I		NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1	118					transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|promoter binding|transcription activator activity|translation regulator activity|zinc ion binding				0														0.572581	215.828554	216.398707	71	53	GG		KEEP	---	---	---	---	capture		Colorectal(79;0.0806)	Missense_Mutation	SNP	44531333	44531333	440	21	G	A	A	40	40	AIRE	A	1	1
IL1R1	3554	broad.mit.edu	36	2	102158392	102158392	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:102158392C>T	uc002tbq.1	+	c.1158C>T	c.(1156-1158)GAC>GAT	p.D386D	IL1R1_uc010fix.1_Intron|IL1R1_uc002tbp.1_Silent_p.D386D|IL1R1_uc002tbr.1_Silent_p.D386D	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	386	TIR.|Cytoplasmic (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding				0					Anakinra(DB00026)					429				0.445238	561.061339	562.159804	187	233	CC		KEEP	---	---	---	---	capture			Silent	SNP	102158392	102158392	7959	2	C	T	T	19	19	IL1R1	T	1	1
ANKAR	150709	broad.mit.edu	36	2	190311649	190311649	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:190311649G>A	uc002uqw.1	+	c.3483G>A	c.(3481-3483)TTG>TTA	p.L1161L	ANKAR_uc002uqu.2_Non-coding_Transcript|ANKAR_uc002uqx.1_Non-coding_Transcript|ANKAR_uc002uqy.1_Silent_p.L328L	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1232						integral to membrane	binding			ovary(2)|pancreas(1)	3														0.425532	181.775929	182.458327	60	81	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)		Silent	SNP	190311649	190311649	626	2	G	A	A	45	45	ANKAR	A	2	2
ZNF513	130557	broad.mit.edu	36	2	27454317	27454317	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:27454317C>T	uc002rkk.1	-	c.1225G>A	c.(1225-1227)GTC>ATC	p.V409I	ZNF513_uc002rkj.1_Missense_Mutation_p.V347I	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	409	C2H2-type 5.				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	promoter binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.445521	551.385531	552.445436	184	229	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27454317	27454317	18552	2	C	T	T	19	19	ZNF513	T	1	1
C2orf78	388960	broad.mit.edu	36	2	73897195	73897195	+	Silent	SNP	T	C	C			TCGA-12-5299-01	TCGA-12-5299-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:73897195T>C	uc002sjr.1	+	c.2337T>C	c.(2335-2337)GGT>GGC	p.G779G		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	779										ovary(2)	2														0.192982	7.693111	12.883219	11	46	TT		KEEP	---	---	---	---	capture			Silent	SNP	73897195	73897195	2285	2	T	C	C	58	58	C2orf78	C	4	4
CHST2	9435	broad.mit.edu	36	3	144322902	144322902	+	Missense_Mutation	SNP	A	G	G			TCGA-12-5299-01	TCGA-12-5299-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:144322902A>G	uc003evm.1	+	c.554A>G	c.(553-555)AAC>AGC	p.N185S	CHST2_uc010huw.1_Missense_Mutation_p.N185S	NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	185	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3														0.352273	97.288633	98.986572	31	57	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	144322902	144322902	3538	3	A	G	G	2	2	CHST2	G	4	4
TSC22D2	9819	broad.mit.edu	36	3	151610197	151610197	+	Missense_Mutation	SNP	G	C	C			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:151610197G>C	uc003exv.1	+	c.370G>C	c.(370-372)GCT>CCT	p.A124P	TSC22D2_uc003exw.1_Non-coding_Transcript|TSC22D2_uc003exx.1_Missense_Mutation_p.A124P	NM_014779	NP_055594	O75157	T22D2_HUMAN	TSC22 domain family, member 2	124					regulation of transcription, DNA-dependent		sequence-specific DNA binding transcription factor activity			ovary(1)	1														0.148148	6.482972	9.691343	4	23	GG		KEEP	---	---	---	---	capture	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)		Missense_Mutation	SNP	151610197	151610197	17159	3	G	C	C	42	42	TSC22D2	C	3	3
