Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TCEB3	6924	broad.mit.edu	37	1	24083610	24083610	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24083610T>C	uc001bho.2	+	10	2390	c.2330T>C	c.(2329-2331)GTG>GCG	p.V777A		NM_003198	NP_003189	Q14241	ELOA1_HUMAN	elongin A	777					positive regulation of viral transcription|regulation of transcription from RNA polymerase II promoter|transcription elongation from RNA polymerase II promoter|viral reproduction	integral to membrane	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		AAACCCACTGTGAAGAGTAAG	0.458													36	7	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34049275	34049275	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34049275C>A	uc001bxn.1	-	48	7242	c.7213G>T	c.(7213-7215)GAG>TAG	p.E2405*	CSMD2_uc001bxm.1_Nonsense_Mutation_p.E2403*	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2405	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TATTGCTTCTCGCTGAGGAAG	0.413													4	81	---	---	---	---	PASS
CAP1	10487	broad.mit.edu	37	1	40530017	40530017	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40530017T>C	uc001cfa.3	+	5	642	c.413T>C	c.(412-414)ATC>ACC	p.I138T	CAP1_uc001cey.3_Missense_Mutation_p.I138T|CAP1_uc001cez.3_Missense_Mutation_p.I138T|CAP1_uc009vvz.2_Missense_Mutation_p.I138T|CAP1_uc010oje.1_Missense_Mutation_p.I55T	NM_006367	NP_006358	Q01518	CAP1_HUMAN	adenylyl cyclase-associated protein	138					activation of adenylate cyclase activity|axon guidance|establishment or maintenance of cell polarity|platelet activation|platelet degranulation|signal transduction	plasma membrane	actin binding			ovary(1)	1	Lung NSC(20;5.03e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;4.63e-18)|Epithelial(16;1.27e-16)|all cancers(16;2.3e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AGCGAAAGTATCCAGGCCCTG	0.517													36	11	---	---	---	---	PASS
EIF2B3	8891	broad.mit.edu	37	1	45444122	45444122	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45444122C>A	uc001cmt.1	-	3	286	c.159G>T	c.(157-159)GTG>GTT	p.V53V	EIF2B3_uc001cmu.1_Silent_p.V53V|EIF2B3_uc001cmv.1_Silent_p.V53V|EIF2B3_uc001cmw.2_Silent_p.V53V	NM_020365	NP_065098	Q9NR50	EI2BG_HUMAN	eukaryotic translation initiation factor 2B,	53					negative regulation of translational initiation in response to stress|oligodendrocyte development|response to glucose stimulus|response to heat|response to peptide hormone stimulus	cytosol|eukaryotic translation initiation factor 2B complex	nucleotidyltransferase activity|protein binding|translation initiation factor activity			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGGTTGTAACCACAATGACTT	0.348													5	117	---	---	---	---	PASS
GPBP1L1	60313	broad.mit.edu	37	1	46099321	46099321	+	Splice_Site	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46099321T>A	uc001coq.2	-	10	2247	c.886_splice	c.e10-1	p.S296_splice	GPBP1L1_uc001coo.2_Splice_Site_p.S40_splice	NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					GGAGGGACTCTGGGCAAATAC	0.502													16	3	---	---	---	---	PASS
PRKAA2	5563	broad.mit.edu	37	1	57140174	57140174	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57140174G>A	uc001cyk.3	+	2	286	c.215G>A	c.(214-216)CGT>CAT	p.R72H		NM_006252	NP_006243	P54646	AAPK2_HUMAN	AMP-activated protein kinase alpha 2 catalytic	72	Protein kinase.				carnitine shuttle|cell cycle arrest|cholesterol biosynthetic process|energy reserve metabolic process|fatty acid biosynthetic process|insulin receptor signaling pathway|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation	cytosol|nucleoplasm	ATP binding|metal ion binding			breast(4)|ovary(1)|stomach(1)	6						AAACTCTTTCGTCATCCTCAT	0.269													18	38	---	---	---	---	PASS
FGGY	55277	broad.mit.edu	37	1	60139733	60139733	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60139733A>T	uc001czi.3	+	14	1652	c.1440A>T	c.(1438-1440)CAA>CAT	p.Q480H	FGGY_uc001czh.2_RNA|FGGY_uc009wac.2_Missense_Mutation_p.Q504H|FGGY_uc001czj.3_Missense_Mutation_p.Q479H|FGGY_uc001czk.3_Missense_Mutation_p.Q368H|FGGY_uc001czl.3_Missense_Mutation_p.Q392H|FGGY_uc001czm.3_Missense_Mutation_p.Q181H	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing	480					carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					TCCTGTCGCAAGAGGTGGAGT	0.612													4	10	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	63100504	63100504	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:63100504C>A	uc001daq.2	-	9	1009	c.975G>T	c.(973-975)CTG>CTT	p.L325L	DOCK7_uc001dan.2_Silent_p.L217L|DOCK7_uc001dao.2_Silent_p.L217L|DOCK7_uc001dap.2_Silent_p.L325L|DOCK7_uc009wah.1_Silent_p.L325L	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	325					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						CTGATCTTGCCAGGGTAGTAA	0.299													5	99	---	---	---	---	PASS
KCNA10	3744	broad.mit.edu	37	1	111060834	111060834	+	Silent	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111060834C>T	uc001dzt.1	-	1	964	c.576G>A	c.(574-576)CTG>CTA	p.L192L		NM_005549	NP_005540	Q16322	KCA10_HUMAN	potassium voltage-gated channel, shaker-related	192						voltage-gated potassium channel complex	intracellular cyclic nucleotide activated cation channel activity|voltage-gated potassium channel activity			ovary(3)|large_intestine(1)	4		all_cancers(81;4.57e-06)|all_epithelial(167;1.52e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|all cancers(265;0.0874)|Colorectal(144;0.103)|Epithelial(280;0.116)|LUSC - Lung squamous cell carcinoma(189;0.134)		TGGTGGGTAGCAGTGTTTCAG	0.527													18	7	---	---	---	---	PASS
NBPF15	284565	broad.mit.edu	37	1	148594604	148594604	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148594604C>G	uc001esc.2	+	19	2466	c.1977C>G	c.(1975-1977)CAC>CAG	p.H659Q		NM_173638	NP_775909	Q8N660	NBPFF_HUMAN	hypothetical protein LOC284565	659	NBPF 6.					cytoplasm					0	all_hematologic(923;0.032)					CAAGTCTCCACCTGGTGTTCC	0.453													4	81	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152286268	152286268	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152286268G>T	uc001ezu.1	-	3	1130	c.1094C>A	c.(1093-1095)TCT>TAT	p.S365Y	uc001ezv.2_RNA	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	365	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGTCCACGAGAGGAAGTCTC	0.562									Ichthyosis				7	270	---	---	---	---	PASS
ARHGEF11	9826	broad.mit.edu	37	1	156913790	156913790	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156913790T>A	uc001fqo.2	-	31	4092	c.3052A>T	c.(3052-3054)AGC>TGC	p.S1018C	ARHGEF11_uc010phu.1_Missense_Mutation_p.S434C|ARHGEF11_uc001fqn.2_Missense_Mutation_p.S1058C	NM_014784	NP_055599	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1018	PH.				actin cytoskeleton organization|apoptosis|axon guidance|cellular component movement|cytokinesis|establishment of cell polarity|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of transcription, DNA-dependent|regulation of cell growth|regulation of Rho protein signal transduction|Rho protein signal transduction|striated muscle contraction	cytosol|Golgi apparatus|plasma membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			ovary(3)|skin(2)|pleura(1)|lung(1)|kidney(1)|pancreas(1)	9	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTCTGCTTGCTGTCTGAGGAG	0.592													23	27	---	---	---	---	PASS
OR6K3	391114	broad.mit.edu	37	1	158687691	158687691	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158687691C>A	uc010pip.1	-	1	263	c.263G>T	c.(262-264)TGG>TTG	p.W88L		NM_001005327	NP_001005327	Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K,	88	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					TGTGGTGTACCAGATCTCCAG	0.423													59	71	---	---	---	---	PASS
OR10J5	127385	broad.mit.edu	37	1	159505361	159505361	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159505361C>G	uc010piw.1	-	1	437	c.437G>C	c.(436-438)TGT>TCT	p.C146S		NM_001004469	NP_001004469	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J,	146	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_hematologic(112;0.0429)					AAAGGACCCACACACCAGCTG	0.512													23	33	---	---	---	---	PASS
KCNJ9	3765	broad.mit.edu	37	1	160057308	160057308	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160057308G>T	uc001fuy.1	+	3	1125	c.883G>T	c.(883-885)GTA>TTA	p.V295L		NM_004983	NP_004974	Q92806	IRK9_HUMAN	potassium inwardly-rectifying channel subfamily	295	Cytoplasmic (By similarity).				synaptic transmission	integral to membrane|plasma membrane	G-protein activated inward rectifier potassium channel activity|protein binding			ovary(1)|skin(1)	2	all_cancers(52;5.86e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCCTACCTGGTAGACGAGGT	0.582													4	44	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176563656	176563656	+	Intron	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176563656C>A	uc001gkz.2	+						PAPPA2_uc001gky.1_Intron|PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TCCTTCTTTCCCAGGTGTGTT	0.493													4	13	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186106962	186106962	+	Silent	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186106962T>C	uc001grq.1	+	89	14011	c.13782T>C	c.(13780-13782)CTT>CTC	p.L4594L	HMCN1_uc001grs.1_Silent_p.L163L	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4594	TSP type-1 2.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AATGGAGTCTTTGGGAAGAAT	0.488													34	42	---	---	---	---	PASS
RASSF5	83593	broad.mit.edu	37	1	206711563	206711563	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206711563G>C	uc001hed.2	+	2	577	c.520G>C	c.(520-522)GAG>CAG	p.E174Q	RASSF5_uc001hec.1_Missense_Mutation_p.E174Q|RASSF5_uc001hee.2_Missense_Mutation_p.E174Q	NM_182663	NP_872604	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family 5	174					apoptosis|intracellular signal transduction	cytoplasm|microtubule	metal ion binding|protein binding			ovary(1)	1	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			CAGTCAGCAGGAGGGTTTATC	0.547													13	60	---	---	---	---	PASS
EXOC8	149371	broad.mit.edu	37	1	231473187	231473187	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231473187G>T	uc001huq.2	-	1	392	c.305C>A	c.(304-306)CCG>CAG	p.P102Q	C1orf124_uc001hur.2_5'Flank|C1orf124_uc001hus.2_5'Flank|C1orf124_uc001hut.2_5'Flank	NM_175876	NP_787072	Q8IYI6	EXOC8_HUMAN	exocyst complex 84-kDa subunit	102					exocytosis|protein transport	growth cone|nucleus	protein binding			skin(1)	1	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				caacgTAAGCGGGATGCTCTC	0.502													3	12	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085236	248085236	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085236G>T	uc010pzc.1	+	1	917	c.917G>T	c.(916-918)TGT>TTT	p.C306F		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ATGGGTCGGTGTGTGGCCTTA	0.423													26	60	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	905878	905878	+	5'Flank	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:905878C>A	uc010ewg.2	-						uc010ewh.1_Missense_Mutation_p.R23L					Homo sapiens cDNA FLJ46162 fis, clone TESTI4002520.																		CCGGGGTCCTCGCCTGCACTG	0.627													6	322	---	---	---	---	PASS
FAM84A	151354	broad.mit.edu	37	2	14774177	14774177	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14774177A>T	uc002rbz.1	+	2	316	c.74A>T	c.(73-75)GAA>GTA	p.E25V	FAM84A_uc002rca.1_5'Flank	NM_145175	NP_660158	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A	25										pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			TCGGGGATTGAAAAGGACGAA	0.622													7	24	---	---	---	---	PASS
RAD51AP2	729475	broad.mit.edu	37	2	17697653	17697653	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17697653G>T	uc002rcl.1	-	1	2054	c.2030C>A	c.(2029-2031)ACA>AAA	p.T677K	RAD51AP2_uc010exn.1_Missense_Mutation_p.T668K	NM_001099218	NP_001092688	Q09MP3	R51A2_HUMAN	RAD51 associated protein 2	677										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CGGAAAACCTGTATTTTGAGT	0.274													5	36	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21236080	21236080	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21236080G>T	uc002red.2	-	25	4296	c.4168C>A	c.(4168-4170)CAC>AAC	p.H1390N		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	1390					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	GCCTTCATGTGGTAACGAGCC	0.532													6	167	---	---	---	---	PASS
UBXN2A	165324	broad.mit.edu	37	2	24199905	24199905	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24199905G>A	uc010exy.2	+	5	715	c.247G>A	c.(247-249)GAT>AAT	p.D83N	UBXN2A_uc002rem.2_RNA|UBXN2A_uc002ren.2_Missense_Mutation_p.D83N|UBXN2A_uc010ykj.1_Missense_Mutation_p.D83N	NM_181713	NP_859064	P68543	UBX2A_HUMAN	UBX domain containing 4	83	SEP.										0						AAGTTATTCCGATGGTGCCAG	0.284													6	74	---	---	---	---	PASS
PNPT1	87178	broad.mit.edu	37	2	55895077	55895077	+	Silent	SNP	G	C	C	rs147013543		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55895077G>C	uc002rzf.2	-	12	1046	c.993C>G	c.(991-993)GCC>GCG	p.A331A	PNPT1_uc002rzg.2_RNA	NM_033109	NP_149100	Q8TCS8	PNPT1_HUMAN	polyribonucleotide nucleotidyltransferase 1	331					mRNA catabolic process|RNA processing	plasma membrane	3'-5'-exoribonuclease activity|polyribonucleotide nucleotidyltransferase activity|RNA binding				0			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CATATGGATCGGCTTCTGGAA	0.279													8	23	---	---	---	---	PASS
WDR54	84058	broad.mit.edu	37	2	74652764	74652764	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74652764C>A	uc002slb.2	+	10	1001	c.941C>A	c.(940-942)TCA>TAA	p.S314*		NM_032118	NP_115494	Q9H977	WDR54_HUMAN	WD repeat domain 54	314											0						TGTGATTCCTCAGGCAACTCC	0.557													6	175	---	---	---	---	PASS
IL1R2	7850	broad.mit.edu	37	2	102632492	102632492	+	Silent	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102632492C>T	uc002tbm.2	+	4	721	c.492C>T	c.(490-492)GAC>GAT	p.D164D	IL1R2_uc002tbn.2_Silent_p.D164D|IL1R2_uc002tbo.1_Silent_p.D164D	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	164	Extracellular (Potential).|Ig-like C2-type 2.				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	ACAAAACTGACGTGAAGATTC	0.378													7	24	---	---	---	---	PASS
GPR39	2863	broad.mit.edu	37	2	133402844	133402844	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133402844C>A	uc002ttl.2	+	2	1496	c.1027C>A	c.(1027-1029)CTG>ATG	p.L343M	LYPD1_uc002ttm.3_3'UTR|LYPD1_uc002ttn.2_3'UTR|LYPD1_uc002tto.2_3'UTR	NM_001508	NP_001499	O43194	GPR39_HUMAN	G protein-coupled receptor 39	343	Helical; Name=7; (Potential).					integral to plasma membrane	G-protein coupled receptor activity|metal ion binding				0						CAACCCGCTCCTGTACACGGT	0.622													5	54	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160294950	160294950	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160294950G>T	uc002uao.2	-	8	1509	c.1157C>A	c.(1156-1158)CCT>CAT	p.P386H	BAZ2B_uc002uap.2_Missense_Mutation_p.P384H|BAZ2B_uc002uas.1_Missense_Mutation_p.P323H|BAZ2B_uc002uau.1_Missense_Mutation_p.P384H|BAZ2B_uc002uaq.1_Missense_Mutation_p.P314H|BAZ2B_uc002uat.3_3'UTR|BAZ2B_uc010fop.1_Missense_Mutation_p.P384H	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	386					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CAAAGATAAAGGTTTCACATT	0.383													6	53	---	---	---	---	PASS
CSRNP3	80034	broad.mit.edu	37	2	166532891	166532891	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166532891G>A	uc002udf.2	+	6	854	c.478G>A	c.(478-480)GAC>AAC	p.D160N	CSRNP3_uc002udg.2_Missense_Mutation_p.D160N	NM_024969	NP_079245	Q8WYN3	CSRN3_HUMAN	cysteine-serine-rich nuclear protein 3	160					apoptosis|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|large_intestine(1)|skin(1)	5						TTCTGATGATGACATTGACCT	0.423													46	212	---	---	---	---	PASS
CHN1	1123	broad.mit.edu	37	2	175664914	175664914	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175664914G>A	uc002uji.2	-	13	1840	c.1310C>T	c.(1309-1311)GCA>GTA	p.A437V	CHN1_uc010zeq.1_Missense_Mutation_p.A411V|CHN1_uc002ujj.2_Missense_Mutation_p.A212V|CHN1_uc002ujg.2_Missense_Mutation_p.A312V	NM_001822	NP_001813	P15882	CHIN_HUMAN	chimerin (chimaerin) 1 isoform a	437	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.226)			ATCATTCAATGCAGCCATGGC	0.403			T	TAF15	extraskeletal myxoid chondrosarcoma								8	43	---	---	---	---	PASS
ZSWIM2	151112	broad.mit.edu	37	2	187709452	187709452	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187709452T>A	uc002upu.1	-	3	315	c.275A>T	c.(274-276)AAC>ATC	p.N92I		NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2	92					apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			ACATTCATGGTTCCTTGGAAG	0.254													25	28	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197087045	197087045	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197087045G>T	uc002utm.1	-	24	4219	c.4036C>A	c.(4036-4038)CTA>ATA	p.L1346I	HECW2_uc002utl.1_Missense_Mutation_p.L990I	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	1346	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						AGGTATTCTAGGTCACTCAGG	0.408													5	68	---	---	---	---	PASS
NBEAL1	65065	broad.mit.edu	37	2	204032030	204032030	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204032030C>T	uc002uzt.3	+	37	6190	c.5857C>T	c.(5857-5859)CTT>TTT	p.L1953F	NBEAL1_uc002uzs.3_Missense_Mutation_p.L663F	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3	1953							binding			ovary(1)|skin(1)	2						AAGATCAGCCCTTGAGATTTT	0.363													16	51	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216247035	216247035	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216247035C>T	uc002vfa.2	-	32	5330	c.5064G>A	c.(5062-5064)ATG>ATA	p.M1688I	FN1_uc002vfb.2_Missense_Mutation_p.M1597I|FN1_uc002vfc.2_Missense_Mutation_p.M1597I|FN1_uc002vfd.2_Missense_Mutation_p.M1688I|FN1_uc002vfe.2_Missense_Mutation_p.M1597I|FN1_uc002vff.2_Missense_Mutation_p.M1597I|FN1_uc002vfg.2_Missense_Mutation_p.M1597I|FN1_uc002vfh.2_Missense_Mutation_p.M1597I|FN1_uc002vfi.2_Missense_Mutation_p.M1688I|FN1_uc002vfj.2_Missense_Mutation_p.M1688I|FN1_uc002vez.2_5'UTR|FN1_uc010zjp.1_Missense_Mutation_p.M315I|FN1_uc010fvc.1_Missense_Mutation_p.M50I|FN1_uc010fvd.1_Missense_Mutation_p.M50I	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CTTCAATAGTCATTTCTGTTT	0.453													6	35	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234347023	234347023	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234347023C>A	uc002vui.1	+	9	1095	c.1083C>A	c.(1081-1083)CTC>CTA	p.L361L	DGKD_uc002vuj.1_Silent_p.L317L|DGKD_uc010fyh.1_Silent_p.L228L|DGKD_uc010fyi.1_RNA|DGKD_uc002vuk.1_Silent_p.L228L	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	361	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	GCCCACACCTCGGGTAGGAAG	0.413													4	98	---	---	---	---	PASS
ITPR1	3708	broad.mit.edu	37	3	4817034	4817034	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4817034G>T	uc003bqa.2	+	44	6292	c.5944G>T	c.(5944-5946)GGC>TGC	p.G1982C	ITPR1_uc010hca.1_Missense_Mutation_p.G1967C|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Missense_Mutation_p.G952C	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	2030	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding	p.L1982L(1)		lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		TGGTCTTCTGGGCTTGTATAT	0.433													6	81	---	---	---	---	PASS
STT3B	201595	broad.mit.edu	37	3	31641848	31641848	+	Intron	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:31641848A>G	uc011axe.1	+						STT3B_uc010hft.1_Intron|STT3B_uc003cer.1_Intron|STT3B_uc003cet.2_Intron	NM_178862	NP_849193	Q8TCJ2	STT3B_HUMAN	source of immunodominant MHC-associated						protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0						TTCTTTTCCTATAGGTCTCTG	0.274													5	8	---	---	---	---	PASS
PRSS45	377047	broad.mit.edu	37	3	46785594	46785594	+	Silent	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46785594C>T	uc010hjl.2	-	2	150	c.150G>A	c.(148-150)AAG>AAA	p.K50K	PRSS45_uc011bam.1_RNA	NM_199183	NP_954652	Q7RTY3	PRS45_HUMAN	testis serine protease 5	50	Peptidase S1.				proteolysis		serine-type endopeptidase activity				0						TGGGCTGCAGCTTGGAGGTGC	0.577													4	4	---	---	---	---	PASS
MIR548I1	100302204	broad.mit.edu	37	3	125509278	125509278	+	RNA	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125509278G>T	hsa-mir-548i-1|MI0006421	-			c.118G>T																				0						TTTGGTAGAAGGAGAAAAGAT	0.259													6	77	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134851709	134851709	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134851709G>T	uc003eqt.2	+	5	1335	c.1115G>T	c.(1114-1116)CGC>CTC	p.R372L	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_3'UTR|EPHB1_uc003equ.2_5'UTR	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	372	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						AGCTGCTCCCGCTGTGACGAC	0.617													19	13	---	---	---	---	PASS
EIF2A	83939	broad.mit.edu	37	3	150301010	150301010	+	Silent	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150301010G>A	uc003eya.2	+	13	1666	c.1650G>A	c.(1648-1650)CTG>CTA	p.L550L	SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Silent_p.L423L|EIF2A_uc003eyc.2_Silent_p.L423L|EIF2A_uc011bnv.1_Silent_p.L525L|EIF2A_uc011bnw.1_Silent_p.L489L|EIF2A_uc003eyd.2_Silent_p.L325L|uc003eye.1_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A	550	Potential.				regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			TCGAACAACTGAAAGAACAAG	0.368													22	190	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164739162	164739162	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164739162G>A	uc003fei.2	-	27	3171	c.3109C>T	c.(3109-3111)CCC>TCC	p.P1037S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1037	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTCTTTTGGGGATCATAAATC	0.328										HNSCC(35;0.089)			9	273	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164792369	164792369	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164792369C>A	uc003fei.2	-	3	267	c.205G>T	c.(205-207)GAT>TAT	p.D69Y		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	69	Lumenal.|P-type 1.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TTGACAGGATCATTTAACACA	0.333										HNSCC(35;0.089)			17	72	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165504037	165504037	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165504037T>C	uc003fem.3	-	3	1740	c.1580A>G	c.(1579-1581)AAA>AGA	p.K527R	BCHE_uc003fen.3_RNA	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	527					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	GGTTAGATATTTTTGTTCAGT	0.333													23	51	---	---	---	---	PASS
HTR3E	285242	broad.mit.edu	37	3	183818359	183818359	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183818359A>C	uc010hxq.2	+	2	620	c.154A>C	c.(154-156)AAG>CAG	p.K52Q	HTR3E_uc003fml.3_Missense_Mutation_p.K52Q|HTR3E_uc003fmm.2_Missense_Mutation_p.K67Q|HTR3E_uc010hxr.2_Missense_Mutation_p.K67Q|HTR3E_uc003fmn.2_Missense_Mutation_p.K67Q	NM_182589	NP_872395	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine receptor 3 subunit E	52	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GTTTAATAGAAAGCCCTTCCG	0.537													37	305	---	---	---	---	PASS
EIF4G1	1981	broad.mit.edu	37	3	184045465	184045465	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184045465G>T	uc003fnp.2	+	25	3951	c.3753G>T	c.(3751-3753)GAG>GAT	p.E1251D	EIF4G1_uc003fnt.2_Missense_Mutation_p.E962D|EIF4G1_uc003fnq.2_Missense_Mutation_p.E1164D|EIF4G1_uc003fnr.2_Missense_Mutation_p.E1087D|EIF4G1_uc010hxx.2_Missense_Mutation_p.E1258D|EIF4G1_uc003fns.2_Missense_Mutation_p.E1211D|EIF4G1_uc010hxy.2_Missense_Mutation_p.E1258D|EIF4G1_uc003fnv.3_Missense_Mutation_p.E1252D|EIF4G1_uc003fnu.3_Missense_Mutation_p.E1251D|EIF4G1_uc003fnw.2_Missense_Mutation_p.E1258D|EIF4G1_uc003fnx.2_Missense_Mutation_p.E1056D|EIF4G1_uc003fny.3_Missense_Mutation_p.E1055D|EIF4G1_uc003foa.2_5'Flank	NM_198241	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4	1251	MI.				insulin receptor signaling pathway|interspecies interaction between organisms|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	protein binding|translation initiation factor activity			lung(2)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTATCATTGAGGAATATCTCC	0.562													7	176	---	---	---	---	PASS
MAGEF1	64110	broad.mit.edu	37	3	184429384	184429384	+	Silent	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184429384G>A	uc003fpa.2	-	1	453	c.226C>T	c.(226-228)CTG>TTG	p.L76L		NM_022149	NP_071432	Q9HAY2	MAGF1_HUMAN	melanoma antigen family F, 1	76	MAGE.									ovary(1)	1	all_cancers(143;4.61e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;5.64e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.56e-22)			GTCCGATTCAGCCGGCGGTAG	0.642													24	129	---	---	---	---	PASS
VPS8	23355	broad.mit.edu	37	3	184675210	184675210	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184675210C>A	uc003fpb.1	+	36	3249	c.3078C>A	c.(3076-3078)ATC>ATA	p.I1026I	VPS8_uc010hyd.1_Silent_p.I936I|VPS8_uc010hye.1_Silent_p.I455I	NM_015303	NP_056118	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog isoform b	1028							zinc ion binding			ovary(1)	1	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			CTCCTTGTATCACAGAGCAGT	0.373													8	65	---	---	---	---	PASS
LSG1	55341	broad.mit.edu	37	3	194366966	194366966	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194366966C>A	uc003fui.2	-	12	1865	c.1550G>T	c.(1549-1551)CGA>CTA	p.R517L		NM_018385	NP_060855	Q9H089	LSG1_HUMAN	large subunit GTPase 1	517					nuclear export|protein transport	Cajal body|endoplasmic reticulum	GTP binding|hydrolase activity				0	all_cancers(143;1.68e-08)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;4.34e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;7.55e-06)		CATGAATCCTCGCATGTCTGT	0.448													5	197	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195484025	195484025	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195484025G>T	uc011bto.1	-	19	15237	c.14777C>A	c.(14776-14778)TCC>TAC	p.S4926Y	MUC4_uc003fuz.2_Missense_Mutation_p.S652Y|MUC4_uc003fva.2_Missense_Mutation_p.S534Y|MUC4_uc003fvb.2_Missense_Mutation_p.S570Y|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Missense_Mutation_p.S570Y|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Missense_Mutation_p.S534Y|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Missense_Mutation_p.S618Y|MUC4_uc011bti.1_Missense_Mutation_p.S618Y|MUC4_uc011btj.1_Missense_Mutation_p.S795Y|MUC4_uc011btk.1_Missense_Mutation_p.S534Y|MUC4_uc011btl.1_Missense_Mutation_p.S563Y|MUC4_uc011btm.1_Missense_Mutation_p.S743Y|MUC4_uc011btn.1_Missense_Mutation_p.S534Y|MUC4_uc003fvo.2_Missense_Mutation_p.S818Y|MUC4_uc003fvp.2_Missense_Mutation_p.S767Y	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1811					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CACCTCCAGGGAGGAGTTGCC	0.572													7	184	---	---	---	---	PASS
UBXN7	26043	broad.mit.edu	37	3	196083658	196083658	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196083658G>T	uc003fwm.3	-	11	1443	c.1368C>A	c.(1366-1368)ACC>ACA	p.T456T	UBXN7_uc003fwn.3_Silent_p.T308T|UBXN7_uc010iae.2_Silent_p.T294T	NM_015562	NP_056377	O94888	UBXN7_HUMAN	UBX domain containing 7	456	UBX.						protein binding			ovary(2)|pancreas(1)	3						GAGGAAAGTTGGTGAGAAGTT	0.393													6	130	---	---	---	---	PASS
FAM193A	8603	broad.mit.edu	37	4	2696737	2696737	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2696737G>A	uc010icl.2	+	15	2635	c.2284G>A	c.(2284-2286)GAC>AAC	p.D762N	FAM193A_uc010ick.2_Missense_Mutation_p.D962N|FAM193A_uc003gfd.2_Missense_Mutation_p.D762N|FAM193A_uc011bvm.1_Missense_Mutation_p.D784N|FAM193A_uc011bvn.1_Missense_Mutation_p.D762N|FAM193A_uc011bvo.1_RNA|FAM193A_uc010icm.2_RNA|FAM193A_uc003gfe.2_Missense_Mutation_p.D616N	NM_003704	NP_003695	P78312	F193A_HUMAN	hypothetical protein LOC8603	762										ovary(3)	3						GGATGATGGGGACGAGAGTGC	0.587													4	7	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5578179	5578179	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5578179C>G	uc003gij.2	-	18	3114	c.3060G>C	c.(3058-3060)GAG>GAC	p.E1020D	EVC2_uc011bwb.1_Missense_Mutation_p.E460D|EVC2_uc003gik.2_Missense_Mutation_p.E940D	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	1020	Potential.					integral to membrane				large_intestine(3)|ovary(2)	5						ACTCCTGGAGCTCCTACACAA	0.627													4	2	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42145969	42145969	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42145969C>G	uc003gwn.2	-	3	1110	c.530G>C	c.(529-531)CGA>CCA	p.R177P	BEND4_uc003gwm.2_Missense_Mutation_p.R177P|BEND4_uc011byy.1_Missense_Mutation_p.R177P	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	177											0						GCTAAGAACTCGACTGCACTG	0.438													18	6	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48566052	48566052	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48566052A>G	uc003gyh.1	-	31	4114	c.3509T>C	c.(3508-3510)ATG>ACG	p.M1170T	FRYL_uc003gyk.2_Missense_Mutation_p.M1170T|FRYL_uc003gyi.1_Missense_Mutation_p.M59T	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	1170					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AGCCCAGTACATCAGGTTGCT	0.527													9	63	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76805858	76805858	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76805858C>A	uc003hix.2	-	8	992	c.635G>T	c.(634-636)CGA>CTA	p.R212L	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.R212L	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	212	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ATCCTTGCCTCGATCCACAAA	0.458													5	176	---	---	---	---	PASS
C4orf37	285555	broad.mit.edu	37	4	98480197	98480197	+	3'UTR	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:98480197C>A	uc003htt.1	-	11						NM_174952	NP_777612	Q8N412	CD037_HUMAN	hypothetical protein LOC285555												0				OV - Ovarian serous cystadenocarcinoma(123;2.27e-08)		AAGTTTTTGCCATAAATTTAT	0.279													7	19	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114251433	114251433	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114251433G>A	uc003ibe.3	+	27	3032	c.2932G>A	c.(2932-2934)GGT>AGT	p.G978S	ANK2_uc003ibd.3_Missense_Mutation_p.G969S|ANK2_uc003ibf.3_Missense_Mutation_p.G978S|ANK2_uc011cgc.1_Missense_Mutation_p.G187S|ANK2_uc003ibg.3_Missense_Mutation_p.G6S|ANK2_uc003ibc.2_Missense_Mutation_p.G954S|ANK2_uc011cgb.1_Missense_Mutation_p.G993S	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	978	ZU5.|Interaction with SPTBN1.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GGATGCCCGAGGTGGTGCTAT	0.448													9	9	---	---	---	---	PASS
RAPGEF2	9693	broad.mit.edu	37	4	160274672	160274672	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:160274672A>T	uc003iqg.3	+	22	3952	c.3642A>T	c.(3640-3642)TTA>TTT	p.L1214F		NM_014247	NP_055062	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor 2	1214					cAMP-mediated signaling|MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|Rap GTPase activator activity|Rap guanyl-nucleotide exchange factor activity|signal transducer activity			lung(2)|upper_aerodigestive_tract(1)|skin(1)	4	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		GCCGAGGCTTATATGCTACAG	0.443													24	26	---	---	---	---	PASS
KLHL2	11275	broad.mit.edu	37	4	166215563	166215563	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:166215563C>G	uc003irb.2	+	6	856	c.597C>G	c.(595-597)ATC>ATG	p.I199M	KLHL2_uc011cjm.1_Missense_Mutation_p.I203M|KLHL2_uc003irc.2_Missense_Mutation_p.I111M|KLHL2_uc010ira.2_Translation_Start_Site	NM_007246	NP_009177	O95198	KLHL2_HUMAN	kelch-like 2, Mayven isoform 1	199					intracellular protein transport	actin cytoskeleton|cytoplasm	actin binding|transporter activity				0	all_hematologic(180;0.221)			GBM - Glioblastoma multiforme(119;2.94e-27)|COAD - Colon adenocarcinoma(41;1.4e-05)|Kidney(143;4.95e-05)|KIRC - Kidney renal clear cell carcinoma(143;0.000927)		ATCTTGGCATCGAACAAGTGT	0.353													4	15	---	---	---	---	PASS
GLRA3	8001	broad.mit.edu	37	4	175598344	175598344	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175598344G>T	uc003ity.1	-	7	1315	c.812C>A	c.(811-813)TCC>TAC	p.S271Y	GLRA3_uc003itz.1_Missense_Mutation_p.S271Y	NM_006529	NP_006520	O75311	GLRA3_HUMAN	glycine receptor, alpha 3 isoform a	271	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|receptor activity|transmitter-gated ion channel activity			ovary(3)	3		Prostate(90;0.00601)|Breast(14;0.0091)|Melanoma(52;0.00959)|Renal(120;0.0183)|all_neural(102;0.0891)|all_hematologic(60;0.107)		all cancers(43;4.99e-18)|Epithelial(43;1.18e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.88e-09)|STAD - Stomach adenocarcinoma(60;0.00442)|GBM - Glioblastoma multiforme(59;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0421)	Glycine(DB00145)	TGAAACCCAGGATAGAATAAC	0.468													4	19	---	---	---	---	PASS
ASB5	140458	broad.mit.edu	37	4	177136878	177136878	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177136878G>C	uc003iuq.1	-	7	879	c.863C>G	c.(862-864)GCT>GGT	p.A288G	ASB5_uc003iup.1_Missense_Mutation_p.A235G	NM_080874	NP_543150	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box-containing protein	288	SOCS box.				intracellular signal transduction					skin(2)	2		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		GCTTGGGGTAGCTACAAGAAG	0.353													8	19	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187630181	187630181	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187630181C>A	uc003izf.2	-	2	989	c.801G>T	c.(799-801)CTG>CTT	p.L267L	FAT1_uc010iso.1_Silent_p.L267L	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	267	Extracellular (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						GGTCCCTGTCCAGTTCTGATG	0.522										HNSCC(5;0.00058)			7	262	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5463104	5463104	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5463104C>A	uc003jdm.3	+	13	3879	c.3657C>A	c.(3655-3657)TAC>TAA	p.Y1219*		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	1219										ovary(1)|central_nervous_system(1)	2						GAGAAAAATACAGAAAGCAAC	0.363													4	51	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065919	35065919	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065919C>T	uc003jjm.2	-	10	1671	c.1141G>A	c.(1141-1143)GAG>AAG	p.E381K	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Missense_Mutation_p.E280K	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	381	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TCTGGCTTCTCAATGACCTCA	0.517													18	51	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262556	45262556	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262556C>A	uc003jok.2	-	8	2165	c.2140G>T	c.(2140-2142)GCT>TCT	p.A714S		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	714	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AAAGTTCGAGCGGCCAGAGGG	0.483													6	16	---	---	---	---	PASS
SNX18	112574	broad.mit.edu	37	5	53814757	53814757	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53814757G>C	uc003jpj.3	+	1	1165	c.975G>C	c.(973-975)GAG>GAC	p.E325D	SNX18_uc011cqg.1_Missense_Mutation_p.E325D|SNX18_uc003jpi.3_Missense_Mutation_p.E325D	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform b	325	PX.				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				GCCTGGCGGAGAAGTTCCCGG	0.632													6	16	---	---	---	---	PASS
SNX18	112574	broad.mit.edu	37	5	53814938	53814938	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53814938G>T	uc003jpj.3	+	1	1346	c.1156G>T	c.(1156-1158)GAC>TAC	p.D386Y	SNX18_uc011cqg.1_Missense_Mutation_p.D386Y|SNX18_uc003jpi.3_Missense_Mutation_p.D386Y	NM_052870	NP_443102	Q96RF0	SNX18_HUMAN	sorting nexin 18 isoform b	386	PX.				cell communication|endocytosis|positive regulation of GTPase activity|protein transport	endomembrane system|endosome membrane|extrinsic to internal side of plasma membrane	phosphatidylinositol binding|protein binding				0		Lung NSC(810;3.46e-05)|Breast(144;0.102)				CAGCAGCACCGACGAGAAAGC	0.642													5	12	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112175468	112175468	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175468C>A	uc010jby.2	+	16	4557	c.4177C>A	c.(4177-4179)CTT>ATT	p.L1393I	APC_uc011cvt.1_Missense_Mutation_p.L1375I|APC_uc003kpz.3_Missense_Mutation_p.L1393I|APC_uc003kpy.3_Missense_Mutation_p.L1393I|APC_uc010jbz.2_Missense_Mutation_p.L1110I|APC_uc010jca.2_Missense_Mutation_p.L693I	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1393	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.D1394fs*1(3)|p.L1393P(1)|p.Y1376fs*41(1)|p.K1192fs*3(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TGTCAGTTCACTTGATAGTTT	0.468		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			21	33	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134143584	134143584	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134143584G>T	uc003kzw.2	+	16	2269	c.2101G>T	c.(2101-2103)GAG>TAG	p.E701*	DDX46_uc003kzv.1_RNA	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	701	Helicase C-terminal.				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CAACCATTATGAGGATTATGT	0.398													6	38	---	---	---	---	PASS
TIFAB	497189	broad.mit.edu	37	5	134785627	134785627	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134785627C>A	uc003law.3	-	2	204	c.3G>T	c.(1-3)ATG>ATT	p.M1I	C5orf20_uc003lav.2_5'Flank	NM_001099221	NP_001092691	Q6ZNK6	TIFAB_HUMAN	TIFA-related protein TIFAB	1											0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GGGGCTTCTCCATGGAAGAAG	0.597													4	38	---	---	---	---	PASS
SIL1	64374	broad.mit.edu	37	5	138356904	138356904	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138356904G>T	uc003ldm.2	-	6	740	c.723C>A	c.(721-723)CTC>CTA	p.L241L	SIL1_uc003ldn.2_Silent_p.L240L|SIL1_uc003ldo.2_Silent_p.L241L|SIL1_uc003ldp.2_Silent_p.L241L|SIL1_uc003ldq.1_Silent_p.L34L	NM_022464	NP_071909	Q9H173	SIL1_HUMAN	SIL1 protein precursor	241	Interaction with HSPA5 and localization to the endoplasmic reticulum (By similarity).				intracellular protein transport|protein folding|transmembrane transport	endoplasmic reticulum lumen	unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ACTCCTTCACGAGGGGCTCTG	0.537									Marinesco-Sj_gren_syndrome				4	43	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145649058	145649058	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145649058G>A	uc003lnz.3	+	17	2768	c.2602G>A	c.(2602-2604)GAG>AAG	p.E868K	RBM27_uc003lny.2_Missense_Mutation_p.E813K	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	868	Potential.				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GACTTTGAAAGAGCTTGGAGA	0.308													17	31	---	---	---	---	PASS
PPARGC1B	133522	broad.mit.edu	37	5	149216148	149216148	+	Silent	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149216148G>A	uc003lrc.2	+	8	2172	c.2130G>A	c.(2128-2130)AGG>AGA	p.R710R	PPARGC1B_uc003lrb.1_Silent_p.R710R|PPARGC1B_uc003lrd.2_Silent_p.R671R|PPARGC1B_uc003lrf.2_Silent_p.R689R|PPARGC1B_uc003lre.1_Silent_p.R689R	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor	710					estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			AGGTGCTGAGGTCCTGGGAGC	0.637													10	19	---	---	---	---	PASS
SYNPO	11346	broad.mit.edu	37	5	150028164	150028164	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150028164G>T	uc003lsn.2	+	3	1433	c.1059G>T	c.(1057-1059)CTG>CTT	p.L353L	SYNPO_uc003lso.3_Silent_p.L109L|SYNPO_uc003lsp.2_Silent_p.L109L	NM_001109974	NP_001103444	Q8N3V7	SYNPO_HUMAN	synaptopodin isoform B	353					positive regulation of actin filament bundle assembly|regulation of stress fiber assembly	actin cytoskeleton|cytoplasm|dendritic spine|perikaryon|postsynaptic density|postsynaptic membrane|tight junction	actin binding|protein binding			large_intestine(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACAGAGCCTGCCACTTTCTA	0.567													5	102	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161116753	161116753	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161116753C>G	uc003lyu.2	+	6	979	c.641C>G	c.(640-642)ACA>AGA	p.T214R	GABRA6_uc003lyv.2_5'UTR	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	214	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity	p.T214I(1)		ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ATTGGACAAACAGTATCTAGT	0.363										TCGA Ovarian(5;0.080)			17	29	---	---	---	---	PASS
TBC1D9B	23061	broad.mit.edu	37	5	179320369	179320369	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179320369G>A	uc003mlh.2	-	5	713	c.676C>T	c.(676-678)CTC>TTC	p.L226F	TBC1D9B_uc003mli.2_Missense_Mutation_p.L226F|TBC1D9B_uc003mlj.2_Missense_Mutation_p.L226F	NM_198868	NP_942568	Q66K14	TBC9B_HUMAN	TBC1 domain family, member 9B (with GRAM domain)	226						integral to membrane|intracellular	calcium ion binding|Rab GTPase activator activity			breast(1)|skin(1)	2	all_cancers(89;0.000197)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0236)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAGAAGAAGAGCTCCTGGTCG	0.607													11	28	---	---	---	---	PASS
HDGFL1	154150	broad.mit.edu	37	6	22569818	22569818	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22569818G>T	uc003nds.2	+	1	141	c.14G>T	c.(13-15)GGC>GTC	p.G5V		NM_138574	NP_612641	Q5TGJ6	HDGL1_HUMAN	hepatoma derived growth factor-like 1	5											0	Ovarian(93;0.163)					TCGGCCTACGGCATGCCCATG	0.647													17	2	---	---	---	---	PASS
GABBR1	2550	broad.mit.edu	37	6	29572420	29572420	+	Intron	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29572420G>A	uc003nmt.3	-						GABBR1_uc003nmp.3_Intron|GABBR1_uc003nms.3_Intron|GABBR1_uc003nmu.3_Intron|GABBR1_uc011dlr.1_Intron	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	CGCATCTGGGGGCAAATGTTT	0.572													10	29	---	---	---	---	PASS
DEFB114	245928	broad.mit.edu	37	6	49928165	49928165	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49928165G>T	uc011dwp.1	-							NM_001037499	NP_001032588	Q30KQ6	DB114_HUMAN	beta-defensin 114 precursor						defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					TGTGGCTACGGTAAAAGAAGA	0.338													9	20	---	---	---	---	PASS
GSTA4	2941	broad.mit.edu	37	6	52849319	52849319	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52849319C>A	uc003pbc.2	-	4	421	c.357G>T	c.(355-357)AAG>AAT	p.K119N	GSTA4_uc003pbd.2_Missense_Mutation_p.K26N|GSTA4_uc003pbe.2_Missense_Mutation_p.K26N|GSTA4_uc003pbf.2_Missense_Mutation_p.K119N	NM_001512	NP_001503	O15217	GSTA4_HUMAN	glutathione S-transferase alpha 4	119	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity|protein homodimerization activity				0	Lung NSC(77;0.103)				Glutathione(DB00143)	TAACCACTTCCTTTTGCTGAT	0.428													5	58	---	---	---	---	PASS
RAB23	51715	broad.mit.edu	37	6	57075140	57075140	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57075140C>A	uc003pds.2	-	2	245	c.39G>T	c.(37-39)GTG>GTT	p.V13V	RAB23_uc003pdt.2_Silent_p.V13V|RAB23_uc010kac.2_Silent_p.V13V|RAB23_uc010kad.2_RNA	NM_183227	NP_899050	Q9ULC3	RAB23_HUMAN	Ras-related protein Rab-23	13			Missing.		protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			skin(1)	1	Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			TCCCTACAACCACCATCTTTA	0.383													6	124	---	---	---	---	PASS
CD109	135228	broad.mit.edu	37	6	74520791	74520791	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74520791C>T	uc003php.2	+	28	4048	c.3623C>T	c.(3622-3624)ACC>ATC	p.T1208I	CD109_uc010kaz.2_Intron|CD109_uc003phq.2_Missense_Mutation_p.T1208I|CD109_uc010kba.2_Missense_Mutation_p.T1131I	NM_133493	NP_598000	Q6YHK3	CD109_HUMAN	CD109 antigen isoform 1 precursor	1208						anchored to membrane|extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			large_intestine(2)|ovary(2)	4						ATCCAAGTGACCGTGACGGGG	0.468													17	48	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75814968	75814968	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75814968G>T	uc003phs.2	-	54	8385	c.8219C>A	c.(8218-8220)ACA>AAA	p.T2740K	COL12A1_uc003pht.2_Missense_Mutation_p.T1576K	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform	2740	Nonhelical region (NC3).				cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						CTGTGTACATGTGCAAGAATT	0.393													7	15	---	---	---	---	PASS
SASH1	23328	broad.mit.edu	37	6	148861573	148861573	+	Intron	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:148861573C>T	uc003qme.1	+						SASH1_uc011eeb.1_Intron|SASH1_uc003qmf.1_Intron	NM_015278	NP_056093	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1								protein binding			central_nervous_system(1)	1		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		GTGTTCTCTCCTCTAGGTAAC	0.517													4	17	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151917703	151917703	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151917703T>G	uc003qol.2	+	9	1790	c.1701T>G	c.(1699-1701)AAT>AAG	p.N567K		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	567	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		CCGACACCAATGAACTGAAGG	0.478													30	56	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152763389	152763389	+	Intron	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152763389A>T	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron|SYNE1_uc003qow.2_Intron|SYNE1_uc003qox.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGCTAGAAGCATTTATTCAAC	0.498										HNSCC(10;0.0054)			18	8	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169621534	169621534	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169621534C>G	uc003qwt.2	-	21	3610	c.3362G>C	c.(3361-3363)GGC>GCC	p.G1121A		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	1121	TSP C-terminal.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CCTGATGTAGCCAGTCTTGGG	0.527													8	70	---	---	---	---	PASS
COX19	90639	broad.mit.edu	37	7	1009037	1009037	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1009037C>A	uc003sjp.1	-	3	340	c.250G>T	c.(250-252)GGA>TGA	p.G84*	ADAP1_uc010ksc.2_Intron	NM_001031617	NP_001026788	Q49B96	COX19_HUMAN	COX19 cytochrome c oxidase assembly homolog	84						cytosol					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;2.15e-15)		TCTGATTTTCCACTAGTCAAG	0.473													9	287	---	---	---	---	PASS
EPHB4	2050	broad.mit.edu	37	7	100421257	100421257	+	Intron	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100421257C>G	uc003uwn.1	-						EPHB4_uc003uwm.1_Intron|EPHB4_uc010lhj.1_Intron|EPHB4_uc011kkf.1_Intron|EPHB4_uc011kkg.1_Intron|EPHB4_uc011kkh.1_Intron	NM_004444	NP_004435	P54760	EPHB4_HUMAN	EPH receptor B4 precursor						cell proliferation|organ morphogenesis|regulation of angiogenesis	cell surface|integral to plasma membrane	ATP binding|ephrin receptor activity			lung(4)|stomach(3)|skin(3)|central_nervous_system(2)|ovary(2)|breast(1)	15	Lung NSC(181;0.041)|all_lung(186;0.0581)					CCTGGGGGCACCCAGGTACCT	0.657													4	11	---	---	---	---	PASS
CTTNBP2	83992	broad.mit.edu	37	7	117431826	117431826	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117431826G>T	uc003vjf.2	-	4	1516	c.1424C>A	c.(1423-1425)TCG>TAG	p.S475*		NM_033427	NP_219499	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	475	Pro-rich.									ovary(4)|central_nervous_system(1)	5	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		ACTTGTAGGCGAGACATCTCT	0.483													7	287	---	---	---	---	PASS
TAS2R16	50833	broad.mit.edu	37	7	122635530	122635530	+	Silent	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122635530G>A	uc003vkl.1	-	1	225	c.159C>T	c.(157-159)GGC>GGT	p.G53G		NM_016945	NP_058641	Q9NYV7	T2R16_HUMAN	taste receptor T2R16	53	Helical; Name=2; (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste	endoplasmic reticulum|external side of plasma membrane|trans-Golgi network	bitter taste receptor activity|protein binding			ovary(1)|skin(1)	2						AGCGAGAGATGCCCAGGCTGA	0.438													16	60	---	---	---	---	PASS
ASB15	142685	broad.mit.edu	37	7	123256317	123256317	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123256317C>A	uc003vku.1	+	5	442	c.150C>A	c.(148-150)GCC>GCA	p.A50A	ASB15_uc003vkv.1_Silent_p.A50A|ASB15_uc003vkw.1_Silent_p.A50A	NM_080928	NP_563616	Q8WXK1	ASB15_HUMAN	ankyrin repeat and SOCS box-containing 15	50					intracellular signal transduction					skin(2)|lung(1)	3						TTGTGGAGGCCATAAAACAAG	0.353													9	58	---	---	---	---	PASS
NUP205	23165	broad.mit.edu	37	7	135307641	135307641	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135307641C>T	uc003vsw.2	+	31	4478	c.4447C>T	c.(4447-4449)CGA>TGA	p.R1483*	NUP205_uc003vsx.2_RNA	NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa	1483					carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						AGTGGTCTGTCGAGATGCTTG	0.383													19	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142239547	142239547	+	Intron	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142239547G>A	uc011krp.1	+						uc011krr.1_Intron|uc011krx.1_Intron|uc011ksa.1_Intron|uc011ksd.1_Silent_p.A111A|uc011kse.1_RNA					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		CTACGCTGCTGGCACAGAAAT	0.547													8	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142327040	142327040	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142327040G>T	uc011krp.1	+						uc011krr.1_Intron|uc003vzo.2_Missense_Mutation_p.S113I					Homo sapiens mRNA for T cell receptor beta variable 3, partial cds, clone: un 191.																		TGTGCCAGTAGTATAGACACA	0.542													4	123	---	---	---	---	PASS
PDIA4	9601	broad.mit.edu	37	7	148718111	148718111	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148718111C>G	uc003wff.2	-	2	499	c.217G>C	c.(217-219)GAT>CAT	p.D73H		NM_004911	NP_004902	P13667	PDIA4_HUMAN	protein disulfide isomerase A4 precursor	73	Thioredoxin 1.				cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			lung(5)|ovary(1)	6	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			ACAAAATTATCAAAGTTTGCA	0.348													10	33	---	---	---	---	PASS
PDIA4	9601	broad.mit.edu	37	7	148718159	148718159	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148718159C>A	uc003wff.2	-	2	451	c.169G>T	c.(169-171)GAA>TAA	p.E57*		NM_004911	NP_004902	P13667	PDIA4_HUMAN	protein disulfide isomerase A4 precursor	57	Thioredoxin 1.				cell redox homeostasis|glycerol ether metabolic process|protein secretion	endoplasmic reticulum lumen|melanosome	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			lung(5)|ovary(1)	6	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			TCCTTAACTTCCAAGTCGtct	0.308													5	32	---	---	---	---	PASS
ABP1	26	broad.mit.edu	37	7	150555890	150555890	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150555890A>G	uc003why.1	+	4	5828	c.1610A>G	c.(1609-1611)GAA>GGA	p.E537G	ABP1_uc003whz.1_Missense_Mutation_p.E537G|ABP1_uc003wia.1_Missense_Mutation_p.E537G	NM_001091	NP_001082	P19801	ABP1_HUMAN	amiloride binding protein 1 precursor	537					amine metabolic process	extracellular space|peroxisome	copper ion binding|diamine oxidase activity|heparin binding|histamine oxidase activity|methylputrescine oxidase activity|primary amine oxidase activity|propane-1,3-diamine oxidase activity|quinone binding			ovary(2)|breast(2)|skin(2)	6	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiloride(DB00594)|Spermine(DB00127)	ATGAAGCTAGAAAACATCACC	0.562													7	41	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3224667	3224667	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3224667C>A	uc011kwk.1	-	20	3395	c.3005G>T	c.(3004-3006)GGG>GTG	p.G1002V	CSMD1_uc011kwj.1_Missense_Mutation_p.G394V|CSMD1_uc003wqe.2_Missense_Mutation_p.G158V	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	1002	Extracellular (Potential).|CUB 6.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAACACCGACCCGGTGAGCCT	0.478													6	12	---	---	---	---	PASS
ADAM7	8756	broad.mit.edu	37	8	24342874	24342874	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:24342874G>C	uc003xeb.2	+	10	1073	c.960G>C	c.(958-960)AAG>AAC	p.K320N	ADAM7_uc003xec.2_Missense_Mutation_p.K92N	NM_003817	NP_003808	Q9H2U9	ADAM7_HUMAN	a disintegrin and metalloproteinase domain 7	320	Peptidase M12B.|Extracellular (Potential).				proteolysis	integral to membrane	metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(1)|kidney(1)	5		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		GTATCATTAAGGTGGGCTGTG	0.368													5	13	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43171087	43171087	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43171087G>C	uc003xpz.1	+	7	1001	c.958G>C	c.(958-960)GAA>CAA	p.E320Q	POTEA_uc003xqa.1_Missense_Mutation_p.E274Q	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	320										ovary(1)	1						TAAAGGAAGTGAAAATAGTCA	0.308													17	39	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87076814	87076814	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076814C>A	uc011lfy.1	-	2	232	c.232G>T	c.(232-234)GTC>TTC	p.V78F		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	78	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			TCTACCCTGACAACCCTGCTG	0.448													29	34	---	---	---	---	PASS
MTERFD1	51001	broad.mit.edu	37	8	97263208	97263208	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:97263208C>A	uc003yhs.1	-	4	681	c.603G>T	c.(601-603)GAG>GAT	p.E201D	MTERFD1_uc003yhr.1_Missense_Mutation_p.E80D|MTERFD1_uc010mbd.1_Missense_Mutation_p.E201D	NM_015942	NP_057026	Q96E29	MTER1_HUMAN	MTERF domain containing 1 precursor	201					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion	transcription regulatory region DNA binding			ovary(1)	1	Breast(36;5.16e-05)					GTTGGTTATCCTCTATACCCA	0.368													6	81	---	---	---	---	PASS
OPLAH	26873	broad.mit.edu	37	8	145113522	145113522	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145113522C>A	uc003zar.3	-	6	742	c.660G>T	c.(658-660)TCG>TCT	p.S220S	OPLAH_uc003zat.1_5'UTR	NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	220							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	GCATGGCCTCCGAGGACAGTG	0.672													3	12	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2039694	2039694	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2039694G>T	uc003zhc.2	+	4	683	c.584G>T	c.(583-585)GGC>GTC	p.G195V	SMARCA2_uc003zhd.2_Missense_Mutation_p.G195V|SMARCA2_uc010mha.2_Missense_Mutation_p.G186V	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	195					chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CTGGCCCGAGGCCAGCCCCTC	0.463													20	2	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971035	21971035	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971035T>C	uc003zpk.2	-	2	535	c.323A>G	c.(322-324)GAT>GGT	p.D108G	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Silent_p.R163R	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	108			D -> Y (in a head and neck tumor).|D -> H (in a bladder tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.D108Y(14)|p.?(13)|p.D108H(9)|p.D108N(5)|p.H83fs*2(2)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCCCCAGGCATCGCGCACGTC	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			4	1	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84608634	84608634	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84608634G>T	uc004amn.2	+	4	3296	c.3249G>T	c.(3247-3249)GAG>GAT	p.E1083D		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1083						integral to membrane					0						GGACAACAGAGGATGGCAGAC	0.507													5	61	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98232095	98232095	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98232095C>A	uc004avk.3	-	13	2035	c.1847G>T	c.(1846-1848)AGC>ATC	p.S616I	PTCH1_uc010mro.2_Missense_Mutation_p.S465I|PTCH1_uc010mrp.2_Missense_Mutation_p.S465I|PTCH1_uc010mrq.2_Missense_Mutation_p.S465I|PTCH1_uc004avl.3_Missense_Mutation_p.S465I|PTCH1_uc010mrr.2_Missense_Mutation_p.S550I|PTCH1_uc004avm.3_Missense_Mutation_p.S615I|PTCH1_uc010mrs.1_Missense_Mutation_p.S284I	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L	616	Cytoplasmic (Potential).				embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity	p.S616N(1)		skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GAAAATGTACCTTGTAAAACA	0.438									Basal_Cell_Nevus_syndrome				7	252	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107565591	107565591	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107565591C>A	uc004bcl.2	-	33	4879	c.4566G>T	c.(4564-4566)AAG>AAT	p.K1522N		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	1522	Extracellular.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	AGATCTTGTTCTTTAAGCTGC	0.408													6	185	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136661648	136661648	+	Splice_Site	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136661648T>A	uc004ces.2	-	11	983	c.937_splice	c.e11-1	p.E313_splice	VAV2_uc004cer.2_Splice_Site_p.E308_splice	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		TGTGCACTCCTGGGAGGGCGA	0.597													7	3	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17086998	17086998	+	Intron	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17086998A>G	uc001ioo.2	-							NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGAAACATTATACATACAGC	0.423													19	57	---	---	---	---	PASS
NRP1	8829	broad.mit.edu	37	10	33502401	33502401	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33502401C>A	uc001iwx.3	-	9	2050	c.1527G>T	c.(1525-1527)AAG>AAT	p.K509N	NRP1_uc001iwv.3_Missense_Mutation_p.K509N|NRP1_uc009xlz.2_Missense_Mutation_p.K509N|NRP1_uc001iww.3_Missense_Mutation_p.K328N|NRP1_uc001iwy.3_Missense_Mutation_p.K509N|NRP1_uc001iwz.2_Missense_Mutation_p.K509N|NRP1_uc001ixa.2_Missense_Mutation_p.K509N|NRP1_uc001ixb.1_Missense_Mutation_p.K509N|NRP1_uc001ixc.1_Missense_Mutation_p.K509N	NM_003873	NP_003864	O14786	NRP1_HUMAN	neuropilin 1 isoform a	509	Extracellular (Potential).|F5/8 type C 2.				axon guidance|cell adhesion|cell-cell signaling|organ morphogenesis|positive regulation of cell proliferation	extracellular region|integral to membrane|plasma membrane	growth factor binding|heparin binding|metal ion binding|vascular endothelial growth factor receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4					Palifermin(DB00039)|Pegaptanib(DB04895)	TCATGAACACCTTGTTCTCTC	0.532													6	102	---	---	---	---	PASS
