Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
ITGA8	8516	broad.mit.edu	36	10	15687753	15687754	+	Missense_Mutation	DNP	GG	AA	AA			TCGA-16-0849-01	TCGA-16-0849-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:15687753_15687754GG>AA	uc001ioc.1	-	c.1945_1946CC>TT	c.(1945-1947)CCT>TTT	p.P649F		NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8	649	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6														0.110497	51.725735	133.290114	60	483	GG		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	15687753	15687754	8186	10	GG	AA	AA	35	35	ITGA8	AA	2	2
KIAA1462	57608	broad.mit.edu	36	10	30356821	30356821	+	Silent	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:30356821C>T	uc009xle.1	-	c.2262G>A	c.(2260-2262)AGG>AGA	p.R754R	KIAA1462_uc001iuz.2_Silent_p.R616R|KIAA1462_uc001iux.2_Silent_p.R754R|KIAA1462_uc001iuy.2_Intron	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	754										ovary(4)	4														0.383333	67.412079	68.127517	23	37	CC		KEEP	---	---	---	---	capture			Silent	SNP	30356821	30356821	8543	10	C	T	T	18	18	KIAA1462	T	2	2
SIRT1	23411	broad.mit.edu	36	10	69339098	69339098	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr10:69339098A>G	uc001jnd.1	+	c.1250A>G	c.(1249-1251)AAT>AGT	p.N417S	SIRT1_uc009xpp.1_Missense_Mutation_p.N225S|SIRT1_uc001jne.1_Missense_Mutation_p.N114S	NM_012238	NP_036370	Q96EB6	SIRT1_HUMAN	sirtuin 1 isoform a	417	Deacetylase sirtuin-type.				apoptosis|cell aging|cellular response to starvation|chromatin silencing at rDNA|DNA repair|DNA replication|establishment of chromatin silencing|interspecies interaction between organisms|maintenance of chromatin silencing|muscle organ development|negative regulation of DNA damage response, signal transduction by p53 class mediator|negative regulation of fat cell differentiation|negative regulation of helicase activity|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine acetylation|peptidyl-lysine deacetylation|positive regulation of anti-apoptosis|positive regulation of chromatin silencing|positive regulation of DNA repair|regulation of apoptosis|regulation of cell proliferation|regulation of endodeoxyribonuclease activity|regulation of protein import into nucleus, translocation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|rRNA processing|transcription, DNA-dependent|triglyceride mobilization|white fat cell differentiation	chromatin silencing complex|cytoplasm|nuclear euchromatin|nuclear heterochromatin|nuclear inner membrane|nucleolus|PML body|rDNA heterochromatin	bHLH transcription factor binding|histone binding|HLH domain binding|identical protein binding|NAD+ binding|NAD-dependent histone deacetylase activity (H3-K9 specific)|p53 binding|protein C-terminus binding|transcription corepressor activity|transcription repressor activity|zinc ion binding				0										395				0.456747	813.088477	814.030935	264	314	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	69339098	69339098	14832	10	A	G	G	4	4	SIRT1	G	4	4
PRG3	10394	broad.mit.edu	36	11	56903593	56903593	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56903593T>G	uc001njv.1	-	c.325A>C	c.(325-327)ACC>CCC	p.T109P		NM_006093	NP_006084	Q9Y2Y8	PRG3_HUMAN	proteoglycan 3	109	C-type lectin.				basophil activation|histamine biosynthetic process|immune response|leukotriene biosynthetic process|negative regulation of translation|neutrophil activation|positive regulation of interleukin-8 biosynthetic process|superoxide anion generation		sugar binding				0						Melanoma(154;1456 2519 19358 45229)								0.176471	7.914025	11.303792	6	28	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56903593	56903593	12923	11	T	G	G	50	50	PRG3	G	4	4