ITPR1	3708	broad.mit.edu	36	3	4644476	4644476	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:4644476C>T	uc003bqa.2	+	c.193C>T	c.(193-195)CGC>TGC	p.R65C	ITPR1_uc010hbz.1_Missense_Mutation_p.R65C|ITPR1_uc010hca.1_Missense_Mutation_p.R65C|ITPR1_uc010hcb.1_Missense_Mutation_p.R65C	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	65	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			ovary(4)|breast(2)|large_intestine(1)|kidney(1)|liver(1)|skin(1)|pancreas(1)	11										2114				0.310044	212.752509	220.106704	71	158	CC		KEEP	---	---	---	---	capture		Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Missense_Mutation	SNP	4644476	4644476	8224	3	C	T	T	23	23	ITPR1	T	1	1
PCDHA3	56145	broad.mit.edu	36	5	140161980	140161980	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140161980C>T	uc003lhf.1	+	c.1014C>T	c.(1012-1014)CTC>CTT	p.L338L	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhe.1_Silent_p.L338L	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	338	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(5)	5														0.434043	317.01969	317.910131	102	133	CC		KEEP	---	---	---	---	capture	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		Silent	SNP	140161980	140161980	11945	5	C	T	T	31	31	PCDHA3	T	1	1
EIF4E1B	253314	broad.mit.edu	36	5	176002786	176002786	+	Missense_Mutation	SNP	C	G	G			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:176002786C>G	uc010jkf.1	+	c.113C>G	c.(112-114)TCT>TGT	p.S38C		NM_001099408	NP_001092878	A6NMX2	I4E1B_HUMAN	eukaryotic translation initiation factor 4E	38					regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0	all_cancers(89;0.00185)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)												0.333333	115.989817	118.572975	35	70	CC		KEEP	---	---	---	---	capture	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Missense_Mutation	SNP	176002786	176002786	5220	5	C	G	G	32	32	EIF4E1B	G	3	3
HEATR7B2	133558	broad.mit.edu	36	5	41040315	41040315	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:41040315C>T	uc003jmj.2	-	c.4084G>A	c.(4084-4086)GTC>ATC	p.V1362I	HEATR7B2_uc003jmi.2_Missense_Mutation_p.V917I	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1362							binding			ovary(6)|central_nervous_system(2)	8														0.42233	258.790732	259.874742	87	119	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	41040315	41040315	7318	5	C	T	T	19	19	HEATR7B2	T	1	1
SLC17A2	10246	broad.mit.edu	36	6	26025009	26025009	+	Silent	SNP	T	A	A			TCGA-12-5299-01	TCGA-12-5299-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr6:26025009T>A	uc003nfl.1	-	c.813A>T	c.(811-813)ACA>ACT	p.T271T		NM_005835	NP_005826	O00624	NPT3_HUMAN	solute carrier family 17 (sodium phosphate),	271					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			ovary(1)	1														0.401361	190.505141	191.753052	59	88	TT		KEEP	---	---	---	---	capture			Silent	SNP	26025009	26025009	14913	6	T	A	A	51	51	SLC17A2	A	4	4