MBL2	4153	broad.mit.edu	37	10	54531335	54531335	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:54531335C>A	uc001jjt.2	-	1	126	c.61G>T	c.(61-63)GAA>TAA	p.E21*		NM_000242	NP_000233	P11226	MBL2_HUMAN	soluble mannose-binding lectin precursor	21	Cys-rich.				acute-phase response|complement activation, classical pathway|complement activation, lectin pathway|defense response to Gram-positive bacterium|negative regulation of growth of symbiont in host|opsonization|response to oxidative stress	collagen|extracellular space	bacterial cell surface binding|calcium-dependent protein binding|eukaryotic cell surface binding|mannose binding|receptor binding			ovary(1)	1						GTCACAGTTTCTGAGTAAGAC	0.532													6	14	---	---	---	---	PASS
SORCS1	114815	broad.mit.edu	37	10	108380176	108380176	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108380176G>T	uc001kym.2	-						SORCS1_uc001kyl.2_Intron|SORCS1_uc009xxs.2_Intron|SORCS1_uc001kyn.1_Intron|SORCS1_uc001kyo.2_Intron	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CATGTGGAAGGTGAACCCACC	0.323													6	31	---	---	---	---	PASS
PDZD8	118987	broad.mit.edu	37	10	119044409	119044409	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:119044409G>T	uc001lde.1	-	5	2034	c.1835C>A	c.(1834-1836)CCA>CAA	p.P612Q		NM_173791	NP_776152	Q8NEN9	PDZD8_HUMAN	PDZ domain containing 8	612	Pro-rich.				intracellular signal transduction		metal ion binding				0		Colorectal(252;0.19)		all cancers(201;0.0121)		GAGAACATCTGGTTCTGCCTG	0.483													5	65	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120810778	120810778	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120810778G>T	uc001ldu.2	-	15	2398	c.2252C>A	c.(2251-2253)TCA>TAA	p.S751*	EIF3A_uc010qsu.1_Nonsense_Mutation_p.S717*|EIF3A_uc009xzg.1_5'Flank	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	751	Interaction with EIF3B.|Glu-rich.				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		AAGCATTCGTGACATTCGATT	0.363													5	53	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	4104567	4104567	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4104567G>C	uc001lyv.2	+	10	1881	c.1313G>C	c.(1312-1314)GGC>GCC	p.G438A	STIM1_uc009yef.2_Missense_Mutation_p.G438A|STIM1_uc009yeg.2_Missense_Mutation_p.G265A	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	438	Cytoplasmic (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		ATCCTCTGTGGCTTCCAGATT	0.582													13	28	---	---	---	---	PASS
TRIM68	55128	broad.mit.edu	37	11	4624558	4624558	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4624558C>T	uc001lzf.1	-	3	677	c.439G>A	c.(439-441)GAG>AAG	p.E147K	TRIM68_uc001lzg.1_5'UTR|TRIM68_uc010qyj.1_RNA|TRIM68_uc009yek.1_Missense_Mutation_p.E147K	NM_018073	NP_060543	Q6AZZ1	TRI68_HUMAN	ring finger protein 137	147					protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		TCGAGGGCCTCATGAAGTTCC	0.552													15	25	---	---	---	---	PASS
SYT9	143425	broad.mit.edu	37	11	7335113	7335113	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7335113G>C	uc001mfe.2	+	3	1222	c.985G>C	c.(985-987)GAC>CAC	p.D329H	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	329	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		TCACTTCCTAGACTTGGCTGA	0.478													35	82	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22239812	22239812	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22239812G>T	uc001mqi.2	+	4	476	c.159G>T	c.(157-159)TTG>TTT	p.L53F	ANO5_uc001mqj.2_Missense_Mutation_p.L52F	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a	53	Cytoplasmic (Potential).					chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						GATTCAATTTGTTCCTGAGGC	0.403													16	17	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26621132	26621132	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26621132G>T	uc001mqt.3	+	17	1852	c.1707G>T	c.(1705-1707)GTG>GTT	p.V569V	ANO3_uc010rdr.1_Silent_p.V553V|ANO3_uc010rds.1_Silent_p.V408V|ANO3_uc010rdt.1_Silent_p.V423V	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	569	Helical; (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTGGAGTTGTGGTGTACCGCC	0.398													5	57	---	---	---	---	PASS
OR4C16	219428	broad.mit.edu	37	11	55339800	55339800	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55339800T>A	uc010rih.1	+	1	197	c.197T>A	c.(196-198)TTA>TAA	p.L66*		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				TACTTATCCTTATCTGATACT	0.413													26	71	---	---	---	---	PASS
OR4P4	81300	broad.mit.edu	37	11	55406117	55406117	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55406117G>C	uc010rij.1	+	1	284	c.284G>C	c.(283-285)TGT>TCT	p.C95S		NM_001004124	NP_001004124	Q8NGL7	OR4P4_HUMAN	olfactory receptor, family 4, subfamily P,	95	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TATAATAACTGTATGATACAA	0.438													32	44	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55607001	55607001	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55607001C>A	uc010rio.1	+	1	774	c.774C>A	c.(772-774)CTC>CTA	p.L258L		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				GCACCATCCTCTTCCTCTACT	0.532													5	57	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55657518	55657518	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55657518G>T	uc010rip.1	+						SPRYD5_uc010riq.1_Intron	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5							intracellular	zinc ion binding				0		all_epithelial(135;0.226)				ATTCAGAGGTGAGTGTCAGCC	0.473													10	8	---	---	---	---	PASS
OR5B21	219968	broad.mit.edu	37	11	58274946	58274946	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58274946G>T	uc010rki.1	-	1	633	c.633C>A	c.(631-633)ATC>ATA	p.I211I		NM_001005218	NP_001005218	A6NL26	OR5BL_HUMAN	olfactory receptor, family 5, subfamily B,	211	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				AAGAAATAAGGATGACCAGGA	0.488													11	17	---	---	---	---	PASS
MS4A3	932	broad.mit.edu	37	11	59834551	59834551	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59834551C>T	uc001nom.2	+	5	607	c.479C>T	c.(478-480)CCG>CTG	p.P160L	MS4A3_uc001non.2_Missense_Mutation_p.P114L|MS4A3_uc001noo.2_Missense_Mutation_p.P37L	NM_006138	NP_006129	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member	160	Extracellular (Potential).					endomembrane system|integral to membrane|perinuclear region of cytoplasm	protein binding|receptor activity			ovary(2)|skin(1)	3		all_epithelial(135;0.245)				TCAGAGTCACCGGACCTATGC	0.358													6	7	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62291567	62291567	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62291567T>G	uc001ntl.2	-	5	10622	c.10322A>C	c.(10321-10323)GAA>GCA	p.E3441A	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	3441					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				AAAGTCACCTTCTAAATTGGG	0.413													18	33	---	---	---	---	PASS
PLCB3	5331	broad.mit.edu	37	11	64026124	64026124	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64026124G>T	uc001nzb.2	+	11	1192	c.1192G>T	c.(1192-1194)GAG>TAG	p.E398*	PLCB3_uc009ypg.1_Nonsense_Mutation_p.E398*|PLCB3_uc009yph.1_Nonsense_Mutation_p.E331*|PLCB3_uc009ypi.2_Nonsense_Mutation_p.E398*	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3	398	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						GGCCATTGCCGAGACTGCCTT	0.627													4	48	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	70003075	70003075	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70003075G>T	uc001opj.2	+	16	1831	c.1526G>T	c.(1525-1527)TGG>TTG	p.W509L	ANO1_uc001opk.1_Missense_Mutation_p.W451L|ANO1_uc001opl.1_RNA|ANO1_uc010rqk.1_Missense_Mutation_p.W218L	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	509	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						AAGCTGACATGGAGAGATCGG	0.498													6	147	---	---	---	---	PASS
CTTN	2017	broad.mit.edu	37	11	70277370	70277370	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70277370C>A	uc001opv.3	+	15	1456	c.1250C>A	c.(1249-1251)TCG>TAG	p.S417*	CTTN_uc001opu.2_Nonsense_Mutation_p.S380*|CTTN_uc001opw.3_Nonsense_Mutation_p.S380*|CTTN_uc010rqm.1_Nonsense_Mutation_p.S101*|CTTN_uc001opx.2_Nonsense_Mutation_p.S101*	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a	417						cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		AGGCTGCCCTCGAGCCCCGTC	0.567													5	151	---	---	---	---	PASS
CBL	867	broad.mit.edu	37	11	119103295	119103295	+	Silent	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119103295A>G	uc001pwe.2	+	2	471	c.333A>G	c.(331-333)GAA>GAG	p.E111E		NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral	111	Cbl-PTB.|4H.				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CACTTGGAGAAAATGAGTATT	0.393									CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				25	43	---	---	---	---	PASS
C11orf63	79864	broad.mit.edu	37	11	122828115	122828115	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122828115G>T	uc001pym.2	+	8	2352	c.2055G>T	c.(2053-2055)AAG>AAT	p.K685N		NM_024806	NP_079082	Q6NUN7	CK063_HUMAN	hypothetical protein LOC79864 isoform 1	685										ovary(3)	3		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.018)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.34e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0311)		AACAAGTCAAGGAGTACAACA	0.373													5	72	---	---	---	---	PASS
FLI1	2313	broad.mit.edu	37	11	128628202	128628202	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128628202G>A	uc010sbu.1	+	2	552	c.211G>A	c.(211-213)GAC>AAC	p.D71N	FLI1_uc010sbt.1_5'UTR|FLI1_uc010sbv.1_Missense_Mutation_p.D38N|FLI1_uc009zci.2_5'UTR|FLI1_uc001qen.2_Missense_Mutation_p.D38N	NM_002017	NP_002008	Q01543	FLI1_HUMAN	Friend leukemia virus integration 1	71					hemostasis|organ morphogenesis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/FLI1(2266)	bone(2210)|soft_tissue(48)|autonomic_ganglia(4)|central_nervous_system(4)|lung(3)|ovary(2)|pancreas(2)	2273	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GCGGGAGTATGACCACATGAA	0.577			T	EWSR1	Ewing sarcoma								7	14	---	---	---	---	PASS
TMEM45B	120224	broad.mit.edu	37	11	129724601	129724601	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129724601T>C	uc001qfe.1	+	3	336	c.275T>C	c.(274-276)ATG>ACG	p.M92T	TMEM45B_uc001qff.1_Missense_Mutation_p.M92T	NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B	92						integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		CACAGCACCATGTACCTATTC	0.522													12	25	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7519883	7519883	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7519883C>T	uc001qsy.2	-	18	4254	c.4228G>A	c.(4228-4230)GAG>AAG	p.E1410K	CD163L1_uc010sge.1_Missense_Mutation_p.E1420K	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1	1410	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						GTCTCCATCTCATGGAATAAA	0.488													11	36	---	---	---	---	PASS
SLC2A14	144195	broad.mit.edu	37	12	7985369	7985369	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7985369G>T	uc001qtk.2	-	8	922	c.129C>A	c.(127-129)ATC>ATA	p.I43I	SLC2A14_uc001qtl.2_Silent_p.I20I|SLC2A14_uc001qtm.2_Silent_p.I20I|SLC2A14_uc010sgg.1_5'UTR|SLC2A14_uc001qtn.2_Silent_p.I43I|SLC2A14_uc001qto.2_Intron|SLC2A14_uc010sgh.1_Silent_p.I58I	NM_153449	NP_703150	Q8TDB8	GTR14_HUMAN	glucose transporter 14	43	Helical; Name=1; (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane	glucose transmembrane transporter activity			ovary(1)	1				Kidney(36;0.0883)		GGAAAGAGCCGATTGTAGCAA	0.473											OREG0021654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	37	44	---	---	---	---	PASS
PRB3	5544	broad.mit.edu	37	12	11420396	11420396	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11420396G>T	uc001qzs.2	-						PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3							extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			TTTCCTGGACGAGGTGGGGGA	0.592													7	247	---	---	---	---	PASS
SMARCC2	6601	broad.mit.edu	37	12	56580987	56580987	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56580987G>A	uc001skb.2	-	2	321	c.215C>T	c.(214-216)CCG>CTG	p.P72L	SMARCC2_uc001skd.2_Missense_Mutation_p.P72L|SMARCC2_uc001ska.2_Missense_Mutation_p.P72L|SMARCC2_uc001skc.2_Missense_Mutation_p.P72L|SMARCC2_uc010sqf.1_5'UTR	NM_003075	NP_003066	Q8TAQ2	SMRC2_HUMAN	SWI/SNF-related matrix-associated	72					chromatin remodeling|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nucleoplasm|SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			lung(2)|central_nervous_system(2)|ovary(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TTTAGTGAGCGGTGCATTGCT	0.463													21	71	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88388402	88388402	+	Intron	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88388402T>C	uc001tam.1	-						C12orf50_uc001tan.2_Intron	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419											skin(2)|ovary(1)	3						AGTAATAAATTAACTCACCTC	0.313													9	18	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104033910	104033910	+	Nonsense_Mutation	SNP	G	T	T	rs12319476	byFrequency	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104033910G>T	uc001tjw.2	+	9	1102	c.916G>T	c.(916-918)GAG>TAG	p.E306*		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	306	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GTCTCACTGCGAGTGTAAGGA	0.383													4	79	---	---	---	---	PASS
DAO	1610	broad.mit.edu	37	12	109286820	109286820	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109286820G>T	uc001tnr.3	+						DAO_uc001tnq.3_Intron|DAO_uc009zvb.2_Intron|DAO_uc001tns.3_Intron	NM_001917	NP_001908	P14920	OXDA_HUMAN	D-amino-acid oxidase						glyoxylate metabolic process	peroxisomal matrix	binding|D-amino-acid oxidase activity			ovary(1)|skin(1)	2						GAGGTGAGTTGCAGGGCTGAT	0.562													12	10	---	---	---	---	PASS
PLBD2	196463	broad.mit.edu	37	12	113824871	113824871	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113824871G>T	uc001tve.2	+	10	1451	c.1416G>T	c.(1414-1416)ATG>ATT	p.M472I	PLBD2_uc001tvf.2_Missense_Mutation_p.M440I	NM_173542	NP_775813	Q8NHP8	PLBL2_HUMAN	phospholipase B domain containing 2 isoform 1	472					lipid catabolic process	lysosomal lumen	hydrolase activity				0						TACAAGACATGGACTCCATGG	0.597													5	68	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129442181	129442181	+	Missense_Mutation	SNP	A	T	T	rs143132819		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129442181A>T	uc010tbh.1	+	12	896	c.887A>T	c.(886-888)AAT>ATT	p.N296I	GLT1D1_uc001uhx.1_Missense_Mutation_p.N211I|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	291					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CTGTTTTCCAATCCTCAGGTA	0.448													7	17	---	---	---	---	PASS
POSTN	10631	broad.mit.edu	37	13	38160416	38160416	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:38160416G>A	uc001uwo.3	-	7	873	c.755C>T	c.(754-756)GCA>GTA	p.A252V	POSTN_uc001uwp.3_Missense_Mutation_p.A252V|POSTN_uc001uwr.2_Missense_Mutation_p.A252V|POSTN_uc001uwq.2_Missense_Mutation_p.A252V|POSTN_uc010teu.1_Missense_Mutation_p.A252V|POSTN_uc010tev.1_Missense_Mutation_p.A252V|POSTN_uc010tew.1_Missense_Mutation_p.A252V|POSTN_uc010tex.1_Missense_Mutation_p.A167V	NM_006475	NP_006466	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor isoform 1	252	FAS1 2.				cell adhesion|skeletal system development	proteinaceous extracellular matrix	heparin binding			ovary(2)	2		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		GATGGCAGCTGCCTGAAACAC	0.458													11	35	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39587739	39587739	+	Silent	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39587739G>A	uc001uwy.2	-	11	2523	c.1650C>T	c.(1648-1650)TCC>TCT	p.S550S	C13orf23_uc001uwz.2_Silent_p.S528S	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1	550	Ser-rich.									ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		TCAGGGGAGTGGAAGTTGAGT	0.587													20	58	---	---	---	---	PASS
ELF1	1997	broad.mit.edu	37	13	41517101	41517101	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:41517101C>T	uc001uxs.2	-	7	1166	c.793G>A	c.(793-795)GGA>AGA	p.G265R	ELF1_uc010tfc.1_Missense_Mutation_p.G241R|ELF1_uc010acd.2_Missense_Mutation_p.G158R	NM_172373	NP_758961	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription	265	ETS.				positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		AGTGCTCTTCCCATGGTCTCA	0.358													13	32	---	---	---	---	PASS
NEK5	341676	broad.mit.edu	37	13	52693485	52693485	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52693485T>C	uc001vge.2	-	4	324	c.184A>G	c.(184-186)AAC>GAC	p.N62D	NEK5_uc001vgf.2_Missense_Mutation_p.N62D	NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	62	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		GCTACAATGTTGGGATGTTTC	0.294													19	22	---	---	---	---	PASS
RNF219	79596	broad.mit.edu	37	13	79213215	79213215	+	Intron	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79213215G>A	uc001vkw.1	-						RNF219_uc010afb.1_Intron|RNF219_uc010afc.2_Intron	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219								zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TCCTGAAAAAGCATTGCATAG	0.348													5	75	---	---	---	---	PASS
SLITRK6	84189	broad.mit.edu	37	13	86369450	86369450	+	Silent	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:86369450A>G	uc001vll.1	-	2	1653	c.1194T>C	c.(1192-1194)CGT>CGC	p.R398R	SLITRK6_uc010afe.1_Intron	NM_032229	NP_115605	Q9H5Y7	SLIK6_HUMAN	slit and trk like 6 precursor	398	Extracellular (Potential).|LRR 7.					integral to membrane				large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_neural(89;0.117)|Medulloblastoma(90;0.163)			GBM - Glioblastoma multiforme(99;0.0456)		GAACTTCAATACGATTGTTTC	0.353													12	30	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33291404	33291404	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33291404A>C	uc001wrq.2	+	13	4555	c.4385A>C	c.(4384-4386)CAT>CCT	p.H1462P		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1462					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		CAAGGAAAACATGATGTGTTT	0.368													6	32	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65207982	65207982	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65207982A>T	uc001xho.1	+	16	2016	c.1747A>T	c.(1747-1749)ATG>TTG	p.M583L	PLEKHG3_uc001xhn.1_Missense_Mutation_p.M527L|PLEKHG3_uc001xhp.2_Missense_Mutation_p.M704L|PLEKHG3_uc010aqh.1_Missense_Mutation_p.M125L|PLEKHG3_uc001xhq.1_Missense_Mutation_p.M88L	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	583					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGAAGAAGAAATGGGAGGTGC	0.627													13	16	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95590801	95590801	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95590801G>T	uc001ydw.2	-	9	1290	c.1108C>A	c.(1108-1110)CTG>ATG	p.L370M	DICER1_uc001ydv.2_Missense_Mutation_p.L360M|DICER1_uc001ydx.2_Missense_Mutation_p.L370M	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	370	Required for interaction with PRKRA and TARBP2.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACAAATTTCAGGTCAAGTGAG	0.383			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				6	124	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102474667	102474667	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102474667C>A	uc001yks.2	+	29	6134	c.5970C>A	c.(5968-5970)TAC>TAA	p.Y1990*		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	1990	AAA 1 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						ACCCCAACTACGACAAGAGTA	0.458													7	25	---	---	---	---	PASS
RCOR1	23186	broad.mit.edu	37	14	103174886	103174886	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103174886C>A	uc001ymb.2	+	6	736	c.736C>A	c.(736-738)CAT>AAT	p.H246N		NM_015156	NP_055971	Q9UKL0	RCOR1_HUMAN	REST corepressor 1	246	Interaction with HDAC1.|Potential.				blood coagulation|histone H4 deacetylation|interspecies interaction between organisms	transcriptional repressor complex	protein binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription regulatory region DNA binding			ovary(1)	1						GATGGATCGCCATGCCCGGAA	0.443													7	219	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106321604	106321604	+	RNA	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106321604C>T	uc010tyt.1	-	3599		c.55792G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						ACATGGAGGACGCATTCTGCT	0.637													8	5	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25959028	25959028	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25959028C>T	uc010ayu.2	-	10	2243	c.2137G>A	c.(2137-2139)GTG>ATG	p.V713M		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	713	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCCACAAGCACGCAGTTGTAG	0.647													4	17	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26812774	26812774	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26812774C>A	uc001zaz.2	-	7	931	c.789G>T	c.(787-789)GTG>GTT	p.V263V	GABRB3_uc010uae.1_Silent_p.V178V|GABRB3_uc001zba.2_Silent_p.V263V|GABRB3_uc001zbb.2_Silent_p.V319V	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	263	Helical; (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TCCAGAAGGACACCCACGACA	0.398													10	23	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29398955	29398955	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29398955A>T	uc001zck.2	+	11	2057	c.1850A>T	c.(1849-1851)CAG>CTG	p.Q617L	APBA2_uc010azj.2_Missense_Mutation_p.Q605L|APBA2_uc010uat.1_Missense_Mutation_p.Q605L|APBA2_uc001zcl.2_Missense_Mutation_p.Q605L	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	617	PDZ 1.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		ATCGGGGACCAGATCATGTCC	0.662													12	11	---	---	---	---	PASS
EHD4	30844	broad.mit.edu	37	15	42246101	42246101	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42246101C>A	uc001zot.2	-	2	337	c.274G>T	c.(274-276)GGT>TGT	p.G92C	EHD4_uc001zou.2_Missense_Mutation_p.G92C	NM_139265	NP_644670	Q9H223	EHD4_HUMAN	EH-domain containing 4	92					endocytic recycling|protein homooligomerization	early endosome membrane|endoplasmic reticulum|nucleus|recycling endosome membrane	ATP binding|calcium ion binding|GTP binding|GTPase activity|nucleic acid binding|protein binding			ovary(2)	2		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		GGCTCCGGACCAATCCTCATG	0.522													4	38	---	---	---	---	PASS
MNS1	55329	broad.mit.edu	37	15	56756394	56756394	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56756394C>G	uc002adr.2	-	2	220	c.55G>C	c.(55-57)GAT>CAT	p.D19H	MNS1_uc010bfo.2_5'UTR	NM_018365	NP_060835	Q8NEH6	MNS1_HUMAN	meiosis-specific nuclear structural 1	19					meiosis					ovary(1)	1				all cancers(107;0.0196)|GBM - Glioblastoma multiforme(80;0.101)		TAGTTTTCATCTACTAATTTC	0.333													25	54	---	---	---	---	PASS
KIAA1024	23251	broad.mit.edu	37	15	79750567	79750567	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79750567G>A	uc002bew.1	+	2	2153	c.2078G>A	c.(2077-2079)AGC>AAC	p.S693N	KIAA1024_uc010unk.1_Missense_Mutation_p.S693N	NM_015206	NP_056021	Q9UPX6	K1024_HUMAN	hypothetical protein LOC23251	693						integral to membrane				pancreas(2)|ovary(1)|central_nervous_system(1)	4						AACAGTGAAAGCCTGCGGGTC	0.547													42	79	---	---	---	---	PASS
FAM154B	283726	broad.mit.edu	37	15	82575397	82575397	+	Silent	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82575397C>G	uc002bgv.2	+	3	1260	c.1191C>G	c.(1189-1191)GCC>GCG	p.A397A	FAM154B_uc010unr.1_Silent_p.A382A|FAM154B_uc010uns.1_RNA	NM_001008226	NP_001008227	Q658L1	F154B_HUMAN	hypothetical protein LOC283726	397										skin(2)	2						CAGTGAAGGCCTTCTAATAAC	0.333													8	19	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85478700	85478700	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85478700G>A	uc002blg.2	+	15	1734	c.1532G>A	c.(1531-1533)CGC>CAC	p.R511H	SLC28A1_uc010bnb.2_Missense_Mutation_p.R511H|SLC28A1_uc010upe.1_Intron|SLC28A1_uc010upf.1_Missense_Mutation_p.R511H|SLC28A1_uc010upg.1_Missense_Mutation_p.R511H	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	511					nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AAGCAACGCCGCCTGGCAGGG	0.617													5	42	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89056181	89056181	+	3'UTR	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89056181C>G	uc002bmr.2	-	5					DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_3'UTR	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2							nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TGGTGAGGCACCTACGTGCAG	0.478													21	21	---	---	---	---	PASS
MSLN	10232	broad.mit.edu	37	16	814042	814042	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:814042C>T	uc002cjw.1	+	5	250	c.199C>T	c.(199-201)CTT>TTT	p.L67F	MSLN_uc002cjt.1_Missense_Mutation_p.L67F|MSLN_uc002cju.1_Missense_Mutation_p.L67F|MSLN_uc010brd.1_Missense_Mutation_p.L66F|MSLN_uc002cjv.1_Missense_Mutation_p.L67F|MSLN_uc002cjx.1_Missense_Mutation_p.L67F|MSLN_uc002cjy.1_5'Flank	NM_013404	NP_037536	Q13421	MSLN_HUMAN	mesothelin isoform 2 preproprotein	67					cell adhesion	anchored to membrane|extracellular region|Golgi apparatus|plasma membrane				pancreas(1)	1		Hepatocellular(780;0.00335)				TCGCCAACTCCTTGGCTTCCC	0.662													8	8	---	---	---	---	PASS
CLDN9	9080	broad.mit.edu	37	16	3063982	3063982	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3063982G>T	uc010uwo.1	+	1	1526	c.619G>T	c.(619-621)GGT>TGT	p.G207C		NM_020982	NP_066192	O95484	CLD9_HUMAN	claudin 9	207	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CTCCCGCTCGGGTGCATCTGG	0.701													5	51	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3777896	3777896	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3777896G>T	uc002cvv.2	-	31	7356	c.7152C>A	c.(7150-7152)CAC>CAA	p.H2384Q	CREBBP_uc002cvw.2_Missense_Mutation_p.H2346Q	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	2384					cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		CGAGTCCGGGGTGGGGGGAAC	0.647			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				9	36	---	---	---	---	PASS
SEC14L5	9717	broad.mit.edu	37	16	5053517	5053517	+	Silent	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5053517C>T	uc002cye.2	+	11	1425	c.1245C>T	c.(1243-1245)ACC>ACT	p.T415T		NM_014692	NP_055507	O43304	S14L5_HUMAN	SEC14-like 5	415	CRAL-TRIO.					integral to membrane|intracellular	transporter activity				0						ACCCAGAGACCCTGGGTCGGC	0.647													10	7	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15098131	15098131	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15098131G>T	uc002dda.3	+	5	554	c.330G>T	c.(328-330)CTG>CTT	p.L110L	PDXDC1_uc010uzl.1_Silent_p.L95L|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Silent_p.L51L|PDXDC1_uc002dcz.2_Silent_p.L110L|PDXDC1_uc002ddb.3_Silent_p.L83L|PDXDC1_uc010uzn.1_Silent_p.L82L|PDXDC1_uc002ddc.2_Silent_p.L110L	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain	110					carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	AAGAGAAGCTGAGAAAACTTA	0.373													6	179	---	---	---	---	PASS
OGFOD1	55239	broad.mit.edu	37	16	56496445	56496445	+	Splice_Site	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56496445G>T	uc002ejb.2	+	4	449	c.348_splice	c.e4-1	p.R116_splice	OGFOD1_uc002ejc.2_Splice_Site	NM_018233	NP_060703	Q8N543	OGFD1_HUMAN	2-oxoglutarate and iron-dependent oxygenase								iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			skin(1)	1					Vitamin C(DB00126)	TACATTTCTAGGAAAATTCTG	0.378													4	33	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77401602	77401602	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77401602G>C	uc002ffc.3	-	4	933	c.514C>G	c.(514-516)CGA>GGA	p.R172G	ADAMTS18_uc002ffe.1_5'UTR|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	172					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TCATTTTTTCGTGTCCTTATT	0.463													30	18	---	---	---	---	PASS
PRDM7	11105	broad.mit.edu	37	16	90126948	90126948	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90126948C>T	uc010cje.2	-	9	1054	c.1034G>A	c.(1033-1035)CGA>CAA	p.R345Q	PRDM7_uc002fqo.2_Intron|PRDM7_uc010cjf.2_Intron|PRDM7_uc010cjg.1_Missense_Mutation_p.R139Q	NM_001098173	NP_001091643	Q9NQW5	PRDM7_HUMAN	PR domain containing 7 isoform 1	345	SET.					chromosome|nucleus	nucleic acid binding			ovary(1)	1		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		CCTAATGACTCGGCAGGTTCT	0.547													15	38	---	---	---	---	PASS
ALOX12B	242	broad.mit.edu	37	17	7979001	7979001	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7979001C>A	uc002gjy.1	-	12	1827	c.1566G>T	c.(1564-1566)CCG>CCT	p.P522P		NM_001139	NP_001130	O75342	LX12B_HUMAN	arachidonate 12-lipoxygenase, 12R type	522	Lipoxygenase.				epidermis development|leukotriene biosynthetic process		arachidonate 12-lipoxygenase activity|iron ion binding|lipoxygenase activity				0						CTGCGTCACTCGGGTAATAAT	0.577										Multiple Myeloma(8;0.094)			5	144	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29684312	29684312	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29684312A>T	uc002hgg.2	+	54	8228	c.7895A>T	c.(7894-7896)GAT>GTT	p.D2632V	NF1_uc002hgh.2_Missense_Mutation_p.D2611V|NF1_uc010cso.2_Missense_Mutation_p.D820V|NF1_uc010wbt.1_Missense_Mutation_p.D110V|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2632					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity	p.D2632E(1)		soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TATACCACAGATGAGTTTGAT	0.358			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			24	22	---	---	---	---	PASS
MED1	5469	broad.mit.edu	37	17	37565935	37565935	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37565935C>T	uc002hrv.3	-	17	2751	c.2539G>A	c.(2539-2541)GGA>AGA	p.G847R	MED1_uc010wee.1_Missense_Mutation_p.G675R|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1	847	Interaction with ESR1.				androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		CTGGGGCTTCCAGCAGCATCT	0.408										HNSCC(31;0.082)			17	49	---	---	---	---	PASS
CD300LG	146894	broad.mit.edu	37	17	41931189	41931189	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41931189T>A	uc002iem.2	+	4	537	c.496T>A	c.(496-498)TAC>AAC	p.Y166N	CD300LG_uc002iel.1_Intron|CD300LG_uc010czk.2_Missense_Mutation_p.Y166N|CD300LG_uc010wil.1_Missense_Mutation_p.Y132N|CD300LG_uc010czl.2_Intron	NM_145273	NP_660316	Q6UXG3	CLM9_HUMAN	CD300 molecule-like family member g precursor	166	Extracellular (Potential).					apical plasma membrane|basolateral plasma membrane|integral to membrane|multivesicular body membrane	receptor activity				0		Breast(137;0.0199)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TCCTGGGCTCTACCCGGCAGC	0.597													14	8	---	---	---	---	PASS
BRIP1	83990	broad.mit.edu	37	17	59821870	59821870	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59821870G>T	uc002izk.1	-	15	2321	c.2180C>A	c.(2179-2181)CCA>CAA	p.P727Q	BRIP1_uc002izl.1_Missense_Mutation_p.P108Q	NM_032043	NP_114432	Q9BX63	FANCJ_HUMAN	BRCA1 interacting protein C-terminal helicase 1	727					DNA damage checkpoint|double-strand break repair|regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(1)	1						TCCTCCCTGTGGTTCTACAAT	0.358			F|N|Mis			AML|leukemia|breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				7	143	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61958850	61958850	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61958850C>A	uc002jco.1	-	2	102	c.40G>T	c.(40-42)GGC>TGC	p.G14C	GH2_uc002jcj.2_Missense_Mutation_p.G14C|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Missense_Mutation_p.G14C|GH2_uc002jcm.1_Missense_Mutation_p.G14C|GH2_uc002jcn.1_Missense_Mutation_p.G14C	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	14						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						CAGAGCAGGCCAAAAGCCAGG	0.622													6	128	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62018542	62018542	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62018542G>T	uc002jds.1	-	24	5177	c.5100C>A	c.(5098-5100)ACC>ACA	p.T1700T		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1700					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	TCTCCTCCATGGTCTGCTTGA	0.587													5	82	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63221324	63221324	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63221324C>A	uc002jfe.2	+	18	1722	c.1612C>A	c.(1612-1614)CAG>AAG	p.Q538K	RGS9_uc010dem.2_Missense_Mutation_p.Q535K|RGS9_uc002jfd.2_Missense_Mutation_p.Q535K|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Missense_Mutation_p.Q309K	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	538					intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						GGGCTTGGAGCAGAAAGGGGA	0.682													12	96	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3534460	3534460	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3534460G>T	uc002kmf.2	-	7	2278	c.2211C>A	c.(2209-2211)TCC>TCA	p.S737S	DLGAP1_uc010wyz.1_Silent_p.S737S|DLGAP1_uc002kme.1_Silent_p.S435S|DLGAP1_uc010dkn.2_Silent_p.S445S|DLGAP1_uc010wyw.1_Silent_p.S443S|DLGAP1_uc010wyx.1_Silent_p.S459S|DLGAP1_uc010wyy.1_Silent_p.S421S|DLGAP1_uc002kmg.2_Silent_p.S435S	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	737					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TGCTGACTGTGGAGGTGCTGG	0.527													4	27	---	---	---	---	PASS
SPIRE1	56907	broad.mit.edu	37	18	12449639	12449639	+	Nonstop_Mutation	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12449639A>G	uc002kre.2	-	17	2316	c.2269T>C	c.(2269-2271)TGA>CGA	p.*757R	SPIRE1_uc002krc.2_RNA|SPIRE1_uc010wzw.1_Nonstop_Mutation_p.*623R|SPIRE1_uc010wzx.1_Nonstop_Mutation_p.*546R|SPIRE1_uc010wzy.1_Nonstop_Mutation_p.*743R	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a	757						cytoskeleton|perinuclear region of cytoplasm	actin binding				0						CACGAGGCTCAGATCTCACTG	0.542													7	11	---	---	---	---	PASS
DSC3	1825	broad.mit.edu	37	18	28598040	28598040	+	Silent	SNP	T	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28598040T>A	uc002kwj.3	-	9	1415	c.1260A>T	c.(1258-1260)GTA>GTT	p.V420V	DSC3_uc002kwi.3_Silent_p.V420V	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	420	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			ACTGTACCTTTACAACAGAAA	0.269													14	48	---	---	---	---	PASS
MEP1B	4225	broad.mit.edu	37	18	29793244	29793244	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29793244T>C	uc002kxj.3	+	11	1348	c.1301T>C	c.(1300-1302)ATA>ACA	p.I434T		NM_005925	NP_005916	Q16820	MEP1B_HUMAN	meprin A beta precursor	434	Extracellular (Potential).|MATH.				digestion|proteolysis	extracellular space|integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			ovary(2)	2						ATCTGGCATATAAGGAATTTC	0.423													8	88	---	---	---	---	PASS
ZNF516	9658	broad.mit.edu	37	18	74091542	74091542	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74091542C>A	uc010dqx.1	-	3	2763	c.2528G>T	c.(2527-2529)GGG>GTG	p.G843V	ZNF516_uc002lme.2_RNA|ZNF516_uc002lmd.2_RNA	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516	843					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		CCCCGGCATCCCCCCTGGCAC	0.637													4	25	---	---	---	---	PASS
DCAF15	90379	broad.mit.edu	37	19	14069902	14069902	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14069902C>T	uc002mxt.2	+	7	836	c.830C>T	c.(829-831)CCC>CTC	p.P277L	DCAF15_uc002mxu.2_5'Flank	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	277										central_nervous_system(1)	1						AGCACCTGCCCCCTGGCGCCT	0.657													7	79	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17759368	17759368	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17759368G>A	uc002nhd.2	-	16	1952	c.1952C>T	c.(1951-1953)ACG>ATG	p.T651M		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	563	Phorbol-ester/DAG-type.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GTAGGTGGGCGTGGTGGCCGT	0.602													7	28	---	---	---	---	PASS
ELL	8178	broad.mit.edu	37	19	18555600	18555600	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18555600C>T	uc002njh.2	-	12	1900	c.1828G>A	c.(1828-1830)GCC>ACC	p.A610T	ELL_uc010ebq.2_Missense_Mutation_p.A553T|ELL_uc002njg.2_Missense_Mutation_p.A477T	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II	610					positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		TCGTACTCGGCGATGAGCCTC	0.637			T	MLL	AL								11	13	---	---	---	---	PASS
ZNF792	126375	broad.mit.edu	37	19	35451839	35451839	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35451839G>T	uc002nxh.1	-	2	480	c.93C>A	c.(91-93)CTC>CTA	p.L31L		NM_175872	NP_787068	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	31	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			GAGCCTCATCGAGGAGCACCC	0.557													5	246	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35822955	35822955	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35822955C>A	uc010edt.2	+	2	89	c.12C>A	c.(10-12)CTC>CTA	p.L4L	CD22_uc010xst.1_5'UTR|CD22_uc010edu.2_Silent_p.L4L|CD22_uc010edv.2_Silent_p.L4L|CD22_uc002nzb.3_Silent_p.L4L	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	4					cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	TGCATCTCCTCGGCCCCTGGC	0.592													6	349	---	---	---	---	PASS
COX6B1	1340	broad.mit.edu	37	19	36142160	36142160	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36142160G>T	uc002oav.2	+	2	177	c.15G>T	c.(13-15)ATG>ATT	p.M5I		NM_001863	NP_001854	P14854	CX6B1_HUMAN	cytochrome c oxidase subunit VIb polypeptide 1	5					respiratory electron transport chain	mitochondrial inner membrane|mitochondrial intermembrane space	cytochrome-c oxidase activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGGAAGACATGGAGACCAAAA	0.567													6	176	---	---	---	---	PASS
CAPNS1	826	broad.mit.edu	37	19	36637217	36637217	+	Intron	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36637217G>T	uc002odj.2	+						CAPNS1_uc002odi.1_Intron|CAPNS1_uc002odk.2_Intron|CAPNS1_uc002odl.2_Intron	NM_001749	NP_001740	P04632	CPNS1_HUMAN	calpain, small subunit 1						positive regulation of cell proliferation	cytoplasm|plasma membrane	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CATGTTCCGTGAGTGACAACC	0.393													8	360	---	---	---	---	PASS
HKR1	284459	broad.mit.edu	37	19	37853645	37853645	+	Silent	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37853645G>C	uc002ogb.2	+	6	1217	c.948G>C	c.(946-948)CTG>CTC	p.L316L	HKR1_uc002ofx.2_Silent_p.L32L|HKR1_uc002ofy.2_Silent_p.L32L|HKR1_uc002oga.2_Silent_p.L298L|HKR1_uc010xto.1_Silent_p.L298L|HKR1_uc002ogc.2_Silent_p.L297L|HKR1_uc010xtp.1_Silent_p.L255L|HKR1_uc002ogd.2_Silent_p.L255L	NM_181786	NP_861451	P10072	HKR1_HUMAN	GLI-Kruppel family member HKR1	316	C2H2-type 1.				multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGTCAAACCTGATCACACATC	0.498													11	202	---	---	---	---	PASS
ZNF527	84503	broad.mit.edu	37	19	37880525	37880525	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37880525C>A	uc010efk.1	+	5	1685	c.1574C>A	c.(1573-1575)CCC>CAC	p.P525H	ZNF527_uc002ogf.3_Missense_Mutation_p.P493H|ZNF527_uc010xtq.1_RNA	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	525					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GGAGAGAAACCCTATGAATGT	0.393													7	196	---	---	---	---	PASS
ZNF540	163255	broad.mit.edu	37	19	38103316	38103316	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38103316G>T	uc002ogq.2	+	5	1467	c.1135G>T	c.(1135-1137)GGT>TGT	p.G379C	ZNF540_uc002ogu.2_Missense_Mutation_p.G379C|ZNF540_uc010efq.2_Missense_Mutation_p.G347C	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	379					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AACTCATGCAGGTAAGAAACC	0.368													8	120	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39090611	39090611	+	Silent	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39090611C>G	uc002oix.1	-	22	1731	c.1623G>C	c.(1621-1623)CGG>CGC	p.R541R	MAP4K1_uc002oiw.1_Silent_p.R128R|MAP4K1_uc002oiy.1_Silent_p.R541R|MAP4K1_uc010xug.1_Intron	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	541	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCCACGTAGTCCGGCTAGGAA	0.602													26	151	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39090744	39090744	+	Silent	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39090744C>G	uc002oix.1	-	21	1689	c.1581G>C	c.(1579-1581)CGG>CGC	p.R527R	MAP4K1_uc002oiw.1_Silent_p.R114R|MAP4K1_uc002oiy.1_Silent_p.R527R|MAP4K1_uc010xug.1_Silent_p.R189R	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	527	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTGGTCATTCCGGTTCAGGA	0.632													6	41	---	---	---	---	PASS
MAP4K1	11184	broad.mit.edu	37	19	39090770	39090770	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39090770C>G	uc002oix.1	-	21	1663	c.1555G>C	c.(1555-1557)GAG>CAG	p.E519Q	MAP4K1_uc002oiw.1_Missense_Mutation_p.E106Q|MAP4K1_uc002oiy.1_Missense_Mutation_p.E519Q|MAP4K1_uc010xug.1_Missense_Mutation_p.E181Q	NM_007181	NP_009112	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase	519	CNH.				activation of JUN kinase activity|peptidyl-serine phosphorylation		ATP binding|MAP kinase kinase kinase kinase activity|protein binding|small GTPase regulator activity			skin(4)|lung(3)|ovary(1)	8	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			ATGCCTTCCTCTGCCCCCAGG	0.622													6	40	---	---	---	---	PASS
CCDC8	83987	broad.mit.edu	37	19	46915941	46915941	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46915941G>C	uc002pep.2	-	1	979	c.127C>G	c.(127-129)CAG>GAG	p.Q43E		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	43						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		tccaggaactgggtcagccgc	0.129													23	5	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56467436	56467436	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56467436A>T	uc002qmh.2	+	3	2083	c.2012A>T	c.(2011-2013)AAG>ATG	p.K671M	NLRP8_uc010etg.2_Missense_Mutation_p.K671M	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	671						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		AACGTGTGGAAGCTCAGCTCC	0.532													31	8	---	---	---	---	PASS
ZNF582	147948	broad.mit.edu	37	19	56901403	56901403	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56901403C>A	uc002qmz.1	-	4	358	c.199G>T	c.(199-201)GTG>TTG	p.V67L	ZNF582_uc002qmy.2_Missense_Mutation_p.V98L	NM_144690	NP_653291	Q96NG8	ZN582_HUMAN	zinc finger protein 582	67	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|large_intestine(1)	4		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		ACTCTCTCCACCATCCAGGGC	0.483													3	26	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	13090814	13090814	+	Silent	SNP	A	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13090814A>G	uc002wod.1	+	7	1171	c.882A>G	c.(880-882)CGA>CGG	p.R294R		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	294					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	GCCAGCCTCGAACCCGCAGAG	0.438													9	20	---	---	---	---	PASS
SNAI1	6615	broad.mit.edu	37	20	48600418	48600418	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48600418C>T	uc002xuz.2	+	2	210	c.140C>T	c.(139-141)CCG>CTG	p.P47L		NM_005985	NP_005976	O95863	SNAI1_HUMAN	snail 1 homolog	47					epithelial to mesenchymal transition|mesoderm formation|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|zinc ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			ATCCCACCTCCGGAGATCCTC	0.597													17	29	---	---	---	---	PASS
RTEL1	51750	broad.mit.edu	37	20	62317137	62317137	+	Intron	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62317137C>T	uc002yfu.1	+						RTEL1_uc011abc.1_Intron|RTEL1_uc002yft.1_Intron|RTEL1_uc011abd.1_Intron|RTEL1_uc011abe.1_Intron|RTEL1_uc002yfw.2_Intron	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1						DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			GGTCCTGTCCCCTCCAGGTGC	0.647													3	2	---	---	---	---	PASS
ZNF280A	129025	broad.mit.edu	37	22	22868913	22868913	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22868913G>T	uc002zwe.2	-	2	1295	c.1042C>A	c.(1042-1044)CAG>AAG	p.Q348K	LOC96610_uc011aim.1_Intron	NM_080740	NP_542778	P59817	Z280A_HUMAN	zinc finger protein 280A	348	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		CACTGTAGCTGGAAGGGAGTG	0.493													6	67	---	---	---	---	PASS
CABIN1	23523	broad.mit.edu	37	22	24434905	24434905	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24434905G>A	uc002zzi.1	+	4	333	c.206G>A	c.(205-207)CGG>CAG	p.R69Q	CABIN1_uc002zzj.1_Missense_Mutation_p.R69Q|CABIN1_uc002zzl.1_Missense_Mutation_p.R69Q|CABIN1_uc010guk.1_Missense_Mutation_p.R69Q|CABIN1_uc002zzk.1_Missense_Mutation_p.R69Q	NM_012295	NP_036427	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	69	TPR 1.				cell surface receptor linked signaling pathway|chromatin modification	nucleus	protein phosphatase inhibitor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AGCCTGCTGCGGGAGGTGAGG	0.358													23	21	---	---	---	---	PASS
GCAT	23464	broad.mit.edu	37	22	38211693	38211693	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38211693C>T	uc003atz.2	+	7	858	c.838C>T	c.(838-840)CCC>TCC	p.P280S	GCAT_uc003aua.1_Missense_Mutation_p.P306S	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor	280					biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	AGGGCCTGGGCCCCTGGTGTC	0.652													15	49	---	---	---	---	PASS
TNRC6B	23112	broad.mit.edu	37	22	40660695	40660695	+	Nonsense_Mutation	SNP	C	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40660695C>G	uc011aor.1	+	5	672	c.461C>G	c.(460-462)TCA>TGA	p.S154*	TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Nonsense_Mutation_p.S154*|TNRC6B_uc003ayo.2_5'UTR	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1	154					gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						TCCCCAGACTCAACCCTTGGA	0.498													7	40	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40534580	40534580	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40534580C>T	uc004dex.3	-	22	3054	c.2914G>A	c.(2914-2916)GAT>AAT	p.D972N		NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	972					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						CTTCGAGCATCCTGATTGCTG	0.358													4	3	---	---	---	---	PASS
SATL1	340562	broad.mit.edu	37	X	84362697	84362697	+	Silent	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84362697C>A	uc011mqx.1	-	1	1278	c.1278G>T	c.(1276-1278)CCG>CCT	p.P426P	SATL1_uc004een.2_Silent_p.P426P	NM_001163541	NP_001157013	Q86VE3	SATL1_HUMAN	spermidine/spermine N1-acetyl transferase-like 1	239	Gln-rich.			P -> L (in Ref. 2; AAI26402).			N-acetyltransferase activity			breast(2)	2						TTGGTTGCCTCGGGACTGGTT	0.562													4	109	---	---	---	---	PASS
POF1B	79983	broad.mit.edu	37	X	84560850	84560850	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84560850C>A	uc004eer.2	-	13	1530	c.1384G>T	c.(1384-1386)GAG>TAG	p.E462*	POF1B_uc004ees.2_Nonsense_Mutation_p.E462*	NM_024921	NP_079197	Q8WVV4	POF1B_HUMAN	premature ovarian failure, 1B	462							actin binding				0						TTTACCATCTCCGTGTAGTGG	0.408													9	405	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100387224	100387224	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100387224C>A	uc004egx.2	+	13	1603	c.1333C>A	c.(1333-1335)CTC>ATC	p.L445I	CENPI_uc011mrg.1_Missense_Mutation_p.L445I|CENPI_uc004egy.2_Missense_Mutation_p.L445I	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	445					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						GAGCCTTCCTCTCTGGGATGG	0.398													8	366	---	---	---	---	PASS
TAF7L	54457	broad.mit.edu	37	X	100547911	100547911	+	Silent	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100547911G>T	uc004ehb.2	-	1	135	c.123C>A	c.(121-123)ACC>ACA	p.T41T	TAF7L_uc004ehc.1_5'Flank	NM_024885	NP_079161	Q5H9L4	TAF7L_HUMAN	TATA box binding protein-associated factor, RNA	41					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription initiation from RNA polymerase II promoter	cytoplasm|transcription factor TFIID complex	binding			breast(1)	1						TTTCATAGGTGGTTTCAGACC	0.527													11	490	---	---	---	---	PASS
GPRASP2	114928	broad.mit.edu	37	X	101972177	101972177	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101972177G>T	uc004ejk.2	+	4	3714	c.2380G>T	c.(2380-2382)GGA>TGA	p.G794*	GPRASP2_uc004ejl.2_Nonsense_Mutation_p.G794*|GPRASP2_uc004ejm.2_Nonsense_Mutation_p.G794*|GPRASP2_uc011mrp.1_Nonsense_Mutation_p.G133*	NM_138437	NP_612446	Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting	794						cytoplasm	protein binding			ovary(1)	1						TATAAAAAGTGGAAAGATGTC	0.308													8	468	---	---	---	---	PASS
IL1RAPL2	26280	broad.mit.edu	37	X	105011134	105011134	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105011134G>T	uc004elz.1	+	11	2297	c.1541G>T	c.(1540-1542)GGG>GTG	p.G514V		NM_017416	NP_059112	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	514	Cytoplasmic (Potential).|TIR.				central nervous system development|innate immune response	integral to membrane	interleukin-1, Type II, blocking receptor activity			breast(2)|ovary(1)	3						GAATTAAAAGGGAAAGTGAAT	0.403													10	342	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105167219	105167219	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105167219C>T	uc004emd.2	+	18	3023	c.2720C>T	c.(2719-2721)CCG>CTG	p.P907L	NRK_uc010npc.1_Missense_Mutation_p.P575L	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	907							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TGGTTAACTCCGGCACCTGTC	0.343										HNSCC(51;0.14)			12	140	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107446160	107446160	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107446160G>T	uc004enw.3	-	13	938	c.835C>A	c.(835-837)CCG>ACG	p.P279T	COL4A6_uc004env.3_Missense_Mutation_p.P278T|COL4A6_uc011msn.1_Missense_Mutation_p.P278T|COL4A6_uc010npk.2_Missense_Mutation_p.P278T	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	279	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						AGACTTACCGGGAAGCCTGGA	0.463									Alport_syndrome_with_Diffuse_Leiomyomatosis				11	554	---	---	---	---	PASS
GUCY2F	2986	broad.mit.edu	37	X	108619384	108619384	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108619384C>A	uc004eod.3	-	18	3439	c.3163G>T	c.(3163-3165)GAG>TAG	p.E1055*	GUCY2F_uc011msq.1_RNA	NM_001522	NP_001513	P51841	GUC2F_HUMAN	guanylate cyclase 2F precursor	1055	Cytoplasmic (Potential).		E -> D (in a lung squamous cell carcinoma sample; somatic mutation).		intracellular signal transduction|receptor guanylyl cyclase signaling pathway|visual perception	integral to plasma membrane|nuclear outer membrane	ATP binding|GTP binding|guanylate cyclase activity|protein kinase activity|receptor activity	p.E1055D(1)		lung(4)|breast(3)|central_nervous_system(1)	8						AAGGTTTCCTCTGTGCCTTTG	0.408													7	279	---	---	---	---	PASS
CHRDL1	91851	broad.mit.edu	37	X	109963156	109963156	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109963156C>A	uc004eou.3	-	6	797	c.448G>T	c.(448-450)GAG>TAG	p.E150*	CHRDL1_uc004eov.2_Nonsense_Mutation_p.E144*|CHRDL1_uc004eow.2_Nonsense_Mutation_p.E149*|CHRDL1_uc010nps.2_Nonsense_Mutation_p.E149*|CHRDL1_uc004eot.2_Intron|CHRDL1_uc011mss.1_Intron|CHRDL1_uc004eox.3_Nonsense_Mutation_p.E143*	NM_001143981	NP_001137453	Q9BU40	CRDL1_HUMAN	chordin-like 1 isoform 1 precursor	143	VWFC 2.				BMP signaling pathway|cell differentiation|nervous system development|ossification	extracellular region					0						ACGTTTCCCTCCTGCCAAGGA	0.463													7	166	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110494322	110494322	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110494322C>A	uc004epc.1	-	8	1149	c.981G>T	c.(979-981)TTG>TTT	p.L327F	CAPN6_uc011msu.1_Missense_Mutation_p.L72F	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	327	Calpain catalytic.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						AAAAGTCCTCCAAGCTCATCC	0.443													9	757	---	---	---	---	PASS
LHFPL1	340596	broad.mit.edu	37	X	111903881	111903881	+	Missense_Mutation	SNP	C	A	A	rs147016809		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111903881C>A	uc004epq.2	-	3	788	c.455G>T	c.(454-456)GGG>GTG	p.G152V	LHFPL1_uc004epp.2_Missense_Mutation_p.G175V|LHFPL1_uc010nqa.2_Intron|LHFPL1_uc010nqb.2_Intron	NM_178175	NP_835469	Q86WI0	LHPL1_HUMAN	lipoma HMGIC fusion partner-like 1 precursor	152						integral to membrane					0						GGAGACATTCCCACATGTTTG	0.463													11	648	---	---	---	---	PASS
AMOT	154796	broad.mit.edu	37	X	112021836	112021836	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112021836C>A	uc004epr.2	-	11	3214	c.3214G>T	c.(3214-3216)GGA>TGA	p.G1072*	AMOT_uc004eps.2_Nonsense_Mutation_p.G663*	NM_001113490	NP_001106962	Q4VCS5	AMOT_HUMAN	angiomotin isoform 1	1072					actin cytoskeleton organization|cell-cell junction assembly|negative regulation of angiogenesis|negative regulation of vascular permeability|positive regulation of blood vessel endothelial cell migration|positive regulation of cell size|positive regulation of stress fiber assembly|regulation of cell migration	actin filament|cell surface|cytoplasm|endocytic vesicle|external side of plasma membrane|integral to membrane|lamellipodium|ruffle|stress fiber|tight junction|tight junction	angiostatin binding|protein binding|receptor activity			ovary(1)	1						GGCTCTTGTCCCAGGATCTGA	0.408													11	484	---	---	---	---	PASS
SLC6A14	11254	broad.mit.edu	37	X	115577987	115577987	+	Silent	SNP	A	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115577987A>C	uc004eqi.2	+	7	974	c.870A>C	c.(868-870)TCA>TCC	p.S290S	SLC6A14_uc011mtm.1_RNA	NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid	290					cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	AGGGTGCTTCAAAAGGCATTT	0.393													14	206	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	2380939	2380942	+	IGR	DEL	AACC	-	-	rs71578389		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2380939_2380942delAACC								PEX10 (36929 upstream) : PLCH2 (26812 downstream)																							gtctcaacaaaaccaaccaaccaa	0.186													4	3	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	7654716	7654716	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:7654716delG	uc001aoi.2	+							NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		agagcagggtggggagaggag	0.000													4	2	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16946455	16946456	+	RNA	INS	-	GCTCACGCTGCA	GCTCACGCTGCA			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16946455_16946456insGCTCACGCTGCA	uc010ocf.1	-	3		c.442_443insTGCAGCGTGAGC			CROCCL1_uc009vov.1_RNA|CROCCL1_uc001aze.2_RNA|CROCCL1_uc001azf.2_RNA					Homo sapiens mRNA for FLJ00313 protein.												0						CAGCTCCTCCTGCTCACGCTGC	0.678													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	18190793	18190797	+	IGR	DEL	TCCCT	-	-	rs140303237	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18190793_18190797delTCCCT								ACTL8 (37237 upstream) : IGSF21 (243443 downstream)																							catccatccatcccttccatccatc	0.161													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19845724	19845724	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19845724delA								CAPZB (33732 upstream) : C1orf151 (77743 downstream)																							gacccatctcaaaaaaaaaaa	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	22583597	22583597	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22583597delT								WNT4 (113212 upstream) : ZBTB40 (194747 downstream)																							CCTGCACGCCTTTTTTTCTCT	0.557													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	29722414	29722414	+	IGR	DEL	T	-	-	rs71828227		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29722414delT								PTPRU (69099 upstream) : None (None downstream)																							TCAGCTCTGGTTTTTTTTTTT	0.259													4	2	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34536972	34536972	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34536972delG	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGCAGCTCCTGGGGCAACTGG	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	37777017	37777017	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37777017delG								GRIK3 (277173 upstream) : ZC3H12A (163102 downstream)																							CCACCCCAGTGAGTTCAACCC	0.577													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39833676	39833676	+	Intron	DEL	T	-	-	rs111840698		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39833676delT	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGTTTGTTTGTTTTTTTTAAA	0.159													2	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	41742041	41742042	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41742041_41742042insT								SCMH1 (34253 upstream) : EDN2 (202407 downstream)																							TGTAGGACACATTTTTTTTTTT	0.411													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44630358	44630359	+	IGR	INS	-	AT	AT	rs141108235	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44630358_44630359insAT								KLF17 (29551 upstream) : DMAP1 (48766 downstream)																							tcacaaagtcCgtgtgtgtgtg	0.015													3	3	---	---	---	---	
TAL1	6886	broad.mit.edu	37	1	47683060	47683061	+	3'UTR	DEL	CA	-	-	rs71645857		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47683060_47683061delCA	uc001cqx.2	-	4					TAL1_uc009vyq.2_3'UTR|TAL1_uc001cqy.2_3'UTR	NM_003189	NP_003180	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1						basophil differentiation|cell fate commitment|cell proliferation|embryonic hemopoiesis|erythrocyte differentiation|megakaryocyte differentiation|positive regulation of cell division|positive regulation of chromatin assembly or disassembly|positive regulation of erythrocyte differentiation|positive regulation of mitotic cell cycle|positive regulation of protein complex assembly|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	E-box binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity			lung(1)	1						caccgtctcTcacacacacaca	0.139			T	TRD@|SIL	lymphoblastic leukemia/biphasic								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	51540268	51540271	+	IGR	DEL	GTGT	-	-	rs112763372		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51540268_51540271delGTGT								CDKN2C (99961 upstream) : C1orf185 (27635 downstream)																							AGAAgtgtgagtgtgtgtgtgtgt	0.309													3	6	---	---	---	---	
GLIS1	148979	broad.mit.edu	37	1	54078509	54078510	+	Intron	DEL	TG	-	-	rs56022424		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54078509_54078510delTG	uc001cvr.1	-							NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1						negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						tttttttttttgagatggggtc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	55798451	55798452	+	IGR	INS	-	GTGA	GTGA	rs61363634		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55798451_55798452insGTGA								USP24 (117689 upstream) : None (None downstream)																							tgtgtgtgtgtgAGAGAGAGAG	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59682561	59682562	+	IGR	INS	-	AGAGA	AGAGA	rs141496049	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59682561_59682562insAGAGA								LOC729467 (70082 upstream) : FGGY (80063 downstream)																							agagaaagaagagagaagagaa	0.134													3	5	---	---	---	---	
