Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
MGEA5	10724	broad.mit.edu	36	10	103540828	103540828	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:103540828C>T	uc001ktv.1	-	c.2269G>A	c.(2269-2271)GGA>AGA	p.G757R	MGEA5_uc001ktu.1_Non-coding_Transcript|MGEA5_uc009xws.1_Missense_Mutation_p.G690R	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	757	Histone acetyltransferase activity (By similarity).|Required for histone H4 binding (By similarity).				glycoprotein catabolic process	cytoplasm|nucleus	beta-N-acetylhexosaminidase activity|histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)										0.368421	40.329318	40.911429	14	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103540828	103540828	9945	10	C	T	T	24	24	MGEA5	T	2	2
BTBD16	118663	broad.mit.edu	36	10	124086169	124086169	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:124086169G>A	uc001lgc.1	+	c.1434G>A	c.(1432-1434)ACG>ACA	p.T478T	BTBD16_uc001lgd.1_Silent_p.T477T	NM_144587	NP_653188	Q32M84	BTBDG_HUMAN	BTB (POZ) domain containing 16	478											0		all_neural(114;0.107)|Lung NSC(174;0.175)|all_lung(145;0.222)|Breast(234;0.238)												0.410714	207.776963	208.935953	69	99	GG		KEEP	---	---	---	---	capture			Silent	SNP	124086169	124086169	1573	10	G	A	A	40	40	BTBD16	A	1	1
CUL2	8453	broad.mit.edu	36	10	35340780	35340780	+	Splice_Site_SNP	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:35340780A>C	uc001ixv.1	-	c.e20_splice_site			CUL2_uc009xma.1_Splice_Site_SNP|CUL2_uc001ixw.1_Splice_Site_SNP	NM_003591	NP_003582			cullin 2						cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding			ovary(3)	3														0.155556	6.497615	11.608417	7	38	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	35340780	35340780	4215	10	A	C	C	14	14	CUL2	C	5	4
ZWINT	11130	broad.mit.edu	36	10	57789827	57789827	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:57789827T>A	uc001jjx.1	-	c.214A>T	c.(214-216)ACT>TCT	p.T72S	ZWINT_uc001jjy.1_Missense_Mutation_p.T72S|ZWINT_uc001jka.1_Missense_Mutation_p.T72S|ZWINT_uc001jjz.1_5'UTR|ZWINT_uc009xoy.1_Intron	NM_007057	NP_127490	O95229	ZWINT_HUMAN	ZW10 interactor isoform a	72					cell division|establishment of localization in cell|mitotic cell cycle checkpoint|mitotic prometaphase|mitotic sister chromatid segregation|phosphatidylinositol-mediated signaling|spindle organization	condensed chromosome kinetochore|cytosol|nucleus	protein N-terminus binding				0														0.189189	7.296019	10.656925	7	30	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57789827	57789827	18854	10	T	A	A	59	59	ZWINT	A	4	4
TAF3	83860	broad.mit.edu	36	10	8096663	8096663	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:8096663G>C	uc009xis.1	+	c.2733G>C	c.(2731-2733)AAG>AAC	p.K911N		NM_031923	NP_114129	Q5VWG9	TAF3_HUMAN	RNA polymerase II transcription factor TAFII140	911	PHD-type.				maintenance of protein location in nucleus|regulation of transcription, DNA-dependent|transcription, DNA-dependent	transcription factor TFIID complex	protein binding|zinc ion binding			ovary(1)	1														0.789474	54.135149	55.607659	15	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8096663	8096663	16046	10	G	C	C	36	36	TAF3	C	3	3
PTEN	5728	broad.mit.edu	36	10	89614250	89614250	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:89614250G>A	uc001kfb.1	+	c.44G>A	c.(43-45)AGA>AAA	p.R15K	KILLIN_uc009xti.1_5'Flank	NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	15	Phosphatase tensin-type.		R -> S (in glioma).		apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of focal adhesion assembly|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of cyclin-dependent protein kinase activity|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.0?(12)|p.R15I(4)|p.R15K(1)|p.R14fs*26(1)|p.N12fs*6(1)|p.R14_D22del(1)		endometrium(831)|central_nervous_system(654)|skin(119)|haematopoietic_and_lymphoid_tissue(101)|prostate(97)|large_intestine(90)|breast(67)|lung(63)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(21)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(12)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2308		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)				31		264	TCGA GBM(2;<1E-8)|TSP Lung(26;0.18)			0.314286	61.927209	64.074149	22	48	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	89614250	89614250	13192	10	G	A	A	33	33	PTEN	A	2	2
KIF11	3832	broad.mit.edu	36	10	94403521	94403521	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr10:94403521G>A	uc001kic.1	+	c.3159G>A	c.(3157-3159)CAG>CAA	p.Q1053Q		NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	1053					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding				0						Colon(47;212 1003 2764 4062 8431)								0.260274	50.102623	53.89408	19	54	GG		KEEP	---	---	---	---	capture			Silent	SNP	94403521	94403521	8583	10	G	A	A	33	33	KIF11	A	2	2
PGR	5241	broad.mit.edu	36	11	100503866	100503866	+	Silent	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:100503866C>A	uc001pgh.2	-	c.1146G>T	c.(1144-1146)CCG>CCT	p.P382P	PGR_uc001pgi.2_Silent_p.P382P|PGR_uc009yww.1_Non-coding_Transcript|PGR_uc001pgj.2_Non-coding_Transcript|PGR_uc009ywx.1_Non-coding_Transcript	NM_000926	NP_000917	P06401	PRGR_HUMAN	progesterone receptor	382	Modulating, Pro-Rich.				cell-cell signaling|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	enzyme binding|receptor binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			lung(1)|liver(1)|central_nervous_system(1)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Mifepristone(DB00834)|Norethindrone(DB00717)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)	Pancreas(124;2271 2354 21954 22882)				429				0.138462	10.83056	19.055449	9	56	CC		KEEP	---	---	---	---	capture			Silent	SNP	100503866	100503866	12228	11	C	A	A	27	27	PGR	A	3	3
DDI1	414301	broad.mit.edu	36	11	103413119	103413120	+	Missense_Mutation	DNP	CC	GT	GT			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:103413119_103413120CC>GT	uc001phr.2	+	c.359_360CC>GT	c.(358-360)CCC>CGT	p.P120R	PDGFD_uc001php.1_Intron|PDGFD_uc001phq.1_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	120					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|pancreas(1)	4		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)										0.285714	6.900189	7.474286	4	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	103413119	103413120	4499	11	CC	GT	GT	22	22	DDI1	GT	3	3
ATM	472	broad.mit.edu	36	11	107655522	107655522	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:107655522G>A	uc001pkb.1	+	c.3379G>A	c.(3379-3381)GCT>ACT	p.A1127T	ATM_uc009yxr.1_Missense_Mutation_p.A1127T	NM_000051	NP_612149	Q13315	ATM_HUMAN	ataxia telangiectasia mutated protein isoform 1	1127					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(24)|breast(14)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	238		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)						1073	TSP Lung(14;0.12)			0.222222	12.733907	14.653517	6	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107655522	107655522	1128	11	G	A	A	34	34	ATM	A	2	2
OR4C16	219428	broad.mit.edu	36	11	55096270	55096270	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:55096270C>T	uc001nhp.1	+	c.91C>T	c.(91-93)CGT>TGT	p.R31C		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	31	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_epithelial(135;0.0748)												0.428571	146.27583	146.85933	57	76	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55096270	55096270	11455	11	C	T	T	27	27	OR4C16	T	1	1
RTN4RL2	349667	broad.mit.edu	36	11	56991749	56991749	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56991749G>A	uc001nkj.1	+	c.123G>A	c.(121-123)CCG>CCA	p.P41P		NM_178570	NP_848665	Q86UN3	R4RL2_HUMAN	reticulon 4 receptor-like 2	41					axon regeneration	anchored to plasma membrane	receptor activity				0														0.540323	197.727039	197.904651	67	57	GG		KEEP	---	---	---	---	capture			Silent	SNP	56991749	56991749	14212	11	G	A	A	38	38	RTN4RL2	A	1	1
SERPING1	710	broad.mit.edu	36	11	57124195	57124196	+	Missense_Mutation	DNP	AC	GG	GG			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:57124195_57124196AC>GG	uc009ymi.1	+	c.319_320AC>GG	c.(319-321)ACC>GGC	p.T107G	SERPING1_uc001nkp.1_Missense_Mutation_p.T107G|SERPING1_uc001nkq.1_Missense_Mutation_p.T107G|SERPING1_uc001nkr.1_Missense_Mutation_p.T107G|SERPING1_uc009ymj.1_Missense_Mutation_p.T107G|SERPING1_uc001nks.1_Intron	NM_001032295	NP_001027466	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	107	6.|7 X 4 AA tandem repeats of [QE]-P-T-[TQ].		Missing (in HAE; type 2).		blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1														0.454545	9.364881	9.385319	5	6	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	57124195	57124196	14604	11	AC	GG	GG	14	14	SERPING1	GG	4	4
SERPING1	710	broad.mit.edu	36	11	57138586	57138586	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr11:57138586A>C	uc009ymi.1	+	c.1486A>C	c.(1486-1488)AAG>CAG	p.K496Q	SERPING1_uc001nkp.1_Missense_Mutation_p.K487Q|SERPING1_uc001nkq.1_Missense_Mutation_p.K450Q|SERPING1_uc001nkr.1_Missense_Mutation_p.K487Q|SERPING1_uc009ymj.1_3'UTR|SERPING1_uc001nks.1_Missense_Mutation_p.K178Q	NM_001032295	NP_001027466	P05155	IC1_HUMAN	serpin peptidase inhibitor, clade G, member 1	487					blood circulation|blood coagulation, intrinsic pathway|complement activation, classical pathway|innate immune response|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation	extracellular space|platelet alpha granule lumen	protein binding|serine-type endopeptidase inhibitor activity			central_nervous_system(1)	1														0.193548	6.623622	9.356117	6	25	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57138586	57138586	14604	11	A	C	C	5	5	SERPING1	C	4	4
OR1S1	219959	broad.mit.edu	36	11	57739030	57739030	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:57739030T>C	uc001nmo.1	+	c.238T>C	c.(238-240)TCC>CCC	p.S80P		NM_001004458	NP_001004458	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S,	80	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1		Breast(21;0.0589)												0.298429	302.041405	316.026359	114	268	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57739030	57739030	11378	11	T	C	C	50	50	OR1S1	C	4	4
TMEM132A	54972	broad.mit.edu	36	11	60457641	60457641	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:60457641G>C	uc001nqi.1	+	c.1411G>C	c.(1411-1413)GCC>CCC	p.A471P	TMEM132A_uc001nqj.1_Missense_Mutation_p.A470P|TMEM132A_uc001nqk.2_Missense_Mutation_p.A483P|TMEM132A_uc001nql.1_3'UTR|TMEM132A_uc001nqm.1_5'Flank	NM_017870	NP_060340	Q24JP5	T132A_HUMAN	transmembrane protein 132A isoform a	470	Extracellular (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane					0														0.6	6.922345	6.965587	3	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	60457641	60457641	16576	11	G	C	C	38	38	TMEM132A	C	3	3
HRASLS5	117245	broad.mit.edu	36	11	62992471	62992471	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:62992471G>A	uc001nwy.1	-	c.418C>T	c.(418-420)CGA>TGA	p.R140*	HRASLS5_uc001nwz.1_Nonsense_Mutation_p.R130*|HRASLS5_uc009yos.1_Intron	NM_054108	NP_473449	Q96KN8	HRSL5_HUMAN	HRAS-like suppressor family, member 5	140										ovary(1)	1														0.431217	517.992237	519.54449	163	215	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	62992471	62992471	7643	11	G	A	A	37	37	HRASLS5	A	5	1
POLD3	10714	broad.mit.edu	36	11	74001593	74001593	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:74001593G>A	uc001ovf.1	+	c.282G>A	c.(280-282)GTG>GTA	p.V94V	POLD3_uc009yua.1_5'UTR	NM_006591	NP_006582	Q15054	DPOD3_HUMAN	polymerase (DNA directed), delta 3	94					base-excision repair|DNA strand elongation involved in DNA replication|DNA synthesis involved in DNA repair|mismatch repair|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	delta DNA polymerase complex|nucleoplasm	DNA-directed DNA polymerase activity|protein binding			kidney(2)|ovary(1)	3	Breast(11;3.21e-06)													0.203947	61.334453	73.714257	31	121	GG		KEEP	---	---	---	---	capture			Silent	SNP	74001593	74001593	12620	11	G	A	A	45	45	POLD3	A	2	2
KIAA1033	23325	broad.mit.edu	36	12	104061127	104061127	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:104061127G>C	uc001tld.1	+	c.1986G>C	c.(1984-1986)AAG>AAC	p.K662N	KIAA1033_uc001tle.1_Missense_Mutation_p.K474N	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	662					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2														0.2	6.421465	7.673765	3	12	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	104061127	104061127	8513	12	G	C	C	35	35	KIAA1033	C	3	3
PTPN11	5781	broad.mit.edu	36	12	111399907	111399907	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:111399907A>G	uc001ttx.1	+	c.923A>G	c.(922-924)AAT>AGT	p.N308S	PTPN11_uc001ttw.1_Missense_Mutation_p.N308S	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	308	Tyrosine-protein phosphatase.		N -> D (in NS1; common mutation).|N -> S (in NS1; some patients also manifest giant cell lesions of bone and soft tissue).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding			haematopoietic_and_lymphoid_tissue(372)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|ovary(1)|NS(1)|kidney(1)	388										372				0.103896	16.693469	40.734832	16	138	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111399907	111399907	13235	12	A	G	G	4	4	PTPN11	G	4	4
GRIN2B	2904	broad.mit.edu	36	12	13910143	13910143	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:13910143C>A	uc001rbt.2	-	c.267G>T	c.(265-267)ATG>ATT	p.M89I		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	89	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|lung(2)|skin(1)	10					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)					371				0.223881	33.39011	38.092892	15	52	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	13910143	13910143	7059	12	C	A	A	17	17	GRIN2B	A	3	3
GRIP1	23426	broad.mit.edu	36	12	65145467	65145467	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:65145467A>G	uc001stk.1	-	c.727T>C	c.(727-729)TCT>CCT	p.S243P	GRIP1_uc001stj.1_5'UTR|GRIP1_uc001stl.1_Missense_Mutation_p.S187P|GRIP1_uc001stm.1_Missense_Mutation_p.S243P	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	243					androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)										0.451613	78.459949	78.589625	28	34	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65145467	65145467	7066	12	A	G	G	11	11	GRIP1	G	4	4
IRS2	8660	broad.mit.edu	36	13	109232421	109232421	+	Silent	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:109232421G>T	uc001vqv.1	-	c.3981C>A	c.(3979-3981)TCC>TCA	p.S1327S		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1327				LPPANTYASIDFLSHHLKEATIVKE -> PAPCPTTYAQH (in Ref. 1; BAA24500).	fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	5	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			Melanoma(100;613 2409 40847)				156				0.857143	13.594359	14.103587	6	1	GG		KEEP	---	---	---	---	capture			Silent	SNP	109232421	109232421	8145	13	G	T	T	43	43	IRS2	T	3	3
TRIM13	10206	broad.mit.edu	36	13	49484354	49484354	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr13:49484354G>A	uc001vdp.1	+	c.286G>A	c.(286-288)GTA>ATA	p.V96I	DLEU2_uc001vdn.1_Intron|DLEU2_uc001vdo.1_Intron|TRIM13_uc001vdq.1_Missense_Mutation_p.V93I|TRIM13_uc001vdr.1_Missense_Mutation_p.V93I|TRIM13_uc001vds.1_Missense_Mutation_p.V93I|TRIM13_uc010adk.1_Missense_Mutation_p.V93I	NM_001007278	NP_998755	O60858	TRI13_HUMAN	ret finger protein 2 isoform 2	93	B box-type.				anatomical structure morphogenesis|ER-associated protein catabolic process|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination	cytoplasm|endoplasmic reticulum membrane|integral to membrane	protein binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)										0.673307	1080.092236	1093.449333	338	164	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49484354	49484354	17032	13	G	A	A	36	36	TRIM13	A	2	2
PCDH17	27253	broad.mit.edu	36	13	57104803	57104803	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr13:57104803A>G	uc001vhq.1	+	c.122A>G	c.(121-123)GAT>GGT	p.D41G	PCDH17_uc010aec.1_Missense_Mutation_p.D41G	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	41	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(2)|pancreas(2)	4		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		Melanoma(72;952 1291 1619 12849 33676)								0.3	6.71912	7.077972	3	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57104803	57104803	11932	13	A	G	G	12	12	PCDH17	G	4	4
SLITRK6	84189	broad.mit.edu	36	13	85266515	85266515	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:85266515T>A	uc001vll.1	-	c.2130A>T	c.(2128-2130)GAA>GAT	p.E710D	SLITRK6_uc010afe.1_Missense_Mutation_p.E163D|SLITRK6_uc010aff.1_Missense_Mutation_p.E710D	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6	710	Cytoplasmic (Potential).					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)										0.136612	40.780087	64.153769	25	158	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	85266515	85266515	15245	13	T	A	A	56	56	SLITRK6	A	4	4