DNAH8	1769	broad.mit.edu	36	6	38942364	38942364	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:38942364G>A	uc003ooe.1	+	c.5867G>A	c.(5866-5868)CGC>CAC	p.R1956H		NM_001371	NP_001362	Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy polypeptide 8	1956	AAA 1 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(5)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	17										2979				0.455446	142.541616	142.715821	46	55	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38942364	38942364	4790	6	G	A	A	38	38	DNAH8	A	1	1
KCNH2	3757	broad.mit.edu	36	7	150280479	150280479	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:150280479G>A	uc003wic.1	-	c.1524C>T	c.(1522-1524)TTC>TTT	p.F508F	KCNH2_uc003wib.1_Silent_p.F168F|KCNH2_uc003wid.1_Silent_p.F168F|KCNH2_uc003wie.1_Silent_p.F508F	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	508	Helical; Name=Segment S3; (Potential).		Missing (in LQT2).		blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			ovary(1)|skin(1)	2	all_neural(206;0.219)				Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	GBM(137;110 1844 13671 20123 45161)				314				0.247059	102.478203	112.370065	42	128	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Silent	SNP	150280479	150280479	8337	7	G	A	A	37	37	KCNH2	A	1	1
SDK1	221935	broad.mit.edu	36	7	4083277	4083277	+	Silent	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:4083277C>T	uc003smx.1	+	c.3132C>T	c.(3130-3132)GAC>GAT	p.D1044D	SDK1_uc010kso.1_Silent_p.D320D	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 isoform 1	1044	Fibronectin type-III 4.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)	5		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)												0.213115	81.843032	95.749788	39	144	CC		KEEP	---	---	---	---	capture		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)	Silent	SNP	4083277	4083277	14454	7	C	T	T	19	19	SDK1	T	1	1
RHBDD2	57414	broad.mit.edu	36	7	75355543	75355543	+	Silent	SNP	G	T	T			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:75355543G>T	uc003udw.1	+	c.1035G>T	c.(1033-1035)GGG>GGT	p.G345G	RHBDD2_uc003udv.1_Silent_p.G204G	NM_001040456	NP_001035547	Q6NTF9	RHBD2_HUMAN	rhomboid domain containing 2 isoform a	345						integral to membrane	serine-type endopeptidase activity				0														0.256272	345.226657	375.183061	143	415	GG		KEEP	---	---	---	---	capture			Silent	SNP	75355543	75355543	13792	7	G	T	T	43	43	RHBDD2	T	3	3
EPPK1	83481	broad.mit.edu	36	8	145013711	145013711	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:145013711G>A	uc003zaa.1	-	c.5624C>T	c.(5623-5625)GCG>GTG	p.A1875V		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1900	Plectin 31.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)	1	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)													0.446154	80.163989	80.328078	29	36	GG		KEEP	---	---	---	---	capture	OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		Missense_Mutation	SNP	145013711	145013711	5383	8	G	A	A	38	38	EPPK1	A	1	1
KCNT1	57582	broad.mit.edu	36	9	137816471	137816471	+	Missense_Mutation	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:137816471G>A	uc004cgn.1	+	c.3071G>A	c.(3070-3072)CGC>CAC	p.R1024H	KCNT1_uc010nbf.1_Missense_Mutation_p.R979H|KCNT1_uc004cgo.1_Missense_Mutation_p.R773H	NM_020822	NP_065873	B9EGP2	B9EGP2_HUMAN	potassium channel, subfamily T, member 1	1024						membrane	binding|calcium-activated potassium channel activity|catalytic activity			large_intestine(2)|ovary(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.0821)												0.680441	755.512078	766.056644	247	116	GG		KEEP	---	---	---	---	capture		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)	Missense_Mutation	SNP	137816471	137816471	8396	9	G	A	A	38	38	KCNT1	A	1	1
