Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	i_TCGAscape_Amplification_Peaks	i_TCGAscape_Deletion_Peaks	DrugBank	i_ACHILLES_Top_Genes	i_CCLE_ONCOMAP_overlapping_mutations	i_CCLE_ONCOMAP_total_mutations_in_gene	i_CCLE_SEQ_overlapping_mutations	i_CCLE_SEQ_total_mutations_in_gene	MUTSIG_Significant_Genes	OREGANNO_ID	OREGANNO_Values	i_tumor_f	i_init_t_lod	i_t_lod_fstar	i_t_alt_count	i_t_ref_count	i_normal_best_gt	i_failure_reasons	i_judgement	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	dataset	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	type	classification	start	end	gene	chr	ref_allele	tum_allele1	tum_allele2	context_orig	context65	gene_name	newbase	categ	categ_ignoring_null_categ
NRAP	4892	broad.mit.edu	36	10	115340372	115340372	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:115340372C>A	uc001lal.2	-	c.4911G>T	c.(4909-4911)CAG>CAT	p.Q1637H	NRAP_uc009xyb.1_Missense_Mutation_p.Q390H|NRAP_uc001laj.1_Missense_Mutation_p.Q1637H|NRAP_uc001lak.1_Missense_Mutation_p.Q1602H	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1637						fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)	9		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)										0.6	6.622428	6.666005	3	2	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	115340372	115340372	11043	10	C	A	A	28	28	NRAP	A	3	3
SVIL	6840	broad.mit.edu	36	10	29828178	29828178	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr10:29828178C>A	uc001iut.1	-	c.3537G>T	c.(3535-3537)GAG>GAT	p.E1179D	SVIL_uc001iuu.1_Missense_Mutation_p.E753D|SVIL_uc009xlc.1_5'Flank	NM_021738	NP_068506	O95425	SVIL_HUMAN	supervillin isoform 2	1179					cytoskeleton organization|skeletal muscle tissue development	cell junction|costamere|invadopodium|nucleus|podosome	actin filament binding			ovary(5)	5		Breast(68;0.103)												0.111475	36.839078	82.34549	34	271	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	29828178	29828178	15941	10	C	A	A	32	32	SVIL	A	3	3
VDAC2	7417	broad.mit.edu	36	10	76640943	76640943	+	Silent	SNP	T	A	A			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr10:76640943T>A	uc001jwz.1	+	c.21T>A	c.(19-21)ACT>ACA	p.T7T	VDAC2_uc001jxa.1_De_novo_Start_OutOfFrame	NM_003375	NP_003366	P45880	VDAC2_HUMAN	voltage-dependent anion channel 2	7						mitochondrial nucleoid|mitochondrial outer membrane|pore complex	nucleotide binding|porin activity|protein binding|voltage-gated anion channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.0642)|all_epithelial(25;0.00604)|Prostate(51;0.0112)|Ovarian(15;0.183)				Dihydroxyaluminium(DB01375)									0.357143	9.260982	9.516699	5	9	TT		KEEP	---	---	---	---	capture			Silent	SNP	76640943	76640943	17714	10	T	A	A	56	56	VDAC2	A	4	4
CRTAC1	55118	broad.mit.edu	36	10	99667300	99667301	+	Missense_Mutation	DNP	CC	TT	TT			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:99667300_99667301CC>TT	uc001kou.1	-	c.661_662GG>AA	c.(661-663)GGC>AAC	p.G221N	CRTAC1_uc001kov.2_Missense_Mutation_p.G210N|CRTAC1_uc001kot.1_Missense_Mutation_p.G11N	NM_018058	NP_060528	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	221						proteinaceous extracellular matrix	calcium ion binding			ovary(4)|pancreas(1)	5		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)										0.368421	13.995432	14.293428	7	12	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	99667300	99667301	4035	10	CC	TT	TT	26	26	CRTAC1	TT	2	2
USP28	57646	broad.mit.edu	36	11	113175312	113175312	+	Silent	SNP	T	G	G			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr11:113175312T>G	uc001poh.1	-	c.3094A>C	c.(3094-3096)AGA>CGA	p.R1032R	USP28_uc001poi.1_Silent_p.R355R|USP28_uc001pog.1_Silent_p.R708R	NM_020886	NP_065937	Q96RU2	UBP28_HUMAN	ubiquitin specific protease 28	1032					cell proliferation|DNA damage checkpoint|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA repair|protein deubiquitination|response to ionizing radiation|ubiquitin-dependent protein catabolic process	nucleolus|nucleoplasm	protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			breast(2)|ovary(1)|large_intestine(1)|kidney(1)	5		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)								0.131579	16.105961	26.124354	10	66	TT		KEEP	---	---	---	---	capture			Silent	SNP	113175312	113175312	17622	11	T	G	G	55	55	USP28	G	4	4
PATE1	160065	broad.mit.edu	36	11	125122847	125122847	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:125122847C>T	uc001qct.1	+	c.167C>T	c.(166-168)CCA>CTA	p.P56L	PATE1_uc009zbr.1_Missense_Mutation_p.P44L	NM_138294	NP_612151	Q8WXA2	PATE1_HUMAN	expressed in prostate and testis	56						extracellular region					0														0.280435	334.090376	354.099243	129	331	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	125122847	125122847	11890	11	C	T	T	21	21	PATE1	T	2	2
NAV2	89797	broad.mit.edu	36	11	20092877	20092877	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:20092877G>A	uc009yhw.1	+	c.7301G>A	c.(7300-7302)AGC>AAC	p.S2434N	NAV2_uc001mpp.1_Missense_Mutation_p.S2311N|NAV2_uc001mpr.2_Missense_Mutation_p.S2378N|NAV2_uc009yhx.1_Missense_Mutation_p.S1439N|NAV2_uc009yhz.1_Missense_Mutation_p.S1020N|NAV2_uc001mpu.1_Missense_Mutation_p.S813N|NAV2_uc001mpv.1_Missense_Mutation_p.S137N	NM_182964	NP_892009	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 1	2434						nucleus	ATP binding|helicase activity			ovary(1)|pancreas(1)	2														0.511628	62.04139	62.04632	22	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20092877	20092877	10580	11	G	A	A	34	34	NAV2	A	2	2
SLC6A5	9152	broad.mit.edu	36	11	20630516	20630516	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr11:20630516G>A	uc001mqd.1	+	c.2176G>A	c.(2176-2178)GTC>ATC	p.V726I	SLC6A5_uc009yic.1_Missense_Mutation_p.V491I	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	726	Helical; Name=12; (Potential).				synaptic transmission	integral to plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)	3					Glycine(DB00145)									0.657534	459.896106	464.687228	144	75	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	20630516	20630516	15184	11	G	A	A	40	40	SLC6A5	A	1	1
SLC17A6	57084	broad.mit.edu	36	11	22354135	22354135	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:22354135C>T	uc001mqk.1	+	c.1206C>T	c.(1204-1206)GTC>GTT	p.V402V		NM_020346	NP_065079	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (sodium-dependent	402	Helical; (Potential).				sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)|breast(1)	4														0.309091	101.01251	104.583041	34	76	CC		KEEP	---	---	---	---	capture			Silent	SNP	22354135	22354135	14917	11	C	T	T	31	31	SLC17A6	T	1	1
ANO3	63982	broad.mit.edu	36	11	26576552	26576552	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:26576552C>T	uc001mqt.2	+	c.1512C>T	c.(1510-1512)ATC>ATT	p.I504I		NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	504	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4														0.217391	38.590411	43.669457	15	54	CC		KEEP	---	---	---	---	capture			Silent	SNP	26576552	26576552	706	11	C	T	T	31	31	ANO3	T	1	1
AGBL2	79841	broad.mit.edu	36	11	47645086	47645086	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:47645086C>A	uc001ngg.1	-	c.2446G>T	c.(2446-2448)GAG>TAG	p.E816*	AGBL2_uc001ngf.1_Non-coding_Transcript	NM_024783	NP_079059	Q5U5Z8	CBPC2_HUMAN	carboxypeptidase 2, cytosolic	816					proteolysis	cytosol	metallocarboxypeptidase activity|zinc ion binding			ovary(2)	2														0.333333	8.257576	8.63281	5	10	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	47645086	47645086	378	11	C	A	A	29	29	AGBL2	A	5	3
LRRC55	219527	broad.mit.edu	36	11	56711495	56711495	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:56711495C>T	uc001njl.1	+	c.991C>T	c.(991-993)CGC>TGC	p.R331C	LRRC55_uc001njm.1_5'Flank	NM_001005210	NP_001005210	Q6ZSA7	LRC55_HUMAN	leucine rich repeat containing 55	301						integral to membrane					0														0.176471	20.574643	25.58076	9	42	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56711495	56711495	9386	11	C	T	T	23	23	LRRC55	T	1	1
C11orf66	220004	broad.mit.edu	36	11	61006439	61006439	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:61006439C>A	uc001nru.1	+	c.190C>A	c.(190-192)CAA>AAA	p.Q64K	C11orf66_uc009ynq.1_Missense_Mutation_p.Q64K	NM_145017	NP_659454	Q7Z5V6	CK066_HUMAN	IIIG9 protein	64										ovary(1)	1												OREG0021002	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.24	6.790534	8.390523	6	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	61006439	61006439	1695	11	C	A	A	21	21	C11orf66	A	3	3
OR2D2	120776	broad.mit.edu	36	11	6870220	6870220	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:6870220C>T	uc001mew.1	-	c.88G>A	c.(88-90)GTA>ATA	p.V30I		NM_003700	NP_003691	Q9H210	OR2D2_HUMAN	olfactory receptor, family 2, subfamily D,	30	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)										0.336601	290.12421	297.354311	103	203	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	6870220	6870220	11400	11	C	T	T	19	19	OR2D2	T	1	1
TYR	7299	broad.mit.edu	36	11	88551548	88551548	+	Missense_Mutation	SNP	C	A	A	rs11826502	by-hapmap	TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr11:88551548C>A	uc001pcs.1	+	c.779C>A	c.(778-780)CCT>CAT	p.P260H		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	260	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|oxidation-reduction process|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)									0.308511	85.241409	88.312665	29	65	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88551548	88551548	17370	11	C	A	A	24	24	TYR	A	3	3
GCN1L1	10985	broad.mit.edu	36	12	119064721	119064721	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:119064721C>T	uc001txo.1	-	c.5802G>A	c.(5800-5802)CTG>CTA	p.L1934L		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1934	HEAT 15.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(3)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)													0.686567	155.077333	157.160805	46	21	CC		KEEP	---	---	---	---	capture			Silent	SNP	119064721	119064721	6565	12	C	T	T	21	21	GCN1L1	T	2	2
STX2	2054	broad.mit.edu	36	12	129849067	129849067	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:129849067C>T	uc001uio.1	-	c.742G>A	c.(742-744)GAA>AAA	p.E248K	STX2_uc001uip.1_Missense_Mutation_p.E248K|STX2_uc001uiq.1_Missense_Mutation_p.E248K	NM_194356	NP_919337	P32856	STX2_HUMAN	syntaxin 2 isoform 2	248	t-SNARE coiled-coil homology.|Cytoplasmic (Potential).				acrosome reaction|ectoderm development|intracellular protein transport|organ morphogenesis|signal transduction	basolateral plasma membrane|integral to membrane|microsome|soluble fraction	calcium-dependent protein binding|SNAP receptor activity				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)										0.216216	270.732646	309.215053	112	406	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129849067	129849067	15865	12	C	T	T	32	32	STX2	T	2	2
IQSEC3	440073	broad.mit.edu	36	12	141466	141466	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:141466G>A	uc001qhw.1	+	c.1648G>A	c.(1648-1650)GAG>AAG	p.E550K	IQSEC3_uc001qhu.1_Missense_Mutation_p.E550K	NM_015232	NP_056047	Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3	853	PH.				regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity			central_nervous_system(2)|large_intestine(1)	3	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)										0.166667	18.848542	24.5316	9	45	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	141466	141466	8122	12	G	A	A	41	41	IQSEC3	A	2	2
STRAP	11171	broad.mit.edu	36	12	15934849	15934849	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:15934849G>A	uc001rdc.2	+	c.382G>A	c.(382-384)GAC>AAC	p.D128N	STRAP_uc001rdd.2_Missense_Mutation_p.D34N	NM_007178	NP_009109	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated	128	WD 3.				mRNA processing|RNA splicing	cell junction|mitochondrion|spliceosomal complex	identical protein binding				0		Hepatocellular(102;0.121)												0.440678	83.842536	84.02315	26	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15934849	15934849	15846	12	G	A	A	45	45	STRAP	A	2	2
