Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
B3GALT6	126792	broad.mit.edu	37	1	1168120	1168120	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1168120G>A	uc001adk.2	+	1	492	c.462G>A	c.(460-462)AAG>AAA	p.K154K	SDF4_uc001adh.3_5'Flank|SDF4_uc001adi.3_5'Flank|SDF4_uc009vjv.2_5'Flank|SDF4_uc009vjw.2_5'Flank	NM_080605	NP_542172	Q96L58	B3GT6_HUMAN	beta-1,3-galactosyltransferase 6	154	Lumenal (Potential).				glycosaminoglycan biosynthetic process|protein glycosylation	Golgi cisterna membrane|Golgi medial cisterna|integral to membrane	galactosylxylosylprotein 3-beta-galactosyltransferase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.22e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		TCGTGCTCAAGGCGGACGACG	0.567													12	15	---	---	---	---	PASS
C1orf187	374946	broad.mit.edu	37	1	11766366	11766366	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11766366G>T	uc001asr.1	+	2	191	c.51G>T	c.(49-51)CTG>CTT	p.L17L		NM_198545	NP_940947	Q8NBI3	DRAXI_HUMAN	chromosome 1 open reading frame 187 precursor	17					axon guidance|commissural neuron differentiation in spinal cord|dorsal spinal cord development|forebrain development|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	extracellular region					0	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00826)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.48e-06)|COAD - Colon adenocarcinoma(227;0.000283)|BRCA - Breast invasive adenocarcinoma(304;0.000316)|Kidney(185;0.000841)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|STAD - Stomach adenocarcinoma(313;0.00754)|READ - Rectum adenocarcinoma(331;0.0651)		TCGTCCTCCTGCTGCCCCTGG	0.657													9	12	---	---	---	---	PASS
LUZP1	7798	broad.mit.edu	37	1	23419271	23419271	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23419271C>A	uc001bgk.2	-	4	1868	c.1484G>T	c.(1483-1485)GGC>GTC	p.G495V	LUZP1_uc010odv.1_Missense_Mutation_p.G495V|LUZP1_uc001bgl.2_Missense_Mutation_p.G495V|LUZP1_uc001bgm.1_Missense_Mutation_p.G495V	NM_033631	NP_361013	Q86V48	LUZP1_HUMAN	leucine zipper protein 1	495						nucleus					0		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		GCTCTCGGTGCCTGGCTTGGA	0.572													35	255	---	---	---	---	PASS
C1orf213	148898	broad.mit.edu	37	1	23698022	23698022	+	3'UTR	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23698022A>G	uc001bgw.2	+	1					ZNF436_uc001bgu.2_5'Flank|C1orf213_uc001bgv.2_3'UTR	NM_138479	NP_612488			hypothetical protein LOC148898 isoform 1												0		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;4.97e-26)|Colorectal(126;4.8e-08)|COAD - Colon adenocarcinoma(152;2.83e-06)|GBM - Glioblastoma multiforme(114;5.23e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000946)|KIRC - Kidney renal clear cell carcinoma(1967;0.00314)|STAD - Stomach adenocarcinoma(196;0.0123)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0827)|LUSC - Lung squamous cell carcinoma(448;0.184)		ATGAGTACCTACTGTGTGTAG	0.254													14	45	---	---	---	---	PASS
CLSPN	63967	broad.mit.edu	37	1	36205073	36205073	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36205073G>A	uc001bzi.2	-	19	3281	c.3201C>T	c.(3199-3201)AGC>AGT	p.S1067S	CLSPN_uc009vux.2_Silent_p.S1003S	NM_022111	NP_071394	Q9HAW4	CLSPN_HUMAN	claspin	1067					activation of protein kinase activity|cell cycle|cellular component disassembly involved in apoptosis|DNA repair|DNA replication|G2/M transition DNA damage checkpoint|mitotic cell cycle DNA replication checkpoint|peptidyl-serine phosphorylation	nucleoplasm	anaphase-promoting complex binding|DNA binding			breast(2)|ovary(2)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACTCATCTTCGCTTCCCACAT	0.398													14	215	---	---	---	---	PASS
GPBP1L1	60313	broad.mit.edu	37	1	46106068	46106068	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46106068C>A	uc001coq.2	-	8	1919	c.558G>T	c.(556-558)CCG>CCT	p.P186P		NM_021639	NP_067652	Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	186					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGGCACTAGGCGGGTTTTCTG	0.443													4	271	---	---	---	---	PASS
TTC39A	22996	broad.mit.edu	37	1	51771650	51771650	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51771650A>T	uc001csl.2	-	7	800	c.695T>A	c.(694-696)CTG>CAG	p.L232Q	TTC39A_uc001csk.2_Missense_Mutation_p.L197Q|TTC39A_uc010ond.1_Missense_Mutation_p.L169Q|TTC39A_uc010one.1_Missense_Mutation_p.L196Q|TTC39A_uc010onf.1_Missense_Mutation_p.L200Q|TTC39A_uc001csn.2_Missense_Mutation_p.L231Q|TTC39A_uc001cso.1_Missense_Mutation_p.L228Q|TTC39A_uc009vyy.1_Missense_Mutation_p.L169Q	NM_001080494	NP_001073963	Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A isoform 2	232							binding			skin(1)	1						AGCACTCACCAGGTTGAAGGC	0.567													10	73	---	---	---	---	PASS
KTI12	112970	broad.mit.edu	37	1	52498725	52498725	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52498725C>A	uc001ctj.1	-	1	748	c.709G>T	c.(709-711)GAG>TAG	p.E237*	TXNDC12_uc001cti.2_Intron	NM_138417	NP_612426	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated	237							ATP binding			central_nervous_system(2)	2						GGCAACGGCTCCTCTAGGCCC	0.637													35	82	---	---	---	---	PASS
FAM159A	348378	broad.mit.edu	37	1	53108627	53108627	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53108627C>A	uc001cuf.2	+	2	375	c.275C>A	c.(274-276)TCT>TAT	p.S92Y	FAM159A_uc001cug.1_RNA|FAM159A_uc001cuh.2_RNA	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378	92						integral to membrane					0						TTCATCAGCTCTAAGCCCCAC	0.522													4	206	---	---	---	---	PASS
YIPF1	54432	broad.mit.edu	37	1	54344035	54344035	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54344035C>A	uc001cvu.2	-	6	654	c.317G>T	c.(316-318)GGG>GTG	p.G106V	YIPF1_uc001cvv.2_RNA|YIPF1_uc001cvw.2_RNA|YIPF1_uc001cvx.2_RNA|YIPF1_uc001cvy.2_RNA	NM_018982	NP_061855	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	106	Cytoplasmic (Potential).					integral to membrane|transport vesicle				large_intestine(1)|ovary(1)	2						AAAGTTTTTCCCGGGTATTGG	0.348													69	196	---	---	---	---	PASS
YIPF1	54432	broad.mit.edu	37	1	54344036	54344036	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54344036C>T	uc001cvu.2	-	6	653	c.316G>A	c.(316-318)GGG>AGG	p.G106R	YIPF1_uc001cvv.2_RNA|YIPF1_uc001cvw.2_RNA|YIPF1_uc001cvx.2_RNA|YIPF1_uc001cvy.2_RNA	NM_018982	NP_061855	Q9Y548	YIPF1_HUMAN	Yip1 domain family, member 1	106	Cytoplasmic (Potential).					integral to membrane|transport vesicle				large_intestine(1)|ovary(1)	2						AAGTTTTTCCCGGGTATTGGC	0.348													67	193	---	---	---	---	PASS
BSND	7809	broad.mit.edu	37	1	55470715	55470715	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55470715C>T	uc001cye.2	+	2	441	c.198C>T	c.(196-198)GAC>GAT	p.D66D		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	66	Cytoplasmic (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						TCCCTGCTGACTCTGACTTTC	0.592													4	115	---	---	---	---	PASS
BSND	7809	broad.mit.edu	37	1	55473948	55473948	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55473948G>C	uc001cye.2	+	4	853	c.610G>C	c.(610-612)GAC>CAC	p.D204H		NM_057176	NP_476517	Q8WZ55	BSND_HUMAN	barttin	204	Cytoplasmic (Potential).					basolateral plasma membrane|cytoplasm|integral to plasma membrane|protein complex				ovary(1)|skin(1)	2						CCTGGACATGGACTCCAGTGA	0.567													6	53	---	---	---	---	PASS
C8B	732	broad.mit.edu	37	1	57420497	57420497	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57420497C>A	uc001cyp.2	-	4	462	c.395G>T	c.(394-396)AGG>ATG	p.R132M	C8B_uc010oon.1_Missense_Mutation_p.R70M|C8B_uc010ooo.1_Missense_Mutation_p.R80M	NM_000066	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	132	LDL-receptor class A.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	membrane attack complex				central_nervous_system(2)|large_intestine(1)|ovary(1)	4						GTTTACACACCTTCCTAGAAT	0.428													7	100	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66102465	66102465	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66102465G>T	uc001dci.2	+	20	3467	c.3265G>T	c.(3265-3267)GAG>TAG	p.E1089*	LEPR_uc009waq.2_3'UTR	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	1089	Cytoplasmic (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CAAAAAGAGAGAGAGTGGTGT	0.418													37	88	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74665362	74665362	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74665362C>G	uc001dge.1	+	2	113	c.97C>G	c.(97-99)CGT>GGT	p.R33G	LRRIQ3_uc001dfy.3_5'Flank|LRRIQ3_uc001dfz.3_5'Flank|TNNI3K_uc001dgc.1_Missense_Mutation_p.R33G|TNNI3K_uc001dgd.2_Missense_Mutation_p.R33G|FPGT_uc010oqt.1_5'UTR|FPGT_uc010oqu.1_Missense_Mutation_p.R33G|FPGT_uc001dgb.1_Missense_Mutation_p.R33G|FPGT_uc010oqv.1_Missense_Mutation_p.R33G	NM_001112808	NP_001106279	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform a	Error:Variant_position_missing_in_Q59H18_after_alignment						cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						ACTTGTAGCACGTGGAGAATT	0.373													10	97	---	---	---	---	PASS
CTTNBP2NL	55917	broad.mit.edu	37	1	112999369	112999369	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112999369G>A	uc001ebx.2	+	6	1483	c.1255G>A	c.(1255-1257)GCC>ACC	p.A419T	CTTNBP2NL_uc001ebz.2_5'Flank	NM_018704	NP_061174	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	419						actin cytoskeleton	protein binding			central_nervous_system(2)|ovary(1)	3		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAGCAGCACTGCCTCCTCCTC	0.567													139	263	---	---	---	---	PASS