FGGY	55277	broad.mit.edu	37	1	59863243	59863243	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59863243delT	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					GTAGGAAGACTTTGAGGAAGG	0.458													4	2	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62640810	62640811	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62640810_62640811insT	uc009wag.2	+							NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						tttttgttttgttttttttttt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64833175	64833175	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64833175delT								UBE2U (123148 upstream) : CACHD1 (103301 downstream)																							TATGGTTAACTTTTTTTGAAT	0.373													4	2	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85809834	85809834	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85809834delA	uc001dlb.2	-						DDAH1_uc001dlc.2_Intron|uc001dla.1_Intron|DDAH1_uc010osb.1_Intron|DDAH1_uc009wco.2_Intron	NM_012137	NP_036269	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	ACAAAGGCACAAAAAATGGAG	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120429341	120429342	+	IGR	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120429341_120429342delAC								NBPF7 (41562 upstream) : ADAM30 (6815 downstream)																							TCTCTCTcatacacacacacac	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142569682	142569682	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142569682delA								None (None upstream) : None (None downstream)																							TTTCTAGATTAAAAGTCAACT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143514250	143514255	+	IGR	DEL	CTTTCC	-	-	rs61801401		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143514250_143514255delCTTTCC								None (None upstream) : LOC100286793 (133384 downstream)																							CCCTTAGAGGCTTTCCCTTCCCCTTC	0.345													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144681814	144681814	+	Intron	DEL	G	-	-	rs67467472		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144681814delG	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF9_uc009wii.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						TTACTAGTACGTTTTTAGTGA	0.348													4	3	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	144852877	144852877	+	Intron	DEL	T	-	-	rs71909310		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144852877delT	uc001elw.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Intron|PDE4DIP_uc001elv.3_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAACAGCCTGTTTGTAGGAAG	0.443			T	PDGFRB	MPD								4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145189018	145189019	+	Intron	INS	-	AAA	AAA			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145189018_145189019insAAA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						aaagttgaaggaaaaaaaaAAA	0.144													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145289274	145289276	+	Intron	DEL	ACT	-	-	rs142911147		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145289274_145289276delACT	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ataCTATAGAACTAATAATAACA	0.128													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149299254	149299254	+	IGR	DEL	T	-	-	rs142718750		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149299254delT								LOC388692 (7512 upstream) : FCGR1C (70040 downstream)																							CCCCACATACTTGCGCCCTGC	0.532													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157277583	157277583	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157277583delG								ETV3 (169200 upstream) : FCRL5 (205585 downstream)																							AGGGACTTCTGGCTAGCAGAG	0.582													4	2	---	---	---	---	
KIRREL	55243	broad.mit.edu	37	1	158036645	158036645	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158036645delC	uc001frn.3	+						KIRREL_uc010pib.1_Intron	NM_018240	NP_060710	Q96J84	KIRR1_HUMAN	kin of IRRE like precursor							integral to membrane				ovary(1)	1	all_hematologic(112;0.0378)					CCTCCTGTCTCCCCTACCTCC	0.537													4	2	---	---	---	---	
CD1E	913	broad.mit.edu	37	1	158322917	158322917	+	5'Flank	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158322917delT	uc001fse.2	+						CD1E_uc010pid.1_5'Flank|CD1E_uc010pie.1_5'Flank|CD1E_uc010pif.1_5'Flank|CD1E_uc001fsd.2_5'Flank|CD1E_uc001fsk.2_5'Flank|CD1E_uc001fsj.2_5'Flank|CD1E_uc001fsc.2_5'Flank|CD1E_uc010pig.1_5'Flank|CD1E_uc001fsa.2_5'Flank|CD1E_uc001fsf.2_5'Flank|CD1E_uc001fry.2_5'Flank|CD1E_uc001fsg.2_5'Flank|CD1E_uc001fsh.2_5'Flank|CD1E_uc001fsi.2_5'Flank|CD1E_uc009wsv.2_5'Flank|CD1E_uc001frz.2_5'Flank|CD1E_uc009wsw.2_5'Flank	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor						antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					TCAGTCTTTCTTCATACCCAG	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161429066	161429067	+	IGR	DEL	CA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161429066_161429067delCA								C1orf192 (91402 upstream) : FCGR2A (46138 downstream)																							gacgcgcacgcacacacacaca	0.223													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	163208635	163208635	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163208635delG								RGS5 (35763 upstream) : NUF2 (83088 downstream)																							TCAAGTGATAGGATGATGTTG	0.299													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164030285	164030285	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164030285delA								NUF2 (704732 upstream) : PBX1 (498517 downstream)																							tcttcagaggaaaggcattga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	168435036	168435036	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168435036delA								MIR557 (90177 upstream) : XCL2 (74969 downstream)																							gggatgcagcaaaagcagtgt	0.000													4	2	---	---	---	---	
C1orf49	84066	broad.mit.edu	37	1	178507387	178507390	+	Intron	DEL	GAGT	-	-	rs5778993		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178507387_178507390delGAGT	uc001glv.1	+									Q5T0J7	CA049_HUMAN	Homo sapiens cDNA FLJ35950 fis, clone TESTI2012090.							microtubule cytoskeleton					0						GAAGAGGCAGGAGTGAGTGCGTGC	0.485													4	3	---	---	---	---	
C1orf125	126859	broad.mit.edu	37	1	179503445	179503445	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179503445delA	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmp.2_Intron|C1orf125_uc009wxh.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TGTAGTAGCTAAGAAGCACAT	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	181093653	181093654	+	IGR	INS	-	CCC	CCC	rs60841769		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181093653_181093654insCCC								IER5 (33676 upstream) : CACNA1E (359062 downstream)																							ctcctcctcctcctcttcctcc	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	182414011	182414011	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182414011delT								TEDDM1 (44260 upstream) : RGSL1 (5245 downstream)																							CTCCTCCTGAttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	187144144	187144144	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:187144144delG								PLA2G4A (186039 upstream) : None (None downstream)																							agttgggggtgggggagttta	0.000													4	2	---	---	---	---	
HHAT	55733	broad.mit.edu	37	1	210827277	210827278	+	Intron	INS	-	G	G	rs141633490		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210827277_210827278insG	uc009xcx.2	+						HHAT_uc010psq.1_Intron|HHAT_uc001hhz.3_Intron|HHAT_uc010psr.1_Intron|HHAT_uc010pss.1_Intron|HHAT_uc009xcy.2_Intron|HHAT_uc010pst.1_Intron|HHAT_uc010psu.1_Intron|HHAT_uc001hia.3_Intron	NM_001122834	NP_001116306	Q5VTY9	HHAT_HUMAN	hedgehog acyltransferase						multicellular organismal development	endoplasmic reticulum membrane|integral to membrane	GTP binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0136)|all cancers(67;0.161)|KIRC - Kidney renal clear cell carcinoma(1967;0.215)		AATACTGTGATGGGAATAGTGT	0.475													13	6	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	210923084	210923085	+	Intron	INS	-	T	T	rs11443301		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210923084_210923085insT	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		AGGCTGCTCACttttttttttt	0.252													4	2	---	---	---	---	
ATF3	467	broad.mit.edu	37	1	212770583	212770583	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212770583delA	uc001hjf.2	+							NM_001030287	NP_001025458	P18847	ATF3_HUMAN	activating transcription factor 3 isoform 1							nucleolus	identical protein binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)		TGACGACAAGAAAAAAGGGGC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	219608054	219608054	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219608054delC								LYPLAL1 (221848 upstream) : SLC30A10 (250715 downstream)																							ACTTGGCTAGCCCAGACTACC	0.438													4	2	---	---	---	---	
IARS2	55699	broad.mit.edu	37	1	220270707	220270708	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220270707_220270708insT	uc001hmc.2	+							NM_018060	NP_060530	Q9NSE4	SYIM_HUMAN	mitochondrial isoleucine tRNA synthetase						isoleucyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|isoleucine-tRNA ligase activity			ovary(2)|skin(2)	4				GBM - Glioblastoma multiforme(131;0.0554)	L-Isoleucine(DB00167)	gttcttttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	222252145	222252145	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222252145delC								DUSP10 (336684 upstream) : HHIPL2 (443457 downstream)																							TCACAATCCTCAGCCTAATTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224071546	224071546	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224071546delT								TP53BP2 (37872 upstream) : FBXO28 (230245 downstream)																							tggagtgcagtggtgcaatct	0.005													4	2	---	---	---	---	
PRSS38	339501	broad.mit.edu	37	1	228032606	228032627	+	Intron	DEL	CTCCTCCCTATGTGTGGTGGGA	-	-	rs71684737		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228032606_228032627delCTCCTCCCTATGTGTGGTGGGA	uc001hrh.2	+							NM_183062	NP_898885	A1L453	PRS38_HUMAN	marapsin 2 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)|pancreas(1)	2						ACGGTCAGGGCTCCTCCCTATGTGTGGTGGGACTCCTCCCTA	0.604													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229923994	229923995	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229923994_229923995delTG								URB2 (128048 upstream) : GALNT2 (269541 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	230122950	230122950	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230122950delC								URB2 (327004 upstream) : GALNT2 (70586 downstream)																							TTACGCTCCTCCCCTGCCCTA	0.498													4	2	---	---	---	---	
GALNT2	2590	broad.mit.edu	37	1	230361687	230361687	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:230361687delG	uc010pwa.1	+						GALNT2_uc010pvy.1_Intron|GALNT2_uc010pvz.1_Intron	NM_004481	NP_004472	Q10471	GALT2_HUMAN	polypeptide N-acetylgalactosaminyltransferase 2						immunoglobulin biosynthetic process|protein O-linked glycosylation via serine|protein O-linked glycosylation via threonine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane|perinuclear region of cytoplasm	manganese ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)	2	Breast(184;0.193)|Ovarian(103;0.249)	all_cancers(173;0.156)|Prostate(94;0.179)				gaagcagtcagggcctaggca	0.065													4	2	---	---	---	---	
EGLN1	54583	broad.mit.edu	37	1	231509449	231509450	+	Intron	DEL	TA	-	-	rs6659323		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231509449_231509450delTA	uc001huv.2	-						EGLN1_uc001huu.3_Intron	NM_022051	NP_071334	Q9GZT9	EGLN1_HUMAN	egl nine homolog 1						negative regulation of sequence-specific DNA binding transcription factor activity|oxygen homeostasis|response to hypoxia	cytosol	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptidyl-proline dioxygenase activity|protein binding|zinc ion binding				0		Prostate(94;0.194)|Acute lymphoblastic leukemia(190;0.244)			Vitamin C(DB00126)	tgtgtgtgtgtatgtgtgtgtg	0.000													2	4	---	---	---	---	
KIAA1804	84451	broad.mit.edu	37	1	233488189	233488189	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233488189delT	uc001hvt.3	+						KIAA1804_uc001hvs.1_Intron	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4						activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				attttgtgtcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238707494	238707496	+	IGR	DEL	ATC	-	-	rs35190991		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238707494_238707496delATC								LOC339535 (58177 upstream) : CHRM3 (842369 downstream)																							TATGTGTAAGATCATCTTTTTCA	0.177													4	2	---	---	---	---	
CHRM3	1131	broad.mit.edu	37	1	239969717	239969718	+	Intron	INS	-	AC	AC	rs138852972	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:239969717_239969718insAC	uc001hyp.2	+						CHRM3_uc001hyo.1_Intron	NM_000740	NP_000731	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3						cell proliferation|energy reserve metabolic process|nervous system development|protein modification process|regulation of insulin secretion	basolateral plasma membrane|cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(4)|skin(1)	5	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Cevimeline(DB00185)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Darifenacin(DB00496)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Solifenacin(DB01591)|Thiethylperazine(DB00372)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tridihexethyl(DB00505)	AGGATGGAGTTacacacacaca	0.401													4	3	---	---	---	---	
FMN2	56776	broad.mit.edu	37	1	240353077	240353077	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240353077delA	uc010pyd.1	+						FMN2_uc010pye.1_Intron	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TGATTAGCCCACAGCGAATAA	0.393													4	2	---	---	---	---	
PLD5	200150	broad.mit.edu	37	1	242598344	242598344	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242598344delC	uc001hzn.1	-						PLD5_uc001hzl.3_Intron|PLD5_uc001hzm.3_Intron|PLD5_uc001hzo.1_Intron			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;							integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			cactccccagcccttgTTTTT	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	244168466	244168466	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244168466delT	uc001iac.2	+											Homo sapiens cDNA clone IMAGE:5244187.																		tcaaggtgggtacaattatta	0.000													4	2	---	---	---	---	
ACP1	52	broad.mit.edu	37	2	277474	277474	+	3'UTR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:277474delG	uc002qwg.2	+	6					ACP1_uc002qwh.2_RNA|ACP1_uc002qwf.2_3'UTR	NM_007099	NP_009030	P24666	PPAC_HUMAN	acid phosphatase 1, soluble isoform b							cytoplasm|internal side of plasma membrane|nucleus|soluble fraction	acid phosphatase activity|identical protein binding|non-membrane spanning protein tyrosine phosphatase activity			skin(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.00175)|Lung NSC(108;0.216)|all_epithelial(98;0.236)		all cancers(51;0.000391)|Epithelial(75;0.00281)|OV - Ovarian serous cystadenocarcinoma(76;0.00542)|GBM - Glioblastoma multiforme(21;0.127)		AGTTGTGTTTGGCAGGAGAAT	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	915830	915833	+	IGR	DEL	GATA	-	-	rs113319898		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:915830_915833delGATA								TMEM18 (238391 upstream) : SNTG2 (30722 downstream)																							gatgatgattgatagatagataga	0.123													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	1615921	1615921	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1615921delC								TPO (69423 upstream) : PXDN (19739 downstream)																							TCCTCACCCTCCCCACCTTCC	0.602													4	5	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2180273	2180274	+	Intron	DEL	TT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2180273_2180274delTT	uc002qxe.2	-						MYT1L_uc002qxd.2_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AGGACATAACtttttttttttt	0.208													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6397827	6397828	+	IGR	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6397827_6397828delAC								LOC400940 (269463 upstream) : CMPK2 (582675 downstream)																							ACTTGTACGAACACACACACAC	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	6634111	6634111	+	IGR	DEL	G	-	-	rs34335873		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:6634111delG								LOC400940 (505747 upstream) : CMPK2 (346392 downstream)																							gtttggctctgtgtccccacc	0.164													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	7286524	7286524	+	IGR	DEL	T	-	-	rs10714037		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7286524delT								RNF144A (102217 upstream) : LOC339788 (776034 downstream)																							AATAGAAACATTTTTTTTTTC	0.363													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8038203	8038204	+	IGR	INS	-	GAAG	GAAG	rs5829130		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8038203_8038204insGAAG								RNF144A (853896 upstream) : LOC339788 (24354 downstream)																							aaaaagagagagaaagaatgaa	0.109													4	2	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9390684	9390684	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9390684delG	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						AAAGGATACAGGGCACATTGC	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11055878	11055878	+	IGR	DEL	G	-	-	rs111436288		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11055878delG								KCNF1 (1528 upstream) : C2orf50 (217301 downstream)																							GGCCTGGCCAGGGGGTGCAAG	0.637													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16172938	16172939	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16172938_16172939insT								MYCN (85810 upstream) : FAM49A (560962 downstream)																							AGTGTGGtttcttttttttttt	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17023339	17023344	+	IGR	DEL	CACACA	-	-	rs111602039		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17023339_17023344delCACACA								FAM49A (176243 upstream) : RAD51AP2 (668642 downstream)																							TCCGCGCGCGcacacacacacacaca	0.330													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	17355235	17355235	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17355235delC								FAM49A (508139 upstream) : RAD51AP2 (336751 downstream)																							TTCCCTTTATCccccctcctt	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	19371159	19371159	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:19371159delG								NT5C1B (600321 upstream) : OSR1 (180088 downstream)																							tttttattctggctgcactgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20013193	20013194	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20013193_20013194delGT								OSR1 (454821 upstream) : TTC32 (83324 downstream)																							AATCATCAACgtgtgtgtgtgt	0.084													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20088657	20088657	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20088657delT								OSR1 (530285 upstream) : TTC32 (7861 downstream)																							ATAGCAAGGGTAGAGGAGTGG	0.532													4	2	---	---	---	---	
PUM2	23369	broad.mit.edu	37	2	20526892	20526893	+	Intron	INS	-	T	T	rs144298018	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20526892_20526893insT	uc002rds.1	-						PUM2_uc002rdt.1_Intron|PUM2_uc002rdr.2_Intron|PUM2_uc010yjy.1_Intron|PUM2_uc002rdu.1_Intron|PUM2_uc010yjz.1_Intron	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2						regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGCTAAAAGCTTTTTTTTTAA	0.297													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	21477332	21477336	+	IGR	DEL	TTTTG	-	-	rs75962820		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21477332_21477336delTTTTG								APOB (210387 upstream) : None (None downstream)																							TTTTTTTCTCTTTTGTTTTGTTTTC	0.376													4	2	---	---	---	---	
KLHL29	114818	broad.mit.edu	37	2	23764642	23764643	+	Intron	INS	-	A	A	rs72793547	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23764642_23764643insA	uc002ref.2	+									Q96CT2	KLH29_HUMAN	SubName: Full=KLHL29 protein; Flags: Fragment;											ovary(1)|lung(1)	2						ACCCAAAAAACAAAAAAAAAAA	0.446													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	23990778	23990779	+	Intron	INS	-	A	A	rs11303963		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:23990778_23990779insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rei.3_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					aaaaaacaaacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24026184	24026187	+	Intron	DEL	ACAC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24026184_24026187delACAC	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc002rei.3_Intron|ATAD2B_uc002rej.3_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATATGTGTGTacacacacacacac	0.324													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	27645712	27645712	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27645712delT								PPM1G (13216 upstream) : NRBP1 (4945 downstream)																							ggctaacgggtatatgaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	32558050	32558051	+	IGR	DEL	AA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32558050_32558051delAA								YIPF4 (26393 upstream) : BIRC6 (24045 downstream)																							actccatctcaaaaaaaaaaaa	0.149													4	2	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33243935	33243935	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33243935delT	uc002ros.2	+							NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				GCTGGCTCCATTTTTTTTTTT	0.443													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	34161999	34162000	+	IGR	DEL	TT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:34161999_34162000delTT								MYADML (208715 upstream) : None (None downstream)																							ttcTACCCACTTTTtttttttt	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	35258132	35258133	+	IGR	INS	-	GGAA	GGAA	rs149431424	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:35258132_35258133insGGAA								None (None upstream) : None (None downstream)																							aaaggaagaagggaaggaagga	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	36539274	36539274	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:36539274delA								None (None upstream) : CRIM1 (44123 downstream)																							gtcaggatacaaaatcaatgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42186194	42186194	+	IGR	DEL	T	-	-	rs67149338		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42186194delT								None (None upstream) : PKDCC (88967 downstream)																							cagacatttcttttttttcct	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	42300250	42300251	+	IGR	INS	-	AA	AA	rs76120914		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42300250_42300251insAA								PKDCC (14584 upstream) : EML4 (96239 downstream)																							CTCTCACACACACACATCTAGA	0.490													4	2	---	---	---	---	
PLEKHH2	130271	broad.mit.edu	37	2	43948462	43948462	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43948462delG	uc010yny.1	+						PLEKHH2_uc002rtf.3_Intron	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H							cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TGTCACCTTTGGATAACTGAA	0.393													4	2	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	51115101	51115101	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51115101delA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CCTTTTAAGTAAAAAAAAAAA	0.284													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54229487	54229488	+	IGR	INS	-	T	T	rs146185531		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54229487_54229488insT								PSME4 (31510 upstream) : ACYP2 (112922 downstream)																							tcatttctttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	59187574	59187575	+	Intron	INS	-	A	A	rs147214066	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:59187574_59187575insA	uc002rzy.2	+						uc002rzz.2_Intron					Homo sapiens cDNA FLJ30838 fis, clone FEBRA2002399.																		AGACGCTTATGAAAAAAATCAT	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60300003	60300004	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60300003_60300004delTG								None (None upstream) : BCL11A (378299 downstream)																							caggcaactttgtgtgttacac	0.252													3	3	---	---	---	---	
XPO1	7514	broad.mit.edu	37	2	61735230	61735230	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61735230delG	uc002sbj.2	-						XPO1_uc010fcl.2_Intron|XPO1_uc010ypn.1_Intron|XPO1_uc002sbk.2_Intron	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1						intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			tgggcatggtggctcacacct	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62036016	62036017	+	IGR	INS	-	T	T	rs146865815	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62036016_62036017insT								XPO1 (270598 upstream) : FAM161A (15968 downstream)																							GTAATGTTGACttttttttttg	0.223													4	2	---	---	---	---	
AFTPH	54812	broad.mit.edu	37	2	64762318	64762318	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64762318delT	uc002scz.2	+						AFTPH_uc002sda.2_Intron|AFTPH_uc002sdb.2_Intron	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a						protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						AGCAGTTCAGTTTAGAAACAT	0.264													4	2	---	---	---	---	
AFTPH	54812	broad.mit.edu	37	2	64802258	64802258	+	Intron	DEL	T	-	-	rs3836066		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64802258delT	uc002sdc.2	+						AFTPH_uc002scz.2_Intron|AFTPH_uc002sda.2_Intron|AFTPH_uc002sdb.2_Intron	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a						protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						TTGCCTGTAATTTTTTCCTCT	0.338													3	3	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66718175	66718175	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66718175delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						CAACAACAAGAAAAAAAAAAT	0.363													4	2	---	---	---	---	
MEIS1	4211	broad.mit.edu	37	2	66757329	66757329	+	Intron	DEL	A	-	-	rs35437118		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:66757329delA	uc002sdu.2	+						MEIS1_uc002sdt.2_Intron|MEIS1_uc002sdv.2_Intron|MEIS1_uc010yqh.1_Intron|MEIS1_uc010yqi.1_Intron|MEIS1_uc002sdw.1_Intron	NM_002398	NP_002389	O00470	MEIS1_HUMAN	Meis homeobox 1								sequence-specific DNA binding transcription factor activity				0						TAGGCaaagcaaaaaaaaaaa	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67527909	67527910	+	IGR	INS	-	AAG	AAG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67527909_67527910insAAG								MEIS1 (728019 upstream) : ETAA1 (96532 downstream)																							TCTACAGAAGAAACAGTGATCC	0.337													4	2	---	---	---	---	
SMYD5	10322	broad.mit.edu	37	2	73448561	73448561	+	Intron	DEL	T	-	-	rs112717194		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73448561delT	uc002siw.2	+						SMYD5_uc010yre.1_Intron|SMYD5_uc002six.1_5'Flank	NM_006062	NP_006053	Q6GMV2	SMYD5_HUMAN	SMYD family member 5								metal ion binding				0						GCCTGTAGTCTTTTTTTTTTT	0.403													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74195710	74195711	+	IGR	DEL	CA	-	-	rs74703312	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74195710_74195711delCA								DGUOK (9624 upstream) : TET3 (77739 downstream)																							cctacccccccacacacacaca	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	74672371	74672371	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74672371delT								RTKN (3311 upstream) : INO80B (9828 downstream)																							caacagaacctttttttttta	0.139													3	3	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77268890	77268893	+	Intron	DEL	TTGT	-	-	rs140637648		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77268890_77268893delTTGT	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		tgctagtgaattgtttgagttttt	0.000													3	5	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77286491	77286492	+	Intron	INS	-	TTTC	TTTC	rs148796065	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77286491_77286492insTTTC	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		CAAAGTCACTTTTTCTTTATTT	0.317													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	77879823	77879825	+	IGR	DEL	TCA	-	-	rs72471971		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77879823_77879825delTCA								LRRTM4 (130321 upstream) : SNAR-H (302208 downstream)																							atcatcattgtcatcatcatcat	0.172													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78079934	78079934	+	IGR	DEL	T	-	-	rs143619533		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78079934delT								LRRTM4 (330432 upstream) : SNAR-H (102099 downstream)																							cTAGAGATGATTTTCTACAAG	0.159													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	78984729	78984730	+	IGR	INS	-	AC	AC	rs144165769	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:78984729_78984730insAC								SNAR-H (802577 upstream) : REG3G (268096 downstream)																							AATTCTATAATacacacacaca	0.035													6	3	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79458826	79458826	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79458826delT	uc010yse.1	+							NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						gcatggaatatttttccattt	0.000													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	79925859	79925860	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79925859_79925860insT	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ATGTGTGTACATGTTGCATATG	0.391													3	4	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91812966	91812977	+	Intron	DEL	CAGGGATTAATA	-	-	rs139939247		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91812966_91812977delCAGGGATTAATA	uc002sts.3	-						LOC654342_uc002stt.2_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						gttaaggtctcagggattaatacagggaatac	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92179176	92179179	+	IGR	DEL	AATG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92179176_92179179delAATG								FKSG73 (48682 upstream) : None (None downstream)																							gaaatgaaataatgaaaatgaaat	0.000													3	3	---	---	---	---	
TMEM131	23505	broad.mit.edu	37	2	98520367	98520367	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98520367delC	uc002syh.3	-						TMEM131_uc010yvg.1_Intron	NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein							integral to membrane				ovary(4)|central_nervous_system(2)	6						ctcaggcaatccaccgcctca	0.000													4	2	---	---	---	---	
REV1	51455	broad.mit.edu	37	2	100074071	100074071	+	Intron	DEL	A	-	-	rs36007747		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100074071delA	uc002tad.2	-						REV1_uc002tac.2_Intron|REV1_uc002tae.1_Intron	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1						DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						cgcttgagccagggaggcaga	0.000								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	6	---	---	---	---	
AFF3	3899	broad.mit.edu	37	2	100547301	100547302	+	Intron	INS	-	TCA	TCA	rs141192548	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100547301_100547302insTCA	uc002tag.2	-						AFF3_uc002taf.2_Intron|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Intron|AFF3_uc002tah.1_Intron|AFF3_uc010fir.1_Intron	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						ATTCATGGTTTTCAAGGACATG	0.406													2	4	---	---	---	---	
NPAS2	4862	broad.mit.edu	37	2	101498147	101498148	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101498147_101498148insA	uc002tap.1	+						NPAS2_uc010yvt.1_Intron	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2						central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						gacttcatctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
IL1RL2	8808	broad.mit.edu	37	2	102804538	102804539	+	Intron	INS	-	ACC	ACC	rs144678772	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102804538_102804539insACC	uc002tbs.2	+						IL1RL2_uc002tbt.2_Intron	NM_003854	NP_003845	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2 precursor						cellular defense response|innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity			ovary(2)	2						GGAAACAGAGAACCAGCTCCAC	0.624													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103663329	103663330	+	IGR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103663329_103663330delTC								TMEM182 (229193 upstream) : None (None downstream)																							gtgccctggttctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	108535609	108535610	+	IGR	INS	-	TG	TG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108535609_108535610insTG								RGPD4 (26610 upstream) : SLC5A7 (67385 downstream)																							gctgagagttttttgtttgttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113030040	113030040	+	IGR	DEL	A	-	-	rs113733729		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113030040delA								ZC3H8 (17376 upstream) : ZC3H6 (3138 downstream)																							actctgtctcaaaaaaaaaCC	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114765688	114765688	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114765688delA								ACTR3 (49521 upstream) : DPP10 (434211 downstream)																							taaagcatagaagggatgggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119953419	119953419	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119953419delG								C1QL2 (36948 upstream) : STEAP3 (27965 downstream)																							gaaggaaggaggggagggagg	0.000													4	2	---	---	---	---	
GLI2	2736	broad.mit.edu	37	2	121568051	121568051	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121568051delT	uc010flp.2	+						GLI2_uc010yyu.1_Intron|GLI2_uc002tmp.1_Intron|GLI2_uc010fln.1_Intron|GLI2_uc002tmq.1_Intron|GLI2_uc002tmr.1_Intron|GLI2_uc002tmt.3_Intron|GLI2_uc002tmu.3_Intron|GLI2_uc002tmv.1_Intron|GLI2_uc010flo.1_Intron|GLI2_uc002tmw.1_Intron	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2						axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				TTGCTGTCCCTCCTCCCTCTA	0.617													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	122599896	122599898	+	IGR	DEL	ATT	-	-	rs10610924		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122599896_122599898delATT								TSN (74470 upstream) : None (None downstream)																							caccatcatcattgtcatcgcca	0.222													5	4	---	---	---	---	
CNTNAP5	129684	broad.mit.edu	37	2	124928910	124928911	+	Intron	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:124928910_124928911insC	uc002tno.2	+						CNTNAP5_uc010flu.2_Intron	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACCCCATTTGGCCAGCCACAAA	0.470													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127493219	127493220	+	IGR	INS	-	TT	TT	rs148081835		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127493219_127493220insTT								GYPC (38974 upstream) : BIN1 (312387 downstream)																							cttttcttttcttttttttttt	0.208													4	3	---	---	---	---	
AMMECR1L	83607	broad.mit.edu	37	2	128633373	128633374	+	Intron	INS	-	TCTT	TCTT	rs138314938	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128633373_128633374insTCTT	uc002tpl.2	-						AMMECR1L_uc002tpm.2_Intron	NM_031445	NP_113633	Q6DCA0	AMERL_HUMAN	AMME chromosomal region gene 1-like											central_nervous_system(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.07)		ctctctctctctctttttcttt	0.119													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132854914	132854915	+	IGR	INS	-	T	T	rs143604842		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132854914_132854915insT								C2orf27B (295680 upstream) : NCRNA00164 (50249 downstream)																							TGTGTTTTTAGTTTTTATTTTG	0.233													3	3	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132981967	132981968	+	Intron	INS	-	C	C	rs148657484		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132981967_132981968insC	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						atttcatagagccttttgaaac	0.000													4	4	---	---	---	---	
NCRNA00164	554226	broad.mit.edu	37	2	132984742	132984743	+	Intron	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132984742_132984743insG	uc002ttj.3	-							NR_027020				Homo sapiens non-protein coding RNA 164, mRNA (cDNA clone IMAGE:5169389), with apparent retained intron.												0						agtggatatttgactgctttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133028130	133028131	+	IGR	DEL	AC	-	-	rs145524384		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133028130_133028131delAC								NCRNA00164 (12588 upstream) : GPR39 (146016 downstream)																							ggacagacagacagagagagag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	134728102	134728112	+	IGR	DEL	GGAAAAACCAT	-	-	rs72491537		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:134728102_134728112delGGAAAAACCAT								NCKAP5 (402071 upstream) : MGAT5 (283718 downstream)																							AATGAACAAAGGAAAAACCATGGCCATTGCC	0.445													4	3	---	---	---	---	
ZRANB3	84083	broad.mit.edu	37	2	136070924	136070925	+	Intron	DEL	AA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136070924_136070925delAA	uc002tum.2	-						ZRANB3_uc002tuk.2_Intron|ZRANB3_uc002tul.2_Intron|ZRANB3_uc002tun.1_Intron	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3							intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		ctcccaactcaaaaaaaaaaaa	0.094													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	142904327	142904327	+	IGR	DEL	A	-	-	rs75170145		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142904327delA								LRP1B (15057 upstream) : KYNU (730868 downstream)																							cccaagaaagaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	142927892	142927893	+	IGR	DEL	CA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142927892_142927893delCA								LRP1B (38622 upstream) : KYNU (707302 downstream)																							ctgcAacatgcacacacacaca	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	144561204	144561205	+	IGR	INS	-	A	A	rs151042533		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144561204_144561205insA								ARHGAP15 (35284 upstream) : GTDC1 (142378 downstream)																							AAGTGCTAATCAAAAAAAAAAA	0.332													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	145872611	145872612	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145872611_145872612delGT	uc002twd.2	+						uc002twe.2_Intron					Homo sapiens, clone IMAGE:5538654, mRNA.																		TGATGTTTTCgtgtgtgtgtgt	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	151179305	151179305	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151179305delT								MMADHC (734975 upstream) : RND3 (145407 downstream)																							atacacgatgtttggttttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	157221681	157221681	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157221681delG								NR4A2 (32394 upstream) : GPD2 (70284 downstream)																							aagaaaaagagGAAAGTGAAC	0.254													4	2	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159353272	159353275	+	Intron	DEL	GTGT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159353272_159353275delGTGT	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						ttctctctccgtgtgtgtgtgtgt	0.191										HNSCC(62;0.18)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	160091809	160091809	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160091809delT								TANC1 (2641 upstream) : WDSUB1 (496 downstream)																							GAACCTGAAGTTTTTTTTCTG	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	165936563	165936563	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165936563delC								SLC38A11 (124528 upstream) : SCN3A (7469 downstream)																							TGAAGAATCTCCCTCGCTCCA	0.403													4	2	---	---	---	---	
TLK1	9874	broad.mit.edu	37	2	171911714	171911714	+	Intron	DEL	A	-	-	rs137886488		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171911714delA	uc002ugn.2	-						TLK1_uc002ugo.2_Intron|TLK1_uc002ugp.2_Intron|TLK1_uc002ugq.2_Intron|TLK1_uc010zdn.1_Intron|TLK1_uc002ugr.1_5'Flank	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1						cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						ttatattagcaaaaaaaaaaa	0.279													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175145143	175145144	+	IGR	INS	-	TG	TG	rs151252230	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175145143_175145144insTG								OLA1 (31778 upstream) : SP9 (54677 downstream)																							tgtgtgtattttgtgtgtgtgt	0.000													3	3	---	---	---	---	
SSFA2	6744	broad.mit.edu	37	2	182759262	182759262	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182759262delA	uc002uoi.2	+						SSFA2_uc010zfn.1_3'UTR|SSFA2_uc002uoh.2_Intron|SSFA2_uc002uoj.2_Intron|SSFA2_uc002uok.2_Intron|SSFA2_uc010zfo.1_Intron	NM_001130445	NP_001123917	P28290	SSFA2_HUMAN	sperm specific antigen 2 isoform 1							cytoplasm|plasma membrane	actin binding			breast(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0856)			TGTTTTAAATAACAACTCAAG	0.323													4	2	---	---	---	---	
FRZB	2487	broad.mit.edu	37	2	183731768	183731768	+	5'Flank	DEL	G	-	-	rs36090522		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183731768delG	uc002upa.1	-							NM_001463	NP_001454	Q92765	SFRP3_HUMAN	frizzled-related protein precursor						brain development|cochlea morphogenesis|gonad development|mammary gland involution|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cartilage development|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of hepatocyte differentiation|positive regulation of apoptosis|positive regulation of fat cell differentiation|skeletal system development|vasculature development|Wnt receptor signaling pathway	cytoplasm|extracellular space|membrane	PDZ domain binding|Wnt receptor activity|Wnt-protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.109)|Epithelial(96;0.231)			AGCTCCTAATGGGAGAGAAGG	0.557													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	191574900	191574903	+	IGR	DEL	CACA	-	-	rs79527034		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191574900_191574903delCACA								NAB1 (17409 upstream) : GLS (170644 downstream)																							TTTGTATTTTcacacacacacaca	0.314													5	3	---	---	---	---	
SLC39A10	57181	broad.mit.edu	37	2	196564126	196564126	+	Intron	DEL	T	-	-	rs34963239		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196564126delT	uc002utg.3	+						SLC39A10_uc002uth.3_Intron|SLC39A10_uc010zgp.1_Intron	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			atcttacttgtttttttcatg	0.000													0	7	---	---	---	---	
PLCL1	5334	broad.mit.edu	37	2	198684609	198684610	+	Intron	DEL	TG	-	-	rs66908716		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198684609_198684610delTG	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	CTATTATGCAtgtgtgtgtgtg	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	201160216	201160216	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201160216delT								C2orf47 (331371 upstream) : SPATS2L (10388 downstream)																							ctcagcctcctgagtggctag	0.000													4	2	---	---	---	---	
CYP20A1	57404	broad.mit.edu	37	2	204149949	204149949	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204149949delT	uc002uzv.3	+						CYP20A1_uc002uzx.3_Intron|CYP20A1_uc010zif.1_Intron|CYP20A1_uc002uzy.3_Intron|CYP20A1_uc002uzw.3_Intron|CYP20A1_uc010ftw.2_Intron	NM_177538	NP_803882	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A,							integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0						AGTGAACTGATAAATCGGCCT	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	205339112	205339112	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205339112delA								ICOS (512816 upstream) : PARD3B (71404 downstream)																							TAAAAATCCTAATTACTCACT	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	209728590	209728591	+	IGR	INS	-	GAC	GAC			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209728590_209728591insGAC								PTH2R (23772 upstream) : MAP2 (560180 downstream)																							aaaggattatatataaatcatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	211666738	211666738	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211666738delC								CPS1 (122909 upstream) : ERBB4 (573704 downstream)																							gcacattgatccccagactca	0.124													4	2	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225843151	225843152	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225843151_225843152insA	uc010fwz.1	-						DOCK10_uc002vod.1_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ctccgtctcggaaaaaaaaaaG	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227301623	227301623	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227301623delT								KIAA1486 (706152 upstream) : IRS1 (294411 downstream)																							CTACTTTAGGTTTTTTTTTTT	0.398													3	4	---	---	---	---	
COL4A4	1286	broad.mit.edu	37	2	227920724	227920725	+	Frame_Shift_Ins	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227920724_227920725insT	uc010zlt.1	-	30	3306_3307	c.2652_2653insA	c.(2650-2655)CCAGGCfs	p.P884fs		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	884_885	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CCTGGGAGGCCTGGGGGACCAT	0.619													22	10	---	---	---	---	
WDR69	164781	broad.mit.edu	37	2	228778705	228778706	+	Intron	DEL	TC	-	-	rs71723734		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228778705_228778706delTC	uc002vpn.1	+						WDR69_uc010zlw.1_Intron|WDR69_uc002vpo.1_Intron	NM_178821	NP_849143	Q8N136	WDR69_HUMAN	WD repeat domain 69											breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)		TATATCTGTAtctctctctctc	0.168													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	229416436	229416437	+	IGR	DEL	TG	-	-	rs111335387		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:229416436_229416437delTG								SPHKAP (370075 upstream) : PID1 (472253 downstream)																							TTTTTGTAAAtgtgtgtgtgtg	0.144													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242484881	242484884	+	IGR	DEL	ATGG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242484881_242484884delATGG								STK25 (35921 upstream) : BOK (13308 downstream)																							GAGTAGCAAAATGGATGAAGATGA	0.436													5	5	---	---	---	---	
ATG4B	23192	broad.mit.edu	37	2	242590652	242590653	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242590652_242590653insT	uc002wbv.2	+						ATG4B_uc002wbu.2_Intron|ATG4B_uc002wbw.2_Intron|ATG4B_uc010zox.1_Intron|ATG4B_uc010zoy.1_Intron|ATG4B_uc010fzp.2_Intron|ATG4B_uc010zoz.1_5'Flank	NM_013325	NP_037457	Q9Y4P1	ATG4B_HUMAN	APG4 autophagy 4 homolog B isoform a						autophagic vacuole assembly|protein transport|proteolysis	cytoplasm	cysteine-type peptidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;2.44e-33)|all cancers(36;5.71e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.75e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0848)		GTGTGTGTGTGTTTTTTTTCTT	0.416													4	2	---	---	---	---	
OGG1	4968	broad.mit.edu	37	3	9793245	9793245	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9793245delC	uc003bsi.2	+						OGG1_uc003bsh.2_Intron|OGG1_uc003bsj.2_Intron|OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|OGG1_uc003bsp.1_5'Flank|OGG1_uc010hcm.1_5'Flank|OGG1_uc003bsq.1_5'Flank|OGG1_uc003bsr.1_5'Flank	NM_002542	NP_002533	O15527	OGG1_HUMAN	8-oxoguanine DNA-glycosylase 1 isoform 1a						depurination|nucleotide-excision repair|regulation of protein import into nucleus, translocation|regulation of transcription, DNA-dependent|response to oxidative stress|response to radiation	mitochondrion|nuclear matrix|nuclear speck	damaged DNA binding|endonuclease activity|oxidized purine base lesion DNA N-glycosylase activity|protein binding				0	Medulloblastoma(99;0.227)					tacattGTGGCCTCTTTATCT	0.254								BER_DNA_glycosylases					4	2	---	---	---	---	
ATG7	10533	broad.mit.edu	37	3	11332379	11332379	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11332379delT	uc003bwc.2	+						ATG7_uc003bwd.2_Intron|ATG7_uc011aum.1_Intron	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a						autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						TGTTATCttctttttttttga	0.209													3	3	---	---	---	---	
IQSEC1	9922	broad.mit.edu	37	3	13110890	13110891	+	Intron	INS	-	GC	GC	rs33997561		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13110890_13110891insGC	uc011auw.1	-							NM_001134382	NP_001127854	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform a						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						GTTTCTTGGAGGTGTGTGTGTG	0.559													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	14354428	14354429	+	IGR	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14354428_14354429delAC								LSM3 (114592 upstream) : SLC6A6 (89677 downstream)																							acatacacagacacacacacac	0.257													4	3	---	---	---	---	
ZNF385D	79750	broad.mit.edu	37	3	21590452	21590452	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21590452delT	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						GTTTGTATGATTTTATATCAA	0.179													4	2	---	---	---	---	
NICN1	84276	broad.mit.edu	37	3	49463962	49463963	+	Intron	INS	-	T	T	rs113679342		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49463962_49463963insT	uc003cwz.1	-						NICN1_uc003cxa.2_Intron|NICN1_uc011bcr.1_Intron	NM_032316	NP_115692	Q9BSH3	NICN1_HUMAN	nicolin 1							microtubule|nucleus					0				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CCCACCttttcttttttttttt	0.248													4	2	---	---	---	---	
IP6K1	9807	broad.mit.edu	37	3	49818498	49818499	+	Intron	INS	-	TTT	TTT	rs34672159		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49818498_49818499insTTT	uc003cxm.1	-						IP6K1_uc003cxn.1_Intron|IP6K1_uc011bcv.1_Intron|IP6K1_uc003cxo.2_Intron	NM_153273	NP_695005	Q92551	IP6K1_HUMAN	inositol hexakisphosphate kinase 1 isoform 1						phosphatidylinositol phosphorylation	cytoplasm|nucleus	ATP binding|inositol hexakisphosphate 5-kinase activity|inositol trisphosphate 3-kinase activity				0						AACAAAAAAGAttttttttttt	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	93513816	93513816	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93513816delT								None (None upstream) : PROS1 (78066 downstream)																							cacaaggaagtttctcagaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110998820	110998820	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110998820delA								PVRL3 (86447 upstream) : CD96 (262106 downstream)																							AGAGACCCCCAAAAACACTTA	0.214													2	4	---	---	---	---	
IQCB1	9657	broad.mit.edu	37	3	121528793	121528793	+	Intron	DEL	A	-	-	rs11306812		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121528793delA	uc010hre.1	-						IQCB1_uc003eek.2_Intron|IQCB1_uc010hrf.1_Intron	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a						cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		ATAACAATGGAAAAAAAAAAA	0.299													4	2	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134576992	134576994	+	Intron	DEL	CAT	-	-	rs113464668		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134576992_134576994delCAT	uc003eqt.2	+						EPHB1_uc010htz.1_Intron|EPHB1_uc011bly.1_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TTTATTGTTCcatcatcatcatc	0.335													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	136905179	136905180	+	IGR	DEL	GA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136905179_136905180delGA								IL20RB (175259 upstream) : SOX14 (578399 downstream)																							ggtaggaaaggagagagagaga	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138495044	138495044	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138495044delA								PIK3CB (16859 upstream) : FOXL2 (168023 downstream)																							ccatctcaacaaaaaaaaaga	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	139038507	139038507	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139038507delC								PISRT1 (86143 upstream) : MRPS22 (24291 downstream)																							ATGCTGCCTGCCCAGCCCTCT	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	144499378	144499378	+	IGR	DEL	A	-	-	rs67194171		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:144499378delA								C3orf58 (788169 upstream) : None (None downstream)																							actccgtcccaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	146995077	146995077	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146995077delA								PLSCR5 (671074 upstream) : ZIC4 (108760 downstream)																							TCTGGACTGtaaaaaaaaaaa	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147165470	147165471	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147165470_147165471delTG								ZIC1 (30966 upstream) : None (None downstream)																							TGTGCATGCATGTGTGTGTGTG	0.406													4	2	---	---	---	---	
SERP1	27230	broad.mit.edu	37	3	150314955	150314955	+	Intron	DEL	C	-	-	rs59270020		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150314955delC	uc003exz.2	-						uc003eye.1_Intron			Q9Y6X1	SERP1_HUMAN	Homo sapiens SERP1 mRNA, complete cds.						plasma membrane organization|protein glycosylation|protein transport|transmembrane transport	endoplasmic reticulum membrane|integral to membrane|ribosome					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ccaaaaaaaacaaaaaaacaa	0.129													5	4	---	---	---	---	
SELT	51714	broad.mit.edu	37	3	150322825	150322825	+	Intron	DEL	A	-	-	rs72219242		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150322825delA	uc011bnx.1	+						SERP1_uc003exz.2_5'Flank|uc003eye.1_5'Flank	NM_016275	NP_057359	P62341	SELT_HUMAN	selenoprotein T precursor						cell redox homeostasis|selenocysteine incorporation		selenium binding				0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			actccgtctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151203916	151203917	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151203916_151203917insA								IGSF10 (27419 upstream) : AADACL2 (247787 downstream)																							aaatggaaagcaaaaaacaaaa	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	151261063	151261063	+	IGR	DEL	A	-	-	rs11294015		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151261063delA								IGSF10 (84566 upstream) : AADACL2 (190641 downstream)																							aagatcactcagggggccata	0.000													3	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	152326320	152326320	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152326320delA								MBNL1 (142752 upstream) : P2RY1 (226416 downstream)																							tccccccgccaaaaaaaaaaa	0.144													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153551167	153551170	+	IGR	DEL	GAGT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153551167_153551170delGAGT								C3orf79 (330684 upstream) : SGEF (287979 downstream)																							cacacacacaGAGTGAGAGAGAGA	0.299													0	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154452008	154452009	+	IGR	DEL	TG	-	-	rs72142785		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154452008_154452009delTG								GPR149 (304504 upstream) : MME (289904 downstream)																							TGCAtgtgcatgtgtgtgtgtg	0.144													11	5	---	---	---	---	
C3orf33	285315	broad.mit.edu	37	3	155523127	155523128	+	Intron	INS	-	T	T	rs150639337	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155523127_155523128insT	uc003fal.1	-						C3orf33_uc003fam.1_Intron	NM_173657	NP_775928	Q96NB5	Q96NB5_HUMAN	hypothetical protein LOC285315								hydrolase activity, acting on ester bonds|nucleic acid binding				0			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			tgacaagtgcctgtagccctag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	155783984	155783984	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155783984delC								GMPS (128466 upstream) : KCNAB1 (54353 downstream)																							tctatctcctccagttctgct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	157721975	157721976	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157721975_157721976insA								C3orf55 (402956 upstream) : SHOX2 (91825 downstream)																							agacacttctcaaaaaaaaggc	0.000													6	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	158548156	158548157	+	IGR	DEL	CT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158548156_158548157delCT								MFSD1 (652 upstream) : SCHIP1 (238960 downstream)																							ccccttcacactctctctctct	0.000													4	2	---	---	---	---	