PKP2	5318	broad.mit.edu	36	12	32840433	32840433	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr12:32840433A>G	uc001rlj.2	-	c.2366T>C	c.(2365-2367)ATT>ACT	p.I789T	PKP2_uc001rlk.2_Missense_Mutation_p.I745T	NM_004572	NP_004563	Q99959	PKP2_HUMAN	plakophilin 2 isoform 2b	789	ARM 7.				cell-cell adhesion	desmosome|integral to membrane|nucleus	binding			ovary(1)|pancreas(1)	2	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)													0.222222	28.969856	32.806265	12	42	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	32840433	32840433	12410	12	A	G	G	4	4	PKP2	G	4	4
KDM5A	5927	broad.mit.edu	36	12	345465	345465	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:345465G>A	uc001qif.1	-	c.433C>T	c.(433-435)CGC>TGC	p.R145C	KDM5A_uc001qie.1_Missense_Mutation_p.R145C	NM_001042603	NP_001036068	P29375	KDM5A_HUMAN	retinoblastoma binding protein 2 isoform 1	145	ARID.				chromatin modification|multicellular organismal development|oxidation-reduction process|positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|sequence-specific DNA binding transcription factor activity|transcription activator activity|zinc ion binding			skin(2)|ovary(1)	3										958				0.3125	74.254226	76.753521	25	55	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	345465	345465	8439	12	G	A	A	37	37	KDM5A	A	1	1
SPATS2	65244	broad.mit.edu	36	12	48174838	48174838	+	Missense_Mutation	SNP	C	G	G			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr12:48174838C>G	uc001rud.2	+	c.312C>G	c.(310-312)AAC>AAG	p.N104K	SPATS2_uc001rue.2_Non-coding_Transcript|SPATS2_uc009zli.1_Missense_Mutation_p.N104K|SPATS2_uc001ruf.2_Missense_Mutation_p.N104K|SPATS2_uc001rug.2_Missense_Mutation_p.N104K	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	104						cytoplasm				breast(1)	1														0.208333	6.454676	8.355977	5	19	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48174838	48174838	15529	12	C	G	G	19	19	SPATS2	G	3	3
NAB2	4665	broad.mit.edu	36	12	55771284	55771284	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:55771284G>A	uc001smz.1	+	c.193G>A	c.(193-195)GGA>AGA	p.G65R		NM_005967	NP_005958	Q15742	NAB2_HUMAN	NGFI-A binding protein 2	65	NCD1.				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	transcription corepressor activity|transcription repressor activity			ovary(1)	1														0.193548	14.234165	16.949287	6	25	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55771284	55771284	10527	12	G	A	A	43	43	NAB2	A	2	2
TRHDE	29953	broad.mit.edu	36	12	71255425	71255425	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:71255425G>A	uc001sxa.1	+	c.2120G>A	c.(2119-2121)CGG>CAG	p.R707Q		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	707	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)	2														0.238095	26.530549	29.161213	10	32	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	71255425	71255425	17023	12	G	A	A	39	39	TRHDE	A	1	1
GLIPR1	11010	broad.mit.edu	36	12	74161880	74161880	+	Splice_Site_SNP	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr12:74161880G>A	uc001sxs.1	+	c.e2_splice_site			GLIPR1_uc009zsb.1_Splice_Site_SNP	NM_006851	NP_006842			GLI pathogenesis-related 1 precursor						cellular lipid metabolic process	extracellular region|integral to membrane				large_intestine(1)|ovary(1)	2														0.292105	303.481373	318.187058	111	269	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	74161880	74161880	6709	12	G	A	A	33	33	GLIPR1	A	5	2
FREM2	341640	broad.mit.edu	36	13	38162221	38162221	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr13:38162221T>C	uc001uwv.1	+	c.2740T>C	c.(2740-2742)TGC>CGC	p.C914R		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2	914	CSPG 5.|Extracellular (Potential).				cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|pancreas(1)	10		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)										0.206897	10.536641	12.845847	6	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38162221	38162221	6292	13	T	C	C	55	55	FREM2	C	4	4
MYH6	4624	broad.mit.edu	36	14	22927925	22927925	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr14:22927925C>A	uc001wjv.2	-	c.4158G>T	c.(4156-4158)GAG>GAT	p.E1386D	MIR208A_hsa-mir-208a|MI0000251_5'Flank	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1386	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)	3	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)										0.225	24.256947	27.033688	9	31	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	22927925	22927925	10433	14	C	A	A	24	24	MYH6	A	3	3
IRF9	10379	broad.mit.edu	36	14	23702427	23702427	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:23702427G>T	uc001wmq.1	+	c.365G>T	c.(364-366)GGC>GTC	p.G122V	RNF31_uc001wmp.1_Non-coding_Transcript|IRF9_uc010ali.1_Missense_Mutation_p.G122V|IRF9_uc010alj.1_Missense_Mutation_p.G20V	NM_006084	NP_006075	Q00978	IRF9_HUMAN	interferon-stimulated transcription factor 3,	122					interferon-gamma-mediated signaling pathway|regulation of transcription, DNA-dependent|response to virus|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|nucleoplasm	DNA binding|identical protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				GBM - Glioblastoma multiforme(265;0.00853)										0.089701	7.3307	58.471889	27	274	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23702427	23702427	8140	14	G	T	T	42	42	IRF9	T	3	3
PAX9	5083	broad.mit.edu	36	14	36202480	36202480	+	Splice_Site_SNP	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr14:36202480G>A	uc001wty.2	+	c.e3_splice_site			PAX9_uc010amq.1_5'Flank	NM_006194	NP_006185			paired box 9						multicellular organismal development|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|transcription repressor activity			ovary(1)|central_nervous_system(1)	2	Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)|Breast(36;0.218)		Lung(8;1.12e-09)|LUAD - Lung adenocarcinoma(9;2.16e-07)|Epithelial(34;0.00357)|all cancers(34;0.00998)|LUSC - Lung squamous cell carcinoma(13;0.0189)	GBM - Glioblastoma multiforme(112;0.0181)										0.217391	6.560473	8.261239	5	18	GG		KEEP	---	---	---	---	capture			Splice_Site_SNP	SNP	36202480	36202480	11906	14	G	A	A	44	44	PAX9	A	5	2
UBE3A	7337	broad.mit.edu	36	15	23168037	23168037	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:23168037G>T	uc001zaq.1	-	c.386C>A	c.(385-387)ACA>AAA	p.T129K	UBE3A_uc001zar.1_Missense_Mutation_p.T106K|UBE3A_uc001zas.1_Missense_Mutation_p.T126K|UBE3A_uc001zat.1_Missense_Mutation_p.T106K	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	129					brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity				0		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)										0.131579	7.551557	12.563305	5	33	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	23168037	23168037	17437	15	G	T	T	48	48	UBE3A	T	3	3
INO80	54617	broad.mit.edu	36	15	39126975	39126975	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:39126975G>T	uc001zni.1	-	c.2658C>A	c.(2656-2658)AGC>AGA	p.S886R		NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1	886					chromatin remodeling	nucleus	ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)	3														0.166667	6.755235	11.843064	8	40	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	39126975	39126975	8047	15	G	T	T	34	34	INO80	T	3	3
CLN6	54982	broad.mit.edu	36	15	66291127	66291127	+	Nonsense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:66291127G>T	uc002arf.1	-	c.426C>A	c.(424-426)TAC>TAA	p.Y142*		NM_017882	NP_060352	Q9NWW5	CLN6_HUMAN	CLN6 protein	142					cell death|cholesterol metabolic process|ganglioside metabolic process|glycosaminoglycan metabolic process|lysosomal lumen acidification|positive regulation of proteolysis|protein catabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	protein homodimerization activity				0														0.181818	6.330193	8.391911	4	18	GG		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	66291127	66291127	3683	15	G	T	T	44	44	CLN6	T	5	3
LRRC49	54839	broad.mit.edu	36	15	68980331	68980331	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:68980331G>A	uc002asw.1	+	c.210G>A	c.(208-210)TTG>TTA	p.L70L	LRRC49_uc002asu.1_Silent_p.L60L|LRRC49_uc002asx.1_Silent_p.L26L|LRRC49_uc002asy.1_5'UTR|LRRC49_uc002asz.1_Silent_p.L42L	NM_017691	NP_060161	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	70						cytoplasm|microtubule				ovary(1)	1														0.327273	49.729671	51.18584	18	37	GG		KEEP	---	---	---	---	capture			Silent	SNP	68980331	68980331	9381	15	G	A	A	47	47	LRRC49	A	2	2
ARID3B	10620	broad.mit.edu	36	15	72670954	72670954	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr15:72670954G>A	uc002aye.1	+	c.1166G>A	c.(1165-1167)GGT>GAT	p.G389D	ARID3B_uc002ayd.1_Missense_Mutation_p.G389D|ARID3B_uc010bjs.1_Missense_Mutation_p.G94D	NM_006465	NP_006456	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B	389					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding				0														0.666667	12.200808	12.348048	4	2	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	72670954	72670954	932	15	G	A	A	44	44	ARID3B	A	2	2
ZNF774	342132	broad.mit.edu	36	15	88705169	88705169	+	Missense_Mutation	SNP	A	T	T			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr15:88705169A>T	uc002bpk.2	+	c.1102A>T	c.(1102-1104)ACA>TCA	p.T368S		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	368	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)											0.1875	6.32407	9.265172	6	26	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	88705169	88705169	18745	15	A	T	T	2	2	ZNF774	T	4	4
ERN2	10595	broad.mit.edu	36	16	23625875	23625875	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:23625875C>T	uc002dma.2	-	c.477G>A	c.(475-477)CTG>CTA	p.L159L	ERN2_uc010bxp.1_Silent_p.L159L|ERN2_uc010bxq.1_5'UTR	NM_033266	NP_150296	Q76MJ5	ERN2_HUMAN	endoplasmic reticulum to nucleus signalling 2	111	Lumenal (Potential).				apoptosis|induction of apoptosis|mRNA processing|negative regulation of transcription, DNA-dependent|protein phosphorylation|rRNA catabolic process|transcription, DNA-dependent	endoplasmic reticulum membrane|integral to membrane	ATP binding|endoribonuclease activity, producing 5'-phosphomonoesters|magnesium ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)						225				0.129213	33.436183	57.235549	23	155	CC		KEEP	---	---	---	---	capture			Silent	SNP	23625875	23625875	5431	16	C	T	T	21	21	ERN2	T	2	2
C16orf93	90835	broad.mit.edu	36	16	30679160	30679160	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:30679160C>T	uc002dzn.1	-	c.415G>A	c.(415-417)GAG>AAG	p.E139K	C16orf93_uc002dzm.1_Missense_Mutation_p.E139K|C16orf93_uc002dzo.1_Missense_Mutation_p.E102K|C16orf93_uc002dzp.2_Missense_Mutation_p.E139K|RNF40_uc002dzq.1_5'Flank|RNF40_uc010caa.1_5'Flank|RNF40_uc010cab.1_5'Flank|RNF40_uc002dzr.1_5'Flank	NM_001014979	NP_001014979	A1A4V9	CP093_HUMAN	hypothetical protein LOC90835	139											0														0.139535	8.831874	14.222018	6	37	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30679160	30679160	1899	16	C	T	T	30	30	C16orf93	T	2	2
ZNF213	7760	broad.mit.edu	36	16	3131257	3131257	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:3131257G>T	uc010btg.1	+	c.1288G>T	c.(1288-1290)GGC>TGC	p.G430C	ZNF213_uc002cud.1_Non-coding_Transcript|ZNF213_uc010btf.1_3'UTR|ZNF213_uc010bth.1_Missense_Mutation_p.G430C	NM_004220	NP_004211	O14771	ZN213_HUMAN	zinc finger protein 213	430	C2H2-type 5.				regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0														0.333333	6.42013	6.642472	3	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	3131257	3131257	18360	16	G	T	T	39	39	ZNF213	T	3	3
MGRN1	23295	broad.mit.edu	36	16	4655138	4655138	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4655138G>A	uc002cxb.1	+	c.663G>A	c.(661-663)TTG>TTA	p.L221L	MGRN1_uc002cwz.1_Silent_p.L221L|MGRN1_uc010btw.1_Silent_p.L222L|MGRN1_uc002cxa.1_Silent_p.L221L|MGRN1_uc010btx.1_Silent_p.L222L	NM_015246	NP_056061	O60291	MGRN1_HUMAN	mahogunin, ring finger 1 isoform 1	221					endosome to lysosome transport|negative regulation of cAMP-mediated signaling|negative regulation of G-protein coupled receptor protein signaling pathway|protein monoubiquitination	cytosol|early endosome|nucleus|plasma membrane|plasma membrane	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1														0.142857	9.055514	13.354641	5	30	GG		KEEP	---	---	---	---	capture			Silent	SNP	4655138	4655138	9949	16	G	A	A	47	47	MGRN1	A	2	2