NELL2	4753	broad.mit.edu	36	12	43212657	43212657	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:43212657A>G	uc001rog.1	-	c.1778T>C	c.(1777-1779)TTT>TCT	p.F593S	NELL2_uc001rof.2_Missense_Mutation_p.F592S|NELL2_uc001roh.1_Missense_Mutation_p.F593S|NELL2_uc009zkd.1_Intron|NELL2_uc001roi.1_Missense_Mutation_p.F593S	NM_006159	NP_006150	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	593	EGF-like 5; calcium-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			central_nervous_system(1)	1	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)										0.372581	672.18486	681.017588	231	389	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43212657	43212657	10733	12	A	G	G	1	1	NELL2	G	4	4
RARG	5916	broad.mit.edu	36	12	51893197	51893197	+	Silent	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:51893197C>T	uc001sce.1	-	c.1116G>A	c.(1114-1116)CAG>CAA	p.Q372Q	RARG_uc001scf.1_Silent_p.Q372Q|RARG_uc001scg.1_Silent_p.Q300Q|RARG_uc001scd.1_Silent_p.Q361Q	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	372	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)	3					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)					80		OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.365539	610.991511	620.848988	227	394	CC		KEEP	---	---	---	---	capture			Silent	SNP	51893197	51893197	13514	12	C	T	T	28	28	RARG	T	2	2
ESYT1	23344	broad.mit.edu	36	12	54808596	54808596	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:54808596C>T	uc001sjr.1	+	c.226C>T	c.(226-228)CTC>TTC	p.L76F	ESYT1_uc001sjq.1_Missense_Mutation_p.L76F	NM_015292	NP_056107	Q9BSJ8	ESYT1_HUMAN	family with sequence similarity 62 (C2 domain	76	Helical; (Potential).					integral to membrane				ovary(4)	4														0.391304	27.169592	27.407573	9	14	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	54808596	54808596	5457	12	C	T	T	20	20	ESYT1	T	2	2
C12orf12	196477	broad.mit.edu	36	12	89871547	89871547	+	Silent	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:89871547G>A	uc001tbj.1	-	c.1104C>T	c.(1102-1104)TTC>TTT	p.F368F		NM_152638	NP_689851	Q8TC90	CL012_HUMAN	hypothetical protein LOC196477	368	Glu-rich.									central_nervous_system(1)|pancreas(1)	2														0.370968	139.816714	141.631057	46	78	GG		KEEP	---	---	---	---	capture			Silent	SNP	89871547	89871547	1720	12	G	A	A	37	37	C12orf12	A	1	1
SAP18	10284	broad.mit.edu	36	13	20619027	20619027	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:20619027T>C	uc001uns.1	+	c.266T>C	c.(265-267)TTT>TCT	p.F89S		NM_005870	NP_005861	O00422	SAP18_HUMAN	Sin3A-associated protein, 18kDa	89					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|plasma membrane	protein binding|transcription corepressor activity				0		all_cancers(29;2.16e-20)|all_epithelial(30;2.97e-18)|all_lung(29;4.58e-16)|Lung SC(185;0.0262)|Breast(139;0.147)		all cancers(112;9.79e-05)|Epithelial(112;0.000292)|OV - Ovarian serous cystadenocarcinoma(117;0.00276)|Lung(94;0.0941)										0.404762	419.480848	422.156912	136	200	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20619027	20619027	14312	13	T	C	C	64	64	SAP18	C	4	4
ACOT2	10965	broad.mit.edu	36	14	73105731	73105731	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr14:73105731T>G	uc001xon.2	+	c.34T>G	c.(34-36)TCA>GCA	p.S12A	ACOT2_uc001xom.1_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	peroxisomal long-chain acyl-coA thioesterase	12					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding				0				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)										0.452055	110.070911	110.216309	33	40	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	73105731	73105731	153	14	T	G	G	62	62	ACOT2	G	4	4
SLC30A4	7782	broad.mit.edu	36	15	43566200	43566200	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:43566200C>A	uc001zvj.1	-	c.1036G>T	c.(1036-1038)GAA>TAA	p.E346*		NM_013309	NP_037441	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter),	346	Cytoplasmic (Potential).				regulation of sequestering of zinc ion|response to toxin	endosome membrane|integral to membrane|late endosome	zinc ion transmembrane transporter activity				0		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)						11				0.48	36.496851	36.505617	12	13	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	43566200	43566200	15054	15	C	A	A	32	32	SLC30A4	A	5	3