TECPR2	9895	broad.mit.edu	36	14	102034302	102034302	+	Silent	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:102034302C>A	uc001ylw.1	+	c.4191C>A	c.(4189-4191)GCC>GCA	p.A1397A		NM_014844	NP_055659	O15040	TCPR2_HUMAN	hypothetical protein LOC9895	1397							protein binding			lung(1)|central_nervous_system(1)	2														0.26087	8.928813	10.12931	6	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	102034302	102034302	16271	14	C	A	A	21	21	TECPR2	A	3	3
CDC42BPB	9578	broad.mit.edu	36	14	102475710	102475710	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:102475710T>G	uc001ymi.1	-	c.4817A>C	c.(4816-4818)GAC>GCC	p.D1606A		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	1606					actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction|protein phosphorylation	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|lung(2)|ovary(1)|breast(1)|skin(1)	8		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)						1085				0.368421	7.487792	7.824861	7	12	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102475710	102475710	3201	14	T	G	G	58	58	CDC42BPB	G	4	4
OR4Q3	441669	broad.mit.edu	36	14	19285978	19285978	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr14:19285978A>T	uc001vwe.1	+	c.552A>T	c.(550-552)CAA>CAT	p.Q184H		NM_172194	NP_751944	Q8NH05	OR4Q3_HUMAN	olfactory receptor, family 4, subfamily Q,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(3)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)										0.206266	168.918315	199.5694	79	304	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19285978	19285978	11491	14	A	T	T	3	3	OR4Q3	T	4	4
SIP1	8487	broad.mit.edu	36	14	38672660	38672660	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:38672660C>T	uc001wuq.1	+	c.789C>T	c.(787-789)ATC>ATT	p.I263I	SIP1_uc001wur.1_Intron|SIP1_uc001wus.1_Silent_p.I248I|SIP1_uc010amx.1_Non-coding_Transcript	NM_003616	NP_003607	O14893	GEMI2_HUMAN	SMN-interacting protein 1 isoform alpha	263					ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	Cajal body|cytosol|spliceosomal complex	protein binding				0	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0121)										0.14	23.201187	35.701935	14	86	CC		KEEP	---	---	---	---	capture			Silent	SNP	38672660	38672660	14822	14	C	T	T	32	32	SIP1	T	2	2
GATM	2628	broad.mit.edu	36	15	43456141	43456141	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43456141C>T	uc001zvc.1	-	c.238G>A	c.(238-240)GTG>ATG	p.V80M	GATM_uc001zvb.1_De_novo_Start_InFrame	NM_001482	NP_001473	P50440	GATM_HUMAN	L-arginine:glycine amidinotransferase precursor	80					creatine biosynthetic process	mitochondrial inner membrane|mitochondrial intermembrane space	glycine amidinotransferase activity|protein binding				0		all_cancers(109;1.25e-09)|all_epithelial(112;5.56e-08)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.87e-16)|GBM - Glioblastoma multiforme(94;1.97e-06)	Creatine(DB00148)|Glycine(DB00145)|L-Ornithine(DB00129)									0.17284	30.607711	38.789791	14	67	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43456141	43456141	6527	15	C	T	T	20	20	GATM	T	2	2
FBN1	2200	broad.mit.edu	36	15	46724153	46724153	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:46724153C>T	uc001zwx.1	-	c.106G>A	c.(106-108)GAA>AAA	p.E36K		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	36					heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)						2933				0.25	26.838689	29.315985	11	33	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46724153	46724153	5938	15	C	T	T	30	30	FBN1	T	2	2
GALK2	2585	broad.mit.edu	36	15	47249819	47249819	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:47249819C>A	uc001zxj.1	+	c.8C>A	c.(7-9)ACA>AAA	p.T3K	GALK2_uc001zxi.1_Intron|GALK2_uc001zxk.1_Non-coding_Transcript	NM_002044	NP_002035	Q01415	GALK2_HUMAN	galactokinase 2 isoform 1	3					galactose metabolic process	cytoplasm	ATP binding|galactokinase activity|N-acetylgalactosamine kinase activity			breast(1)	1		all_lung(180;0.000325)		all cancers(107;3.71e-08)|GBM - Glioblastoma multiforme(94;7e-05)										0.3125	10.008591	10.488416	5	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47249819	47249819	6468	15	C	A	A	17	17	GALK2	A	3	3
MAN2C1	4123	broad.mit.edu	36	15	73437949	73437949	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:73437949G>A	uc002baf.1	-	c.2310C>T	c.(2308-2310)AGC>AGT	p.S770S	MAN2C1_uc002bag.1_Silent_p.S770S|MAN2C1_uc002bah.1_Silent_p.S787S|MAN2C1_uc010bkk.1_Silent_p.S671S	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	770					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0														0.714286	17.378225	17.667085	5	2	GG		KEEP	---	---	---	---	capture			Silent	SNP	73437949	73437949	9601	15	G	A	A	38	38	MAN2C1	A	1	1
SCNN1B	6338	broad.mit.edu	36	16	23274150	23274150	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:23274150C>T	uc002dln.1	+	c.615C>T	c.(613-615)TTC>TTT	p.F205F		NM_000336	NP_000327	P51168	SCNNB_HUMAN	sodium channel, nonvoltage-gated 1, beta	205	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(3)|breast(2)|large_intestine(1)|pancreas(1)	7				GBM - Glioblastoma multiforme(48;0.0465)	Amiloride(DB00594)|Triamterene(DB00384)									0.283019	38.70256	40.944521	15	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	23274150	23274150	14410	16	C	T	T	30	30	SCNN1B	T	2	2
TNRC6A	27327	broad.mit.edu	36	16	24723108	24723108	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:24723108G>A	uc002dmm.1	+	c.3804G>A	c.(3802-3804)GAG>GAA	p.E1268E	TNRC6A_uc010bxs.1_Silent_p.E1015E|TNRC6A_uc002dmn.1_Silent_p.E1015E|TNRC6A_uc002dmo.1_Silent_p.E956E|TNRC6A_uc002dmp.2_5'UTR|TNRC6A_uc002dmq.2_5'Flank	NM_014494	NP_055309	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1268	Sufficient for interaction with EIF2C1 and EIF2C4.				negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|micro-ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0394)										0.30303	83.318237	86.7435	30	69	GG		KEEP	---	---	---	---	capture			Silent	SNP	24723108	24723108	16881	16	G	A	A	36	36	TNRC6A	A	2	2
SLC5A11	115584	broad.mit.edu	36	16	24827834	24827834	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:24827834C>T	uc002dmu.1	+	c.1566C>T	c.(1564-1566)CTC>CTT	p.L522L	SLC5A11_uc002dms.1_Silent_p.L458L|SLC5A11_uc002dmt.1_Silent_p.L366L|SLC5A11_uc010bxt.1_Silent_p.L458L|SLC5A11_uc002dmv.1_Silent_p.L145L	NM_052944	NP_443176	Q8WWX8	SC5AB_HUMAN	solute carrier family 5 (sodium/glucose	522	Helical; (Potential).				apoptosis|carbohydrate transport|sodium ion transport	integral to membrane|plasma membrane	polyol transmembrane transporter activity|symporter activity			ovary(2)	2				GBM - Glioblastoma multiforme(48;0.0365)										0.161765	17.583072	24.989165	11	57	CC		KEEP	---	---	---	---	capture			Silent	SNP	24827834	24827834	15160	16	C	T	T	32	32	SLC5A11	T	2	2
PYCARD	29108	broad.mit.edu	36	16	31120983	31120983	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:31120983G>A	uc010cak.1	-	c.317C>T	c.(316-318)TCG>TTG	p.S106L	PYCARD_uc002ebm.1_Intron	NM_013258	NP_037390	Q9ULZ3	ASC_HUMAN	PYD and CARD domain containing isoform a	106					activation of caspase activity|induction of apoptosis|positive regulation of interleukin-1 beta secretion|positive regulation of NF-kappaB transcription factor activity|proteolysis|tumor necrosis factor-mediated signaling pathway	IkappaB kinase complex	caspase activator activity|cysteine-type endopeptidase activity|protein homodimerization activity|Pyrin domain binding				0														0.416667	11.971485	12.04431	5	7	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31120983	31120983	13312	16	G	A	A	37	37	PYCARD	A	1	1
PLA2G15	23659	broad.mit.edu	36	16	66850924	66850924	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66850924G>A	uc002evr.1	+	c.1102G>A	c.(1102-1104)GCC>ACC	p.A368T	PLA2G15_uc002evs.1_Missense_Mutation_p.A189T	NM_012320	NP_036452	Q8NCC3	PAG15_HUMAN	lysophospholipase 3 (lysosomal phospholipase	368					fatty acid catabolic process	extracellular region|lysosome	lysophospholipase activity|phosphatidylcholine-sterol O-acyltransferase activity|phospholipid binding			ovary(1)	1														0.227273	7.060123	8.568007	5	17	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66850924	66850924	12418	16	G	A	A	46	46	PLA2G15	A	2	2
SMPD3	55512	broad.mit.edu	36	16	66962448	66962448	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66962448C>T	uc002ewa.1	-	c.1138G>A	c.(1138-1140)GGC>AGC	p.G380S	SMPD3_uc010cfe.1_Missense_Mutation_p.G380S	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	sphingomyelin phosphodiesterase 3, neutral	380	Lumenal (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)									0.555556	46.825714	46.898516	15	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	66962448	66962448	15306	16	C	T	T	23	23	SMPD3	T	1	1
USP7	7874	broad.mit.edu	36	16	8907914	8907914	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:8907914A>C	uc002czl.2	-	c.1298T>G	c.(1297-1299)CTT>CGT	p.L433R	USP7_uc002czk.2_Missense_Mutation_p.L417R|USP7_uc002czj.2_Non-coding_Transcript	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific protease 7	433					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3														0.315789	9.631116	10.211692	6	13	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	8907914	8907914	17652	16	A	C	C	3	3	USP7	C	4	4
GRIN2A	2903	broad.mit.edu	36	16	9770268	9770268	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:9770268G>A	uc002czp.1	-	c.2536C>T	c.(2536-2538)CGC>TGC	p.R846C	GRIN2A_uc002czq.1_Missense_Mutation_p.R846C|GRIN2A_uc002czr.2_Missense_Mutation_p.R846C	NM_000833	NP_000824	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	846	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)					324				0.285714	23.437049	24.879342	10	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9770268	9770268	7058	16	G	A	A	38	38	GRIN2A	A	1	1
MYO15A	51168	broad.mit.edu	36	17	18007786	18007786	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18007786C>T	uc010cpt.1	+	c.9696C>T	c.(9694-9696)GCC>GCT	p.A3232A	MYO15A_uc010cpu.1_Silent_p.A3232A|MYO15A_uc002gsl.1_Silent_p.A239A|MYO15A_uc002gsm.1_Silent_p.A154A|MYO15A_uc010cpv.1_Non-coding_Transcript	NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	3232	Tail.|FERM.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)|skin(1)	6	all_neural(463;0.228)													0.254902	31.975573	34.740078	13	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	18007786	18007786	10458	17	C	T	T	22	22	MYO15A	T	2	2
FAM83G	644815	broad.mit.edu	36	17	18822157	18822157	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:18822157A>G	uc002guw.1	-	c.1547T>C	c.(1546-1548)CTA>CCA	p.L516P	SLC5A10_uc002gur.1_Intron|SLC5A10_uc002gut.1_Intron|SLC5A10_uc002guu.1_Intron|SLC5A10_uc002guv.1_Intron	NM_001039999	NP_001035088	A6ND36	FA83G_HUMAN	hypothetical protein LOC644815	516										ovary(1)	1														0.266667	6.399762	7.134974	4	11	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18822157	18822157	5865	17	A	G	G	15	15	FAM83G	G	4	4
SLC47A1	55244	broad.mit.edu	36	17	19404203	19404203	+	Splice_Site_SNP	SNP	T	C	C			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:19404203T>C	uc002gvx.2	+	c.e11_splice_site			SLC47A1_uc002gvy.1_Splice_Site_SNP|SLC47A1_uc010cqp.1_Intron|SLC47A1_uc010cqq.1_Splice_Site_SNP	NM_018242	NP_060712			solute carrier family 47, member 1							integral to membrane|plasma membrane	drug:hydrogen antiporter activity				0	all_cancers(12;2.49e-05)|all_epithelial(12;0.00263)|Hepatocellular(7;0.00345)													0.233333	9.602172	11.565757	7	23	TT		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	19404203	19404203	15144	17	T	C	C	59	59	SLC47A1	C	5	4
SLC6A4	6532	broad.mit.edu	36	17	25568327	25568327	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:25568327C>T	uc002hey.2	-	c.820G>A	c.(820-822)GTC>ATC	p.V274I		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	274					response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|integral to plasma membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			ovary(1)	1					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)									0.439024	53.462247	53.590757	18	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25568327	25568327	15183	17	C	T	T	19	19	SLC6A4	T	1	1
NF1	4763	broad.mit.edu	36	17	26533676	26533676	+	Nonsense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr17:26533676T>A	uc002hgg.1	+	c.755T>A	c.(754-756)TTG>TAG	p.L252*	NF1_uc002hge.1_Nonsense_Mutation_p.L252*|NF1_uc002hgf.1_Nonsense_Mutation_p.L252*|NF1_uc002hgh.1_Nonsense_Mutation_p.L252*|NF1_uc010csn.1_Nonsense_Mutation_p.L112*	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	252					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.?(2)		soft_tissue(155)|central_nervous_system(56)|large_intestine(27)|lung(19)|haematopoietic_and_lymphoid_tissue(13)|ovary(12)|autonomic_ganglia(7)|skin(3)|stomach(2)|breast(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	300		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)						847	TCGA GBM(6;<1E-8)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			0.261538	45.047729	48.391427	17	48	TT		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	26533676	26533676	10756	17	T	A	A	63	63	NF1	A	5	4
SLFN13	146857	broad.mit.edu	36	17	30795756	30795756	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:30795756C>T	uc002hjk.1	-	c.1057G>A	c.(1057-1059)GCA>ACA	p.A353T	SLFN13_uc002hjl.1_Missense_Mutation_p.A353T|SLFN13_uc010ctt.1_Missense_Mutation_p.A35T|SLFN13_uc002hjm.1_Missense_Mutation_p.A22T	NM_144682	NP_653283	Q68D06	SLN13_HUMAN	schlafen family member 13	353						intracellular	ATP binding			ovary(1)|breast(1)	2				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)										0.224852	86.480526	98.228167	38	131	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30795756	30795756	15233	17	C	T	T	27	27	SLFN13	T	1	1
NAGLU	4669	broad.mit.edu	36	17	37948851	37948851	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:37948851C>G	uc002hzv.1	+	c.1301C>G	c.(1300-1302)CCC>CGC	p.P434R	NAGLU_uc010cyh.1_Missense_Mutation_p.P101R	NM_000263	NP_000254	P54802	ANAG_HUMAN	alpha-N-acetylglucosaminidase precursor	434						lysosome	alpha-N-acetylglucosaminidase activity				0		all_cancers(22;1.58e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)	N-Acetyl-D-glucosamine(DB00141)									0.32	12.531013	13.285205	8	17	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37948851	37948851	10539	17	C	G	G	22	22	NAGLU	G	3	3
CALCOCO2	10241	broad.mit.edu	36	17	44274113	44274113	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:44274113G>A	uc002iof.1	+	c.45G>A	c.(43-45)CTG>CTA	p.L15L		NM_005831	NP_005822	Q13137	CACO2_HUMAN	calcium binding and coiled-coil domain 2	15					response to interferon-gamma|viral reproduction	cytoskeleton|Golgi apparatus|nucleus|perinuclear region of cytoplasm|soluble fraction	protein homodimerization activity			ovary(1)	1														0.398496	146.94075	148.1403	53	80	GG		KEEP	---	---	---	---	capture			Silent	SNP	44274113	44274113	2694	17	G	A	A	47	47	CALCOCO2	A	2	2
PDK2	5164	broad.mit.edu	36	17	45540771	45540771	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:45540771G>A	uc002iqc.1	+	c.852G>A	c.(850-852)CTG>CTA	p.L284L	PDK2_uc002iqb.1_Silent_p.L220L	NM_002611	NP_002602	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2	284	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|nucleus	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			central_nervous_system(3)	3										445				0.248521	101.77288	111.493924	42	127	GG		KEEP	---	---	---	---	capture			Silent	SNP	45540771	45540771	12097	17	G	A	A	48	48	PDK2	A	2	2
CUEDC1	404093	broad.mit.edu	36	17	53312024	53312024	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:53312024G>A	uc002ivd.1	-	c.411C>T	c.(409-411)CAC>CAT	p.H137H	CUEDC1_uc002ive.1_Silent_p.H137H	NM_017949	NP_060419	Q9NWM3	CUED1_HUMAN	CUE domain-containing 1	137	Pro-rich.										0														0.188406	14.73028	21.021011	13	56	GG		KEEP	---	---	---	---	capture			Silent	SNP	53312024	53312024	4212	17	G	A	A	48	48	CUEDC1	A	2	2
CSH2	1443	broad.mit.edu	36	17	59304367	59304367	+	Silent	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:59304367A>C	uc002jch.1	-	c.75T>G	c.(73-75)GGT>GGG	p.G25G	CSH2_uc002jcg.1_Silent_p.G25G|CSH2_uc002jci.1_Silent_p.G25G|GH2_uc002jcj.1_Intron|CSH2_uc002jck.1_Silent_p.G25G	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1	25					female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0														0.346154	7.67764	8.354825	9	17	AA		KEEP	---	---	---	---	capture			Silent	SNP	59304367	59304367	4082	17	A	C	C	6	6	CSH2	C	4	4