HIST2H2BF	440689	broad.mit.edu	37	1	149783693	149783693	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149783693G>T	uc001esr.2	-	1	236	c.186C>A	c.(184-186)ATC>ATA	p.I62I	HIST2H2BF_uc010pbj.1_Silent_p.I62I|HIST2H2BF_uc010pbk.1_Silent_p.I62I	NM_001024599	NP_001019770	Q5QNW6	H2B2F_HUMAN	histone cluster 2, H2bf isoform a	62					nucleosome assembly	nucleosome|nucleus	DNA binding				0	Breast(34;0.0124)|all_hematologic(923;0.127)					AGGAGTTCATGATGCCCATGG	0.612													4	321	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152188497	152188497	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152188497C>G	uc001ezt.1	-	3	5684	c.5608G>C	c.(5608-5610)GGA>CGA	p.G1870R		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	1870	20.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACCAAATCCAGAAGACTGA	0.577													15	802	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155736467	155736467	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155736467G>T	uc001flz.2	-	21	2894	c.2797C>A	c.(2797-2799)CAC>AAC	p.H933N	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Missense_Mutation_p.H933N|GON4L_uc009wrh.1_Missense_Mutation_p.H933N|GON4L_uc001fma.1_Missense_Mutation_p.H933N|GON4L_uc001fmb.3_Missense_Mutation_p.H129N|GON4L_uc001fmc.2_Missense_Mutation_p.H933N|GON4L_uc001fmd.3_Missense_Mutation_p.H933N|GON4L_uc009wri.2_Missense_Mutation_p.H519N	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	933					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCAGCCATGTGCCGCAGTTCT	0.428													4	161	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158627256	158627256	+	Intron	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158627256C>A	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TTAAACCCACCCCCACCTTAC	0.433													72	95	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160143418	160143418	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160143418C>A	uc001fve.3	+	13	2381	c.1902C>A	c.(1900-1902)GCC>GCA	p.A634A	ATP1A4_uc001fvf.3_RNA|ATP1A4_uc001fvg.2_Silent_p.A137A	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1	634	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			AGGCCATTGCCAAGGGTGTGG	0.542													79	223	---	---	---	---	PASS
FCGR2A	2212	broad.mit.edu	37	1	161487886	161487886	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161487886A>T	uc001gan.2	+	7	955	c.902A>T	c.(901-903)AAA>ATA	p.K301I	FCGR2A_uc001gam.2_Missense_Mutation_p.K300I|FCGR2A_uc001gao.2_RNA	NM_001136219	NP_001129691	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor	301	Cytoplasmic (Potential).					integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	GACGATGATAAAAACATCTAC	0.398													64	586	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175092665	175092665	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175092665G>T	uc001gkl.1	+	12	2893	c.2780G>T	c.(2779-2781)AGG>ATG	p.R927M		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	927	Fibronectin type-III 8.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GGAGAGACCAGGGAGGTTCCG	0.622													60	85	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182823280	182823280	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182823280A>G	uc001gpr.2	+	6	756	c.593A>G	c.(592-594)TAT>TGT	p.Y198C	DHX9_uc001gps.2_Translation_Start_Site	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	198	DRBM 2.|Interaction with CREBBP.				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						CAAGGAGAATATAAGTACACC	0.378													92	125	---	---	---	---	PASS
GNPAT	8443	broad.mit.edu	37	1	231403566	231403566	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231403566C>T	uc001hup.3	+	9	1402	c.1196C>T	c.(1195-1197)TCC>TTC	p.S399F	GNPAT_uc009xfp.2_Missense_Mutation_p.S338F	NM_014236	NP_055051	O15228	GNPAT_HUMAN	glyceronephosphate O-acyltransferase	399					ether lipid biosynthetic process|fatty acid metabolic process|organ morphogenesis	peroxisomal matrix|peroxisomal membrane	glycerone-phosphate O-acyltransferase activity			ovary(3)|breast(1)	4	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				AACCGGCCATCCATGGACTTT	0.458													84	74	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234614038	234614038	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234614038G>T	uc001hwd.2	-	1	812	c.812C>A	c.(811-813)GCG>GAG	p.A271E		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	271					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			GCCCAGCCCCGCCTGCACCGT	0.527													2	2	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240256727	240256727	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240256727A>T	uc010pyd.1	+	1	1543	c.1318A>T	c.(1318-1320)AGC>TGC	p.S440C	FMN2_uc010pye.1_Missense_Mutation_p.S440C	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	440					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCCTAATCAGAGCCCCAGGAT	0.662													42	64	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1812859	1812859	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1812859C>T	uc002qxe.2	-	22	3988	c.3161G>A	c.(3160-3162)CGG>CAG	p.R1054Q	MYT1L_uc002qxd.2_Missense_Mutation_p.R1052Q|MYT1L_uc010ewk.2_Missense_Mutation_p.R50Q	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	1054					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GTTGCTGGCCCGCTGTTTGAT	0.597													10	129	---	---	---	---	PASS
C2orf39	92749	broad.mit.edu	37	2	26624930	26624930	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26624930C>T	uc002rhg.2	+	1	147	c.73C>T	c.(73-75)CCC>TCC	p.P25S	C2orf39_uc010eym.1_RNA	NM_145038	NP_659475	Q96MC2	CC164_HUMAN	hypothetical protein LOC92749	25											0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GATTCTCGCGCCCTCGGTCCA	0.632													13	28	---	---	---	---	PASS
GPN1	11321	broad.mit.edu	37	2	27864157	27864157	+	Intron	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27864157A>C	uc010ymc.1	+						GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Intron|GPN1_uc010ezg.1_Intron	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						GTAAGAAGGGAGGCTGTTTGT	0.328													8	182	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32361636	32361636	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32361636G>C	uc002roc.2	+	10	1471	c.1250G>C	c.(1249-1251)GGA>GCA	p.G417A	SPAST_uc002rod.2_Missense_Mutation_p.G385A	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	417	Sufficient for microtubule severing.				cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTTTAGGTGGGAGAAGGAGAG	0.308													69	149	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40387975	40387975	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40387975T>C	uc002rrx.2	-	8	2223	c.2199A>G	c.(2197-2199)ACA>ACG	p.T733T	uc002rrw.2_Intron|SLC8A1_uc002rry.2_Silent_p.T728T|SLC8A1_uc002rrz.2_Silent_p.T720T|SLC8A1_uc002rsa.2_Silent_p.T697T|SLC8A1_uc002rsd.3_Silent_p.T697T	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	733	Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GGGCCAGGTTTGTCTTCTTAA	0.413													64	98	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656127	40656127	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656127T>A	uc002rrx.2	-	1	1318	c.1294A>T	c.(1294-1296)AGA>TGA	p.R432*	SLC8A1_uc002rry.2_Nonsense_Mutation_p.R432*|SLC8A1_uc002rrz.2_Nonsense_Mutation_p.R432*|SLC8A1_uc002rsa.2_Nonsense_Mutation_p.R432*|SLC8A1_uc002rsd.3_Nonsense_Mutation_p.R432*|SLC8A1_uc002rsb.1_Nonsense_Mutation_p.R432*|SLC8A1_uc010fan.1_Nonsense_Mutation_p.R432*|SLC8A1_uc002rsc.1_Nonsense_Mutation_p.R432*	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	432	Calx-beta 1.|Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TCACCACCTCTGCGGATAATG	0.433													65	112	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43926841	43926841	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43926841C>T	uc010yny.1	+	8	827	c.744C>T	c.(742-744)GGC>GGT	p.G248G	PLEKHH2_uc002rte.3_Silent_p.G248G|PLEKHH2_uc002rtf.3_Silent_p.G247G	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	248						cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ACAACAGAGGCCAGAGAACAT	0.418													26	147	---	---	---	---	PASS
FBXO11	80204	broad.mit.edu	37	2	48059965	48059965	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48059965T>A	uc010fbl.2	-	9	958	c.844A>T	c.(844-846)ATT>TTT	p.I282F	FBXO11_uc002rwe.2_Missense_Mutation_p.I282F|FBXO11_uc002rwf.2_Missense_Mutation_p.I282F|FBXO11_uc002rwg.1_Missense_Mutation_p.I282F|FBXO11_uc010fbk.2_5'Flank	NM_025133	NP_079409	Q86XK2	FBX11_HUMAN	F-box only protein 11 isoform 1	366					ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|ubiquitin ligase complex	protein binding|protein-arginine N-methyltransferase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TTTACTGTAATCTCTAAGCAG	0.313													43	288	---	---	---	---	PASS
FANCL	55120	broad.mit.edu	37	2	58425768	58425768	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58425768C>A	uc002rzw.3	-	7	568	c.501G>T	c.(499-501)GTG>GTT	p.V167V	FANCL_uc002rzx.3_Silent_p.V167V|FANCL_uc010fce.2_Silent_p.V167V|FANCL_uc010fcf.1_Silent_p.V108V	NM_018062	NP_060532	Q9NW38	FANCL_HUMAN	Fanconi anemia, complementation group L isoform	167					DNA repair	cytoplasm|nucleoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						CAGGAAAATCCACAAAATAAT	0.299								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				33	56	---	---	---	---	PASS
CEP68	23177	broad.mit.edu	37	2	65298860	65298860	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65298860C>A	uc002sdl.3	+	3	844	c.630C>A	c.(628-630)CAC>CAA	p.H210Q	CEP68_uc002sdj.2_Missense_Mutation_p.H210Q|CEP68_uc010yqb.1_Missense_Mutation_p.H210Q|CEP68_uc002sdk.3_Missense_Mutation_p.H210Q|CEP68_uc010yqc.1_Missense_Mutation_p.H210Q|CEP68_uc010yqd.1_Missense_Mutation_p.H210Q	NM_015147	NP_055962	Q76N32	CEP68_HUMAN	centrosomal protein 68kDa	210					centrosome organization	centrosome				skin(1)	1						TCCAGGGTCACCAGGAGAGGG	0.647													3	104	---	---	---	---	PASS
FAM136A	84908	broad.mit.edu	37	2	70528037	70528037	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70528037C>A	uc002sgq.3	-	2	240	c.163G>T	c.(163-165)GAG>TAG	p.E55*	FAM136A_uc010fdp.2_RNA	NM_032822	NP_116211	Q96C01	F136A_HUMAN	hypothetical protein LOC84908	55						mitochondrion	protein binding				0						TGGCAGCGCTCGATGCACTGG	0.572													5	319	---	---	---	---	PASS