B3GALNT1	8706	broad.mit.edu	37	3	160817598	160817599	+	Intron	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160817598_160817599delAC	uc003fdv.2	-						B3GALNT1_uc003fdw.2_Intron|B3GALNT1_uc003fdx.2_Intron|B3GALNT1_uc003fdy.2_Intron|B3GALNT1_uc003fdz.2_Intron|B3GALNT1_uc003fea.2_Intron|B3GALNT1_uc011bpa.1_Intron	NM_033169	NP_149359	O75752	B3GL1_HUMAN	UDP-Gal:betaGlcNAc beta						protein glycosylation	Golgi membrane|integral to membrane	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			CCCTTCTCTAacacacacacac	0.292													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161265583	161265584	+	IGR	INS	-	T	T	rs71715876		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161265583_161265584insT								OTOL1 (43855 upstream) : None (None downstream)																							tcacttaaccgttttttttttt	0.124													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161274335	161274336	+	IGR	DEL	AA	-	-	rs67477049		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161274335_161274336delAA								OTOL1 (52607 upstream) : None (None downstream)																							CATAGCAACCAAAAAAAAAAAA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162500454	162500454	+	Intron	DEL	A	-	-	rs76712885		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162500454delA	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																		gcagctcctcaaaaaaaaaat	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	162666804	162666804	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:162666804delA	uc003feg.2	+											Homo sapiens, clone IMAGE:2905387, mRNA.																		agaccaaaataaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163413796	163413798	+	IGR	DEL	AAT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163413796_163413798delAAT								None (None upstream) : MIR1263 (475461 downstream)																							ctgtacagccaataataatctcc	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166505516	166505517	+	IGR	INS	-	T	T	rs149989752	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166505516_166505517insT								BCHE (950263 upstream) : ZBBX (452564 downstream)																							agtgtgtgaaaaaaaaaagaaa	0.045													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167725818	167725818	+	IGR	DEL	T	-	-	rs71176691		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167725818delT								SERPINI1 (182462 upstream) : GOLIM4 (1836 downstream)																							CTTTTACTCCTAGAACTCTTC	0.398													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	167997214	167997214	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167997214delC								GOLIM4 (183797 upstream) : MIR551B (272428 downstream)																							AGTGTATGTGCAAGTATGTTT	0.368													4	2	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169881650	169881659	+	Intron	DEL	AAAAAAAAAA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169881650_169881659delAAAAAAAAAA	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron|PHC3_uc011bpr.1_Intron|PHC3_uc003fgm.2_Intron|PHC3_uc003fgo.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			gactctgtccaaaaaaaaaaaaaaaaaaaa	0.067													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	170578565	170578566	+	IGR	DEL	CT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170578565_170578566delCT								CLDN11 (396 upstream) : RPL22L1 (4101 downstream)																							tctttgtctcctctctctctct	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	171621332	171621332	+	IGR	DEL	A	-	-	rs75776549		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171621332delA								TMEM212 (44224 upstream) : FNDC3B (136086 downstream)																							actctatctcaaaaaaaaaaa	0.000													1	6	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171959354	171959354	+	Intron	DEL	A	-	-	rs147543781		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171959354delA	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ggatggcagcaaaaaaaaaaa	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	172340863	172340864	+	IGR	INS	-	A	A	rs149141947	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172340863_172340864insA								TNFSF10 (99594 upstream) : NCEH1 (7572 downstream)																							AAAAGCATGTTAAAAAAAAATA	0.376													3	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173166169	173166169	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173166169delT	uc003fio.1	+							NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			gattttcatatgttgaaccag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174164743	174164743	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174164743delT	uc003fiq.1	+						uc003fir.2_Intron|uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																		TCTGGACCCCTTTTTTGCATT	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174403455	174403465	+	Intron	DEL	ACTTTTATTTA	-	-	rs6148198		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174403455_174403465delACTTTTATTTA	uc003fir.2	+						uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																		TTATCCATTTACTtttatttaacttttatta	0.204													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174417207	174417208	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174417207_174417208insT	uc003fir.2	+						uc003fis.2_Intron|uc010hwx.1_Intron					Homo sapiens NAALADL2 gene, partial 5'UTR, variant 1.																		tcccttgaacctgggaggcgga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	174528388	174528388	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174528388delA								NLGN1 (527272 upstream) : NAALADL2 (48723 downstream)																							atatgtaagcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
NAALADL2	254827	broad.mit.edu	37	3	174960859	174960860	+	Intron	INS	-	AC	AC	rs145805880	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174960859_174960860insAC	uc003fit.2	+						NAALADL2_uc003fiu.1_Intron|NAALADL2_uc010hwy.1_Intron	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TCCTTTCCATAacacacacaca	0.228													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	175662929	175662929	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:175662929delG								NAALADL2 (139503 upstream) : None (None downstream)																							catccaaattggggatgaaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177176336	177176336	+	IGR	DEL	T	-	-	rs111310205		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177176336delT								TBL1XR1 (261288 upstream) : None (None downstream)																							taaagacttgtttttttctta	0.000													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177235513	177235514	+	IGR	INS	-	T	T	rs6443466	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177235513_177235514insT								TBL1XR1 (320465 upstream) : None (None downstream)																							cagccAAAAAAtttttttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177542468	177542468	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177542468delA	uc003fiz.1	+											Homo sapiens cDNA FLJ31690 fis, clone NT2RI2005621.																		GGGGGACAGGAAAAAATGCCA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178613189	178613190	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178613189_178613190insT								KCNMB2 (50973 upstream) : ZMAT3 (128337 downstream)																							agtggaatgacttttttttttt	0.000													3	5	---	---	---	---	
USP13	8975	broad.mit.edu	37	3	179438600	179438600	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179438600delT	uc003fkh.2	+						USP13_uc003fkf.2_Intron	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			CTTTAAAATCttttttttttt	0.169													4	2	---	---	---	---	
DNAJC19	131118	broad.mit.edu	37	3	180704074	180704075	+	Intron	INS	-	T	T	rs138755965		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180704074_180704075insT	uc003fkt.2	-						DNAJC19_uc003fku.2_Intron	NM_145261	NP_660304	Q96DA6	TIM14_HUMAN	DnaJ homolog, subfamily C, member 19						genitalia development|protein folding|protein targeting to mitochondrion|transmembrane transport|visual perception	integral to membrane|mitochondrial inner membrane	heat shock protein binding				0	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			GAAGAGttttgttttttttttt	0.163													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181493727	181493727	+	IGR	DEL	T	-	-	rs111872395		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181493727delT								SOX2OT (34724 upstream) : None (None downstream)																							tttctttttcttttttttttt	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183185747	183185748	+	IGR	INS	-	A	A	rs7637348	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183185747_183185748insA								MCF2L2 (39892 upstream) : KLHL6 (19573 downstream)																							aaaaccctgtcaaaaaaaaaaa	0.178													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183611698	183611698	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183611698delT								PARL (9005 upstream) : ABCC5 (26028 downstream)																							AGGCAtttccttttttttttt	0.025													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	183778476	183778479	+	IGR	DEL	GTTT	-	-	rs111532443		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183778476_183778479delGTTT								HTR3C (17 upstream) : HTR3E (36373 downstream)																							TGGCTCTTCAgtttgtttgtttgt	0.235													6	3	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	185872434	185872434	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185872434delA	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	actctgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186102080	186102080	+	IGR	DEL	G	-	-	rs34016837		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186102080delG								DGKG (22057 upstream) : CRYGS (154153 downstream)																							CTTGTGCAGAGGGGGTCATTG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	186237645	186237645	+	IGR	DEL	T	-	-	rs11294887		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186237645delT								DGKG (157622 upstream) : CRYGS (18588 downstream)																							accagcatggtaaaaccccat	0.025													2	5	---	---	---	---	
KNG1	3827	broad.mit.edu	37	3	186439313	186439314	+	Intron	INS	-	TG	TG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186439313_186439314insTG	uc011bsa.1	+						KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1						blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	agtaggcattttgtgtgtgttt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	187485046	187485046	+	IGR	DEL	A	-	-	rs74552797		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187485046delA								BCL6 (21571 upstream) : LPP (386673 downstream)																							tatttaactcataaatttttt	0.169													1	5	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	187925410	187925411	+	Intron	DEL	TT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187925410_187925411delTT	uc011bsg.1	+							NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CTTTTTCTTCTTtttttttttt	0.168			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	3	---	---	---	---	
TPRG1	285386	broad.mit.edu	37	3	188987807	188987809	+	Intron	DEL	TCT	-	-	rs143941879		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188987807_188987809delTCT	uc003frv.1	+						TPRG1_uc003frw.1_Intron	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1												0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		CTTCTCTGGAtcttcttcttctt	0.320													2	5	---	---	---	---	
LEPREL1	55214	broad.mit.edu	37	3	189775427	189775428	+	Intron	INS	-	T	T	rs145774084	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189775427_189775428insT	uc011bsk.1	-						LEPREL1_uc003fsg.2_Intron	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a						collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AGCCATCACACTTTATCTTACA	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189845766	189845767	+	IGR	INS	-	AC	AC	rs140325289	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189845766_189845767insAC								LEPREL1 (5540 upstream) : CLDN1 (177736 downstream)																							CCCCTGAGCTGACAGTGCACTG	0.500													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189892563	189892564	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189892563_189892564insT								LEPREL1 (52337 upstream) : CLDN1 (130939 downstream)																							ttctttcttccttttttttttg	0.059													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190016138	190016139	+	IGR	DEL	AC	-	-	rs72037893		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190016138_190016139delAC								LEPREL1 (175912 upstream) : CLDN1 (7364 downstream)																							tgtatattatacacacacacac	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190554536	190554536	+	IGR	DEL	G	-	-	rs73056090	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190554536delG								IL1RAP (178693 upstream) : LOC647309 (15990 downstream)																							caagtcatttgggctctttat	0.000													5	3	---	---	---	---	
LOC647309	647309	broad.mit.edu	37	3	190580147	190580148	+	Intron	INS	-	AGAG	AGAG	rs141175183	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190580147_190580148insAGAG	uc011bsl.1	-							NM_001146686	NP_001140158	A6NCL1	GEMC1_HUMAN	hypothetical protein LOC647309						cell cycle|cell proliferation|DNA replication	nucleus	chromatin binding				0						GTAGTAATAACagaaagagaga	0.233													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	190626465	190626465	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:190626465delT								SNAR-I (30626 upstream) : OSTN (303857 downstream)																							GCCTACATAATTTTTTTTTTG	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191197140	191197143	+	IGR	DEL	ACTT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191197140_191197143delACTT								PYDC2 (17897 upstream) : FGF12 (662541 downstream)																							CAAGGGACTCACTTAGTAGGCAGT	0.338													2	4	---	---	---	---	
FGF12	2257	broad.mit.edu	37	3	192397425	192397425	+	Intron	DEL	A	-	-	rs72404495		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192397425delA	uc003fsy.2	-							NM_004113	NP_004104	P61328	FGF12_HUMAN	fibroblast growth factor 12 isoform 2						cell-cell signaling|heart development|JNK cascade|nervous system development|signal transduction	extracellular space|nucleus	growth factor activity|heparin binding			ovary(1)|skin(1)|lung(1)|pancreas(1)	4	all_cancers(143;1.72e-08)|Ovarian(172;0.0634)|Breast(254;0.247)	Lung NSC(153;0.21)	LUSC - Lung squamous cell carcinoma(58;5.45e-06)|Lung(62;6.17e-06)	GBM - Glioblastoma multiforme(46;0.00032)		CCTGCCAACCAAAAAAAAAAA	0.343													5	3	---	---	---	---	
ATP13A4	84239	broad.mit.edu	37	3	193275679	193275679	+	5'Flank	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193275679delG	uc003ftd.2	-						ATP13A4_uc003fte.1_5'Flank|ATP13A4_uc011bsr.1_5'Flank	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		TTTGAAGCAAGGGAATCATCA	0.493													4	2	---	---	---	---	
OPA1	4976	broad.mit.edu	37	3	193384582	193384582	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193384582delA	uc003ftm.2	+						OPA1_uc003ftg.2_Intron|OPA1_uc003fth.2_Intron|OPA1_uc003fti.2_Intron|OPA1_uc003ftj.2_Intron|OPA1_uc003ftk.2_Intron|OPA1_uc003ftl.2_Intron|OPA1_uc003ftn.2_Intron	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1						apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		ttgtctctttaaaaaaaaaag	0.104													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193943863	193943877	+	IGR	DEL	CTGTCCTGTTCGCAG	-	-	rs140853977		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193943863_193943877delCTGTCCTGTTCGCAG								HES1 (87467 upstream) : LOC100131551 (73547 downstream)																							aaacccctaactgtcctgttcgcagctgtcccctt	0.181													1	6	---	---	---	---	
ATP13A3	79572	broad.mit.edu	37	3	194170429	194170430	+	Intron	INS	-	A	A	rs114784800		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194170429_194170430insA	uc003fty.3	-						ATP13A3_uc003ftz.1_Intron	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3						ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		aaaaaaaaaacaaaaaaaaaaT	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194297969	194297970	+	IGR	INS	-	T	T	rs79089496		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194297969_194297970insT								ATP13A3 (109001 upstream) : TMEM44 (10433 downstream)																							AATAGCTCAGAttttttttttt	0.149													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194907625	194907626	+	Intron	INS	-	TT	TT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194907625_194907626insTT	uc003fum.3	-						C3orf21_uc003ful.2_5'Flank|C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		ACTGGCTGAAGttttttttttt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195428352	195428352	+	RNA	DEL	C	-	-	rs11337909		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195428352delC	uc011btd.1	+	1		c.1531delC			uc003fux.1_RNA					Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																		CTGCTGTCTGCCAGTGACTGC	0.557													13	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195432772	195432772	+	Intron	DEL	G	-	-	rs113380974		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195432772delG	uc011btd.1	+						uc003fux.1_Intron					Homo sapiens cDNA FLJ46488 fis, clone THYMU3026869.																		TTTGTAAACAGGGCTCTGGAA	0.378													5	3	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195447796	195447798	+	5'UTR	DEL	CCT	-	-	rs63042061		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195447796_195447798delCCT	uc010hzo.2	+	1						NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L						protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		GGAGGCTGCCCCTCCTCCCTGGT	0.621													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195661031	195661039	+	IGR	DEL	AGAAGGAGA	-	-	rs71180987	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195661031_195661039delAGAAGGAGA								TNK2 (22215 upstream) : SDHAP1 (25753 downstream)																							aaggagaaggagaaggagaagaagaagaa	0.033													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195665818	195665819	+	IGR	INS	-	TT	TT	rs140209605		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195665818_195665819insTT								TNK2 (27002 upstream) : SDHAP1 (20973 downstream)																							CCGCTGATTTCtctttctttct	0.312													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195895220	195895221	+	IGR	DEL	AA	-	-	rs75895584		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195895220_195895221delAA								TFRC (86188 upstream) : ZDHHC19 (29103 downstream)																							actccatctcaaaaaaaaaaaa	0.000													7	4	---	---	---	---	
NCBP2	22916	broad.mit.edu	37	3	196665877	196665878	+	Intron	DEL	AT	-	-	rs60130071		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196665877_196665878delAT	uc003fxd.1	-						NCBP2_uc003fxb.1_Intron|NCBP2_uc011btz.1_Intron|NCBP2_uc003fxc.1_Intron|NCBP2_uc003fxe.1_Intron|NCBP2_uc003fxf.2_3'UTR	NM_007362	NP_031388	P52298	NCBP2_HUMAN	nuclear cap binding protein subunit 2, 20kDa						gene silencing by RNA|histone mRNA metabolic process|mRNA 3'-end processing|mRNA capping|mRNA export from nucleus|ncRNA metabolic process|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of RNA export from nucleus|positive regulation of viral transcription|regulation of translational initiation|snRNA export from nucleus|spliceosomal snRNP assembly|termination of RNA polymerase II transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytosol|mRNA cap binding complex|nucleoplasm	nucleotide binding|protein binding|RNA 7-methylguanosine cap binding				0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;3.42e-24)|all cancers(36;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(49;4.13e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00551)		ATTCTTTGGAATTTTTTTTTTT	0.337													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197201524	197201524	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197201524delA								DLG1 (175381 upstream) : BDH1 (35131 downstream)																							actccgtctcaaaaaaaaaaa	0.000													4	3	---	---	---	---	
BDH1	622	broad.mit.edu	37	3	197273010	197273011	+	Intron	INS	-	A	A	rs71623360		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197273010_197273011insA	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	ccatcaaaaagaaaaaaaaata	0.218													4	2	---	---	---	---	
IQCG	84223	broad.mit.edu	37	3	197681207	197681208	+	Intron	INS	-	T	T	rs112330576		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197681207_197681208insT	uc003fyp.2	-						RPL35A_uc003fyr.2_Intron|RPL35A_uc003fys.2_Intron	NM_032263	NP_115639	Q9H095	IQCG_HUMAN	IQ motif containing G												0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		tttgttttttgttttttttttg	0.153													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	44158	44167	+	IGR	DEL	GTTTTGTTTT	-	-	rs3055893		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44158_44167delGTTTTGTTTT								None (None upstream) : ZNF595 (9060 downstream)																							AACAAAAGGAgttttgttttgttttgtttt	0.114													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3600248	3600248	+	IGR	DEL	G	-	-	rs66494629		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3600248delG								LRPAP1 (66024 upstream) : ADRA2C (167827 downstream)																							tgtgtgagcaggtgtggacat	0.164													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4581025	4581025	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4581025delT	uc003gid.2	+											Homo sapiens, clone IMAGE:5204729, mRNA.																		TTTCTTAGCATTTTTTTTTTT	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	4727358	4727359	+	IGR	DEL	AG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4727358_4727359delAG								STX18 (183583 upstream) : MSX1 (134033 downstream)																							gtgtgcatgcagagagagagag	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	22676975	22676976	+	IGR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:22676975_22676976delTC								GPR125 (159303 upstream) : GBA3 (17572 downstream)																							tccttccctttctctctctctt	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28522620	28522621	+	IGR	INS	-	C	C	rs5857087		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28522620_28522621insC								None (None upstream) : None (None downstream)																							ccttccttccttccttcctctc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	29482550	29482550	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:29482550delA								None (None upstream) : None (None downstream)																							ATACAAGCATAAAAATATACA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	46475865	46475866	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46475865_46475866insA								GABRA2 (83444 upstream) : COX7B2 (260983 downstream)																							caaaacaaaacaaaaAACTACC	0.342													4	2	---	---	---	---	
GABRB1	2560	broad.mit.edu	37	4	47114771	47114771	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47114771delA	uc003gxh.2	+						GABRB1_uc011bze.1_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	acagtgaaataaaaaaaaaaa	0.134													3	3	---	---	---	---	
TEC	7006	broad.mit.edu	37	4	48174452	48174453	+	Intron	INS	-	T	T	rs142368483		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48174452_48174453insT	uc003gxz.2	-							NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						AAGGAATGTACttttttttttt	0.149													4	2	---	---	---	---	
TEC	7006	broad.mit.edu	37	4	48249147	48249148	+	Intron	DEL	AT	-	-	rs145900797		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48249147_48249148delAT	uc003gxz.2	-							NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase						intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						gtcagcaaacatataaaaaaat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	48935140	48935151	+	IGR	DEL	AACAACAACAAC	-	-	rs71960669		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48935140_48935151delAACAACAACAAC								OCIAD2 (26325 upstream) : CWH43 (53114 downstream)																							tccgtctcaaaacaacaacaacaacaacaaca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49200238	49200239	+	IGR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49200238_49200239delTC								CWH43 (136145 upstream) : None (None downstream)																							gtagcagtgttctggaatccta	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49218022	49218022	+	IGR	DEL	A	-	-	rs78904448		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49218022delA								CWH43 (153929 upstream) : None (None downstream)																							aattccccagaaaaaataaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49231275	49231275	+	IGR	DEL	T	-	-	rs113689037		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49231275delT								CWH43 (167182 upstream) : None (None downstream)																							cagaaaaaaataattcctaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53065357	53065357	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53065357delA								SPATA18 (101900 upstream) : USP46 (391772 downstream)																							tacaaaaaataaaaaaaaatt	0.000													2	4	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54357440	54357441	+	Intron	INS	-	A	A	rs35978164		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54357440_54357441insA	uc003haa.2	+						LNX1_uc003haf.3_Intron|LNX1_uc003hag.3_Intron|LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	TTCAAAGTGAGAAAAAAAAAAA	0.366			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			2	4	---	---	---	---	
PDGFRA	5156	broad.mit.edu	37	4	54401064	54401066	+	Intron	DEL	TTG	-	-	rs145945720		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54401064_54401066delTTG	uc003haa.2	+						LNX1_uc003haf.3_Intron|LNX1_uc003hag.3_Intron|LNX1_uc003hah.3_Intron	NM_006206	NP_006197	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor alpha						cardiac myofibril assembly|cell activation|luteinization|metanephric glomerular capillary formation|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of DNA replication|positive regulation of fibroblast proliferation|protein autophosphorylation|retina vasculature development in camera-type eye	cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet-derived growth factor alpha-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|protein homodimerization activity|vascular endothelial growth factor receptor activity			soft_tissue(572)|small_intestine(40)|stomach(16)|lung(16)|central_nervous_system(13)|haematopoietic_and_lymphoid_tissue(7)|skin(3)|ovary(3)|gastrointestinal_tract_(site_indeterminate)(1)|autonomic_ganglia(1)|prostate(1)|bone(1)	674	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Sunitinib(DB01268)	CTTAACAGCCTTGTTGTAAAAAT	0.404			Mis|O|T	FIP1L1	GIST|idiopathic hypereosinophilic syndrome				Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Intestinal_Neurofibromatosis	TSP Lung(21;0.16)			2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	56039222	56039222	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56039222delT								KDR (47460 upstream) : SRD5A3 (173187 downstream)																							ATGACCTGCCTGACCTGATCA	0.408													4	2	---	---	---	---	
CEP135	9662	broad.mit.edu	37	4	56888678	56888678	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56888678delG	uc003hbi.2	+						CEP135_uc003hbj.2_Intron	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4						centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					gggataatctggggaggaaaa	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57637637	57637637	+	IGR	DEL	A	-	-	rs113067846		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57637637delA								HOPX (89765 upstream) : SPINK2 (38397 downstream)																							cacagtctctaaaaaaaaaaa	0.149													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	58006503	58006503	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58006503delC	uc003hco.2	+											Homo sapiens, clone IMAGE:5722917, mRNA.																		attattttttcccattgttca	0.000													4	2	---	---	---	---	
LOC550112	550112	broad.mit.edu	37	4	68752876	68752877	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68752876_68752877delGT	uc003hdl.3	+											Homo sapiens chromosome 4 cDNA.												0						TCCCAAGGCAgtgtgtgtgtgt	0.252													4	2	---	---	---	---	
RCHY1	25898	broad.mit.edu	37	4	76431851	76431851	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76431851delA	uc003hik.2	-						RCHY1_uc003hij.2_Intron|RCHY1_uc003hil.2_Intron|RCHY1_uc010iip.2_Intron|RCHY1_uc010iiq.2_Intron|RCHY1_uc010iir.2_Intron	NM_015436	NP_056251	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein autoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nuclear speck|ubiquitin ligase complex	electron carrier activity|p53 binding|protein homodimerization activity|ubiquitin-protein ligase activity|zinc ion binding			pancreas(1)	1			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			gaaatacaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	99877752	99877753	+	IGR	INS	-	A	A	rs33952764		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99877752_99877753insA								EIF4E (25966 upstream) : METAP1 (39035 downstream)																							gactctgtctcaaaaaaaaaaa	0.168													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	105810896	105810896	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:105810896delG								CXXC4 (394838 upstream) : TET2 (257047 downstream)																							TGGCATATGTGGAGACATCTG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	108964179	108964180	+	IGR	DEL	CA	-	-	rs113611450		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108964179_108964180delCA								HADH (7849 upstream) : LEF1 (4521 downstream)																							CGTGCACGTGcacacacacaca	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111220731	111220732	+	IGR	INS	-	AA	AA	rs138786023	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111220731_111220732insAA								ELOVL6 (100911 upstream) : ENPEP (176497 downstream)																							TAACCGTAGTCAAaaaaacaaa	0.297													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	111260223	111260224	+	IGR	DEL	CC	-	-	rs143253022	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111260223_111260224delCC								ELOVL6 (140403 upstream) : ENPEP (137005 downstream)																							ttccttccttccccttccttcc	0.000													4	2	---	---	---	---	
MYOZ2	51778	broad.mit.edu	37	4	120076027	120076028	+	Intron	DEL	CA	-	-	rs60416531		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120076027_120076028delCA	uc003icp.3	+							NM_016599	NP_057683	Q9NPC6	MYOZ2_HUMAN	myozenin 2								protein phosphatase 2B binding				0						cacacacacgcacacacacaca	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	121182122	121182123	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121182122_121182123insT								MAD2L1 (194109 upstream) : PRDM5 (433807 downstream)																							AAAAAAAAGGGggatggtgatg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	123029921	123029921	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123029921delA								TRPC3 (157012 upstream) : KIAA1109 (61837 downstream)																							cctgtgggacaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	134922033	134922033	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134922033delC								PCDH10 (809302 upstream) : PABPC4L (195458 downstream)																							caggccttcaccctacaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152779314	152779314	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152779314delG								PET112L (97168 upstream) : FBXW7 (463097 downstream)																							aggggacacagaccatgcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	170703916	170703916	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170703916delG								C4orf27 (24823 upstream) : MFAP3L (203834 downstream)																							tatcgcaggtggtgtacaccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	184686856	184686856	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:184686856delT								C4orf41 (52112 upstream) : STOX2 (139653 downstream)																							TCTTTGTGAATTTGCATGTAG	0.493													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185296491	185296492	+	IGR	INS	-	TT	TT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185296491_185296492insTT								ENPP6 (157377 upstream) : IRF2 (12386 downstream)																							tgtatttgctattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	186032199	186032199	+	IGR	DEL	A	-	-	rs144920700		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186032199delA								HELT (90241 upstream) : SLC25A4 (32199 downstream)																							ctgtccccccaaaaaaaaaaa	0.164													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	187214402	187214403	+	Intron	DEL	GT	-	-	rs113744702		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187214402_187214403delGT	uc003izb.1	-											Homo sapiens coagulation factor XI (plasma thromboplastin antecedent), mRNA (cDNA clone IMAGE:4831055).																		AGGAATGTCCgtgtgtgtgtgt	0.257													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190201968	190201968	+	IGR	DEL	G	-	-	rs111665089		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190201968delG								None (None upstream) : FRG1 (660006 downstream)																							agggtcaaaaggggggcaggt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190566242	190566243	+	IGR	INS	-	T	T	rs11393860		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190566242_190566243insT								None (None upstream) : FRG1 (295731 downstream)																							TAAGGAGACGCTGCTGATTAGA	0.475													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190605033	190605033	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190605033delG								None (None upstream) : FRG1 (256941 downstream)																							ggagtgcagtggcgcgatctc	0.080													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190678578	190678579	+	IGR	INS	-	G	G	rs70947923		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190678578_190678579insG								None (None upstream) : FRG1 (183395 downstream)																							aaaaaaaaaCCCACAATAAAAT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190818022	190818022	+	Intron	DEL	A	-	-	rs113369235		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190818022delA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		ttgtgatggtaggggggtggc	0.000													5	3	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1093609	1093610	+	Intron	INS	-	GGGCGGGGACT	GGGCGGGGACT	rs138268307	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1093609_1093610insGGGCGGGGACT	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CGGGACACACGGGGCGGGGACT	0.668													5	4	---	---	---	---	
LOC728613	728613	broad.mit.edu	37	5	1631829	1631831	+	Intron	DEL	AGG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1631829_1631831delAGG	uc003jcq.3	-						LOC728613_uc003jcp.3_Intron|LOC728613_uc003jcr.2_Intron|LOC728613_uc003jcs.2_Intron|LOC728613_uc010ith.1_Intron|LOC728613_uc003jct.2_Intron|LOC728613_uc003jcu.2_Intron|LOC728613_uc003jcv.2_Intron|LOC728613_uc010iti.1_Intron|LOC728613_uc003jcw.2_Intron	NR_003713				Homo sapiens cDNA, FLJ97024.												0						AAATAAAAAAAGGAGGATTTAAG	0.350													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2729583	2729584	+	IGR	DEL	TG	-	-	rs151000348		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2729583_2729584delTG								IRX4 (846703 upstream) : IRX2 (16697 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.396													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3795100	3795100	+	IGR	DEL	A	-	-	rs144607276		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3795100delA								IRX1 (193584 upstream) : None (None downstream)																							TCATCAAGGGAAAAAAAAAAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4020202	4020203	+	IGR	INS	-	ATC	ATC	rs138036031	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4020202_4020203insATC								IRX1 (418686 upstream) : None (None downstream)																							CATCCATGGGGATCAGCAGGAG	0.485													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	5911933	5911934	+	IGR	INS	-	AAGA	AAGA	rs149323698	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5911933_5911934insAAGA								KIAA0947 (421596 upstream) : FLJ33360 (398620 downstream)																							AGTGAGGAAGGGTTACCAAACC	0.337													4	3	---	---	---	---	
PAPD7	11044	broad.mit.edu	37	5	6738023	6738023	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6738023delT	uc003jdx.1	+						PAPD7_uc011cmn.1_Intron	NM_006999	NP_008930	Q5XG87	PAPD7_HUMAN	DNA polymerase sigma						cell division|DNA replication|double-strand break repair|mitotic chromosome condensation|response to drug|sister chromatid cohesion	nucleus	DNA binding|DNA-directed DNA polymerase activity|metal ion binding|SMC protein binding			ovary(1)	1						ATTTGTTGGGTTTTTTTTTTT	0.483													3	3	---	---	---	---	
MARCH6	10299	broad.mit.edu	37	5	10410649	10410649	+	Intron	DEL	T	-	-	rs78539753		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10410649delT	uc003jet.1	+						MARCH6_uc011cmu.1_Intron|MARCH6_uc003jeu.1_Intron|MARCH6_uc011cmv.1_Intron	NM_005885	NP_005876	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6						protein K48-linked ubiquitination	integral to endoplasmic reticulum membrane	ubiquitin conjugating enzyme binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|breast(1)	2						AGTAAATGTCTTTTTTTTTTT	0.323													4	2	---	---	---	---	
DAP	1611	broad.mit.edu	37	5	10687643	10687645	+	Intron	DEL	GTG	-	-	rs144284404		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10687643_10687645delGTG	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385	P51397	DAP1_HUMAN	death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)				aactgcagatgtggtgaaaacag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13189896	13189896	+	IGR	DEL	A	-	-	rs112716643		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13189896delA								None (None upstream) : DNAH5 (500541 downstream)																							GTTCCAGGGGAAAAAAAAAAT	0.458													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13524932	13524932	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13524932delG								None (None upstream) : DNAH5 (165505 downstream)																							actagctccagggggggtggc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	20984328	20984329	+	IGR	INS	-	G	G	rs140626121	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:20984328_20984329insG								CDH18 (996021 upstream) : GUSBP1 (357613 downstream)																							GCCATTTCTGTGGGTTTCTGTA	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	24285493	24285493	+	IGR	DEL	G	-	-	rs56035518		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24285493delG								PRDM9 (756789 upstream) : CDH10 (201717 downstream)																							agtttgctgagaatgatggtt	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26048444	26048447	+	IGR	DEL	AGGA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26048444_26048447delAGGA								None (None upstream) : CDH9 (832262 downstream)																							aagaaaagggaggaagggaataag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28224494	28224495	+	IGR	DEL	TG	-	-	rs66595599		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28224494_28224495delTG								None (None upstream) : None (None downstream)																							tttgcctttttgtgtgtgtgtg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	30543879	30543880	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:30543879_30543880insA								None (None upstream) : CDH6 (649916 downstream)																							aagattccaccaaaaaaaaata	0.000													4	2	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31790034	31790034	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31790034delA	uc003jhl.2	+							NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						tccaaacaacaaaaaaaaatt	0.000													4	2	---	---	---	---	
PRLR	5618	broad.mit.edu	37	5	35153861	35153862	+	Intron	DEL	AC	-	-	rs112698281		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35153861_35153862delAC	uc003jjm.2	-							NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor						activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	tacacacactacacacacacac	0.342													4	2	---	---	---	---	
SPEF2	79925	broad.mit.edu	37	5	35644819	35644820	+	Intron	DEL	CT	-	-	rs140309566		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35644819_35644820delCT	uc003jjo.2	+						SPEF2_uc003jjn.1_Intron|SPEF2_uc003jjq.3_Intron	NM_024867	NP_079143	Q9C093	SPEF2_HUMAN	KPL2 protein isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|protein dimerization activity			skin(2)|ovary(1)|central_nervous_system(1)	4	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTCTTGCTGACTCTCACCTCTA	0.485													1	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39433164	39433165	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39433164_39433165delGT								DAB2 (7829 upstream) : None (None downstream)																							tgtgttaagcgtgtgtgtgtgt	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	42996570	42996579	+	IGR	DEL	GTTTTGTTTT	-	-	rs113032280		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42996570_42996579delGTTTTGTTTT								SEPP1 (170572 upstream) : C5orf39 (42604 downstream)																							ataaacagtggttttgttttgttttgtttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	50669903	50669903	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50669903delC								PARP8 (531734 upstream) : ISL1 (9055 downstream)																							TGGATTCTGGCTGGGTGTGAC	0.488													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	53737985	53737986	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:53737985_53737986insT								ARL15 (131582 upstream) : HSPB3 (13459 downstream)																							TTTTTTCTTCATTTTTTTTTAA	0.381													4	2	---	---	---	---	
PPAP2A	8611	broad.mit.edu	37	5	54767031	54767031	+	Intron	DEL	T	-	-	rs113348948		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54767031delT	uc003jqa.2	-						PPAP2A_uc003jpz.2_Intron|PPAP2A_uc003jqb.2_Intron	NM_003711	NP_003702	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|androgen receptor signaling pathway|germ cell migration|negative regulation of cell proliferation|phospholipid dephosphorylation|regulation of lipid metabolic process|sphingolipid metabolic process	integral to plasma membrane|membrane fraction	phosphatidate phosphatase activity|sphingosine-1-phosphate phosphatase activity			ovary(2)	2		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				tcagatcagattttttttttt	0.000													4	2	---	---	---	---	
IL6ST	3572	broad.mit.edu	37	5	55253497	55253497	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55253497delC	uc003jqq.2	-						IL6ST_uc010iwb.2_Intron|IL6ST_uc010iwc.2_Intron|IL6ST_uc010iwd.2_Intron|IL6ST_uc011cqk.1_Intron|IL6ST_uc003jqr.2_Intron	NM_002184	NP_002175	P40189	IL6RB_HUMAN	interleukin 6 signal transducer isoform 1						interleukin-6-mediated signaling pathway|leukemia inhibitory factor signaling pathway|negative regulation of interleukin-6-mediated signaling pathway|positive regulation of anti-apoptosis|positive regulation of cardiac muscle hypertrophy|positive regulation of osteoblast differentiation|positive regulation of T cell proliferation|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation vascular endothelial growth factor production	ciliary neurotrophic factor receptor complex|extracellular region|extracellular space|interleukin-6 receptor complex|oncostatin-M receptor complex	ciliary neurotrophic factor receptor activity|ciliary neurotrophic factor receptor binding|growth factor binding|protein homodimerization activity			large_intestine(1)|ovary(1)	2		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				TCCTGGTCTGCCTGTCCTCAC	0.388			O		hepatocellular ca								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	55899982	55899983	+	IGR	INS	-	G	G	rs139194452	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:55899982_55899983insG								ANKRD55 (370796 upstream) : MAP3K1 (210917 downstream)																							ATACCAAAATTAGCGGGGGGAA	0.431													1	5	---	---	---	---	
ERCC8	1161	broad.mit.edu	37	5	60195752	60195752	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60195752delA	uc003jsm.3	-						ERCC8_uc003jsk.2_Intron|ERCC8_uc003jsl.3_Intron|ERCC8_uc011cqp.1_Intron	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent						positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				AGTAAATAGCAAAAAAAAAAA	0.294								Direct_reversal_of_damage|NER					4	2	---	---	---	---	
FLJ37543	285668	broad.mit.edu	37	5	60981605	60981606	+	Intron	DEL	GA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60981605_60981606delGA	uc003jst.1	+						uc003jsu.1_Intron|uc010iwo.1_Intron|uc003jsv.2_Intron	NM_173667	NP_775938	Q2M2E5	CE064_HUMAN	hypothetical protein LOC285668 precursor							extracellular region					0		Lung NSC(810;0.000468)|Prostate(74;0.0283)|Breast(144;0.237)				gggagatagggagagagagaga	0.000													3	3	---	---	---	---	
KIF2A	3796	broad.mit.edu	37	5	61606902	61606902	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61606902delT	uc003jsy.3	+						KIF2A_uc003jsz.3_Intron|KIF2A_uc010iwp.2_Intron|KIF2A_uc003jsx.3_Intron	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1						blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		accagaaaggtttttggagat	0.154													4	2	---	---	---	---	
IPO11	51194	broad.mit.edu	37	5	61910537	61910538	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61910537_61910538delGT	uc003jtc.2	+						IPO11_uc011cqr.1_Intron|IPO11_uc010iwr.2_Intron|IPO11_uc003jte.2_Intron	NM_016338	NP_057422	Q9UI26	IPO11_HUMAN	Ran binding protein 11 isoform 2							cytoplasm|nucleus	protein binding			lung(2)|skin(2)	4		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		ccaagtgtgcgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
CWC27	10283	broad.mit.edu	37	5	64074059	64074060	+	Intron	INS	-	T	T	rs72534229	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:64074059_64074060insT	uc003jtn.1	+						CWC27_uc003jtl.2_Intron|CWC27_uc003jtm.2_Intron|CWC27_uc010iwt.1_Intron	NM_005869	NP_005860	Q6UX04	CWC27_HUMAN	serologically defined colon cancer antigen 10						protein folding	catalytic step 2 spliceosome	peptidyl-prolyl cis-trans isomerase activity				0						TATGTAATGACCTCAGGATAGT	0.238													4	4	---	---	---	---	
CDK7	1022	broad.mit.edu	37	5	68528448	68528451	+	5'Flank	DEL	TTCT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68528448_68528451delTTCT	uc003jvs.3	+						CDK7_uc010ixd.1_5'Flank|CDK7_uc003jvt.3_5'Flank|CDK7_uc003jvu.3_5'Flank	NM_001799	NP_001790	P50613	CDK7_HUMAN	cyclin-dependent kinase 7						androgen receptor signaling pathway|cell division|cell proliferation|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex|mitochondrion	androgen receptor binding|ATP binding|cyclin-dependent protein kinase activity|DNA-dependent ATPase activity|protein C-terminus binding|RNA polymerase II carboxy-terminal domain kinase activity|transcription coactivator activity			lung(1)	1		Lung NSC(167;7.26e-05)|Prostate(74;0.00634)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.98e-56)|Epithelial(20;3.54e-52)|all cancers(19;9.11e-48)|Lung(70;0.0185)		ctttcttcccttctttctttcttt	0.201								NER					7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	71952000	71952000	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71952000delT								ZNF366 (148751 upstream) : TNPO1 (160418 downstream)																							gaggtgcttgtttaggttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	77627819	77627822	+	IGR	DEL	AGTC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77627819_77627822delAGTC								AP3B1 (37291 upstream) : SCAMP1 (28517 downstream)																							CCAATCTGAGAGTCAGTTTTCCAT	0.446													4	2	---	---	---	---	
DMGDH	29958	broad.mit.edu	37	5	78296957	78296957	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78296957delC	uc003kfs.2	-							NM_013391	NP_037523	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase precursor						choline metabolic process|glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|dimethylglycine dehydrogenase activity|electron carrier activity			ovary(2)|liver(1)|skin(1)	4		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		GCCCTGGAAGCAGCTCTGCGG	0.348													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	85242179	85242182	+	IGR	DEL	AGAA	-	-	rs70990579		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:85242179_85242182delAGAA								None (None upstream) : NBPF22P (336080 downstream)																							agagagagagagaaagaaagaaag	0.005													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	87995657	87995658	+	IGR	INS	-	A	A	rs75550085		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87995657_87995658insA								LOC645323 (15037 upstream) : MEF2C (18400 downstream)																							AATGTTGTAAGAAAAAAAAAAA	0.307													4	2	---	---	---	---	
FAM172A	83989	broad.mit.edu	37	5	93380823	93380824	+	Intron	DEL	AA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93380823_93380824delAA	uc010jbd.2	-						FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_Intron|FAM172A_uc011cui.1_Intron|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Intron	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1							endoplasmic reticulum|extracellular region					0						actccatctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C5orf36	285600	broad.mit.edu	37	5	93707253	93707254	+	Intron	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93707253_93707254insG	uc011cuk.1	-						C5orf36_uc003kkn.2_Intron	NM_001145678	NP_001139150	Q8IV33	K0825_HUMAN	hypothetical protein LOC285600 isoform 1												0		all_cancers(142;2.12e-08)|all_epithelial(76;5.95e-11)|all_lung(232;0.000996)|Lung NSC(167;0.0108)|Ovarian(174;0.0218)|Colorectal(57;0.0329)|Breast(839;0.214)|Lung SC(612;0.236)		all cancers(79;3.96e-19)		gagagccgagcgaggggggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	97891305	97891306	+	IGR	INS	-	TCT	TCT	rs142819533	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:97891305_97891306insTCT								None (None upstream) : RGMB (213693 downstream)																							TGCTGCATGCATCTTCTGTCAA	0.381													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116150063	116150064	+	IGR	INS	-	AC	AC	rs147896280	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116150063_116150064insAC								SEMA6A (239512 upstream) : None (None downstream)																							AGAAGTTGTCTacacacacaca	0.267													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116155677	116155678	+	IGR	INS	-	A	A	rs145467310	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116155677_116155678insA								SEMA6A (245126 upstream) : None (None downstream)																							gatcctgtctcaaaaaaaaCCA	0.168													2	4	---	---	---	---	
CHSY3	337876	broad.mit.edu	37	5	129463923	129463924	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:129463923_129463924delGT	uc003kvd.2	+							NM_175856	NP_787052	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3							Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(2)|pancreas(1)	3		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		AGAAAAtgtggtgtgtgtgtgt	0.238													4	2	---	---	---	---	
ACSL6	23305	broad.mit.edu	37	5	131238196	131238202	+	Intron	DEL	TGCTTCC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131238196_131238202delTGCTTCC	uc003kvv.1	-							NM_015256		Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane|plasma membrane	ATP binding|long-chain fatty acid-CoA ligase activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ttgtacatcttgcttcctgtacatcat	0.000													4	2	---	---	---	---	
SPOCK1	6695	broad.mit.edu	37	5	136812614	136812614	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:136812614delA	uc003lbo.2	-						SPOCK1_uc003lbp.2_Intron	NM_004598	NP_004589	Q08629	TICN1_HUMAN	sparc/osteonectin, cwcv and kazal-like domains						cell adhesion|cell proliferation|cellular component movement|nervous system development|signal transduction	proteinaceous extracellular matrix	calcium ion binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			actctgtctcaaaaaaaaaaG	0.040													4	2	---	---	---	---	
BRD8	10902	broad.mit.edu	37	5	137399917	137399919	+	Intron	DEL	GAG	-	-	rs140185075		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137399917_137399919delGAG	uc003lcc.1	-							NM_001164326		Q9H0E9	BRD8_HUMAN	bromodomain containing 8 isoform 4						cell surface receptor linked signaling pathway|histone H2A acetylation|histone H4 acetylation|regulation of growth|regulation of transcription from RNA polymerase II promoter	mitochondrion|NuA4 histone acetyltransferase complex	sequence-specific DNA binding transcription factor activity|thyroid hormone receptor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ggaagagagagaggaggaggagg	0.059													4	2	---	---	---	---	
DIAPH1	1729	broad.mit.edu	37	5	140920385	140920386	+	Intron	DEL	GG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140920385_140920386delGG	uc003llb.3	-						DIAPH1_uc003llc.3_Intron|DIAPH1_uc010jgc.1_Intron	NM_005219	NP_005210	O60610	DIAP1_HUMAN	diaphanous 1 isoform 1						regulation of microtubule-based process|sensory perception of sound	cytoplasm|cytoskeleton|ruffle membrane	actin binding|receptor binding|Rho GTPase binding			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ccagcactttgggaggctgagg	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141377252	141377253	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141377252_141377253insT								RNF14 (8500 upstream) : GNPDA1 (2985 downstream)																							ggggttagaggtttgggacctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	141678138	141678139	+	IGR	INS	-	AATTAT	AATTAT	rs149464900	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141678138_141678139insAATTAT								NDFIP1 (144132 upstream) : SPRY4 (11853 downstream)																							CCAGTCATAAACCAGCTCACCC	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	151990832	151990833	+	IGR	INS	-	T	T	rs112788270		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151990832_151990833insT								NMUR2 (205992 upstream) : GRIA1 (878342 downstream)																							gagaagctgtattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	152278075	152278075	+	Intron	DEL	T	-	-	rs111288513		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:152278075delT	uc003lux.1	-											Homo sapiens cDNA FLJ35529 fis, clone SPLEN2001912.																		CTGTGTCTGCTTTTTTTTTAT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	158544834	158544843	+	IGR	DEL	ACACACACAC	-	-	rs71728291		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158544834_158544843delACACACACAC								EBF1 (18046 upstream) : RNF145 (39576 downstream)																							CTACCAacatacacacacacacacacacac	0.300													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	165809034	165809034	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:165809034delT								None (None upstream) : ODZ2 (902809 downstream)																							TGGGTATTTCTTTTGAGCAGG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	170793008	170793009	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170793008_170793009insA								TLX3 (53871 upstream) : NPM1 (21111 downstream)																							ctgtctcaaacaaaaaaaaaca	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	176135698	176135699	+	IGR	INS	-	C	C	rs147628836	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176135698_176135699insC								TSPAN17 (49640 upstream) : UNC5A (101861 downstream)																							CGGTACCCCCTCCCAGCCCTCC	0.317													4	2	---	---	---	---	
COL23A1	91522	broad.mit.edu	37	5	177993817	177993817	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177993817delA	uc003mje.2	-							NM_173465	NP_775736	Q86Y22	CONA1_HUMAN	collagen, type XXIII, alpha 1							collagen|integral to membrane|plasma membrane	protein binding			central_nervous_system(1)|skin(1)	2	all_cancers(89;0.00188)|Renal(175;0.000159)|Lung NSC(126;0.00814)|all_lung(126;0.0129)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.153)|all cancers(165;0.172)		actctgtctcaaaaaaaaaag	0.000													4	2	---	---	---	---	
ADAMTS2	9509	broad.mit.edu	37	5	178584974	178584974	+	Intron	DEL	T	-	-	rs11322430		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178584974delT	uc003mjw.2	-						ADAMTS2_uc011dgm.1_Intron	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1						collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		tttttgtctcttttttttttg	0.000													4	2	---	---	---	---	
DUSP22	56940	broad.mit.edu	37	6	346696	346697	+	Intron	DEL	GT	-	-	rs145552805		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:346696_346697delGT	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		CTTGAATGAAGTGTGTTATTAA	0.446													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	865269	865269	+	IGR	DEL	A	-	-	rs34602957		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:865269delA								EXOC2 (172160 upstream) : LOC285768 (95973 downstream)																							cgtctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2550589	2550589	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2550589delG								GMDS (304743 upstream) : C6orf195 (72383 downstream)																							cagactttcagggccacccag	0.090													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	10017873	10017874	+	Intron	DEL	CA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10017873_10017874delCA	uc003myn.2	-						uc010joj.1_Intron|uc003myp.1_Intron					RecName: Full=Orofacial cleft 1 candidate gene 1 protein; AltName: Full=Orofacial clefting chromosomal breakpoint region candidate 1 protein;																		CCCTCATCTTCACCATTATCAC	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	12429680	12429681	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12429680_12429681delTG								EDN1 (132254 upstream) : PHACTR1 (287207 downstream)																							tctgtgtgcctgtgtgtgtgtg	0.040													4	2	---	---	---	---	
PHACTR1	221692	broad.mit.edu	37	6	12977613	12977614	+	Intron	DEL	CA	-	-	rs147157052		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12977613_12977614delCA	uc010jpc.2	+						PHACTR1_uc011dir.1_Intron|PHACTR1_uc003nag.1_Intron|PHACTR1_uc003nah.1_Intron	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1							cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CTCTCTCTTTcacacacacaca	0.233													4	3	---	---	---	---	