NLGN2	57555	broad.mit.edu	36	17	7260991	7260991	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7260991C>T	uc002ggt.1	+	c.1657C>T	c.(1657-1659)CAG>TAG	p.Q553*		NM_020795	NP_065846	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	553	Extracellular (Potential).				cell-cell junction maintenance|neuron cell-cell adhesion|positive regulation of synaptogenesis|regulation of inhibitory postsynaptic membrane potential|regulation of synaptic transmission|synapse assembly	cell surface|integral to plasma membrane|postsynaptic membrane	carboxylesterase activity|neurexin binding			central_nervous_system(1)	1		Prostate(122;0.157)												0.357143	26.938693	27.443342	10	18	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	7260991	7260991	10865	17	C	T	T	25	25	NLGN2	T	5	2
TP53	7157	broad.mit.edu	36	17	7518275	7518275	+	Missense_Mutation	SNP	C	T	T	rs28934572	unknown	TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7518275C>T	uc002gim.2	-	c.731G>A	c.(730-732)GGC>GAC	p.G244D	TP53_uc002gig.1_Missense_Mutation_p.G244D|TP53_uc002gih.1_Missense_Mutation_p.G244D|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G112D|TP53_uc010cng.1_Missense_Mutation_p.G112D|TP53_uc002gii.1_Missense_Mutation_p.G112D|TP53_uc010cnh.1_Missense_Mutation_p.G244D|TP53_uc010cni.1_Missense_Mutation_p.G244D|TP53_uc002gij.2_Missense_Mutation_p.G244D|TP53_uc010cnj.1_Non-coding_Transcript|TP53_uc002gin.2_Missense_Mutation_p.G151D|TP53_uc002gio.2_Missense_Mutation_p.G112D	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	244	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> A (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.G244D(32)|p.G244V(13)|p.G244A(9)|p.0?(6)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.G244E(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.C238_M246delCNSSCMGGM(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)		111	p.G244V(EB2-Tumor)|p.G244A(HLF-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.562842	633.800372	635.073248	206	160	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7518275	7518275	16923	17	C	T	T	26	26	TP53	T	2	2
GUCY2D	3000	broad.mit.edu	36	17	7851119	7851119	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7851119C>T	uc002gjt.2	+	c.1395C>T	c.(1393-1395)CTC>CTT	p.L465L		NM_000180	NP_000171	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane	465	Helical; (Potential).				intracellular signal transduction|protein phosphorylation|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity			skin(1)	1		Prostate(122;0.157)								285				0.246154	36.062827	39.882534	16	49	CC		KEEP	---	---	---	---	capture			Silent	SNP	7851119	7851119	7177	17	C	T	T	31	31	GUCY2D	T	1	1
PTPN2	5771	broad.mit.edu	36	18	12820956	12820956	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:12820956C>A	uc002krp.1	-	c.346G>T	c.(346-348)GTG>TTG	p.V116L	PTPN2_uc002krl.1_Missense_Mutation_p.V116L|PTPN2_uc002krm.1_Missense_Mutation_p.V116L|PTPN2_uc002krn.1_Missense_Mutation_p.V116L|PTPN2_uc002kro.1_Missense_Mutation_p.V116L	NM_002828	NP_536347	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type	116	Tyrosine-protein phosphatase.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway	endoplasmic reticulum|nucleoplasm	protein binding				0		Lung NSC(161;8.94e-06)												0.25	7.156775	8.301982	5	15	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12820956	12820956	13240	18	C	A	A	17	17	PTPN2	A	3	3
CCDC11	220136	broad.mit.edu	36	18	46031224	46031224	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:46031224G>A	uc002lee.1	-	c.898C>T	c.(898-900)CAG>TAG	p.Q300*		NM_145020	NP_659457	Q96M91	CCD11_HUMAN	coiled-coil domain containing 11	300	Potential.									ovary(1)|pancreas(1)	2				STAD - Stomach adenocarcinoma(97;2.66e-05)|Colorectal(21;7.57e-05)|Lung(128;0.00932)|READ - Rectum adenocarcinoma(32;0.164)										0.155211	122.584717	173.726728	70	381	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	46031224	46031224	2866	18	G	A	A	45	45	CCDC11	A	5	2
DCC	1630	broad.mit.edu	36	18	49267192	49267192	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr18:49267192C>T	uc002lfe.1	+	c.3764C>T	c.(3763-3765)ACG>ATG	p.T1255M	DCC_uc010dpf.1_Missense_Mutation_p.T890M	NM_005215	NP_005206	P43146	DCC_HUMAN	deleted in colorectal carcinoma	1255	Cytoplasmic (Potential).				apoptosis|induction of apoptosis	cytosol|integral to membrane				ovary(6)|large_intestine(1)|central_nervous_system(1)|skin(1)	9		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)										0.138756	45.439479	71.831457	29	180	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	49267192	49267192	4453	18	C	T	T	19	19	DCC	T	1	1
ZNF627	199692	broad.mit.edu	36	19	11589118	11589118	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:11589118G>T	uc002msk.1	+	c.800G>T	c.(799-801)CGA>CTA	p.R267L	ZNF627_uc010dyf.1_Missense_Mutation_p.R157L	NM_145295	NP_660338	Q7L945	ZN627_HUMAN	zinc finger protein 627	267	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						Melanoma(112;173 1614 10731 17751 23322)								0.192982	20.693816	25.713386	11	46	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11589118	11589118	18646	19	G	T	T	37	37	ZNF627	T	3	3
HAMP	57817	broad.mit.edu	36	19	40465319	40465319	+	De_novo_Start_InFrame	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40465319C>T	uc002nyw.1	+	c.-1C>T	c.(-3-1)CACGA>CATGA			NM_021175	NP_066998			hepcidin antimicrobial peptide preproprotein						defense response to bacterium|defense response to fungus|immune response|killing of cells of other organism	extracellular region	hormone activity			central_nervous_system(1)	1	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)											0.333333	19.950329	20.450983	7	14	CC		KEEP	---	---	---	---	capture			De_novo_Start_InFrame	SNP	40465319	40465319	7230	19	C	T	T	19	19	HAMP	T	5	1
NPHS1	4868	broad.mit.edu	36	19	41014216	41014216	+	Splice_Site_SNP	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:41014216A>C	uc002oby.2	-	c.e25_splice_site			NPHS1_uc010eem.1_Splice_Site_SNP	NM_004646	NP_004637			nephrin precursor						cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)	4	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)											0.625	6.470773	6.559067	5	3	AA		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	41014216	41014216	10986	19	A	C	C	14	14	NPHS1	C	5	4
SPINT2	10653	broad.mit.edu	36	19	43472610	43472610	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:43472610G>A	uc002ohr.1	+	c.403G>A	c.(403-405)GCC>ACC	p.A135T	SPINT2_uc002ohs.1_Missense_Mutation_p.A78T	NM_021102	NP_066925	O43291	SPIT2_HUMAN	serine protease inhibitor, Kunitz type, 2	135	Extracellular (Potential).|BPTI/Kunitz inhibitor 2.				cellular component movement	cytoplasm|extracellular region|integral to membrane|soluble fraction	serine-type endopeptidase inhibitor activity				0	all_cancers(60;6.83e-07)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)											0.207547	23.797928	27.99821	11	42	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43472610	43472610	15581	19	G	A	A	38	38	SPINT2	A	1	1
TTC9B	148014	broad.mit.edu	36	19	45413992	45413993	+	Missense_Mutation	DNP	AG	CT	CT			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:45413992_45413993AG>CT	uc002onc.1	-	c.637_638CT>AG	c.(637-639)CTG>AGG	p.L213R		NM_152479	NP_689692	Q8N6N2	TTC9B_HUMAN	tetratricopeptide repeat domain 9B	213							binding				0														0.366667	19.58173	20.063574	11	19	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	45413992	45413993	17271	19	AG	CT	CT	7	7	TTC9B	CT	4	4
CYP2A6	1548	broad.mit.edu	36	19	46041627	46041627	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:46041627A>G	uc002opl.2	-	c.1399T>C	c.(1399-1401)TCA>CCA	p.S467P		NM_000762	NP_000753	P11509	CP2A6_HUMAN	cytochrome P450, family 2, subfamily A,	467					coumarin catabolic process|exogenous drug catabolic process|oxidation-reduction process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|enzyme binding|heme binding			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Chlorzoxazone(DB00356)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Formoterol(DB00983)|Halothane(DB01159)|Letrozole(DB01006)|Methoxsalen(DB00553)|Metyrapone(DB01011)|Nicotine(DB00184)|Pilocarpine(DB01085)|Tolbutamide(DB01124)|Tranylcypromine(DB00752)									0.16	7.460866	12.985897	8	42	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46041627	46041627	4327	19	A	G	G	10	10	CYP2A6	G	4	4
VASP	7408	broad.mit.edu	36	19	50712921	50712921	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:50712921C>A	uc002pcg.1	+	c.166C>A	c.(166-168)CCC>ACC	p.P56T	VASP_uc010eki.1_Missense_Mutation_p.S39R|VASP_uc002pci.1_Missense_Mutation_p.P43T	NM_003370	NP_003361	P50552	VASP_HUMAN	vasodilator-stimulated phosphoprotein	56	WH1.				axon guidance|cell junction assembly|T cell receptor signaling pathway	actin cytoskeleton|cytosol|filopodium membrane|focal adhesion|lamellipodium membrane	actin binding|profilin binding|SH3 domain binding				0		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0145)|GBM - Glioblastoma multiforme(486;0.154)										0.444444	16.687161	16.736674	8	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	50712921	50712921	17693	19	C	A	A	26	26	VASP	A	3	3
SCAF1	58506	broad.mit.edu	36	19	54846131	54846132	+	Missense_Mutation	DNP	TT	GA	GA			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:54846131_54846132TT>GA	uc002poq.1	+	c.673_674TT>GA	c.(673-675)TTC>GAC	p.F225D	SCAF1_uc002por.1_Missense_Mutation_p.F225D	NM_021228	NP_067051	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	225	Pro-rich.				mRNA processing|RNA splicing	nucleus	RNA binding				0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)										0.466667	13.715309	13.730104	7	8	TT		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	54846131	54846132	14349	19	TT	GA	GA	52	52	SCAF1	GA	4	4
LILRB5	10990	broad.mit.edu	36	19	59451830	59451830	+	Silent	SNP	A	T	T			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59451830A>T	uc002qey.1	-	c.543T>A	c.(541-543)CCT>CCA	p.P181P	LILRA6_uc002qew.1_Intron|LILRB5_uc002qex.1_Silent_p.P181P|LILRB5_uc002qez.1_Intron|LILRB5_uc002qfa.1_Intron	NM_001081442	NP_001074911	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor,	181	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|defense response	integral to membrane	transmembrane receptor activity			ovary(1)|pancreas(1)	2	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)										0.368421	13.210883	13.503183	7	12	AA		KEEP	---	---	---	---	capture			Silent	SNP	59451830	59451830	9120	19	A	T	T	7	7	LILRB5	T	4	4
ADAMTS10	81794	broad.mit.edu	36	19	8571875	8571875	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:8571875C>T	uc002mkj.1	-	c.747G>A	c.(745-747)AAG>AAA	p.K249K	ADAMTS10_uc002mkk.1_5'UTR	NM_030957	NP_112219	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1	249	Peptidase M12B.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			pancreas(2)|skin(1)	3														0.154179	174.003595	253.432227	107	587	CC		KEEP	---	---	---	---	capture			Silent	SNP	8571875	8571875	257	19	C	T	T	32	32	ADAMTS10	T	2	2
OR7G2	390882	broad.mit.edu	36	19	9074978	9074978	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9074978G>A	uc002mkr.1	-	c.5C>T	c.(4-6)CCG>CTG	p.P2L		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	Error:Variant_position_missing_in_Q8NG99_after_alignment					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						Esophageal Squamous(67;143 1448 28637 40648)								0.285714	49.931275	52.523316	18	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	9074978	9074978	11634	19	G	A	A	39	39	OR7G2	A	1	1
AMY2B	280	broad.mit.edu	36	1	103923563	103923563	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:103923563C>T	uc001duo.1	+	c.1454C>T	c.(1453-1455)TCT>TTT	p.S485F	LOC648740_uc009wei.1_Intron|AMY2B_uc009wej.1_Intron|AMY2B_uc001dus.1_Intron|AMY2B_uc001dup.1_Missense_Mutation_p.S485F|AMY2B_uc001duq.1_Missense_Mutation_p.S485F|LOC648740_uc001dur.1_Missense_Mutation_p.S485F	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor	485					carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)										0.149682	81.232531	118.184807	47	267	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103923563	103923563	598	1	C	T	T	32	32	AMY2B	T	2	2
LRIG2	9860	broad.mit.edu	36	1	113460484	113460484	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:113460484G>A	uc001edf.1	+	c.2583G>A	c.(2581-2583)ACG>ACA	p.T861T	LRIG2_uc009wgn.1_Silent_p.T758T	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	861	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)										0.781609	221.426963	227.787273	68	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	113460484	113460484	9318	1	G	A	A	38	38	LRIG2	A	1	1
DENND2C	163259	broad.mit.edu	36	1	114938649	114938649	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:114938649T>A	uc001efd.1	-	c.2399A>T	c.(2398-2400)GAA>GTA	p.E800V	DENND2C_uc001eez.2_Non-coding_Transcript|DENND2C_uc001efc.1_Missense_Mutation_p.E743V	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	800											0	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)										0.526316	33.251641	33.263176	10	9	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	114938649	114938649	4609	1	T	A	A	62	62	DENND2C	A	4	4
TRIM45	80263	broad.mit.edu	36	1	117465120	117465120	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:117465120G>A	uc001egz.1	-	c.227C>T	c.(226-228)TCA>TTA	p.S76L	TRIM45_uc009whe.1_Missense_Mutation_p.S76L|TRIM45_uc001eha.1_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45	76	RING-type.					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)										0.146341	18.654874	28.509501	12	70	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	117465120	117465120	17065	1	G	A	A	45	45	TRIM45	A	2	2
HRNR	388697	broad.mit.edu	36	1	150457758	150457758	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150457758G>A	uc001ezt.1	-	c.2971C>T	c.(2971-2973)CGT>TGT	p.R991C		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	991	11.				keratinization		calcium ion binding|protein binding			ovary(1)	1	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.14433	24.596382	36.40093	14	83	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150457758	150457758	7653	1	G	A	A	39	39	HRNR	A	1	1
FLG	2312	broad.mit.edu	36	1	150543140	150543140	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:150543140C>T	uc001ezu.1	-	c.10846G>A	c.(10846-10848)GAA>AAA	p.E3616K		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3616	Filaggrin 22.|Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)	9	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)											0.098253	20.692387	94.663146	45	413	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150543140	150543140	6160	1	C	T	T	29	29	FLG	T	2	2
NUP210L	91181	broad.mit.edu	36	1	152328570	152328570	+	Missense_Mutation	SNP	A	G	G			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152328570A>G	uc001fdw.1	-	c.2312T>C	c.(2311-2313)GTG>GCG	p.V771A	NUP210L_uc009woq.1_5'UTR	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	771						integral to membrane				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)											0.393939	31.659593	31.986246	13	20	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	152328570	152328570	11166	1	A	G	G	6	6	NUP210L	G	4	4
IL6R	3570	broad.mit.edu	36	1	152673706	152673706	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:152673706G>A	uc001fez.1	+	c.546G>A	c.(544-546)GAG>GAA	p.E182E	IL6R_uc001ffa.1_Silent_p.E182E	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor	182	Extracellular (Potential).				acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|monocyte chemotaxis|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|neutrophil mediated immunity|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)											0.293103	41.945896	44.173202	17	41	GG		KEEP	---	---	---	---	capture			Silent	SNP	152673706	152673706	8003	1	G	A	A	35	35	IL6R	A	2	2
KCNN3	3782	broad.mit.edu	36	1	153011432	153011433	+	Missense_Mutation	DNP	AG	TT	TT			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:153011432_153011433AG>TT	uc001ffp.1	-	c.1090_1091CT>AA	c.(1090-1092)CTG>AAG	p.L364K	KCNN3_uc001ffo.1_Missense_Mutation_p.L59K|KCNN3_uc009wox.1_Missense_Mutation_p.L364K	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	369						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)											0.19403	16.146638	22.005779	13	54	AA		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	153011432	153011433	8385	1	AG	TT	TT	7	7	KCNN3	TT	4	4
GON4L	54856	broad.mit.edu	36	1	154052230	154052230	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:154052230G>A	uc001flz.2	-	c.1151C>T	c.(1150-1152)ACT>ATT	p.T384I	GON4L_uc001fly.1_Missense_Mutation_p.T384I|GON4L_uc009wrh.1_Missense_Mutation_p.T384I|GON4L_uc001fma.1_Missense_Mutation_p.T384I|GON4L_uc001fmc.1_Missense_Mutation_p.T384I|GON4L_uc001fmd.2_Missense_Mutation_p.T384I|GON4L_uc009wri.1_5'UTR|GON4L_uc001fme.2_Missense_Mutation_p.T212I|GON4L_uc001fmf.2_Missense_Mutation_p.T78I	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	384					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)													0.16129	10.355124	13.739087	5	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	154052230	154052230	6845	1	G	A	A	36	36	GON4L	A	2	2