CCT7	10574	broad.mit.edu	37	2	73477477	73477477	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73477477T>C	uc002siz.2	+	10	1216	c.1114T>C	c.(1114-1116)TTC>CTC	p.F372L	CCT7_uc002sja.2_Missense_Mutation_p.F168L|CCT7_uc010yrf.1_Missense_Mutation_p.F328L|CCT7_uc010feu.2_Missense_Mutation_p.F330L|CCT7_uc010yrg.1_Missense_Mutation_p.F272L|CCT7_uc010yrh.1_Missense_Mutation_p.F244L|CCT7_uc010yri.1_Missense_Mutation_p.F285L	NM_006429	NP_006420	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 isoform a	372					'de novo' posttranslational protein folding		ATP binding|unfolded protein binding				0						GACATGCACCTTCATTCTCCG	0.527													98	156	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74593753	74593753	+	Intron	SNP	T	G	G	rs150222185	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74593753T>G	uc002skx.2	-						DCTN1_uc002skt.1_5'Flank|DCTN1_uc002skv.2_Intron|DCTN1_uc002sku.2_Intron|DCTN1_uc002skw.1_Intron|DCTN1_uc010ffd.2_Intron|DCTN1_uc002sky.2_Intron	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1						cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						GATACCTGTGTGCCAGGCCAG	0.567													11	358	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89278251	89278251	+	Intron	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89278251T>A	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ACAGGGTGGGTGGAGACTGTG	0.463													70	138	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89399795	89399795	+	Intron	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89399795C>G	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCAGCAGGAGCCCCAGGAGCT	0.517													17	135	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90139137	90139137	+	RNA	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90139137G>C	uc010fhm.2	+	17		c.2049G>C								Parts of antibodies, mostly variable regions.																		AGCTCCTGGGGCTCCTGCTGC	0.517													9	417	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141643896	141643896	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141643896C>T	uc002tvj.1	-	24	4747	c.3775G>A	c.(3775-3777)GAA>AAA	p.E1259K	LRP1B_uc010fnl.1_Missense_Mutation_p.E441K	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1259	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGAATGCTTCAAAAGGATCT	0.284										TSP Lung(27;0.18)			23	67	---	---	---	---	PASS
KIF5C	3800	broad.mit.edu	37	2	149850999	149850999	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149850999T>A	uc010zbu.1	+	17	2338	c.1970T>A	c.(1969-1971)CTA>CAA	p.L657Q	KIF5C_uc002tws.1_RNA|KIF5C_uc002twt.2_Missense_Mutation_p.L209Q	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C	657					microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		AGGAGGCAGCTAGAAGAGTCC	0.493													4	4	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152520196	152520196	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152520196T>A	uc010fnx.2	-	45	5820	c.5629A>T	c.(5629-5631)AGT>TGT	p.S1877C		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	1877	Nebulin 49.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCCACCACACTGAGCATGTCC	0.517													4	56	---	---	---	---	PASS
CCDC141	285025	broad.mit.edu	37	2	179732747	179732747	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179732747G>A	uc002unf.1	-							NM_173648	NP_775919	Q6ZP82	CC141_HUMAN	coiled-coil domain containing 141								protein binding			ovary(7)|pancreas(2)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.0531)|all cancers(119;0.147)			GTTATTAGATGCTTACAGGCC	0.448													41	68	---	---	---	---	PASS
ICA1L	130026	broad.mit.edu	37	2	203690498	203690498	+	Intron	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203690498T>C	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron|ICA1L_uc002uzj.2_Intron|ICA1L_uc002uzk.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						AACCTTGAGATATAAATTTTA	0.289													36	73	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206050578	206050578	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206050578A>T	uc002var.1	+	14	2222	c.2015A>T	c.(2014-2016)TAC>TTC	p.Y672F	PARD3B_uc010fub.1_Missense_Mutation_p.Y672F|PARD3B_uc002vao.1_Missense_Mutation_p.Y672F|PARD3B_uc002vap.1_Missense_Mutation_p.Y610F|PARD3B_uc002vaq.1_Missense_Mutation_p.Y672F	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	672					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CTCGAAGATTACAGCCACAGG	0.423													62	78	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216269278	216269278	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216269278C>T	uc002vfa.2	-	20	3353	c.3087G>A	c.(3085-3087)CTG>CTA	p.L1029L	FN1_uc002vfb.2_Silent_p.L1029L|FN1_uc002vfc.2_Silent_p.L1029L|FN1_uc002vfd.2_Silent_p.L1029L|FN1_uc002vfe.2_Silent_p.L1029L|FN1_uc002vff.2_Silent_p.L1029L|FN1_uc002vfg.2_Silent_p.L1029L|FN1_uc002vfh.2_Silent_p.L1029L|FN1_uc002vfi.2_Silent_p.L1029L|FN1_uc002vfj.2_Silent_p.L1029L	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	1029	|Fibronectin type-III 5.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGCCCACGGTCAGTCGGTATC	0.537													35	147	---	---	---	---	PASS
SLC11A1	6556	broad.mit.edu	37	2	219254677	219254677	+	Missense_Mutation	SNP	G	A	A	rs140981969	byFrequency	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219254677G>A	uc002vhv.2	+	9	1220	c.880G>A	c.(880-882)GTC>ATC	p.V294I	SLC11A1_uc010fvp.1_Missense_Mutation_p.V294I|SLC11A1_uc010fvq.1_Missense_Mutation_p.V227I|SLC11A1_uc010zkc.1_Missense_Mutation_p.V227I|SLC11A1_uc002vhu.1_Missense_Mutation_p.V89I|SLC11A1_uc002vhw.2_Missense_Mutation_p.V176I|SLC11A1_uc010fvr.2_Missense_Mutation_p.V89I	NM_000578	NP_000569	P49279	NRAM1_HUMAN	natural resistance-associated macrophage protein	294	Helical; (Potential).				activation of protein kinase activity|antigen processing and presentation of peptide antigen|cadmium ion transmembrane transport|cellular cadmium ion homeostasis|cellular iron ion homeostasis|defense response to Gram-negative bacterium|defense response to protozoan|divalent metal ion export|inflammatory response|interleukin-2 production|interleukin-3 production|iron ion transport|L-arginine import|macrophage activation|MHC class II biosynthetic process|mRNA stabilization|multicellular organismal iron ion homeostasis|negative regulation of cytokine production|nitrite transport|phagocytosis|positive regulation of dendritic cell antigen processing and presentation|positive regulation of interferon-gamma production|positive regulation of phagocytosis|positive regulation of T-helper 1 type immune response|positive regulation of transcription from RNA polymerase II promoter|respiratory burst|response to interferon-gamma|response to lipopolysaccharide|T cell cytokine production|T cell proliferation involved in immune response|vacuolar acidification|wound healing	integral to plasma membrane|late endosome membrane|lysosome|phagocytic vesicle membrane|tertiary granule membrane	manganese ion transmembrane transporter activity|metal ion:hydrogen antiporter activity|protein homodimerization activity			ovary(3)|central_nervous_system(1)	4		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000195)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CGCCCTGTCCGTCTCCTTTAT	0.547													23	40	---	---	---	---	PASS
IL5RA	3568	broad.mit.edu	37	3	3143397	3143397	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3143397C>A	uc011ask.1	-	6	990	c.346G>T	c.(346-348)GCT>TCT	p.A116S	IL5RA_uc010hbq.2_Missense_Mutation_p.A116S|IL5RA_uc010hbr.2_Missense_Mutation_p.A116S|IL5RA_uc010hbs.2_Missense_Mutation_p.A116S|IL5RA_uc011asl.1_Missense_Mutation_p.A116S|IL5RA_uc011asm.1_Missense_Mutation_p.A116S|IL5RA_uc010hbt.2_Missense_Mutation_p.A116S|IL5RA_uc011asn.1_Missense_Mutation_p.A116S|IL5RA_uc010hbu.2_Missense_Mutation_p.A116S	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1	116	Extracellular (Potential).				cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		TGAAGTTCAGCAGAAGCCCAG	0.463													21	87	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7721755	7721755	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7721755C>T	uc003bqm.2	+	9	2745	c.2471C>T	c.(2470-2472)ACG>ATG	p.T824M	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.T824M|GRM7_uc003bql.2_Missense_Mutation_p.T824M|GRM7_uc003bqn.1_Missense_Mutation_p.T407M	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	824	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	CAAACTACCACGCTTACAATC	0.438													26	56	---	---	---	---	PASS
CAMK1	8536	broad.mit.edu	37	3	9803340	9803340	+	Silent	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9803340G>C	uc003bst.2	-	6	709	c.531C>G	c.(529-531)ACC>ACG	p.T177T	OGG1_uc003bsk.2_Intron|OGG1_uc003bsl.2_Intron|OGG1_uc003bsm.2_Intron|OGG1_uc003bsn.2_Intron|OGG1_uc003bso.2_Intron|CAMK1_uc003bsu.2_RNA|CAMK1_uc003bss.2_5'Flank|uc003bsv.1_RNA	NM_003656	NP_003647	Q14012	KCC1A_HUMAN	calcium/calmodulin-dependent protein kinase I	177	Protein kinase.			T->A: Loss of activation by CaMKK1.|T->D: Partial activation in absence of CaMKK1.	cell differentiation|nervous system development|positive regulation of muscle cell differentiation|signal transduction	cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|skin(1)	2	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.0475)		TTCCACAGGCGGTGGAGAGCA	0.587													28	69	---	---	---	---	PASS
STAC	6769	broad.mit.edu	37	3	36485038	36485038	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36485038G>T	uc003cgh.1	+	2	333	c.294G>T	c.(292-294)AGG>AGT	p.R98S	STAC_uc010hgd.1_RNA|STAC_uc011aya.1_Missense_Mutation_p.R98S	NM_003149	NP_003140	Q99469	STAC_HUMAN	SH3 and cysteine rich domain	98					intracellular signal transduction	cytoplasm|soluble fraction	metal ion binding			skin(2)|ovary(1)|pancreas(1)	4						CACCCGCCAGGGCTGGTCTGC	0.557													89	122	---	---	---	---	PASS
DCLK3	85443	broad.mit.edu	37	3	36763059	36763059	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36763059C>G	uc003cgi.2	-	3	2035	c.1544G>C	c.(1543-1545)GGG>GCG	p.G515A		NM_033403	NP_208382	Q9C098	DCLK3_HUMAN	doublecortin-like kinase 3	515	Protein kinase.					cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			lung(3)|large_intestine(2)|breast(1)|skin(1)|ovary(1)|kidney(1)	9						AGTTGGGGTCCCACACACAGT	0.408													64	227	---	---	---	---	PASS
ZNF445	353274	broad.mit.edu	37	3	44488820	44488820	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44488820C>A	uc003cnf.2	-	8	2691	c.2343G>T	c.(2341-2343)CAG>CAT	p.Q781H	ZNF445_uc011azv.1_Missense_Mutation_p.Q769H|ZNF445_uc011azw.1_Missense_Mutation_p.Q781H	NM_181489	NP_852466	P59923	ZN445_HUMAN	zinc finger protein 445	781	C2H2-type 8.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(197;0.0514)|Kidney(197;0.0646)		TGTGAACTCTCTGATGGATGA	0.507													3	54	---	---	---	---	PASS