ANPEP	290	broad.mit.edu	36	15	88150761	88150761	+	Missense_Mutation	SNP	C	T	T	rs10152474	by-hapmap	TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:88150761C>T	uc002bop.2	-	c.58G>A	c.(58-60)GTG>ATG	p.V20M		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	20	Helical; Signal-anchor for type II membrane protein; (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)	3	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	NSCLC(30;827 977 2459 19669 26125)								0.423729	219.500501	220.395772	75	102	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88150761	88150761	718	15	C	T	T	19	19	ANPEP	T	1	1
C15orf32	145858	broad.mit.edu	36	15	90816528	90816528	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr15:90816528C>T	uc002brc.1	+	c.146C>T	c.(145-147)CCA>CTA	p.P49L	C15orf32_uc010bod.1_Non-coding_Transcript	NM_153040	NP_694585	Q32M92	CO032_HUMAN	hypothetical protein LOC145858	49										ovary(1)	1	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0493)|OV - Ovarian serous cystadenocarcinoma(32;0.125)											0.313725	216.597625	224.477693	80	175	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	90816528	90816528	1840	15	C	T	T	21	21	C15orf32	T	2	2
TP53	7157	broad.mit.edu	36	17	7517846	7517846	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:7517846G>A	uc002gim.2	-	c.817C>T	c.(817-819)CGT>TGT	p.R273C	TP53_uc002gig.1_Intron|TP53_uc002gih.1_Missense_Mutation_p.R273C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.R141C|TP53_uc010cng.1_Missense_Mutation_p.R141C|TP53_uc002gii.1_Missense_Mutation_p.R141C|TP53_uc010cnh.1_Missense_Mutation_p.R273C|TP53_uc010cni.1_Missense_Mutation_p.R273C|TP53_uc002gij.2_Missense_Mutation_p.R273C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	273	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of gene-specific transcription from RNA polymerase II promoter|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	chromatin|cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|promoter binding|promoter binding|protease binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|ubiquitin protein ligase binding|zinc ion binding	p.R273C(388)|p.R273S(11)|p.R273G(9)|p.0?(6)|p.R273fs*72(2)|p.R273fs*33(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.?(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.C141fs*29(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		large_intestine(4614)|breast(2344)|upper_aerodigestive_tract(2150)|lung(1958)|ovary(1559)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1212)|stomach(1127)|urinary_tract(1113)|central_nervous_system(1072)|liver(805)|skin(693)|pancreas(370)|biliary_tract(247)|soft_tissue(209)|prostate(192)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(41)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	21904		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		Pancreas(47;798 1329 9957 10801)	R273C(SH10TC_STOMACH)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(RH30_SOFT_TISSUE)|R273C(PANC0213_PANCREAS)|R273C(SJRH30_SOFT_TISSUE)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(TT2609C02_THYROID)|R273C(MFE319_ENDOMETRIUM)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(NCIH1048_LUNG)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)	111	p.R273C(SUDHL4-Tumor)|p.R273C(EFO27-Tumor)|p.R273C(SH10TC-Tumor)|p.R273C(TGBC11TKB-Tumor)|p.R273C(KARPAS299-Tumor)|p.R273C(SW1710-Tumor)|p.R273Y(SNUC2A-Tumor)|p.R273C(TT2609C02-Tumor)|p.R273Y(PF382-Tumor)|p.R273Y(SW1783-Tumor)|p.R273C(RPMI8402-Tumor)|p.R273C(BL70-Tumor)|p.R273C(8305C-Tumor)|p.R273C(SW1088-Tumor)|p.R273C(NCIH1048-Tumor)|p.R273C(SNU1196-Tumor)|p.R273C(CL14-Tumor)|p.R273C(SJRH30-Tumor)|p.R273C(MFE319-Tumor)|p.R273C(PANC02.13-Tumor)|p.R273C(8MGBA-Tumor)	690	TCGA GBM(1;<1E-8)|TSP Lung(2;<1E-8)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			0.916667	762.666248	804.039599	242	22	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7517846	7517846	16923	17	G	A	A	38	38	TP53	A	1	1