FCRL2	79368	broad.mit.edu	36	1	156006405	156006405	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:156006405C>A	uc001fre.1	-	c.470G>T	c.(469-471)AGC>ATC	p.S157I	FCRL2_uc001frd.1_5'Flank|FCRL2_uc009wsp.1_Intron	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 isoform b	157	Extracellular (Potential).|Ig-like C2-type 2.				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)											0.304348	13.109466	13.899495	7	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	156006405	156006405	6032	1	C	A	A	28	28	FCRL2	A	3	3
ARHGAP30	257106	broad.mit.edu	36	1	159288707	159288707	+	Silent	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159288707G>C	uc001fxl.1	-	c.1011C>G	c.(1009-1011)GCC>GCG	p.A337A	ARHGAP30_uc001fxk.1_Silent_p.A337A|ARHGAP30_uc001fxm.1_Silent_p.A183A|ARHGAP30_uc009wtx.1_Silent_p.A10A|ARHGAP30_uc001fxn.1_Silent_p.A183A	NM_001025598	NP_001020769	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30 isoform 1	337					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(2)	2	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)											0.208333	7.255797	9.15549	5	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	159288707	159288707	891	1	G	C	C	47	47	ARHGAP30	C	3	3
DUSP12	11266	broad.mit.edu	36	1	159986236	159986236	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159986236G>A	uc001gbo.1	+	c.21G>A	c.(19-21)CCG>CCA	p.P7P	DUSP12_uc001gbp.1_5'UTR	NM_007240	NP_009171	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	7					positive regulation of glucokinase activity	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|zinc ion binding			breast(1)	1	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)											0.444444	12.836232	12.853182	4	5	GG		KEEP	---	---	---	---	capture			Silent	SNP	159986236	159986236	4997	1	G	A	A	37	37	DUSP12	A	1	1
DUSP12	11266	broad.mit.edu	36	1	159988302	159988302	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:159988302C>T	uc001gbo.1	+	c.481C>T	c.(481-483)CAA>TAA	p.Q161*	DUSP12_uc001gbp.1_Nonsense_Mutation_p.Q31*	NM_007240	NP_009171	Q9UNI6	DUS12_HUMAN	dual specificity phosphatase 12	161					positive regulation of glucokinase activity	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity|zinc ion binding			breast(1)	1	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)											0.2	21.820767	26.008831	10	40	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	159988302	159988302	4997	1	C	T	T	25	25	DUSP12	T	5	2
QSOX1	5768	broad.mit.edu	36	1	178411742	178411742	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:178411742T>A	uc001gnz.1	+	c.466T>A	c.(466-468)TCC>ACC	p.S156T	QSOX1_uc001gny.1_Missense_Mutation_p.S156T|QSOX1_uc001goa.1_Missense_Mutation_p.S156T	NM_002826	NP_002817	O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1 isoform a	156	Thioredoxin.				cell redox homeostasis|oxidation-reduction process|protein thiol-disulfide exchange	extracellular space|integral to Golgi membrane	flavin-linked sulfhydryl oxidase activity			ovary(1)|central_nervous_system(1)	2														0.451613	25.838743	25.900954	14	17	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	178411742	178411742	13341	1	T	A	A	58	58	QSOX1	A	4	4
MYOG	4656	broad.mit.edu	36	1	201321320	201321320	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:201321320G>A	uc001gzd.1	-	c.393C>T	c.(391-393)CGC>CGT	p.R131R		NM_002479	NP_002470	P15173	MYOG_HUMAN	myogenin	131	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of muscle cell differentiation	transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity			skin(1)	1														0.590909	37.780406	37.94241	13	9	GG		KEEP	---	---	---	---	capture			Silent	SNP	201321320	201321320	10485	1	G	A	A	42	42	MYOG	A	2	2
PROX1	5629	broad.mit.edu	36	1	212236822	212236822	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:212236822G>A	uc001hkh.1	+	c.321G>A	c.(319-321)ACG>ACA	p.T107T	PROX1_uc001hkg.1_Silent_p.T107T	NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	107					aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of gene-specific transcription|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of gene-specific transcription|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|promoter binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulator activity			ovary(3)|lung(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)										0.208	52.492987	62.366633	26	99	GG		KEEP	---	---	---	---	capture			Silent	SNP	212236822	212236822	13003	1	G	A	A	39	39	PROX1	A	1	1
USH2A	7399	broad.mit.edu	36	1	213880574	213880574	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:213880574C>T	uc001hku.1	-	c.14917G>A	c.(14917-14919)GTG>ATG	p.V4973M		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4973	Fibronectin type-III 35.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|kidney(1)|central_nervous_system(1)	22				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)										0.235294	31.801	35.050582	12	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	213880574	213880574	17598	1	C	T	T	19	19	USH2A	T	1	1
MTR	4548	broad.mit.edu	36	1	235124289	235124289	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:235124289G>A	uc001hyi.2	+	c.3214G>A	c.(3214-3216)GAC>AAC	p.D1072N		NM_000254	NP_000245	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine	1072	AdoMet activation.				nervous system development|xenobiotic metabolic process	cytosol	cobalamin binding|homocysteine S-methyltransferase activity|methionine synthase activity|protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)									0.51	151.024466	151.033437	51	49	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	235124289	235124289	10351	1	G	A	A	41	41	MTR	A	2	2
OPN3	23596	broad.mit.edu	36	1	239827899	239827899	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:239827899C>T	uc001hza.1	-	c.717G>A	c.(715-717)CAG>CAA	p.Q239Q	OPN3_uc001hzb.1_Non-coding_Transcript|OPN3_uc001hzc.1_Non-coding_Transcript	NM_014322	NP_055137	Q9H1Y3	OPN3_HUMAN	opsin 3	239	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)											0.119048	7.344758	13.328838	5	37	CC		KEEP	---	---	---	---	capture			Silent	SNP	239827899	239827899	11287	1	C	T	T	32	32	OPN3	T	2	2
THRAP3	9967	broad.mit.edu	36	1	36539885	36539885	+	Splice_Site_SNP	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:36539885G>T	uc001cae.2	+	c.e11_splice_site			THRAP3_uc001caf.2_Splice_Site_SNP	NM_005119	NP_005110			thyroid hormone receptor associated protein 3						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ATP binding|ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription mediator activity|thyroid hormone receptor binding|transcription activator activity|vitamin D receptor binding			ovary(5)|lung(1)	6		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				Pancreas(129;785 1795 20938 23278 32581)				199				0.207865	154.861772	183.041906	74	282	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	36539885	36539885	16402	1	G	T	T	44	44	THRAP3	T	5	3
STK40	83931	broad.mit.edu	36	1	36593600	36593600	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:36593600C>G	uc001cal.1	-	c.379G>C	c.(379-381)GAG>CAG	p.E127Q	STK40_uc001cak.1_Missense_Mutation_p.E122Q|STK40_uc001cam.1_Missense_Mutation_p.E122Q|STK40_uc009vva.1_Missense_Mutation_p.E122Q|STK40_uc001can.1_Missense_Mutation_p.E122Q	NM_032017	NP_114406	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	122	Protein kinase.				protein phosphorylation	cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(1)	1		Myeloproliferative disorder(586;0.0393)								230				0.206897	7.122183	9.448173	6	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	36593600	36593600	15827	1	C	G	G	29	29	STK40	G	3	3
TIE1	7075	broad.mit.edu	36	1	43552074	43552075	+	Missense_Mutation	DNP	GC	CT	CT			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:43552074_43552075GC>CT	uc001ciu.1	+	c.2257_2258GC>CT	c.(2257-2259)GCT>CTT	p.A753L	TIE1_uc009vwq.1_Missense_Mutation_p.A709L	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and	753	Extracellular (Potential).				mesoderm development|protein phosphorylation	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			stomach(1)|salivary_gland(1)|lung(1)|ovary(1)	4	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)								488				0.193548	7.235628	9.957017	6	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	43552074	43552075	16421	1	GC	CT	CT	34	34	TIE1	CT	3	3
CYP4X1	260293	broad.mit.edu	36	1	47262194	47262194	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:47262194C>G	uc001cqt.1	+	c.118C>G	c.(118-120)CTG>GTG	p.L40V	CYP4X1_uc001cqr.1_Intron|CYP4X1_uc001cqs.1_Intron	NM_178033	NP_828847	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X,	40					oxidation-reduction process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1														0.375	6.318619	6.429784	3	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47262194	47262194	4358	1	C	G	G	28	28	CYP4X1	G	3	3
DHCR24	1718	broad.mit.edu	36	1	55109689	55109689	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:55109689G>A	uc001cyc.1	-	c.798C>T	c.(796-798)TTC>TTT	p.F266F		NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	266					anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|oxidation-reduction process|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1						Pancreas(39;516 1021 24601 30715 32780)								0.118644	14.194235	31.043842	14	104	GG		KEEP	---	---	---	---	capture			Silent	SNP	55109689	55109689	4655	1	G	A	A	37	37	DHCR24	A	1	1
HFM1	164045	broad.mit.edu	36	1	91514780	91514780	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:91514780C>T	uc001doa.2	-	c.3581G>A	c.(3580-3582)CGT>CAT	p.R1194H	HFM1_uc009wdb.1_Non-coding_Transcript|HFM1_uc001dob.2_Missense_Mutation_p.R382H	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	1194							ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)										0.538462	23.125649	23.142372	7	6	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	91514780	91514780	7366	1	C	T	T	19	19	HFM1	T	1	1
ARHGAP29	9411	broad.mit.edu	36	1	94458492	94458492	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:94458492G>A	uc001dqj.2	-	c.250C>T	c.(250-252)CGT>TGT	p.R84C	ARHGAP29_uc009wdq.1_Non-coding_Transcript|ARHGAP29_uc001dql.2_Missense_Mutation_p.R84C	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	84					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|ovary(1)	10		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)						391				0.333333	27.467838	28.131136	9	18	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	94458492	94458492	890	1	G	A	A	39	39	ARHGAP29	A	1	1
SLC44A3	126969	broad.mit.edu	36	1	95083548	95083548	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:95083548G>C	uc001dqv.2	+	c.1012G>C	c.(1012-1014)GCC>CCC	p.A338P	SLC44A3_uc001dqx.2_Missense_Mutation_p.A338P|SLC44A3_uc001dqw.2_Missense_Mutation_p.A290P|SLC44A3_uc009wds.1_Missense_Mutation_p.A241P	NM_001114106	NP_001107578	Q8N4M1	CTL3_HUMAN	solute carrier family 44, member 3 isoform 1	338	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			kidney(1)	1		all_lung(203;0.000712)|Lung NSC(277;0.00316)		all cancers(265;0.039)|Epithelial(280;0.124)	Choline(DB00122)									0.156863	6.66333	12.414561	8	43	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95083548	95083548	15134	1	G	C	C	46	46	SLC44A3	C	3	3
CSRP2BP	57325	broad.mit.edu	36	20	18111822	18111822	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:18111822C>T	uc002wqj.1	+	c.1864C>T	c.(1864-1866)CAC>TAC	p.H622Y	CSRP2BP_uc002wqk.1_Missense_Mutation_p.H494Y	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein isoform a	622					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			ovary(2)	2														0.191781	27.419484	33.897042	14	59	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	18111822	18111822	4109	20	C	T	T	21	21	CSRP2BP	T	2	2
ERGIC3	51614	broad.mit.edu	36	20	33607314	33607314	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:33607314G>A	uc002xcu.1	+	c.859G>A	c.(859-861)GCC>ACC	p.A287T	ERGIC3_uc002xcs.1_Missense_Mutation_p.A277T|ERGIC3_uc002xct.1_Missense_Mutation_p.A272T|ERGIC3_uc002xcv.1_Missense_Mutation_p.A235T	NM_015966	NP_057050	Q9Y282	ERGI3_HUMAN	serologically defined breast cancer antigen 84	272	Lumenal (Potential).				vesicle-mediated transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi apparatus|integral to membrane	protein binding			large_intestine(2)	2	Lung NSC(9;0.00489)|all_lung(11;0.00729)		BRCA - Breast invasive adenocarcinoma(18;0.0127)											0.224719	41.908969	48.071374	20	69	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	33607314	33607314	5418	20	G	A	A	35	35	ERGIC3	A	2	2
TGM2	7052	broad.mit.edu	36	20	36217789	36217789	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:36217789G>A	uc002xhr.1	-	c.307C>T	c.(307-309)CAG>TAG	p.Q103*	TGM2_uc002xhs.1_Nonsense_Mutation_p.Q79*|TGM2_uc002xht.1_Nonsense_Mutation_p.Q103*|TGM2_uc002xhu.2_Nonsense_Mutation_p.Q103*	NM_004613	NP_004604	P21980	TGM2_HUMAN	transglutaminase 2 isoform a	103					apoptotic cell clearance|peptide cross-linking|positive regulation of cell adhesion		acyltransferase activity|metal ion binding|protein binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(1)|lung(1)|ovary(1)	3		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)									0.584746	199.947133	200.715503	69	49	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	36217789	36217789	16358	20	G	A	A	46	46	TGM2	A	5	2
SNX21	90203	broad.mit.edu	36	20	43902954	43902954	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:43902954C>A	uc002xpv.1	+	c.717C>A	c.(715-717)TTC>TTA	p.F239L	SNX21_uc002xpt.1_3'UTR|SNX21_uc002xps.1_Intron|SNX21_uc002xpu.1_3'UTR|SNX21_uc002xpw.1_Missense_Mutation_p.F50L|SNX21_uc002xpx.2_Missense_Mutation_p.F229L|SNX21_uc002xpy.1_Missense_Mutation_p.F50L|SNX21_uc002xpz.1_Missense_Mutation_p.F50L	NM_033421	NP_219489	Q969T3	SNX21_HUMAN	sorting nexin 21 isoform a	239	PX.				cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding			breast(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)												0.515152	35.14761	35.153575	17	16	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43902954	43902954	15393	20	C	A	A	31	31	SNX21	A	3	3
NCOA3	8202	broad.mit.edu	36	20	45697853	45697853	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:45697853C>T	uc002xtk.1	+	c.1493C>T	c.(1492-1494)TCT>TTT	p.S498F	NCOA3_uc010ght.1_Missense_Mutation_p.S508F|NCOA3_uc002xtl.1_Missense_Mutation_p.S498F|NCOA3_uc002xtm.1_Missense_Mutation_p.S498F|NCOA3_uc002xtn.1_Missense_Mutation_p.S498F	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	498					androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding|transcription regulator activity			ovary(3)|lung(1)|skin(1)	5										361				0.105263	21.398009	53.772164	22	187	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45697853	45697853	10629	20	C	T	T	32	32	NCOA3	T	2	2
PCK1	5105	broad.mit.edu	36	20	55571285	55571285	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:55571285G>A	uc002xyn.2	+	c.534G>A	c.(532-534)ACG>ACA	p.T178T		NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	178					gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity				0	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)											0.394366	79.919234	80.599747	28	43	GG		KEEP	---	---	---	---	capture			Silent	SNP	55571285	55571285	12001	20	G	A	A	38	38	PCK1	A	1	1
PLCB1	23236	broad.mit.edu	36	20	8665809	8665809	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr20:8665809C>T	uc002wnb.1	+	c.2178C>T	c.(2176-2178)GTC>GTT	p.V726V	PLCB1_uc002wna.1_Silent_p.V726V|PLCB1_uc002wnc.1_Silent_p.V625V|PLCB1_uc002wnd.1_Silent_p.V303V	NM_015192	NP_056007	Q9NQ66	PLCB1_HUMAN	phosphoinositide-specific phospholipase C beta 1	726	C2.				activation of meiosis involved in egg activation|CD24 biosynthetic process|cerebral cortex development|G1 phase|G2/M transition of mitotic cell cycle|glutamate signaling pathway|insulin-like growth factor receptor signaling pathway|interleukin-1-mediated signaling pathway|interleukin-12-mediated signaling pathway|interleukin-15-mediated signaling pathway|intracellular signal transduction|lipid catabolic process|memory|muscarinic acetylcholine receptor signaling pathway|negative regulation of gene-specific transcription|negative regulation of monocyte extravasation|phosphatidylinositol metabolic process|positive regulation of acrosome reaction|positive regulation of developmental growth|positive regulation of embryonic development|positive regulation of gene-specific transcription|positive regulation of interleukin-12 production|positive regulation of JNK cascade|positive regulation of myoblast differentiation|regulation of fertilization|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	cytosol|nuclear chromatin|nuclear speck	calcium ion binding|calmodulin binding|enzyme binding|GTPase activator activity|phosphatidylinositol phospholipase C activity|phosphatidylinositol-4,5-bisphosphate binding|protein homodimerization activity|signal transducer activity|transcription repressor activity			ovary(4)|breast(3)|lung(1)	8														0.205882	32.415706	37.869343	14	54	CC		KEEP	---	---	---	---	capture			Silent	SNP	8665809	8665809	12453	20	C	T	T	32	32	PLCB1	T	2	2