SEMA3F	6405	broad.mit.edu	37	3	50197101	50197101	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50197101G>T	uc003cyj.2	+	2	244	c.46G>T	c.(46-48)GCC>TCC	p.A16S	SEMA3F_uc003cyk.2_Missense_Mutation_p.A16S	NM_004186	NP_004177	Q13275	SEM3F_HUMAN	semaphorin 3F precursor	16					axon guidance	extracellular space|membrane	chemorepellent activity|receptor activity			lung(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00013)|KIRC - Kidney renal clear cell carcinoma(197;0.00599)|Kidney(197;0.00688)		ACTGACCGGGGCCTGGCCATC	0.602													27	49	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52621527	52621527	+	Splice_Site	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52621527C>T	uc003des.2	-	19	2978	c.2966_splice	c.e19-1	p.G989_splice	PBRM1_uc003dex.2_Splice_Site|PBRM1_uc003deq.2_Splice_Site_p.G989_splice|PBRM1_uc003der.2_Splice_Site_p.G957_splice|PBRM1_uc003det.2_Splice_Site_p.G1004_splice|PBRM1_uc003deu.2_Splice_Site_p.G1004_splice|PBRM1_uc003dev.2_Splice_Site|PBRM1_uc003dew.2_Splice_Site_p.G989_splice|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Splice_Site_p.G988_splice|PBRM1_uc003dfb.1_Splice_Site_p.G901_splice|PBRM1_uc003dfa.1_Splice_Site_p.G335_splice	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		CATTTTTCACCTCAAAAATGG	0.313			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								54	48	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52621529	52621529	+	Intron	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52621529C>A	uc003des.2	-						PBRM1_uc003dex.2_Intron|PBRM1_uc003deq.2_Intron|PBRM1_uc003der.2_Intron|PBRM1_uc003det.2_Intron|PBRM1_uc003deu.2_Intron|PBRM1_uc003dev.2_Intron|PBRM1_uc003dew.2_Intron|PBRM1_uc010hmk.1_Intron|PBRM1_uc003dey.2_Intron|PBRM1_uc003dez.1_Intron|PBRM1_uc003dfb.1_Intron|PBRM1_uc003dfa.1_Intron	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4						chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TTTTTCACCTCAAAAATGGGG	0.313			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								52	48	---	---	---	---	PASS
PBRM1	55193	broad.mit.edu	37	3	52685796	52685796	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52685796C>G	uc003des.2	-	6	688	c.676G>C	c.(676-678)GAG>CAG	p.E226Q	PBRM1_uc003dex.2_RNA|PBRM1_uc003deq.2_Missense_Mutation_p.E226Q|PBRM1_uc003der.2_Missense_Mutation_p.E226Q|PBRM1_uc003det.2_Missense_Mutation_p.E226Q|PBRM1_uc003deu.2_Missense_Mutation_p.E226Q|PBRM1_uc003dev.2_RNA|PBRM1_uc003dew.2_Missense_Mutation_p.E226Q|PBRM1_uc010hmk.1_Missense_Mutation_p.E226Q|PBRM1_uc003dey.2_Missense_Mutation_p.E226Q|PBRM1_uc003dez.1_Missense_Mutation_p.E226Q|PBRM1_uc003dfb.1_Missense_Mutation_p.E124Q	NM_181042	NP_060635	Q86U86	PB1_HUMAN	polybromo 1 isoform 4	226	Bromo 2.		E -> G (found in hematopoietic and lymphoid cancer cell lines).		chromatin remodeling|mitosis|negative regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear chromosome	chromatin binding|DNA binding|protein binding			kidney(136)|breast(4)	140				BRCA - Breast invasive adenocarcinoma(193;1.8e-05)|Kidney(197;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00122)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)		TCTATAGGCTCCTTAATTATT	0.368			Mis|N|F|S|D|O		clear cell renal carcinoma|breast								96	103	---	---	---	---	PASS
ITIH1	3697	broad.mit.edu	37	3	52822040	52822040	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52822040T>A	uc003dfs.2	+	17	1987	c.1963T>A	c.(1963-1965)TCC>ACC	p.S655T	ITIH1_uc010hmn.1_RNA|ITIH1_uc003dft.2_Missense_Mutation_p.S256T|ITIH1_uc010hmo.1_Missense_Mutation_p.S209T|ITIH1_uc003dfu.2_Missense_Mutation_p.S21T	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1	655	Hyaluronan-binding.				hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		TCCTACTCATTCCAGCTCCAA	0.617													48	212	---	---	---	---	PASS
FAM19A1	407738	broad.mit.edu	37	3	68466452	68466452	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68466452A>G	uc003dnd.2	+	3	357	c.141A>G	c.(139-141)ATA>ATG	p.I47M	FAM19A1_uc003dne.2_Missense_Mutation_p.I47M|FAM19A1_uc003dng.2_Missense_Mutation_p.I47M	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	47						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		GTGAAGTGATAGCAGCACACC	0.478													18	47	---	---	---	---	PASS
GPR27	2850	broad.mit.edu	37	3	71804003	71804003	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71804003G>T	uc011bge.1	+	1	803	c.803G>T	c.(802-804)CGC>CTC	p.R268L	EIF4E3_uc003dox.2_5'Flank|EIF4E3_uc011bgd.1_5'Flank|EIF4E3_uc010hoc.2_5'Flank	NM_018971	NP_061844	Q9NS67	GPR27_HUMAN	G protein-coupled receptor 27	268	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)	1		Prostate(10;0.00899)		BRCA - Breast invasive adenocarcinoma(55;1.78e-05)|Epithelial(33;5.75e-05)|Lung(16;0.0012)|LUSC - Lung squamous cell carcinoma(21;0.00156)		cgcggcgcgcgccgccTCCTC	0.557													9	13	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	85961705	85961705	+	Intron	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85961705C>A	uc003dqj.2	+						CADM2_uc003dqk.2_Intron|CADM2_uc003dql.2_Intron	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TAAGTAAACACTACTTCCCCC	0.443													17	43	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	97194270	97194270	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97194270G>A	uc010how.1	+	8	2012	c.1969G>A	c.(1969-1971)GTC>ATC	p.V657I	EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_Missense_Mutation_p.V23I|EPHA6_uc003drs.3_Missense_Mutation_p.V49I|EPHA6_uc003drr.3_Missense_Mutation_p.V49I|EPHA6_uc003drt.2_Missense_Mutation_p.V49I|EPHA6_uc010hox.1_RNA	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	562	Helical; (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						CACTCTCCTCGTCATCCTCAC	0.403													4	31	---	---	---	---	PASS
CEP97	79598	broad.mit.edu	37	3	101481404	101481404	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101481404G>T	uc003dvk.1	+	10	1920	c.1893G>T	c.(1891-1893)CAG>CAT	p.Q631H	CEP97_uc011bhf.1_Missense_Mutation_p.Q572H|CEP97_uc003dvl.1_Missense_Mutation_p.Q327H|CEP97_uc003dvm.1_Missense_Mutation_p.Q469H	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	631	CEP110 binding.					centrosome|nucleus	protein binding			ovary(2)	2						TTTGGAACCAGGTAAACTCCC	0.313													51	123	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114058223	114058223	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114058223C>G	uc003ebi.2	-	5	2035	c.1855G>C	c.(1855-1857)GAT>CAT	p.D619H	ZBTB20_uc003ebj.2_Missense_Mutation_p.D546H|ZBTB20_uc010hqp.2_Missense_Mutation_p.D546H|ZBTB20_uc003ebk.2_Missense_Mutation_p.D546H|ZBTB20_uc003ebl.2_Missense_Mutation_p.D546H|ZBTB20_uc003ebm.2_Missense_Mutation_p.D546H|ZBTB20_uc003ebn.2_Missense_Mutation_p.D546H	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	619	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ATAAGGTAATCCTTTAAGGAG	0.512													29	132	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121208879	121208879	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121208879T>C	uc003eee.3	-	16	3028	c.2899A>G	c.(2899-2901)AGT>GGT	p.S967G	POLQ_uc003eed.2_Missense_Mutation_p.S139G	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	967					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		TTAAAGGAACTTGTATGCTCT	0.299								DNA_polymerases_(catalytic_subunits)					21	86	---	---	---	---	PASS
COPG	22820	broad.mit.edu	37	3	128987831	128987831	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128987831G>T	uc003els.2	+	18	1931	c.1831G>T	c.(1831-1833)GAG>TAG	p.E611*	COPG_uc010htb.2_Nonsense_Mutation_p.E517*	NM_016128	NP_057212	Q9Y678	COPG_HUMAN	coatomer protein complex, subunit gamma 1	611	Interaction with ZNF289/ARFGAP2.				COPI coating of Golgi vesicle|intracellular protein transport|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol	protein binding|structural molecule activity			ovary(3)|breast(1)	4						TACCAGGCAGGAGATCTTCCA	0.468													44	128	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129284817	129284817	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129284817A>G	uc003emx.2	-	24	4335	c.4235T>C	c.(4234-4236)TTG>TCG	p.L1412S	PLXND1_uc011blb.1_Missense_Mutation_p.L80S	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1412	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						TGAGGAGAACAAGCTAATTCC	0.562													9	48	---	---	---	---	PASS
NPHP3	27031	broad.mit.edu	37	3	132440894	132440894	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132440894G>A	uc003epe.1	-	1	383	c.306C>T	c.(304-306)CGC>CGT	p.R102R	NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_5'UTR|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3	102	Potential.				maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						TCTTGCTGACGCGAAAGATCT	0.647													12	85	---	---	---	---	PASS
C3orf58	205428	broad.mit.edu	37	3	143691417	143691417	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143691417C>A	uc003evo.2	+	1	778	c.243C>A	c.(241-243)CGC>CGA	p.R81R	C3orf58_uc011bnl.1_5'Flank	NM_173552	NP_775823	Q8NDZ4	CC058_HUMAN	hypothetical protein LOC205428 isoform a	81						COPI vesicle coat|extracellular region				ovary(1)	1						GCCGCTTGCGCCTGCTGGACT	0.682													27	70	---	---	---	---	PASS
NAALADL2	254827	broad.mit.edu	37	3	174815049	174815049	+	Silent	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:174815049A>C	uc003fit.2	+	2	600	c.513A>C	c.(511-513)ACA>ACC	p.T171T	NAALADL2_uc003fiu.1_Silent_p.T164T	NM_207015	NP_996898	Q58DX5	NADL2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	171	Extracellular (Potential).				proteolysis	integral to membrane	peptidase activity			pancreas(1)	1	Ovarian(172;0.0102)	all_cancers(1;0.0272)|all_epithelial(1;0.0553)	OV - Ovarian serous cystadenocarcinoma(80;9.26e-28)	Colorectal(1;1.66e-10)|COAD - Colon adenocarcinoma(1;2.1e-07)|STAD - Stomach adenocarcinoma(1;0.00261)|READ - Rectum adenocarcinoma(3;0.0284)		TTCTCAAGACAATCCAGGCAG	0.378													8	315	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179483640	179483640	+	Intron	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179483640A>G	uc003fkh.2	+							NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13						ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TCTGGAAGTAAGTTCTTGCCT	0.453													22	108	---	---	---	---	PASS