ZNF500	26048	broad.mit.edu	36	16	4742680	4742680	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr16:4742680A>C	uc002cxp.1	-	c.1141T>G	c.(1141-1143)TAC>GAC	p.Y381D	ZNF500_uc002cxo.1_Missense_Mutation_p.Y173D	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	381	C2H2-type 3.				regulation of transcription, DNA-dependent|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2														0.363636	7.190147	7.372516	4	7	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	4742680	4742680	18542	16	A	C	C	15	15	ZNF500	C	4	4
NUP93	9688	broad.mit.edu	36	16	55433183	55433183	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:55433183G>C	uc002eka.1	+	c.2286G>C	c.(2284-2286)AGG>AGC	p.R762S	NUP93_uc002ekb.1_Missense_Mutation_p.R639S	NM_014669	NP_055484	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	762					carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(1)|lung(1)	2						Colon(33;610 796 1305 1705 38917)								0.128571	9.637523	28.51174	18	122	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55433183	55433183	11177	16	G	C	C	42	42	NUP93	C	3	3
CTCF	10664	broad.mit.edu	36	16	66202830	66202830	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:66202830G>A	uc002etl.1	+	c.594G>A	c.(592-594)CAG>CAA	p.Q198Q	CTCF_uc010cek.1_Intron	NM_006565	NP_006556	P49711	CTCF_HUMAN	CCCTC-binding factor	198					chromatin modification|chromosome segregation|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|regulation of centromeric sister chromatid cohesion|regulation of molecular function, epigenetic	chromosome, centromeric region|condensed chromosome|nucleolus|nucleoplasm	chromatin insulator sequence binding|promoter binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		Colon(175;1200 1966 6945 23069 27405)								0.314286	31.110983	32.185952	11	24	GG		KEEP	---	---	---	---	capture			Silent	SNP	66202830	66202830	4159	16	G	A	A	34	34	CTCF	A	2	2
MSLNL	401827	broad.mit.edu	36	16	763177	763177	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr16:763177G>C	uc002cjz.1	-	c.2092C>G	c.(2092-2094)CTG>GTG	p.L698V		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	347	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4														0.333333	9.262719	9.635373	5	10	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	763177	763177	10275	16	G	C	C	35	35	MSLNL	C	3	3
IL17C	27189	broad.mit.edu	36	16	87233937	87233937	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr16:87233937C>T	uc002fla.1	+	c.550C>T	c.(550-552)CAC>TAC	p.H184Y		NM_013278	NP_037410	Q9P0M4	IL17C_HUMAN	interleukin 17C	184					cell surface receptor linked signaling pathway|cell-cell signaling|inflammatory response	extracellular space|soluble fraction	cytokine activity				0				BRCA - Breast invasive adenocarcinoma(80;0.0477)										0.2	12.569198	14.655236	5	20	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	87233937	87233937	7937	16	C	T	T	21	21	IL17C	T	2	2
ZZEF1	23140	broad.mit.edu	36	17	3859731	3859731	+	Silent	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr17:3859731A>G	uc002fxe.1	-	c.8649T>C	c.(8647-8649)TTT>TTC	p.F2883F	ZZEF1_uc002fxg.1_Silent_p.F204F	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1	2883					regulation of mitotic metaphase/anaphase transition	anaphase-promoting complex	calcium ion binding|zinc ion binding			ovary(1)|pancreas(1)	2														0.263158	8.462163	9.430251	5	14	AA		KEEP	---	---	---	---	capture			Silent	SNP	3859731	3859731	18861	17	A	G	G	5	5	ZZEF1	G	4	4
NXN	64359	broad.mit.edu	36	17	669447	669447	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr17:669447G>A	uc002fsa.1	-	c.802C>T	c.(802-804)CGG>TGG	p.R268W	NXN_uc002fry.1_Missense_Mutation_p.R19W|NXN_uc002frz.1_Missense_Mutation_p.R19W|NXN_uc002fsb.1_Missense_Mutation_p.R155W	NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin	268	Thioredoxin.				cell differentiation|cell redox homeostasis|multicellular organismal development|oxidation-reduction process|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)										0.925651	818.160948	854.317247	249	20	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	669447	669447	11192	17	G	A	A	39	39	NXN	A	1	1
DCC	1630	broad.mit.edu	36	18	48988142	48988142	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr18:48988142G>A	uc002lfe.1	+	c.1818G>A	c.(1816-1818)CCG>CCA	p.P606P	DCC_uc010dpf.1_Silent_p.P261P	NM_005215	NP_005206	P43146	DCC_HUMAN	deleted in colorectal carcinoma	606	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis	cytosol|integral to membrane				ovary(6)|large_intestine(1)|central_nervous_system(1)|skin(1)	9		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)										0.173913	28.765673	35.683169	12	57	GG		KEEP	---	---	---	---	capture			Silent	SNP	48988142	48988142	4453	18	G	A	A	39	39	DCC	A	1	1
SYDE1	85360	broad.mit.edu	36	19	15085506	15085506	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15085506C>T	uc002nah.1	+	c.1940C>T	c.(1939-1941)CCG>CTG	p.P647L	SYDE1_uc002nai.1_Missense_Mutation_p.P580L|SYDE1_uc002naj.1_Missense_Mutation_p.P304L	NM_033025	NP_149014	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1	647					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|pancreas(1)	2														0.444444	7.296089	7.320065	4	5	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15085506	15085506	15956	19	C	T	T	23	23	SYDE1	T	1	1
CYP4F11	57834	broad.mit.edu	36	19	15885598	15885598	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:15885598G>A	uc002nbu.2	-	c.1519C>T	c.(1519-1521)CGC>TGC	p.R507C	CYP4F11_uc010eab.1_3'UTR|CYP4F11_uc002nbt.2_Missense_Mutation_p.R507C	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	507					inflammatory response|oxidation-reduction process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1														0.194444	14.107514	17.241853	7	29	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	15885598	15885598	4351	19	G	A	A	38	38	CYP4F11	A	1	1
USF2	7392	broad.mit.edu	36	19	40453287	40453287	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:40453287G>C	uc002nyq.1	+	c.527G>C	c.(526-528)GGA>GCA	p.G176A	USF2_uc002nyr.1_Missense_Mutation_p.G109A|USF2_uc002nys.1_5'UTR|USF2_uc002nyt.1_Intron|USF2_uc002nyu.1_5'UTR|USF2_uc002nyv.1_5'UTR	NM_003367	NP_003358	Q15853	USF2_HUMAN	upstream stimulatory factor 2 isoform 1	176					late viral mRNA transcription|lipid homeostasis|positive regulation of gene-specific transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter by glucose	nucleus	bHLH transcription factor binding|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity				0	all_lung(56;2.37e-08)|Lung NSC(56;3.66e-08)|Esophageal squamous(110;0.162)		Epithelial(14;7.4e-20)|OV - Ovarian serous cystadenocarcinoma(14;6.47e-19)|all cancers(14;4.17e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			NSCLC(103;173 2832 8890)								0.555556	13.374353	13.39844	5	4	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40453287	40453287	17595	19	G	C	C	41	41	USF2	C	3	3
ZNF221	7638	broad.mit.edu	36	19	49163081	49163081	+	Silent	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:49163081T>C	uc002oxx.2	+	c.1587T>C	c.(1585-1587)ACT>ACC	p.T529T	ZNF221_uc010ejb.1_Silent_p.T529T	NM_013359	NP_037491	Q9UK13	ZN221_HUMAN	zinc finger protein 221	529					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0352)												0.160714	53.820021	72.228373	27	141	TT		KEEP	---	---	---	---	capture			Silent	SNP	49163081	49163081	18366	19	T	C	C	55	55	ZNF221	C	4	4
SIGLEC8	27181	broad.mit.edu	36	19	56647531	56647531	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr19:56647531C>T	uc002pwt.1	-	c.1414G>A	c.(1414-1416)GAG>AAG	p.E472K	SIGLEC8_uc010eox.1_Missense_Mutation_p.E379K|SIGLEC8_uc002pwu.2_Intron	NM_014442	NP_055257	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	472	Cytoplasmic (Potential).|SLAM-like motif.				cell adhesion	integral to membrane	sugar binding|transmembrane receptor activity			ovary(2)|kidney(1)|central_nervous_system(1)	4		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)										0.817204	2036.957348	2107.359317	608	136	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	56647531	56647531	14809	19	C	T	T	30	30	SIGLEC8	T	2	2
LENG8	114823	broad.mit.edu	36	19	59659833	59659833	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr19:59659833T>C	uc002qfw.1	+	c.1652T>C	c.(1651-1653)GTG>GCG	p.V551A	LENG8_uc002qfv.1_Missense_Mutation_p.V514A	NM_052925	NP_443157	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster member 8	514							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)										0.5	12.786573	12.786573	7	7	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	59659833	59659833	9048	19	T	C	C	59	59	LENG8	C	4	4
PTPRH	5794	broad.mit.edu	36	19	60388804	60388804	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr19:60388804G>A	uc002qjq.1	-	c.2940C>T	c.(2938-2940)CAC>CAT	p.H980H	PTPRH_uc010esv.1_Silent_p.H802H	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	980	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)	3		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)										0.147059	8.255039	12.323008	5	29	GG		KEEP	---	---	---	---	capture			Silent	SNP	60388804	60388804	13260	19	G	A	A	36	36	PTPRH	A	2	2
COL11A1	1301	broad.mit.edu	36	1	103136917	103136917	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:103136917C>T	uc001dum.1	-	c.4177G>A	c.(4177-4179)GGG>AGG	p.G1393R	COL11A1_uc001duk.1_Missense_Mutation_p.G577R|COL11A1_uc001dul.1_Missense_Mutation_p.G1381R|COL11A1_uc001dun.1_Missense_Mutation_p.G1342R|COL11A1_uc009weh.1_Missense_Mutation_p.G1265R	NM_080629	NP_542196	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform B	1381	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|central_nervous_system(1)|pancreas(1)	11		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)										0.272727	21.222819	22.722461	9	24	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103136917	103136917	3805	1	C	T	T	22	22	COL11A1	T	2	2
VPS13D	55187	broad.mit.edu	36	1	12265442	12265442	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12265442A>C	uc001atv.1	+	c.4696A>C	c.(4696-4698)ACC>CCC	p.T1566P	VPS13D_uc001atw.1_Missense_Mutation_p.T1566P|VPS13D_uc001atx.1_Missense_Mutation_p.T754P	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	1566					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)										0.186667	16.700677	23.625254	14	61	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	12265442	12265442	17759	1	A	C	C	14	14	VPS13D	C	4	4
PRAMEF2	65122	broad.mit.edu	36	1	12842585	12842585	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:12842585G>A	uc001aum.1	+	c.738G>A	c.(736-738)ACG>ACA	p.T246T		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	246											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)										0.43038	414.760257	416.091651	136	180	GG		KEEP	---	---	---	---	capture			Silent	SNP	12842585	12842585	12872	1	G	A	A	40	40	PRAMEF2	A	1	1
OTUD7B	56957	broad.mit.edu	36	1	148183344	148183344	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:148183344C>A	uc001etn.1	-	c.1568G>T	c.(1567-1569)GGC>GTC	p.G523V		NM_020205	NP_064590	Q6GQQ9	OTU7B_HUMAN	zinc finger protein Cezanne	523					negative regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|microtubule cytoskeleton|nucleus	cysteine-type peptidase activity|DNA binding|protein binding|zinc ion binding				0	Breast(34;0.0009)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.247)											0.137725	64.359885	106.733922	46	288	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	148183344	148183344	11732	1	C	A	A	26	26	OTUD7B	A	3	3