CD83	9308	broad.mit.edu	37	6	14130065	14130066	+	Intron	DEL	TG	-	-	rs111303556		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14130065_14130066delTG	uc003nbi.2	+						CD83_uc003nbh.2_Intron	NM_004233	NP_004224	Q01151	CD83_HUMAN	CD83 antigen isoform a						defense response|humoral immune response|signal transduction	integral to plasma membrane					0	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				CAGAAATGACtgtgtgtgtgtg	0.386											OREG0017204	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14464407	14464408	+	IGR	INS	-	TAC	TAC	rs140373040	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14464407_14464408insTAC								CD83 (327261 upstream) : JARID2 (781326 downstream)																							AAGGAACATCTTACTCAATCTC	0.356													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14904712	14904712	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14904712delA								CD83 (767566 upstream) : JARID2 (341022 downstream)																							aagatggagtaaaagttacca	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15801239	15801240	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15801239_15801240insA								DTNBP1 (137968 upstream) : MYLIP (328077 downstream)																							ACTGCCTAGGCAAAAAAAAAAA	0.421													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18565947	18565948	+	Intron	INS	-	CCTT	CCTT	rs138624874	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18565947_18565948insCCTT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		cttccttcttgccttccttcct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18566545	18566545	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18566545delT	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		TCTTTCTTCCTTTTTTTTTTG	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	28671984	28671985	+	IGR	INS	-	TTTG	TTTG	rs139089584	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28671984_28671985insTTTG								SCAND3 (116872 upstream) : TRIM27 (198795 downstream)																							tttttgttgtttttgtttgttt	0.203													3	3	---	---	---	---	
GABBR1	2550	broad.mit.edu	37	6	29601578	29601579	+	5'Flank	INS	-	AA	AA	rs142708238	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29601578_29601579insAA	uc003nmt.3	-						GABBR1_uc003nmu.3_5'Flank|GABBR1_uc011dlr.1_5'Flank|GABBR1_uc011dls.1_5'Flank	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1						gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	AAGGACAAGAGAAAAGAACCTC	0.465													4	2	---	---	---	---	
HLA-G	3135	broad.mit.edu	37	6	29968170	29968171	+	Intron	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29968170_29968171insG	uc011dmb.1	+							NM_002127	NP_002118	P17693	HLAG_HUMAN	major histocompatibility complex, class I, G						antigen processing and presentation of peptide antigen via MHC class I|cellular defense response|interferon-gamma-mediated signaling pathway|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex	MHC class I receptor activity			ovary(3)|central_nervous_system(1)	4						gaaagtattatggggtcgcacc	0.000													4	2	---	---	---	---	
HLA-B	3106	broad.mit.edu	37	6	31275455	31275456	+	Intron	INS	-	AGG	AGG	rs147714295	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31275455_31275456insAGG	uc003ntf.2	-						HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron			P01889	1B07_HUMAN	SubName: Full=MHC class I antigen;						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to plasma membrane|MHC class I protein complex	MHC class I receptor activity				0						ggaggaggagaaggaggaggag	0.436									Melanoma_Familial_Clustering_of|Lichen_Sclerosis_et_Atrophicus_Familial_Clustering_of				4	3	---	---	---	---	
SNRPC	6631	broad.mit.edu	37	6	34733524	34733524	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34733524delT	uc003ojt.1	+							NM_003093	NP_003084	P09234	RU1C_HUMAN	small nuclear ribonucleoprotein polypeptide C						spliceosomal snRNP assembly	Cajal body|U1 snRNP	protein homodimerization activity|single-stranded RNA binding|zinc ion binding			pancreas(1)	1						ccagtcACAAtttttttttta	0.005													4	2	---	---	---	---	
DAAM2	23500	broad.mit.edu	37	6	39855490	39855491	+	Intron	INS	-	TGGA	TGGA	rs140358304	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39855490_39855491insTGGA	uc003oow.2	+						DAAM2_uc003oox.2_Intron|uc003ooz.1_5'Flank	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					AGGCATTGATCTGGAACTGTCT	0.634													3	5	---	---	---	---	
TFEB	7942	broad.mit.edu	37	6	41678585	41678587	+	Intron	DEL	CTC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41678585_41678587delCTC	uc003oqs.1	-						TFEB_uc003oqt.1_Intron|TFEB_uc003oqu.1_Intron|TFEB_uc003oqv.1_Intron|TFEB_uc010jxo.1_Intron|TFEB_uc003oqx.1_Intron|TFEB_uc003oqy.1_Intron|TFEB_uc003oqz.1_Intron|TFEB_uc010jxq.1_Intron	NM_007162	NP_009093	P19484	TFEB_HUMAN	transcription factor EB						embryonic placenta development|humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GCTCCAGGGTCTCCTCCTCCTCC	0.394			T	ALPHA	renal (childhood epithelioid)								4	2	---	---	---	---	
GUCA1A	2978	broad.mit.edu	37	6	42133502	42133502	+	Intron	DEL	A	-	-	rs78367517		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42133502delA	uc003orx.2	+						GUCA1A_uc011duo.1_Intron|GUCA1A_uc010jxt.2_Intron	NM_000409	NP_000400	P43080	GUC1A_HUMAN	guanylate cyclase activator 1A (retina)						signal transduction|visual perception	membrane	calcium ion binding|calcium sensitive guanylate cyclase activator activity				0	Colorectal(47;0.196)		STAD - Stomach adenocarcinoma(11;5.54e-05)|Epithelial(12;0.000167)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			tttttgagataagagtttcac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	44624769	44624770	+	IGR	INS	-	AC	AC	rs145204715	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44624769_44624770insAC								CDC5L (209990 upstream) : SUPT3H (152284 downstream)																							CTCCCGTGCGTacacacacaca	0.327													10	5	---	---	---	---	
MCM3	4172	broad.mit.edu	37	6	52135975	52135976	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52135975_52135976insA	uc003pan.1	-						MCM3_uc011dwu.1_Intron	NM_002388	NP_002379	P25205	MCM3_HUMAN	minichromosome maintenance complex component 3						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	alpha DNA polymerase:primase complex|centrosome|MCM complex|perinuclear region of cytoplasm	ATP binding|DNA binding|helicase activity|protein binding			ovary(1)|lung(1)|skin(1)	3	Lung NSC(77;0.0931)					gaccgcatctcaaaaaaaaaGT	0.198													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57296446	57296446	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57296446delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ccctgcctttaaaaaaaaaaa	0.144													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57382856	57382857	+	Intron	INS	-	TT	TT	rs150444876		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57382856_57382857insTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tgtcctggatctttccaagtaa	0.030													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57387177	57387178	+	Intron	INS	-	T	T	rs145242761		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57387177_57387178insT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTGTTTATGACTGGCAGAGATT	0.361													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57436887	57436890	+	Intron	DEL	ACTC	-	-	rs149977851		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57436887_57436890delACTC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		GTTGTCAAATACTCAGGAAATGAA	0.279													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57513140	57513141	+	Splice_Site	INS	-	AACA	AACA	rs149351797		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57513140_57513141insAACA	uc003pdx.2	+	19	2070	c.1983_splice	c.e19+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTGAGGTAACGAGACTTTCAC	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57543218	57543219	+	IGR	DEL	TG	-	-	rs70989773		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57543218_57543219delTG								PRIM2 (29843 upstream) : GUSBL2 (702940 downstream)																							tttttttttttgtagagatgag	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57551315	57551315	+	IGR	DEL	T	-	-	rs111976434		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57551315delT								PRIM2 (37940 upstream) : GUSBL2 (694844 downstream)																							agaacaaagctggagacatca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57552929	57552929	+	IGR	DEL	A	-	-	rs111299945		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57552929delA								PRIM2 (39554 upstream) : GUSBL2 (693230 downstream)																							aacttttaacaaaaaactttt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57558058	57558058	+	IGR	DEL	T	-	-	rs74318708		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57558058delT								PRIM2 (44683 upstream) : GUSBL2 (688101 downstream)																							tatgacaaagttctaatatcc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57575522	57575522	+	IGR	DEL	G	-	-	rs67290515		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57575522delG								PRIM2 (62147 upstream) : GUSBL2 (670637 downstream)																							AAAGCCTATAGGAAAAAAAAG	0.393													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58177175	58177176	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58177175_58177176delGT								PRIM2 (663800 upstream) : GUSBL2 (68983 downstream)																							ATTGGTGGGGGTGTGTGTGTAT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58652232	58652233	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58652232_58652233delTG								GUSBL2 (364508 upstream) : None (None downstream)																							CATGAGTGATTGTGTGTGTGTG	0.322													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	64454365	64454365	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64454365delG	uc011dxu.1	-						EYS_uc011dxt.1_Intron	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						ACCAAGTGATGGTGTTCCCAC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	79004778	79004778	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79004778delC								HTR1B (831658 upstream) : IRAK1BP1 (572411 downstream)																							tgggacacagcaaaagcagta	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85492696	85492697	+	IGR	DEL	TG	-	-	rs112862504		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85492696_85492697delTG								TBX18 (18797 upstream) : NT5E (666605 downstream)																							tgtttgtgtttgtgtgtgtgtg	0.317													4	2	---	---	---	---	
MDN1	23195	broad.mit.edu	37	6	90422673	90422673	+	Intron	DEL	A	-	-	rs5878107		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90422673delA	uc003pnn.1	-							NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog						protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		ATGTAAGTTTAAAAAAAAAAA	0.323													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	93556343	93556343	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93556343delA								None (None upstream) : EPHA7 (393399 downstream)																							ATGCTAGCTTAAAAGGAAGAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	93746594	93746594	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93746594delT								None (None upstream) : EPHA7 (203148 downstream)																							tattattgggttttttttttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	102725761	102725762	+	IGR	INS	-	G	G	rs146906527	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:102725761_102725762insG								GRIK2 (207804 upstream) : None (None downstream)																							tctatccatgttgctgcaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	103849106	103849106	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:103849106delC								None (None upstream) : None (None downstream)																							ctcactgcaacctctgcctcc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	106525358	106525358	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106525358delG								PREP (674389 upstream) : PRDM1 (8837 downstream)																							CCAGGTGTCTGGGGCCATGCC	0.483													4	2	---	---	---	---	
SOBP	55084	broad.mit.edu	37	6	107863970	107863971	+	Intron	INS	-	T	T	rs113045000		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107863970_107863971insT	uc003prx.2	+						SOBP_uc003prw.1_Intron	NM_018013	NP_060483	A7XYQ1	SOBP_HUMAN	sine oculis binding protein homolog								metal ion binding			ovary(1)	1		all_cancers(87;5.26e-06)|Acute lymphoblastic leukemia(125;2.87e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.00193)|Colorectal(196;0.156)		BRCA - Breast invasive adenocarcinoma(108;0.026)|all cancers(137;0.087)|Epithelial(106;0.104)|OV - Ovarian serous cystadenocarcinoma(136;0.154)		TGTGTGTTTTGTTTTTTTTTTG	0.401													4	2	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109237284	109237284	+	Intron	DEL	A	-	-	rs67444094		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109237284delA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TGCTTAGAGGAAAAAAAAACA	0.358													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	112728964	112728964	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112728964delA								RFPL4B (56466 upstream) : None (None downstream)																							tttatttcatagggatatatg	0.005													4	2	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114385247	114385248	+	5'Flank	INS	-	TTGT	TTGT	rs149681830	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114385247_114385248insTTGT	uc003pwg.3	-						uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		TCAAGATAAGATTGTTTGCCTC	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	120164313	120164314	+	IGR	INS	-	GA	GA	rs140545169	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:120164313_120164314insGA								MAN1A1 (493387 upstream) : None (None downstream)																							aagggcaaagtgagagagagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	122345150	122345151	+	IGR	INS	-	TG	TG	rs147791692	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:122345150_122345151insTG								GJA1 (574278 upstream) : HSF2 (375545 downstream)																							gtttgtgtgtttgtgtgtgtgt	0.000													3	4	---	---	---	---	
EYA4	2070	broad.mit.edu	37	6	133615646	133615647	+	Intron	INS	-	CT	CT	rs141349870	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133615646_133615647insCT	uc003qec.3	+						EYA4_uc011ecq.1_Intron|EYA4_uc011ecr.1_Intron|EYA4_uc003qed.3_Intron|EYA4_uc003qee.3_Intron|EYA4_uc011ecs.1_Intron	NM_004100	NP_004091	O95677	EYA4_HUMAN	eyes absent 4 isoform a						anatomical structure morphogenesis|chromatin modification|DNA repair|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent|visual perception	cytoplasm|nucleus	metal ion binding|protein tyrosine phosphatase activity			large_intestine(2)	2	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		GTGTGTCACCACTCTGCTCAGT	0.134													4	3	---	---	---	---	
MAP3K5	4217	broad.mit.edu	37	6	136915941	136915942	+	Intron	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136915941_136915942delTG	uc003qhc.2	-						MAP3K5_uc011edj.1_Intron|MAP3K5_uc011edk.1_Intron	NM_005923	NP_005914	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|activation of MAPKK activity|cellular response to hydrogen peroxide|induction of apoptosis by extracellular signals|interspecies interaction between organisms		ATP binding|caspase activator activity|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein phosphatase binding			ovary(2)|skin(2)|lung(1)	5	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		tttccgtgtttgtgtgtgtgtg	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140594955	140594956	+	IGR	DEL	TG	-	-	rs71820684		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140594955_140594956delTG								CITED2 (899170 upstream) : None (None downstream)																							tgtatatatatgtgtgtgtgtg	0.238													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140718282	140718282	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140718282delA								None (None upstream) : None (None downstream)																							acaaacaaataaacaaaAAAG	0.338													4	2	---	---	---	---	
AIG1	51390	broad.mit.edu	37	6	143517488	143517495	+	Intron	DEL	ACACACAC	-	-	rs72073960	byFrequency	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143517488_143517495delACACACAC	uc003qjh.2	+						AIG1_uc003qjf.2_Intron|AIG1_uc003qji.2_Intron	NM_016108	NP_057192	Q9NVV5	AIG1_HUMAN	androgen-induced 1							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(155;2.34e-05)|GBM - Glioblastoma multiforme(68;0.0246)		AACAAAAGCAacacacacacacacacac	0.288													4	2	---	---	---	---	
ESR1	2099	broad.mit.edu	37	6	152151640	152151641	+	Intron	DEL	CT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152151640_152151641delCT	uc003qom.3	+						ESR1_uc010kin.2_Intron|ESR1_uc010kio.2_Intron|ESR1_uc010kip.2_Intron|ESR1_uc003qon.3_Intron|ESR1_uc003qoo.3_Intron|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4						positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	CAAATTGCAGCTCTCTCTCTCT	0.396													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	154943640	154943640	+	IGR	DEL	A	-	-	rs67548165		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154943640delA								CNKSR3 (111887 upstream) : RBM16 (110872 downstream)																							ATCCCTTCTCAAAAAAAAAAA	0.303													4	3	---	---	---	---	
LPA	4018	broad.mit.edu	37	6	161081801	161081801	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161081801delA	uc003qtl.2	-							NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	AAAATTAAGCAAAAAAAAAAT	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164135709	164135709	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164135709delC	uc003quk.1	+											Homo sapiens cDNA FLJ35795 fis, clone TESTI2005827.																		GCCTCTCCCTCCCCACCTGCC	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164514843	164514850	+	IGR	DEL	GTGTGTGT	-	-	rs10549544		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164514843_164514850delGTGTGTGT								QKI (519951 upstream) : None (None downstream)																							GCTTTTACTGgtgtgtgtgtgtgtgtgt	0.385													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164530743	164530744	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164530743_164530744insA								QKI (535851 upstream) : None (None downstream)																							GGCAGTCACTCAAAAAAAGTCC	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166235390	166235390	+	Intron	DEL	T	-	-	rs11316149		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166235390delT	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																		AGGTGCCGGGTTTTTTTTTCC	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	166240267	166240267	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166240267delG	uc003qup.1	-											Homo sapiens cDNA FLJ33369 fis, clone BRACE2005904.																		GCGGTTGGGAGGGGGGACGCA	0.343													2	4	---	---	---	---	
MLLT4	4301	broad.mit.edu	37	6	168319289	168319290	+	Intron	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168319289_168319290delTG	uc003qwd.2	+						MLLT4_uc003qwb.1_Intron|MLLT4_uc003qwc.1_Intron|MLLT4_uc003qwg.1_Intron	NM_001040001	NP_001035090	P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						adherens junction organization|cell adhesion|cell junction assembly|cell-cell signaling|signal transduction	adherens junction|cell-cell junction|cytosol|nucleus	protein C-terminus binding			ovary(2)|lung(1)|kidney(1)|central_nervous_system(1)	5		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TGCGTCTGTCTGTGTGTGTGTG	0.500			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168744684	168744684	+	IGR	DEL	G	-	-	rs72180247		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168744684delG								DACT2 (24282 upstream) : SMOC2 (97347 downstream)																							GTGGGGAGATGGCGATTTAGC	0.458													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169530468	169530469	+	IGR	INS	-	AGGG	AGGG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169530468_169530469insAGGG								SMOC2 (461797 upstream) : THBS2 (85407 downstream)																							ccacccaaattagggagggcca	0.000													4	2	---	---	---	---	
UNCX	340260	broad.mit.edu	37	7	1271877	1271879	+	5'Flank	DEL	CCT	-	-	rs113867402		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1271877_1271879delCCT	uc011jvw.1	+							NM_001080461	NP_001073930	A6NJT0	UNC4_HUMAN	UNC homeobox						cell differentiation	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		TCGGGATCGCcctcctcctcctc	0.414													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	7868376	7868378	+	Intron	DEL	CTC	-	-	rs147841701		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7868376_7868378delCTC	uc011jxf.1	+											SubName: Full=cDNA FLJ54628; SubName: Full=HCG19535; SubName: Full=Hypothetical gene supported by AK027125;																		CTTCCCAGTGCTCCTCCTCCTCC	0.468													6	4	---	---	---	---	
DGKB	1607	broad.mit.edu	37	7	14686961	14686963	+	Intron	DEL	AAC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:14686961_14686963delAAC	uc003ssz.2	-						DGKB_uc011jxt.1_Intron|DGKB_uc003sta.2_Intron|DGKB_uc011jxu.1_Intron	NM_004080	NP_004071	Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity|protein binding			lung(5)|ovary(4)|breast(2)|skin(1)	12					Phosphatidylserine(DB00144)	ccaaaaagaaaacaacaacaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	17708408	17708409	+	IGR	DEL	AA	-	-	rs71551795		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:17708408_17708409delAA								AHR (322633 upstream) : SNX13 (121977 downstream)																							ctataataataaaaaaaaaaAA	0.054													4	2	---	---	---	---	
IGF2BP3	10643	broad.mit.edu	37	7	23486820	23486821	+	Intron	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23486820_23486821delAC	uc003swg.2	-						IGF2BP3_uc003swh.1_Intron	NM_006547	NP_006538	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation|translation	cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity			ovary(2)	2						actctgactgacacacacacac	0.000													4	3	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28598927	28598930	+	Intron	DEL	TTTG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28598927_28598930delTTTG	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						ATATAGgttttttgtttgtttgtt	0.211													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	28902955	28902955	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28902955delA								CREB5 (37446 upstream) : TRIL (90021 downstream)																							ctggaacaggaaaaaaatgac	0.040													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	29618230	29618230	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29618230delT								PRR15 (11319 upstream) : LOC646762 (67309 downstream)																							ttataaattatccagttttgg	0.090													4	4	---	---	---	---	
WIPF3	644150	broad.mit.edu	37	7	29884719	29884719	+	Intron	DEL	A	-	-	rs72054603		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29884719delA	uc003taj.1	+							NM_001080529	NP_001073998	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3											ovary(1)	1						TTCTAATAGGAAAAAAAAAAA	0.348													4	2	---	---	---	---	
WIPF3	644150	broad.mit.edu	37	7	29928125	29928126	+	Intron	DEL	GC	-	-	rs174977	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29928125_29928126delGC	uc003taj.1	+							NM_001080529	NP_001073998	A6NGB9	WIPF3_HUMAN	WAS/WASL interacting protein family, member 3											ovary(1)	1						gcgtgtgtgtgcgtgtgtgtgt	0.272													4	2	---	---	---	---	
AQP1	358	broad.mit.edu	37	7	30937270	30937271	+	Intron	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30937270_30937271insG	uc011kac.1	+							NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1						ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	CTTCAAACTCCGGGTTCAGATC	0.332													4	2	---	---	---	---	
RP9	6100	broad.mit.edu	37	7	33136450	33136451	+	Intron	INS	-	A	A	rs147970667	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33136450_33136451insA	uc003tdm.2	-							NM_203288	NP_976033	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9						RNA splicing	nucleus	nucleic acid binding|protein binding|zinc ion binding				0			GBM - Glioblastoma multiforme(11;0.0403)			ACCTCAAAAACAAAGAAAAATA	0.238													4	4	---	---	---	---	
NPSR1	387129	broad.mit.edu	37	7	34755634	34755635	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34755634_34755635insA	uc003teg.1	+						AAA1_uc010kwo.1_Intron|AAA1_uc010kwp.1_Intron|AAA1_uc003tdz.2_Intron|AAA1_uc010kwq.1_Intron|AAA1_uc003teb.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Intron|NPSR1_uc010kwt.1_Intron|NPSR1_uc010kwu.1_Intron|NPSR1_uc010kwv.1_Intron|NPSR1_uc003tei.1_Intron|NPSR1_uc010kww.1_Intron|NPSR1_uc011kar.1_Intron|AAA1_uc010kwx.1_Intron	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma							cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	AAACCTTGGGGAAAGAGTGGAA	0.441													4	2	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38636458	38636459	+	Intron	DEL	TC	-	-	rs111733350		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38636458_38636459delTC	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TATGCATTTATCTCTCTGTTTT	0.495													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	39856347	39856347	+	IGR	DEL	G	-	-	rs149957233	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39856347delG								LOC349114 (22126 upstream) : CDK13 (133612 downstream)																							ATAACTAGTTGGTGAAATGTG	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	41849480	41849481	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:41849480_41849481delGT								LOC285954 (30506 upstream) : GLI3 (151069 downstream)																							GAGAAAGCTGgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	42301578	42301581	+	IGR	DEL	TCTT	-	-	rs77485659		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42301578_42301581delTCTT								GLI3 (24960 upstream) : C7orf25 (647293 downstream)																							tctcgctctctctttctttctttc	0.044													4	2	---	---	---	---	
NUDCD3	23386	broad.mit.edu	37	7	44435687	44435688	+	Intron	DEL	TG	-	-	rs141156620		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44435687_44435688delTG	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						tatcttctgttgtgtgtgtgtg	0.094													7	4	---	---	---	---	
NUDCD3	23386	broad.mit.edu	37	7	44507256	44507256	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507256delA	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						CCAAGCCCCTAAAAAAAAAAA	0.373													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45878237	45878238	+	IGR	INS	-	GT	GT	rs149435425	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45878237_45878238insGT								SEPT7P2 (69620 upstream) : IGFBP1 (49721 downstream)																							ACAACAtgtgcgtgtgtgtgtg	0.342													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	45922886	45922887	+	IGR	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45922886_45922887delAC								SEPT7P2 (114269 upstream) : IGFBP1 (5072 downstream)																							acacaccccaacacacacacac	0.411													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54695478	54695479	+	IGR	INS	-	C	C	rs142611747	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54695478_54695479insC								VSTM2A (57291 upstream) : SEC61G (124462 downstream)																							ccatgcagcctcccccaatgca	0.000													4	2	---	---	---	---	
EGFR	1956	broad.mit.edu	37	7	55099211	55099212	+	Intron	INS	-	GA	GA	rs144333902	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55099211_55099212insGA	uc003tqk.2	+						EGFR_uc003tqh.2_Intron|EGFR_uc003tqi.2_Intron|EGFR_uc003tqj.2_Intron|EGFR_uc010kzg.1_Intron	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTGGTGTCAGGGAGAGAGTTGA	0.436		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			4	2	---	---	---	---	
ZNF713	349075	broad.mit.edu	37	7	55997442	55997442	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55997442delA	uc003trc.1	+						ZNF713_uc003tra.1_Intron|MRPS17_uc003trb.2_Intron	NM_182633	NP_872439	Q8N859	ZN713_HUMAN	zinc finger protein 713						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			agcaagactcaaaaaaaaaaa	0.040													4	3	---	---	---	---	
GBAS	2631	broad.mit.edu	37	7	56062938	56062938	+	Intron	DEL	A	-	-	rs34820247		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:56062938delA	uc003tre.1	+						GBAS_uc003trf.1_Intron	NM_001483	NP_001474	O75323	NIPS2_HUMAN	nipsnap homolog 2							integral to plasma membrane|membrane fraction|mitochondrion	protein binding			central_nervous_system(1)	1	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GCCATGGAAGAAGGAGGCCAG	0.493													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57723992	57723993	+	IGR	DEL	AG	-	-	rs142987140		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57723992_57723993delAG								ZNF716 (190727 upstream) : None (None downstream)																							ATCCCAGGGCAGAGTctcatct	0.317													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57731360	57731363	+	IGR	DEL	TTTA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57731360_57731363delTTTA								ZNF716 (198095 upstream) : None (None downstream)																							ttttaaagagtttatttaagcaaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57739001	57739002	+	IGR	DEL	AA	-	-	rs140610795		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57739001_57739002delAA								ZNF716 (205736 upstream) : None (None downstream)																							CTGGAGACATAAATAGAGGAAG	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62506138	62506139	+	IGR	INS	-	CATC	CATC	rs148194183	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62506138_62506139insCATC								None (None upstream) : LOC643955 (245533 downstream)																							atccatccattcatccatccat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	63023116	63023116	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:63023116delC								LOC100287704 (210965 upstream) : ZNF727 (482705 downstream)																							GTCCAGCCATCCCCCACCCTG	0.647													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64098115	64098116	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64098115_64098116insT								ZNF680 (74610 upstream) : ZNF107 (28395 downstream)																							caataagtcacttttttttttt	0.000													4	2	---	---	---	---	
ZNF273	10793	broad.mit.edu	37	7	64363092	64363093	+	5'Flank	DEL	AG	-	-	rs141687458		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64363092_64363093delAG	uc003tto.2	+						ZNF273_uc003ttl.2_Intron|ZNF273_uc003ttm.1_5'Flank|ZNF273_uc003ttn.2_5'Flank|ZNF273_uc003ttp.1_5'Flank	NM_021148	NP_066971	Q14593	ZN273_HUMAN	zinc finger protein 273						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(55;0.0295)|all_lung(88;0.0691)				cgaaagagacagagagagagaa	0.005													3	5	---	---	---	---	
RABGEF1	27342	broad.mit.edu	37	7	66119054	66119055	+	Intron	INS	-	T	T	rs149895647	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66119054_66119055insT	uc003tvf.2	+							NM_014504	NP_055319	Q9UJ41	RABX5_HUMAN	RAB guanine nucleotide exchange factor (GEF) 1						endocytosis|protein transport	early endosome|recycling endosome	DNA binding|protein binding|zinc ion binding			ovary(1)	1						tcttctaaagATTCAGCTGCTT	0.233													3	3	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	70947136	70947137	+	Intron	DEL	TT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70947136_70947137delTT	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CAAGGATACAtttttttttttt	0.089													3	3	---	---	---	---	
HIP1	3092	broad.mit.edu	37	7	75199598	75199599	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75199598_75199599insT	uc003uds.1	-						HIP1_uc011kfz.1_Intron	NM_005338	NP_005329	O00291	HIP1_HUMAN	huntingtin interacting protein 1						activation of caspase activity|cell differentiation|clathrin coat assembly|endocytosis|induction of apoptosis|positive regulation of receptor-mediated endocytosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	clathrin coated vesicle membrane|cytoskeleton|Golgi apparatus|membrane fraction|nucleus	actin binding|clathrin binding|phosphatidylinositol binding|structural constituent of cytoskeleton			lung(3)|pancreas(2)|ovary(1)|breast(1)|central_nervous_system(1)	8						tgacacgtttcttttttttttt	0.000			T	PDGFRB	CMML								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75374893	75374894	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75374893_75374894insT								HIP1 (6614 upstream) : CCL26 (23948 downstream)																							aaaaaaaagacttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	80869057	80869058	+	IGR	INS	-	G	G	rs147059897	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80869057_80869058insG								SEMA3C (317382 upstream) : HGF (462387 downstream)																							TGTCAAGACAACTTATCCTCTA	0.327													3	5	---	---	---	---	
CACNA2D1	781	broad.mit.edu	37	7	82060809	82060810	+	Intron	INS	-	CT	CT	rs150823729	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82060809_82060810insCT	uc003uhr.1	-							NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha							voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	TTACATGACTCCTCTCTCTCAA	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	84845674	84845675	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84845674_84845675delTG								SEMA3D (29503 upstream) : None (None downstream)																							ataagagtgttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	89710210	89710211	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:89710210_89710211insA								ZNF804B (743866 upstream) : DPY19L2P4 (38503 downstream)																							TATGTAAGTGCAAATAAACATG	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93006991	93006991	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93006991delT								CCDC132 (18654 upstream) : CALCR (46808 downstream)																							GGTTTTGCCATTTTAGCAATT	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	97200817	97200818	+	IGR	DEL	CT	-	-	rs72022147		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97200817_97200818delCT								ACN9 (389744 upstream) : TAC1 (160453 downstream)																							cacacacacacTCCTATCTGTT	0.178													4	2	---	---	---	---	
BAIAP2L1	55971	broad.mit.edu	37	7	98015040	98015041	+	Intron	INS	-	T	T	rs144554018	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98015040_98015041insT	uc003upj.2	-							NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			ATCAACATTTCTTTTTTTTGTT	0.178													16	7	---	---	---	---	
SMURF1	57154	broad.mit.edu	37	7	98684019	98684019	+	Intron	DEL	A	-	-	rs146454469		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98684019delA	uc003upu.1	-						SMURF1_uc003upv.1_Intron|SMURF1_uc003upt.2_Intron	NM_020429	NP_065162	Q9HCE7	SMUF1_HUMAN	Smad ubiquitination regulatory factor 1 isoform						BMP signaling pathway|cell differentiation|ectoderm development|negative regulation of BMP signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of protein ubiquitination|proteasomal ubiquitin-dependent protein catabolic process|protein export from nucleus|protein localization at cell surface|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|receptor catabolic process|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent SMAD protein catabolic process	cytosol|plasma membrane	activin binding|I-SMAD binding|R-SMAD binding|ubiquitin-protein ligase activity			skin(2)|ovary(1)|lung(1)	4	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			taagatagttaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100606564	100606564	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100606564delT	uc003uxk.1	+						uc003uxl.1_Intron|uc010lhn.1_5'Flank					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		ctcgaactactgactttgtga	0.090													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100611279	100611279	+	5'Flank	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100611279delT	uc003uxm.1	-						uc003uxn.1_Intron					Homo sapiens cDNA FLJ32697 fis, clone TESTI2000372.																		CTGCTGTTCCTCCCCATCACC	0.592													8	4	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101040824	101040825	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101040824_101040825insT	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					cccccccctccttttttttttt	0.000													4	2	---	---	---	---	
CUX1	1523	broad.mit.edu	37	7	101913092	101913093	+	Intron	INS	-	CC	CC	rs142970949	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101913092_101913093insCC	uc003uyt.2	+						CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_001913	NP_001904	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform b						negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						cttcttccatgccccccaaacg	0.208													2	4	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103129651	103129652	+	Intron	DEL	GT	-	-	rs111672292		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103129651_103129652delGT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCATAAAGGGgtgtgtgtgtgt	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	103755436	103755437	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103755436_103755437delGT								RELN (125473 upstream) : ORC5L (11353 downstream)																							gtgtgagagagtgtgtgtgtgt	0.000													4	2	---	---	---	---	
SRPK2	6733	broad.mit.edu	37	7	105006814	105006815	+	Intron	INS	-	TT	TT	rs34409221		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105006814_105006815insTT	uc003vcv.2	-						SRPK2_uc003vcw.1_Intron	NM_182692	NP_872634	P78362	SRPK2_HUMAN	serine/arginine-rich protein-specific kinase 2						angiogenesis|cell differentiation|intracellular protein kinase cascade|negative regulation of viral genome replication|nuclear speck organization|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of gene expression|positive regulation of neuron apoptosis|positive regulation of viral genome replication|spliceosome assembly	cytoplasm|nucleolus	14-3-3 protein binding|ATP binding|magnesium ion binding|protein serine/threonine kinase activity			central_nervous_system(3)|ovary(2)|upper_aerodigestive_tract(1)	6						acaggtatgccttttttttttt	0.000													4	2	---	---	---	---	
IMMP2L	83943	broad.mit.edu	37	7	111166046	111166046	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111166046delC	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TCCACCCCCACCCCCAAAAAA	0.294													4	2	---	---	---	---	
TFEC	22797	broad.mit.edu	37	7	115700381	115700382	+	Intron	DEL	AG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:115700381_115700382delAG	uc011kmw.1	-									O14948	TFEC_HUMAN	SubName: Full=cDNA FLJ55256, highly similar to Homo sapiens transcription factor EC (TFEC), transcript variant 1, mRNA;							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			large_intestine(1)	1			STAD - Stomach adenocarcinoma(10;0.00878)			gactaaaagcagaactaccatt	0.000													2	5	---	---	---	---	
KCND2	3751	broad.mit.edu	37	7	120041014	120041014	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120041014delA	uc003vjj.1	+							NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related						regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					ATGTACTATTAAAAAAAAAAA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	120582071	120582071	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120582071delT								TSPAN12 (83894 upstream) : ING3 (8746 downstream)																							TGTTCCAGGATTTGTCTTGGC	0.413													4	2	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	121968210	121968215	+	Intron	DEL	CACACG	-	-	rs71898401	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121968210_121968215delCACACG	uc010lkp.2	-						CADPS2_uc011knx.1_Intron|CADPS2_uc003vkg.3_Intron|CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						cacacacacacacacgcacgcacaca	0.301													2	4	---	---	---	---	
LEP	3952	broad.mit.edu	37	7	127880318	127880318	+	5'Flank	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127880318delG	uc003vml.2	+							NM_000230	NP_000221	P41159	LEP_HUMAN	leptin precursor						adult feeding behavior|energy reserve metabolic process|negative regulation of appetite|placenta development|positive regulation of developmental growth	extracellular space					0						GTTTGTTTTTGGAGCTGCTCT	0.129													4	2	---	---	---	---	
FLJ43663	378805	broad.mit.edu	37	7	130779030	130779033	+	Intron	DEL	AAAC	-	-	rs71873633		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130779030_130779033delAAAC	uc011kpk.1	-						FLJ43663_uc003vqo.1_Intron|FLJ43663_uc003vqp.2_Intron|FLJ43663_uc003vqq.2_Intron	NR_024153				Homo sapiens cDNA FLJ43663 fis, clone SYNOV4005989.												0						ctgtctcaaaaaacaaacaaacaa	0.127													4	2	---	---	---	---	
MKLN1	4289	broad.mit.edu	37	7	130939420	130939423	+	Intron	DEL	AATT	-	-	rs142601474		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130939420_130939423delAATT	uc011kpl.1	+							NM_001145354	NP_001138826	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					taaagagaaaaattaattagaggg	0.000													0	7	---	---	---	---	
MKLN1	4289	broad.mit.edu	37	7	131056130	131056130	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131056130delG	uc011kpm.1	+						MKLN1_uc011kpl.1_Intron|MKLN1_uc010lmh.2_Intron|MKLN1_uc003vqs.2_Intron	NM_013255	NP_037387	Q9UL63	MKLN1_HUMAN	muskelin 1, intracellular mediator containing						signal transduction	cytoplasm	protein binding			breast(1)	1	Melanoma(18;0.162)					cctaaatgatggactcccaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131319257	131319260	+	IGR	DEL	TTCT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131319257_131319260delTTCT								PODXL (77881 upstream) : PLXNA4 (488832 downstream)																							ccttctttccttctttctttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	131520345	131520345	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131520345delA								PODXL (278969 upstream) : PLXNA4 (287747 downstream)																							GAGCAAGATTAAGATAAAAAC	0.408													2	4	---	---	---	---	
PLXNA4	91584	broad.mit.edu	37	7	132111794	132111795	+	Intron	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132111794_132111795delTC	uc003vra.3	-						PLXNA4_uc003vrc.2_Intron	NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1							integral to membrane|intracellular|plasma membrane				ovary(1)	1						AGGAGGGGATTCTTCCCCAGAA	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	134987477	134987477	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134987477delA								STRA8 (44235 upstream) : CNOT4 (59076 downstream)																							acgcacctataatcccagcta	0.000													4	2	---	---	---	---	
AGK	55750	broad.mit.edu	37	7	141264270	141264273	+	Intron	DEL	ACTC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141264270_141264273delACTC	uc003vwi.2	+						AGK_uc011krg.1_Intron|AGK_uc003vwh.2_Intron	NM_018238	NP_060708	Q53H12	AGK_HUMAN	acylglycerol kinase precursor						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)					tcttgtgagaactcactcactttc	0.000													2	4	---	---	---	---	
TRPV5	56302	broad.mit.edu	37	7	142605706	142605706	+	Frame_Shift_Del	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142605706delC	uc003wby.1	-	15	2428	c.2164delG	c.(2164-2166)GATfs	p.D722fs		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	722	Cytoplasmic (Potential).|Involved in Ca(2+)-dependent inactivation (By similarity).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TCCTCTCCATCCCCCTCACTA	0.572													39	29	---	---	---	---	
CASP2	835	broad.mit.edu	37	7	143000715	143000715	+	Intron	DEL	T	-	-	rs111737095		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143000715delT	uc003wco.2	+						CASP2_uc003wcp.2_Intron|CASP2_uc011kta.1_Intron|CASP2_uc003wcq.2_Intron|CASP2_uc011ktb.1_Intron	NM_032982	NP_116764	P42575	CASP2_HUMAN	caspase 2 isoform 1 preproprotein						apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding			lung(2)|ovary(1)	3	Melanoma(164;0.059)					AGAGtaataattttttttttt	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143114264	143114265	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143114264_143114265insT	uc003wda.2	+											Homo sapiens mRNA; cDNA DKFZp686O0656 (from clone DKFZp686O0656).																		TACACTCTAACTtttttttttc	0.238													4	2	---	---	---	---	
TPK1	27010	broad.mit.edu	37	7	144173987	144173988	+	Intron	INS	-	TATTT	TATTT	rs140735281	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144173987_144173988insTATTT	uc003weq.2	-						TPK1_uc003weo.2_Intron|TPK1_uc003wep.2_Intron|TPK1_uc003wer.2_Intron|TPK1_uc003wes.2_Intron	NM_022445	NP_071890	Q9H3S4	TPK1_HUMAN	thiamin pyrophosphokinase 1 isoform a						thiamine diphosphate biosynthetic process	cytosol	ATP binding|kinase activity|thiamine diphosphokinase activity			ovary(2)	2					Thiamine(DB00152)	CTTTCAGAGACTATTTTGTATA	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	144828374	144828375	+	IGR	INS	-	G	G	rs150688850	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144828374_144828375insG								TPK1 (295228 upstream) : CNTNAP2 (985078 downstream)																							tgactttgagtggggcagcttc	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148179923	148179924	+	IGR	INS	-	T	T	rs145679013		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148179923_148179924insT								CNTNAP2 (61837 upstream) : C7orf33 (107733 downstream)																							TCAAATGCTGCttttttttttt	0.277													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152181963	152181964	+	IGR	INS	-	T	T	rs71198786		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152181963_152181964insT								LOC100128822 (19335 upstream) : XRCC2 (161625 downstream)																							tccttctttccaccctccttcc	0.168													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155883032	155883032	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155883032delC								SHH (278065 upstream) : C7orf4 (450153 downstream)																							tgtaatttgtcgtattctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	157279059	157279060	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157279059_157279060delGT								DNAJB6 (68927 upstream) : PTPRN2 (52691 downstream)																							GTTTGGAGGGgtgtgtgtgtgt	0.421													4	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	158207167	158207168	+	Intron	DEL	AC	-	-	rs141488360		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158207167_158207168delAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		AGATTTCACTACAGTAATTGCA	0.465													3	4	---	---	---	---	
ESYT2	57488	broad.mit.edu	37	7	158574280	158574282	+	Intron	DEL	GAG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158574280_158574282delGAG	uc003wob.1	-						ESYT2_uc003woc.1_Intron|ESYT2_uc003wod.1_Intron	NM_020728	NP_065779	A0FGR8	ESYT2_HUMAN	family with sequence similarity 62 (C2 domain							integral to membrane|plasma membrane				central_nervous_system(2)|kidney(1)	3						TGAGAGGTTTGAGTATAAGACCG	0.256													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	4973734	4973735	+	IGR	DEL	TG	-	-	rs3063391		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:4973734_4973735delTG								CSMD1 (121406 upstream) : None (None downstream)																							TCATTAGTTTtgtgtgtgtgtg	0.297													2	4	---	---	---	---	
GATA4	2626	broad.mit.edu	37	8	11546033	11546034	+	Intron	INS	-	CA	CA	rs145128130	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11546033_11546034insCA	uc003wub.1	+						GATA4_uc011kxb.1_Intron	NM_002052	NP_002043	P43694	GATA4_HUMAN	GATA binding protein 4						atrial septum primum morphogenesis|atrial septum secundum morphogenesis|blood coagulation|cardiac right ventricle morphogenesis|cell-cell signaling|embryonic foregut morphogenesis|embryonic heart tube anterior/posterior pattern formation|endocardial cushion development|endoderm development|heart looping|intestinal epithelial cell differentiation|male gonad development|positive regulation of angiogenesis|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation vascular endothelial growth factor production|response to drug|transcription from RNA polymerase II promoter|ventricular septum development	nucleoplasm	activating transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		GTGCGCGCATGcacacacacac	0.381													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	16629765	16629766	+	IGR	INS	-	GT	GT	rs149596161	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16629765_16629766insGT								MSR1 (579465 upstream) : FGF20 (220568 downstream)																							TCATAGGAGGGgtgtgtgtgtg	0.267													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37568528	37568529	+	IGR	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37568528_37568529delAC								ZNF703 (12132 upstream) : ERLIN2 (25568 downstream)																							tcttcccccaacacacacacac	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37593487	37593487	+	Frame_Shift_Del	DEL	A	-	-	rs112819064		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37593487delA	uc003xkb.1	-	2	878	c.529delT	c.(529-531)TCTfs	p.S177fs	ERLIN2_uc003xkc.3_5'Flank|ERLIN2_uc003xkd.2_5'Flank|ERLIN2_uc003xke.3_5'Flank|ERLIN2_uc003xkf.3_5'Flank|ERLIN2_uc003xkg.2_5'Flank					SubName: Full=Putative uncharacterized protein ENSP00000328874;																		TCAAGGAGAGAAAAAAAAAAA	0.199													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	37800857	37800858	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37800857_37800858insA								GOT1L1 (3210 upstream) : ADRB3 (19658 downstream)																							aactccatctcaaaaaaaaaaa	0.168													4	2	---	---	---	---	
TACC1	6867	broad.mit.edu	37	8	38703958	38703958	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38703958delA	uc010lwp.2	+						TACC1_uc003xma.2_Intron|TACC1_uc003xlz.2_Intron|TACC1_uc003xmc.3_Intron|TACC1_uc011lbz.1_Intron|TACC1_uc003xmb.3_Intron|TACC1_uc003xmf.3_Intron|TACC1_uc011lca.1_Intron|TACC1_uc011lcb.1_Intron|TACC1_uc011lcd.1_Intron|TACC1_uc003xmh.3_Intron|TACC1_uc010lwq.2_Intron	NM_006283	NP_006274	O75410	TACC1_HUMAN	transforming, acidic coiled-coil containing						cell cycle|cell division	intermediate filament cytoskeleton|microtubule organizing center|nucleus	protein binding			ovary(1)	1		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.065)	LUSC - Lung squamous cell carcinoma(45;1.7e-09)|COAD - Colon adenocarcinoma(9;0.235)			GTACTGGTCTAAAAAAAAAAA	0.338													4	2	---	---	---	---	
HGSNAT	138050	broad.mit.edu	37	8	43016297	43016297	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43016297delG	uc003xpx.3	+							NM_152419	NP_689632	Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase						lysosomal transport|protein oligomerization	integral to membrane|lysosomal membrane	heparan-alpha-glucosaminide N-acetyltransferase activity				0	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			gggggtgggtgggtagttata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	50510326	50510326	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:50510326delC								C8orf22 (521685 upstream) : SNTG1 (312023 downstream)																							ctctggtcttcccaaaggcag	0.000													4	2	---	---	---	---	
XKR4	114786	broad.mit.edu	37	8	56338934	56338937	+	Intron	DEL	CTCT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56338934_56338937delCTCT	uc003xsf.2	+							NM_052898	NP_443130	Q5GH76	XKR4_HUMAN	XK, Kell blood group complex subunit-related							integral to membrane				pancreas(2)	2			Epithelial(17;0.000117)|all cancers(17;0.000836)			ctcacttgcgctctctctctCTCT	0.123													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60684344	60684344	+	IGR	DEL	T	-	-	rs76192120		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60684344delT								TOX (652577 upstream) : CA8 (417079 downstream)																							tacaagattatttttttatac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	71434532	71434533	+	IGR	INS	-	C	C	rs149235233	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71434532_71434533insC								NCOA2 (118512 upstream) : TRAM1 (51140 downstream)																							ggaaatatacttatcgcttgac	0.000													3	3	---	---	---	---	
STAU2	27067	broad.mit.edu	37	8	74559173	74559174	+	Intron	INS	-	AC	AC	rs142043134	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74559173_74559174insAC	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			cacacagccagacacacacaca	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	80357939	80357940	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80357939_80357940insA								IL7 (640181 upstream) : STMN2 (165440 downstream)																							CAAACAGAGAGAAAAAAAAAGA	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81319343	81319345	+	IGR	DEL	CAA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81319343_81319345delCAA								TPD52 (235507 upstream) : ZBTB10 (78509 downstream)																							aaaacaacagcaacaacaacaac	0.163													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	83703948	83703949	+	IGR	DEL	CT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:83703948_83703949delCT								SNX16 (949427 upstream) : None (None downstream)																							GGTTCTGGCActctctctctct	0.361													4	2	---	---	---	---	
CA2	760	broad.mit.edu	37	8	86392674	86392675	+	Intron	INS	-	T	T	rs145691122		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86392674_86392675insT	uc003ydk.2	+							NM_000067	NP_000058	P00918	CAH2_HUMAN	carbonic anhydrase II						one-carbon metabolic process	apical part of cell	carbonate dehydratase activity|zinc ion binding			central_nervous_system(1)	1					Acetazolamide(DB00819)|Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Brinzolamide(DB01194)|Chlorothiazide(DB00880)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Dorzolamide(DB00869)|Ethinamate(DB01031)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Topiramate(DB00273)|Trichlormethiazide(DB01021)	gtgtgtgtgtgttttttttttt	0.000													2	4	---	---	---	---	
PSKH2	85481	broad.mit.edu	37	8	87069133	87069134	+	Intron	INS	-	T	T	rs36014357		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87069133_87069134insT	uc011lfy.1	-							NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2								ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			ggtagttggagttttttttttt	0.000													3	4	---	---	---	---	
CPNE3	8895	broad.mit.edu	37	8	87567463	87567463	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87567463delA	uc003ydv.2	+						CPNE3_uc003ydw.1_Intron	NM_003909	NP_003900	O75131	CPNE3_HUMAN	copine III						lipid metabolic process|vesicle-mediated transport	cytosol	calcium-dependent phospholipid binding|protein serine/threonine kinase activity|transporter activity			ovary(1)|skin(1)	2						AGGTTCTACCAAAAAAAAAAA	0.308													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	91186422	91186429	+	IGR	DEL	AAGGAAGG	-	-	rs57930531	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:91186422_91186429delAAGGAAGG								CALB1 (78735 upstream) : TMEM64 (447794 downstream)																							agaaagaagaaaggaaggaaggaaggaa	0.000													4	2	---	---	---	---	
ESRP1	54845	broad.mit.edu	37	8	95681018	95681019	+	Intron	DEL	TG	-	-	rs34761061		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95681018_95681019delTG	uc003ygq.3	+						ESRP1_uc003ygr.3_Intron|ESRP1_uc003ygs.3_Intron|ESRP1_uc003ygt.3_Intron|ESRP1_uc003ygu.3_Intron|ESRP1_uc003ygv.2_Intron|ESRP1_uc003ygw.2_Intron	NM_017697	NP_060167	Q6NXG1	ESRP1_HUMAN	RNA binding motif protein 35A isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus|plasma membrane	mRNA binding|nucleotide binding		ESRP1/RAF1(4)	prostate(4)	4						GCTTTCAGCATGTGTGTGTGTG	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96202422	96202422	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96202422delA								PLEKHF2 (33511 upstream) : C8orf37 (55813 downstream)																							TAAAAAAGacaaaaaaattat	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	103706264	103706267	+	IGR	DEL	GTGT	-	-	rs142180069		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103706264_103706267delGTGT								KLF10 (38281 upstream) : AZIN1 (132270 downstream)																							ATGTGGGCCAgtgtgtgtgtgtgt	0.221													4	2	---	---	---	---	
SLC25A32	81034	broad.mit.edu	37	8	104426906	104426907	+	Intron	DEL	AC	-	-	rs59125759		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104426906_104426907delAC	uc003yll.2	-						SLC25A32_uc011lhr.1_Intron|DCAF13_uc003ylm.1_5'Flank|DCAF13_uc003yln.2_5'Flank|DCAF13_uc003ylo.2_5'Flank	NM_030780	NP_110407	Q9H2D1	MFTC_HUMAN	solute carrier family 25, member 32						folic acid metabolic process|mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding|folic acid transporter activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GCGGACAGCAACGCTCCCTTCA	0.599													5	5	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	105113789	105113790	+	Intron	INS	-	AC	AC	rs147589283	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105113789_105113790insAC	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			tacatatagatacacacacaca	0.030										HNSCC(12;0.0054)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	105798570	105798573	+	IGR	DEL	AAAC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105798570_105798573delAAAC								LRP12 (197350 upstream) : ZFPM2 (532574 downstream)																							tctgtctccaaaacaaacaaacaa	0.103													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	107074649	107074650	+	IGR	DEL	GT	-	-	rs147425843		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107074649_107074650delGT								ZFPM2 (257884 upstream) : OXR1 (207823 downstream)																							tgtgtgtggggtgtgtgtgtgt	0.109													5	3	---	---	---	---	
ANGPT1	284	broad.mit.edu	37	8	108491368	108491369	+	Intron	INS	-	T	T	rs144246840	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108491368_108491369insT	uc003ymn.2	-						ANGPT1_uc003ymo.2_Intron	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TATCTTCCAGATTTTTTTTTTG	0.312													6	3	---	---	---	---	