PEX5L	51555	broad.mit.edu	37	3	179529588	179529588	+	Splice_Site	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179529588C>T	uc003fki.1	-	11	1284	c.1154_splice	c.e11+1	p.R385_splice	PEX5L_uc011bqd.1_Splice_Site_p.R342_splice|PEX5L_uc011bqe.1_Splice_Site_p.R193_splice|PEX5L_uc011bqf.1_Splice_Site_p.R277_splice|PEX5L_uc003fkj.1_Splice_Site_p.R350_splice|PEX5L_uc010hxd.1_Splice_Site_p.R383_splice|PEX5L_uc011bqg.1_Splice_Site_p.R361_splice|PEX5L_uc011bqh.1_Splice_Site_p.R326_splice	NM_016559	NP_057643	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						protein import into peroxisome matrix|regulation of cAMP-mediated signaling	cytosol|peroxisomal membrane	peroxisome matrix targeting signal-1 binding			ovary(3)|large_intestine(1)	4	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			GCTTCCTTTACCTCTGGAGGG	0.428													127	148	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182775130	182775130	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182775130C>A	uc003fle.2	-	8	979	c.842G>T	c.(841-843)CGA>CTA	p.R281L	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.R164L|MCCC1_uc003flg.2_Missense_Mutation_p.R172L|MCCC1_uc011bqp.1_Missense_Mutation_p.R234L|MCCC1_uc011bqq.1_Missense_Mutation_p.R172L	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	281	Biotin carboxylation.|ATP-grasp.				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTTCTGATGTCGCCTCTGCAC	0.428													31	35	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182775210	182775210	+	Missense_Mutation	SNP	C	A	A	rs149389595		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182775210C>A	uc003fle.2	-	8	899	c.762G>T	c.(760-762)AGG>AGT	p.R254S	MCCC1_uc010hxi.2_RNA|MCCC1_uc011bqo.1_RNA|MCCC1_uc003flf.2_Missense_Mutation_p.R137S|MCCC1_uc003flg.2_Missense_Mutation_p.R145S|MCCC1_uc011bqp.1_Missense_Mutation_p.R207S|MCCC1_uc011bqq.1_Missense_Mutation_p.R145S	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)	254	Biotin carboxylation.|ATP-grasp.				biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	CTTCTACATGCCTATATAAAA	0.393													11	41	---	---	---	---	PASS
MCCC1	56922	broad.mit.edu	37	3	182775211	182775211	+	Splice_Site	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182775211C>A	uc003fle.2	-	8	899	c.762_splice	c.e8-1	p.R254_splice	MCCC1_uc010hxi.2_Splice_Site|MCCC1_uc011bqo.1_Splice_Site|MCCC1_uc003flf.2_Splice_Site_p.R137_splice|MCCC1_uc003flg.2_Splice_Site_p.R145_splice|MCCC1_uc011bqp.1_Splice_Site_p.R207_splice|MCCC1_uc011bqq.1_Splice_Site_p.R145_splice	NM_020166	NP_064551	Q96RQ3	MCCA_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 1 (alpha)						biotin metabolic process|leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|metal ion binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(143;1.84e-14)|Ovarian(172;0.0355)		all cancers(12;1.8e-44)|Epithelial(37;3.23e-38)|LUSC - Lung squamous cell carcinoma(7;5.04e-25)|Lung(8;5.03e-23)|OV - Ovarian serous cystadenocarcinoma(80;5.07e-21)		Biotin(DB00121)	TTCTACATGCCTATATAAAAG	0.388													11	40	---	---	---	---	PASS
IGF2BP2	10644	broad.mit.edu	37	3	185393116	185393116	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185393116C>T	uc003fpo.2	-	9	1118	c.1039G>A	c.(1039-1041)GAG>AAG	p.E347K	IGF2BP2_uc010hyi.2_Missense_Mutation_p.E290K|IGF2BP2_uc010hyj.2_Missense_Mutation_p.E284K|IGF2BP2_uc010hyk.2_Missense_Mutation_p.E211K|IGF2BP2_uc010hyl.2_Missense_Mutation_p.E284K|IGF2BP2_uc003fpp.2_Missense_Mutation_p.E347K|IGF2BP2_uc003fpq.2_Missense_Mutation_p.E352K	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding	347					anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TCAAAGGCCTCACGCAGCTTC	0.453													40	251	---	---	---	---	PASS
LPP	4026	broad.mit.edu	37	3	188242542	188242542	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188242542G>C	uc003frs.1	+	5	642	c.396G>C	c.(394-396)GAG>GAC	p.E132D	LPP_uc011bsg.1_Missense_Mutation_p.E132D|LPP_uc011bsi.1_Missense_Mutation_p.E132D|LPP_uc003frt.2_Missense_Mutation_p.E132D	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation	132	Pro-rich.				cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		CTGACCTTGAGTGCAGCTCCC	0.542			T	HMGA2|MLL|C12orf9	lipoma|leukemia								14	299	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196387954	196387954	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196387954C>A	uc003fwv.2	+	3	1544	c.1440C>A	c.(1438-1440)TGC>TGA	p.C480*		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	480	Extracellular (Potential).|LRR 16.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGCCAGACTGCCCATTCCAAG	0.597													74	139	---	---	---	---	PASS
PHOX2B	8929	broad.mit.edu	37	4	41750634	41750634	+	5'UTR	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41750634G>T	uc003gwf.3	-	1						NM_003924	NP_003915	Q99453	PHX2B_HUMAN	paired-like homeobox 2b						positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			autonomic_ganglia(7)|lung(2)|ovary(2)|central_nervous_system(1)	12						ACATTGAAAAGGTTCTGGATG	0.483			Mis|F		neuroblastoma	neuroblastoma	congenital central hypoventilation syndrome		Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				3	32	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55972058	55972058	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55972058T>A	uc003has.2	-	12	1888	c.1586A>T	c.(1585-1587)AAA>ATA	p.K529I	KDR_uc003hat.1_Missense_Mutation_p.K529I|KDR_uc011bzx.1_Missense_Mutation_p.K529I	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	529	Ig-like C2-type 5.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CGCTTCACATTTGTACAAAGC	0.488			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			53	347	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56841063	56841063	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56841063A>G	uc003hbi.2	+	11	1635	c.1401A>G	c.(1399-1401)ATA>ATG	p.I467M	CEP135_uc003hbj.2_Missense_Mutation_p.I173M	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	467	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					TCCAACATATAATACAGCGAA	0.373													60	143	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57215750	57215750	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57215750T>C	uc003hbn.2	-	11	2320	c.2167A>G	c.(2167-2169)AAT>GAT	p.N723D	AASDH_uc010ihb.2_Missense_Mutation_p.N238D|AASDH_uc011caa.1_Missense_Mutation_p.N570D|AASDH_uc003hbo.2_Missense_Mutation_p.N623D|AASDH_uc011cab.1_Missense_Mutation_p.N238D|AASDH_uc010ihc.2_Missense_Mutation_p.N723D|AASDH_uc003hbp.2_Missense_Mutation_p.N723D	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	723					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding			ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				ACTGGAGAATTTAAGCCTTTC	0.398													18	128	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62775413	62775413	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62775413C>T	uc010ihh.2	+	9	1992	c.1819C>T	c.(1819-1821)CGG>TGG	p.R607W	LPHN3_uc003hcq.3_Missense_Mutation_p.R607W|LPHN3_uc003hct.2_Missense_Mutation_p.R13W|LPHN3_uc003hcs.1_Missense_Mutation_p.R436W	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	607	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TGTACAGCTTCGGAACTTGAC	0.428													4	14	---	---	---	---	PASS
AMBN	258	broad.mit.edu	37	4	71467291	71467291	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71467291G>C	uc003hfl.2	+	6	526	c.451G>C	c.(451-453)GGA>CGA	p.G151R		NM_016519	NP_057603	Q9NP70	AMBN_HUMAN	ameloblastin precursor	151					bone mineralization|cell adhesion|cell proliferation|odontogenesis of dentine-containing tooth	proteinaceous extracellular matrix	growth factor activity|structural constituent of tooth enamel			ovary(3)|skin(1)	4			Lung(101;0.235)			AATTCACCTGGGACATCTGCC	0.537											OREG0016218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	55	139	---	---	---	---	PASS
SLC4A4	8671	broad.mit.edu	37	4	72420899	72420899	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72420899G>A	uc003hfy.2	+	21	2854	c.2737G>A	c.(2737-2739)GGA>AGA	p.G913R	SLC4A4_uc010iic.2_Missense_Mutation_p.G913R|SLC4A4_uc010iib.2_Missense_Mutation_p.G829R|SLC4A4_uc003hfz.2_Missense_Mutation_p.G913R|SLC4A4_uc003hgc.3_Missense_Mutation_p.G869R|SLC4A4_uc010iid.2_Missense_Mutation_p.G117R	NM_001098484	NP_001091954	Q9Y6R1	S4A4_HUMAN	solute carrier family 4, sodium bicarbonate	913	Cytoplasmic (Potential).			G -> R (in Ref. 3; AAF21719).		basolateral plasma membrane|integral to plasma membrane	inorganic anion exchanger activity|protein binding|sodium:bicarbonate symporter activity			ovary(3)|kidney(1)|skin(1)	5			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)			CCTGTATATGGGAGTAGCATC	0.343													87	262	---	---	---	---	PASS
PPEF2	5470	broad.mit.edu	37	4	76808007	76808007	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76808007T>C	uc003hix.2	-	7	934	c.577A>G	c.(577-579)AAG>GAG	p.K193E	PPEF2_uc003hiy.2_RNA|PPEF2_uc003hiz.1_Missense_Mutation_p.K193E	NM_006239	NP_006230	O14830	PPE2_HUMAN	serine/threonine protein phosphatase with	193	Catalytic.				detection of stimulus involved in sensory perception|negative regulation of MAPKKK cascade|negative regulation of peptidyl-threonine phosphorylation|protein dephosphorylation|visual perception	cytoplasm|photoreceptor inner segment|photoreceptor outer segment	calcium ion binding|Hsp70 protein binding|Hsp90 protein binding|iron ion binding|manganese ion binding|mitogen-activated protein kinase kinase kinase binding|protein serine/threonine phosphatase activity			ovary(2)|lung(1)|central_nervous_system(1)	4			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			ATTCATACCTTATAAAATATA	0.299													9	134	---	---	---	---	PASS
HPSE	10855	broad.mit.edu	37	4	84230076	84230076	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84230076T>C	uc003hoj.3	-	8	1112	c.1013A>G	c.(1012-1014)AAG>AGG	p.K338R	HPSE_uc010ika.2_Missense_Mutation_p.K280R|HPSE_uc011ccq.1_RNA|HPSE_uc011ccr.1_RNA|HPSE_uc011ccs.1_Missense_Mutation_p.K81R|HPSE_uc011cct.1_Intron|HPSE_uc003hok.3_Missense_Mutation_p.K338R	NM_001098540	NP_001092010	Q9Y251	HPSE_HUMAN	heparanase precursor	338					carbohydrate metabolic process|cell adhesion|proteoglycan metabolic process	extracellular region|lysosomal membrane|nucleus	beta-glucuronidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.114)		COAD - Colon adenocarcinoma(81;0.141)	Heparin(DB01109)	TAACCAGACCTTCTTGCCAGG	0.498													7	106	---	---	---	---	PASS
MMRN1	22915	broad.mit.edu	37	4	90830444	90830444	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:90830444T>A	uc003hst.2	+	2	712	c.641T>A	c.(640-642)GTA>GAA	p.V214E	MMRN1_uc010iku.2_Missense_Mutation_p.V180E|MMRN1_uc011cds.1_5'UTR	NM_007351	NP_031377	Q13201	MMRN1_HUMAN	multimerin 1	214	EMI.				cell adhesion|platelet activation|platelet degranulation	extracellular region|platelet alpha granule lumen				ovary(4)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TGTGCTTATGTACATACCAGG	0.403													44	121	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94344033	94344033	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94344033G>C	uc011cdt.1	+	10	1717	c.1459G>C	c.(1459-1461)GAA>CAA	p.E487Q	GRID2_uc011cdu.1_Missense_Mutation_p.E392Q	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	487	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TTTTAACTACGAAATTTACGT	0.418													25	87	---	---	---	---	PASS