TOR1AIP1	26092	broad.mit.edu	36	1	178118456	178118456	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:178118456G>C	uc001gnq.1	+	c.196G>C	c.(196-198)GTG>CTG	p.V66L	TOR1AIP1_uc001gnp.1_Missense_Mutation_p.V66L	NM_015602	NP_056417	Q5JTV8	TOIP1_HUMAN	lamina-associated polypeptide 1B	66	Nuclear (Potential).					integral to membrane|nuclear inner membrane				breast(1)|central_nervous_system(1)	2														0.5	6.567097	6.567097	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	178118456	178118456	16914	1	G	C	C	36	36	TOR1AIP1	C	3	3
CR2	1380	broad.mit.edu	36	1	205713838	205713838	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:205713838C>T	uc001hfv.1	+	c.2225C>T	c.(2224-2226)ACG>ATG	p.T742M	CR2_uc001hfw.1_Missense_Mutation_p.T683M|CR2_uc009xch.1_Missense_Mutation_p.T683M	NM_001006658	NP_001006659	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus)	814	Sushi 13.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to membrane|plasma membrane	complement receptor activity|protein homodimerization activity			upper_aerodigestive_tract(1)|urinary_tract(1)|ovary(1)	3														0.359375	139.328264	141.550805	46	82	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	205713838	205713838	3981	1	C	T	T	19	19	CR2	T	1	1
COL16A1	1307	broad.mit.edu	36	1	31903776	31903776	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:31903776G>A	uc001btk.1	-	c.3487C>T	c.(3487-3489)CCA>TCA	p.P1163S	COL16A1_uc001bti.1_5'UTR|COL16A1_uc001btj.1_Missense_Mutation_p.P961S	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	1163	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		Colon(143;498 1786 21362 25193 36625)								0.338983	51.167603	52.526861	20	39	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	31903776	31903776	3811	1	G	A	A	43	43	COL16A1	A	2	2
RLF	6018	broad.mit.edu	36	1	40475396	40475396	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr1:40475396A>G	uc001cfc.2	+	c.2435A>G	c.(2434-2436)TAT>TGT	p.Y812C	RLF_uc001cfd.2_Missense_Mutation_p.Y503C	NM_012421	NP_036553	Q13129	RLF_HUMAN	rearranged L-myc fusion	812	C2H2-type 6.				chromosome organization|DNA integration|DNA mediated transformation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|protein binding|transcription activator activity|zinc ion binding			ovary(2)|pancreas(1)	3	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)											0.589744	151.458367	152.00865	46	32	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	40475396	40475396	13866	1	A	G	G	16	16	RLF	G	4	4
KIAA0467	23334	broad.mit.edu	36	1	43675453	43675453	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:43675453C>T	uc001cjk.1	+	c.3362C>T	c.(3361-3363)GCG>GTG	p.A1121V		NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	2020						peroxisome				breast(6)|ovary(4)|pancreas(1)	11	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)												0.548023	297.06386	297.417998	97	80	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	43675453	43675453	8485	1	C	T	T	27	27	KIAA0467	T	1	1
MUTYH	4595	broad.mit.edu	36	1	45567576	45567576	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:45567576C>T	uc009vxp.1	-	c.1639G>A	c.(1639-1641)GCA>ACA	p.A547T	MUTYH_uc009vxn.1_Missense_Mutation_p.A369T|MUTYH_uc001cnf.1_Missense_Mutation_p.A519T|MUTYH_uc009vxo.1_Missense_Mutation_p.A519T|MUTYH_uc001cng.1_Missense_Mutation_p.A530T|MUTYH_uc001cnj.1_Missense_Mutation_p.A427T|MUTYH_uc001cni.1_Missense_Mutation_p.A519T|MUTYH_uc001cnh.1_Missense_Mutation_p.A520T|MUTYH_uc001cnm.1_Missense_Mutation_p.A544T|MUTYH_uc001cno.1_Missense_Mutation_p.A427T|MUTYH_uc001cnk.1_Missense_Mutation_p.A404T|MUTYH_uc001cnl.1_Missense_Mutation_p.A533T|MUTYH_uc001cnn.1_Missense_Mutation_p.A534T	NM_001128425	NP_001121897	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 5	544					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)									162				0.812734	745.905768	770.355454	217	50	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	45567576	45567576	10387	1	C	T	T	25	25	MUTYH	T	2	2
SPATA6	54558	broad.mit.edu	36	1	48597973	48597973	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:48597973C>A	uc001crr.1	-	c.966G>T	c.(964-966)GAG>GAT	p.E322D	SPATA6_uc001crs.1_Missense_Mutation_p.E322D	NM_019073	NP_061946	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	322					cell differentiation|multicellular organismal development|spermatogenesis	extracellular region				ovary(1)	1														0.258621	38.503997	41.562448	15	43	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48597973	48597973	15523	1	C	A	A	20	20	SPATA6	A	3	3
DIO1	1733	broad.mit.edu	36	1	54132744	54132744	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:54132744G>A	uc001cwa.1	+	c.273G>A	c.(271-273)CTG>CTA	p.L91L	DIO1_uc001cvz.1_Intron|DIO1_uc001cwb.1_Silent_p.L91L|DIO1_uc001cwc.1_Silent_p.L91L|DIO1_uc001cwd.1_Non-coding_Transcript|DIO1_uc001cwe.1_Non-coding_Transcript|DIO1_uc009vzl.1_Silent_p.L91L|DIO1_uc001cwf.1_Intron|DIO1_uc001cwg.1_Intron	NM_000792	NP_001034804	P49895	IOD1_HUMAN	deiodinase, iodothyronine, type I isoform a	91					hormone biosynthetic process|oxidation-reduction process|thyroid hormone generation	endoplasmic reticulum membrane|integral to membrane|plasma membrane	selenium binding|thyroxine 5'-deiodinase activity				0														0.136364	9.22763	14.855256	6	38	GG		KEEP	---	---	---	---	capture			Silent	SNP	54132744	54132744	4703	1	G	A	A	47	47	DIO1	A	2	2
DHCR24	1718	broad.mit.edu	36	1	55092301	55092301	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr1:55092301G>C	uc001cyc.1	-	c.1215C>G	c.(1213-1215)ATC>ATG	p.I405M		NM_014762	NP_055577	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase precursor	405					anti-apoptosis|apoptosis|cell cycle arrest|cholesterol biosynthetic process|negative regulation of caspase activity|neuroprotection|oxidation-reduction process|response to oxidative stress|skin development	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus	delta24-sterol reductase activity|enzyme binding|flavin adenine dinucleotide binding|peptide antigen binding			pancreas(1)	1						Pancreas(39;516 1021 24601 30715 32780)								0.4	11.73912	11.872106	6	9	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55092301	55092301	4655	1	G	C	C	41	41	DHCR24	C	3	3
C8A	731	broad.mit.edu	36	1	57105880	57105880	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr1:57105880C>T	uc001cyo.1	+	c.88C>T	c.(88-90)CGG>TGG	p.R30W		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	30					complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)	2														0.422414	295.201178	296.420763	98	134	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	57105880	57105880	2525	1	C	T	T	19	19	C8A	T	1	1
LMO4	8543	broad.mit.edu	36	1	87577837	87577837	+	Silent	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr1:87577837T>C	uc001dmi.1	+	c.267T>C	c.(265-267)GCT>GCC	p.A89A	LMO4_uc001dmj.1_Silent_p.A89A	NM_006769	NP_006760	P61968	LMO4_HUMAN	LIM domain only 4	89	LIM zinc-binding 2.				neural tube closure|transcription from RNA polymerase II promoter	transcription factor complex	sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding				0		Lung NSC(277;0.179)		all cancers(265;0.00456)|Epithelial(280;0.0148)|BRCA - Breast invasive adenocarcinoma(282;0.153)										0.222222	7.288311	8.5684	4	14	TT		KEEP	---	---	---	---	capture			Silent	SNP	87577837	87577837	9183	1	T	C	C	56	56	LMO4	C	4	4
KCNK15	60598	broad.mit.edu	36	20	42812420	42812420	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr20:42812420G>T	uc002xmr.1	+	c.520G>T	c.(520-522)GGG>TGG	p.G174W		NM_022358	NP_071753	Q9H427	KCNKF_HUMAN	potassium family, subfamily K, member 15	174	Helical; (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity				0		Myeloproliferative disorder(115;0.0122)												0.428571	13.746482	13.808637	6	8	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	42812420	42812420	8367	20	G	T	T	39	39	KCNK15	T	3	3
SEC14L2	23541	broad.mit.edu	36	22	29135223	29135223	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr22:29135223G>A	uc003ahr.1	+	c.471G>A	c.(469-471)GGG>GGA	p.G157G	SEC14L2_uc003ahq.2_Silent_p.G157G|SEC14L2_uc003ahs.1_Silent_p.G83G|SEC14L2_uc003aht.1_Non-coding_Transcript|SEC14L2_uc010gvv.1_Non-coding_Transcript|SEC14L2_uc003ahu.2_5'UTR|SEC14L2_uc010gvw.1_Non-coding_Transcript|MTFP1_uc010gvx.1_5'UTR|MTFP1_uc003ahv.1_5'UTR|MTFP1_uc010gvy.1_5'Flank	NM_012429	NP_036561	O76054	S14L2_HUMAN	SEC14-like 2 isoform 1	157	CRAL-TRIO.				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	phospholipid binding|transcription activator activity|transporter activity|vitamin E binding				0					Vitamin E(DB00163)									0.24	9.157489	10.690411	6	19	GG		KEEP	---	---	---	---	capture			Silent	SNP	29135223	29135223	14468	22	G	A	A	42	42	SEC14L2	A	2	2
GLI2	2736	broad.mit.edu	36	2	121456849	121456849	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:121456849G>A	uc010flp.1	+	c.1606G>A	c.(1606-1608)GAG>AAG	p.E536K	GLI2_uc002tmq.1_Missense_Mutation_p.E208K|GLI2_uc002tmr.1_Missense_Mutation_p.E191K|GLI2_uc002tmt.2_Missense_Mutation_p.E208K|GLI2_uc002tmu.2_Missense_Mutation_p.E191K|GLI2_uc002tmw.1_Missense_Mutation_p.E519K	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	536	C2H2-type 4.				axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription activator activity|zinc ion binding			ovary(7)|central_nervous_system(1)	8	Renal(3;0.0496)	Prostate(154;0.0623)								376				0.287879	36.888282	39.559653	19	47	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	121456849	121456849	6706	2	G	A	A	45	45	GLI2	A	2	2
TANC1	85461	broad.mit.edu	36	2	159795542	159795542	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr2:159795542G>T	uc002uag.1	+	c.5359G>T	c.(5359-5361)GTT>TTT	p.V1787F	TANC1_uc010fon.1_Missense_Mutation_p.V631F	NM_033394	NP_203752	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and	1787						cell junction|postsynaptic density|postsynaptic membrane	binding			ovary(2)|central_nervous_system(1)	3														0.263158	8.261985	9.230472	5	14	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	159795542	159795542	16065	2	G	T	T	48	48	TANC1	T	3	3
TTC32	130502	broad.mit.edu	36	2	19965056	19965056	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr2:19965056A>G	uc002rdg.1	-	c.41T>C	c.(40-42)CTC>CCC	p.L14P		NM_001008237	NP_001008238	Q5I0X7	TTC32_HUMAN	tetratricopeptide repeat domain 32	14	TPR 1.						identical protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)													0.195122	19.073181	26.192571	16	66	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19965056	19965056	17256	2	A	G	G	11	11	TTC32	G	4	4
COL6A3	1293	broad.mit.edu	36	2	237936659	237936659	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:237936659C>T	uc002vwl.2	-	c.6039G>A	c.(6037-6039)TTG>TTA	p.L2013L	COL6A3_uc002vwk.2_Silent_p.L1846L|COL6A3_uc002vwm.2_Silent_p.L1812L|COL6A3_uc002vwn.2_Silent_p.L1813L|COL6A3_uc002vwo.2_Silent_p.L1807L	NM_004369	NP_004360	P12111	CO6A3_HUMAN	alpha 3 type VI collagen isoform 1 precursor	2013	VWFA 10.|Nonhelical region.				axon guidance|cell adhesion|muscle organ development	collagen type VI|extracellular space	serine-type endopeptidase inhibitor activity			ovary(8)|central_nervous_system(6)|pancreas(1)	15		Breast(86;0.000301)|Renal(207;0.000966)|all_hematologic(139;0.067)|Ovarian(221;0.0694)|all_lung(227;0.0943)|Melanoma(123;0.203)		Epithelial(121;1.23e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-10)|Kidney(56;5.71e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.51e-07)|BRCA - Breast invasive adenocarcinoma(100;0.00025)|Lung(119;0.0142)|LUSC - Lung squamous cell carcinoma(224;0.034)										0.2	12.832784	15.344661	6	24	CC		KEEP	---	---	---	---	capture			Silent	SNP	237936659	237936659	3839	2	C	T	T	21	21	COL6A3	T	2	2
PLB1	151056	broad.mit.edu	36	2	28618144	28618144	+	Nonsense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:28618144C>T	uc002rmb.1	+	c.841C>T	c.(841-843)CAG>TAG	p.Q281*	PLB1_uc010ezj.1_Nonsense_Mutation_p.Q292*	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1	281	4 X 308-326 AA approximate repeats.|Extracellular (Potential).|1.				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|breast(1)	7	Acute lymphoblastic leukemia(172;0.155)													0.604167	91.732982	92.179373	29	19	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	28618144	28618144	12450	2	C	T	T	21	21	PLB1	T	5	2