CCDC102B	79839	broad.mit.edu	36	18	64715596	64715596	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr18:64715596A>G	uc002lkk.2	+	c.1214A>G	c.(1213-1215)CAA>CGA	p.Q405R	CCDC102B_uc002lki.2_Missense_Mutation_p.Q405R|CCDC102B_uc002lkj.1_Missense_Mutation_p.Q405R	NM_001093729	NP_079057	Q68D86	C102B_HUMAN	coiled-coil domain containing 102B	405	Potential.									ovary(1)|lung(1)	2		Esophageal squamous(42;0.0559)|Colorectal(73;0.0604)												0.2	15.804052	18.735196	7	28	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	64715596	64715596	2857	18	A	G	G	5	5	CCDC102B	G	4	4
FUT5	2527	broad.mit.edu	36	19	5818192	5818192	+	Missense_Mutation	SNP	T	C	C			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:5818192T>C	uc002mdo.2	-	c.545A>G	c.(544-546)TAC>TGC	p.Y182C	FUT5_uc010duo.1_Missense_Mutation_p.Y182C|FUT5_uc010dup.1_Missense_Mutation_p.Y182C	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	182	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0														0.444444	69.132662	69.285124	24	30	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5818192	5818192	6358	19	T	C	C	57	57	FUT5	C	4	4
OR1M1	125963	broad.mit.edu	36	19	9065370	9065370	+	Silent	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:9065370G>A	uc002mkq.1	+	c.450G>A	c.(448-450)GCG>GCA	p.A150A		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0														0.460957	543.189832	543.713986	183	214	GG		KEEP	---	---	---	---	capture			Silent	SNP	9065370	9065370	11374	19	G	A	A	40	40	OR1M1	A	1	1
RUSC1	23623	broad.mit.edu	36	1	153558986	153558986	+	Nonsense_Mutation	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:153558986G>A	uc001fkj.2	+	c.798G>A	c.(796-798)TGG>TGA	p.W266*	C1orf104_uc001fkh.1_5'Flank|C1orf104_uc001fki.1_Intron|RUSC1_uc001fkk.2_Nonsense_Mutation_p.W266*|RUSC1_uc009wqn.1_Non-coding_Transcript|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank|RUSC1_uc001fkp.2_5'Flank|RUSC1_uc001fkq.2_5'Flank|RUSC1_uc009wqp.1_5'Flank|RUSC1_uc001fko.2_5'Flank|RUSC1_uc001fkn.2_5'Flank|RUSC1_uc001fkr.2_5'Flank|RUSC1_uc001fks.2_5'Flank	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	266						cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)											0.242424	131.280839	145.263737	56	175	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	153558986	153558986	14230	1	G	A	A	41	41	RUSC1	A	5	2
FCER1A	2205	broad.mit.edu	36	1	157540376	157540376	+	Silent	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:157540376A>G	uc001ftq.1	+	c.111A>G	c.(109-111)CCA>CCG	p.P37P		NM_002001	NP_001992	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor	37	Extracellular (Potential).|Ig-like 1.					integral to plasma membrane					0	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)									0.511111	70.317695	70.322352	23	22	AA		KEEP	---	---	---	---	capture			Silent	SNP	157540376	157540376	6011	1	A	G	G	8	8	FCER1A	G	4	4
ATP1A2	477	broad.mit.edu	36	1	158365116	158365116	+	Silent	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:158365116G>A	uc001fvc.1	+	c.1068G>A	c.(1066-1068)GTG>GTA	p.V356V	ATP1A2_uc001fvb.1_Silent_p.V356V|ATP1A2_uc001fvd.1_Silent_p.V92V|ATP1A2_uc009wtg.1_Silent_p.V44V	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	356	Cytoplasmic (Potential).				ATP biosynthetic process	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|central_nervous_system(2)	4	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)											0.097959	19.021989	98.359608	48	442	GG		KEEP	---	---	---	---	capture			Silent	SNP	158365116	158365116	1148	1	G	A	A	45	45	ATP1A2	A	2	2