KRTAP27-1	643812	broad.mit.edu	36	21	30631588	30631588	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:30631588G>A	uc002ynx.1	-	c.270C>T	c.(268-270)TCC>TCT	p.S90S		NM_001077711	NP_001071179	Q3LI81	KR271_HUMAN	keratin associated protein 27-1	90						intermediate filament				ovary(2)	2														0.352941	31.585605	32.235697	12	22	GG		KEEP	---	---	---	---	capture			Silent	SNP	30631588	30631588	8866	21	G	A	A	47	47	KRTAP27-1	A	2	2
AGPAT3	56894	broad.mit.edu	36	21	44222354	44222354	+	Splice_Site_SNP	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:44222354G>A	uc002zdx.1	+	c.e9_splice_site			AGPAT3_uc002zdv.1_Splice_Site_SNP|AGPAT3_uc002zdw.1_Splice_Site_SNP|AGPAT3_uc002zdy.1_Splice_Site_SNP	NM_020132	NP_064517			1-acylglycerol-3-phosphate O-acyltransferase 3						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane|plasma membrane	1-acylglycerol-3-phosphate O-acyltransferase activity				0				STAD - Stomach adenocarcinoma(101;0.18)|Colorectal(79;0.24)		Pancreas(60;623 1650 5574 52796)								0.170732	11.498591	15.707624	7	34	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	44222354	44222354	391	21	G	A	A	35	35	AGPAT3	A	5	2
ITGB2	3689	broad.mit.edu	36	21	45151264	45151264	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr21:45151264G>A	uc002zgd.1	-	c.322C>T	c.(322-324)CGA>TGA	p.R108*	ITGB2_uc002zge.1_Nonsense_Mutation_p.R108*|ITGB2_uc002zgf.2_Nonsense_Mutation_p.R108*|ITGB2_uc010gpw.1_Nonsense_Mutation_p.R108*|ITGB2_uc002zgg.1_Nonsense_Mutation_p.R108*	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	108	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(3)|central_nervous_system(3)|breast(2)	8				Colorectal(79;0.0669)	Simvastatin(DB00641)									0.123894	18.583518	34.205365	14	99	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	45151264	45151264	8198	21	G	A	A	38	38	ITGB2	A	5	1
PACSIN2	11252	broad.mit.edu	36	22	41602912	41602912	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:41602912G>A	uc010gzg.1	-	c.1077C>T	c.(1075-1077)TCC>TCT	p.S359S	PACSIN2_uc003bde.2_Silent_p.S359S|PACSIN2_uc003bdf.2_Intron|PACSIN2_uc003bdg.2_Silent_p.S359S	NM_007229	NP_009160	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in	359					actin cytoskeleton organization|endocytosis	cytoplasmic membrane-bounded vesicle	transporter activity				0		Glioma(61;0.222)												0.328947	67.554619	69.523281	25	51	GG		KEEP	---	---	---	---	capture			Silent	SNP	41602912	41602912	11791	22	G	A	A	47	47	PACSIN2	A	2	2
IL1RL2	8808	broad.mit.edu	36	2	102202790	102202790	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:102202790G>T	uc002tbs.1	+	c.872G>T	c.(871-873)CGG>CTG	p.R291L	IL1RL2_uc002tbt.1_Missense_Mutation_p.R173L	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor	291	Extracellular (Potential).|Ig-like C2-type 3.				cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2														0.349057	221.093318	225.352023	74	138	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	102202790	102202790	7965	2	G	T	T	39	39	IL1RL2	T	3	3
RANBP2	5903	broad.mit.edu	36	2	108747039	108747039	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:108747039C>T	uc002tem.2	+	c.3612C>T	c.(3610-3612)TTC>TTT	p.F1204F		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	1204	RanBD1 1.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(14)	soft_tissue(14)|pancreas(1)	15														0.20339	27.768296	32.588705	12	47	CC		KEEP	---	---	---	---	capture			Silent	SNP	108747039	108747039	13488	2	C	T	T	31	31	RANBP2	T	1	1
SDPR	8436	broad.mit.edu	36	2	192409276	192409276	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:192409276C>T	uc002utb.1	-	c.896G>A	c.(895-897)CGG>CAG	p.R299Q		NM_004657	NP_004648	O95810	SDPR_HUMAN	serum deprivation response protein	299						caveola|cytosol	phosphatidylserine binding|protein binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0647)		Phosphatidylserine(DB00144)									0.104762	9.496627	25.770323	11	94	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	192409276	192409276	14456	2	C	T	T	23	23	SDPR	T	1	1
PLCL1	5334	broad.mit.edu	36	2	198657891	198657891	+	Silent	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:198657891C>A	uc010fsp.1	+	c.1405C>A	c.(1405-1407)CGA>AGA	p.R469R	PLCL1_uc002uuv.2_Silent_p.R390R|PLCL1_uc002uuw.2_Silent_p.R371R	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	phospholipase C-like 1 isoform a	469	PI-PLC X-box.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)	1					Quinacrine(DB01103)									0.136364	9.023489	14.656306	6	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	198657891	198657891	12465	2	C	A	A	31	31	PLCL1	A	3	3
MAP2	4133	broad.mit.edu	36	2	210267004	210267004	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:210267004C>T	uc002vde.1	+	c.1865C>T	c.(1864-1866)ACA>ATA	p.T622I	MAP2_uc002vdc.1_Missense_Mutation_p.T622I|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.T618I	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	622					negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|large_intestine(2)|pancreas(2)|central_nervous_system(1)	14		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	Pancreas(27;423 979 28787 29963)								0.191489	8.262954	12.451508	9	38	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	210267004	210267004	9618	2	C	T	T	17	17	MAP2	T	2	2
COL4A3	1285	broad.mit.edu	36	2	227855343	227855343	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:227855343G>A	uc002vom.1	+	c.2507G>A	c.(2506-2508)GGG>GAG	p.G836E	COL4A3_uc002von.1_Missense_Mutation_p.G836E|COL4A3_uc002voo.1_Missense_Mutation_p.G836E|COL4A3_uc002vop.1_Missense_Mutation_p.G836E	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	836	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)										0.6	19.152857	19.241197	6	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	227855343	227855343	3829	2	G	A	A	43	43	COL4A3	A	2	2
SP110	3431	broad.mit.edu	36	2	230751147	230751147	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:230751147C>T	uc002vqg.2	-	c.1417G>A	c.(1417-1419)GGG>AGG	p.G473R	SP110_uc002vqh.2_Missense_Mutation_p.G473R|SP110_uc010fxj.1_Missense_Mutation_p.G116R|SP110_uc002vqi.2_Missense_Mutation_p.G473R|SP110_uc010fxk.1_Missense_Mutation_p.G471R	NM_080424	NP_536349	Q9HB58	SP110_HUMAN	SP110 nuclear body protein isoform c	473	SAND.				interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|signal transducer activity|zinc ion binding			ovary(2)|breast(2)	4		Renal(207;0.0112)|all_lung(227;0.0223)|Lung NSC(271;0.0983)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.169)		Epithelial(121;2.61e-12)|all cancers(144;6.39e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.0097)						445				0.537634	318.108657	318.339791	100	86	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	230751147	230751147	15461	2	C	T	T	24	24	SP110	T	2	2
ABCG5	64240	broad.mit.edu	36	2	43919316	43919316	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:43919316C>T	uc002rtn.1	-	c.7G>A	c.(7-9)GAC>AAC	p.D3N	ABCG5_uc002rto.1_5'UTR|ABCG5_uc002rtp.1_5'UTR|ABCG8_uc002rtq.1_5'Flank	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	3	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|intestinal cholesterol absorption|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)												0.55	35.626686	35.670236	11	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43919316	43919316	72	2	C	T	T	29	29	ABCG5	T	2	2
PCBP1	5093	broad.mit.edu	36	2	70168885	70168885	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:70168885C>T	uc002sgf.1	+	c.506C>T	c.(505-507)ACG>ATG	p.T169M	ASPRV1_uc002sga.2_5'Flank	NM_006196	NP_006187	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	169					nuclear mRNA splicing, via spliceosome	cytoplasm|nucleoplasm|ribonucleoprotein complex	protein binding|RNA binding|single-stranded DNA binding				0						Colon(85;1146 1307 3484 18706 25380)								0.277778	8.161764	8.966483	5	13	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	70168885	70168885	11920	2	C	T	T	19	19	PCBP1	T	1	1
ZNF2	7549	broad.mit.edu	36	2	95211025	95211025	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:95211025G>A	uc002suf.1	+	c.722G>A	c.(721-723)CGT>CAT	p.R241H	ZNF2_uc002sug.1_Missense_Mutation_p.R199H|ZNF2_uc010fhs.1_Missense_Mutation_p.R162H	NM_021088	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2 isoform a	241	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)										0.138462	16.643388	24.845879	9	56	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	95211025	95211025	18351	2	G	A	A	40	40	ZNF2	A	1	1
ZBED2	79413	broad.mit.edu	36	3	112795468	112795468	+	Missense_Mutation	SNP	C	G	G			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:112795468C>G	uc003dxy.1	-	c.271G>C	c.(271-273)GTC>CTC	p.V91L	CD96_uc003dxw.1_Intron|CD96_uc003dxx.1_Intron|CD96_uc010hpy.1_Intron|CD96_uc003dxv.2_Intron|ZBED2_uc010hpz.1_Missense_Mutation_p.V91L	NM_024508	NP_078784	Q9BTP6	ZBED2_HUMAN	zinc finger, BED domain containing 2	91	BED-type.						DNA binding|metal ion binding				0														0.220339	28.64883	32.897226	13	46	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	112795468	112795468	18102	3	C	G	G	18	18	ZBED2	G	3	3
ABTB1	80325	broad.mit.edu	36	3	128877845	128877845	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:128877845G>T	uc003ejt.1	+	c.361G>T	c.(361-363)GTA>TTA	p.V121L	ABTB1_uc003ejr.1_5'UTR|ABTB1_uc003ejs.1_Missense_Mutation_p.V96L|ABTB1_uc003eju.1_5'UTR|ABTB1_uc010hsm.1_5'Flank	NM_172027	NP_742024	Q969K4	ABTB1_HUMAN	ankyrin repeat and BTB (POZ) domain containing 1	121	BTB 1.					cytoplasm|nucleolus|plasma membrane	translation elongation factor activity				0														0.141176	6.723627	17.251128	12	73	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128877845	128877845	103	3	G	T	T	36	36	ABTB1	T	3	3
PCOLCE2	26577	broad.mit.edu	36	3	144089303	144089303	+	Silent	SNP	A	T	T			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:144089303A>T	uc003evd.1	-	c.90T>A	c.(88-90)GTT>GTA	p.V30V		NM_013363	NP_037495	Q9UKZ9	PCOC2_HUMAN	procollagen C-endopeptidase enhancer 2	30						extracellular region	collagen binding|heparin binding|peptidase activator activity			ovary(2)	2														0.363636	7.391553	7.573477	4	7	AA		KEEP	---	---	---	---	capture			Silent	SNP	144089303	144089303	12015	3	A	T	T	1	1	PCOLCE2	T	4	4
LRCH3	84859	broad.mit.edu	36	3	199065679	199065679	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:199065679G>A	uc003fyj.1	+	c.1610G>A	c.(1609-1611)AGG>AAG	p.R537K	LRCH3_uc003fyk.1_Missense_Mutation_p.R132K	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	537						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)										0.163158	61.837132	82.297996	31	159	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199065679	199065679	9307	3	G	A	A	35	35	LRCH3	A	2	2
LMLN	89782	broad.mit.edu	36	3	199195221	199195221	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:199195221G>A	uc010iar.1	+	c.739G>A	c.(739-741)GGA>AGA	p.G247R	LMLN_uc003fyt.1_Missense_Mutation_p.G195R|LMLN_uc003fyu.1_Missense_Mutation_p.G7R|LMLN_uc010ias.1_Missense_Mutation_p.G195R|LMLN_uc003fyv.1_Missense_Mutation_p.G247R	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	247					cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)										0.336245	215.701009	221.1351	77	152	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199195221	199195221	9176	3	G	A	A	35	35	LMLN	A	2	2
LMLN	89782	broad.mit.edu	36	3	199195299	199195299	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:199195299G>A	uc010iar.1	+	c.817G>A	c.(817-819)GAG>AAG	p.E273K	LMLN_uc003fyt.1_Missense_Mutation_p.E221K|LMLN_uc003fyu.1_Missense_Mutation_p.E33K|LMLN_uc010ias.1_Missense_Mutation_p.E221K|LMLN_uc003fyv.1_Missense_Mutation_p.E273K	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2	273		By similarity.			cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)										0.345528	241.420159	246.593783	85	161	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	199195299	199195299	9176	3	G	A	A	45	45	LMLN	A	2	2
LRRFIP2	9209	broad.mit.edu	36	3	37075356	37075356	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:37075356C>T	uc003cgp.1	-	c.1799G>A	c.(1798-1800)AGG>AAG	p.R600K	LRRFIP2_uc003cgq.1_Missense_Mutation_p.R279K|LRRFIP2_uc003cgr.1_Missense_Mutation_p.R303K|LRRFIP2_uc003cgs.2_Missense_Mutation_p.R303K|LRRFIP2_uc003cgt.2_Missense_Mutation_p.R279K	NM_006309	NP_006300	Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting	600	Potential.				Wnt receptor signaling pathway		LRR domain binding	p.0?(1)		ovary(1)	1														0.201087	81.254802	96.568179	37	147	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	37075356	37075356	9404	3	C	T	T	24	24	LRRFIP2	T	2	2
SMARCC1	6599	broad.mit.edu	36	3	47702628	47702628	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr3:47702628A>C	uc003crq.2	-	c.1300T>G	c.(1300-1302)TCA>GCA	p.S434A		NM_003074	NP_003065	Q92922	SMRC1_HUMAN	SWI/SNF-related matrix-associated	434					chromatin assembly or disassembly|chromatin remodeling|nervous system development|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex|WINAC complex	DNA binding|protein N-terminus binding|transcription coactivator activity			lung(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)										0.672269	268.227637	271.359492	80	39	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	47702628	47702628	15273	3	A	C	C	12	12	SMARCC1	C	4	4
PRKCD	5580	broad.mit.edu	36	3	53187485	53187485	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:53187485C>T	uc003dgl.1	+	c.7C>T	c.(7-9)CCG>TCG	p.P3S	PRKCD_uc003dgm.1_Missense_Mutation_p.P3S|PRKCD_uc003dgn.1_5'Flank	NM_006254	NP_997704	Q05655	KPCD_HUMAN	protein kinase C, delta	3	C2.				activation of phospholipase C activity|cellular component disassembly involved in apoptosis|cellular senescence|interferon-gamma-mediated signaling pathway|intracellular signal transduction|mRNA metabolic process|negative regulation of insulin receptor signaling pathway|negative regulation of peptidyl-tyrosine phosphorylation|negative regulation of protein binding|nerve growth factor receptor signaling pathway|platelet activation|protein phosphorylation|protein stabilization|regulation of receptor activity	cytosol|endoplasmic reticulum|nucleoplasm	ATP binding|calcium-independent protein kinase C activity|enzyme activator activity|enzyme binding|insulin receptor substrate binding|metal ion binding|protein C-terminus binding			central_nervous_system(4)|lung(1)	5		Ovarian(412;0.0728)		OV - Ovarian serous cystadenocarcinoma(275;3.58e-08)|BRCA - Breast invasive adenocarcinoma(193;0.000142)|Kidney(197;0.00153)|KIRC - Kidney renal clear cell carcinoma(197;0.00173)						215				0.47619	20.935477	20.946422	10	11	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	53187485	53187485	12952	3	C	T	T	26	26	PRKCD	T	2	2
MINA	84864	broad.mit.edu	36	3	99169129	99169129	+	De_novo_Start_InFrame	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:99169129G>A	uc003drz.1	-	c.-1C>T	c.(-3-1)AACGA>AATGA		MINA_uc003dsa.1_De_novo_Start_InFrame|MINA_uc003dsb.1_De_novo_Start_InFrame|MINA_uc003dsc.1_De_novo_Start_InFrame|MINA_uc010hpa.1_Non-coding_Transcript|MINA_uc010hpb.1_Intron	NM_001042533	NP_694822			MYC induced nuclear antigen isoform a						ribosome biogenesis	cytoplasm|nucleolus				ovary(1)	1														0.181818	9.193657	11.28051	4	18	GG		KEEP	---	---	---	---	capture			De_novo_Start_InFrame	SNP	99169129	99169129	9976	3	G	A	A	40	40	MINA	A	5	1
ADH1A	124	broad.mit.edu	36	4	100427069	100427069	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:100427069C>T	uc003hur.1	-	c.220G>A	c.(220-222)GTG>ATG	p.V74M	ADH1A_uc010ilf.1_5'Flank|ADH1A_uc010ilg.1_Missense_Mutation_p.V74M	NM_000667	NP_000658	P07327	ADH1A_HUMAN	class I alcohol dehydrogenase, alpha subunit	74					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|protein binding|transcription regulator activity|zinc ion binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(123;9.56e-08)	Fomepizole(DB01213)|NADH(DB00157)									0.25	53.809606	58.809683	22	66	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100427069	100427069	308	4	C	T	T	19	19	ADH1A	T	1	1
PCDH7	5099	broad.mit.edu	36	4	30332345	30332345	+	Missense_Mutation	SNP	T	C	C			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr4:30332345T>C	uc010iez.1	+	c.203T>C	c.(202-204)CTG>CCG	p.L68P	PCDH7_uc003gsj.1_Missense_Mutation_p.L68P|PCDH7_uc003gsk.1_Missense_Mutation_p.L68P	NM_032457	NP_115833	O60245	PCDH7_HUMAN	protocadherin 7 isoform c precursor	68	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			upper_aerodigestive_tract(1)|ovary(1)|liver(1)|skin(1)	4														0.304348	36.616629	38.198525	14	32	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30332345	30332345	11936	4	T	C	C	55	55	PCDH7	C	4	4