CRIM1	51232	broad.mit.edu	36	2	36602842	36602842	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:36602842C>T	uc002rpd.1	+	c.2310C>T	c.(2308-2310)GAC>GAT	p.D770D		NM_016441	NP_057525	Q9NZV1	CRIM1_HUMAN	cysteine-rich motor neuron 1	770	Extracellular (Potential).|VWFC 5.				nervous system development|regulation of cell growth	extracellular region|integral to membrane|plasma membrane	insulin-like growth factor binding|insulin-like growth factor receptor activity|serine-type endopeptidase inhibitor activity			ovary(2)	2		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)												0.542169	141.872231	142.000606	45	38	CC		KEEP	---	---	---	---	capture			Silent	SNP	36602842	36602842	4012	2	C	T	T	19	19	CRIM1	T	1	1
C2orf42	54980	broad.mit.edu	36	2	70231070	70231070	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:70231070C>T	uc002sgh.1	-	c.1647G>A	c.(1645-1647)GTG>GTA	p.V549V		NM_017880	NP_060350	Q9NWW7	CB042_HUMAN	hypothetical protein LOC54980	549											0														0.2	16.507577	19.435198	7	28	CC		KEEP	---	---	---	---	capture			Silent	SNP	70231070	70231070	2254	2	C	T	T	21	21	C2orf42	T	2	2
SEMA4F	10505	broad.mit.edu	36	2	74754389	74754389	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr2:74754389T>G	uc002sna.1	+	c.748T>G	c.(748-750)TTC>GTC	p.F250V	SEMA4F_uc010ffq.1_Missense_Mutation_p.F217V|SEMA4F_uc010ffr.1_Intron|SEMA4F_uc002snb.1_5'UTR|SEMA4F_uc002snc.1_Intron	NM_004263	NP_004254	O95754	SEM4F_HUMAN	semaphorin W	250	Sema.|Extracellular (Potential).				cell-cell signaling	endoplasmic reticulum|integral to plasma membrane	receptor activity			ovary(2)|pancreas(1)	3														0.435065	383.269225	384.403743	134	174	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	74754389	74754389	14521	2	T	G	G	56	56	SEMA4F	G	4	4
CIAO1	9391	broad.mit.edu	36	2	96296807	96296807	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr2:96296807C>A	uc002svs.1	+	c.161C>A	c.(160-162)TCT>TAT	p.S54Y	TMEM127_uc002svq.1_5'Flank|TMEM127_uc002svr.1_5'Flank	NM_004804	NP_004795	O76071	CIAO1_HUMAN	WD repeat domain 39	54					chromosome segregation|iron-sulfur cluster assembly|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter	MMXD complex	protein binding				0														0.21875	8.089859	10.444911	7	25	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	96296807	96296807	3552	2	C	A	A	32	32	CIAO1	A	3	3
TATDN2	9797	broad.mit.edu	36	3	10287128	10287128	+	Missense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:10287128C>A	uc003bvf.1	+	c.1262C>A	c.(1261-1263)CCC>CAC	p.P421H	TATDN2_uc003bvg.1_Missense_Mutation_p.P421H	NM_014760	NP_055575	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	421						nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding			pancreas(2)	2														0.52381	22.002112	22.011412	11	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	10287128	10287128	16114	3	C	A	A	22	22	TATDN2	A	3	3
MORC1	27136	broad.mit.edu	36	3	110164957	110164957	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr3:110164957G>A	uc003dxl.1	-	c.2793C>T	c.(2791-2793)CTC>CTT	p.L931L		NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	931	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|breast(2)	5														0.140625	9.833458	25.872875	18	110	GG		KEEP	---	---	---	---	capture			Silent	SNP	110164957	110164957	10092	3	G	A	A	41	41	MORC1	A	2	2
GAP43	2596	broad.mit.edu	36	3	116877909	116877909	+	Silent	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:116877909C>A	uc003ebr.1	+	c.498C>A	c.(496-498)TCC>TCA	p.S166S	GAP43_uc003ebq.1_Silent_p.S130S	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	130					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of growth|response to wounding	cell junction|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)										0.428571	17.756132	17.852077	9	12	CC		KEEP	---	---	---	---	capture			Silent	SNP	116877909	116877909	6499	3	C	A	A	24	24	GAP43	A	3	3
PIK3CA	5290	broad.mit.edu	36	3	180399584	180399584	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:180399584C>T	uc003fjk.1	+	c.277C>T	c.(277-279)CGG>TGG	p.R93W		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	93					epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.R93W(5)		breast(1506)|large_intestine(749)|endometrium(244)|urinary_tract(195)|ovary(136)|skin(112)|stomach(89)|thyroid(77)|central_nervous_system(69)|lung(61)|upper_aerodigestive_tract(48)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|kidney(2)|prostate(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3437	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			Colon(199;1504 1750 3362 26421 31210 32040)		57	p.R93W(YKG1-Tumor)	621	TCGA GBM(8;5.49e-07)			0.454545	208.559007	208.815791	65	78	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	180399584	180399584	12337	3	C	T	T	31	31	PIK3CA	T	1	1
OPA1	4976	broad.mit.edu	36	3	194815419	194815419	+	Nonsense_Mutation	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr3:194815419C>A	uc003ftg.1	+	c.246C>A	c.(244-246)TAC>TAA	p.Y82*	OPA1_uc003fth.1_Nonsense_Mutation_p.Y82*|OPA1_uc003fti.1_Nonsense_Mutation_p.Y82*|OPA1_uc003ftj.1_Nonsense_Mutation_p.Y82*|OPA1_uc003ftk.1_Nonsense_Mutation_p.Y82*|OPA1_uc003ftl.1_Nonsense_Mutation_p.Y82*|OPA1_uc003ftm.1_Nonsense_Mutation_p.Y82*|OPA1_uc003ftn.1_Nonsense_Mutation_p.Y82*	NM_130837	NP_570850	O60313	OPA1_HUMAN	optic atrophy 1 isoform 8	82					apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)										0.222222	11.149831	13.675008	8	28	CC		KEEP	---	---	---	---	capture			Nonsense_Mutation	SNP	194815419	194815419	11277	3	C	A	A	18	18	OPA1	A	5	3
C3orf71	646450	broad.mit.edu	36	3	48930903	48930904	+	Missense_Mutation	DNP	CT	AC	AC			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:48930903_48930904CT>AC	uc010hkk.1	-	c.683_684AG>GT	c.(682-684)CAG>CGT	p.Q228R	ARIH2_uc003cvb.1_5'Flank|ARIH2_uc003cvc.1_5'Flank	NM_001123040	NP_001116512	Q8N7S6	CC071_HUMAN	hypothetical protein LOC646450	228						integral to membrane					0														0.25	9.700239	11.303643	7	21	CC		KEEP	---	---	---	---	capture			Missense_Mutation	DNP	48930903	48930904	2336	3	CT	AC	AC	24	24	C3orf71	AC	3	3
ENPEP	2028	broad.mit.edu	36	4	111617407	111617407	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:111617407C>T	uc003iab.2	+	c.388C>T	c.(388-390)CGG>TGG	p.R130W		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	130	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			ovary(1)|breast(1)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)									0.4	16.751927	16.881357	6	9	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	111617407	111617407	5321	4	C	T	T	23	23	ENPEP	T	1	1
KLF3	51274	broad.mit.edu	36	4	38375116	38375116	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr4:38375116G>A	uc003gth.2	+	c.875G>A	c.(874-876)TGT>TAT	p.C292Y		NM_016531	NP_057615	P57682	KLF3_HUMAN	Kruppel-like factor 3 (basic)	292	C2H2-type 2.				multicellular organismal development|regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)	2														0.340708	222.219515	227.281365	77	149	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	38375116	38375116	8659	4	G	A	A	48	48	KLF3	A	2	2
ZAR1	326340	broad.mit.edu	36	4	48190888	48190888	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr4:48190888C>T	uc003gyd.1	+	c.1145C>T	c.(1144-1146)ACG>ATG	p.T382M		NM_175619	NP_783318	Q86SH2	ZAR1_HUMAN	zygote arrest 1	382					multicellular organismal development	cytoplasm|membrane	bile acid:sodium symporter activity				0														0.333333	9.564555	9.93629	5	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	48190888	48190888	18098	4	C	T	T	19	19	ZAR1	T	1	1
FAM13A	10144	broad.mit.edu	36	4	89945226	89945226	+	Silent	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr4:89945226A>G	uc003hse.1	-	c.1008T>C	c.(1006-1008)AGT>AGC	p.S336S	FAM13A_uc003hsf.1_Intron|FAM13A_uc003hsh.1_Silent_p.S150S|FAM13A_uc003hsb.1_Silent_p.S10S|FAM13A_uc003hsc.1_Intron|FAM13A_uc003hsd.1_Silent_p.S10S|FAM13A_uc003hsg.1_Intron|FAM13A_uc010ikr.1_5'UTR	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	336					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2														0.375	6.321252	6.431513	3	5	AA		KEEP	---	---	---	---	capture			Silent	SNP	89945226	89945226	5649	4	A	G	G	2	2	FAM13A	G	4	4
P4HA2	8974	broad.mit.edu	36	5	131572833	131572833	+	Missense_Mutation	SNP	T	G	G			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr5:131572833T>G	uc003kwh.1	-	c.800A>C	c.(799-801)GAA>GCA	p.E267A	P4HA2_uc003kwg.1_Missense_Mutation_p.E267A|P4HA2_uc003kwi.1_Missense_Mutation_p.E267A|P4HA2_uc003kwj.1_Missense_Mutation_p.E267A|P4HA2_uc003kwk.1_Missense_Mutation_p.E267A|P4HA2_uc003kwl.1_Missense_Mutation_p.E267A	NM_004199	NP_004190	O15460	P4HA2_HUMAN	prolyl 4-hydroxylase, alpha II subunit isoform 1	267					oxidation-reduction process	endoplasmic reticulum lumen	electron carrier activity|iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity|protein binding				0		all_cancers(142;0.103)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		L-Proline(DB00172)|Succinic acid(DB00139)	Esophageal Squamous(68;117 1135 17362 19256 34242)								0.178571	6.554082	9.285991	5	23	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	131572833	131572833	11770	5	T	G	G	62	62	P4HA2	G	4	4
FSTL4	23105	broad.mit.edu	36	5	132597096	132597096	+	Silent	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:132597096G>T	uc003kyn.1	-	c.927C>A	c.(925-927)ACC>ACA	p.T309T		NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4	309	Ig-like 1.					extracellular region	calcium ion binding			central_nervous_system(1)	1		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)											0.726027	171.990932	175.35465	53	20	GG		KEEP	---	---	---	---	capture			Silent	SNP	132597096	132597096	6330	5	G	T	T	47	47	FSTL4	T	3	3
PCDHB6	56130	broad.mit.edu	36	5	140511636	140511636	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:140511636G>A	uc003lir.1	+	c.1614G>A	c.(1612-1614)GCG>GCA	p.A538A		NM_018939	NP_061762	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6 precursor	538	Cadherin 5.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)											0.391304	25.577788	25.812867	9	14	GG		KEEP	---	---	---	---	capture			Silent	SNP	140511636	140511636	11966	5	G	A	A	40	40	PCDHB6	A	1	1
NNT	23530	broad.mit.edu	36	5	43686400	43686400	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr5:43686400G>A	uc003joe.1	+	c.1671G>A	c.(1669-1671)CAG>CAA	p.Q557Q	NNT_uc003jof.1_Silent_p.Q557Q	NM_012343	NP_892022	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	557					tricarboxylic acid cycle	integral to membrane|mitochondrial respiratory chain	NAD binding|NAD(P)+ transhydrogenase (AB-specific) activity|NAD(P)+ transhydrogenase (B-specific) activity|NADP binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(6;2.58e-06)				NADH(DB00157)									0.105	22.936965	53.954728	21	179	GG		KEEP	---	---	---	---	capture			Silent	SNP	43686400	43686400	10913	5	G	A	A	35	35	NNT	A	2	2
PRSS16	10279	broad.mit.edu	36	6	27328609	27328609	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:27328609G>A	uc003nja.1	+	c.1052G>A	c.(1051-1053)CGA>CAA	p.R351Q	PRSS16_uc003njb.1_Missense_Mutation_p.R94Q|PRSS16_uc010jqq.1_Missense_Mutation_p.R128Q|PRSS16_uc010jqr.1_Missense_Mutation_p.R102Q|PRSS16_uc003njc.1_Non-coding_Transcript|PRSS16_uc003njd.1_Intron	NM_005865	NP_005856	Q9NQE7	TSSP_HUMAN	protease, serine, 16	351					protein catabolic process|proteolysis	cytoplasmic membrane-bounded vesicle	serine-type peptidase activity			ovary(2)|central_nervous_system(2)	4						NSCLC(178;1118 2105 17078 23587 44429)								0.243523	108.936278	120.509758	47	146	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	27328609	27328609	13066	6	G	A	A	37	37	PRSS16	A	1	1