RCC2	55920	broad.mit.edu	36	1	17621327	17621327	+	Missense_Mutation	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:17621327C>T	uc001bal.1	-	c.703G>A	c.(703-705)GGC>AGC	p.G235S	RCC2_uc001bam.1_Missense_Mutation_p.G235S	NM_018715	NP_061185	Q9P258	RCC2_HUMAN	regulator of chromosome condensation 2	235	RCC1 3.				cell division|mitotic prometaphase	chromosome, centromeric region|cytosol|microtubule|nucleolus|spindle					0		Colorectal(325;0.000147)|Breast(348;0.00122)|Renal(390;0.00145)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00492)|BRCA - Breast invasive adenocarcinoma(304;7.69e-06)|COAD - Colon adenocarcinoma(227;1.19e-05)|Kidney(64;0.000189)|KIRC - Kidney renal clear cell carcinoma(64;0.00273)|STAD - Stomach adenocarcinoma(196;0.0135)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.19)										0.155172	60.962989	87.33163	36	196	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	17621327	17621327	13643	1	C	T	T	22	22	RCC2	T	2	2
TXLNA	200081	broad.mit.edu	36	1	32422780	32422780	+	Silent	SNP	T	G	G			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:32422780T>G	uc001bui.1	+	c.573T>G	c.(571-573)GCT>GCG	p.A191A	TXLNA_uc001buj.1_Silent_p.A191A	NM_175852	NP_787048	P40222	TXLNA_HUMAN	taxilin	191	Potential.				cell proliferation|exocytosis	cytoplasm|extracellular region	cytokine activity|high molecular weight B cell growth factor receptor binding			ovary(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)												0.336683	411.726769	421.117336	134	264	TT		KEEP	---	---	---	---	capture			Silent	SNP	32422780	32422780	17343	1	T	G	G	54	54	TXLNA	G	4	4
CA6	765	broad.mit.edu	36	1	8931923	8931923	+	Nonsense_Mutation	SNP	G	T	T			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:8931923G>T	uc001apm.1	+	c.94G>T	c.(94-96)GAA>TAA	p.E32*	CA6_uc009vmn.1_Intron	NM_001215	NP_001206	P23280	CAH6_HUMAN	carbonic anhydrase VI precursor	32					one-carbon metabolic process	extracellular region	carbonate dehydratase activity|zinc ion binding			ovary(2)	2	Ovarian(185;0.112)|all_lung(157;0.143)	all_epithelial(116;1.02e-19)|all_lung(118;3.6e-06)|Lung NSC(185;7.94e-06)|Renal(390;0.000147)|Breast(348;0.00123)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.9e-07)|COAD - Colon adenocarcinoma(227;8.28e-05)|Kidney(185;0.000268)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|STAD - Stomach adenocarcinoma(132;0.00184)|BRCA - Breast invasive adenocarcinoma(304;0.00192)|READ - Rectum adenocarcinoma(331;0.0649)										0.430962	300.025077	301.007594	103	136	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	8931923	8931923	2637	1	G	T	T	37	37	CA6	T	5	3
MGAT3	4248	broad.mit.edu	36	22	38214019	38214019	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr22:38214019A>G	uc003axv.2	+	c.721A>G	c.(721-723)AAC>GAC	p.N241D	MGAT3_uc010gxy.1_Missense_Mutation_p.N241D	NM_002409	NP_002400	Q09327	MGAT3_HUMAN	mannosyl (beta-1,4-)-glycoprotein	241	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity				0	Melanoma(58;0.04)													0.333333	24.923598	25.66992	10	20	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38214019	38214019	9934	22	A	G	G	5	5	MGAT3	G	4	4
RXFP1	59350	broad.mit.edu	36	4	159785683	159785683	+	Nonsense_Mutation	SNP	C	T	T			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:159785683C>T	uc003ipz.1	+	c.1288C>T	c.(1288-1290)CGA>TGA	p.R430*	RXFP1_uc010iqj.1_Nonsense_Mutation_p.R259*|RXFP1_uc010iqk.1_Nonsense_Mutation_p.R298*|RXFP1_uc010iql.1_Nonsense_Mutation_p.R274*|RXFP1_uc010iqm.1_Nonsense_Mutation_p.R397*|RXFP1_uc010iqn.1_Nonsense_Mutation_p.R375*|RXFP1_uc010iqo.1_Nonsense_Mutation_p.R382*	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	430	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)										0.169643	42.156903	53.721806	19	93	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	159785683	159785683	14239	4	C	T	T	27	27	RXFP1	T	5	1