FGF5	2250	broad.mit.edu	36	4	81407014	81407014	+	Silent	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:81407014C>A	uc003hmd.1	+	c.12C>A	c.(10-12)TCC>TCA	p.S4S	FGF5_uc003hme.1_Silent_p.S4S	NM_004464	NP_004455	P12034	FGF5_HUMAN	fibroblast growth factor 5 isoform 1 precursor	4					cell proliferation|cell-cell signaling|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|positive regulation of cell division|positive regulation of cell proliferation	extracellular space	fibroblast growth factor receptor binding|growth factor activity			ovary(1)	1														0.4	15.544054	15.675893	6	9	CC		KEEP	---	---	---	---	capture			Silent	SNP	81407014	81407014	6092	4	C	A	A	24	24	FGF5	A	3	3
DMP1	1758	broad.mit.edu	36	4	88803160	88803160	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:88803160G>T	uc003hqv.1	+	c.1206G>T	c.(1204-1206)GAG>GAT	p.E402D	DMP1_uc003hqw.1_Missense_Mutation_p.E386D	NM_004407	NP_004398	Q13316	DMP1_HUMAN	dentin matrix acidic phosphoprotein 1 isoform 1	402					biomineral tissue development|ossification	cytoplasm|nucleus|proteinaceous extracellular matrix	calcium ion binding|integrin binding			pancreas(1)	1		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.227)		OV - Ovarian serous cystadenocarcinoma(123;0.000516)										0.2	16.24734	20.020324	9	36	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88803160	88803160	4763	4	G	T	T	34	34	DMP1	T	3	3
ABCG2	9429	broad.mit.edu	36	4	89272020	89272020	+	Nonsense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:89272020G>A	uc003hrg.1	-	c.337C>T	c.(337-339)CGA>TGA	p.R113*	ABCG2_uc003hrf.1_5'UTR|ABCG2_uc003hrh.1_Nonsense_Mutation_p.R113*|ABCG2_uc003hri.1_Nonsense_Mutation_p.R113*|ABCG2_uc003hrj.1_Nonsense_Mutation_p.R113*|ABCG2_uc003hrk.1_Nonsense_Mutation_p.R113*	NM_004827	NP_004818	Q9UNQ0	ABCG2_HUMAN	ATP-binding cassette, sub-family G, member 2	113	ABC transporter.|Cytoplasmic (Potential).				cellular iron ion homeostasis|urate metabolic process	integral to membrane|plasma membrane	ATP binding|heme transporter activity|protein homodimerization activity|xenobiotic-transporting ATPase activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;7.02e-05)	Imatinib(DB00619)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nitrendipine(DB01054)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Topotecan(DB01030)									0.385542	95.789514	96.739204	32	51	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	89272020	89272020	70	4	G	A	A	38	38	ABCG2	A	5	1
SLCO4C1	353189	broad.mit.edu	36	5	101610855	101610855	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:101610855C>A	uc003knm.1	-	c.1811G>T	c.(1810-1812)AGG>ATG	p.R604M		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	604	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)										0.133333	9.628667	15.49463	6	39	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	101610855	101610855	15227	5	C	A	A	24	24	SLCO4C1	A	3	3
MEGF10	84466	broad.mit.edu	36	5	126796965	126796965	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:126796965G>A	uc003kuh.2	+	c.1705G>A	c.(1705-1707)GAC>AAC	p.D569N	MEGF10_uc003kui.2_Missense_Mutation_p.D569N	NM_032446	NP_115822	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	569	Extracellular (Potential).|EGF-like 10.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				cell adhesion|phagocytosis	basolateral plasma membrane|cell projection|integral to membrane|phagocytic cup				ovary(4)	4		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)										0.226562	126.566618	144.208848	58	198	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	126796965	126796965	9849	5	G	A	A	45	45	MEGF10	A	2	2
PCDHB2	56133	broad.mit.edu	36	5	140456508	140456508	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140456508C>T	uc003lil.1	+	c.1950C>T	c.(1948-1950)GGC>GGT	p.G650G	PCDHB2_uc003lim.1_Silent_p.G311G	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	650	Cadherin 6.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.388889	14.630536	14.820912	7	11	CC		KEEP	---	---	---	---	capture			Silent	SNP	140456508	140456508	11962	5	C	T	T	27	27	PCDHB2	T	1	1
SLC6A3	6531	broad.mit.edu	36	5	1467901	1467901	+	Missense_Mutation	SNP	G	C	C			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:1467901G>C	uc003jck.2	-	c.1061C>G	c.(1060-1062)TCC>TGC	p.S354C		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	354	Helical; Name=7; (Potential).			S -> C (in Ref. 2; AAB23443).	cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)									0.916667	28.159521	30.033425	11	1	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	1467901	1467901	15182	5	G	C	C	41	41	SLC6A3	C	3	3
UGT3A1	133688	broad.mit.edu	36	5	35990150	35990150	+	Missense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:35990150G>T	uc003jjv.1	-	c.1483C>A	c.(1483-1485)CTC>ATC	p.L495I	UGT3A1_uc003jjx.1_Missense_Mutation_p.L365I|UGT3A1_uc003jjw.1_Non-coding_Transcript	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide	495	Helical; (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)											0.57377	100.916407	101.204963	35	26	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	35990150	35990150	17521	5	G	T	T	34	34	UGT3A1	T	3	3
ARRDC3	57561	broad.mit.edu	36	5	90706538	90706538	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:90706538G>A	uc003kjz.1	-	c.827C>T	c.(826-828)TCT>TTT	p.S276F		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	276					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)										0.123077	12.660331	21.690116	8	57	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90706538	90706538	1002	5	G	A	A	33	33	ARRDC3	A	2	2
HIST1H1D	3007	broad.mit.edu	36	6	26342744	26342744	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:26342744C>A	uc003nhd.1	-	c.397G>T	c.(397-399)GCT>TCT	p.A133S		NM_005320	NP_005311	P16402	H13_HUMAN	histone cluster 1, H1d	133					nucleosome assembly	nucleosome|nucleus	DNA binding				0		all_hematologic(11;0.0945)|Acute lymphoblastic leukemia(11;0.167)												0.206897	7.028687	9.349436	6	23	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	26342744	26342744	7410	6	C	A	A	25	25	HIST1H1D	A	3	3
DUSP22	56940	broad.mit.edu	36	6	290928	290928	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:290928G>A	uc003msx.1	+	c.263G>A	c.(262-264)TGC>TAC	p.C88Y	DUSP22_uc003msy.1_Missense_Mutation_p.C45Y	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22	88	Tyrosine-protein phosphatase.	Phosphocysteine intermediate (By similarity).			apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)										0.206278	110.810067	128.584428	46	177	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	290928	290928	5006	6	G	A	A	47	47	DUSP22	A	2	2
CUL7	9820	broad.mit.edu	36	6	43114304	43114304	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43114304G>A	uc003otq.1	-	c.4545C>T	c.(4543-4545)CAC>CAT	p.H1515H	CUL7_uc010jyg.1_Silent_p.H794H|CUL7_uc010jyh.1_Silent_p.H508H|KLC4_uc003otr.1_5'Flank	NM_014780	NP_055595	Q14999	CUL7_HUMAN	cullin 7	1515					interspecies interaction between organisms|regulation of mitotic metaphase/anaphase transition|ubiquitin-dependent protein catabolic process|vasculogenesis	anaphase-promoting complex|mitochondrion	ubiquitin protein ligase binding			ovary(3)|kidney(1)	4			all cancers(41;0.00231)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)											0.52381	63.842992	63.863401	22	20	GG		KEEP	---	---	---	---	capture			Silent	SNP	43114304	43114304	4220	6	G	A	A	40	40	CUL7	A	1	1
CUL9	23113	broad.mit.edu	36	6	43289259	43289259	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:43289259G>A	uc003ouk.1	+	c.5464G>A	c.(5464-5466)GAG>AAG	p.E1822K	CUL9_uc003oul.1_Missense_Mutation_p.E1822K|CUL9_uc010jyk.1_Missense_Mutation_p.E974K|CUL9_uc003oun.1_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	1822					regulation of mitotic metaphase/anaphase transition|ubiquitin-dependent protein catabolic process	anaphase-promoting complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|central_nervous_system(1)	6														0.177778	28.057723	36.856598	16	74	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43289259	43289259	4221	6	G	A	A	45	45	CUL9	A	2	2
MYO6	4646	broad.mit.edu	36	6	76675009	76675009	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:76675009C>T	uc003pih.1	+	c.3357C>T	c.(3355-3357)AAC>AAT	p.N1119N	MYO6_uc003pii.1_Silent_p.N1096N|MYO6_uc003pij.1_Silent_p.N76N	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	1128					actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)										0.190476	7.486124	9.370807	4	17	CC		KEEP	---	---	---	---	capture			Silent	SNP	76675009	76675009	10476	6	C	T	T	17	17	MYO6	T	2	2
DUS4L	11062	broad.mit.edu	36	7	107004141	107004141	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:107004141G>A	uc003veh.1	+	c.574G>A	c.(574-576)GAA>AAA	p.E192K	DUS4L_uc003veg.1_Missense_Mutation_p.E71K|DUS4L_uc010ljl.1_Missense_Mutation_p.E102K	NM_181581	NP_853559	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like	192					oxidation-reduction process|tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0														0.284553	95.699192	100.809979	35	88	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107004141	107004141	4993	7	G	A	A	33	33	DUS4L	A	2	2
CTTNBP2	83992	broad.mit.edu	36	7	117185229	117185229	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:117185229G>A	uc003vjf.1	-	c.3204C>T	c.(3202-3204)TTC>TTT	p.F1068F		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1068										ovary(4)	4	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)										0.213592	56.90081	64.699123	22	81	GG		KEEP	---	---	---	---	capture			Silent	SNP	117185229	117185229	4204	7	G	A	A	37	37	CTTNBP2	A	1	1
TRPV6	55503	broad.mit.edu	36	7	142283701	142283701	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:142283701T>A	uc003wbx.1	-	c.841A>T	c.(841-843)ACA>TCA	p.T281S	TRPV6_uc003wbw.1_Missense_Mutation_p.T67S|TRPV6_uc010lou.1_Missense_Mutation_p.T152S	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	281	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(1)	1	Melanoma(164;0.059)													0.158537	22.635325	31.74101	13	69	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	142283701	142283701	17151	7	T	A	A	59	59	TRPV6	A	4	4
NOS3	4846	broad.mit.edu	36	7	150337032	150337032	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:150337032C>T	uc003wif.1	+	c.2194C>T	c.(2194-2196)CGC>TGC	p.R732C		NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 (endothelial cell)	732					anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|oxidation-reduction process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)	7	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)					755		OREG0018442	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.538462	40.046188	40.079359	14	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150337032	150337032	10947	7	C	T	T	27	27	NOS3	T	1	1
CAMK2B	816	broad.mit.edu	36	7	44226269	44226269	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:44226269T>G	uc003tkq.1	-	c.1918A>C	c.(1918-1920)ACC>CCC	p.T640P	CAMK2B_uc010kyc.1_Missense_Mutation_p.T516P|CAMK2B_uc003tkp.1_Missense_Mutation_p.T516P|CAMK2B_uc003tkx.1_Missense_Mutation_p.T476P|CAMK2B_uc010kyd.1_Non-coding_Transcript|CAMK2B_uc003tkr.1_Missense_Mutation_p.T492P|CAMK2B_uc003tks.1_Missense_Mutation_p.T491P|CAMK2B_uc003tkt.1_Missense_Mutation_p.T466P|CAMK2B_uc003tku.1_Missense_Mutation_p.T477P|CAMK2B_uc003tkv.1_Missense_Mutation_p.T453P|CAMK2B_uc003tkw.1_Missense_Mutation_p.T423P|CAMK2B_uc003tkn.1_5'Flank	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II	640					interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2										200				0.3	6.523758	6.879747	3	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	44226269	44226269	2717	7	T	G	G	58	58	CAMK2B	G	4	4
TBL2	26608	broad.mit.edu	36	7	72626315	72626315	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:72626315C>T	uc003tyh.1	-	c.335G>A	c.(334-336)CGC>CAC	p.R112H	TBL2_uc010lbg.1_Missense_Mutation_p.R17H|TBL2_uc003tyi.1_5'UTR|TBL2_uc010lbh.1_Missense_Mutation_p.R17H	NM_012453	NP_036585	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	112	WD 1.										0		Lung NSC(55;0.0659)|all_lung(88;0.152)												0.161905	26.894351	38.248839	17	88	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72626315	72626315	16168	7	C	T	T	27	27	TBL2	T	1	1
CD36	948	broad.mit.edu	36	7	80130287	80130287	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr7:80130287A>C	uc003uhc.1	+	c.475A>C	c.(475-477)AAT>CAT	p.N159H	CD36_uc003uhd.2_Missense_Mutation_p.N159H|CD36_uc003uhe.2_Missense_Mutation_p.N159H|CD36_uc003uhf.2_Missense_Mutation_p.N159H|CD36_uc003uhg.2_Missense_Mutation_p.N159H|CD36_uc003uhh.2_Missense_Mutation_p.N159H	NM_001127444	NP_001120916	P16671	CD36_HUMAN	CD36 antigen	159	Extracellular (Potential).				cell adhesion|cGMP-mediated signaling|cholesterol transport|lipid metabolic process|lipid storage|lipoprotein transport|low-density lipoprotein particle clearance|nitric oxide mediated signal transduction|plasma membrane long-chain fatty acid transport|platelet activation|platelet degranulation|positive regulation of cell-matrix adhesion|positive regulation of macrophage derived foam cell differentiation	integral to plasma membrane|membrane fraction|platelet alpha granule membrane	lipid binding|low-density lipoprotein receptor activity|thrombospondin receptor activity|transforming growth factor beta binding			ovary(1)	1														0.298507	56.574702	59.005741	20	47	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	80130287	80130287	3135	7	A	C	C	5	5	CD36	C	4	4
DYNC1I1	1780	broad.mit.edu	36	7	95277675	95277675	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:95277675C>T	uc003uoc.2	+	c.144C>T	c.(142-144)GAC>GAT	p.D48D	DYNC1I1_uc003uob.1_Silent_p.D48D|DYNC1I1_uc003uod.2_Silent_p.D48D|DYNC1I1_uc003uoe.2_Silent_p.D48D|DYNC1I1_uc010lfl.1_Silent_p.D54D	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	48	Interaction with DCTN1 (By similarity).				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)											0.144578	18.362259	28.444331	12	71	CC		KEEP	---	---	---	---	capture			Silent	SNP	95277675	95277675	5028	7	C	T	T	19	19	DYNC1I1	T	1	1
CDCA2	157313	broad.mit.edu	36	8	25383344	25383344	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:25383344G>A	uc003xep.1	+	c.751G>A	c.(751-753)GGT>AGT	p.G251S	PPP2R2A_uc003xek.1_Intron|CDCA2_uc003xeq.1_Missense_Mutation_p.G236S|CDCA2_uc003xer.1_5'UTR	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	251					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)										0.193548	22.561794	28.003913	12	50	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	25383344	25383344	3215	8	G	A	A	47	47	CDCA2	A	2	2
CYP7B1	9420	broad.mit.edu	36	8	65671951	65671951	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr8:65671951C>T	uc003xvj.2	-	c.1323G>A	c.(1321-1323)CCG>CCA	p.P441P		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	441					bile acid biosynthetic process|cell death|cholesterol metabolic process|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)												0.44	33.423927	33.501705	11	14	CC		KEEP	---	---	---	---	capture			Silent	SNP	65671951	65671951	4362	8	C	T	T	19	19	CYP7B1	T	1	1
CYP7B1	9420	broad.mit.edu	36	8	65691194	65691194	+	Missense_Mutation	SNP	A	T	T			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr8:65691194A>T	uc003xvj.2	-	c.458T>A	c.(457-459)CTC>CAC	p.L153H		NM_004820	NP_004811	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B,	153					bile acid biosynthetic process|cell death|cholesterol metabolic process|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	25-hydroxycholesterol 7alpha-hydroxylase activity|electron carrier activity|heme binding|oxysterol 7-alpha-hydroxylase activity			ovary(3)	3		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)												0.148649	20.279786	29.042774	11	63	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	65691194	65691194	4362	8	A	T	T	11	11	CYP7B1	T	4	4
TBC1D2	55357	broad.mit.edu	36	9	100046142	100046142	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:100046142G>A	uc004ayq.1	-	c.602C>T	c.(601-603)CCT>CTT	p.P201L	TBC1D2_uc004ayo.2_Missense_Mutation_p.P201L|TBC1D2_uc004ayr.1_5'UTR	NM_018421	NP_060891	Q9BYX2	TBD2A_HUMAN	TBC1 domain family, member 2	201						cell junction|cytoplasmic membrane-bounded vesicle|nucleus	Rab GTPase activator activity			ovary(3)	3		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.55e-37)										0.288889	35.862931	37.657442	13	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	100046142	100046142	16130	9	G	A	A	35	35	TBC1D2	A	2	2
C9orf125	84302	broad.mit.edu	36	9	103278008	103278008	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:103278008G>A	uc004bbm.1	-	c.1188C>T	c.(1186-1188)TAC>TAT	p.Y396Y	C9orf125_uc010mte.1_Silent_p.Y396Y	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	396						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)												0.306122	242.518233	252.387958	90	204	GG		KEEP	---	---	---	---	capture			Silent	SNP	103278008	103278008	2567	9	G	A	A	48	48	C9orf125	A	2	2