C4orf21	55345	broad.mit.edu	37	4	113539940	113539940	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113539940T>A	uc003iau.2	-	6	1469	c.1258A>T	c.(1258-1260)AGC>TGC	p.S420C	C4orf21_uc003iaw.2_Missense_Mutation_p.S420C	NM_018392	NP_060862	Q6ZU11	YD002_HUMAN	prematurely terminated mRNA decay factor-like	Error:Variant_position_missing_in_Q6ZU11_after_alignment						integral to membrane	zinc ion binding				0		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		TCTGCACTGCTACAAGTAACC	0.343													30	183	---	---	---	---	PASS
BBS12	166379	broad.mit.edu	37	4	123665001	123665001	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123665001A>T	uc003ieu.2	+	2	2147	c.1954A>T	c.(1954-1956)ATT>TTT	p.I652F		NM_152618	NP_689831	Q6ZW61	BBS12_HUMAN	Bardet-Biedl syndrome 12	652					cellular protein metabolic process	cilium	ATP binding			ovary(2)	2						TAATTCAGACATTTCAAATAA	0.368									Bardet-Biedl_syndrome				33	82	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134071448	134071448	+	Silent	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134071448C>G	uc003iha.2	+	1	979	c.153C>G	c.(151-153)CGC>CGG	p.R51R	uc003igy.2_5'Flank|PCDH10_uc003igz.2_Silent_p.R51R	NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor	51	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TTTCGGCTCGCGGGTTTCAGA	0.522													16	128	---	---	---	---	PASS
NR3C2	4306	broad.mit.edu	37	4	149075852	149075852	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149075852C>A	uc003ilj.3	-	5	2549	c.2215G>T	c.(2215-2217)GTT>TTT	p.V739F	NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	739	Steroid-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	AGGACCATAACGGGGGAAGGT	0.502													64	138	---	---	---	---	PASS
C4orf39	152756	broad.mit.edu	37	4	165878659	165878659	+	3'UTR	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165878659C>T	uc003iqx.1	+	1					TRIM61_uc003iqw.2_Intron	NM_153027	NP_694572	Q96MZ4	CD039_HUMAN	hypothetical protein LOC152756												0	all_hematologic(180;0.221)	Prostate(90;0.109)		GBM - Glioblastoma multiforme(119;0.146)		AGCAGGCTGCCTCAAGGAAGA	0.473													3	49	---	---	---	---	PASS
WDR17	116966	broad.mit.edu	37	4	177084335	177084335	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177084335G>A	uc003iuj.2	+	23	3109	c.2953G>A	c.(2953-2955)GAA>AAA	p.E985K	WDR17_uc003iuk.2_Missense_Mutation_p.E961K|WDR17_uc003ium.3_Missense_Mutation_p.E961K|WDR17_uc003iul.1_Intron|WDR17_uc003iun.2_Missense_Mutation_p.E204K	NM_170710	NP_733828	Q8IZU2	WDR17_HUMAN	WD repeat domain 17 isoform 1	985										ovary(2)|skin(2)|pancreas(1)|central_nervous_system(1)	6		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCGCGGAAATGAACTGGAGTT	0.463													35	104	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187535499	187535499	+	Splice_Site	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187535499C>G	uc003izf.2	-	12	9264	c.9076_splice	c.e12-1	p.T3026_splice		NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor						actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						AATATAAAGTCTGCAAAGAGT	0.378										HNSCC(5;0.00058)			23	48	---	---	---	---	PASS
SDHA	6389	broad.mit.edu	37	5	251216	251216	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:251216G>A	uc003jao.3	+	12	1776	c.1661G>A	c.(1660-1662)CGG>CAG	p.R554Q	SDHA_uc011clv.1_Missense_Mutation_p.R554Q|SDHA_uc011clw.1_Missense_Mutation_p.R506Q|SDHA_uc003jap.3_Intron|SDHA_uc003jaq.3_Missense_Mutation_p.R329Q|SDHA_uc003jar.3_Missense_Mutation_p.R148Q	NM_004168	NP_004159	P31040	DHSA_HUMAN	succinate dehydrogenase complex, subunit A,	554			R -> W (in LS).		nervous system development|respiratory electron transport chain|succinate metabolic process|transport|tricarboxylic acid cycle	mitochondrial respiratory chain complex II	electron carrier activity|flavin adenine dinucleotide binding|protein binding|succinate dehydrogenase (ubiquinone) activity				0			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	ACGTTCGACCGGGGTGAGCAG	0.562									Familial_Paragangliomas				11	275	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5242217	5242217	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5242217C>T	uc003jdl.2	+	17	2713	c.2575C>T	c.(2575-2577)CGC>TGC	p.R859C	ADAMTS16_uc003jdk.1_Missense_Mutation_p.R859C	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	859	Spacer.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CTCCATGCCTCGCTTGGGGAC	0.552													6	214	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629847	9629847	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629847C>T	uc003jem.1	-	1	617	c.298G>A	c.(298-300)GGC>AGC	p.G100S		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	100	Helical; Name=3; (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						TAGAAAACGCCGAGCCATGTG	0.443													4	78	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13917329	13917329	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13917329T>C	uc003jfd.2	-	8	1054	c.1012A>G	c.(1012-1014)ACT>GCT	p.T338A	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	338	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GCTTCATTAGTTGCATCAGTG	0.368									Kartagener_syndrome				17	175	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24593422	24593422	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24593422G>A	uc003jgr.1	-	2	510	c.178C>T	c.(178-180)CAA>TAA	p.Q60*	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	60	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		AAGAAAAATTGATTCCACATC	0.383										HNSCC(23;0.051)			95	288	---	---	---	---	PASS
RAI14	26064	broad.mit.edu	37	5	34823967	34823967	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34823967G>A	uc003jir.2	+	15	2216	c.2020G>A	c.(2020-2022)GAA>AAA	p.E674K	RAI14_uc010iur.2_Missense_Mutation_p.E645K|RAI14_uc011coj.1_Missense_Mutation_p.E674K|RAI14_uc003jis.2_Missense_Mutation_p.E677K|RAI14_uc003jit.2_Missense_Mutation_p.E674K|RAI14_uc011cok.1_Missense_Mutation_p.E666K	NM_015577	NP_056392	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14 isoform a	674	Potential.					cell cortex|cytoskeleton	protein binding			ovary(1)	1	all_lung(31;0.000191)					TGTCACAGCTGAATATATCCA	0.448													14	123	---	---	---	---	PASS
PRLR	5618	broad.mit.edu	37	5	35065589	35065589	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35065589G>A	uc003jjm.2	-	10	2001	c.1471C>T	c.(1471-1473)CCC>TCC	p.P491S	PRLR_uc003jjg.1_Intron|PRLR_uc003jjh.1_Intron|PRLR_uc003jji.1_Intron|PRLR_uc003jjj.1_Intron|PRLR_uc003jjk.1_Intron|PRLR_uc003jjl.3_Missense_Mutation_p.P390S	NM_000949	NP_000940	P16471	PRLR_HUMAN	prolactin receptor precursor	491	Cytoplasmic (Potential).				activation of JAK2 kinase activity|activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|embryo implantation|lactation|steroid biosynthetic process|T cell activation	cell surface|extracellular region|integral to membrane	metal ion binding|ornithine decarboxylase activator activity|peptide hormone binding|prolactin receptor activity|protein homodimerization activity			ovary(2)|skin(1)	3	all_lung(31;3.83e-05)		COAD - Colon adenocarcinoma(61;0.174)|Colorectal(62;0.229)		Dromostanolone(DB00858)|Fluoxymesterone(DB01185)|Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	AGCAGCCAGGGCGTATCCTGG	0.483													86	241	---	---	---	---	PASS
C5orf34	375444	broad.mit.edu	37	5	43487036	43487036	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43487036A>C	uc003jnz.1	-	14	2215	c.1898T>G	c.(1897-1899)CTA>CGA	p.L633R		NM_198566	NP_940968	Q96MH7	CE034_HUMAN	hypothetical protein LOC375444	633										breast(1)	1	Lung NSC(6;2.07e-05)					AGAGTTTGATAGAAGACAGTC	0.308													68	147	---	---	---	---	PASS
ARRDC3	57561	broad.mit.edu	37	5	90667245	90667245	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90667245T>C	uc003kjz.2	-	8	1457	c.1217A>G	c.(1216-1218)GAT>GGT	p.D406G		NM_020801	NP_065852	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	406					signal transduction	cytoplasm	protein binding			ovary(1)|breast(1)	2		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		TGGTCTATCATCTGCTGACTG	0.413													15	43	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115298562	115298562	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115298562C>A	uc003kro.2	+	1	412	c.248C>A	c.(247-249)ACC>AAC	p.T83N	AQPEP_uc003krp.2_RNA|uc003krn.1_5'UTR	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	83	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						GTGACGACCACCCCGAGCAAC	0.692													15	38	---	---	---	---	PASS
FTMT	94033	broad.mit.edu	37	5	121187708	121187708	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121187708C>T	uc003kss.2	+	1	59	c.50C>T	c.(49-51)GCG>GTG	p.A17V		NM_177478	NP_803431	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial precursor	17					cellular iron ion homeostasis|iron ion transport|positive regulation of cell proliferation|positive regulation of lyase activity|positive regulation of oxidoreductase activity|positive regulation of transferase activity	mitochondrion	ferric iron binding|ferroxidase activity			ovary(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		CCTTCGCTGGCGTCTCTGCGC	0.726													13	40	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140223348	140223348	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140223348G>A	uc003lhs.2	+						PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.L814L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor						homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGGAAATTGTAGTTACTTT	0.264													19	53	---	---	---	---	PASS
PCDHA10	56139	broad.mit.edu	37	5	140235897	140235897	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140235897G>T	uc003lhx.2	+	1	264	c.264G>T	c.(262-264)CGG>CGT	p.R88R	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lhu.2_Intron|PCDHA10_uc003lhw.2_Silent_p.R88R|PCDHA10_uc011dad.1_Silent_p.R88R	NM_018901	NP_061724	Q9Y5I2	PCDAA_HUMAN	protocadherin alpha 10 isoform 1 precursor	88	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)|breast(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAATTCTCGGATTGACCGCG	0.592													81	183	---	---	---	---	PASS
PCDHGB4	8641	broad.mit.edu	37	5	140767900	140767900	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140767900C>T	uc003lkc.1	+	1	449	c.449C>T	c.(448-450)ACA>ATA	p.T150I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc011dav.1_Missense_Mutation_p.T150I	NM_003736	NP_003727	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4 isoform 1	150	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCTGGCACACGATTTATA	0.423													19	61	---	---	---	---	PASS