RSPO2	340419	broad.mit.edu	37	8	108936322	108936322	+	Intron	DEL	A	-	-	rs35777465		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108936322delA	uc003yms.2	-						RSPO2_uc003ymq.2_Intron|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor						Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			acatacaattaaaaaaaaaaa	0.010													1	5	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113460985	113460987	+	Intron	DEL	AAA	-	-	rs147505515		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113460985_113460987delAAA	uc003ynu.2	-						CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Intron|CSMD3_uc011lhx.1_Intron	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ACAATCTATTaaaaaaaaaaaaa	0.207										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117580962	117580962	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117580962delA								TRPS1 (899734 upstream) : EIF3H (76094 downstream)																							aatgttcaggaaaaaaaaaaa	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	117849663	117849663	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117849663delG								UTP23 (62744 upstream) : RAD21 (8511 downstream)																							gtttgagggaggggagtatgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	122326725	122326733	+	IGR	DEL	GGCCTTCAG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122326725_122326733delGGCCTTCAG								SNTB1 (502416 upstream) : HAS2 (298538 downstream)																							TACTCAGATAGGCCTTCAGGGCCTTCAGG	0.531													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123907654	123907655	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123907654_123907655delGT	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			CAGGAAGAACGTGTGACCACTA	0.426													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	124300606	124300606	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124300606delC								ZHX1 (12825 upstream) : ATAD2 (31487 downstream)																							CATGGTCTTACCACTGAGTTT	0.358													4	2	---	---	---	---	
FAM91A1	157769	broad.mit.edu	37	8	124807514	124807515	+	Intron	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124807514_124807515delTG	uc003yqv.2	+						FAM91A1_uc011lik.1_Intron|FAM91A1_uc011lil.1_Intron	NM_144963	NP_659400	Q658Y4	F91A1_HUMAN	hypothetical protein LOC157769											ovary(1)|central_nervous_system(1)	2	Lung NSC(37;8.76e-13)|Ovarian(258;0.00744)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00192)			Tgttttgatctgtgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	128631935	128631936	+	IGR	INS	-	A	A	rs146814288	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128631935_128631936insA								LOC727677 (137551 upstream) : MYC (115829 downstream)																							GGCAAACCCACAAAAAACCCTC	0.475													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130097498	130097498	+	IGR	DEL	A	-	-	rs36104757		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130097498delA								MIR1208 (935064 upstream) : GSDMC (662945 downstream)																							TGCATGTGGTAAAAAAAAAAA	0.303													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	130495395	130495395	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130495395delG								None (None upstream) : GSDMC (265048 downstream)																							gaggagggaagggggaagggg	0.070													4	2	---	---	---	---	
ASAP1	50807	broad.mit.edu	37	8	131392004	131392004	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131392004delC	uc003yta.1	-						ASAP1_uc011liw.1_Intron	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor						cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						CTGAGACACTCCCCGGGCCCT	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	131440685	131440686	+	IGR	INS	-	CATCAT	CATCAT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131440685_131440686insCATCAT								ASAP1 (26469 upstream) : ADCY8 (351862 downstream)																							atcatcaccaccaccaccatca	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	135255994	135255996	+	IGR	DEL	AGA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135255994_135255996delAGA								ST3GAL1 (671811 upstream) : ZFAT (234037 downstream)																							gagaaggaggagaaggagaagga	0.000													4	2	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139187625	139187625	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139187625delC	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			attctgtctacctaaacaata	0.000										HNSCC(54;0.14)			4	2	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139818397	139818398	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139818397_139818398delGT	uc003yvd.2	-							NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			gtgtgtgatggtgtgtgtgtgt	0.000										HNSCC(7;0.00092)			4	2	---	---	---	---	
PTP4A3	11156	broad.mit.edu	37	8	142418718	142418718	+	Intron	DEL	A	-	-	rs79235694		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142418718delA	uc010mes.2	+									O75365	TP4A3_HUMAN	Homo sapiens cDNA, FLJ18299.							early endosome|plasma membrane	identical protein binding|prenylated protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			actctgtctgaaaaaaaaaaa	0.104													4	2	---	---	---	---	
ARHGAP39	80728	broad.mit.edu	37	8	145913214	145913214	+	5'Flank	DEL	C	-	-	rs67768207		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145913214delC	uc011llk.1	-							NM_025251	NP_079527	Q9C0H5	RHG39_HUMAN	KIAA1688 protein						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|nucleus	GTPase activator activity				0						GCACTTCCCACCCCCGTGACC	0.597													4	2	---	---	---	---	
C8orf33	65265	broad.mit.edu	37	8	146281196	146281197	+	3'UTR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146281196_146281197delTC	uc003zfc.3	+	5					C8orf33_uc003zfd.2_RNA	NM_023080	NP_075568	Q9H7E9	CH033_HUMAN	hypothetical protein LOC65265												0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;9.1e-38)|all cancers(56;7.37e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.243)		ctctctctcttctctctctctc	0.000													4	2	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6594803	6594804	+	Intron	INS	-	AAAGAAAG	AAAGAAAG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6594803_6594804insAAAGAAAG	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	aaaaggaaataaaagaaagaaa	0.069													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	13373909	13373909	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:13373909delA								MPDZ (94346 upstream) : NFIB (707939 downstream)																							GGAAACCAAgaaacaggccct	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	14010699	14010714	+	IGR	DEL	TTCTTTTCTTTCTTTC	-	-	rs12337116	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14010699_14010714delTTCTTTTCTTTCTTTC								MPDZ (731136 upstream) : NFIB (71134 downstream)																							ccttccttctttcttttctttctttctttctttctt	0.000													4	2	---	---	---	---	
C9orf93	203238	broad.mit.edu	37	9	15954668	15954668	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15954668delT	uc003zmd.2	+						C9orf93_uc003zme.2_Intron|C9orf93_uc011lmu.1_Intron	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238												0				GBM - Glioblastoma multiforme(50;4.84e-07)		tgcttgttgattttttttttg	0.000													4	3	---	---	---	---	
MLLT3	4300	broad.mit.edu	37	9	20586396	20586397	+	Intron	INS	-	AA	AA			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20586396_20586397insAA	uc003zoe.2	-						MLLT3_uc011lne.1_Intron|MLLT3_uc011lnf.1_Intron|MLLT3_uc003zof.2_Intron|MLLT3_uc011lng.1_Intron	NM_004529	NP_004520	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		TCTGTGACTGGAAAGAAAAAAA	0.317			T	MLL	ALL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44791361	44791361	+	IGR	DEL	G	-	-	rs113829324		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44791361delG								None (None upstream) : FAM27C (198875 downstream)																							ggagtgcagtggcgtgatctc	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66797228	66797228	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66797228delA								LOC442421 (294201 upstream) : AQP7P1 (457039 downstream)																							atcttcacataaaaactacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66840357	66840358	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66840357_66840358insT								LOC442421 (337330 upstream) : AQP7P1 (413909 downstream)																							ttgaatctttcttttcatttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66842729	66842730	+	IGR	DEL	CA	-	-	rs150223912		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66842729_66842730delCA								LOC442421 (339702 upstream) : AQP7P1 (411537 downstream)																							gaattcatctcacagagttgaa	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68412339	68412339	+	RNA	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68412339delA	uc004aew.1	+	2		c.501delA			uc004aex.2_5'Flank					Homo sapiens cDNA, FLJ98602.																		ACCTTTACAGAGGGCAAAGAA	0.542													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68474143	68474143	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68474143delG								FAM27B (679954 upstream) : MIR1299 (528096 downstream)																							AGATTGTAGTGGGGGCCAAAG	0.398													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69056404	69056406	+	IGR	DEL	AAT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69056404_69056406delAAT								MIR1299 (54083 upstream) : PGM5P2 (23839 downstream)																							caaaaatacaaataattggatta	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69963569	69963569	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69963569delA								LOC100133920 (298620 upstream) : FOXD4L5 (212140 downstream)																							gtaagtggacatttgaagcgc	0.000													4	2	---	---	---	---	
C9orf135	138255	broad.mit.edu	37	9	72515788	72515788	+	Intron	DEL	T	-	-	rs138083455		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72515788delT	uc004ahl.2	+						C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Intron	NM_001010940	NP_001010940	Q5VTT2	CI135_HUMAN	hypothetical protein LOC138255							integral to membrane				ovary(1)	1						CTGCTATGTAtttttttttta	0.239													4	2	---	---	---	---	
TMC1	117531	broad.mit.edu	37	9	75190823	75190824	+	Intron	INS	-	CA	CA	rs148271593	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75190823_75190824insCA	uc004aiz.1	+						TMC1_uc010moz.1_5'Flank	NM_138691	NP_619636	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1						sensory perception of sound	integral to membrane				ovary(1)	1						GAAACTGGGCTcacacacacac	0.406													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	75945418	75945418	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:75945418delT								ANXA1 (160111 upstream) : None (None downstream)																							tttacttgaattttattcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	77029239	77029239	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77029239delT								None (None upstream) : RORB (83013 downstream)																							tttttctttctttttttttta	0.139													1	6	---	---	---	---	
SLC28A3	64078	broad.mit.edu	37	9	86938113	86938113	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86938113delT	uc010mpz.2	-						SLC28A3_uc011lsy.1_Intron|SLC28A3_uc004anu.1_Intron|SLC28A3_uc010mqb.2_Intron	NM_022127	NP_071410	Q9HAS3	S28A3_HUMAN	concentrative Na+-nucleoside cotransporter						nucleobase, nucleoside and nucleotide metabolic process	integral to membrane|plasma membrane	nucleoside binding			upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|skin(1)	4						AAATGGTTGATTAATAGCTGA	0.219													4	2	---	---	---	---	
SHC3	53358	broad.mit.edu	37	9	91674225	91674236	+	Intron	DEL	GTGGAGGACGTT	-	-	rs113970651		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91674225_91674236delGTGGAGGACGTT	uc004aqg.2	-							NM_016848	NP_058544	Q92529	SHC3_HUMAN	src homology 2 domain-containing transforming						central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4						gaggacggtggtggaggacgttgtggaggatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98141600	98141600	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98141600delT								FANCC (61609 upstream) : PTCH1 (63666 downstream)																							TTCCTGTGGCttttttttttg	0.030													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98978824	98978826	+	IGR	DEL	AAG	-	-	rs71948154		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98978824_98978826delAAG								NCRNA00092 (194787 upstream) : HSD17B3 (18763 downstream)																							CTCCAGGGAAAAGAAGAAGAGCA	0.527													6	3	---	---	---	---	
HSD17B3	3293	broad.mit.edu	37	9	99055944	99055945	+	Intron	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99055944_99055945delTG	uc004awa.1	-						HSD17B3_uc010msc.1_Intron	NM_000197	NP_000188	P37058	DHB3_HUMAN	estradiol 17 beta-dehydrogenase 3						androgen biosynthetic process|male genitalia development	endoplasmic reticulum membrane|microsome	binding|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity				0		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)			NADH(DB00157)	tgtgtgtgtatgtgtgtgtgtg	0.074													4	2	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101180029	101180030	+	Intron	INS	-	TA	TA	rs139059981	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101180029_101180030insTA	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	ttgtgtaagactattataaggt	0.000													2	5	---	---	---	---	
INVS	27130	broad.mit.edu	37	9	102986332	102986333	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102986332_102986333insA	uc004bap.1	+						INVS_uc010mta.1_Intron|INVS_uc011lve.1_Intron|INVS_uc004bao.1_Intron|INVS_uc004baq.1_Intron|INVS_uc004bar.1_Intron|INVS_uc010mtb.1_Intron	NM_014425	NP_055240	Q9Y283	INVS_HUMAN	inversin isoform a						negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|membrane|microtubule|nucleus|spindle	calmodulin binding			ovary(2)	2		Acute lymphoblastic leukemia(62;0.056)				aaaaacaaaacaaaaaaaaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	107324012	107324013	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107324012_107324013insA								OR13C3 (24918 upstream) : OR13C8 (7436 downstream)																							gacttcgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	113590717	113590718	+	IGR	INS	-	T	T	rs150659557	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113590717_113590718insT								MUSK (27439 upstream) : LPAR1 (45338 downstream)																							CAAAGTCCCCCTTTTTTTTTGC	0.460													4	2	---	---	---	---	
HSDL2	84263	broad.mit.edu	37	9	115217599	115217599	+	Intron	DEL	C	-	-	rs11313853		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115217599delC	uc004bga.1	+						HSDL2_uc011lwv.1_Intron|HSDL2_uc004bgb.1_Intron|HSDL2_uc004bgc.1_Intron|HSDL2_uc011lww.1_Intron	NM_032303	NP_115679	Q6YN16	HSDL2_HUMAN	hydroxysteroid dehydrogenase like 2							peroxisome	oxidoreductase activity|sterol binding				0						TATACACAAACCTTTTTTATT	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	115446248	115446249	+	IGR	INS	-	CATA	CATA	rs3033101		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115446248_115446249insCATA								KIAA1958 (23542 upstream) : C9orf80 (2544 downstream)																							TATTCCAGGGTCAAAGCACTGA	0.218													4	2	---	---	---	---	
C9orf27	58483	broad.mit.edu	37	9	118685557	118685557	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118685557delC	uc004bjm.2	-							NR_024032				Homo sapiens EST-YD1 mRNA, complete cds.												0						gagggcagagccctaaggact	0.000													4	2	---	---	---	---	
MAPKAP1	79109	broad.mit.edu	37	9	128275624	128275625	+	Intron	INS	-	AG	AG	rs145264769	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128275624_128275625insAG	uc004bpv.2	-						MAPKAP1_uc011lzt.1_Intron|MAPKAP1_uc010mwz.2_Intron|MAPKAP1_uc011lzu.1_Intron|MAPKAP1_uc011lzv.1_Intron|MAPKAP1_uc004bpw.2_Intron|MAPKAP1_uc004bpx.2_Intron|MAPKAP1_uc004bpy.2_Intron|MAPKAP1_uc004bpz.2_Intron|MAPKAP1_uc010mxa.2_Intron|MAPKAP1_uc010mxb.1_Intron	NM_001006617	NP_001006618	Q9BPZ7	SIN1_HUMAN	mitogen-activated protein kinase associated						nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|response to stress|T cell costimulation	cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	Ras GTPase binding			ovary(2)|lung(2)	4						GGAAAAATGACAGTCAAAAGCT	0.361													3	3	---	---	---	---	
RALGPS1	9649	broad.mit.edu	37	9	129942870	129942870	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:129942870delT	uc004bqo.1	+						RALGPS1_uc011mab.1_Intron|RALGPS1_uc011mac.1_Intron|RALGPS1_uc004bqq.3_Intron	NM_014636	NP_055451	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1						small GTPase mediated signal transduction	cytoplasm|plasma membrane	guanyl-nucleotide exchange factor activity			ovary(1)	1						GTCCAGCCCCTGGCATACACT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132235391	132235391	+	IGR	DEL	A	-	-	rs73633152	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132235391delA								C9orf106 (150509 upstream) : C9orf50 (139115 downstream)																							caaaacatttaaaaaAAAATA	0.010													4	2	---	---	---	---	
GPR107	57720	broad.mit.edu	37	9	132895680	132895680	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132895680delT	uc004bze.2	+						GPR107_uc004bzc.3_Intron|GPR107_uc011mbx.1_Intron|GPR107_uc004bzd.2_Intron|GPR107_uc004bzg.1_Intron	NM_001136557	NP_001130029	Q5VW38	GP107_HUMAN	G protein-coupled receptor 107 isoform 1							integral to membrane				upper_aerodigestive_tract(1)	1		Ovarian(14;0.000531)				GCAGTAACCATAGGACAGCTG	0.507													4	2	---	---	---	---	
NTNG2	84628	broad.mit.edu	37	9	135108720	135108721	+	Intron	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135108720_135108721delAC	uc004cbh.2	+							NM_032536	NP_115925	Q96CW9	NTNG2_HUMAN	netrin G2 precursor						axonogenesis	anchored to plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		acgcacatgtacacacacacac	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	136351532	136351532	+	IGR	DEL	C	-	-	rs35448055		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136351532delC								SLC2A6 (7256 upstream) : TMEM8C (28227 downstream)																							gctcacaataccccacttctg	0.259											OREG0019588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	3	---	---	---	---	
WDR5	11091	broad.mit.edu	37	9	137001763	137001763	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137001763delC	uc004cey.2	+							NM_017588	NP_060058	P61964	WDR5_HUMAN	WD repeat domain 5						histone H3 acetylation|histone H3-K4 methylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ada2/Gcn5/Ada3 transcription activator complex|MLL1 complex|Set1C/COMPASS complex	protein binding				0		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		CCGCCGCTCACCCCAACCCGA	0.711													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	137100861	137100861	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137100861delC								RNU6ATAC (71175 upstream) : RXRA (108083 downstream)																							attggaagctccactaaacca	0.075													4	2	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137573807	137573808	+	Intron	DEL	CT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137573807_137573808delCT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ctctccctccctctctctctct	0.233													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140564001	140564001	+	Intron	DEL	G	-	-	rs11289791		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140564001delG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AAGACGCCCCGCACAGCACgt	0.368													6	4	---	---	---	---	
ADARB2	105	broad.mit.edu	37	10	1275635	1275636	+	Intron	INS	-	AT	AT	rs75596623		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1275635_1275636insAT	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		tgtgtgtgcacatgtgcttatg	0.079													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8809942	8809943	+	IGR	INS	-	GT	GT	rs138835958	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8809942_8809943insGT								GATA3 (692780 upstream) : None (None downstream)																							tgtgtgtgtgcgtgtgtgtgtg	0.317													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8917047	8917047	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8917047delG								GATA3 (799885 upstream) : None (None downstream)																							TATGGCAAGTGAAAAAACTGG	0.313													4	2	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16954975	16954975	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16954975delT	uc001ioo.2	-							NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ctttctaaaataatccaagtg	0.000													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	21725966	21725966	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21725966delA								NEBL (262850 upstream) : C10orf114 (57456 downstream)																							ctccatctcgaaaaaaaaaaa	0.095													4	2	---	---	---	---	
SPAG6	9576	broad.mit.edu	37	10	22672567	22672567	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22672567delA	uc001iri.2	+						SPAG6_uc001irj.2_Intron|SPAG6_uc010qct.1_Intron|SPAG6_uc009xkh.2_Intron	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1						cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						actccatctcaaaaaaaaaga	0.060													4	2	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24480326	24480327	+	Intron	DEL	GA	-	-	rs147899185	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24480326_24480327delGA	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						catactatttgatagtacaata	0.144													4	2	---	---	---	---	
APBB1IP	54518	broad.mit.edu	37	10	26828336	26828337	+	Intron	INS	-	A	A	rs113271338		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26828336_26828337insA	uc001iss.2	+						APBB1IP_uc009xks.1_Intron	NM_019043	NP_061916	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding,						blood coagulation|signal transduction	cytoskeleton|cytosol|focal adhesion|lamellipodium				lung(4)|skin(2)|central_nervous_system(1)	7						atgagatcctgaaaaaaaaaaa	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	28713058	28713058	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:28713058delT								MPP7 (121063 upstream) : WAC (108369 downstream)																							tttgtggccctgtgtcttcag	0.020													4	2	---	---	---	---	
LOC387647	387647	broad.mit.edu	37	10	29719433	29719436	+	Intron	DEL	TCTC	-	-	rs71492595		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29719433_29719436delTCTC	uc001iuo.1	+						LOC387647_uc001iup.2_Intron|LOC387647_uc001iuq.1_Intron					Homo sapiens cDNA FLJ31518 fis, clone NT2RI2000064.												0						ttcctttctttctctctttctctt	0.098													2	5	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30399440	30399455	+	Intron	DEL	CTGATGTATGGACTCC	-	-	rs72082544		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30399440_30399455delCTGATGTATGGACTCC	uc001iuz.2	-									Q9P266	K1462_HUMAN	RecName: Full=Uncharacterized protein KIAA1462;											ovary(4)	4						TATGGACTAGCTGATGTATGGACTCCCTGATGTATA	0.500													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	33883146	33883146	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33883146delA								NRP1 (259140 upstream) : PARD3 (516952 downstream)																							GCAACTGAAGAAAAAAAAAAG	0.428													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	35923579	35923579	+	IGR	DEL	T	-	-	rs78754471		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:35923579delT								GJD4 (25716 upstream) : FZD8 (3598 downstream)																							TGCTCATCCCttttttttttt	0.254													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42667291	42667292	+	IGR	INS	-	TT	TT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42667291_42667292insTT								None (None upstream) : LOC441666 (160023 downstream)																							tgaatgaaatcagaatggaatt	0.000													7	4	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47047087	47047088	+	Intron	INS	-	A	A	rs142033998		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47047087_47047088insA	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						cattggttgttaaaactcagcc	0.000													3	3	---	---	---	---	
ARID5B	84159	broad.mit.edu	37	10	63661716	63661717	+	Intron	INS	-	G	G	rs147126849	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63661716_63661717insG	uc001jlt.1	+						ARID5B_uc010qil.1_Intron	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)						liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					GTAGAAGTGGCGGTGGGGGGCC	0.396													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	72759452	72759453	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72759452_72759453delTG								PCBD1 (110911 upstream) : UNC5B (212845 downstream)																							CTCTCGTGTCTGTGTGTGTGTG	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86380063	86380065	+	IGR	DEL	CTC	-	-	rs112703941		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86380063_86380065delCTC								FAM190B (101787 upstream) : GRID1 (979247 downstream)																							caaacctattctcctccaagtta	0.158													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	86939500	86939500	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:86939500delC								FAM190B (661224 upstream) : GRID1 (419812 downstream)																							ttctcattttcccttttccct	0.080													4	2	---	---	---	---	
FGF8	2253	broad.mit.edu	37	10	103530561	103530561	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103530561delT	uc001ktp.1	-						FGF8_uc001ktq.1_Intron|FGF8_uc001ktr.1_Intron|FGF8_uc001kts.1_Intron|FGF8_uc009xwr.1_Intron	NM_033164	NP_149354	P55075	FGF8_HUMAN	fibroblast growth factor 8 isoform E precursor						bone development|dopaminergic neuron differentiation|fibroblast growth factor receptor signaling pathway|gastrulation|gonad development|insulin receptor signaling pathway|mesonephros development|metanephros development|negative regulation of cardiac muscle tissue development|neuroepithelial cell differentiation|odontogenesis|positive regulation of cell division|positive regulation of cell proliferation	extracellular region|extracellular space	growth factor activity|growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		GGCAACTTCCTGTCCTCCCAG	0.672													4	2	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103739270	103739271	+	Intron	INS	-	ACT	ACT	rs146850223	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103739270_103739271insACT	uc009xwy.1	-						C10orf76_uc009xwx.1_Intron	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		acagaagagtaactactactgg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	115049321	115049322	+	IGR	INS	-	AAAC	AAAC	rs140703792	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115049321_115049322insAAAC								TCF7L2 (121887 upstream) : HABP2 (263456 downstream)																							actctgtcaaaaaacaaacaaa	0.139													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	125990246	125990246	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:125990246delC								CHST15 (137040 upstream) : OAT (95626 downstream)																							agtttgggctcccccagaagc	0.209													4	2	---	---	---	---	
FANK1	92565	broad.mit.edu	37	10	127586308	127586309	+	Intron	INS	-	T	T	rs33969384		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127586308_127586309insT	uc001ljh.3	+						DHX32_uc001ljg.1_5'Flank|FANK1_uc010quk.1_Intron|FANK1_uc009yan.2_Intron	NM_145235	NP_660278	Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains							cytoplasm|nucleus				ovary(1)	1		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				TGGATTCTACATTTTTTTAACC	0.342													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133116405	133116406	+	IGR	INS	-	GG	GG	rs146474168	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133116405_133116406insGG								TCERG1L (6421 upstream) : PPP2R2D (631554 downstream)																							GGGAGGTAGAAGGGAGAGGGAA	0.500													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	133285184	133285185	+	IGR	INS	-	TG	TG	rs144646437	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:133285184_133285185insTG								TCERG1L (175200 upstream) : PPP2R2D (462775 downstream)																							cattatgtgtatgtgtttatgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	135461246	135461247	+	IGR	INS	-	G	G	rs140694261		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135461246_135461247insG								FRG2B (20947 upstream) : LOC653544 (29032 downstream)																							atttattgcaaaaaaaaagaat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	268315	268315	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:268315delG								PSMD13 (15331 upstream) : NLRP6 (10255 downstream)																							CAGCAGCCCAGGGAGCCTTGC	0.697													4	2	---	---	---	---	
PPFIBP2	8495	broad.mit.edu	37	11	7583953	7583953	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7583953delT	uc001mfj.3	+							NM_003621	NP_003612	Q8ND30	LIPB2_HUMAN	PTPRF interacting protein, binding protein 2						cell communication|DNA integration	intracellular	DNA binding|integrase activity|protein binding			ovary(2)|breast(2)	4				Epithelial(150;2.01e-07)|BRCA - Breast invasive adenocarcinoma(625;0.236)		TCTTCTTCCCTTAGTTTTCTG	0.373													4	2	---	---	---	---	
IPO7	10527	broad.mit.edu	37	11	9422729	9422729	+	Intron	DEL	A	-	-	rs79023386		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9422729delA	uc001mho.2	+							NM_006391	NP_006382	O95373	IPO7_HUMAN	importin 7						interspecies interaction between organisms|signal transduction	Golgi apparatus|nuclear pore|soluble fraction	protein transporter activity|Ran GTPase binding|small GTPase regulator activity			lung(1)|breast(1)	2				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		attctgtctcaaaaaaaaaaa	0.109													4	2	---	---	---	---	
GALNTL4	374378	broad.mit.edu	37	11	11562815	11562815	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11562815delA	uc001mjo.2	-							NM_198516	NP_940918	Q6P9A2	GLTL4_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding				0				all cancers(16;3.67e-05)|Epithelial(150;0.000184)		CTTTAGACCCAAaatcatcca	0.239													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16052294	16052294	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16052294delA	uc001mme.2	-						SOX6_uc001mmd.2_Intron|SOX6_uc001mmf.2_Intron|SOX6_uc001mmg.2_Intron	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						GATTTGCTTGAAATAGACTTC	0.368													4	2	---	---	---	---	
SOX6	55553	broad.mit.edu	37	11	16640871	16640871	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16640871delT	uc001mmh.1	-									P35712	SOX6_HUMAN	Synthetic construct DNA, clone: pF1KB8405, Homo sapiens SOX6 gene for SRY (sex determining region Y)-box 6, without stop codon, in Flexi system.						muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						TGCTCTGTGCTTTTTTTTTTA	0.308													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	23179936	23179936	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:23179936delG								SVIP (328554 upstream) : None (None downstream)																							acttatatgtgggagctgcac	0.109													4	2	---	---	---	---	
KIF18A	81930	broad.mit.edu	37	11	28084739	28084739	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28084739delA	uc001msc.2	-							NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GCCTTGAAACAAATGCTACCT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	44347762	44347763	+	IGR	DEL	TG	-	-	rs112884773		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44347762_44347763delTG								ALX4 (16046 upstream) : CD82 (239378 downstream)																							CCTCTAAGACtgtgtgtgtgtg	0.460													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48854814	48854814	+	IGR	DEL	T	-	-	rs144760649	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48854814delT								OR4A47 (343542 upstream) : FOLH1 (313374 downstream)																							ggaaaaggaattatcttcaca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48862746	48862746	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48862746delT								OR4A47 (351474 upstream) : FOLH1 (305442 downstream)																							ttgtgatgtgtgcattcaact	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50715581	50715582	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50715581_50715582insA								LOC646813 (335778 upstream) : OR4A5 (695866 downstream)																							gtgtagtttttatgggaaggta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55016930	55016931	+	IGR	INS	-	C	C	rs113024394		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55016930_55016931insC								None (None upstream) : TRIM48 (12727 downstream)																							tatttccttttcaccataggcc	0.000													4	2	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63798357	63798358	+	Intron	INS	-	A	A	rs35687023		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63798357_63798358insA	uc001nyh.2	-							NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						tcctgtctcttaaaaaaaaaaa	0.267													4	2	---	---	---	---	
FLRT1	23769	broad.mit.edu	37	11	63879867	63879868	+	Intron	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63879867_63879868insC	uc001nyi.1	+						MACROD1_uc001nyh.2_Intron	NM_013280	NP_037412	Q9NZU1	FLRT1_HUMAN	fibronectin leucine rich transmembrane protein						cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity				0						acacctgtagtcccagctactc	0.000													3	3	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	70004952	70004958	+	Intron	DEL	TGGGGGC	-	-	rs112349570		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70004952_70004958delTGGGGGC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						ACCCCCTCGGTGGGGGCTGGGGGCTGG	0.671													4	5	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	70027884	70027885	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70027884_70027885insA	uc001opj.2	+						ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron|ANO1_uc010rql.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						ctctctctctgaaaaaaaaaaa	0.030													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	70305916	70305916	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70305916delG								CTTN (23227 upstream) : SHANK2 (8046 downstream)																							tgaccaacaaggtgaaacccc	0.000													4	2	---	---	---	---	
SHANK2	22941	broad.mit.edu	37	11	70504366	70504369	+	Intron	DEL	ACAG	-	-	rs1149505		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70504366_70504369delACAG	uc001oqc.2	-						SHANK2_uc010rqn.1_Intron|SHANK2_uc001opz.2_Intron|uc009ysn.1_Intron|SHANK2_uc010rqp.1_Intron	NM_012309	NP_036441	Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2						intracellular signal transduction	cell junction|cytoplasm|postsynaptic density|postsynaptic membrane	GKAP/Homer scaffold activity|ionotropic glutamate receptor binding|SH3 domain binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			acacacacacacagacacacacac	0.260													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	71087472	71087473	+	IGR	INS	-	AG	AG	rs76868924		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71087472_71087473insAG								SHANK2 (151664 upstream) : DHCR7 (57986 downstream)																							gctgctataacaataccacaga	0.000													4	4	---	---	---	---	
ARAP1	116985	broad.mit.edu	37	11	72436359	72436360	+	Intron	INS	-	TC	TC			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72436359_72436360insTC	uc001osu.2	-						ARAP1_uc001osv.2_Intron|ARAP1_uc001oss.2_5'Flank|ARAP1_uc009yth.2_5'Flank|ARAP1_uc010rre.1_5'Flank	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						ctctctctctctctctttttct	0.406											OREG0021202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	5	---	---	---	---	
RAB6A	5870	broad.mit.edu	37	11	73452576	73452576	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73452576delA	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron|RAB6A_uc001oug.2_Intron	NM_002869	NP_002860	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0						tctgcacaagaaaaaaaaaaa	0.005													4	2	---	---	---	---	
RAB6A	5870	broad.mit.edu	37	11	73469184	73469185	+	Intron	INS	-	CTA	CTA	rs146423872	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73469184_73469185insCTA	uc001oue.2	-						RAB6A_uc001ouf.2_Intron|RAB6A_uc009yts.2_Intron|RAB6A_uc001oug.2_Intron	NM_002869	NP_002860	P20340	RAB6A_HUMAN	RAB6A, member RAS oncogene family isoform a						minus-end-directed organelle transport along microtubule|peptidyl-cysteine methylation|protein targeting to Golgi|retrograde vesicle-mediated transport, Golgi to ER|small GTPase mediated signal transduction	cytoplasmic vesicle|cytosol|Golgi membrane|trans-Golgi network	GTP binding|GTPase activity|protein domain specific binding				0						TCTACAGACTTCTAACGCATAA	0.327													3	4	---	---	---	---	
MRPL48	51642	broad.mit.edu	37	11	73554267	73554267	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73554267delT	uc001ouh.3	+						MRPL48_uc009ytt.2_Intron|MRPL48_uc010rri.1_Intron|MRPL48_uc009ytu.2_Intron	NM_016055	NP_057139	Q96GC5	RM48_HUMAN	mitochondrial ribosomal protein L48 precursor						translation	mitochondrial ribosome	protein binding|structural constituent of ribosome				0						TTGTTTTAACttttttttttt	0.164													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	73649358	73649358	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73649358delA								PAAF1 (10579 upstream) : DNAJB13 (12006 downstream)																							caaattatttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
UCP2	7351	broad.mit.edu	37	11	73696305	73696306	+	5'Flank	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73696305_73696306insA	uc001oup.1	-						UCP2_uc001ouq.1_5'Flank	NM_003355	NP_003346	P55851	UCP2_HUMAN	uncoupling protein 2						proton transport|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding				0	Breast(11;0.000112)					gactctgtctcaaaaaaaaaaa	0.134													2	4	---	---	---	---	
C2CD3	26005	broad.mit.edu	37	11	73795753	73795753	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73795753delA	uc001ouu.2	-						C2CD3_uc001out.2_Intron	NM_015531	NP_056346	Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3							centrosome				ovary(4)|pancreas(2)|skin(1)	7	Breast(11;4.16e-06)					tctttaaactaaaAAAAAAAA	0.154													4	6	---	---	---	---	
P4HA3	283208	broad.mit.edu	37	11	74014630	74014631	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74014630_74014631insT	uc001ouz.2	-						P4HA3_uc001ouy.3_Intron|P4HA3_uc010rrj.1_Intron	NM_182904	NP_878907	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha III subunit							endoplasmic reticulum lumen	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 4-dioxygenase activity			skin(1)	1	Breast(11;2.31e-05)					AAAGTCAACACttttttttttt	0.025													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74209625	74209626	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74209625_74209626insA								LIPT2 (4870 upstream) : POLD3 (94003 downstream)																							tatttcaaactaaaaaaaaaaa	0.020													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74212922	74212924	+	IGR	DEL	ACG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74212922_74212924delACG								LIPT2 (8167 upstream) : POLD3 (90705 downstream)																							agactcatccacgacaacttcca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	74245376	74245377	+	IGR	INS	-	AA	AA	rs36135010		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74245376_74245377insAA								LIPT2 (40621 upstream) : POLD3 (58252 downstream)																							aagtctgtctcaaaaaaaaaaa	0.198													6	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	77295248	77295248	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77295248delT								PAK1 (110140 upstream) : AQP11 (5188 downstream)																							agaattctaatttttttttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	81955348	81955351	+	Intron	DEL	TGTT	-	-	rs623422	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81955348_81955351delTGTT	uc001ozo.1	-											Homo sapiens cDNA clone IMAGE:5298883.																		TGTGTGTGTGTGTTTGTGTTTATG	0.137													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	85205118	85205119	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85205118_85205119insT	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				atcttgaccccttatataagga	0.000													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	85290738	85290739	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85290738_85290739insT	uc001pak.2	-							NM_001142699	NP_001136171	Q15700	DLG2_HUMAN	chapsyn-110 isoform 1							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				ggacaaacaacttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90520696	90520696	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90520696delT								CHORDC1 (564164 upstream) : MIR1261 (81593 downstream)																							aagtgaaaacttttaagttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	91425807	91425808	+	IGR	DEL	AC	-	-	rs35562566		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:91425807_91425808delAC								MIR1261 (823437 upstream) : FAT3 (659454 downstream)																							TTTACcacagacacacacacac	0.307													2	5	---	---	---	---	
KIAA1377	57562	broad.mit.edu	37	11	101820244	101820245	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101820244_101820245delGT	uc001pgm.2	+						KIAA1377_uc001pgn.2_Intron|KIAA1377_uc009yxa.1_Intron	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562								protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		GTGAtgagcagtgaagaacagc	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	104470321	104470322	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104470321_104470322insA								PDGFD (435294 upstream) : CASP12 (286120 downstream)																							cctgtctctagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ELMOD1	55531	broad.mit.edu	37	11	107518030	107518030	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107518030delT	uc010rvs.1	+						ELMOD1_uc001pjm.2_Intron|ELMOD1_uc010rvt.1_Intron	NM_018712	NP_061182	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1 isoform 1						phagocytosis	cytoskeleton	GTPase activator activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		TGATCACATCTTTTTTTTTTC	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	123367179	123367179	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123367179delA								ASAM (301172 upstream) : GRAMD1B (29349 downstream)																							ggtgctctataaccttcttgt	0.000													4	2	---	---	---	---	
TMEM45B	120224	broad.mit.edu	37	11	129683162	129683162	+	5'Flank	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129683162delA	uc001qfe.1	+							NM_138788	NP_620143	Q96B21	TM45B_HUMAN	transmembrane protein 45B							integral to membrane					0	all_hematologic(175;0.0537)	Breast(109;0.00526)|Lung NSC(97;0.00901)|all_lung(97;0.018)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.012)|Lung(977;0.179)|LUSC - Lung squamous cell carcinoma(976;0.189)		aataaaaagtaaaaaaaaaaa	0.144													4	2	---	---	---	---	
ADIPOR2	79602	broad.mit.edu	37	12	1807373	1807374	+	Intron	DEL	TG	-	-	rs151217431		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1807373_1807374delTG	uc001qjm.2	+						ADIPOR2_uc001qjn.2_Intron	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			CTTGGCTGATtgtgtgtgtgtg	0.257													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5028033	5028034	+	IGR	INS	-	T	T	rs112806155		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5028033_5028034insT								KCNA1 (613 upstream) : KCNA5 (125051 downstream)																							CTTTCTTTCTGTTTTTTTTTTT	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5184181	5184181	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5184181delA								KCNA5 (28233 upstream) : NTF3 (357099 downstream)																							AATAGTGGGGAAAAAGGTTCA	0.463													4	2	---	---	---	---	
PLEKHG6	55200	broad.mit.edu	37	12	6432244	6432244	+	Intron	DEL	T	-	-	rs11331384		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6432244delT	uc001qnr.2	+						PLEKHG6_uc010sew.1_Intron|PLEKHG6_uc010sex.1_Intron	NM_018173	NP_060643	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain-containing family G						regulation of Rho protein signal transduction	cleavage furrow|cytoplasm|spindle pole	GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|skin(1)	2						CTTTCTCCTCTTTTTTTTGGT	0.478													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6727232	6727233	+	IGR	INS	-	CACA	CACA	rs142096781	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6727232_6727233insCACA								CHD4 (10681 upstream) : LPAR5 (768 downstream)																							acacattctctcacacacacaG	0.267											OREG0021631	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	7423343	7423344	+	IGR	INS	-	A	A	rs143448209	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7423343_7423344insA								PEX5 (52176 upstream) : ACSM4 (33584 downstream)																							aacaaacaaacaaaaaaaaGAA	0.119													2	6	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	12218470	12218470	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12218470delA	uc001raa.1	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				actccatctcaaaaaaaaaaa	0.000			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								3	3	---	---	---	---	
LRP6	4040	broad.mit.edu	37	12	12387221	12387222	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:12387221_12387222insA	uc001rah.3	-						LRP6_uc010shl.1_Intron	NM_002336	NP_002327	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein						cellular response to cholesterol|negative regulation of protein phosphorylation|negative regulation of protein serine/threonine kinase activity|negative regulation of smooth muscle cell apoptosis|neural crest formation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell cycle|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway involved in dorsal/ventral axis specification|Wnt receptor signaling pathway involved in dorsal/ventral axis specification	cell surface|cytoplasmic vesicle|endoplasmic reticulum|integral to membrane|plasma membrane	coreceptor activity|frizzled binding|kinase inhibitor activity|low-density lipoprotein receptor activity|protein homodimerization activity|toxin transporter activity|Wnt-protein binding			lung(4)|skin(4)|ovary(2)|kidney(1)|central_nervous_system(1)	12		Prostate(47;0.0865)				aactccatctcaaaaaaaaaaa	0.000													5	4	---	---	---	---	
DERA	51071	broad.mit.edu	37	12	16132284	16132284	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:16132284delC	uc001rde.2	+						DERA_uc010shx.1_Intron	NM_015954	NP_057038	Q9Y315	DEOC_HUMAN	deoxyribose-phosphate aldolase-like						deoxyribonucleoside catabolic process|deoxyribonucleotide catabolic process	cytoplasm	deoxyribose-phosphate aldolase activity|protein binding				0		Hepatocellular(102;0.121)				TGGTGGCTGGCCCCTGGGACA	0.502											OREG0021702	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17780940	17780940	+	IGR	DEL	C	-	-	rs138671372		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17780940delC								None (None upstream) : RERGL (452864 downstream)																							tctacccattctcagatctcc	0.000													4	2	---	---	---	---	
PLEKHA5	54477	broad.mit.edu	37	12	19308331	19308334	+	Intron	DEL	TCTA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19308331_19308334delTCTA	uc001reb.2	+						PLEKHA5_uc010sie.1_Intron|PLEKHA5_uc001rea.2_Intron|PLEKHA5_uc009zin.2_Intron|PLEKHA5_uc001rdz.3_Intron	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A								1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GCTAGATTTTTCTATTAAGTCCCG	0.368													4	2	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	23940886	23940887	+	Intron	DEL	CA	-	-	rs66482260		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23940886_23940887delCA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						AGGATCTGAGCAAAGAGTCTTA	0.337													0	6	---	---	---	---	
SOX5	6660	broad.mit.edu	37	12	24060681	24060681	+	Intron	DEL	A	-	-	rs34922628		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:24060681delA	uc001rfw.2	-						SOX5_uc001rfx.2_Intron|SOX5_uc001rfy.2_Intron|SOX5_uc010siv.1_Intron|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Intron|SOX5_uc001rga.2_Intron	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a						transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						GTGCATAAGCAAAAAAAAAAA	0.323													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	37877826	37877826	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:37877826delC								None (None upstream) : ALG10B (832731 downstream)																							atagcatttacctttcctttt	0.010													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38087836	38087836	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38087836delA								None (None upstream) : ALG10B (622721 downstream)																							tgaagatattaccttttccac	0.000													4	4	---	---	---	---	
PPHLN1	51535	broad.mit.edu	37	12	42671823	42671824	+	Intron	INS	-	A	A	rs146256723	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42671823_42671824insA	uc001rmy.2	+							NM_201439	NP_958847	Q8NEY8	PPHLN_HUMAN	periphilin 1 isoform 3						keratinization	cytoplasm|nucleus				ovary(1)|breast(1)	2	all_cancers(12;0.00049)|Breast(8;0.165)	Lung NSC(34;0.123)		GBM - Glioblastoma multiforme(48;0.0875)		aagaccctgtcaaaaaaagaga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	43727953	43727953	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43727953delA								PRICKLE1 (744381 upstream) : ADAMTS20 (20060 downstream)																							taaataagataacacatgtag	0.085													4	2	---	---	---	---	
ADAMTS20	80070	broad.mit.edu	37	12	43931020	43931020	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43931020delT	uc010skx.1	-							NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with							proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		attttgaaggttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	54045698	54045699	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54045698_54045699insT								ATF7 (25499 upstream) : ATP5G2 (13246 downstream)																							TATTCTTTTTCTTTTTTTTTtc	0.020													4	2	---	---	---	---	
HOXC13	3229	broad.mit.edu	37	12	54334576	54334577	+	Intron	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54334576_54334577insC	uc001sei.2	+						HOXC13_uc010sop.1_Intron	NM_017410	NP_059106	P31276	HXC13_HUMAN	homeobox C13							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						GGGGCCCAGGGCAGCCACAGAT	0.574			T	NUP98	AML								4	2	---	---	---	---	
PAN2	9924	broad.mit.edu	37	12	56726385	56726386	+	Intron	DEL	AA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56726385_56726386delAA	uc001skx.2	-						PAN2_uc001skz.2_Intron|PAN2_uc001sky.2_Intron	NM_001127460	NP_001120932	Q504Q3	PAN2_HUMAN	PAN2 polyA specific ribonuclease subunit homolog						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|ubiquitin-dependent protein catabolic process	cytosol|nucleus	nucleic acid binding|poly(A)-specific ribonuclease activity|ubiquitin thiolesterase activity			ovary(2)|skin(2)|large_intestine(1)|breast(1)	6						ccctgtctcgaaaaaaaaaaaa	0.193													4	3	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56825139	56825139	+	Intron	DEL	A	-	-	rs67117398		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56825139delA	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						attctgtctcaaaaaaaaaaa	0.174													6	3	---	---	---	---	
PPM1H	57460	broad.mit.edu	37	12	63090599	63090600	+	Intron	INS	-	G	G	rs57507559		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63090599_63090600insG	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		cagaccaaaaaggtggagtggc	0.134													4	2	---	---	---	---	
PPM1H	57460	broad.mit.edu	37	12	63253518	63253518	+	Intron	DEL	C	-	-	rs150592585		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63253518delC	uc001srk.3	-							NM_020700	NP_065751	Q9ULR3	PPM1H_HUMAN	protein phosphatase 1H (PP2C domain containing)								phosphoprotein phosphatase activity			lung(3)|ovary(1)	4			GBM - Glioblastoma multiforme(1;0.000443)|BRCA - Breast invasive adenocarcinoma(9;0.209)	GBM - Glioblastoma multiforme(28;0.0126)		CCAGTGCTTGCCACCAGGCCC	0.473													1	5	---	---	---	---	
SRGAP1	57522	broad.mit.edu	37	12	64240514	64240516	+	Intron	DEL	TCC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64240514_64240516delTCC	uc010ssp.1	+						SRGAP1_uc001srt.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		CTGCCCTGAGTCCAGGCTTTACC	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70369671	70369672	+	IGR	INS	-	CACA	CACA	rs137876678	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70369671_70369672insCACA								RAB3IP (152689 upstream) : CNOT2 (267105 downstream)																							GGGAATCAAAGcacacacacac	0.347													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	70900390	70900392	+	Intron	DEL	AAG	-	-	rs78625576		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70900390_70900392delAAG	uc001svz.2	+											Homo sapiens cDNA clone IMAGE:4823238.																		ggagaagaaaaagaagaagaaca	0.010													4	2	---	---	---	---	
PTPRR	5801	broad.mit.edu	37	12	71052501	71052502	+	Intron	INS	-	T	T	rs80074826		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71052501_71052502insT	uc001swi.1	-						PTPRR_uc001swf.1_Intron|PTPRR_uc001swg.1_Intron|PTPRR_uc001swh.1_Intron|PTPRR_uc009zrs.2_Intron|PTPRR_uc010stq.1_Intron	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R						in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		GAAATACATCCTTTTTTTTTTT	0.188													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	73525865	73525866	+	IGR	INS	-	ACAT	ACAT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:73525865_73525866insACAT								TRHDE (466444 upstream) : None (None downstream)																							cacacacacacacacacacaca	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74711593	74711596	+	IGR	DEL	CCTC	-	-	rs7978816		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74711593_74711596delCCTC								None (None upstream) : ATXN7L3B (219955 downstream)																							ttccttccttcctccctccctccc	0.127													4	2	---	---	---	---	
NAP1L1	4673	broad.mit.edu	37	12	76451975	76451988	+	Intron	DEL	ATATATATATATAT	-	-	rs149913180		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76451975_76451988delATATATATATATAT	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				AGAGGCCtacatatatatatatatatatatatat	0.341													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	85056764	85056765	+	IGR	INS	-	T	T	rs74309678	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85056764_85056765insT								None (None upstream) : SLC6A15 (196504 downstream)																							gtcttaaggaaaagtaggaaga	0.000													3	3	---	---	---	---	
MGAT4C	25834	broad.mit.edu	37	12	86554019	86554020	+	Intron	INS	-	T	T	rs140974907	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86554019_86554020insT	uc001tai.3	-						MGAT4C_uc001tal.3_Intron|MGAT4C_uc001taj.3_Intron|MGAT4C_uc001tak.3_Intron|MGAT4C_uc010sum.1_Intron|MGAT4C_uc001tah.3_Intron	NM_013244	NP_037376	Q9UBM8	MGT4C_HUMAN	alpha-1,3-mannosyl-glycoprotein						post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(3)	3						tttttcccctgttttcatatat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	91468922	91468923	+	IGR	DEL	GA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91468922_91468923delGA								KERA (16791 upstream) : LUM (28310 downstream)																							AGAGAGAGAGGAGAGAGagggc	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93006704	93006706	+	IGR	DEL	TGA	-	-	rs140223958		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93006704_93006706delTGA								CLLU1 (129248 upstream) : C12orf74 (90134 downstream)																							TGTGTGCTGCTGATGTCATGTCA	0.276													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	93978545	93978546	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93978545_93978546insT								SOCS2 (8567 upstream) : CRADD (92605 downstream)																							ttcttcccttcttttttttttg	0.173													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	95277247	95277248	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95277247_95277248insA								MIR492 (48958 upstream) : NDUFA12 (87864 downstream)																							actctatctccaaaaaaaaaaa	0.010													4	2	---	---	---	---	
APAF1	317	broad.mit.edu	37	12	99128883	99128883	+	3'UTR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99128883delA	uc001tfz.2	+	27					APAF1_uc001tfy.2_3'UTR|APAF1_uc001tga.2_3'UTR|APAF1_uc001tgb.2_3'UTR|APAF1_uc001tgc.2_3'UTR|APAF1_uc009zto.2_3'UTR	NM_181861	NP_863651	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1 isoform						activation of caspase activity by cytochrome c|defense response|induction of apoptosis by intracellular signals|nervous system development	cytosol|Golgi apparatus|nucleus	ATP binding|caspase activator activity|protein binding			ovary(2)|lung(1)	3					Adenosine triphosphate(DB00171)	GAAGAAAGACAAGGTAACATG	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	102322607	102322610	+	IGR	DEL	AGAG	-	-	rs35233174		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102322607_102322610delAGAG								DRAM1 (5208 upstream) : CCDC53 (84108 downstream)																							TTCAGTAGTCagagagagagagag	0.363													4	2	---	---	---	---	
ACACB	32	broad.mit.edu	37	12	109597895	109597895	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109597895delA	uc001tob.2	+						ACACB_uc001toc.2_Intron	NM_001093	NP_001084	O00763	ACACB_HUMAN	acetyl-Coenzyme A carboxylase beta						acetyl-CoA metabolic process|carnitine shuttle|energy reserve metabolic process|fatty acid biosynthetic process|positive regulation of cellular metabolic process|protein homotetramerization|regulation of fatty acid oxidation	cytosol|endomembrane system|Golgi apparatus|membrane	acetyl-CoA carboxylase activity|ATP binding|biotin carboxylase activity|metal ion binding|protein binding			ovary(5)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	8					Biotin(DB00121)	actctgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