C9orf125	84302	broad.mit.edu	36	9	103278620	103278620	+	Silent	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:103278620G>A	uc004bbm.1	-	c.576C>T	c.(574-576)GTC>GTT	p.V192V	C9orf125_uc010mte.1_Silent_p.V192V	NM_032342	NP_115718	Q9BRR3	CI125_HUMAN	hypothetical protein LOC84302	192						integral to membrane					0		Acute lymphoblastic leukemia(62;0.0527)												0.118519	17.81488	37.118066	16	119	GG		KEEP	---	---	---	---	capture			Silent	SNP	103278620	103278620	2567	9	G	A	A	33	33	C9orf125	A	2	2
OR13C2	392376	broad.mit.edu	36	9	106407012	106407012	+	Missense_Mutation	SNP	T	A	A			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:106407012T>A	uc004bce.1	-	c.718A>T	c.(718-720)ACC>TCC	p.T240S		NM_001004481	NP_001004481	Q8NGS9	O13C2_HUMAN	olfactory receptor, family 13, subfamily C,	240	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.116667	19.166787	45.194914	21	159	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	106407012	106407012	11340	9	T	A	A	57	57	OR13C2	A	4	4
CTNNAL1	8727	broad.mit.edu	36	9	110757912	110757912	+	Nonsense_Mutation	SNP	G	T	T			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:110757912G>T	uc004bdo.1	-	c.1608C>A	c.(1606-1608)TAC>TAA	p.Y536*	CTNNAL1_uc010mts.1_Nonsense_Mutation_p.Y188*|CTNNAL1_uc010mtt.1_Nonsense_Mutation_p.Y536*|CTNNAL1_uc004bdp.1_Nonsense_Mutation_p.Y536*|CTNNAL1_uc004bdq.1_Nonsense_Mutation_p.Y22*	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1	536					cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)										0.26087	11.036923	12.23414	6	17	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	110757912	110757912	4174	9	G	T	T	44	44	CTNNAL1	T	5	3
PALM2-AKAP2	445815	broad.mit.edu	36	9	111940559	111940559	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:111940559C>T	uc004bei.2	+	c.3610C>T	c.(3610-3612)CAA>TAA	p.Q1204*	PALM2-AKAP2_uc004bek.2_Nonsense_Mutation_p.Q972*|PALM2-AKAP2_uc004bej.2_Nonsense_Mutation_p.Q972*|PALM2-AKAP2_uc004bel.1_Nonsense_Mutation_p.Q782*|AKAP2_uc004bem.1_Nonsense_Mutation_p.Q830*|PALM2-AKAP2_uc010mtw.1_Nonsense_Mutation_p.Q790*|PALM2-AKAP2_uc004ben.1_Nonsense_Mutation_p.Q741*	NM_001004065	NP_001004065	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 1	741	Potential.						enzyme binding			ovary(3)|central_nervous_system(2)	5														0.52	36.168031	36.17656	13	12	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	111940559	111940559	11826	9	C	T	T	17	17	PALM2-AKAP2	T	5	2
PSMD5	5711	broad.mit.edu	36	9	122644897	122644897	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:122644897G>A	uc004bko.1	-	c.112C>T	c.(112-114)CGC>TGC	p.R38C	LOC253039_uc004bkp.2_5'Flank|LOC253039_uc004bkq.1_5'Flank	NM_005047	NP_005038	Q16401	PSMD5_HUMAN	proteasome 26S non-ATPase subunit 5	38					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|proteasome regulatory particle assembly|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	protein binding				0														0.717949	86.816989	88.49638	28	11	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	122644897	122644897	13154	9	G	A	A	37	37	PSMD5	A	1	1
LMX1B	4010	broad.mit.edu	36	9	128498438	128498438	+	Missense_Mutation	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:128498438A>C	uc004bqj.2	+	c.1027A>C	c.(1027-1029)ACC>CCC	p.T343P	LMX1B_uc004bqi.2_Missense_Mutation_p.T336P	NM_002316	NP_002307	O60663	LMX1B_HUMAN	LIM homeobox transcription factor 1, beta	343					dorsal/ventral pattern formation|in utero embryonic development	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity|zinc ion binding				0						Pancreas(110;1796 2278 18357 20466)								0.384615	9.215758	9.384891	5	8	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	128498438	128498438	9191	9	A	C	C	2	2	LMX1B	C	4	4
TOR2A	27433	broad.mit.edu	36	9	129536424	129536424	+	Missense_Mutation	SNP	T	G	G			TCGA-14-1795-01	TCGA-14-1795-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129536424T>G	uc004brs.2	-	c.392A>C	c.(391-393)CAC>CCC	p.H131P	TOR2A_uc004brw.2_Missense_Mutation_p.H131P|TOR2A_uc004brt.2_Missense_Mutation_p.H131P|TOR2A_uc004bru.2_Intron|TOR2A_uc004brv.2_Intron|TOR2A_uc004brx.1_5'UTR	NM_001085347	NP_001078816	Q5JU69	TOR2A_HUMAN	torsin family 2, member A isoform a	131					chaperone mediated protein folding requiring cofactor	endoplasmic reticulum|extracellular region	ATP binding|nucleoside-triphosphatase activity				0												OREG0019509	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.4	7.379663	7.471743	4	6	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129536424	129536424	16917	9	T	G	G	59	59	TOR2A	G	4	4
NTNG2	84628	broad.mit.edu	36	9	134063548	134063548	+	Silent	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:134063548C>A	uc004cbh.2	+	c.588C>A	c.(586-588)ACC>ACA	p.T196T		NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2	196	Laminin N-terminal.				axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)										0.266667	11.738087	13.185745	8	22	CC		KEEP	---	---	---	---	capture			Silent	SNP	134063548	134063548	11110	9	C	A	A	23	23	NTNG2	A	3	3
CEL	1056	broad.mit.edu	36	9	134936913	134936913	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:134936913C>T	uc010naa.1	+	c.2212C>T	c.(2212-2214)CCT>TCT	p.P738S		NM_001807	NP_001798	P19835	CEL_HUMAN	carboxyl ester lipase precursor	735	17.|17 X 11 AA tandem repeats, glycodomain, O-linked (mucin type).				cholesterol catabolic process|fatty acid catabolic process|intestinal cholesterol absorption|intestinal lipid catabolic process|pancreatic juice secretion|protein esterification|regulation of synaptic transmission|triglyceride metabolic process		acylglycerol lipase activity|heparin binding|sterol esterase activity|triglyceride lipase activity			pancreas(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.03e-40)|Epithelial(140;3.58e-37)|GBM - Glioblastoma multiforme(294;0.00164)|READ - Rectum adenocarcinoma(205;0.196)										0.307692	6.889587	7.321701	4	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	134936913	134936913	3342	9	C	T	T	22	22	CEL	T	2	2
C9orf93	203238	broad.mit.edu	36	9	15735613	15735613	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:15735613C>T	uc003zmd.1	+	c.2655C>T	c.(2653-2655)GAC>GAT	p.D885D	C9orf93_uc003zme.1_Silent_p.D800D|C9orf93_uc003zmf.1_Silent_p.D193D	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	885											0				GBM - Glioblastoma multiforme(50;4.84e-07)										0.333333	25.881014	26.537797	9	18	CC		KEEP	---	---	---	---	capture			Silent	SNP	15735613	15735613	2622	9	C	T	T	19	19	C9orf93	T	1	1
IFNA16	3449	broad.mit.edu	36	9	21206936	21206936	+	Silent	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:21206936C>T	uc003zor.1	-	c.369G>A	c.(367-369)GTG>GTA	p.V123V	IFNA14_uc003zoo.1_Intron	NM_002173	NP_002164	P05015	IFN16_HUMAN	interferon, alpha 16	123					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|interferon-alpha/beta receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)										0.094286	25.641195	141.534389	66	634	CC		KEEP	---	---	---	---	capture			Silent	SNP	21206936	21206936	7836	9	C	T	T	29	29	IFNA16	T	2	2
PTCH1	5727	broad.mit.edu	36	9	97308567	97308567	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:97308567C>T	uc004avk.2	-	c.337G>A	c.(337-339)GCG>ACG	p.A113T	PTCH1_uc010mro.1_5'UTR|PTCH1_uc010mrp.1_5'UTR|PTCH1_uc010mrq.1_5'UTR|PTCH1_uc004avl.2_5'UTR|PTCH1_uc010mrr.1_Missense_Mutation_p.A47T|PTCH1_uc004avm.2_Missense_Mutation_p.A112T|PTCH1_uc010mrt.1_Non-coding_Transcript|PTCH1_uc010mru.1_Non-coding_Transcript|PTCH1_uc004avo.2_Missense_Mutation_p.A47T|PTCH1_uc010mrv.1_Intron|PTCH1_uc010mrw.1_Intron	NM_000264	NP_001077076	Q13635	PTC1_HUMAN	patched isoform L	113	Helical; (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(229)|central_nervous_system(43)|bone(33)|upper_aerodigestive_tract(10)|lung(5)|large_intestine(4)|oesophagus(3)|ovary(3)|breast(2)|vulva(1)	333		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)								509				0.545455	11.836927	11.85579	6	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	97308567	97308567	13184	9	C	T	T	27	27	PTCH1	T	1	1
MORC4	79710	broad.mit.edu	36	X	106123204	106123204	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:106123204C>T	uc004emu.2	-	c.220G>A	c.(220-222)GAT>AAT	p.D74N	MORC4_uc004emp.2_5'UTR|MORC4_uc004emv.2_Missense_Mutation_p.D74N|MORC4_uc004emw.2_5'UTR	NM_024657	NP_078933	Q8TE76	MORC4_HUMAN	zinc finger, CW type with coiled-coil domain 2	74							ATP binding|zinc ion binding			ovary(1)	1														0.547619	211.25408	211.500945	69	57	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	106123204	106123204	10095	23	C	T	T	32	32	MORC4	T	2	2
MSL3	10943	broad.mit.edu	36	X	11691911	11691911	+	Nonsense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:11691911C>T	uc004cuw.1	+	c.841C>T	c.(841-843)CAG>TAG	p.Q281*	MSL3_uc004cuv.1_Nonsense_Mutation_p.Q281*|MSL3_uc004cux.1_Nonsense_Mutation_p.Q222*|MSL3_uc004cuy.1_Nonsense_Mutation_p.Q115*	NM_078629	NP_006791	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3-like 1 isoform a	281					chromatin assembly or disassembly|histone H4-K16 acetylation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	chromatin|MSL complex	chromatin binding|DNA binding|methylated histone residue binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1														0.873239	195.250467	204.887619	62	9	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	11691911	11691911	10272	23	C	T	T	29	29	MSL3	T	5	2
USP26	83844	broad.mit.edu	36	X	131988354	131988354	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:131988354G>A	uc010nrm.1	-	c.1561C>T	c.(1561-1563)CTC>TTC	p.L521F	USP26_uc004exa.1_Missense_Mutation_p.L521F	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	521					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			central_nervous_system(3)|kidney(1)|liver(1)	5	Acute lymphoblastic leukemia(192;0.000127)					NSCLC(104;342 1621 36940 47097 52632)								0.719512	192.421823	195.978216	59	23	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	131988354	131988354	17620	23	G	A	A	35	35	USP26	A	2	2
FANCB	2187	broad.mit.edu	36	X	14793441	14793441	+	Missense_Mutation	SNP	G	A	A			TCGA-14-1795-01	TCGA-14-1795-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:14793441G>A	uc004cwg.1	-	c.113C>T	c.(112-114)ACA>ATA	p.T38I	FANCB_uc004cwh.1_Missense_Mutation_p.T38I	NM_001018113	NP_689846	Q8NB91	FANCB_HUMAN	Fanconi anemia complementation group B	38					DNA repair	nucleoplasm					0	Hepatocellular(33;0.183)									92				0.195122	18.382095	21.931461	8	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	14793441	14793441	5899	23	G	A	A	48	48	FANCB	A	2	2
GABRE	2564	broad.mit.edu	36	X	150881729	150881729	+	Missense_Mutation	SNP	C	T	T			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:150881729C>T	uc004ffi.1	-	c.385G>A	c.(385-387)GAA>AAA	p.E129K	GABRE_uc004ffg.1_Intron|GABRE_uc004fff.1_Missense_Mutation_p.E16K|GABRE_uc004ffh.1_Missense_Mutation_p.E16K	NM_004961	NP_068830	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	129	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.2103	121.11074	139.157305	49	184	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150881729	150881729	6421	23	C	T	T	31	31	GABRE	T	1	1
PDZD4	57595	broad.mit.edu	36	X	152723755	152723755	+	Silent	SNP	A	C	C			TCGA-14-1795-01	TCGA-14-1795-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chrX:152723755A>C	uc004fja.1	-	c.771T>G	c.(769-771)CCT>CCG	p.P257P	PDZD4_uc004fix.1_Silent_p.P155P|PDZD4_uc004fiy.1_Silent_p.P176P|PDZD4_uc004fiz.1_Silent_p.P251P	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	251						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)													0.714286	12.106806	12.438632	5	2	AA		KEEP	---	---	---	---	capture			Silent	SNP	152723755	152723755	12124	23	A	C	C	7	7	PDZD4	C	4	4
ITM2A	9452	broad.mit.edu	36	X	78505221	78505221	+	Missense_Mutation	SNP	C	A	A			TCGA-14-1795-01	TCGA-14-1795-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chrX:78505221C>A	uc004edh.1	-	c.315G>T	c.(313-315)GAG>GAT	p.E105D		NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A	105						integral to membrane	protein binding			lung(2)	2														0.777778	20.526398	21.164379	7	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	78505221	78505221	8216	23	C	A	A	28	28	ITM2A	A	3	3
TM9SF3	56889	broad.mit.edu	36	10	98280318	98280318	+	Frame_Shift_Del	DEL	T	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:98280318_98280318delT	uc001kmm.2	-	c.1363_1363delA	c.(1363-1365)ATTfs	p.I455fs		NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	455	Helical; (Potential).					integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	98280318	98280318	16509	10	T	-	-	52	52	TM9SF3	-	5	5
METTL12	751071	broad.mit.edu	36	11	62189990	62189991	+	Frame_Shift_Ins	INS	-	GG	GG			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr11:62189990_62189991insGG	uc001nug.1	+	c.63_64insGG	c.(61-66)TTTGCGfs	p.F21fs	C11orf48_uc001nue.1_Intron|C11orf48_uc001nuf.1_Intron|METTL12_uc001nuh.2_5'UTR	NM_001043229	NP_001036694	A8MUP2	MTL12_HUMAN	hypothetical protein LOC751071	21_22						mitochondrion	methyltransferase activity				0														0.86			771	127				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	62189990	62189991	9886	11	-	GG	GG	63	63	METTL12	GG	5	5
CDKN1B	1027	broad.mit.edu	36	12	12762501	12762501	+	Frame_Shift_Del	DEL	G	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:12762501_12762501delG	uc001rat.1	+	c.461_461delG	c.(460-462)CGAfs	p.R154fs		NM_004064	NP_004055	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B	154	Nuclear localization signal (Potential).				autophagic cell death|cell cycle arrest|cellular response to lithium ion|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of gene-specific transcription|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process|S phase of mitotic cell cycle	cytosol|endosome|nucleoplasm	cyclin-dependent protein kinase inhibitor activity|protein phosphatase binding|transforming growth factor beta receptor, cytoplasmic mediator activity			ovary(1)	1		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)						63				0.59			16	11				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	12762501	12762501	3288	12	G	-	-	37	37	CDKN1B	-	5	5
DNAJC22	79962	broad.mit.edu	36	12	48029223	48029228	+	In_Frame_Del	DEL	TCCATG	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:48029223_48029228delTCCATG	uc001rua.1	+	c.301_306delTCCATG	c.(301-306)TCCATGdel	p.SM101del	DNAJC22_uc001rub.1_In_Frame_Del_p.SM101del	NM_024902	NP_079178	Q8N4W6	DJC22_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 22	101_102					protein folding	integral to membrane	heat shock protein binding|unfolded protein binding			ovary(1)	1														0.53			136	120				---	---	---	---	capture_indel			In_Frame_Del	DEL	48029223	48029228	4824	12	TCCATG	-	-	62	62	DNAJC22	-	5	5
IRS2	8660	broad.mit.edu	36	13	109232405	109232411	+	Frame_Shift_Del	DEL	CCTCCTT	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:109232405_109232411delCCTCCTT	uc001vqv.1	-	c.3991_3997delAAGGAGG	c.(3991-3999)AAGGAGGCCfs	p.K1331fs		NM_003749	NP_003740	Q9Y4H2	IRS2_HUMAN	insulin receptor substrate 2	1331_1333				LPPANTYASIDFLSHHLKEATIVKE -> PAPCPTTYAQH (in Ref. 1; BAA24500).	fibroblast growth factor receptor signaling pathway|glucose metabolic process|insulin receptor signaling pathway|lipid homeostasis|negative regulation of B cell apoptosis|negative regulation of kinase activity|negative regulation of plasma membrane long-chain fatty acid transport|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of B cell proliferation|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|response to glucose stimulus	cytosol|plasma membrane	insulin receptor binding|signal transducer activity			large_intestine(2)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	5	all_cancers(4;7.57e-15)|all_epithelial(4;5.91e-09)|all_lung(23;7.64e-07)|Lung NSC(43;0.000183)|Colorectal(4;0.00159)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0155)	Breast(118;0.159)	all cancers(43;0.00815)|BRCA - Breast invasive adenocarcinoma(86;0.11)|Epithelial(84;0.127)|GBM - Glioblastoma multiforme(44;0.147)			Melanoma(100;613 2409 40847)				156				0.70			19	8				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	109232405	109232411	8145	13	CCTCCTT	-	-	26	26	IRS2	-	5	5
RIPK3	11035	broad.mit.edu	36	14	23876465	23876466	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:23876465_23876466insA	uc001wpb.1	-	c.941_942insT	c.(940-942)AGAfs	p.R314fs	ADCY4_uc001wov.1_5'Flank|ADCY4_uc001wow.1_5'Flank|ADCY4_uc001wox.1_5'Flank|ADCY4_uc001woy.1_5'Flank|ADCY4_uc001woz.2_5'Flank|RIPK3_uc001wpa.1_Frame_Shift_Ins_p.R114fs|RIPK3_uc010alq.1_Non-coding_Transcript	NM_006871	NP_006862	Q9Y572	RIPK3_HUMAN	receptor-interacting serine-threonine kinase 3	314					apoptosis|induction of apoptosis by extracellular signals|protein phosphorylation	cytoplasm	ATP binding|protein binding|transcription coactivator activity			central_nervous_system(2)|ovary(1)|lung(1)	4				GBM - Glioblastoma multiforme(265;0.0181)		Pancreas(58;918 1191 4668 13304 15331)				120				0.33			52	107				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	23876465	23876466	13859	14	-	A	A	50	50	RIPK3	A	5	5