PDGFRB	5159	broad.mit.edu	37	5	149514533	149514533	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149514533G>C	uc003lro.2	-	4	880	c.411C>G	c.(409-411)ATC>ATG	p.I137M	PDGFRB_uc010jhd.2_Translation_Start_Site|PDGFRB_uc011dcg.1_Missense_Mutation_p.I137M	NM_002609	NP_002600	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor beta	137	Extracellular (Potential).|Ig-like C2-type 2.				aorta morphogenesis|cardiac myofibril assembly|hemopoiesis|metanephric glomerular capillary formation|metanephric glomerular mesangial cell proliferation involved in metanephros development|peptidyl-tyrosine phosphorylation|positive regulation of calcium ion import|positive regulation of chemotaxis|positive regulation of DNA biosynthetic process|positive regulation of ERK1 and ERK2 cascade|positive regulation of MAP kinase activity|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway|positive regulation of mitosis|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of reactive oxygen species metabolic process|positive regulation of smooth muscle cell migration|positive regulation of smooth muscle cell proliferation|protein autophosphorylation|regulation of actin cytoskeleton organization|retina vasculature development in camera-type eye|smooth muscle cell chemotaxis	apical plasma membrane|cytoplasm|integral to plasma membrane|nucleus	ATP binding|platelet activating factor receptor activity|platelet-derived growth factor beta-receptor activity|platelet-derived growth factor binding|platelet-derived growth factor receptor binding|vascular endothelial growth factor receptor activity			central_nervous_system(4)|lung(4)|breast(3)|stomach(2)|prostate(2)|large_intestine(1)|ovary(1)	17		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCGTGAGAAAGATGAATAGTT	0.453			T	ETV6|TRIP11|HIP1|RAB5EP|H4|NIN|HCMOGT-1|PDE4DIP	MPD|AML|CMML|CML								29	84	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153029961	153029961	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153029961T>A	uc003lva.3	+	4	897	c.532T>A	c.(532-534)TTG>ATG	p.L178M	GRIA1_uc003luy.3_Missense_Mutation_p.L178M|GRIA1_uc003luz.3_Missense_Mutation_p.L83M|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.L98M|GRIA1_uc011dcx.1_Missense_Mutation_p.L109M|GRIA1_uc011dcy.1_Missense_Mutation_p.L188M|GRIA1_uc011dcz.1_Missense_Mutation_p.L188M|GRIA1_uc010jia.1_Missense_Mutation_p.L158M	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	178	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGTCAACATTTTGACAACCAC	0.498													21	66	---	---	---	---	PASS
HK3	3101	broad.mit.edu	37	5	176314610	176314610	+	Missense_Mutation	SNP	C	T	T	rs61741552	byFrequency	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176314610C>T	uc003mfa.2	-	11	1534	c.1442G>A	c.(1441-1443)CGC>CAC	p.R481H	HK3_uc003mez.2_Missense_Mutation_p.R37H	NM_002115	NP_002106	P52790	HXK3_HUMAN	hexokinase 3	481	Regulatory.				glucose transport|glycolysis|transmembrane transport	cytosol|membrane	ATP binding|glucokinase activity			ovary(3)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)|skin(1)	7	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTCCAGCAGGCGCCGGTGGGC	0.662													11	23	---	---	---	---	PASS
FGFR4	2264	broad.mit.edu	37	5	176517820	176517820	+	Missense_Mutation	SNP	C	G	G	rs74633199		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176517820C>G	uc003mfl.2	+	4	597	c.430C>G	c.(430-432)CAG>GAG	p.Q144E	FGFR4_uc003mfm.2_Missense_Mutation_p.Q144E|FGFR4_uc011dfu.1_Missense_Mutation_p.Q144E|FGFR4_uc011dfv.1_RNA|FGFR4_uc003mfn.1_Missense_Mutation_p.Q144E|FGFR4_uc011dfw.1_Missense_Mutation_p.Q144E|FGFR4_uc003mfo.2_Missense_Mutation_p.Q144E	NM_002011	NP_002002	P22455	FGFR4_HUMAN	fibroblast growth factor receptor 4 isoform 1	144	Extracellular (Potential).				insulin receptor signaling pathway|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity			lung(11)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|prostate(1)	16	all_cancers(89;5.93e-05)|Renal(175;0.000269)|Lung NSC(126;0.0088)|all_lung(126;0.0142)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Palifermin(DB00039)	CAGTTACCCCCAGCAAGGTCA	0.562										TSP Lung(9;0.080)			14	54	---	---	---	---	PASS
TRIM38	10475	broad.mit.edu	37	6	25967059	25967059	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25967059C>T	uc003nfm.2	+	3	744	c.309C>T	c.(307-309)TTC>TTT	p.F103F	TRIM38_uc003nfn.2_Silent_p.F103F	NM_006355	NP_006346	O00635	TRI38_HUMAN	tripartite motif-containing 38	103	B box-type.				positive regulation of I-kappaB kinase/NF-kappaB cascade	intracellular	signal transducer activity|zinc ion binding				0						TCCACCTGTTCTGCGAAGACG	0.567													24	68	---	---	---	---	PASS
ZKSCAN3	80317	broad.mit.edu	37	6	28327584	28327584	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327584G>T	uc003nle.3	+	2	437	c.221G>T	c.(220-222)TGG>TTG	p.W74L	ZKSCAN3_uc010jrc.2_Missense_Mutation_p.W74L|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	74	SCAN box.				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						TGCCGACAGTGGCTGCAGCCT	0.677													10	35	---	---	---	---	PASS
WDR46	9277	broad.mit.edu	37	6	33247137	33247137	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33247137C>A	uc003ods.2	-	15	1793	c.1749G>T	c.(1747-1749)CAG>CAT	p.Q583H	WDR46_uc011dra.1_Missense_Mutation_p.Q529H	NM_005452	NP_005443	O15213	WDR46_HUMAN	WD repeat domain 46 isoform 1	583											0						GCTGAAGGCTCTGCCGGACCT	0.642													4	185	---	---	---	---	PASS
SCUBE3	222663	broad.mit.edu	37	6	35201038	35201038	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35201038T>A	uc003okf.1	+	6	678	c.672T>A	c.(670-672)CAT>CAA	p.H224Q	SCUBE3_uc003okg.1_Missense_Mutation_p.H223Q|SCUBE3_uc003okh.1_Missense_Mutation_p.H95Q	NM_152753	NP_689966	Q8IX30	SCUB3_HUMAN	signal peptide, CUB domain, EGF-like 3	224	EGF-like 5.				protein heterooligomerization|protein homooligomerization	cell surface|extracellular region	calcium ion binding|protein binding			skin(1)	1						GCGGCTGCCATATCAAGTTTG	0.607													9	20	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38899660	38899660	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38899660C>T	uc003ooe.1	+	74	11297	c.10697C>T	c.(10696-10698)CCT>CTT	p.P3566L	DNAH8_uc003oog.1_Missense_Mutation_p.P15L|uc003oof.1_Intron	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						TTACCAAATCCTGCCTTTACC	0.328													14	245	---	---	---	---	PASS
TCTE1	202500	broad.mit.edu	37	6	44253968	44253968	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44253968G>A	uc003oxi.2	-	3	735	c.579C>T	c.(577-579)GTC>GTT	p.V193V	SPATS1_uc003oxg.2_Intron|TMEM151B_uc003oxf.2_Intron	NM_182539	NP_872345	Q5JU00	TCTE1_HUMAN	t-complex-associated testis expressed 1	193										ovary(2)|skin(2)	4	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			GGAACTGATCGACGTGGACCC	0.652													5	53	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51618128	51618128	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51618128C>T	uc003pah.1	-	57	9097	c.8821G>A	c.(8821-8823)GGC>AGC	p.G2941S	PKHD1_uc010jzn.1_Missense_Mutation_p.G924S|PKHD1_uc003pai.2_Missense_Mutation_p.G2941S	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	2941	Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					ATGTGTCGGCCATCCTCCGTG	0.468													19	71	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51907648	51907648	+	Intron	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51907648C>G	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					GAGACCCTCCCCAGATTACCA	0.468													8	75	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70812096	70812096	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70812096A>G	uc003pfc.1	+	16	1377	c.1260A>G	c.(1258-1260)CCA>CCG	p.P420P	COL19A1_uc010kam.1_Silent_p.P316P	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	420	Triple-helical region 2 (COL2).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CCGGAAAACCAGGACCCCCAG	0.393													32	147	---	---	---	---	PASS
PNRC1	10957	broad.mit.edu	37	6	89793726	89793726	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89793726G>T	uc003pmv.2	+	2	980	c.795G>T	c.(793-795)AAG>AAT	p.K265N	PNRC1_uc003pmx.2_Missense_Mutation_p.K80N	NM_006813	NP_006804	Q12796	PNRC1_HUMAN	proline-rich nuclear receptor coactivator 1	265					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding				0		all_cancers(76;3.64e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00527)		BRCA - Breast invasive adenocarcinoma(108;0.102)		CGCATTTGAAGAAATCAGCAT	0.373										Multiple Myeloma(7;0.094)			35	149	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123539864	123539864	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123539864C>A	uc003pzj.1	-	41	2094	c.2072G>T	c.(2071-2073)TGT>TTT	p.C691F	TRDN_uc010kem.1_Missense_Mutation_p.C192F	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin	691	Lumenal.				muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		CAAGTAGACACACTGGAAGAA	0.398													3	13	---	---	---	---	PASS
VNN1	8876	broad.mit.edu	37	6	133013397	133013397	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:133013397C>G	uc003qdo.2	-	5	1173	c.1153G>C	c.(1153-1155)GGA>CGA	p.G385R		NM_004666	NP_004657	O95497	VNN1_HUMAN	vanin 1 precursor	385					acute inflammatory response|anti-apoptosis|cell-cell adhesion|cellular component movement|chronic inflammatory response|innate immune response|pantothenate metabolic process|positive regulation of T cell differentiation in thymus|response to oxidative stress	anchored to membrane|integral to membrane|plasma membrane	GPI anchor binding|pantetheine hydrolase activity			ovary(3)	3	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.0027)|GBM - Glioblastoma multiforme(226;0.0189)		GTGTGCAGTCCGTCAAATGCC	0.308													35	184	---	---	---	---	PASS
FBXO30	84085	broad.mit.edu	37	6	146126164	146126164	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146126164T>C	uc003qla.2	-	2	1577	c.1378A>G	c.(1378-1380)ACT>GCT	p.T460A	uc003qky.1_Intron	NM_032145	NP_115521	Q8TB52	FBX30_HUMAN	F-box only protein 30	460							ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|large_intestine(1)	3		Ovarian(120;0.0776)		OV - Ovarian serous cystadenocarcinoma(155;1.95e-07)|GBM - Glioblastoma multiforme(68;0.0149)		AGTGAAAAAGTCTGAGTCCCA	0.443													49	254	---	---	---	---	PASS