HLA-DOA	3111	broad.mit.edu	36	6	33082876	33082876	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:33082876G>A	uc003ocr.1	-	c.708C>T	c.(706-708)ACC>ACT	p.T236T	HLA-DOA_uc010jui.1_3'UTR	NM_002119	NP_002110	P06340	DOA_HUMAN	major histocompatibility complex, class II, DO	236	Helical; (Potential).				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endosome membrane|integral to membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0														0.5	50.919191	50.919191	16	16	GG		KEEP	---	---	---	---	capture			Silent	SNP	33082876	33082876	7491	6	G	A	A	39	39	HLA-DOA	A	1	1
TDRD6	221400	broad.mit.edu	36	6	46768851	46768851	+	Missense_Mutation	SNP	A	G	G			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr6:46768851A>G	uc003oyj.1	+	c.5027A>G	c.(5026-5028)GAT>GGT	p.D1676G	TDRD6_uc010jze.1_Missense_Mutation_p.D1670G	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1676					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)	5			Lung(136;0.192)											0.532258	221.356088	221.468518	66	58	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	46768851	46768851	16261	6	A	G	G	12	12	TDRD6	G	4	4
BMP6	654	broad.mit.edu	36	6	7672804	7672804	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr6:7672804G>C	uc003mxu.2	+	c.617G>C	c.(616-618)AGC>ACC	p.S206T		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	206					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)													0.5	6.620612	6.620612	3	3	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	7672804	7672804	1489	6	G	C	C	34	34	BMP6	C	3	3
PHIP	55023	broad.mit.edu	36	6	79763959	79763959	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr6:79763959C>T	uc003pir.1	-	c.2092G>A	c.(2092-2094)GTA>ATA	p.V698I		NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	698					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|ovary(1)	5		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)						490				0.125	19.4858	38.173647	17	119	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	79763959	79763959	12266	6	C	T	T	17	17	PHIP	T	2	2
MUC17	140453	broad.mit.edu	36	7	100470759	100470759	+	Silent	SNP	C	A	A			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:100470759C>A	uc003uxp.1	+	c.9342C>A	c.(9340-9342)ACC>ACA	p.T3114T	MUC17_uc010lho.1_Non-coding_Transcript	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17	3114	Extracellular (Potential).|Ser-rich.|50.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|breast(3)|lung(2)	19	Lung NSC(181;0.136)|all_lung(186;0.182)													0.156951	61.568425	86.637126	35	188	CC		KEEP	---	---	---	---	capture			Silent	SNP	100470759	100470759	10368	7	C	A	A	21	21	MUC17	A	3	3
NUP205	23165	broad.mit.edu	36	7	134913170	134913170	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:134913170C>T	uc003vsw.1	+	c.735C>T	c.(733-735)GAC>GAT	p.D245D		NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	245					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6														0.179487	25.607738	33.150159	14	64	CC		KEEP	---	---	---	---	capture			Silent	SNP	134913170	134913170	11164	7	C	T	T	17	17	NUP205	T	2	2
EGFR	1956	broad.mit.edu	36	7	55187768	55187768	+	Missense_Mutation	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr7:55187768C>T	uc003tqk.1	+	c.664C>T	c.(664-666)CGC>TGC	p.R222C	EGFR_uc003tqh.1_Missense_Mutation_p.R222C|EGFR_uc003tqi.1_Missense_Mutation_p.R222C|EGFR_uc003tqj.1_Missense_Mutation_p.R222C|EGFR_uc010kzg.1_Missense_Mutation_p.R177C|EGFR_uc003tql.1_Non-coding_Transcript	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a	222	Approximate.|Extracellular (Potential).				activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity	p.V30_R297>G(10)|p.R222C(2)		lung(8200)|central_nervous_system(103)|upper_aerodigestive_tract(37)|prostate(32)|ovary(31)|thyroid(23)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|stomach(6)|urinary_tract(6)|skin(5)|adrenal_gland(5)|kidney(4)|soft_tissue(4)|bone(3)|NS(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)|pancreas(1)	8515	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)			8		608	TCGA GBM(3;<1E-8)|TSP Lung(4;<1E-8)			0.978448	1556.113559	1570.759161	454	10	CC		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	55187768	55187768	5156	7	C	T	T	27	27	EGFR	T	1	1
DAGLB	221955	broad.mit.edu	36	7	6452155	6452155	+	Silent	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chr7:6452155T>C	uc003sqa.1	-	c.201A>G	c.(199-201)GCA>GCG	p.A67A	DAGLB_uc003sqb.1_Intron|DAGLB_uc003sqc.1_5'UTR|DAGLB_uc003sqd.2_Silent_p.A26A	NM_139179	NP_631918	Q8NCG7	DGLB_HUMAN	diacylglycerol lipase, beta isoform 1	67	Helical; (Potential).				lipid catabolic process|platelet activation	integral to membrane|plasma membrane	acylglycerol lipase activity|metal ion binding|triglyceride lipase activity			ovary(2)|central_nervous_system(1)	3		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.102)										0.177536	105.914223	132.943736	49	227	TT		KEEP	---	---	---	---	capture			Silent	SNP	6452155	6452155	4394	7	T	C	C	55	55	DAGLB	C	4	4
BAIAP2L1	55971	broad.mit.edu	36	7	97829606	97829606	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr7:97829606G>A	uc003upj.1	-	c.126C>T	c.(124-126)AAC>AAT	p.N42N		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1	42	IMD.				filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)											0.22807	63.792467	71.529157	26	88	GG		KEEP	---	---	---	---	capture			Silent	SNP	97829606	97829606	1323	7	G	A	A	40	40	BAIAP2L1	A	1	1
ATP6V1C1	528	broad.mit.edu	36	8	104123773	104123773	+	Silent	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:104123773G>A	uc003ykz.2	+	c.162G>A	c.(160-162)TTG>TTA	p.L54L	ATP6V1C1_uc010mbz.1_5'UTR|ATP6V1C1_uc003yla.1_Silent_p.L54L	NM_001695	NP_001686	P21283	VATC1_HUMAN	ATPase, H+ transporting, lysosomal V1 subunit	54					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|plasma membrane|proton-transporting V-type ATPase, V1 domain	protein binding|proton-transporting ATPase activity, rotational mechanism				0	Lung NSC(17;0.000427)|all_lung(17;0.000533)		OV - Ovarian serous cystadenocarcinoma(57;3.57e-05)|STAD - Stomach adenocarcinoma(118;0.133)											0.098592	7.228518	30.164275	14	128	GG		KEEP	---	---	---	---	capture			Silent	SNP	104123773	104123773	1199	8	G	A	A	48	48	ATP6V1C1	A	2	2
ADAM28	10863	broad.mit.edu	36	8	24240085	24240085	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chr8:24240085G>A	uc003xdy.1	+	c.964G>A	c.(964-966)GTT>ATT	p.V322I	ADAM28_uc003xdx.1_Missense_Mutation_p.V322I|ADAM28_uc010lua.1_Missense_Mutation_p.V9I	NM_014265	NP_055080	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28 isoform 1	322	Peptidase M12B.|Extracellular (Potential).				proteolysis|spermatogenesis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(2)|lung(1)|central_nervous_system(1)	4		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		NSCLC(193;488 2149 22258 34798 40734)			p.V322I(COLO775-Tumor)|p.V322I(NCIH1385-Tumor)	410				0.427966	316.332158	317.400957	101	135	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	24240085	24240085	247	8	G	A	A	40	40	ADAM28	A	1	1
FAM129B	64855	broad.mit.edu	36	9	129327247	129327247	+	Missense_Mutation	SNP	A	C	C			TCGA-28-1757-01	TCGA-28-1757-01	A	A								Phase_I	Unspecified				Illumina GAIIx	g.chr9:129327247A>C	uc004brh.1	-	c.332T>G	c.(331-333)GTC>GGC	p.V111G	FAM129B_uc004bri.1_Missense_Mutation_p.V98G|FAM129B_uc004brj.2_Missense_Mutation_p.V111G	NM_022833	NP_073744	Q96TA1	NIBL1_HUMAN	hypothetical protein LOC64855 isoform 1	98	PH.						protein binding				0														0.3	7.896793	8.644104	6	14	AA		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129327247	129327247	5634	9	A	C	C	10	10	FAM129B	C	4	4
SURF4	6836	broad.mit.edu	36	9	135220439	135220439	+	Silent	SNP	C	T	T			TCGA-28-1757-01	TCGA-28-1757-01	C	C								Phase_I	Unspecified				Illumina GAIIx	g.chr9:135220439C>T	uc004cdj.1	-	c.561G>A	c.(559-561)GTG>GTA	p.V187V	SURF4_uc010nal.1_Nonsense_Mutation_p.W157*	NM_033161	NP_149351	O15260	SURF4_HUMAN	surfeit 4	187	Helical; (Potential).					endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane	protein binding				0				OV - Ovarian serous cystadenocarcinoma(145;5.32e-07)|Epithelial(140;4.56e-06)|all cancers(34;4.25e-05)										0.104575	27.265823	74.925763	32	274	CC		KEEP	---	---	---	---	capture			Silent	SNP	135220439	135220439	15925	9	C	T	T	21	21	SURF4	T	2	2
ESX1	80712	broad.mit.edu	36	X	103382112	103382112	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:103382112G>T	uc004ely.1	-	c.674C>A	c.(673-675)GCT>GAT	p.A225D		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	225					regulation of cell cycle|regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|specific transcriptional repressor activity			ovary(1)	1						Pancreas(200;1705 2227 25194 28471 45274)								0.166667	9.377524	18.291228	14	70	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	103382112	103382112	5456	23	G	T	T	34	34	ESX1	T	3	3
VSIG1	340547	broad.mit.edu	36	X	107196891	107196891	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:107196891G>T	uc004eno.1	+	c.283G>T	c.(283-285)GAT>TAT	p.D95Y		NM_182607	NP_872413	Q86XK7	VSIG1_HUMAN	V-set and immunoglobulin domain containing 1	95	Extracellular (Potential).|Ig-like V-type 1.					integral to membrane				ovary(1)	1														0.142857	6.568688	18.67721	14	84	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	107196891	107196891	17789	23	G	T	T	37	37	VSIG1	T	3	3
ARHGAP6	395	broad.mit.edu	36	X	11072042	11072042	+	Missense_Mutation	SNP	G	A	A			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:11072042G>A	uc004cup.1	-	c.2155C>T	c.(2155-2157)CCT>TCT	p.P719S	ARHGAP6_uc004cuo.1_Non-coding_Transcript|ARHGAP6_uc004cur.1_Missense_Mutation_p.P719S|ARHGAP6_uc004cum.1_Missense_Mutation_p.P516S|ARHGAP6_uc004cun.1_Missense_Mutation_p.P539S|ARHGAP6_uc010neb.1_Missense_Mutation_p.P541S	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	719					actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2												OREG0019666	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.217391	128.29525	146.928637	55	198	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	11072042	11072042	901	23	G	A	A	41	41	ARHGAP6	A	2	2
ZCCHC16	340595	broad.mit.edu	36	X	111584888	111584888	+	Silent	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:111584888T>C	uc004epo.1	+	c.276T>C	c.(274-276)AAT>AAC	p.N92N	ZCCHC16_uc010npz.1_Silent_p.N92N	NM_001004308	NP_001004308	Q6ZR62	ZCH16_HUMAN	zinc finger, CCHC domain containing 16	92							nucleic acid binding|zinc ion binding			ovary(1)	1														0.789809	425.667142	437.862313	124	33	TT		KEEP	---	---	---	---	capture			Silent	SNP	111584888	111584888	18172	23	T	C	C	51	51	ZCCHC16	C	4	4
AIFM1	9131	broad.mit.edu	36	X	129097816	129097816	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:129097816G>T	uc004evg.1	-	c.1190C>A	c.(1189-1191)GCT>GAT	p.A397D	AIFM1_uc004evh.1_Missense_Mutation_p.A393D|AIFM1_uc004evi.1_Missense_Mutation_p.A110D|AIFM1_uc004evj.1_Non-coding_Transcript|AIFM1_uc004evk.1_Non-coding_Transcript|AIFM1_uc004evf.1_Missense_Mutation_p.A58D	NM_004208	NP_004199	O95831	AIFM1_HUMAN	programmed cell death 8 isoform 1	397	FAD-dependent oxidoreductase (By similarity).				activation of caspase activity|apoptosis in response to endoplasmic reticulum stress|cell redox homeostasis|DNA damage response, signal transduction resulting in induction of apoptosis|DNA fragmentation involved in apoptotic nuclear change|oxidation-reduction process	cytosol|mitochondrial inner membrane|mitochondrial intermembrane space|nucleus|perinuclear region of cytoplasm	DNA binding|electron carrier activity|flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			ovary(4)|central_nervous_system(1)	5										210				0.333333	6.722612	6.943712	3	6	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	129097816	129097816	429	23	G	T	T	34	34	AIFM1	T	3	3