PTPRD	5789	broad.mit.edu	36	9	8482897	8482897	+	Missense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:8482897C>T	uc003zkk.1	-	c.2432G>A	c.(2431-2433)CGC>CAC	p.R811H	PTPRD_uc003zkp.1_Intron|PTPRD_uc003zkq.1_Intron|PTPRD_uc003zkr.1_Intron|PTPRD_uc003zks.1_Intron|PTPRD_uc003zkl.1_Missense_Mutation_p.R802H|PTPRD_uc003zkm.1_Missense_Mutation_p.R798H|PTPRD_uc003zko.1_Intron|PTPRD_uc003zkn.1_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	811	Fibronectin type-III 5.|Extracellular (Potential).				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(10)|large_intestine(3)|ovary(2)|urinary_tract(1)	16		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)								1253	TSP Lung(15;0.13)			0.868545	612.009927	640.123875	185	28	CC		KEEP	---	---	---	---	capture		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)	Missense_Mutation	SNP	8482897	8482897	13256	9	C	T	T	27	27	PTPRD	T	1	1
CXorf58	254158	broad.mit.edu	36	X	23863381	23863381	+	Nonsense_Mutation	SNP	C	T	T			TCGA-12-5299-01	TCGA-12-5299-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:23863381C>T	uc004daz.1	+	c.703C>T	c.(703-705)CGA>TGA	p.R235*		NM_152761	NP_689974	Q96LI9	CX058_HUMAN	hypothetical protein LOC254158	235											0														0.417431	275.188055	276.485121	91	127	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	23863381	23863381	4278	23	C	T	T	19	19	CXorf58	T	5	1
ARSD	414	broad.mit.edu	36	X	2846003	2846003	+	Silent	SNP	G	A	A			TCGA-12-5299-01	TCGA-12-5299-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:2846003G>A	uc004cqy.1	-	c.705C>T	c.(703-705)GGC>GGT	p.G235G	ARSD_uc004cqz.1_Intron|ARSD_uc004cra.1_Silent_p.G235G	NM_001669	NP_001660	P51689	ARSD_HUMAN	arylsulfatase D isoform a precursor	235						lysosome	arylsulfatase activity|metal ion binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)												0.425532	50.483969	50.71225	20	27	GG		KEEP	---	---	---	---	capture			Silent	SNP	2846003	2846003	1007	23	G	A	A	38	38	ARSD	A	1	1
ZNF358	140467	broad.mit.edu	36	19	7491646	7491669	+	In_Frame_Del	DEL	TGTGCCCAGCCCAGACCTTGATCC	-	-			TCGA-12-5299-01	TCGA-12-5299-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:7491646_7491669delTGTGCCCAGCCCAGACCTTGATCC	uc002mgn.2	+	c.1518_1541delTGTGCCCAGCCCAGACCTTGATCC	c.(1516-1542)CTTGTGCCCAGCCCAGACCTTGATCCT>CTT	p.VPSPDLDP507del	ZNF358_uc010dvg.1_In_Frame_Del_p.VPSPDLDP507del|MCOLN1_uc010dvh.1_5'Flank|MCOLN1_uc002mgo.1_5'Flank|MCOLN1_uc002mgp.1_5'Flank	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	507_514					embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1														0.31			59	133				---	---	---	---	capture_indel			In_Frame_Del	DEL	7491646	7491669	18459	19	TGTGCCCAGCCCAGACCTTGATCC	-	-	63	63	ZNF358	-	5	5
FAM120B	84498	broad.mit.edu	36	6	170469585	170469620	+	In_Frame_Del	DEL	CCCTGAATCCAGGCGAGAAGTTCCCATGTGTTCAGA	-	-			TCGA-12-5299-01	TCGA-12-5299-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:170469585_170469620delCCCTGAATCCAGGCGAGAAGTTCCCATGTGTTCAGA	uc003qxp.1	+	c.1182_1217delCCCTGAATCCAGGCGAGAAGTTCCCATGTGTTCAGA	c.(1180-1218)GGCCCTGAATCCAGGCGAGAAGTTCCCATGTGTTCAGAC>GGC	p.PESRREVPMCSD395del	FAM120B_uc003qxo.1_In_Frame_Del_p.PESRREVPMCSD395del	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	395_406					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)										0.30			154	352				---	---	---	---	capture_indel			In_Frame_Del	DEL	170469585	170469620	5614	6	CCCTGAATCCAGGCGAGAAGTTCCCATGTGTTCAGA	-	-	26	26	FAM120B	-	5	5