NAA25	80018	broad.mit.edu	37	12	112473139	112473139	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112473139delT	uc001ttm.2	-						NAA25_uc001ttn.3_Intron	NM_024953	NP_079229	Q14CX7	NAA25_HUMAN	mitochondrial distribution and morphology 20							cytoplasm	protein binding			ovary(1)|breast(1)|pancreas(1)	3						TTTGCCCTCCTtttttttttc	0.204													5	3	---	---	---	---	
TMEM233	387890	broad.mit.edu	37	12	120064289	120064290	+	Intron	INS	-	AAG	AAG	rs117389918		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120064289_120064290insAAG	uc010szd.1	+							NM_001136534	NP_001130006	B4DJY2	TM233_HUMAN	hypothetical protein LOC387890						response to biotic stimulus	integral to membrane					0						aaaaaaaaaaaaagaagaaaaa	0.000													4	2	---	---	---	---	
SPPL3	121665	broad.mit.edu	37	12	121203904	121203907	+	Intron	DEL	CACA	-	-	rs71732442		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121203904_121203907delCACA	uc001tzd.2	-						SPPL3_uc009zwz.2_Intron|SPPL3_uc001tzc.2_Intron	NM_139015	NP_620584	Q8TCT6	PSL4_HUMAN	signal peptide peptidase 3							integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGCGCGCGCGcacacacacacaca	0.446													6	3	---	---	---	---	
PITPNM2	57605	broad.mit.edu	37	12	123618368	123618369	+	Intron	INS	-	AT	AT	rs150653921	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123618368_123618369insAT	uc001uek.1	-							NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,						metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		cacagacacacacacGCTCCTC	0.243													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	124719601	124719603	+	IGR	DEL	CAT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124719601_124719603delCAT								ZNF664 (219634 upstream) : FAM101A (54107 downstream)																							ccatcatcaccatcaccatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	131939341	131939342	+	IGR	INS	-	AGAG	AGAG	rs148733327		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131939341_131939342insAGAG								LOC116437 (241866 upstream) : SFRS8 (256293 downstream)																							CAAAATCACACAGAGTTGCAAG	0.594													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132642172	132642175	+	IGR	DEL	ACAC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132642172_132642175delACAC								NOC4L (5186 upstream) : GALNT9 (38743 downstream)																							cacacacactacacacacacacca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	133416543	133416544	+	IGR	INS	-	C	C	rs149468729	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133416543_133416544insC								GOLGA3 (11093 upstream) : CHFR (394 downstream)																							ACTCGGGACCTCCCTGCTCAGC	0.649													2	5	---	---	---	---	
LATS2	26524	broad.mit.edu	37	13	21636943	21636944	+	5'Flank	INS	-	CTT	CTT	rs148067635	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21636943_21636944insCTT	uc009zzs.2	-						LATS2_uc001unr.3_5'Flank	NM_014572	NP_055387	Q9NRM7	LATS2_HUMAN	LATS, large tumor suppressor, homolog 2						cell division|G1/S transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|intracellular protein kinase cascade|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity	microtubule organizing center|nucleus|spindle pole	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|central_nervous_system(3)|ovary(2)|breast(1)|pancreas(1)	10		all_cancers(29;4.74e-22)|all_epithelial(30;1.45e-18)|all_lung(29;4.69e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000781)|Epithelial(112;0.00144)|OV - Ovarian serous cystadenocarcinoma(117;0.0183)|Lung(94;0.0375)|LUSC - Lung squamous cell carcinoma(192;0.104)		CTCCTCCCCTCCCTCTCTTTCA	0.441													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	35106870	35106870	+	IGR	DEL	A	-	-	rs11318620		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35106870delA								RFC3 (566176 upstream) : NBEA (409586 downstream)																							AGATTCCATTAAAAAAAAAAA	0.308													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	35296427	35296441	+	IGR	DEL	CTATATAATACAAAG	-	-	rs6144997		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35296427_35296441delCTATATAATACAAAG								RFC3 (755733 upstream) : NBEA (220015 downstream)																							AGGTTACACTCTATATAATACAAAGCAGTTTTGTC	0.363													3	3	---	---	---	---	
LHFP	10186	broad.mit.edu	37	13	40098481	40098482	+	Intron	INS	-	A	A	rs79615385		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40098481_40098482insA	uc001uxf.2	-							NM_005780	NP_005771	Q9Y693	LHFP_HUMAN	lipoma HMGIC fusion partner precursor							integral to membrane	DNA binding		HMGA2/LHFP(2)	soft_tissue(2)|lung(1)|breast(1)	4		Lung NSC(96;3.55e-06)|Breast(139;0.00408)|Ovarian(182;0.0107)|Prostate(109;0.0118)|Lung SC(185;0.0719)|Hepatocellular(188;0.114)		OV - Ovarian serous cystadenocarcinoma(117;6.48e-46)|Epithelial(112;8.43e-42)|all cancers(112;1.42e-36)|GBM - Glioblastoma multiforme(144;0.00187)|BRCA - Breast invasive adenocarcinoma(63;0.00886)|KIRC - Kidney renal clear cell carcinoma(186;0.048)|Kidney(163;0.0601)|LUSC - Lung squamous cell carcinoma(192;0.105)		GTAAGGCCTAGAAAAAAAAAAA	0.371			T	HMGA2	lipoma								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	42124731	42124736	+	IGR	DEL	GGAAGA	-	-	rs66801905		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42124731_42124736delGGAAGA								C13orf15 (79718 upstream) : KIAA0564 (16226 downstream)																							CCCAGGAGAGGGAAGAGGATGAAAGG	0.568													4	2	---	---	---	---	
SLC25A30	253512	broad.mit.edu	37	13	45976793	45976796	+	Intron	DEL	TCTT	-	-	rs34566641		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45976793_45976796delTCTT	uc001vag.2	-						SLC25A30_uc010tfs.1_Intron|SLC25A30_uc001vah.2_Intron|SLC25A30_uc010tft.1_Intron|SLC25A30_uc001vaf.2_Intron	NM_001010875	NP_001010875	Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30						mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding			breast(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		GTGAAAAAAGTCTTTCTAGGATAG	0.353													3	3	---	---	---	---	
C13orf18	80183	broad.mit.edu	37	13	46980909	46980910	+	Intron	INS	-	A	A	rs145248103	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46980909_46980910insA	uc001vbi.3	-							NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		gactccgtctcaaaaaaaaaac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55969185	55969185	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55969185delG								None (None upstream) : None (None downstream)																							CAGTAGACATGGTGAAATTAC	0.323													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	69835393	69835394	+	IGR	INS	-	GT	GT	rs79725639		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:69835393_69835394insGT								None (None upstream) : KLHL1 (439332 downstream)																							tgtgtgtgtgcgtgtgtgtgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88256361	88256362	+	Intron	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88256361_88256362delAC	uc001vlm.1	-											Homo sapiens clone IMAGE:32106, mRNA sequence.																		acacacagggacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	88477792	88477792	+	IGR	DEL	A	-	-	rs67614196		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88477792delA								SLITRK5 (145924 upstream) : None (None downstream)																							accccatctgaaaaaaaaaaa	0.174													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	91542652	91542652	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:91542652delG								MIR622 (659121 upstream) : LOC144776 (556 downstream)																							TTAGTGTAGTGGAAAGACTAA	0.428													4	2	---	---	---	---	
GPC5	2262	broad.mit.edu	37	13	92241444	92241444	+	Intron	DEL	T	-	-	rs75945545		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92241444delT	uc010tif.1	+							NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTTCAAACTGTTTTTTTATGA	0.343													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	94991322	94991323	+	Intron	INS	-	T	T	rs75346224		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:94991322_94991323insT	uc001vlt.2	+							NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGGAGttttccttttttttttt	0.203													4	2	---	---	---	---	
GPC6	10082	broad.mit.edu	37	13	95050492	95050492	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95050492delA	uc001vlt.2	+							NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor							anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AGTGCCATTTAAAAAAAAAAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	97870994	97870994	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97870994delA								OXGR1 (224390 upstream) : MBNL2 (3580 downstream)																							aggaaagaagaaggaggagga	0.234													4	2	---	---	---	---	
MBNL2	10150	broad.mit.edu	37	13	98033370	98033371	+	Intron	DEL	AC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:98033370_98033371delAC	uc010aft.2	+						MBNL2_uc001vmz.2_Intron|MBNL2_uc001vna.2_Intron|MBNL2_uc001vnb.2_Intron|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1						mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			cctctctctGacacacacacac	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	103614534	103614534	+	IGR	DEL	A	-	-	rs5806332		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103614534delA								LOC121952 (66151 upstream) : SLC10A2 (81816 downstream)																							CCTTTTATTGAAAAAAAAAAA	0.333													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	112851450	112851451	+	IGR	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:112851450_112851451insC								SOX1 (125430 upstream) : C13orf28 (179218 downstream)																							gttccctggttccctggttccc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19035224	19035225	+	IGR	INS	-	T	T	rs142975778		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19035224_19035225insT								None (None upstream) : OR11H12 (342369 downstream)																							agcgttccaaatattcacttgc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19106624	19106624	+	IGR	DEL	C	-	-	rs78800147		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19106624delC								None (None upstream) : OR11H12 (270970 downstream)																							aaaaaaaaaacagcactgtga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19492018	19492019	+	IGR	INS	-	GT	GT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19492018_19492019insGT								OR11H12 (113446 upstream) : POTEG (61346 downstream)																							CAATAAACtgcgtgtgtgtgtg	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	19818287	19818287	+	IGR	DEL	C	-	-	rs111887361		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19818287delC								POTEG (233345 upstream) : P704P (165667 downstream)																							gcatgagacacgcaccaccac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	35437143	35437143	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35437143delT								C14orf19 (27441 upstream) : SRP54 (14961 downstream)																							CTTAAGGAGAttttttttttt	0.189													4	2	---	---	---	---	
KIAA0391	9692	broad.mit.edu	37	14	35700144	35700145	+	Intron	INS	-	AC	AC	rs71444202		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35700144_35700145insAC	uc001wsy.1	+						KIAA0391_uc010tps.1_Intron|KIAA0391_uc001wsz.1_Intron|KIAA0391_uc001wta.2_Intron|KIAA0391_uc001wtb.1_Intron|KIAA0391_uc001wtc.1_Intron	NM_014672	NP_055487	O15091	MRRP3_HUMAN	mitochondrial RNase P protein 3 precursor						tRNA processing	mitochondrion					0	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		AGGAAAAGAGAacacacacaca	0.337													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	37108556	37108559	+	IGR	DEL	CAGT	-	-	rs143917011		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37108556_37108559delCAGT								NKX2-8 (56770 upstream) : PAX9 (18223 downstream)																							AGACATAGCACAGTCATTTTTCAG	0.426													3	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	37115016	37115019	+	IGR	DEL	GAAG	-	-	rs111320345		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:37115016_37115019delGAAG								NKX2-8 (63230 upstream) : PAX9 (11763 downstream)																							GAAGCTACAAGAAGGAAGGAAGAC	0.466													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38030813	38030814	+	IGR	INS	-	GT	GT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38030813_38030814insGT								MIPOL1 (13948 upstream) : FOXA1 (28379 downstream)																							TTTTGGTTTGGgtgtgtgtgtg	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	38157794	38157795	+	Intron	DEL	GA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:38157794_38157795delGA	uc001wug.2	+											Homo sapiens chromosome 14 open reading frame 25, mRNA (cDNA clone IMAGE:5268731), partial cds.																		tggctcaggggagagagagaga	0.000													9	4	---	---	---	---	
FBXO33	254170	broad.mit.edu	37	14	39874333	39874333	+	Intron	DEL	A	-	-	rs112467446		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:39874333delA	uc001wvk.2	-							NM_203301	NP_976046	Q7Z6M2	FBX33_HUMAN	F-box protein 33												0	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		attctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	40971049	40971049	+	IGR	DEL	A	-	-	rs144527960		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:40971049delA								None (None upstream) : None (None downstream)																							gtaaaaacctaaaaaagattc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	41403968	41403969	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:41403968_41403969insT								None (None upstream) : LRFN5 (672795 downstream)																							acatgatcttgtttttttttaa	0.000													4	2	---	---	---	---	
GPHB5	122876	broad.mit.edu	37	14	63781915	63781915	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63781915delC	uc010apu.2	-						GPHB5_uc001xgc.2_Intron	NM_145171	NP_660154	Q86YW7	GPHB5_HUMAN	glycoprotein beta 5							extracellular region	hormone activity			breast(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00372)|all cancers(60;0.0226)|BRCA - Breast invasive adenocarcinoma(234;0.0978)		caggtgttagccaccacgccc	0.184													4	2	---	---	---	---	
HSPA2	3306	broad.mit.edu	37	14	65009534	65009535	+	3'UTR	INS	-	T	T	rs148978517	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65009534_65009535insT	uc001xhj.2	+	2					HSPA2_uc001xhk.3_3'UTR	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2						response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CTCTCTCTCTCTTTTTTTTTGT	0.411													3	4	---	---	---	---	
MAP3K9	4293	broad.mit.edu	37	14	71226771	71226771	+	Intron	DEL	C	-	-	rs140277296		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:71226771delC	uc001xmm.2	-						MAP3K9_uc010ttk.1_Intron|MAP3K9_uc001xmk.2_Intron|MAP3K9_uc001xml.2_Intron	NM_033141	NP_149132	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|protein autophosphorylation		ATP binding|JUN kinase kinase kinase activity|MAP kinase kinase activity|protein homodimerization activity			stomach(2)|lung(1)|central_nervous_system(1)|skin(1)	5				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		ctgtatccagccaacttatac	0.015													4	2	---	---	---	---	
RGS6	9628	broad.mit.edu	37	14	72463794	72463795	+	Intron	INS	-	TGA	TGA	rs138970451	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:72463794_72463795insTGA	uc001xna.3	+						RGS6_uc010ttn.1_Intron|RGS6_uc001xmx.3_Intron|RGS6_uc010tto.1_Intron|RGS6_uc001xmy.3_Intron	NM_004296	NP_004287	P49758	RGS6_HUMAN	regulator of G-protein signalling 6						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			upper_aerodigestive_tract(1)|lung(1)|skin(1)	3				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		tgcagcaatcttgagagatggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87796854	87796857	+	IGR	DEL	AAAG	-	-	rs11469791		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87796854_87796857delAAAG								None (None upstream) : GALC (507307 downstream)																							CCAAAGTAATAAAGAAAGAAGCAA	0.265													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	87849557	87849562	+	IGR	DEL	TTGTTG	-	-	rs141326535		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:87849557_87849562delTTGTTG								None (None upstream) : GALC (454602 downstream)																							ATTTttgttattgttgttgttgttgt	0.267													4	2	---	---	---	---	
FOXN3	1112	broad.mit.edu	37	14	89962714	89962715	+	Intron	INS	-	GCT	GCT	rs149305916	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89962714_89962715insGCT	uc001xxo.3	-						FOXN3_uc010atk.2_Intron|FOXN3_uc001xxp.2_Intron	NM_001085471	NP_001078940	O00409	FOXN3_HUMAN	checkpoint suppressor 1 isoform 1						DNA damage checkpoint|embryo development|G2 phase of mitotic cell cycle|negative regulation of transcription, DNA-dependent|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein C-terminus binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(2)|ovary(1)	3						CAAGGCTTTAGGAGTGCAGCAA	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	91004180	91004180	+	IGR	DEL	C	-	-	rs142918612		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91004180delC								CALM1 (129570 upstream) : TTC7B (2753 downstream)																							tttccttctaccagaaggtag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	92719773	92719774	+	IGR	DEL	AC	-	-	rs67090734		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92719773_92719774delAC								CPSF2 (89230 upstream) : SLC24A4 (69151 downstream)																							gccctgagggacacacacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	95149795	95149795	+	IGR	DEL	A	-	-	rs11313887		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95149795delA								SERPINA13 (36465 upstream) : GSC (84766 downstream)																							actccttctcaaaaaaaaaaa	0.104													4	2	---	---	---	---	
C14orf132	56967	broad.mit.edu	37	14	96531953	96531954	+	Intron	INS	-	T	T	rs146735355	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96531953_96531954insT	uc001yff.3	+							NR_023938				Homo sapiens clone 25027 mRNA sequence.												0						GGATTACATAGTTTTTTTCTTG	0.327													3	4	---	---	---	---	
BDKRB2	624	broad.mit.edu	37	14	96671208	96671216	+	5'UTR	DEL	GGTGGGGAC	-	-	rs72348790		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96671208_96671216delGGTGGGGAC	uc010avm.1	+	1					BDKRB2_uc010avl.1_In_Frame_Del_p.GGD24del|BDKRB2_uc010twu.1_5'UTR|BDKRB2_uc001yfg.2_5'UTR	NM_000623	NP_000614	P30411	BKRB2_HUMAN	bradykinin receptor B2						arachidonic acid secretion|elevation of cytosolic calcium ion concentration|transmembrane receptor protein tyrosine kinase signaling pathway	endosome|integral to plasma membrane	bradykinin receptor activity|phosphatidylinositol phospholipase C activity|protease binding|protein heterodimerization activity|type 1 angiotensin receptor binding			ovary(3)|breast(1)|kidney(1)	5		all_cancers(154;0.0678)|Melanoma(154;0.155)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.226)		TCCGAGGAGGggtggggacggtggggacg	0.569													4	2	---	---	---	---	
VRK1	7443	broad.mit.edu	37	14	97302751	97302753	+	Intron	DEL	CTG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97302751_97302753delCTG	uc001yft.2	+							NM_003384	NP_003375	Q99986	VRK1_HUMAN	vaccinia related kinase 1							cytoplasm|nucleolus	ATP binding|protein binding|protein serine/threonine kinase activity			large_intestine(1)|stomach(1)	2		Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.234)		tgtttgttccctgctgctttctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	98982445	98982446	+	IGR	INS	-	A	A	rs35527312		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:98982445_98982446insA								C14orf64 (537984 upstream) : C14orf177 (195504 downstream)																							AATTTGTTACCAAAAAAAAAAA	0.356													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99364466	99364466	+	IGR	DEL	T	-	-	rs5810911		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99364466delT								C14orf177 (180369 upstream) : BCL11B (271161 downstream)																							caacccatgatttttttatcc	0.020													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99384853	99384854	+	IGR	INS	-	A	A	rs113775428	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99384853_99384854insA								C14orf177 (200756 upstream) : BCL11B (250773 downstream)																							CACACACACACAAAAAAAACTC	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99596847	99596848	+	IGR	INS	-	AG	AG	rs71110572		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99596847_99596848insAG								C14orf177 (412750 upstream) : BCL11B (38779 downstream)																							gaaagaaagaaagaaagaaaga	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	104702675	104702676	+	IGR	INS	-	TGTG	TGTG	rs150156612	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104702675_104702676insTGTG								KIF26A (55441 upstream) : C14orf180 (343380 downstream)																							atgagctcagttgtgtgtgtgt	0.000													3	3	---	---	---	---	
INF2	64423	broad.mit.edu	37	14	105163430	105163430	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105163430delG	uc001ypb.2	+						INF2_uc001ypc.2_Intron|INF2_uc001yoy.3_Intron	NM_022489	NP_071934	Q27J81	INF2_HUMAN	inverted formin 2 isoform 1						actin cytoskeleton organization	endoplasmic reticulum|nucleus|perinuclear region of cytoplasm	actin binding|Rho GTPase binding				0		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00188)|OV - Ovarian serous cystadenocarcinoma(23;0.0191)|Epithelial(46;0.047)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.176)		TGGGGAGCCTGGACCCAGGCA	0.672													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106902128	106902128	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106902128delG	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						AGACATCAGTGGGAAGACATA	0.498													3	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106932579	106932580	+	Intron	INS	-	A	A	rs150402327	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106932579_106932580insA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						tagattgtgtttttttttattt	0.000													5	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107254886	107254887	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107254886_107254887insT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						tcatctatgtcttttttttact	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20460860	20460860	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20460860delG								None (None upstream) : GOLGA6L6 (276234 downstream)																							CCACATGGGTGGAAGGGGATC	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20484277	20484277	+	IGR	DEL	A	-	-	rs111867281		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20484277delA								None (None upstream) : GOLGA6L6 (252817 downstream)																							atggaaatgcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20564458	20564459	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20564458_20564459insA								None (None upstream) : GOLGA6L6 (172635 downstream)																							GGTGTATTTCCAAAAAACACTT	0.361													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22487906	22487907	+	IGR	INS	-	T	T	rs148052169	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22487906_22487907insT								OR4N3P (73521 upstream) : MIR1268 (25322 downstream)																							TCAACAGATTCTTTTTCTCTAG	0.342													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22490485	22490486	+	IGR	INS	-	TGATCTTGG	TGATCTTGG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490485_22490486insTGATCTTGG								OR4N3P (76100 upstream) : MIR1268 (22743 downstream)																							GATCTTGATGATGATCTTGGTG	0.450													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26453103	26453103	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26453103delT								ATP10A (342786 upstream) : GABRB3 (335592 downstream)																							TTTATGTCCCTTTAGAAGTGA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26725237	26725237	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26725237delT								ATP10A (614920 upstream) : GABRB3 (63458 downstream)																							TGTTGTAATGTTTTTGAATGA	0.408													4	2	---	---	---	---	
FAM189A1	23359	broad.mit.edu	37	15	29784269	29784269	+	Intron	DEL	T	-	-	rs112587093		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29784269delT	uc010azk.1	-							NM_015307	NP_056122	O60320	F1891_HUMAN	hypothetical protein LOC23359							integral to membrane					0						GTTGGTTTGATTTTTTTTTTT	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	36686093	36686095	+	IGR	DEL	TTG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36686093_36686095delTTG								ATPBD4 (847689 upstream) : C15orf41 (185717 downstream)																							atctcattatttgttgttgttgt	0.000													4	2	---	---	---	---	
SLC27A2	11001	broad.mit.edu	37	15	50511887	50511887	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50511887delT	uc001zxw.2	+						SLC27A2_uc010bes.2_Intron|SLC27A2_uc001zxx.2_Intron	NM_003645	NP_003636	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid						bile acid biosynthetic process|fatty acid alpha-oxidation	endoplasmic reticulum membrane|integral to membrane|peroxisomal matrix|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity|phytanate-CoA ligase activity|pristanate-CoA ligase activity			ovary(1)|skin(1)	2		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		agctatcacctttcatagggt	0.194													4	2	---	---	---	---	
CYP19A1	1588	broad.mit.edu	37	15	51541460	51541460	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51541460delT	uc001zyz.3	-						CYP19A1_uc001zza.3_Intron|CYP19A1_uc001zzb.2_Intron|CYP19A1_uc010bey.1_Intron|CYP19A1_uc001zze.1_Intron	NM_031226	NP_112503	P11511	CP19A_HUMAN	cytochrome P450, family 19						estrogen biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|membrane fraction	aromatase activity|electron carrier activity|heme binding|oxygen binding|steroid hydroxylase activity			skin(3)	3				all cancers(107;0.000372)|GBM - Glioblastoma multiforme(94;0.0128)	Aminoglutethimide(DB00357)|Anastrozole(DB01217)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Diethylstilbestrol(DB00255)|Exemestane(DB00990)|Letrozole(DB01006)|Testolactone(DB00894)|Testosterone(DB00624)	TGACCCAGCCTTATTTCTTGG	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60186307	60186307	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60186307delC								BNIP2 (204665 upstream) : FOXB1 (110114 downstream)																							aaagagagaaccagggacgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	62563040	62563040	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62563040delA								C2CD4B (105558 upstream) : MGC15885 (366331 downstream)																							AGGGAAAGGGAAAAAAAAAAG	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	63437275	63437276	+	IGR	INS	-	AT	AT	rs149873121	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63437275_63437276insAT								LACTB (3021 upstream) : RPS27L (8264 downstream)																							CACACACACACGTAatttagat	0.035													2	4	---	---	---	---	
HERC1	8925	broad.mit.edu	37	15	64011856	64011856	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64011856delA	uc002amp.2	-						HERC1_uc010uil.1_Intron	NM_003922	NP_003913	Q15751	HERC1_HUMAN	hect domain and RCC1-like domain 1						protein modification process|transport	cytosol|Golgi apparatus|membrane	acid-amino acid ligase activity|ARF guanyl-nucleotide exchange factor activity			ovary(6)|breast(6)|lung(5)|central_nervous_system(2)	19						gatgactcagaaaaaggtaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	64150130	64150130	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64150130delT								HERC1 (23983 upstream) : MIR422A (12999 downstream)																							CTGCCGTCTCTATTCATCCTT	0.333													4	2	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65246322	65246324	+	Intron	DEL	TTC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65246322_65246324delTTC	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						cttctattgtttcttttttcttc	0.000													4	4	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66459997	66460004	+	Intron	DEL	AAACAAAC	-	-	rs72154876		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66459997_66460004delAAACAAAC	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						caaacaaacaaaacaaacaaacaaacaa	0.159													0	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69410037	69410037	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69410037delT								TMEM84 (21876 upstream) : GLCE (42936 downstream)																							GCTGTCTCTGTTTTCTTTTTC	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	75125522	75125522	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75125522delT								CPLX3 (1386 upstream) : ULK3 (2937 downstream)																							tcctttctccttcATACCCTT	0.398													4	2	---	---	---	---	
CSPG4	1464	broad.mit.edu	37	15	76006041	76006041	+	5'Flank	DEL	G	-	-	rs71440260		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76006041delG	uc002baw.2	-							NM_001897	NP_001888	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4 precursor						angiogenesis|cell differentiation|intracellular signal transduction|positive regulation of peptidyl-tyrosine phosphorylation|tissue remodeling	apical plasma membrane|cell surface|integral to plasma membrane|intracellular|lamellipodium membrane	protein kinase binding|signal transducer activity			ovary(2)|pancreas(1)	3						GCTTCAGGCTGGGGCCCTTCT	0.403													4	2	---	---	---	---	
SGK269	79834	broad.mit.edu	37	15	77481781	77481782	+	Intron	INS	-	CAG	CAG	rs145143746	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:77481781_77481782insCAG	uc002bcm.2	-							NM_024776	NP_079052	Q9H792	PEAK1_HUMAN	NKF3 kinase family member						cell migration|protein autophosphorylation|substrate adhesion-dependent cell spreading	actin cytoskeleton|cytoplasm|focal adhesion	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding				0				STAD - Stomach adenocarcinoma(199;0.124)		GACAGTCCACAcagcagcagca	0.342													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	80061920	80061921	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80061920_80061921insA								KIAA1024 (297278 upstream) : MTHFS (75399 downstream)																							ATAAGATTCAGAAAAAAAGAGG	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85801139	85801142	+	IGR	DEL	GTGT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85801139_85801142delGTGT								PDE8A (118769 upstream) : AKAP13 (122729 downstream)																							AAgtgtgtgagtgtgtgtgtgtgt	0.284													3	3	---	---	---	---	
WDR93	56964	broad.mit.edu	37	15	90280480	90280480	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90280480delG	uc002boj.2	+						WDR93_uc010bnr.2_Intron|WDR93_uc010upz.1_Intron	NM_020212	NP_064597	Q6P2C0	WDR93_HUMAN	WD repeat domain 93						electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			TGGGAGCACAGGTGAGAAATG	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93898102	93898103	+	Intron	INS	-	AC	AC	rs140638332	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93898102_93898103insAC	uc002bsu.1	+											Homo sapiens cDNA FLJ37033 fis, clone BRACE2011389.																		caaacaaacaaaaaaaacaaaa	0.188													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96999440	96999441	+	IGR	DEL	CA	-	-	rs35403436		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96999440_96999441delCA								NR2F2 (115950 upstream) : SPATA8 (327238 downstream)																							cacacgcgtgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	102299886	102299887	+	5'Flank	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102299886_102299887insG	uc002bzh.1	-						uc002bzk.2_5'Flank|uc002bzn.2_5'Flank|uc010uso.1_5'Flank|uc002bzs.2_5'Flank|uc010usv.1_5'Flank|uc002cal.2_5'Flank|uc002cam.2_5'Flank|uc010usx.1_5'Flank|uc002cao.2_5'Flank|uc002cap.2_5'Flank|uc002caq.2_5'Flank|uc010usz.1_5'Flank|uc010uta.1_5'Flank|uc002cas.2_5'Flank|uc002cat.1_5'Flank|uc002cau.2_5'Flank|uc010utb.1_5'Flank|uc002cav.2_5'Flank|uc002caw.2_5'Flank|uc002cax.2_5'Flank|uc010utc.1_5'Flank|uc002cay.2_5'Flank|uc002cbb.2_5'Flank|uc002cbc.1_5'Flank|uc002cbd.2_5'Flank|uc002cbe.2_5'Flank|uc002cbg.2_5'Flank|uc002cbh.2_5'Flank|uc002cbi.2_5'Flank|uc002cbk.2_5'Flank|uc002cbl.2_5'Flank|uc010utd.1_5'Flank					DQ575740																		AACCTGTACTCGCGTCGGAACC	0.589													4	2	---	---	---	---	
HBZ	3050	broad.mit.edu	37	16	201719	201719	+	5'Flank	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:201719delC	uc002cft.1	+							NM_005332	NP_005323	P02008	HBAZ_HUMAN	hemoglobin, zeta							hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity				0		all_cancers(16;4.28e-07)|all_epithelial(16;2.09e-06)|Hepatocellular(16;0.000325)|Lung NSC(18;0.0104)|all_lung(18;0.0239)				gcctgggcaacagagcgagac	0.000													4	2	---	---	---	---	
RAB11FIP3	9727	broad.mit.edu	37	16	518297	518299	+	Intron	DEL	GGA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:518297_518299delGGA	uc002chf.2	+							NM_014700	NP_055515	O75154	RFIP3_HUMAN	rab11-family interacting protein 3 isoform 1						cell cycle|cytokinesis|endocytic recycling|protein transport	centrosome|cleavage furrow|midbody|recycling endosome membrane	ADP-ribosylation factor binding|calcium ion binding|protein homodimerization activity|Rab GTPase binding				0		Hepatocellular(16;0.0218)				GGGGCGTCAGGGAGGAGGAGGTC	0.640													4	2	---	---	---	---	
TELO2	9894	broad.mit.edu	37	16	1545215	1545216	+	Intron	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1545215_1545216insC	uc002cly.2	+						TELO2_uc010uvg.1_Intron	NM_016111	NP_057195	Q9Y4R8	TELO2_HUMAN	TEL2, telomere maintenance 2, homolog							chromosome, telomeric region|cytoplasm|membrane|nucleus	protein binding				0		Hepatocellular(780;0.219)				CCATCCGGCTTGTGGTTTTGGA	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	3474605	3474605	+	IGR	DEL	T	-	-	rs111857582		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3474605delT								ZNF174 (15243 upstream) : ZNF597 (11506 downstream)																							attcatcttattttttttttt	0.000													4	2	---	---	---	---	
HMOX2	3163	broad.mit.edu	37	16	4535586	4535586	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4535586delA	uc010bts.2	+						HMOX2_uc002cwr.3_Intron|HMOX2_uc002cwq.3_Intron|HMOX2_uc002cws.3_Intron	NM_001127206	NP_001120678	P30519	HMOX2_HUMAN	heme oxygenase (decyclizing) 2						cellular iron ion homeostasis|heme catabolic process|heme oxidation|response to hypoxia|transmembrane transport	endoplasmic reticulum membrane|microsome|plasma membrane	electron carrier activity|heme oxygenase (decyclizing) activity|metal ion binding|protein binding				0					NADH(DB00157)	AAGGGAAGAGAAGGAAGGAGG	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	5444566	5444567	+	Intron	INS	-	T	T	rs79369505		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:5444566_5444567insT	uc002cyq.1	+											Homo sapiens cDNA clone IMAGE:5244947, **** WARNING: chimeric clone ****.																		ttctttctgtcttttttttttt	0.114													5	3	---	---	---	---	
A2BP1	54715	broad.mit.edu	37	16	6426304	6426306	+	Intron	DEL	GTT	-	-	rs150868014		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:6426304_6426306delGTT	uc002cys.2	+						A2BP1_uc010buf.1_Intron|A2BP1_uc002cyr.1_Intron|A2BP1_uc002cyt.2_Intron|A2BP1_uc010uxz.1_Intron	NM_018723	NP_061193	Q9NWB1	RFOX1_HUMAN	ataxin 2-binding protein 1 isoform 4						mRNA processing|RNA splicing|RNA transport	nucleus|trans-Golgi network	nucleotide binding|protein C-terminus binding|RNA binding				0		all_cancers(2;4.54e-52)|Colorectal(2;6.95e-44)|all_epithelial(2;1.15e-37)|Lung NSC(2;0.000289)|all_lung(2;0.00148)|Myeloproliferative disorder(2;0.0122)|Medulloblastoma(2;0.0354)|all_neural(2;0.0381)|all_hematologic(2;0.0749)|Renal(2;0.0758)|Melanoma(2;0.211)		Colorectal(1;3.55e-51)|COAD - Colon adenocarcinoma(2;1.92e-46)|all cancers(1;5.36e-16)|Epithelial(1;3.98e-15)|READ - Rectum adenocarcinoma(2;3.71e-05)|GBM - Glioblastoma multiforme(1;0.0499)		TTGTTGGTTGGTTGTTGTTGTTG	0.251													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	8033547	8033548	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8033547_8033548delGT								A2BP1 (270207 upstream) : TMEM114 (585955 downstream)																							CATATGTATAgtgtgtgtgtgt	0.396													4	2	---	---	---	---	
C16orf72	29035	broad.mit.edu	37	16	9201726	9201726	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9201726delT	uc002czm.2	+						uc002czn.2_5'Flank	NM_014117	NP_054836	Q14CZ0	CP072_HUMAN	hypothetical protein LOC29035											large_intestine(1)	1						GTCTTGGTCCTTTTTTTTTTG	0.448													3	3	---	---	---	---	
GRIN2A	2903	broad.mit.edu	37	16	10210919	10210919	+	Intron	DEL	A	-	-	rs111371826		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10210919delA	uc002czo.3	-						GRIN2A_uc010uym.1_Intron|GRIN2A_uc002czr.3_Intron	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	caagtgactgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10318658	10318658	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10318658delA								GRIN2A (42047 upstream) : ATF7IP2 (161254 downstream)																							TGGCCTCATGAAAAATTGACA	0.313													4	2	---	---	---	---	
CLEC16A	23274	broad.mit.edu	37	16	11192959	11192960	+	Intron	INS	-	GAGCCAA	GAGCCAA	rs145032105	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11192959_11192960insGAGCCAA	uc002dao.2	+						CLEC16A_uc002dan.3_Intron	NM_015226	NP_056041	Q2KHT3	CL16A_HUMAN	C-type lectin domain family 16, member A											ovary(1)|central_nervous_system(1)	2						CCAGGCTGAGTGAGCCAAGAGT	0.619													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14151124	14151124	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14151124delA								ERCC4 (104919 upstream) : MKL2 (14072 downstream)																							ATATTTCCGGAAAAAAAAAAT	0.433													4	2	---	---	---	---	
NPIP	9284	broad.mit.edu	37	16	15040379	15040379	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15040379delT	uc002dcy.3	+						NPIP_uc002dcx.3_Intron	NM_006985	NP_008916	Q9UND3	NPIP_HUMAN	nuclear pore complex interacting protein						mRNA transport|protein transport|transmembrane transport	nuclear membrane|nuclear pore					0						acacccagGCttttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	20158916	20158916	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20158916delC								GPR139 (73816 upstream) : GP2 (162896 downstream)																							CACCCCTGTGCCTATGCTCTG	0.547													4	2	---	---	---	---	
COG7	91949	broad.mit.edu	37	16	23457291	23457291	+	Intron	DEL	A	-	-	rs71379679		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23457291delA	uc002dlo.2	-							NM_153603	NP_705831	P83436	COG7_HUMAN	component of oligomeric golgi complex 7						intracellular protein transport|protein glycosylation|protein localization in Golgi apparatus|protein stabilization|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|Golgi transport complex	protein binding				0				GBM - Glioblastoma multiforme(48;0.0401)		TTCTGTAGTTAAAAAAAAAAA	0.408													25	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25040865	25040867	+	5'Flank	DEL	TCT	-	-	rs112587595		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25040865_25040867delTCT	uc010bxu.1	+											SubName: Full=cDNA FLJ40572 fis, clone THYMU2006170;																		ttcctcttcctcttcttcttctt	0.084													3	3	---	---	---	---	
NSMCE1	197370	broad.mit.edu	37	16	27241481	27241481	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27241481delC	uc002doi.1	-						NSMCE1_uc002doj.1_Intron	NM_145080	NP_659547	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog						DNA recombination|DNA repair|intracellular signal transduction	nucleus	zinc ion binding				0						TCCCCGCTGACCCCAACCACC	0.657													4	2	---	---	---	---	
RABEP2	79874	broad.mit.edu	37	16	28921607	28921607	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28921607delT	uc002drq.2	-						uc010vct.1_Intron|RABEP2_uc010vdf.1_Intron|RABEP2_uc010byn.2_Intron	NM_024816	NP_079092	Q9H5N1	RABE2_HUMAN	rabaptin, RAB GTPase binding effector protein 2						endocytosis|protein transport	early endosome	growth factor activity|GTPase activator activity			ovary(1)|breast(1)|skin(1)	3						tctgatttgcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	29231205	29231206	+	Intron	DEL	CA	-	-	rs150954013		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29231205_29231206delCA	uc010vct.1	-											RecName: Full=Nuclear pore complex-interacting protein-like 2; Flags: Precursor;																		atagtactcgcacacacacgca	0.030													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	30552959	30552960	+	IGR	DEL	CC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30552959_30552960delCC								ZNF768 (6740 upstream) : ZNF764 (12126 downstream)																							ATATCCTCTTCCAGCTGGGACG	0.490													4	2	---	---	---	---	
ZNF764	92595	broad.mit.edu	37	16	30571776	30571777	+	5'Flank	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30571776_30571777insA	uc002dyq.2	-						ZNF764_uc002dyr.1_5'Flank	NM_033410	NP_219363	Q96H86	ZN764_HUMAN	zinc finger protein 764						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						tactaaaaattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
FBRS	64319	broad.mit.edu	37	16	30674838	30674838	+	5'Flank	DEL	A	-	-	rs112134216		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30674838delA	uc002dzd.3	+						FBRS_uc002dzc.3_Intron	NM_001105079	NP_001098549	Q9HAH7	FBRS_HUMAN	fibrosin											ovary(1)	1			Colorectal(24;0.103)			aggctaagttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31836432	31836432	+	IGR	DEL	G	-	-	rs1238215	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31836432delG								ZNF720 (30242 upstream) : ZNF267 (48647 downstream)																							CTACCtttttgttttttcttg	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32296311	32296312	+	IGR	INS	-	ATG	ATG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32296311_32296312insATG								HERC2P4 (132437 upstream) : TP53TG3B (388529 downstream)																							gaaatgatgaaatgaatcgatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32312207	32312207	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32312207delT	uc002edb.2	-											Homo sapiens similar to protein phosphatase 2A 48 kDa regulatory subunit isoform 1; serine/threonine protein phosphatase 2A, 48kDa regulatory subunit; PP2A, subunit B, PR48 isoform; PP2A B subunit PR48; NY-REN-8 antigen, mRNA (cDNA clone IMAGE:5272051).																		CTTCTTTTCCTTTTTTTTTGT	0.269													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32356294	32356294	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32356294delT								HERC2P4 (192420 upstream) : TP53TG3B (328547 downstream)																							tacaaaaaaattttaaatatt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32494367	32494368	+	IGR	INS	-	T	T	rs143786075	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32494367_32494368insT								HERC2P4 (330493 upstream) : TP53TG3B (190473 downstream)																							ttaaacccttcttttcattcag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32526437	32526437	+	IGR	DEL	T	-	-	rs112044218		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32526437delT								HERC2P4 (362563 upstream) : TP53TG3B (158404 downstream)																							agaaagttactttctagtctt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32539797	32539798	+	IGR	INS	-	A	A	rs138179239		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32539797_32539798insA								HERC2P4 (375923 upstream) : TP53TG3B (145043 downstream)																							caagatcctacaaaaatgcgtt	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32557544	32557545	+	IGR	DEL	TT	-	-	rs112211416		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32557544_32557545delTT								HERC2P4 (393670 upstream) : TP53TG3B (127296 downstream)																							tttggaaacatttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33918554	33918554	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33918554delT								None (None upstream) : MIR1826 (46954 downstream)																							agggaatatcttcacataaaa	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33926368	33926368	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33926368delT								None (None upstream) : MIR1826 (39140 downstream)																							aagtgtagccttttcaatact	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33977168	33977168	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33977168delT								MIR1826 (11576 upstream) : UBE2MP1 (426634 downstream)																							tgcattcatctcacagagttg	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34292450	34292451	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34292450_34292451insA								MIR1826 (326858 upstream) : UBE2MP1 (111351 downstream)																							actccatctcgaaaaaaaaaaa	0.178													4	2	---	---	---	---	
ZNF423	23090	broad.mit.edu	37	16	49827126	49827126	+	Intron	DEL	A	-	-	rs10714108		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49827126delA	uc002efs.2	-							NM_015069	NP_055884	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation|negative regulation of transcription, DNA-dependent|nervous system development|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(1)|lung(1)|kidney(1)|pancreas(1)	4		all_cancers(37;0.0155)				TGGCATCACTAAGCAGGGGCA	0.607													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52675505	52675506	+	IGR	INS	-	T	T	rs112208450		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52675505_52675506insT								TOX3 (93791 upstream) : CHD9 (413439 downstream)																							GTTTACGTTGGTTTTTTTTTTT	0.351													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	53013776	53013776	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53013776delA								TOX3 (432062 upstream) : CHD9 (75169 downstream)																							accttgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54487402	54487402	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54487402delC								IRX3 (167024 upstream) : IRX5 (477709 downstream)																							cccatctctacaaaaaatatt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	55198503	55198503	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55198503delA								IRX5 (230110 upstream) : IRX6 (159968 downstream)																							AGCATTAAGGAAAAAAAAAAA	0.512													9	5	---	---	---	---	
CES1	1066	broad.mit.edu	37	16	55854588	55854588	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:55854588delC	uc002eim.2	-						CES1_uc002eil.2_Intron|CES1_uc002ein.2_Intron	NM_001025194	NP_001020365	P23141	EST1_HUMAN	carboxylesterase 1 isoform b precursor						response to toxin	endoplasmic reticulum lumen	carboxylesterase activity|methyl indole-3-acetate esterase activity|methyl jasmonate esterase activity|methyl salicylate esterase activity				0				all cancers(182;0.13)|Epithelial(162;0.137)	Aminoglutethimide(DB00357)|Bezafibrate(DB01393)|Cholestyramine(DB01432)|Moexipril(DB00691)	GGGTTTTCATCCCAGATCCCC	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	56093263	56093263	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56093263delG								CES7 (133891 upstream) : LOC283856 (33636 downstream)																							ggccatttgtggaaataaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	60331693	60331693	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:60331693delT								None (None upstream) : None (None downstream)																							tccaccatggttttacctcct	0.000													4	2	---	---	---	---	
CDH8	1006	broad.mit.edu	37	16	61925618	61925618	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61925618delG	uc002eog.1	-							NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		ATTCGTATCAGGTAGAACAGC	0.373													4	2	---	---	---	---	
LOC283867	283867	broad.mit.edu	37	16	65492436	65492439	+	Intron	DEL	GTGT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65492436_65492439delGTGT	uc010cdp.1	-						LOC283867_uc002eol.1_Intron					Homo sapiens cDNA clone IMAGE:5276218.												0				OV - Ovarian serous cystadenocarcinoma(108;0.17)		AGGACAAGACgtgtgtgtgtgtgt	0.279													4	2	---	---	---	---	
ESRP2	80004	broad.mit.edu	37	16	68267118	68267118	+	Intron	DEL	G	-	-	rs72173261		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68267118delG	uc010cfa.1	-						ESRP2_uc002evp.1_5'Flank|ESRP2_uc002evq.1_Intron	NM_024939	NP_079215	Q9H6T0	ESRP2_HUMAN	RNA binding motif protein 35B						mRNA processing|regulation of RNA splicing|RNA splicing	nucleus	mRNA binding|nucleotide binding			ovary(1)	1						aaaaaaaaaagaaaTGACAAA	0.254													5	3	---	---	---	---	
WWP2	11060	broad.mit.edu	37	16	69922897	69922897	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69922897delC	uc002exu.1	+						WWP2_uc002ext.2_Intron|WWP2_uc002exv.1_Intron|WWP2_uc010vlm.1_Intron	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase						entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						gcaggagccaccacacccggc	0.060													4	2	---	---	---	---	
ZFHX3	463	broad.mit.edu	37	16	73093232	73093233	+	5'UTR	DEL	AC	-	-	rs150890465		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73093232_73093233delAC	uc002fcl.2	-	1								Q15911	ZFHX3_HUMAN	RecName: Full=Zinc finger homeobox protein 3; AltName: Full=Zinc finger homeodomain protein 3;          Short=ZFH-3; AltName: Full=Alpha-fetoprotein enhancer-binding protein; AltName: Full=AT motif-binding factor; AltName: Full=AT-binding transcription factor 1;						muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				TGTATTAAAAacacacacacac	0.094													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73106344	73106345	+	IGR	DEL	AA	-	-	rs140717043		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73106344_73106345delAA								ZFHX3 (13107 upstream) : HTA (19903 downstream)																							actccgtctcaaaaaaaaaaaa	0.149													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	73886865	73886868	+	IGR	DEL	AAAC	-	-	rs151272104		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:73886865_73886868delAAAC								HTA (759195 upstream) : PSMD7 (443813 downstream)																							tcaacaagtaaaacaaacaaacaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74646330	74646330	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74646330delG								GLG1 (5288 upstream) : RFWD3 (8968 downstream)																							aaaaaaaaaagaaaaagaaaa	0.065													4	2	---	---	---	---	
ADAMTS18	170692	broad.mit.edu	37	16	77359570	77359570	+	Intron	DEL	A	-	-	rs112943550		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77359570delA	uc002ffc.3	-						ADAMTS18_uc010chc.1_Intron|ADAMTS18_uc002ffe.1_Intron	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						GGTATCTTATAGGGGGAAAAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79449240	79449241	+	IGR	INS	-	CAGG	CAGG	rs137919902	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79449240_79449241insCAGG								WWOX (202677 upstream) : MAF (178505 downstream)																							gggaggatgaacaggcaggcag	0.059													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80056963	80056964	+	IGR	INS	-	A	A	rs147782980		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80056963_80056964insA								MAF (422341 upstream) : DYNLRB2 (517890 downstream)																							ATCTCTTCATGAAAAAAAAAAA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	82573498	82573499	+	IGR	DEL	AC	-	-	rs72437150		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82573498_82573499delAC								MPHOSPH6 (369669 upstream) : CDH13 (87079 downstream)																							ATTTATAATGacacacacacac	0.337													4	2	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83984410	83984411	+	Intron	DEL	GT	-	-	rs72371417		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83984410_83984411delGT	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						actggcacacgtacacacatgc	0.030													4	2	---	---	---	---	
ATP2C2	9914	broad.mit.edu	37	16	84462554	84462554	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84462554delG	uc002fhx.2	+						ATP2C2_uc010chj.2_Intron|ATP2C2_uc002fhy.2_Intron|ATP2C2_uc002fhz.2_Intron	NM_014861	NP_055676	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2						ATP biosynthetic process	Golgi membrane|integral to membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			breast(1)|central_nervous_system(1)	2						TGTCTTTGCTGGGTTGCAGCC	0.478													4	2	---	---	---	---	
USP10	9100	broad.mit.edu	37	16	84762588	84762588	+	Intron	DEL	G	-	-	rs74550308		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84762588delG	uc002fii.2	+						USP10_uc010voe.1_Intron|USP10_uc010vof.1_Intron|USP10_uc002fij.2_Intron	NM_005153	NP_005144	Q14694	UBP10_HUMAN	ubiquitin specific protease 10						DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						tatttttagtggaggtggatt	0.000													6	5	---	---	---	---	
ZNF469	84627	broad.mit.edu	37	16	88506600	88506600	+	3'UTR	DEL	T	-	-	rs67897677		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88506600delT	uc002fku.2	+	2						NM_001127464	NP_001120936	Q96JG9	ZN469_HUMAN	zinc finger protein 469						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCTTCCTTGATTTTTTTTTTT	0.532													4	4	---	---	---	---	
ITGAE	3682	broad.mit.edu	37	17	3653471	3653472	+	Intron	INS	-	CACA	CACA	rs144393457	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3653471_3653472insCACA	uc002fwo.3	-							NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor						cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		ctgcccaaaggctgagagggct	0.084													4	3	---	---	---	---	
AIPL1	23746	broad.mit.edu	37	17	6333365	6333376	+	Intron	DEL	GTGTGTGTGTGT	-	-	rs34785851		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6333365_6333376delGTGTGTGTGTGT	uc002gcp.2	-						AIPL1_uc002gcq.2_Intron|AIPL1_uc002gcr.2_Intron|AIPL1_uc010clk.2_Intron|AIPL1_uc010cll.2_Intron|AIPL1_uc002gcs.2_Intron	NM_014336	NP_055151	Q9NZN9	AIPL1_HUMAN	aryl hydrocarbon receptor interacting						protein farnesylation|protein folding|visual perception	cytoplasm|nucleus	farnesylated protein binding|unfolded protein binding				0				COAD - Colon adenocarcinoma(228;0.141)		TCTAGAAGGGgtgtgtgtgtgtgtgtgtgtgt	0.250													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	7783677	7783678	+	IGR	INS	-	A	A	rs142996525	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7783677_7783678insA								CYB5D1 (18079 upstream) : CHD3 (4445 downstream)																							ttaaactcaggaaaacaggcag	0.119													1	5	---	---	---	---	
RAI1	10743	broad.mit.edu	37	17	17589883	17589884	+	Intron	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17589883_17589884delGT	uc002grm.2	+							NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		TCTTGAACCCgtgtgtgtgtgt	0.361													4	2	---	---	---	---	
TOM1L2	146691	broad.mit.edu	37	17	17781192	17781192	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17781192delA	uc002grz.3	-						TOM1L2_uc002gry.3_Intron|TOM1L2_uc010vwy.1_Intron|TOM1L2_uc010cpr.2_Intron|TOM1L2_uc010vwz.1_Intron|TOM1L2_uc010vxa.1_Intron|TOM1L2_uc010vxb.1_Intron	NM_001082968	NP_001076437	Q6ZVM7	TM1L2_HUMAN	target of myb1-like 2 isoform 3						intracellular protein transport	intracellular					0	all_neural(463;0.228)					GGGCTTGTTTAAAAAAAAAAA	0.468													3	3	---	---	---	---	
SHMT1	6470	broad.mit.edu	37	17	18248861	18248862	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18248861_18248862insT	uc002gta.2	-						SHMT1_uc002gtb.2_Intron|SHMT1_uc010cqb.2_Intron|SHMT1_uc010vxt.1_Intron|SHMT1_uc002gtd.1_Intron|SHMT1_uc010vxu.1_Intron	NM_004169	NP_004160	P34896	GLYC_HUMAN	serine hydroxymethyltransferase 1 (soluble)						carnitine biosynthetic process|folic acid metabolic process|L-serine catabolic process|one-carbon metabolic process|purine base biosynthetic process	cytosol|nucleus	glycine hydroxymethyltransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					Glycine(DB00145)|Mimosine(DB01055)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	gtgcaccaccAtgtatttttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21223391	21223391	+	IGR	DEL	C	-	-	rs67148773		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21223391delC								MAP2K3 (4842 upstream) : KCNJ12 (56308 downstream)																							GAAATTCTTTCCTTGTCTGCC	0.552													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25279365	25279365	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25279365delC								None (None upstream) : WSB1 (341741 downstream)																							aaagaaagaacagaaagaaag	0.000													3	3	---	---	---	---	
TAOK1	57551	broad.mit.edu	37	17	27778449	27778450	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27778449_27778450insT	uc002hdz.1	+						TAOK1_uc010wbe.1_Intron|TAOK1_uc010wbf.1_Intron	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1						mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			CCTTTTCTGACTTTTTTTTTCT	0.332													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	28627717	28627718	+	IGR	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28627717_28627718delTG								BLMH (8643 upstream) : TMIGD1 (15648 downstream)																							atgcaaatcttgtgacctctaa	0.000													4	2	---	---	---	---	
LRRC37B2	147172	broad.mit.edu	37	17	28985771	28985772	+	Intron	INS	-	AGGA	AGGA	rs28881798		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28985771_28985772insAGGA	uc010csj.1	+											Homo sapiens cDNA FLJ90801 fis, clone Y79AA1000207.												0						gagaaagaaagaggaaggaagg	0.000													6	4	---	---	---	---	