MAP7D2	256714	broad.mit.edu	36	X	19944321	19944321	+	Missense_Mutation	SNP	G	C	C			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:19944321G>C	uc010nfo.1	-	c.1456C>G	c.(1456-1458)CTT>GTT	p.L486V	MAP7D2_uc004czq.1_Missense_Mutation_p.L330V|MAP7D2_uc004czr.1_Missense_Mutation_p.L445V	NM_152780	NP_689993	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	445										ovary(2)|breast(1)	3														0.25	10.509762	12.105432	7	21	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	19944321	19944321	9651	23	G	C	C	34	34	MAP7D2	C	3	3
CXorf21	80231	broad.mit.edu	36	X	30487950	30487950	+	Missense_Mutation	SNP	G	T	T			TCGA-28-1757-01	TCGA-28-1757-01	G	G								Phase_I	Unspecified				Illumina GAIIx	g.chrX:30487950G>T	uc004dcg.1	-	c.444C>A	c.(442-444)AGC>AGA	p.S148R	CXorf21_uc010ngi.1_Missense_Mutation_p.S148R	NM_025159	NP_079435	Q9HAI6	CX021_HUMAN	hypothetical protein LOC80231	148										ovary(1)	1														0.276923	96.145176	101.968055	36	94	GG		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	30487950	30487950	4261	23	G	T	T	46	46	CXorf21	T	3	3
FAM46D	169966	broad.mit.edu	36	X	79585815	79585815	+	Missense_Mutation	SNP	T	C	C			TCGA-28-1757-01	TCGA-28-1757-01	T	T								Phase_I	Unspecified				Illumina GAIIx	g.chrX:79585815T>C	uc004edl.1	+	c.1121T>C	c.(1120-1122)TTC>TCC	p.F374S	FAM46D_uc004edm.1_Missense_Mutation_p.F374S|FAM46D_uc010nmh.1_Missense_Mutation_p.F374S	NM_152630	NP_689843	Q8NEK8	FA46D_HUMAN	hypothetical protein LOC169966	374										lung(2)	2														0.555556	6.707892	6.713571	5	4	TT		KEEP	---	---	---	---	capture			Missense_Mutation	SNP	79585815	79585815	5789	23	T	C	C	62	62	FAM46D	C	4	4
ZNF438	220929	broad.mit.edu	36	10	31178325	31178339	+	In_Frame_Del	DEL	CTGCATTAAAGCCTT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:31178325_31178339delCTGCATTAAAGCCTT	uc001ivl.1	-	c.1001_1015delAAGGCTTTAATGCAG	c.(1000-1017)GAAGGCTTTAATGCAGCC>GCC	p.EGFNA334del	ZNF438_uc001ivm.1_In_Frame_Del_p.EGFNA324del|ZNF438_uc001ivn.1_In_Frame_Del_p.EGFNA285del|ZNF438_uc001ivo.2_5'UTR|ZNF438_uc001ivp.2_In_Frame_Del_p.EGFNA324del|ZNF438_uc009xlg.1_In_Frame_Del_p.EGFNA334del	NM_182755	NP_877432	Q7Z4V0	ZN438_HUMAN	zinc finger protein 438 isoform a	334_338					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|breast(1)	2		Prostate(175;0.0587)												0.42			45	62				---	---	---	---	capture_indel			In_Frame_Del	DEL	31178325	31178339	18503	10	CTGCATTAAAGCCTT	-	-	28	28	ZNF438	-	5	5
FAM190B	54462	broad.mit.edu	36	10	86123377	86123378	+	Frame_Shift_Ins	INS	-	CC	CC			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr10:86123377_86123378insCC	uc001kdh.1	+	c.1440_1441insCC	c.(1438-1443)CATACTfs	p.H480fs	FAM190B_uc001kdg.1_Frame_Shift_Ins_p.H480fs	NM_018999	NP_061872	Q9H7U1	F190B_HUMAN	granule cell antiserum positive 14	480_481										ovary(3)	3														0.39			11	17				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	86123377	86123378	5733	10	-	CC	CC	49	49	FAM190B	CC	5	5
HS6ST3	266722	broad.mit.edu	36	13	96282942	96282952	+	Frame_Shift_Del	DEL	CCTACAACCTG	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr13:96282942_96282952delCCTACAACCTG	uc001vmw.1	+	c.905_915delCCTACAACCTG	c.(904-915)ACCTACAACCTGfs	p.T302fs		NM_153456	NP_703157	Q8IZP7	H6ST3_HUMAN	heparan sulfate 6-O-sulfotransferase 3	302_305	Lumenal (Potential).				carbohydrate biosynthetic process	integral to membrane	sulfotransferase activity			ovary(1)	1	all_neural(89;0.0878)|Medulloblastoma(90;0.163)													0.34			65	126				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	96282942	96282952	7666	13	CCTACAACCTG	-	-	18	18	HS6ST3	-	5	5
TMEM55B	90809	broad.mit.edu	36	14	19997714	19997715	+	Frame_Shift_Ins	INS	-	CA	CA			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr14:19997714_19997715insCA	uc001vxk.2	-	c.479_480insTG	c.(478-480)CTGfs	p.L160fs	TMEM55B_uc001vxl.2_Frame_Shift_Ins_p.L153fs	NM_001100814	NP_001094284	Q86T03	TM55B_HUMAN	transmembrane protein 55B isoform 1	153						integral to membrane|late endosome membrane|lysosomal membrane	hydrolase activity				0	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)										0.48			189	202				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	19997714	19997715	16721	14	-	CA	CA	21	21	TMEM55B	CA	5	5
CHST14	113189	broad.mit.edu	36	15	38551435	38551440	+	In_Frame_Del	DEL	GGTACA	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:38551435_38551440delGGTACA	uc001zlw.1	+	c.731_736delGGTACA	c.(730-738)CGGTACAGG>CGG	p.244_246RYR>R		NM_130468	NP_569735	Q8NCH0	CHSTE_HUMAN	dermatan 4 sulfotransferase 1	244_246	Lumenal (Potential).				carbohydrate biosynthetic process|dermatan sulfate proteoglycan metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity|phosphate binding				0		all_cancers(109;2.34e-14)|all_epithelial(112;1.08e-11)|Lung NSC(122;2.95e-09)|all_lung(180;6.03e-08)|Melanoma(134;0.091)|Colorectal(260;0.198)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0781)										0.48			31	34				---	---	---	---	capture_indel			In_Frame_Del	DEL	38551435	38551440	3536	15	GGTACA	-	-	39	39	CHST14	-	5	5
CDAN1	146059	broad.mit.edu	36	15	40804034	40804034	+	Frame_Shift_Del	DEL	T	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr15:40804034_40804034delT	uc001zql.1	-	c.3631_3631delA	c.(3631-3633)AGAfs	p.R1211fs	CDAN1_uc001zqj.1_Non-coding_Transcript|CDAN1_uc001zqk.1_Frame_Shift_Del_p.R537fs	NM_138477	NP_612486	Q8IWY9	CDAN1_HUMAN	codanin 1	1211						integral to membrane	protein binding			ovary(2)	2		all_cancers(109;5.4e-16)|all_epithelial(112;2.97e-14)|Lung NSC(122;1.75e-08)|all_lung(180;5.99e-08)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;2.49e-07)										0.31			4	9				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	40804034	40804034	3182	15	T	-	-	56	56	CDAN1	-	5	5
MT1H	4496	broad.mit.edu	36	16	55261984	55261997	+	Splice_Site_Del	DEL	AGTGAGTGCGGGGC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:55261984_55261997delAGTGAGTGCGGGGC	uc002ejw.1	+	c.e2_splice_site			MT1G_uc002eju.1_5'Flank|MT1G_uc002ejv.1_5'Flank	NM_005951	NP_005942			metallothionein 1H								metal ion binding|protein binding				0														0.30			38	87				---	---	---	---	capture_indel			Splice_Site_Del	DEL	55261984	55261997	10295	16	AGTGAGTGCGGGGC	-	-	11	11	MT1H	-	5	5
NDRG4	65009	broad.mit.edu	36	16	57095266	57095291	+	Frame_Shift_Del	DEL	AACCGCCCAGCCATCCTCACCTACCA	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr16:57095266_57095291delAACCGCCCAGCCATCCTCACCTACCA	uc002enm.1	+	c.241_266delAACCGCCCAGCCATCCTCACCTACCA	c.(241-267)AACCGCCCAGCCATCCTCACCTACCATfs	p.N81fs	NDRG4_uc002enk.1_Frame_Shift_Del_p.N61fs|NDRG4_uc002enl.1_Non-coding_Transcript|NDRG4_uc002eno.1_Frame_Shift_Del_p.N29fs|NDRG4_uc002enp.1_Frame_Shift_Del_p.N29fs|NDRG4_uc010cdk.1_Frame_Shift_Del_p.N29fs|NDRG4_uc002enq.1_5'Flank	NM_022910	NP_075061	Q9ULP0	NDRG4_HUMAN	NDRG family member 4 isoform 1	29_37					cell differentiation|cell growth|multicellular organismal development|response to stress	cytoplasm					0														0.39			62	95				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	57095266	57095291	10653	16	AACCGCCCAGCCATCCTCACCTACCA	-	-	9	9	NDRG4	-	5	5
DYNLL2	140735	broad.mit.edu	36	17	53519534	53519548	+	In_Frame_Del	DEL	CATGGAGAAGTACAA	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:53519534_53519548delCATGGAGAAGTACAA	uc002ivl.1	+	c.84_98delCATGGAGAAGTACAA	c.(82-99)GCCATGGAGAAGTACAAT>GCT	p.MEKYN29del		NM_080677	NP_542408	Q96FJ2	DYL2_HUMAN	dynein, light chain, LC8-type 2	29_33					activation of pro-apoptotic gene products|induction of apoptosis by intracellular signals|microtubule-based process|transport	cytosol|dynein complex|microtubule|myosin complex|plasma membrane	motor activity				0														0.39			60	92				---	---	---	---	capture_indel			In_Frame_Del	DEL	53519534	53519548	5035	17	CATGGAGAAGTACAA	-	-	21	21	DYNLL2	-	5	5
BIRC5	332	broad.mit.edu	36	17	73723668	73723674	+	Frame_Shift_Del	DEL	GTAATAC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr17:73723668_73723674delGTAATAC	uc002jvf.1	+	c.248_254delGTAATAC	c.(247-255)TGTAATACCfs	p.C83fs	BIRC5_uc002jve.1_Intron|BIRC5_uc002jvd.1_Frame_Shift_Del_p.V107fs|BIRC5_uc010dhk.1_Non-coding_Transcript|BIRC5_uc010dhl.1_Frame_Shift_Del_p.C108fs|BIRC5_uc002jvg.1_Intron|BIRC5_uc002jvh.1_Intron|BIRC5_uc002jvi.1_Intron|EPR1_uc002jvj.1_Intron	NM_001012271	NP_001012271	O15392	BIRC5_HUMAN	baculoviral IAP repeat-containing protein 5	74	BIR.				anti-apoptosis|apoptosis|cell division|chromosome segregation|cytokinesis|establishment of chromosome localization|G2/M transition of mitotic cell cycle|mitosis|mitotic prometaphase|negative regulation of caspase activity|positive regulation of exit from mitosis|positive regulation of mitotic cell cycle|protein complex localization|spindle checkpoint	centriole|chromosome passenger complex|chromosome, centromeric region|cytoplasm|cytoplasmic microtubule|cytosol|interphase microtubule organizing center|midbody|midbody|nuclear chromosome|spindle|spindle microtubule	caspase inhibitor activity|chaperone binding|cobalt ion binding|cofactor binding|cysteine-type endopeptidase inhibitor activity|metal ion binding|microtubule binding|protein heterodimerization activity|protein homodimerization activity|Ran GTPase binding|zinc ion binding			kidney(1)	1			BRCA - Breast invasive adenocarcinoma(99;0.00269)|OV - Ovarian serous cystadenocarcinoma(97;0.153)							64				0.73			179	65				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	73723668	73723674	1462	17	GTAATAC	-	-	48	48	BIRC5	-	5	5
SPIRE1	56907	broad.mit.edu	36	18	12536742	12536749	+	Frame_Shift_Del	DEL	TTCTGCAG	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr18:12536742_12536749delTTCTGCAG	uc002kre.1	-	c.527_534delCTGCAGAA	c.(526-534)GCTGCAGAAfs	p.A176fs	SPIRE1_uc002krc.1_Non-coding_Transcript|SPIRE1_uc010dle.1_Frame_Shift_Del_p.A17fs|SPIRE1_uc002krd.1_Frame_Shift_Del_p.A17fs	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a	176_178	KIND.					cytoskeleton|perinuclear region of cytoplasm	actin binding|zinc ion binding				0														0.30			55	128				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	12536742	12536749	15584	18	TTCTGCAG	-	-	56	56	SPIRE1	-	5	5
POU2F2	5452	broad.mit.edu	36	19	47288175	47288176	+	Frame_Shift_Ins	INS	-	G	G			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:47288175_47288176insG	uc002osp.1	-	c.1285_1286insC	c.(1285-1287)CTCfs	p.L429fs	POU2F2_uc002osn.1_Frame_Shift_Ins_p.L413fs|POU2F2_uc002oso.1_Frame_Shift_Ins_p.L202fs|POU2F2_uc002osq.1_Intron|POU2F2_uc002osr.1_Frame_Shift_Ins_p.L429fs	NM_002698	NP_002689	P09086	PO2F2_HUMAN	POU domain, class 2, transcription factor 2	429					humoral immune response|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulator activity			ovary(1)|skin(1)	2		Prostate(69;0.059)												0.33			3	6				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	47288175	47288176	12702	19	-	G	G	11	11	POU2F2	G	5	5
CCDC114	93233	broad.mit.edu	36	19	53493291	53493296	+	In_Frame_Del	DEL	CTTCTC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr19:53493291_53493296delCTTCTC	uc002pir.1	-	c.1243_1248delGAGAAG	c.(1243-1248)GAGAAGdel	p.EK415del	CCDC114_uc002pip.1_In_Frame_Del_p.EK208del|CCDC114_uc002piq.1_In_Frame_Del_p.EK208del|CCDC114_uc002pio.2_In_Frame_Del_p.EK452del|CCDC114_uc002pis.1_In_Frame_Del_p.EK95del|CCDC114_uc002pit.1_In_Frame_Del_p.EK452del	NM_144577	NP_653178	Q96M63	CC114_HUMAN	coiled-coil domain containing 114 isoform 2	415_416										ovary(1)	1		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)										0.35			49	90				---	---	---	---	capture_indel			In_Frame_Del	DEL	53493291	53493296	2871	19	CTTCTC	-	-	28	28	CCDC114	-	5	5
SIPA1L2	57568	broad.mit.edu	36	1	230716896	230716897	+	Frame_Shift_Ins	INS	-	T	T			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:230716896_230716897insT	uc001hvg.1	-	c.812_813insA	c.(811-813)GGGfs	p.G271fs		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	271					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)												0.34			64	123				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	230716896	230716897	14825	1	-	T	T	30	30	SIPA1L2	T	5	5