ADAMTS16	170690	broad.mit.edu	36	5	5356863	5356863	+	Missense_Mutation	SNP	T	G	G			TCGA-16-0849-01	TCGA-16-0849-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:5356863T>G	uc003jdl.1	+	c.3170T>G	c.(3169-3171)GTG>GGG	p.V1057G	ADAMTS16_uc003jdk.1_Missense_Mutation_p.V1057G	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1057	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8														0.222222	6.380665	7.671642	4	14	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5356863	5356863	262	5	T	G	G	59	59	ADAMTS16	G	4	4
LAMA2	3908	broad.mit.edu	36	6	129815885	129815885	+	Missense_Mutation	SNP	G	C	C			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:129815885G>C	uc003qbn.1	+	c.6489G>C	c.(6487-6489)AAG>AAC	p.K2163N	LAMA2_uc003qbo.1_Missense_Mutation_p.K2163N|LAMA2_uc010kfe.1_Missense_Mutation_p.K2163N	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2163	Laminin G-like 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)										0.099678	21.186148	71.042077	31	280	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129815885	129815885	8929	6	G	C	C	33	33	LAMA2	C	3	3
TNFAIP3	7128	broad.mit.edu	36	6	138241334	138241334	+	Nonsense_Mutation	SNP	C	A	A			TCGA-16-0849-01	TCGA-16-0849-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:138241334C>A	uc003qhr.1	+	c.1059C>A	c.(1057-1059)TAC>TAA	p.Y353*	TNFAIP3_uc003qhs.1_Nonsense_Mutation_p.Y353*	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	353	2 X approximate repeats.|2.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of caspase activity|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(21)		haematopoietic_and_lymphoid_tissue(129)|lung(2)|ovary(1)	132	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		GBM(130;153 1739 22295 28918 47987)				159				0.274008	522.956039	558.875653	214	567	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	138241334	138241334	16815	6	C	A	A	17	17	TNFAIP3	A	5	3
RNASET2	8635	broad.mit.edu	36	6	167280188	167280188	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:167280188G>A	uc003qve.1	-	c.233C>T	c.(232-234)TCG>TTG	p.S78L	RNASET2_uc003qvf.1_5'UTR|RNASET2_uc003qvg.1_Missense_Mutation_p.S15L|RNASET2_uc003qvh.1_Intron|RNASET2_uc003qvi.1_Intron	NM_003730	NP_003721	O00584	RNT2_HUMAN	ribonuclease T2 precursor	78					RNA catabolic process	extracellular region	ribonuclease T2 activity|RNA binding				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;1.53e-19)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00665)										0.439024	155.531861	155.929468	54	69	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	167280188	167280188	13895	6	G	A	A	37	37	RNASET2	A	1	1
EGFR	1956	broad.mit.edu	36	7	55200537	55200537	+	Missense_Mutation	SNP	G	T	T			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55200537G>T	uc003tqk.1	+	c.1793G>T	c.(1792-1794)GGA>GTA	p.G598V	EGFR_uc003tqi.1_Missense_Mutation_p.G598V|EGFR_uc003tqj.1_Missense_Mutation_p.G598V|EGFR_uc010kzg.1_Missense_Mutation_p.G553V|EGFR_uc003tqn.1_Non-coding_Transcript	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	598	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.G598V(16)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.103074	26.775431	113.632426	57	496	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55200537	55200537	5156	7	G	T	T	41	41	EGFR	T	3	3
OR1L8	138881	broad.mit.edu	36	9	124370347	124370347	+	Silent	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr9:124370347G>A	uc004bmp.1	-	c.231C>T	c.(229-231)AGC>AGT	p.S77S		NM_001004454	NP_001004454	Q8NGR8	OR1L8_HUMAN	olfactory receptor, family 1, subfamily L,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3														0.389831	134.322553	135.576987	46	72	GG		KEEP	---	---	---	---	capture			Silent	SNP	124370347	124370347	11373	9	G	A	A	38	38	OR1L8	A	1	1