TCL1B	9623	broad.mit.edu	36	14	95226979	95226982	+	Frame_Shift_Del	DEL	ATAG	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:95226979_95226982delATAG	uc001yez.1	+	c.316_319delATAG	c.(316-321)ATAGCAfs	p.I106fs	TCL6_uc001yew.1_Non-coding_Transcript|TCL6_uc001yex.1_Non-coding_Transcript|TCL6_uc010avj.1_Non-coding_Transcript|TCL6_uc001yey.1_Non-coding_Transcript|TCL1B_uc001yfa.1_Frame_Shift_Del_p.I106fs	NM_004918	NP_954676	O95988	TCL1B_HUMAN	T-cell leukemia/lymphoma 1B	106_107										ovary(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)										0.52			49	46				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	95226979	95226982	16231	14	ATAG	-	-	4	4	TCL1B	-	5	5
MYO9A	4649	broad.mit.edu	36	15	69906119	69906142	+	In_Frame_Del	DEL	TTTTTGTTTGCCCTTTTCCGGGTT	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:69906119_69906142delTTTTTGTTTGCCCTTTTCCGGGTT	uc002atl.2	-	c.7480_7503delAACCCGGAAAAGGGCAAACAAAAA	c.(7480-7503)AACCCGGAAAAGGGCAAACAAAAAdel	p.NPEKGKQK2494del	MYO9A_uc002atj.1_In_Frame_Del_p.NPEKGKQK425del|MYO9A_uc002atk.1_In_Frame_Del_p.NPEKGKQK1289del	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	2494_2501	Tail.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3														0.61			84	54				---	---	---	---	capture_indel			In_Frame_Del	DEL	69906119	69906142	10479	15	TTTTTGTTTGCCCTTTTCCGGGTT	-	-	52	52	MYO9A	-	5	5
VAC14	55697	broad.mit.edu	36	16	69363522	69363524	+	In_Frame_Del	DEL	GTG	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:69363522_69363524delGTG	uc002ezm.1	-	c.1149_1151delCAC	c.(1147-1152)TTCACT>TTT	p.T384del	VAC14_uc010cfw.1_In_Frame_Del_p.T150del|VAC14_uc002ezn.1_Intron	NM_018052	NP_060522	Q08AM6	VAC14_HUMAN	Vac14 homolog	384					interspecies interaction between organisms	endoplasmic reticulum|endosome membrane|microsome	protein binding|receptor activity			pancreas(1)	1		Ovarian(137;0.0699)												0.33			136	279				---	---	---	---	capture_indel			In_Frame_Del	DEL	69363522	69363524	17676	16	GTG	-	-	36	36	VAC14	-	5	5
ZCCHC14	23174	broad.mit.edu	36	16	86003010	86003011	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:86003010_86003011delTC	uc002fjz.1	-	c.2406_2407delGA	c.(2404-2409)CTGACTfs	p.L802fs	ZCCHC14_uc002fka.1_Non-coding_Transcript|ZCCHC14_uc002fkb.2_Frame_Shift_Del_p.L578fs	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14	802_803					cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			breast(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0285)										0.71			5	2				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	86003010	86003011	18171	16	TC	-	-	58	58	ZCCHC14	-	5	5
SREBF1	6720	broad.mit.edu	36	17	17659331	17659332	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:17659331_17659332insC	uc002grt.1	-	c.2510_2511insG	c.(2509-2511)GAAfs	p.E837fs	SREBF1_uc002grp.1_Frame_Shift_Ins_p.E426fs|SREBF1_uc002grq.1_Frame_Shift_Ins_p.E326fs|SREBF1_uc002grr.1_Frame_Shift_Ins_p.E553fs|SREBF1_uc002grs.1_Frame_Shift_Ins_p.E783fs|SREBF1_uc002gru.1_Frame_Shift_Ins_p.E807fs	NM_001005291	NP_001005291	P36956	SRBP1_HUMAN	sterol regulatory element binding transcription	807	Cytoplasmic (Potential).				cellular response to starvation|cholesterol metabolic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter	endoplasmic reticulum|endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane|Golgi membrane|integral to membrane|nuclear envelope|nucleus	protein binding|protein binding|RNA polymerase II transcription factor activity|sequence-specific DNA binding transcription factor activity|sterol response element binding				0														0.57			46	35				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	17659331	17659332	15655	17	-	C	C	60	60	SREBF1	C	5	5
DUSP14	11072	broad.mit.edu	36	17	32946385	32946403	+	Splice_Site_Del	DEL	GTATTTTGCAGGAAGGAGA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:32946385_32946403delGTATTTTGCAGGAAGGAGA	uc002hnx.2	+	c.e3_splice_site			DUSP14_uc002hny.2_Splice_Site_Del|DUSP14_uc002hnz.2_Splice_Site_Del|DUSP14_uc010cvc.1_5'Flank	NM_007026	NP_008957			dual specificity phosphatase 14								MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0		Breast(25;0.00637)|Ovarian(249;0.15)												0.46			6	7				---	---	---	---	capture_indel			Splice_Site_Del	DEL	32946385	32946403	4999	17	GTATTTTGCAGGAAGGAGA	-	-	48	48	DUSP14	-	5	5
KIRREL2	84063	broad.mit.edu	36	19	41049053	41049054	+	Frame_Shift_Ins	INS	-	C	C			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:41049053_41049054insC	uc002ocb.2	+	c.1946_1947insC	c.(1945-1947)GTCfs	p.V649fs	KIRREL2_uc002obz.2_Intron|KIRREL2_uc002oca.2_Intron|KIRREL2_uc002occ.2_Frame_Shift_Ins_p.V596fs|KIRREL2_uc002ocd.2_Frame_Shift_Ins_p.V611fs|APLP1_uc002oce.1_5'Flank|APLP1_uc002ocf.1_5'Flank|APLP1_uc002ocg.1_5'Flank	NM_199180	NP_954649	Q6UWL6	KIRR2_HUMAN	kin of IRRE-like 2 isoform c	649	Pro-rich.|Cytoplasmic (Potential).				cell adhesion	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)											0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	41049053	41049054	8637	19	-	C	C	58	58	KIRREL2	C	5	5
NLRP13	126204	broad.mit.edu	36	19	61115177	61115178	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:61115177_61115178delAC	uc002qmg.1	-	c.1817_1818delGT	c.(1816-1818)TGTfs	p.C606fs		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	606							ATP binding			ovary(3)|skin(2)|pancreas(1)|lung(1)	7		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)										0.42			28	39				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	61115177	61115178	10878	19	AC	-	-	14	14	NLRP13	-	5	5
PARP1	142	broad.mit.edu	36	1	224634390	224634392	+	In_Frame_Del	DEL	TGG	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:224634390_224634392delTGG	uc001hqd.2	-	c.1397_1399delCCA	c.(1396-1401)ACCAAG>AAG	p.T466del		NM_001618	NP_001609	P09874	PARP1_HUMAN	poly (ADP-ribose) polymerase family, member 1	466	Automodification domain.|BRCT.				cellular response to insulin stimulus|protein ADP-ribosylation|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nuclear envelope|nucleolus|transcription factor complex	DNA binding|identical protein binding|NAD+ ADP-ribosyltransferase activity|protein N-terminus binding|transcription factor binding|zinc ion binding			ovary(2)|breast(2)|lung(1)	5	Breast(184;0.133)			GBM - Glioblastoma multiforme(131;0.0531)						1012				0.40			14	21				---	---	---	---	capture_indel			In_Frame_Del	DEL	224634390	224634392	11871	1	TGG	-	-	63	63	PARP1	-	5	5
TXLNA	200081	broad.mit.edu	36	1	32422750	32422773	+	In_Frame_Del	DEL	TCTGAGTACCCCAGAGGAGAAGCT	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:32422750_32422773delTCTGAGTACCCCAGAGGAGAAGCT	uc001bui.1	+	c.543_566delTCTGAGTACCCCAGAGGAGAAGCT	c.(541-567)ACTCTGAGTACCCCAGAGGAGAAGCTG>ACG	p.LSTPEEKL182del	TXLNA_uc001buj.1_In_Frame_Del_p.LSTPEEKL182del	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	182_189	Potential.				cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)												0.39			101	161				---	---	---	---	capture_indel			In_Frame_Del	DEL	32422750	32422773	17343	1	TCTGAGTACCCCAGAGGAGAAGCT	-	-	54	54	TXLNA	-	5	5
TMPRSS2	7113	broad.mit.edu	36	21	41762331	41762338	+	Splice_Site_Del	DEL	CTTCCCTA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:41762331_41762338delCTTCCCTA	uc010gor.1	-	c.e12_splice_site			TMPRSS2_uc010gos.1_Splice_Site_Del|TMPRSS2_uc002yzj.1_Splice_Site_Del	NM_005656	NP_005647			transmembrane protease, serine 2 isoform 2						proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2058)|TMPRSS2/ETV1(24)	prostate(2082)|central_nervous_system(1)	2083		Prostate(19;4.48e-07)|all_epithelial(19;0.031)								848				0.33			26	54				---	---	---	---	capture_indel			Splice_Site_Del	DEL	41762331	41762338	16788	21	CTTCCCTA	-	-	32	32	TMPRSS2	-	5	5
POFUT2	23275	broad.mit.edu	36	21	45530141	45530147	+	Frame_Shift_Del	DEL	GGCCCCA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:45530141_45530147delGGCCCCA	uc002zhc.1	-	c.256_262delTGGGGCC	c.(256-264)TGGGGCCGCfs	p.W86fs	POFUT2_uc002zhb.1_Non-coding_Transcript|POFUT2_uc002zhd.1_Frame_Shift_Del_p.W86fs|LOC642852_uc002zhe.1_5'Flank	NM_133635	NP_598368	Q9Y2G5	OFUT2_HUMAN	protein O-fucosyltransferase 2 isoform C	86_88					fucose metabolic process	endoplasmic reticulum	peptide-O-fucosyltransferase activity				0				Colorectal(79;0.243)										0.33			13	27				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	45530141	45530147	12612	21	GGCCCCA	-	-	39	39	POFUT2	-	5	5
PCNT	5116	broad.mit.edu	36	21	46611308	46611309	+	Frame_Shift_Ins	INS	-	TA	TA			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr21:46611308_46611309insTA	uc002zji.2	+	c.2991_2992insTA	c.(2989-2994)TTTGAGfs	p.F997fs	PCNT_uc002zjj.1_Frame_Shift_Ins_p.F879fs	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	997_998					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)													0.43			21	28				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	46611308	46611309	12010	21	-	TA	TA	63	63	PCNT	TA	5	5
XDH	7498	broad.mit.edu	36	2	31415984	31415993	+	Frame_Shift_Del	DEL	CGGGGGAATA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:31415984_31415993delCGGGGGAATA	uc002rnv.1	-	c.3640_3649delTATTCCCCCG	c.(3640-3651)TATTCCCCCGAGfs	p.Y1214fs		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1214_1217					oxidation-reduction process|purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	5	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	Colon(66;682 1445 30109 40147)								0.40			55	83				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	31415984	31415993	18007	2	CGGGGGAATA	-	-	31	31	XDH	-	5	5
ATP2B2	491	broad.mit.edu	36	3	10419001	10419002	+	Frame_Shift_Ins	INS	-	G	G			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:10419001_10419002insG	uc003bvt.1	-	c.428_429insC	c.(427-429)GATfs	p.D143fs	ATP2B2_uc003bvv.1_Frame_Shift_Ins_p.D143fs|ATP2B2_uc003bvw.1_Frame_Shift_Ins_p.D143fs|ATP2B2_uc010hdp.1_Frame_Shift_Ins_p.D143fs|ATP2B2_uc010hdo.1_5'UTR|ATP2B2_uc003bvu.1_Frame_Shift_Ins_p.D143fs	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	143	Extracellular (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|central_nervous_system(1)	4						Ovarian(125;1619 1709 15675 19819 38835)								0.61			14	9				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	10419001	10419002	1159	3	-	G	G	8	8	ATP2B2	G	5	5
TGFBR2	7048	broad.mit.edu	36	3	30707919	30707920	+	Frame_Shift_Ins	INS	-	T	T			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:30707919_30707920insT	uc003cen.1	+	c.1603_1604insT	c.(1603-1605)ATCfs	p.I535fs	TGFBR2_uc003ceo.1_Frame_Shift_Ins_p.I510fs	NM_001024847	NP_001020018	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	510	Protein kinase.|Cytoplasmic (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane|transforming growth factor beta receptor complex	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(3)|ovary(3)|lung(2)|central_nervous_system(1)	24										132				0.61			78	50				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	30707919	30707920	16350	3	-	T	T	8	8	TGFBR2	T	5	5
CCDC96	257236	broad.mit.edu	36	4	7094310	7094317	+	Frame_Shift_Del	DEL	ATTGAAGG	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:7094310_7094317delATTGAAGG	uc003gjv.1	-	c.1250_1257delCCTTCAAT	c.(1249-1257)ACCTTCAATfs	p.T417fs	TADA2B_uc003gjw.2_5'Flank|TADA2B_uc010idi.1_5'Flank	NM_153376	NP_699207	Q2M329	CCD96_HUMAN	coiled-coil domain containing 96	417_419	Potential.										0														0.46			103	121				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	7094310	7094317	2999	4	ATTGAAGG	-	-	8	8	CCDC96	-	5	5
PDGFRB	5159	broad.mit.edu	36	5	149492667	149492668	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:149492667_149492668delCA	uc003lro.1	-	c.965_966delTG	c.(964-966)GTGfs	p.V322fs	PDGFRB_uc010jhd.1_Frame_Shift_Del_p.V161fs	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	322	Extracellular (Potential).				cardiac myofibril assembly|cell chemotaxis|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(3)|large_intestine(1)|stomach(1)|breast(1)|ovary(1)	11		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)					880				0.82			18	4				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	149492667	149492668	12083	5	CA	-	-	21	21	PDGFRB	-	5	5
ZBTB12	221527	broad.mit.edu	36	6	31975997	31976008	+	In_Frame_Del	DEL	CTGCGCCCGCAT	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:31975997_31976008delCTGCGCCCGCAT	uc003nyd.1	-	c.1054_1065delATGCGGGCGCAG	c.(1054-1065)ATGCGGGCGCAGdel	p.MRAQ352del	C2_uc003nyc.1_Intron|EHMT2_uc003nxz.1_5'Flank|EHMT2_uc003nya.1_5'Flank|EHMT2_uc003nyb.1_5'Flank|ZBTB12_uc010jtj.1_In_Frame_Del_p.MRAQ352del	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	352_355	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0														0.57			58	44				---	---	---	---	capture_indel			In_Frame_Del	DEL	31975997	31976008	18111	6	CTGCGCCCGCAT	-	-	28	28	ZBTB12	-	5	5
ANKS1A	23294	broad.mit.edu	36	6	35161670	35161671	+	Frame_Shift_Ins	INS	-	A	A			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:35161670_35161671insA	uc003ojx.2	+	c.3282_3283insA	c.(3280-3285)CGGGTCfs	p.R1094fs	ANKS1A_uc010jvp.1_Frame_Shift_Ins_p.R468fs	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	1094_1095						cytoplasm	protein binding			ovary(3)	3														0.40			23	35				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	35161670	35161671	696	6	-	A	A	43	43	ANKS1A	A	5	5
PALM2-AKAP2	445815	broad.mit.edu	36	9	111939655	111939679	+	Frame_Shift_Del	DEL	CGCCCGGGCTGTCCTCACTGTGGTC	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:111939655_111939679delCGCCCGGGCTGTCCTCACTGTGGTC	uc004bei.2	+	c.2706_2730delCGCCCGGGCTGTCCTCACTGTGGTC	c.(2704-2730)AGCGCCCGGGCTGTCCTCACTGTGGTCfs	p.S902fs	PALM2-AKAP2_uc004bek.2_Frame_Shift_Del_p.S670fs|PALM2-AKAP2_uc004bej.2_Frame_Shift_Del_p.S670fs|PALM2-AKAP2_uc004bel.1_Frame_Shift_Del_p.S480fs|AKAP2_uc004bem.1_Frame_Shift_Del_p.S528fs|PALM2-AKAP2_uc010mtw.1_Frame_Shift_Del_p.S488fs|PALM2-AKAP2_uc004ben.1_Frame_Shift_Del_p.S439fs	NM_001004065	NP_001004065	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 1	439_447							enzyme binding			ovary(3)|central_nervous_system(2)	5														0.43			12	16				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	111939655	111939679	11826	9	CGCCCGGGCTGTCCTCACTGTGGTC	-	-	27	27	PALM2-AKAP2	-	5	5
LRRC8A	56262	broad.mit.edu	36	9	130709751	130709756	+	In_Frame_Del	DEL	TGCTTC	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:130709751_130709756delTGCTTC	uc004bwl.2	+	c.487_492delTGCTTC	c.(487-492)TGCTTCdel	p.CF163del	LRRC8A_uc010myp.1_In_Frame_Del_p.CF163del|LRRC8A_uc010myq.1_In_Frame_Del_p.CF163del	NM_019594	NP_062540	Q8IWT6	LRC8A_HUMAN	leucine rich repeat containing 8 family, member	163_164					pre-B cell differentiation	integral to membrane					0														0.52			87	80				---	---	---	---	capture_indel			In_Frame_Del	DEL	130709751	130709756	9397	9	TGCTTC	-	-	59	59	LRRC8A	-	5	5
SLC9A7	84679	broad.mit.edu	36	X	46503169	46503170	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:46503169_46503170delCA	uc004dgu.1	-	c.239_240delTG	c.(238-240)CTGfs	p.L80fs	SLC9A7_uc004dgv.1_Frame_Shift_Del_p.L80fs	NM_032591	NP_115980	Q96T83	SL9A7_HUMAN	solute carrier family 9, member 7	80	Helical; (Potential).				regulation of pH	Golgi membrane|integral to membrane|recycling endosome membrane|trans-Golgi network	potassium:hydrogen antiporter activity|protein homodimerization activity|sodium:hydrogen antiporter activity			ovary(2)	2						Pancreas(118;454 1696 1930 13865 39976)								0.39			14	22				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46503169	46503170	15216	23	CA	-	-	25	25	SLC9A7	-	5	5
SHROOM2	357	broad.mit.edu	36	X	9822696	9822697	+	In_Frame_Ins	INS	-	TTT	TTT			TCGA-14-1795-01	TCGA-14-1795-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:9822696_9822697insTTT	uc004csu.1	+	c.748_749insTTT	c.(748-750)CGG>CTTTGG	p.250_250R>LW		NM_001649	NP_001640	Q13796	SHRM2_HUMAN	apical protein of Xenopus-like	250					apical protein localization|brain development|cell migration|cell morphogenesis|cellular pigment accumulation|ear development|establishment of melanosome localization|eye pigment granule organization|lens morphogenesis in camera-type eye|melanosome organization	apical plasma membrane|cell-cell adherens junction|microtubule|tight junction	actin filament binding|beta-catenin binding|ligand-gated sodium channel activity			ovary(3)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	6		Hepatocellular(5;0.000888)												0.60			12	8				---	---	---	---	capture_indel			In_Frame_Ins	INS	9822696	9822697	14789	23	-	TTT	TTT	23	23	SHROOM2	TTT	5	5