LRRC47	57470	broad.mit.edu	36	1	3688023	3688038	+	Splice_Site_Del	DEL	AACCTTAAAAGAAAAA	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr1:3688023_3688038delAACCTTAAAAGAAAAA	uc001akx.1	-	c.e6_splice_site				NM_020710	NP_065761			leucine rich repeat containing 47						translation		phenylalanine-tRNA ligase activity|RNA binding			large_intestine(1)|ovary(1)	2	all_cancers(77;0.0375)|Ovarian(185;0.0634)|all_lung(157;0.208)|Lung NSC(156;0.21)	all_epithelial(116;1.34e-16)|all_lung(118;2.53e-06)|Lung NSC(185;0.00028)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Lung SC(97;0.0743)|Ovarian(437;0.127)		Epithelial(90;5.49e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.43e-22)|GBM - Glioblastoma multiforme(42;3.69e-16)|Colorectal(212;1.21e-05)|COAD - Colon adenocarcinoma(227;5.87e-05)|Kidney(185;0.000367)|BRCA - Breast invasive adenocarcinoma(365;0.000704)|KIRC - Kidney renal clear cell carcinoma(229;0.00567)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.124)										0.63			150	89				---	---	---	---	capture_indel			Splice_Site_Del	DEL	3688023	3688038	9379	1	AACCTTAAAAGAAAAA	-	-	13	13	LRRC47	-	5	5
DZIP1L	199221	broad.mit.edu	36	3	139305280	139305287	+	Frame_Shift_Del	DEL	CAGCGGCT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:139305280_139305287delCAGCGGCT	uc003erq.1	-	c.217_224delAGCCGCTG	c.(217-225)AGCCGCTGTfs	p.S73fs	DZIP1L_uc003err.1_Frame_Shift_Del_p.S73fs	NM_173543	NP_775814	Q8IYY4	DZI1L_HUMAN	DAZ interacting protein 1-like	73_75						intracellular	zinc ion binding			ovary(1)|pancreas(1)	2														0.59			17	12				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	139305280	139305287	5050	3	CAGCGGCT	-	-	17	17	DZIP1L	-	5	5
PEX5L	51555	broad.mit.edu	36	3	181020394	181020396	+	In_Frame_Del	DEL	ATC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:181020394_181020396delATC	uc003fki.1	-	c.885_887delGAT	c.(883-888)TGGATA>TGA	p.295_296WI>*	PEX5L_uc003fkj.1_In_Frame_Del_p.260_261WI>*|PEX5L_uc010hxd.1_In_Frame_Del_p.293_294WI>*	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	295_296					protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)							648				0.39			95	151				---	---	---	---	capture_indel			In_Frame_Del	DEL	181020394	181020396	12171	3	ATC	-	-	16	16	PEX5L	-	5	5
WDR6	11180	broad.mit.edu	36	3	49026202	49026203	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr3:49026202_49026203insC	uc003cvj.1	+	c.2231_2232insC	c.(2230-2232)ATCfs	p.I744fs	WDR6_uc010hkn.1_Frame_Shift_Ins_p.I718fs	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein	744					cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)								OREG0015565	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	0.35			58	108				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	49026202	49026203	17883	3	-	C	C	50	50	WDR6	C	5	5
WHSC1	7468	broad.mit.edu	36	4	1889950	1889951	+	Frame_Shift_Del	DEL	AC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr4:1889950_1889951delAC	uc003gdz.2	+	c.1212_1213delAC	c.(1210-1215)AAACTGfs	p.K404fs	WHSC1_uc003gdx.2_Frame_Shift_Del_p.K404fs|WHSC1_uc003gdy.1_Frame_Shift_Del_p.K404fs|WHSC1_uc010icd.1_Frame_Shift_Del_p.K404fs|WHSC1_uc003gea.1_Frame_Shift_Del_p.K404fs|WHSC1_uc003geb.2_Frame_Shift_Del_p.K404fs|WHSC1_uc003gec.2_Frame_Shift_Del_p.K404fs|WHSC1_uc003ged.2_Frame_Shift_Del_p.K404fs|WHSC1_uc003gee.2_Non-coding_Transcript|WHSC1_uc003gef.2_Non-coding_Transcript|WHSC1_uc010ice.1_Frame_Shift_Del_p.K404fs|WHSC1_uc003geh.1_Frame_Shift_Del_p.K404fs	NM_001042424	NP_579890	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	404_405					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|skin(2)|pancreas(1)|lung(1)	7		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)						355				0.49			45	46				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	1889950	1889951	17936	4	AC	-	-	2	2	WHSC1	-	5	5
PCDHAC2	56134	broad.mit.edu	36	5	140328221	140328223	+	In_Frame_Del	DEL	TGT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:140328221_140328223delTGT	uc003lii.1	+	c.1686_1688delTGT	c.(1684-1689)ACTGTG>ACG	p.V563del	PCDHA1_uc003lha.1_Intron|PCDHA1_uc003lhb.1_Intron|PCDHA2_uc003lhd.1_Intron|PCDHA3_uc003lhf.1_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA4_uc003lhi.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.1_Intron|PCDHA6_uc003lho.1_Intron|PCDHA6_uc003lhn.1_Intron|PCDHA7_uc003lhq.1_Intron|PCDHA8_uc003lhs.1_Intron|PCDHA9_uc003lhu.1_Intron|PCDHA10_uc003lhx.1_Intron|PCDHA10_uc003lhw.1_Intron|PCDHA11_uc003lia.1_Intron|PCDHA12_uc003lic.1_Intron|PCDHA13_uc003lie.1_Intron|PCDHA13_uc003lif.1_Intron|PCDHAC1_uc003lih.1_Intron|PCDHAC2_uc003lij.1_In_Frame_Del_p.V563del	NM_018899	NP_061722	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2 isoform 1	563	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			Melanoma(190;638 2083 3390 11909 52360)								0.56			34	27				---	---	---	---	capture_indel			In_Frame_Del	DEL	140328221	140328223	11953	5	TGT	-	-	55	55	PCDHAC2	-	5	5
PLEKHG4B	153478	broad.mit.edu	36	5	222579	222587	+	In_Frame_Del	DEL	CGAGGGAAG	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr5:222579_222587delCGAGGGAAG	uc003jak.2	+	c.2533_2541delCGAGGGAAG	c.(2533-2541)CGAGGGAAGdel	p.RGK845del		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	845_847	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)										0.56			102	80				---	---	---	---	capture_indel			In_Frame_Del	DEL	222579	222587	12498	5	CGAGGGAAG	-	-	31	31	PLEKHG4B	-	5	5
TDRD6	221400	broad.mit.edu	36	6	46767831	46767841	+	Frame_Shift_Del	DEL	AGAGATTAAAC	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:46767831_46767841delAGAGATTAAAC	uc003oyj.1	+	c.4007_4017delAGAGATTAAAC	c.(4006-4017)GAGAGATTAAACfs	p.E1336fs	TDRD6_uc010jze.1_Frame_Shift_Del_p.E1330fs	NM_001010870	NP_001010870	O60522	TDRD6_HUMAN	tudor domain containing 6	1336_1339					cell differentiation|multicellular organismal development|spermatogenesis	chromatoid body	nucleic acid binding			breast(3)|ovary(2)	5			Lung(136;0.192)											0.43			35	46				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	46767831	46767841	16261	6	AGAGATTAAAC	-	-	11	11	TDRD6	-	5	5
C6orf168	84553	broad.mit.edu	36	6	99903956	99903957	+	Frame_Shift_Ins	INS	-	C	C			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr6:99903956_99903957insC	uc003ppj.2	-	c.13_14insG	c.(13-15)GTTfs	p.V5fs		NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553	5										ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)										0.33			2	4				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	99903956	99903957	2448	6	-	C	C	2	2	C6orf168	C	5	5
ARHGEF10	9639	broad.mit.edu	36	8	1838949	1838950	+	Frame_Shift_Ins	INS	-	G	G			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:1838949_1838950insG	uc003wpr.1	+	c.1746_1747insG	c.(1744-1749)GAAAGAfs	p.E582fs	ARHGEF10_uc003wpq.1_Frame_Shift_Ins_p.E606fs|ARHGEF10_uc003wps.1_Frame_Shift_Ins_p.E544fs|ARHGEF10_uc003wpt.2_Frame_Shift_Ins_p.E458fs|ARHGEF10_uc003wpv.2_Frame_Shift_Ins_p.E315fs|ARHGEF10_uc010lre.1_Frame_Shift_Ins_p.E262fs	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	607_608	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)						2844				0.46			23	27				---	---	---	---	capture_indel			Frame_Shift_Ins	INS	1838949	1838950	908	8	-	G	G	1	1	ARHGEF10	G	5	5
FGFR1	2260	broad.mit.edu	36	8	38396330	38396339	+	Frame_Shift_Del	DEL	AGATGAGGAA	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr8:38396330_38396339delAGATGAGGAA	uc010lwg.1	-	c.1153_1162delTTCCTCATCT	c.(1153-1164)TTCCTCATCTCCfs	p.F385fs	FGFR1_uc010lwh.1_Frame_Shift_Del_p.F383fs|FGFR1_uc010lwi.1_Frame_Shift_Del_p.F294fs|FGFR1_uc010lwj.1_Frame_Shift_Del_p.F296fs|FGFR1_uc010lwk.1_Frame_Shift_Del_p.F377fs|FGFR1_uc003xlp.1_Frame_Shift_Del_p.F385fs|FGFR1_uc003xlt.2_Frame_Shift_Del_p.F225fs|FGFR1_uc010lwl.1_Frame_Shift_Del_p.F416fs|FGFR1_uc010lwm.1_Frame_Shift_Del_p.F383fs|FGFR1_uc010lwn.1_Frame_Shift_Del_p.F296fs|FGFR1_uc010lwf.1_5'Flank	NM_023110	NP_075598	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1 isoform 1	385_388	Helical; (Potential).				axon guidance|cell growth|insulin receptor signaling pathway|MAPKKK cascade|positive regulation of cell proliferation|protein phosphorylation|skeletal system development	extracellular region|integral to plasma membrane|membrane fraction	ATP binding|fibroblast growth factor receptor activity|heparin binding|protein homodimerization activity			lung(5)|central_nervous_system(5)|ovary(1)|breast(1)	12	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)	Melanoma(146;1153 1840 21453 21841 43625)		1		244				0.45			114	139				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	38396330	38396339	6100	8	AGATGAGGAA	-	-	11	11	FGFR1	-	5	5
FPGS	2356	broad.mit.edu	36	9	129615364	129615375	+	In_Frame_Del	DEL	ACCACCTGGACG	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:129615364_129615375delACCACCTGGACG	uc004bsg.1	+	c.1424_1435delACCACCTGGACG	c.(1423-1437)AACCACCTGGACGAA>AAA	p.475_479NHLDE>K	FPGS_uc004bsh.1_In_Frame_Del_p.292_296NHLDE>K|FPGS_uc004bsi.1_In_Frame_Del_p.425_429NHLDE>K	NM_004957	NP_004948	Q05932	FOLC_HUMAN	folylpolyglutamate synthase isoform a precursor	475_479					folic acid metabolic process|folic acid-containing compound biosynthetic process|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|one-carbon metabolic process	cytosol|mitochondrial matrix	ATP binding|tetrahydrofolylpolyglutamate synthase activity				0					L-Glutamic Acid(DB00142)									0.55			12	10				---	---	---	---	capture_indel			In_Frame_Del	DEL	129615364	129615375	6282	9	ACCACCTGGACG	-	-	2	2	FPGS	-	5	5
DAPK1	1612	broad.mit.edu	36	9	89501876	89501894	+	Frame_Shift_Del	DEL	CTGAACCAAGTGATTTTCT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chr9:89501876_89501894delCTGAACCAAGTGATTTTCT	uc004apc.1	+	c.2548_2566delCTGAACCAAGTGATTTTCT	c.(2548-2568)CTGAACCAAGTGATTTTCTGGfs	p.L850fs	DAPK1_uc004apd.1_Frame_Shift_Del_p.L850fs	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	850_856					apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade|protein phosphorylation	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2									p.Q852H(NCIH1436-Tumor)	862				0.58			41	30				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	89501876	89501894	4402	9	CTGAACCAAGTGATTTTCT	-	-	28	28	DAPK1	-	5	5
GABRE	2564	broad.mit.edu	36	X	150874012	150874020	+	In_Frame_Del	DEL	GCAGGCCAG	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:150874012_150874020delGCAGGCCAG	uc004ffi.1	-	c.1330_1338delCTGGCCTGC	c.(1330-1338)CTGGCCTGCdel	p.LAC444del	GABRE_uc004ffg.1_In_Frame_Del_p.LAC299del|GABRE_uc004fff.1_In_Frame_Del_p.LAC331del|GABRE_uc004ffh.1_In_Frame_Del_p.LAC331del	NM_004961	NP_068830	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,	444_446	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)													0.55			16	13				---	---	---	---	capture_indel			In_Frame_Del	DEL	150874012	150874020	6421	23	GCAGGCCAG	-	-	34	34	GABRE	-	5	5
OGT	8473	broad.mit.edu	36	X	70699507	70699508	+	Frame_Shift_Del	DEL	TT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chrX:70699507_70699508delTT	uc004eaa.1	+	c.2063_2064delTT	c.(2062-2064)GTTfs	p.V688fs	OGT_uc004eab.1_Frame_Shift_Del_p.V678fs|OGT_uc004eac.2_Frame_Shift_Del_p.V549fs|OGT_uc004ead.2_Frame_Shift_Del_p.V307fs	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1	688					cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)													0.56			67	53				---	---	---	---	capture_indel			Frame_Shift_Del	DEL	70699507	70699508	11252	23	TT	-	-	60	60	OGT	-	5	5
RPS4Y1	6192	broad.mit.edu	36	Y	2770272	2770277	+	In_Frame_Del	DEL	ACGGGT	-	-			TCGA-28-1757-01	TCGA-28-1757-01										Phase_I	Unspecified				Illumina GAIIx	g.chrY:2770272_2770277delACGGGT	uc004fqi.1	+	c.70_75delACGGGT	c.(70-75)ACGGGTdel	p.TG24del	RPS4Y1_uc004fqe.1_Non-coding_Transcript|RPS4Y1_uc004fqf.1_Intron	NM_001008	NP_000999	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1 Y isoform	24_25					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0						Melanoma(193;1927 2965 17170 18413)								0.35			25	46				---	---	---	---	capture_indel			In_Frame_Del	DEL	2770272	2770277	14126	24	ACGGGT	-	-	2	2	RPS4Y1	-	5	5