AATF	26574	broad.mit.edu	37	17	35391258	35391258	+	Intron	DEL	C	-	-	rs148039736	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:35391258delC	uc002hni.2	+						AATF_uc002hnj.2_Intron	NM_012138	NP_036270	Q9NY61	AATF_HUMAN	apoptosis antagonizing transcription factor						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|negative regulation of superoxide anion generation|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to DNA damage stimulus	centrosome|focal adhesion|nucleolus	leucine zipper domain binding|sequence-specific DNA binding transcription factor activity				0		Breast(25;0.00607)				tgttgccactccaggtagagc	0.159													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	38665272	38665272	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38665272delT								TNS4 (7418 upstream) : CCR7 (44751 downstream)																							ccgtttatccttttttttttt	0.075													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39953947	39953948	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39953947_39953948insT								JUP (10983 upstream) : SC65 (4258 downstream)																							ATTGCAGGGGAttttttttttt	0.089													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	40708031	40708034	+	5'Flank	DEL	AAGA	-	-	rs139366873		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40708031_40708034delAAGA	uc002hzy.2	-											Homo sapiens cDNA FLJ32461 fis, clone SKNMC1000168.																		ATGTGTAAAGAAGAAAGAGGGCTA	0.363													1	6	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44274282	44274283	+	Intron	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44274282_44274283insG	uc010dav.2	-							NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				agaacagcccagggaaaacagc	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	45177142	45177143	+	Intron	INS	-	AA	AA	rs71365037		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45177142_45177143insAA	uc002ilc.1	-											full-length cDNA clone CS0DH004YI07 of T cells (Jurkat cell line) of Homo sapiens (human).																		gaccccgtctcaaaaaaaaaaa	0.059													4	2	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45360440	45360440	+	Intron	DEL	T	-	-	rs113911670		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45360440delT	uc002ilj.2	+						ITGB3_uc002ili.1_Intron|ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	ttctttttccttttttttttt	0.179													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49219116	49219117	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49219116_49219117insT								SPAG9 (20890 upstream) : NME1 (11803 downstream)																							tgcccaaccaatttttgtagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	49535891	49535892	+	IGR	DEL	GA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49535891_49535892delGA								UTP18 (160601 upstream) : CA10 (171783 downstream)																							TGGGGGGCAGgagagagagaga	0.342													4	2	---	---	---	---	
MSI2	124540	broad.mit.edu	37	17	55700211	55700211	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55700211delG	uc002iuz.1	+						MSI2_uc010wnm.1_Intron|MSI2_uc002iva.2_Intron	NM_138962	NP_620412	Q96DH6	MSI2H_HUMAN	musashi 2 isoform a							cytoplasm	nucleotide binding|RNA binding			central_nervous_system(1)|pancreas(1)	2	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		GCCGCTTCCTGGTGGACAGAG	0.318			T	HOXA9	CML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	55766540	55766541	+	IGR	INS	-	T	T	rs148355642	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55766540_55766541insT								MSI2 (9241 upstream) : MRPS23 (150303 downstream)																							TGGGTTTTCtctttttttttaa	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	57539308	57539309	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57539308_57539309insA								YPEL2 (60213 upstream) : DHX40 (103577 downstream)																							tgtgtctcaagaaaaaaaaaaa	0.188													4	2	---	---	---	---	
CLTC	1213	broad.mit.edu	37	17	57719487	57719487	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57719487delT	uc002ixq.1	+						CLTC_uc002ixp.2_Intron|CLTC_uc002ixr.1_Intron	NM_004859	NP_004850	Q00610	CLH1_HUMAN	clathrin heavy chain 1						axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|mitosis|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport|receptor internalization|transferrin transport	clathrin coat of coated pit|clathrin coat of trans-Golgi network vesicle|cytosol|melanosome|spindle	protein binding|structural molecule activity		CLTC/ALK(44)|CLTC/TFE3(2)	haematopoietic_and_lymphoid_tissue(33)|soft_tissue(11)|kidney(2)|ovary(1)|breast(1)	48	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GAAACACAGGTTTTTGACTTT	0.388			T	ALK|TFE3	ALCL|renal 								4	2	---	---	---	---	
INTS2	57508	broad.mit.edu	37	17	59986482	59986483	+	Intron	INS	-	T	T	rs148698664	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59986482_59986483insT	uc002izn.2	-						INTS2_uc002izm.2_Intron	NM_020748	NP_065799	Q9H0H0	INT2_HUMAN	integrator complex subunit 2						snRNA processing	integral to membrane|integrator complex|nuclear membrane	protein binding			ovary(1)|lung(1)|pancreas(1)	3						tattatttttctttttttttga	0.015													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	61008264	61008265	+	IGR	DEL	TT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61008264_61008265delTT								MARCH10 (122559 upstream) : MIR633 (13311 downstream)																							gcctggctaatttttttttttt	0.000													4	2	---	---	---	---	
TANC2	26115	broad.mit.edu	37	17	61493196	61493197	+	Intron	INS	-	T	T	rs147536574	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61493196_61493197insT	uc002jal.3	+						TANC2_uc010wpe.1_Intron|TANC2_uc002jao.3_Intron	NM_025185	NP_079461	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and								binding			ovary(2)	2						GAAATCAAGTCTAAGTACAATC	0.391													3	3	---	---	---	---	
CSH2	1443	broad.mit.edu	37	17	61952870	61952871	+	5'Flank	INS	-	CTTC	CTTC			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61952870_61952871insCTTC	uc002jch.2	-						CSH2_uc002jcg.2_5'Flank|CSH2_uc002jci.2_5'Flank|GH2_uc002jcj.2_Intron|CSH2_uc002jck.2_Intron	NM_020991	NP_066271	P01243	CSH_HUMAN	chorionic somatomammotropin hormone 2 isoform 1						female pregnancy|signal transduction	extracellular region	hormone activity|metal ion binding				0						ttccttcctttcttccttcctt	0.000													8	4	---	---	---	---	
AMZ2P1	201283	broad.mit.edu	37	17	62973323	62973323	+	5'Flank	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62973323delC	uc002jez.3	-						AMZ2P1_uc002jfa.3_5'Flank|AMZ2P1_uc002jfb.3_5'Flank|AMZ2P1_uc010del.2_5'Flank					Homo sapiens cDNA FLJ32065 fis, clone OCBBF1000086, weakly similar to Archeobacterial metalloproteinase-like protein 2 (EC 3.-.-.-).												0						acctctgcctcctgggttcaa	0.000													4	2	---	---	---	---	
RGS9	8787	broad.mit.edu	37	17	63173443	63173446	+	Intron	DEL	CCAT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63173443_63173446delCCAT	uc002jfe.2	+						RGS9_uc010dem.2_Intron|RGS9_uc002jfd.2_Intron|RGS9_uc002jff.2_Intron	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1						intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						atctgtctggccatccatccatcc	0.201													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64179740	64179740	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64179740delA	uc002jfl.2	-						CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			ggtattggtgaaaggatagac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	64900803	64900804	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64900803_64900804insA								CACNG5 (19447 upstream) : CACNG4 (60209 downstream)																							AATTTTTAGGGAAAAAAAAAGA	0.282													4	2	---	---	---	---	
CACNG4	27092	broad.mit.edu	37	17	65026269	65026272	+	Intron	DEL	GTGT	-	-	rs79931933		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65026269_65026272delGTGT	uc002jft.1	+							NM_014405	NP_055220	Q9UBN1	CCG4_HUMAN	voltage-dependent calcium channel gamma-4						membrane depolarization|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane	voltage-gated calcium channel activity			central_nervous_system(1)	1	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			AATAATAGGGgtgtgtgtgtgtgt	0.255													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	66010792	66010795	+	IGR	DEL	CAAA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66010792_66010795delCAAA								C17orf58 (21027 upstream) : KPNA2 (21053 downstream)																							gagtccatctcaaacaaacaaaca	0.181													6	3	---	---	---	---	
FAM20A	54757	broad.mit.edu	37	17	66537811	66537812	+	Intron	DEL	TG	-	-	rs140594131		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66537811_66537812delTG	uc002jho.2	-						FAM20A_uc010wqp.1_Intron|PRKAR1A_uc002jhm.2_Intron|FAM20A_uc002jhn.2_Intron	NM_017565	NP_060035	Q96MK3	FA20A_HUMAN	family with sequence similarity 20, member A							extracellular region					0	Breast(10;1.64e-13)					agtgctgtgctgtgttttcgtg	0.010													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68442332	68442333	+	IGR	INS	-	TG	TG	rs144759058	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68442332_68442333insTG								KCNJ2 (266151 upstream) : None (None downstream)																							ATGTACATACAtgtgtgtgtgt	0.252													4	2	---	---	---	---	
CD300LB	124599	broad.mit.edu	37	17	72526690	72526703	+	Intron	DEL	ACACACACACACAC	-	-	rs66889281		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72526690_72526703delACACACACACACAC	uc002jkx.2	-						CD300LB_uc010wqz.1_Intron	NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b							integral to membrane|plasma membrane	receptor activity			ovary(1)	1						AGGTCCCCCAacacacacacacacacacacacac	0.425													5	3	---	---	---	---	
GRB2	2885	broad.mit.edu	37	17	73326789	73326789	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73326789delA	uc002jnx.3	-						GRB2_uc002jny.3_Intron	NM_002086	NP_002077	P62993	GRB2_HUMAN	growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	aacaaaAAACAAAAAAAAAAA	0.199													4	2	---	---	---	---	
FBF1	85302	broad.mit.edu	37	17	73936329	73936329	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73936329delT	uc002jqc.2	-						FBF1_uc010wsp.1_5'Flank|FBF1_uc002jqd.1_Intron	NM_001080542	NP_001074011	Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1												0						gccttctttcttttttttttt	0.000													4	3	---	---	---	---	
CDK3	1018	broad.mit.edu	37	17	73998838	73998838	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73998838delG	uc010dgt.2	+						CDK3_uc002jqg.3_Intron	NM_001258	NP_001249	Q00526	CDK3_HUMAN	cyclin-dependent kinase 3						cell division|cell proliferation|mitosis		ATP binding|cyclin-dependent protein kinase activity			central_nervous_system(1)	1						ccagcactttgggaggctgag	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	76331616	76331616	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76331616delT								LOC283999 (94549 upstream) : SOCS3 (21243 downstream)																							tttctttctcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77010341	77010341	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77010341delA								CANT1 (4442 upstream) : C1QTNF1 (9910 downstream)																							tgtgtttggtaaaagattata	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	77826373	77826374	+	IGR	INS	-	T	T	rs142364320		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77826373_77826374insT								CBX4 (13160 upstream) : TBC1D16 (87447 downstream)																							ttctttttttcttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	79841732	79841733	+	IGR	INS	-	A	A	rs151015592		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79841732_79841733insA								ARHGDIA (12494 upstream) : THOC4 (3978 downstream)																							aaaacaaaaacaaaaaaaaCCA	0.010													1	5	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80738029	80738051	+	Intron	DEL	CCCTTGGCTCCCTTCTGCCCTGG	-	-	rs61340715	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80738029_80738051delCCCTTGGCTCCCTTCTGCCCTGG	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TTCGCGAGTTCCCTTGGCTCCCTTCTGCCCTGGGCCCTGGCTC	0.632													2	5	---	---	---	---	
TBCD	6904	broad.mit.edu	37	17	80844264	80844265	+	Intron	INS	-	A	A	rs149384028	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80844264_80844265insA	uc002kfz.2	+						TBCD_uc002kfx.1_Intron|TBCD_uc002kfy.1_Intron	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D						'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GCTGACATTGCAAGAAGACATG	0.515													2	6	---	---	---	---	
B3GNTL1	146712	broad.mit.edu	37	17	80984843	80984843	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80984843delG	uc002kgg.1	-						B3GNTL1_uc002kgf.1_Intron	NM_001009905	NP_001009905	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal								transferase activity, transferring glycosyl groups			ovary(1)|pancreas(1)	2	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			GAGCGGGGCAGGGAGCCTGCA	0.647													6	3	---	---	---	---	
COLEC12	81035	broad.mit.edu	37	18	435599	435600	+	Intron	DEL	TC	-	-	rs113875705		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:435599_435600delTC	uc002kkm.2	-							NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12						carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				TAAATCCAAATCTCTCTCTCTC	0.223													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	982179	982180	+	IGR	INS	-	A	A	rs143295780	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:982179_982180insA								ADCYAP1 (70008 upstream) : C18orf2 (272210 downstream)																							caaccttctccggtctactcgc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	1776939	1776940	+	IGR	INS	-	G	G			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1776939_1776940insG								C18orf2 (369758 upstream) : METTL4 (760585 downstream)																							CTAGAGCCACAGGGATCTCAGG	0.376													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	2110435	2110435	+	IGR	DEL	A	-	-	rs76061247		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2110435delA								C18orf2 (703254 upstream) : METTL4 (427090 downstream)																							accctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SMCHD1	23347	broad.mit.edu	37	18	2682313	2682313	+	Intron	DEL	T	-	-	rs33973338		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2682313delT	uc002klm.3	+							NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0						TTTCTTCTTCttttttttttt	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4510891	4510891	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4510891delG								DLGAP1 (55625 upstream) : LOC642597 (632781 downstream)																							gtgtggtggtggtgtggtggt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	4912886	4912887	+	IGR	INS	-	C	C	rs34770341		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:4912886_4912887insC								DLGAP1 (457620 upstream) : LOC642597 (230785 downstream)																							ttcttcttcttttttttttttt	0.000													4	2	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	8021316	8021317	+	Intron	DEL	AC	-	-	rs145662824		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8021316_8021317delAC	uc002knn.3	+						PTPRM_uc010dkv.2_Intron|PTPRM_uc010wzl.1_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CATAAAAGAGacacacacacac	0.193													4	2	---	---	---	---	
RAB31	11031	broad.mit.edu	37	18	9826377	9826378	+	Intron	INS	-	ACAA	ACAA	rs34799219		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9826377_9826378insACAA	uc002kog.2	+							NM_006868	NP_006859	Q13636	RAB31_HUMAN	RAB31, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			skin(1)	1						tgtctcaaaatacaaacaaaca	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12217676	12217676	+	IGR	DEL	T	-	-	rs112871832		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12217676delT								IMPA2 (186800 upstream) : CIDEA (36642 downstream)																							ACATTAGAAATTTTTTTTCCA	0.363													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12750417	12750418	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12750417_12750418insA								PSMG2 (24680 upstream) : PTPN2 (35063 downstream)																							CAAGGCTGTTTAAAAAAAAAAA	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	14962831	14962831	+	IGR	DEL	T	-	-	rs34911570		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14962831delT								ANKRD30B (110094 upstream) : LOC644669 (350724 downstream)																							GGCCACGTTCTGGCCACAGGC	0.632													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20354372	20354372	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20354372delT								CTAGE1 (356494 upstream) : RBBP8 (158923 downstream)																							ATCTCATTCATTAGAGTACTT	0.313													4	2	---	---	---	---	
NPC1	4864	broad.mit.edu	37	18	21134570	21134570	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21134570delA	uc002kum.3	-						NPC1_uc010xaz.1_Intron|NPC1_uc010xba.1_Intron	NM_000271	NP_000262	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1 precursor						autophagy|bile acid metabolic process|cholesterol efflux|cholesterol homeostasis|lysosomal transport	endoplasmic reticulum|integral to plasma membrane|late endosome membrane|lysosomal membrane|nuclear envelope|perinuclear region of cytoplasm	hedgehog receptor activity|protein binding|sterol transporter activity			ovary(2)	2	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					accctgtctcaaaaaaaaaaa	0.050													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	27656310	27656310	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:27656310delA								None (None upstream) : MIR302F (222566 downstream)																							atgtatatgtaaagcagtttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	32909444	32909445	+	IGR	INS	-	T	T	rs138876839	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32909444_32909445insT								ZNF271 (18715 upstream) : ZNF24 (2733 downstream)																							tgttgtccttgttttttgttac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	41621687	41621712	+	IGR	DEL	CTCTCTCCTTCCCCCTCACTCCCTCG	-	-	rs149058908	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:41621687_41621712delCTCTCTCCTTCCCCCTCACTCCCTCG								SYT4 (764072 upstream) : SETBP1 (638426 downstream)																							AGTCACATGTCTCTCTCCTTCCCCCTCACTCCCTCGCCCAACCTCG	0.478													5	3	---	---	---	---	
KATNAL2	83473	broad.mit.edu	37	18	44535068	44535069	+	Intron	INS	-	CCTT	CCTT	rs145271644	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44535068_44535069insCCTT	uc002lco.2	+						KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lcp.3_Intron	NM_031303	NP_112593	Q8IYT4	KATL2_HUMAN	katanin p60 subunit A-like 2							cytoplasm|microtubule	ATP binding|microtubule-severing ATPase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						ctccctccctcccttccttcct	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45490573	45490573	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45490573delA								SMAD2 (33058 upstream) : ZBTB7C (63175 downstream)																							GTGGCTCCTCATCCACCTATC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51761133	51761133	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51761133delT								MBD2 (9975 upstream) : POLI (34716 downstream)																							gtgaaactaattaagaaacaa	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	56863287	56863288	+	IGR	INS	-	AG	AG			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56863287_56863288insAG								SEC11C (37226 upstream) : GRP (24112 downstream)																							cacacacagacacacacacaca	0.356													4	2	---	---	---	---	
CCBE1	147372	broad.mit.edu	37	18	57140975	57140975	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:57140975delT	uc002lib.2	-							NM_133459	NP_597716	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1						lymphangiogenesis|sprouting angiogenesis|venous blood vessel morphogenesis	collagen	calcium ion binding			skin(2)|ovary(1)	3		Colorectal(73;0.175)				cactatttcctcccccactac	0.075													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77379366	77379366	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77379366delG								NFATC1 (90044 upstream) : CTDP1 (60435 downstream)																							TGTGAAATCAGTCAGTGTGAG	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	1666514	1666515	+	IGR	INS	-	CTCCTT	CTCCTT	rs148251033	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1666514_1666515insCTCCTT								TCF3 (14188 upstream) : ONECUT3 (87147 downstream)																							ctctcctcctcctccttctTCC	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	2362384	2362385	+	IGR	INS	-	TG	TG	rs147427236	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2362384_2362385insTG								SPPL2B (7285 upstream) : TMPRSS9 (27399 downstream)																							gtcattgtgcctgtgattgtgg	0.109													2	4	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153023	7153028	+	Intron	DEL	ACCACA	-	-	rs149041762	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153023_7153028delACCACA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	acacacacacaccacacacacacacc	0.170													4	3	---	---	---	---	
DOCK6	57572	broad.mit.edu	37	19	11341015	11341016	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11341015_11341016insA	uc002mqs.3	-						DOCK6_uc010xlq.1_Intron	NM_020812	NP_065863	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(2)|skin(1)	3						gactccgtctcaaaaaaaaaag	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	15004898	15004899	+	IGR	INS	-	AAAC	AAAC	rs148058190	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15004898_15004899insAAAC								OR7A17 (12731 upstream) : OR7C2 (47402 downstream)																							ctctgtctcaaaaacaaacaaa	0.267													2	5	---	---	---	---	
NOTCH3	4854	broad.mit.edu	37	19	15299340	15299340	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15299340delC	uc002nan.2	-						NOTCH3_uc002nao.1_Intron	NM_000435	NP_000426	Q9UM47	NOTC3_HUMAN	Notch homolog 3 precursor						Notch receptor processing|Notch signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			lung(8)|ovary(5)|skin(4)|prostate(2)|central_nervous_system(1)|breast(1)	21			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			CAGCCGTGGTCCCAACTGGCC	0.607													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16084309	16084309	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16084309delC								OR10H4 (23542 upstream) : LOC126536 (42135 downstream)																							tgctctccctccccctgaccc	0.000													4	2	---	---	---	---	
CHERP	10523	broad.mit.edu	37	19	16651989	16651989	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16651989delC	uc002nei.1	-						MED26_uc002nee.2_Intron|CHERP_uc002nej.2_Intron	NM_006387	NP_006378	Q8IWX8	CHERP_HUMAN	calcium homeostasis endoplasmic reticulum						cellular calcium ion homeostasis|negative regulation of cell proliferation|nervous system development|RNA processing	endoplasmic reticulum|perinuclear region of cytoplasm	RNA binding			ovary(2)	2						gatcaaACAGCGGACAACCAC	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17556737	17556738	+	Intron	INS	-	C	C	rs145880080	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17556737_17556738insC	uc002ngr.2	-											Homo sapiens cDNA clone IMAGE:5300504.																		tccaccatccactatctgatat	0.104													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17806212	17806213	+	IGR	INS	-	GG	GG	rs59536177		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17806212_17806213insGG								UNC13A (6811 upstream) : MAP1S (24090 downstream)																							aaagagagagagacagaaagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	17810514	17810514	+	IGR	DEL	G	-	-	rs56125442		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17810514delG								UNC13A (11113 upstream) : MAP1S (19789 downstream)																							aaaaaaaaaagaagaagaaga	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	20883713	20883715	+	IGR	DEL	GTA	-	-	rs146756275		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20883713_20883715delGTA								ZNF626 (39311 upstream) : ZNF85 (222365 downstream)																							AGTTGTAAATGTAGTCTCAATTT	0.305													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	24523560	24523561	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24523560_24523561insA								LOC100101266 (177311 upstream) : None (None downstream)																							agaaaaattagaaaaacgcttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30607200	30607209	+	IGR	DEL	ACACACATAT	-	-	rs144339566	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30607200_30607209delACACACATAT								C19orf2 (100589 upstream) : ZNF536 (256119 downstream)																							acacacagacacacacatatagacacacag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32561075	32561075	+	IGR	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32561075delC								TSHZ3 (720885 upstream) : ZNF507 (275439 downstream)																							GAGCCCACGTCCGAATATTCA	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32976299	32976300	+	IGR	DEL	GT	-	-	rs35801162		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32976299_32976300delGT								DPY19L3 (1063 upstream) : PDCD5 (95804 downstream)																							CGTGACAGGAgtgtgtgtgtgt	0.351													4	2	---	---	---	---	
ZNF30	90075	broad.mit.edu	37	19	35429597	35429598	+	Intron	INS	-	G	G	rs143720225	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35429597_35429598insG	uc010edp.1	+						ZNF30_uc002nxf.2_Intron|ZNF30_uc010edq.1_Intron|ZNF30_uc010edr.1_Intron	NM_194325	NP_919306	P17039	ZNF30_HUMAN	zinc finger protein 30 isoform b						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_lung(56;8.38e-08)|Lung NSC(56;1.31e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)	GBM - Glioblastoma multiforme(1328;0.0265)		cagtgcccaccggaggttcatc	0.153													4	2	---	---	---	---	
LOC100128675	100128675	broad.mit.edu	37	19	35557800	35557801	+	Intron	INS	-	CAA	CAA	rs147318605	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35557800_35557801insCAA	uc010xsi.1	-							NR_024562				SubName: Full=cDNA FLJ57934;												0						aaagtcccaggcaacaacaaca	0.000													3	6	---	---	---	---	
CD22	933	broad.mit.edu	37	19	35835072	35835073	+	Intron	INS	-	T	T	rs146822699	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35835072_35835073insT	uc010edt.2	+						CD22_uc010xst.1_Intron|CD22_uc010edu.2_Intron|CD22_uc010edv.2_Intron|CD22_uc002nzb.3_Intron|CD22_uc010edx.2_Intron	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor						cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	gcactccagcctgggtgaaaga	0.000													4	5	---	---	---	---	
GAPDHS	26330	broad.mit.edu	37	19	36032867	36032868	+	Intron	DEL	CA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36032867_36032868delCA	uc002oaf.1	+						uc010eec.1_RNA|uc002oag.2_RNA	NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,						gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)	GCCTCACAGTCACAGAGTCCAC	0.609													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36153087	36153087	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36153087delT								COX6B1 (3404 upstream) : UPK1A (4628 downstream)																							CCTTTTCAGCttttttttttt	0.045													2	4	---	---	---	---	
UPK1A	11045	broad.mit.edu	37	19	36167098	36167098	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36167098delT	uc002oaw.2	+						UPK1A_uc010eeh.2_Intron|uc002oax.1_5'Flank	NM_007000	NP_008931	O00322	UPK1A_HUMAN	uroplakin 1A						epithelial cell differentiation|protein oligomerization	endoplasmic reticulum|integral to membrane	monosaccharide binding|protein homodimerization activity				0	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			tctttctttcttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	36456669	36456670	+	IGR	DEL	CA	-	-	rs67344613		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36456669_36456670delCA								LRFN3 (20574 upstream) : SDHAF1 (29431 downstream)																							cacacacgcgcacacacacaca	0.337													5	3	---	---	---	---	
ALKBH6	84964	broad.mit.edu	37	19	36503029	36503029	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36503029delT	uc002oct.2	-						C19orf46_uc010een.1_5'Flank|ALKBH6_uc002ocv.1_Intron|ALKBH6_uc002ocx.1_Intron|ALKBH6_uc002ocw.1_Intron|ALKBH6_uc010eeo.1_Intron|ALKBH6_uc010eep.1_Intron|uc002ocy.2_5'Flank	NM_032878	NP_116267	Q3KRA9	ALKB6_HUMAN	alkB, alkylation repair homolog 6 isoform 2							cytoplasm|nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			gccactgcagtccagcctggg	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	37669914	37669914	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37669914delT								ZNF585A (6299 upstream) : ZNF585B (5810 downstream)																							CATTCTGACATTAGGGCAAGT	0.488													4	2	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37933441	37933441	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37933441delA	uc002ogi.2	-						ZNF569_uc002ogh.2_Intron|ZNF569_uc002ogj.2_Intron	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			agatggtattaagcagagaag	0.000													4	2	---	---	---	---	
ZNF569	148266	broad.mit.edu	37	19	37953321	37953321	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37953321delA	uc002ogi.2	-						ZNF569_uc002ogj.2_Intron	NM_152484	NP_689697	Q5MCW4	ZN569_HUMAN	zinc finger protein 569						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(2)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ttccatttagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SIPA1L3	23094	broad.mit.edu	37	19	38416785	38416785	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38416785delC	uc002ohk.2	+							NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ctaaCAGCTTCCTTTCAGGAA	0.299													4	4	---	---	---	---	
SIPA1L3	23094	broad.mit.edu	37	19	38524310	38524317	+	Intron	DEL	CGTATGTG	-	-	rs113291718		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38524310_38524317delCGTATGTG	uc002ohk.2	+							NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like						regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			gagaGAGATACgtatgtgtgtgtgtgtg	0.168													6	3	---	---	---	---	
SARS2	54938	broad.mit.edu	37	19	39407225	39407226	+	Intron	INS	-	G	G	rs141826588	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39407225_39407226insG	uc002oka.2	-						SARS2_uc002ojz.2_Intron|SARS2_uc010xup.1_Intron|SARS2_uc002okb.2_Intron|SARS2_uc010xuq.1_Intron	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor						seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GGTTGATGGGAGGGGAAAAAGG	0.485													1	7	---	---	---	---	
CYP2A7	1549	broad.mit.edu	37	19	41399557	41399558	+	Intron	INS	-	T	T	rs113899786		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41399557_41399558insT	uc002opo.2	-						uc002opp.1_Intron	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TGAGTCTGGACTTTTTTTTTTT	0.446													4	2	---	---	---	---	
CYP2F1	1572	broad.mit.edu	37	19	41862757	41862757	+	Intron	DEL	A	-	-	rs66960437		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41862757delA	uc010xvw.1	+						TGFB1_uc002oqh.1_5'Flank|TMEM91_uc002oqi.2_Intron|B9D2_uc002oqj.2_Intron			P24903	CP2F1_HUMAN	SubName: Full=cDNA FLJ51986, highly similar to Homo sapiens cytochrome P450, family 2, subfamily F, polypeptide 1 (CYP2F1), mRNA;						naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						ctctgtctccaaaaaaaaaaa	0.259													1	6	---	---	---	---	
GLTSCR1	29998	broad.mit.edu	37	19	48175835	48175838	+	Intron	DEL	TGGA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48175835_48175838delTGGA	uc002phh.3	+							NM_015711	NP_056526	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1								protein binding			pancreas(3)	3		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GATAAAGAAGtggatggatggatg	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54487240	54487241	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54487240_54487241insA								CACNG8 (1101 upstream) : CACNG6 (8301 downstream)																							gtgaATGGTGTACAAAGGGAAG	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	55209855	55209855	+	IGR	DEL	G	-	-	rs11332118		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55209855delG								LILRB4 (30011 upstream) : LILRP2 (9746 downstream)																							GACAGGGGATGGGGGGGAGGG	0.657													2	4	---	---	---	---	
C20orf30	29058	broad.mit.edu	37	20	5059557	5059558	+	Intron	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5059557_5059558insC	uc010gbi.2	-							NM_014145	NP_054864	Q96A57	CT030_HUMAN	hypothetical protein LOC29058 isoform 2							integral to membrane					0						tgcctcagccttccaagtagct	0.054													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6189846	6189847	+	IGR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6189846_6189847delTC								FERMT1 (85655 upstream) : BMP2 (558898 downstream)																							tctttcctcttctctttctttc	0.000													4	3	---	---	---	---	
SEL1L2	80343	broad.mit.edu	37	20	13912073	13912073	+	Intron	DEL	A	-	-	rs11087068		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13912073delA	uc010gcf.2	-						SEL1L2_uc002woq.3_Intron|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_Intron	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor							integral to membrane	binding			ovary(2)	2						accctgtctcaaaaaaataaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	18043297	18043297	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18043297delG								OVOL2 (4776 upstream) : CSRP2BP (75230 downstream)																							cagGTTGAAAGGAGGCAGGTA	0.229													4	2	---	---	---	---	
RIN2	54453	broad.mit.edu	37	20	19905106	19905106	+	Intron	DEL	T	-	-	rs79521230	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19905106delT	uc002wro.1	+						RIN2_uc010gcu.1_Intron	NM_018993	NP_061866	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2						endocytosis|small GTPase mediated signal transduction	cytoplasm	GTPase activator activity|Rab guanyl-nucleotide exchange factor activity			lung(4)|ovary(1)	5						cttcataccctcaccttcata	0.070													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26117648	26117649	+	IGR	INS	-	A	A	rs149172160		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26117648_26117649insA								C20orf191 (22971 upstream) : MIR663 (71173 downstream)																							gaggaacgggggaaagactatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29507910	29507911	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29507910_29507911delGT								None (None upstream) : FRG1B (103968 downstream)																							GGTCAtgtgagtgtgtgtgtgt	0.421													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29589550	29589550	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29589550delT								None (None upstream) : FRG1B (22329 downstream)																							tgacctaagatttgatctatc	0.000													8	5	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29633770	29633771	+	Intron	INS	-	AA	AA	rs145484297	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29633770_29633771insAA	uc010ztl.1	+						FRG1B_uc002wvm.1_Intron|FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TATTTTAATATGTGTTGTGGTA	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29946152	29946152	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29946152delG								DEFB116 (49764 upstream) : DEFB118 (10276 downstream)																							gaagaaacatgggggaaaagc	0.000													4	2	---	---	---	---	
CTNNBL1	56259	broad.mit.edu	37	20	36319795	36319797	+	5'Flank	DEL	CAA	-	-	rs116554188	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36319795_36319797delCAA	uc010zvw.1	+						CTNNBL1_uc010zvv.1_5'Flank	NM_030877	NP_110517	Q8WYA6	CTBL1_HUMAN	beta catenin-like 1						apoptosis|positive regulation of apoptosis|somatic diversification of immunoglobulins	nucleus	enzyme binding			ovary(2)	2		Myeloproliferative disorder(115;0.00878)				acaacaacagcaacaacaacaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36515056	36515057	+	IGR	DEL	CC	-	-	rs11468903		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36515056_36515057delCC								CTNNBL1 (14537 upstream) : VSTM2L (16442 downstream)																							GGATGGGGCTCCCCCCGGGTGG	0.520													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37256286	37256286	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37256286delG								ADIG (39182 upstream) : SLC32A1 (96819 downstream)																							gggtgtgtgtggggtgtgttg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37880308	37880309	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37880308_37880309insT								LOC339568 (26917 upstream) : None (None downstream)																							AAATAAATGGATGGATGAGAGA	0.282													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	39599581	39599581	+	IGR	DEL	A	-	-	rs112700047		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39599581delA								MAFB (281705 upstream) : TOP1 (57881 downstream)																							tctctgacttaaaaaaaaaaa	0.159													4	2	---	---	---	---	
ADA	100	broad.mit.edu	37	20	43264544	43264544	+	Intron	DEL	A	-	-	rs74928427		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43264544delA	uc002xmj.2	-						ADA_uc010ggt.2_Intron	NM_000022	NP_000013	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process|cell adhesion|hypoxanthine salvage|inosine biosynthetic process|negative regulation of adenosine receptor signaling pathway|purine nucleotide salvage|purine ribonucleoside monophosphate biosynthetic process|regulation of cell-cell adhesion mediated by integrin|response to hypoxia|T cell activation	cell junction|cytoplasmic membrane-bounded vesicle lumen|cytosol|external side of plasma membrane|lysosome	adenosine deaminase activity|protein binding|zinc ion binding			pancreas(2)|ovary(1)	3		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Cladribine(DB00242)|Dipyridamole(DB00975)|Erythromycin(DB00199)|Fludarabine(DB01073)|Idoxuridine(DB00249)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	atctcaaaagaaaaaaaaaaa	0.274									Adenosine_Deaminase_Deficiency				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46120915	46120916	+	IGR	INS	-	AA	AA	rs144540848		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46120915_46120916insAA								ZMYND8 (135441 upstream) : NCOA3 (9741 downstream)																							gcaaaactgtcaaaaaaaaaaa	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55324935	55324936	+	IGR	DEL	CT	-	-	rs11467830		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55324935_55324936delCT								TFAP2C (110599 upstream) : BMP7 (418873 downstream)																							tgctctgtgGctctctctctct	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55542834	55542834	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55542834delT								TFAP2C (328498 upstream) : BMP7 (200975 downstream)																							GGAATCTGCATTTTTTTTTCC	0.308													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58104856	58104857	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58104856_58104857insT								EDN3 (203810 upstream) : PHACTR3 (47707 downstream)																							aatagatagtcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61712858	61712859	+	Intron	INS	-	A	A	rs139097802	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61712858_61712859insA	uc002yec.1	+											Homo sapiens cDNA FLJ46471 fis, clone THYMU3023394.																		GCGTGCGAAACCATGCATGGTC	0.564													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9415664	9415665	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9415664_9415665insT								None (None upstream) : None (None downstream)																							tctacacaacattttttccgtt	0.015													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9588129	9588130	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9588129_9588130insA								None (None upstream) : None (None downstream)																							atttaaaaaTTAAAAAAAAAAA	0.173													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9828225	9828226	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9828225_9828226insT								None (None upstream) : None (None downstream)																							catccatttgctggaagagctc	0.050													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9833418	9833418	+	IGR	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9833418delG								None (None upstream) : None (None downstream)																							GGTTGGGTTTGTGAACAAATA	0.343													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10518716	10518717	+	Intron	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10518716_10518717insT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		gctgggcgtggtggcaggtgcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10535339	10535340	+	Intron	INS	-	GG	GG	rs71261238		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10535339_10535340insGG	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		cgctgctggctggggtggccag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10756596	10756599	+	IGR	DEL	TCAA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10756596_10756599delTCAA								None (None upstream) : TPTE (150144 downstream)																							tccaaactgctcaatcaaagaaaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10854786	10854787	+	IGR	INS	-	ATGGA	ATGGA	rs113871072		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10854786_10854787insATGGA								None (None upstream) : TPTE (51956 downstream)																							aatcgaaagggatggaatggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10894837	10894838	+	IGR	INS	-	TTC	TTC	rs149040382	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10894837_10894838insTTC								None (None upstream) : TPTE (11905 downstream)																							tcctctttcttttttttctttt	0.020													4	8	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11028180	11028180	+	Intron	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11028180delT	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAGTCAAAAATTTATGGTGAT	0.333													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11044669	11044669	+	Intron	DEL	G	-	-	rs28375420		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11044669delG	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		cacagcataagcttttaacca	0.119													4	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11076555	11076557	+	Intron	DEL	TAA	-	-	rs151275384		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11076555_11076557delTAA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		tctaatttgttaataataatata	0.000													7	6	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11091025	11091026	+	Intron	INS	-	A	A	rs144528420		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11091025_11091026insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		agagaaggtagaagaggaggta	0.000													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11149249	11149249	+	IGR	DEL	C	-	-	rs55718578		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11149249delC								BAGE (50312 upstream) : None (None downstream)																							tcactgcaagctctgcctcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14362019	14362020	+	IGR	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14362019_14362020insC								None (None upstream) : C21orf99 (48467 downstream)																							gtgtttccaaactggtcaatca	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14362686	14362687	+	IGR	DEL	GT	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14362686_14362687delGT								None (None upstream) : C21orf99 (47800 downstream)																							tacaaaaatagtgtttccaaac	0.000													5	3	---	---	---	---	
RUNX1	861	broad.mit.edu	37	21	36708065	36708065	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:36708065delA	uc002yut.1	-									Q01196	RUNX1_HUMAN	Synthetic construct DNA, clone: pF1KB4846, Homo sapiens RUNX1 gene for runt-related transcription factor 1, complete cds, without stop codon, in Flexi system.						myeloid cell differentiation|negative regulation of granulocyte differentiation|positive regulation of angiogenesis|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent	nucleus|nucleus	ATP binding|calcium ion binding|DNA binding|DNA binding|protein binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			haematopoietic_and_lymphoid_tissue(383)|lung(2)|ovary(1)|central_nervous_system(1)	387						GATGGAAAAGAAAAAAAAAAA	0.398			T	RPL22|MDS1|EVI1|CBFA2T3|CBFA2T1|ETV6|LAF4	AML|preB- ALL|T-ALL				Platelet_disorder_associated_with_Myeloid_Malignancies				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	41337504	41337505	+	IGR	DEL	CA	-	-	rs112084177		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:41337504_41337505delCA								PCP4 (36184 upstream) : DSCAM (46838 downstream)																							cacacacatgcacacacacaca	0.282													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	44030057	44030060	+	Intron	DEL	CGCA	-	-	rs67305845		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44030057_44030060delCGCA	uc002zbk.1	-											Homo sapiens, clone IMAGE:5189363, mRNA.																		gccatgtgaccgcacccaaccaca	0.078													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16361044	16361044	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16361044delT								POTEH (73107 upstream) : OR11H1 (87782 downstream)																							ctcttatttctTTTTTTTTTT	0.209													6	3	---	---	---	---	
psiTPTE22	387590	broad.mit.edu	37	22	17131430	17131432	+	Intron	DEL	CAC	-	-	rs142037179		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17131430_17131432delCAC	uc002zls.1	+						psiTPTE22_uc002zlt.2_Intron					Homo sapiens cDNA FLJ10437 fis, clone NT2RP1000581.												0						caccatccatcaccaacagaaac	0.187													8	4	---	---	---	---	
IL17RA	23765	broad.mit.edu	37	22	17584771	17584771	+	Intron	DEL	G	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17584771delG	uc002zly.2	+						IL17RA_uc010gqt.2_Intron	NM_014339	NP_055154	Q96F46	I17RA_HUMAN	interleukin 17A receptor precursor						fibroblast activation|positive regulation of interleukin-23 production	integral to plasma membrane	interleukin-17 receptor activity			skin(2)	2		all_epithelial(15;0.0181)|Lung NSC(13;0.109)|all_lung(157;0.132)		Colorectal(9;0.241)		tggtgtggctgggagtgggga	0.040													4	2	---	---	---	---	
MICAL3	57553	broad.mit.edu	37	22	18496882	18496883	+	Intron	INS	-	AC	AC	rs137998959	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18496882_18496883insAC	uc002zng.3	-						MICAL3_uc002znh.2_Intron|MICAL3_uc010grf.2_Intron|MICAL3_uc011agm.1_Intron	NM_015241	NP_056056	Q7RTP6	MICA3_HUMAN	microtubule associated monoxygenase, calponin							cytoplasm|cytoskeleton	monooxygenase activity|zinc ion binding				0		all_epithelial(15;0.198)		Lung(27;0.0427)		CCCTCTCTTAGacacacacaca	0.223													5	3	---	---	---	---	
HIRA	7290	broad.mit.edu	37	22	19407564	19407565	+	Intron	DEL	TG	-	-	rs72224062		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19407564_19407565delTG	uc002zpf.1	-						HIRA_uc011agx.1_Intron|HIRA_uc010grn.1_Intron|HIRA_uc010gro.1_Intron|HIRA_uc010grp.2_Intron	NM_003325	NP_003316	P54198	HIRA_HUMAN	HIR histone cell cycle regulation defective						chromatin modification|regulation of transcription from RNA polymerase II promoter	PML body	chromatin binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(1)	1	Colorectal(54;0.0993)					ATACAACCATtgtgtgtgtgtg	0.351													4	2	---	---	---	---	
RTN4R	65078	broad.mit.edu	37	22	20239261	20239262	+	Intron	INS	-	CATTACCAT	CATTACCAT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20239261_20239262insCATTACCAT	uc002zrv.2	-						MIR1286_hsa-mir-1286|MI0006348_5'Flank	NM_023004	NP_075380	Q9BZR6	RTN4R_HUMAN	reticulon 4 receptor precursor						axonogenesis|negative regulation of axonogenesis|nerve growth factor receptor signaling pathway	anchored to membrane|cell surface|endoplasmic reticulum|plasma membrane	protein binding|receptor activity				0	Colorectal(54;0.0993)					accatcatcaccatcactatca	0.000													4	2	---	---	---	---	
MN1	4330	broad.mit.edu	37	22	28181045	28181050	+	Intron	DEL	CACACA	-	-	rs71315058		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28181045_28181050delCACACA	uc003adj.2	-						MN1_uc010gvg.2_Intron	NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1								binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						TGGCATCCGCcacacacacacacaca	0.320			T	ETV6	AML|meningioma								4	2	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28615194	28615195	+	Intron	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28615194_28615195insA	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						caaaaataaagaaaaaaaaaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	33656414	33656414	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:33656414delT								SYN3 (202037 upstream) : LARGE (12649 downstream)																							aggcatgggctttggggtctg	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	35152944	35152944	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35152944delT								LARGE (834360 upstream) : ISX (309185 downstream)																							TGTGTGCTCCTTTGGTTCTTc	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	39510090	39510090	+	IGR	DEL	A	-	-	rs34968997		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39510090delA								APOBEC3H (10020 upstream) : CBX7 (16700 downstream)																							ccctatcttcaaaaaaaaaaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	40737105	40737105	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40737105delA								TNRC6B (5294 upstream) : ADSL (5399 downstream)																							CTCAAGAAACAAAAAAAAATT	0.328													4	2	---	---	---	---	
EFCAB6	64800	broad.mit.edu	37	22	44126142	44126143	+	Intron	INS	-	GAT	GAT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44126142_44126143insGAT	uc003bdy.1	-						EFCAB6_uc003bdz.1_Intron|EFCAB6_uc010gzi.1_Intron|EFCAB6_uc010gzk.1_Intron|EFCAB6_uc011aqa.1_Intron|EFCAB6_uc003bea.1_Intron|EFCAB6_uc003beb.3_Intron	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				aaggaggaaagggagcgaggga	0.000													5	4	---	---	---	---	
CERK	64781	broad.mit.edu	37	22	47086953	47086954	+	Intron	INS	-	AC	AC	rs141210280	by1000genomes	TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47086953_47086954insAC	uc003bia.2	-						CERK_uc010hae.2_Intron	NM_022766	NP_073603	Q8TCT0	CERK1_HUMAN	ceramide kinase						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|ceramide metabolic process	integral to membrane of membrane fraction|membrane|nucleus	ATP binding|ceramide kinase activity|diacylglycerol kinase activity|magnesium ion binding			skin(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		tatacatacatacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	50068942	50068945	+	IGR	DEL	GGAG	-	-	rs35207498		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50068942_50068945delGGAG								C22orf34 (17752 upstream) : BRD1 (97993 downstream)																							aggaaagaaaggagggagggaggg	0.005													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	442427	442428	+	IGR	INS	-	AGGA	AGGA			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:442427_442428insAGGA								PPP2R3B (94800 upstream) : SHOX (142651 downstream)																							gaaggagacggaggaaggagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	685596	685597	+	IGR	INS	-	C	C			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:685596_685597insC								SHOX (65451 upstream) : CRLF2 (629290 downstream)																							GCAGGGACCCTCCCCACCTGAG	0.579													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1959360	1959361	+	IGR	INS	-	CTTA	CTTA			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1959360_1959361insCTTA								ASMT (197387 upstream) : DHRSX (178196 downstream)																							gatgggcatttcttacttttag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	53043948	53043948	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53043948delA								FAM156A (106365 upstream) : GPR173 (34558 downstream)																							agaccttgccaaaaaaaaaaa	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61861438	61861438	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61861438delT								None (None upstream) : SPIN4 (705670 downstream)																							tatcttcacataaaaactgga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	74155987	74155987	+	IGR	DEL	A	-	-	rs74414348		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74155987delA								KIAA2022 (10700 upstream) : ABCB7 (117120 downstream)																							atccagttagaaaaaaaaaaa	0.000													3	3	---	---	---	---	
ATRX	546	broad.mit.edu	37	X	76819171	76819172	+	Intron	INS	-	GTGT	GTGT			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:76819171_76819172insGTGT	uc004ecp.3	-						ATRX_uc004ecq.3_Intron|ATRX_uc004eco.3_Intron	NM_000489	NP_000480	P46100	ATRX_HUMAN	transcriptional regulator ATRX isoform 1						DNA methylation|DNA recombination|DNA repair|regulation of transcription, DNA-dependent	nuclear heterochromatin	ATP binding|chromo shadow domain binding|DNA binding|DNA helicase activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(14)|pancreas(12)|lung(1)|breast(1)|skin(1)|kidney(1)	30					Phosphatidylserine(DB00144)	tgtgtacatgcgtgtgtgtgtg	0.000			Mis|F|N		Pancreatic neuroendocrine tumors		ATR-X (alpha thalassemia/mental retardation) syndrome						3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	80072502	80072503	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:80072502_80072503insA								BRWD3 (7269 upstream) : HMGN5 (296697 downstream)																							gaaggaagcagaaaaaaaaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	88461626	88461628	+	IGR	DEL	GTT	-	-	rs67179957		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88461626_88461628delGTT								CPXCR1 (451843 upstream) : TGIF2LX (715312 downstream)																							TACATTCGTCGTTGTCGTGAAAT	0.335													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	95494960	95494961	+	IGR	INS	-	T	T			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:95494960_95494961insT								None (None upstream) : LOC643486 (97125 downstream)																							attattgttaattttttttttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	98257355	98257355	+	IGR	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:98257355delA								None (None upstream) : LOC442459 (459245 downstream)																							tggcttaaagaaaaacactaa	0.000													4	2	---	---	---	---	
NUP62CL	54830	broad.mit.edu	37	X	106433059	106433066	+	Intron	DEL	GGAAGGAA	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106433059_106433066delGGAAGGAA	uc004ena.2	-						NUP62CL_uc004enb.2_Intron	NM_017681	NP_060151	Q9H1M0	N62CL_HUMAN	nucleoporin 62kDa C-terminal like						protein transport	nuclear pore	structural constituent of nuclear pore				0						aaagaaggagggaaggaaggaaggaagg	0.000													9	5	---	---	---	---	
CXorf41	139212	broad.mit.edu	37	X	106471779	106471779	+	Intron	DEL	A	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106471779delA	uc004enc.2	+						CXorf41_uc004end.2_Intron	NM_173494	NP_775765	Q9NQM4	CX041_HUMAN	hypothetical protein LOC139212												0						aacaaacagtaaaaaaaaaaa	0.065													5	3	---	---	---	---	
COL4A6	1288	broad.mit.edu	37	X	107603638	107603638	+	Intron	DEL	C	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107603638delC	uc004enw.3	-						COL4A6_uc004env.3_Intron|COL4A6_uc011msn.1_Intron|COL4A6_uc010npk.2_Intron|COL4A6_uc004enx.2_Intron|COL4A6_uc004eny.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor						cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						GAATTTACTTCCCCAAACTAT	0.274									Alport_syndrome_with_Diffuse_Leiomyomatosis				4	2	---	---	---	---	
TRPC5	7224	broad.mit.edu	37	X	111053110	111053111	+	Intron	INS	-	T	T	rs113643677		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111053110_111053111insT	uc004epl.1	-						TRPC5_uc004epm.1_Intron	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,						axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TCTTCAttttgttttttttttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	117839335	117839336	+	IGR	INS	-	A	A			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117839335_117839336insA								DOCK11 (19212 upstream) : IL13RA1 (22223 downstream)																							ctccgtctcagaaaaaaaaaaa	0.084													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	118954590	118954590	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118954590delT								RPL39 (28984 upstream) : UPF3B (13399 downstream)																							gcctggccaattttttttttt	0.000													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155238667	155238668	+	Intron	DEL	TG	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155238667_155238668delTG	uc004fnv.1	+						IL9R_uc004fnu.1_Intron	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor						cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					tgtgtgtgtttgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9956897	9956899	+	IGR	DEL	GTG	-	-	rs112328349		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9956897_9956899delGTG								TTTY22 (306043 upstream) : None (None downstream)																							cccagcagcagtgttctggaatc	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13285655	13285656	+	IGR	INS	-	GA	GA	rs113499634		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13285655_13285656insGA								None (None upstream) : None (None downstream)																							caataccacgggggggtgtata	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13399277	13399277	+	IGR	DEL	T	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13399277delT								None (None upstream) : None (None downstream)																							tgtatcagcctaaTACAACGG	0.413													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13634412	13634413	+	IGR	DEL	TC	-	-			TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13634412_13634413delTC								None (None upstream) : None (None downstream)																							atcactgcaatctctgtctctg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58979741	58979742	+	IGR	INS	-	ATCTG	ATCTG	rs10449153		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58979741_58979742insATCTG								None (None upstream) : None (None downstream)																							atcccattccactccattccac	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	59013019	59013019	+	IGR	DEL	A	-	-	rs148494923		TCGA-18-3412-01	TCGA-18-3412-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:59013019delA								None (None upstream) : None (None downstream)																							gtctcaaaagaaaaaaaaaaT	0.189													4	3	---	---	---	---	