KIAA1432	57589	broad.mit.edu	36	9	5703972	5703972	+	Missense_Mutation	SNP	A	G	G			TCGA-16-0849-01	TCGA-16-0849-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:5703972A>G	uc003zji.1	+	c.172A>G	c.(172-174)AAA>GAA	p.K58E	KIAA1432_uc003zjh.2_Missense_Mutation_p.K58E|KIAA1432_uc003zjj.1_5'UTR	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	137						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)										0.422018	152.030546	152.608652	46	63	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	5703972	5703972	8542	9	A	G	G	9	9	KIAA1432	G	4	4
MAGEA4	4103	broad.mit.edu	36	X	150843037	150843037	+	Missense_Mutation	SNP	G	A	A			TCGA-16-0849-01	TCGA-16-0849-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:150843037G>A	uc004fez.1	+	c.245G>A	c.(244-246)AGG>AAG	p.R82K	MAGEA4_uc004ffa.1_Missense_Mutation_p.R82K|MAGEA4_uc004ffb.1_Missense_Mutation_p.R82K|MAGEA4_uc004ffc.1_Missense_Mutation_p.R82K|MAGEA4_uc004ffd.1_Missense_Mutation_p.R82K|MAGEA4_uc010nth.1_Missense_Mutation_p.R82K	NM_002362	NP_002353	P43358	MAGA4_HUMAN	melanoma antigen family A, 4	82							protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)													0.157895	16.037075	22.402578	9	48	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	150843037	150843037	9547	23	G	A	A	35	35	MAGEA4	A	2	2
EP400	57634	broad.mit.edu	36	12	131128030	131128031	+	Frame_Shift_Ins	INS	-	A	A			TCGA-16-0849-01	TCGA-16-0849-01										Phase_I	Unspecified				Illumina GAIIx	g.chr12:131128030_131128031insA	uc001ujn.1	+	c.9231_9232insA	c.(9229-9234)GCGTCGfs	p.A3077fs	EP400_uc001ujl.1_Frame_Shift_Ins_p.A3076fs|EP400_uc001ujp.1_Frame_Shift_Ins_p.A287fs	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	3113_3114					histone H2A acetylation|histone H4 acetylation	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	131128030	131128031	5342	12	-	A	A	40	40	EP400	A	5	5
UNC13D	201294	broad.mit.edu	36	17	71350208	71350226	+	Frame_Shift_Del	DEL	TGCCGATGCCGGGACCCGG	-	-			TCGA-16-0849-01	TCGA-16-0849-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:71350208_71350226delTGCCGATGCCGGGACCCGG	uc002jpp.1	-	c.452_470delCCGGGTCCCGGCATCGGCA	c.(451-471)CCCGGGTCCCGGCATCGGCAGfs	p.P151fs	UNC13D_uc002jpq.1_5'UTR|UNC13D_uc010dgq.1_5'UTR	NM_199242	NP_954712	Q70J99	UN13D_HUMAN	unc-13 homolog D	151_157	C2 1.				positive regulation of exocytosis|regulation of mast cell degranulation	exocytic vesicle|late endosome|lysosome|membrane|recycling endosome	protein binding				0			all cancers(21;2.11e-06)|Epithelial(20;2.32e-06)|BRCA - Breast invasive adenocarcinoma(9;0.000618)|LUSC - Lung squamous cell carcinoma(166;0.154)											0.31			14	31				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	71350208	71350226	17545	17	TGCCGATGCCGGGACCCGG	-	-	55	55	UNC13D	-	5	5
C20orf94	128710	broad.mit.edu	36	20	10551648	10551665	+	In_Frame_Del	DEL	CAAAACAAAGTCCACGAG	-	-			TCGA-16-0849-01	TCGA-16-0849-01										Phase_I	Unspecified				Illumina GAIIx	g.chr20:10551648_10551665delCAAAACAAAGTCCACGAG	uc002wnv.1	+	c.848_865delCAAAACAAAGTCCACGAG	c.(847-867)CCAAAACAAAGTCCACGAGTG>CTG	p.283_289PKQSPRV>L		NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710	283_289							protein binding				0														0.40			14	21				---	---	---	---	capture_indel			In_Frame_Del	DEL	10551648	10551665	2201	20	CAAAACAAAGTCCACGAG	-	-	21	21	C20orf94	-	5	5
MARCH4	57574	broad.mit.edu	36	2	216943140	216943141	+	Frame_Shift_Ins	INS	-	G	G			TCGA-16-0849-01	TCGA-16-0849-01										Phase_I	Unspecified				Illumina GAIIx	g.chr2:216943140_216943141insG	uc002vgb.1	-	c.88_89insC	c.(88-90)CAGfs	p.Q30fs		NM_020814	NP_065865	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4	30						Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	216943140	216943141	9686	2	-	G	G	55	55	MARCH4	G	5	5