ESR1	2099	broad.mit.edu	37	6	152265432	152265432	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152265432G>T	uc003qom.3	+	6	1255	c.885G>T	c.(883-885)CCG>CCT	p.P295P	ESR1_uc010kin.2_Silent_p.P295P|ESR1_uc010kio.2_Silent_p.P297P|ESR1_uc010kip.2_Silent_p.P294P|ESR1_uc003qon.3_Silent_p.P295P|ESR1_uc003qoo.3_Silent_p.P295P|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Silent_p.P76P|ESR1_uc010kit.1_Silent_p.P32P|ESR1_uc011eey.1_Silent_p.P32P	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	295	Interaction with AKAP13.|Hinge.|Mediates interaction with DNTTIP2.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	GGCCAAGCCCGCTCATGATCA	0.562													28	137	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152668193	152668193	+	Splice_Site	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152668193C>A	uc010kiw.2	-	73	12680	c.12078_splice	c.e73+1	p.R4026_splice	SYNE1_uc003qot.3_Splice_Site_p.R3955_splice|SYNE1_uc003qou.3_Splice_Site_p.R4026_splice|SYNE1_uc010kja.1_Splice_Site_p.R731_splice	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		GGGGCACTCACCCTCTGAGCT	0.483										HNSCC(10;0.0054)			17	76	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152746553	152746553	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152746553C>T	uc010kiw.2	-	39	5832	c.5230G>A	c.(5230-5232)GAG>AAG	p.E1744K	SYNE1_uc003qot.3_Missense_Mutation_p.E1751K|SYNE1_uc003qou.3_Missense_Mutation_p.E1744K|SYNE1_uc010kjb.1_Missense_Mutation_p.E1727K	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1744	Spectrin 2.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTCCATCTCTCATCCAACTGC	0.318										HNSCC(10;0.0054)			44	162	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152762360	152762360	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152762360C>A	uc010kiw.2	-	32	4656	c.4054G>T	c.(4054-4056)GTA>TTA	p.V1352L	SYNE1_uc003qot.3_Missense_Mutation_p.V1359L|SYNE1_uc003qou.3_Missense_Mutation_p.V1352L|SYNE1_uc010kjb.1_Missense_Mutation_p.V1335L|SYNE1_uc003qow.2_Missense_Mutation_p.V647L|SYNE1_uc003qox.1_Missense_Mutation_p.V868L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1352	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TATCTTACTACTGTTTCTTTG	0.323										HNSCC(10;0.0054)			8	32	---	---	---	---	PASS
GET4	51608	broad.mit.edu	37	7	926205	926205	+	Splice_Site	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:926205G>A	uc003sjl.1	+	3	327	c.235_splice	c.e3-1	p.Q79_splice	GET4_uc003sjj.1_Splice_Site	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608						tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						TTCTCTTGTAGCAAAACAGTG	0.562													24	205	---	---	---	---	PASS
GET4	51608	broad.mit.edu	37	7	926206	926206	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:926206C>T	uc003sjl.1	+	3	327	c.235C>T	c.(235-237)CAA>TAA	p.Q79*	GET4_uc003sjj.1_RNA	NM_015949	NP_057033	Q7L5D6	GET4_HUMAN	hypothetical protein LOC51608	79					tail-anchored membrane protein insertion into ER membrane|transport	BAT3 complex	protein binding				0						TCTCTTGTAGCAAAACAGTGC	0.557													25	205	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11464333	11464333	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11464333G>A	uc003ssf.3	-	15	3625	c.3373C>T	c.(3373-3375)CGA>TGA	p.R1125*		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1125	TSP type-1 11.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CTCACTTTTCGGGTTTGCACG	0.488										HNSCC(18;0.044)			142	271	---	---	---	---	PASS
HOXA3	3200	broad.mit.edu	37	7	27148028	27148028	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27148028T>A	uc011jzl.1	-	3	1038	c.838A>T	c.(838-840)ATG>TTG	p.M280L	HOXA3_uc011jzk.1_Missense_Mutation_p.M122L|HOXA3_uc003syk.2_Missense_Mutation_p.M280L	NM_030661	NP_109377	O43365	HXA3_HUMAN	homeobox A3 isoform a	280					angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						AGCGAATGCATAGAGTTCAGA	0.657													72	48	---	---	---	---	PASS
EGFR	1956	broad.mit.edu	37	7	55223520	55223520	+	Intron	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55223520C>T	uc003tqk.2	+						EGFR_uc003tqh.2_Intron|EGFR_uc003tqi.2_Intron|EGFR_uc003tqj.2_Intron|EGFR_uc010kzg.1_Intron|EGFR_uc011kco.1_Intron|EGFR_uc011kcp.1_5'Flank|EGFR_uc011kcq.1_5'Flank	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTCTCTTCCCCAGGTAATTAT	0.587		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			62	58	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57187553	57187553	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57187553A>G	uc010kzo.2	-	5	1840	c.1569T>C	c.(1567-1569)TGT>TGC	p.C523C		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	523					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			CATATTATTCACATTTGTAGG	0.353													8	54	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72744195	72744195	+	Missense_Mutation	SNP	G	A	A	rs3950376		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72744195G>A	uc003tya.2	+	4	440	c.308G>A	c.(307-309)CGG>CAG	p.R103Q	FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Missense_Mutation_p.R98Q|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	103	PPIase FKBP-type.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				CTGAGCATGCGGAGAGGAGAG	0.473													7	54	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72744255	72744255	+	Missense_Mutation	SNP	G	C	C	rs1064197		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72744255G>C	uc003tya.2	+	4	500	c.368G>C	c.(367-369)TGC>TCC	p.C123S	FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Missense_Mutation_p.C118S|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	123	PPIase FKBP-type.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				ACGCTGGGCTGCCCTCCCTTG	0.547													10	81	---	---	---	---	PASS
FKBP6	8468	broad.mit.edu	37	7	72744316	72744316	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72744316G>A	uc003tya.2	+	4	561	c.429G>A	c.(427-429)CTG>CTA	p.L143L	FKBP6_uc003twz.2_Intron|FKBP6_uc011kew.1_Silent_p.L138L|FKBP6_uc010lbe.1_RNA|TRIM50_uc003txy.1_5'Flank|TRIM50_uc003txz.1_5'Flank	NM_003602	NP_003593	O75344	FKBP6_HUMAN	FK506 binding protein 6 isoform a	143	PPIase FKBP-type.				protein folding	membrane	FK506 binding|peptidyl-prolyl cis-trans isomerase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				TTGACTTCCTGGACTGTGCTG	0.498													14	73	---	---	---	---	PASS
WBSCR22	114049	broad.mit.edu	37	7	73101371	73101371	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73101371G>A	uc003tyt.2	+	5	366	c.308G>A	c.(307-309)GGG>GAG	p.G103E	WBSCR22_uc010lbi.1_Intron|WBSCR22_uc003tyu.2_Missense_Mutation_p.G103E|WBSCR22_uc003tyv.2_Missense_Mutation_p.G65E|WBSCR22_uc003tyw.1_Intron	NM_017528	NP_059998	O43709	WBS22_HUMAN	Williams Beuren syndrome chromosome region 22	103						nucleus	methyltransferase activity				0		Lung NSC(55;0.0908)|all_lung(88;0.198)				CTGCTGCTGGGGGATATGGGC	0.453													5	197	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82764123	82764123	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82764123C>A	uc003uhx.2	-	3	3032	c.2743G>T	c.(2743-2745)GCC>TCC	p.A915S	PCLO_uc003uhv.2_Missense_Mutation_p.A915S	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	861	Pro-rich.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GATTTGGGGGCATCAGTAATA	0.502													117	106	---	---	---	---	PASS
GRM3	2913	broad.mit.edu	37	7	86416093	86416093	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86416093C>A	uc003uid.2	+	3	2084	c.985C>A	c.(985-987)CCT>ACT	p.P329T	GRM3_uc010lef.2_Missense_Mutation_p.P327T|GRM3_uc010leg.2_Missense_Mutation_p.P201T|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor	329	Extracellular (Potential).				synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	GGCCTCCCAGCCTGTCCGCCA	0.642													23	16	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965674	88965674	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965674C>A	uc011khi.1	+	4	3916	c.3378C>A	c.(3376-3378)GAC>GAA	p.D1126E		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1126						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AGAAACCTGACAAAGTCGAAG	0.338										HNSCC(36;0.09)			89	98	---	---	---	---	PASS
TRIM4	89122	broad.mit.edu	37	7	99490142	99490142	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99490142C>G	uc003usd.2	-	7	1277	c.1147G>C	c.(1147-1149)GAA>CAA	p.E383Q	TRIM4_uc003use.2_Missense_Mutation_p.E357Q|TRIM4_uc011kjc.1_Missense_Mutation_p.E213Q	NM_033017	NP_148977	Q9C037	TRIM4_HUMAN	tripartite motif protein TRIM4 isoform alpha	383	B30.2/SPRY.				protein trimerization	cytoplasm|plasma membrane	zinc ion binding			ovary(1)|kidney(1)	2	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				CTCTCAACTTCCCAGTAATGT	0.468													57	219	---	---	---	---	PASS
C7orf47	221908	broad.mit.edu	37	7	100032996	100032996	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100032996C>T	uc003uuy.1	-	4	846	c.749G>A	c.(748-750)CGA>CAA	p.R250Q	C7orf47_uc003uux.1_Missense_Mutation_p.R148Q	NM_145030	NP_659467	Q8TAP8	CG047_HUMAN	hypothetical protein LOC221908	250										ovary(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CGCTTCCCATCGCCTCAGTGT	0.507													4	88	---	---	---	---	PASS
PNPLA8	50640	broad.mit.edu	37	7	108142996	108142996	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108142996A>G	uc003vff.1	-	6	1704	c.1297T>C	c.(1297-1299)TAT>CAT	p.Y433H	PNPLA8_uc003vfg.1_RNA|PNPLA8_uc003vfh.1_Missense_Mutation_p.Y433H|PNPLA8_uc003vfi.1_Missense_Mutation_p.Y333H|PNPLA8_uc003vfj.1_Missense_Mutation_p.Y433H|PNPLA8_uc003vfk.1_Missense_Mutation_p.Y333H	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8	433					fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						GGATCCACATAGCCAATTAGG	0.353													3	180	---	---	---	---	PASS
TMEM209	84928	broad.mit.edu	37	7	129813706	129813706	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129813706G>T	uc003vpn.2	-	12	1541	c.1418C>A	c.(1417-1419)ACT>AAT	p.T473N	TMEM209_uc010lmc.1_Missense_Mutation_p.T431N	NM_032842	NP_116231	Q96SK2	TM209_HUMAN	transmembrane protein 209	473						integral to membrane				ovary(2)|large_intestine(1)	3	Melanoma(18;0.0435)					AGAAGTAAAAGTTTTTCCGTC	0.368													161	184	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134890771	134890771	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134890771C>T	uc003vsp.2	-	5	696	c.634G>A	c.(634-636)GAG>AAG	p.E212K	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	212	Potential.									breast(2)|ovary(1)|skin(1)	4						TGTTGCTCCTCTTTCTTCAGT	0.517													8	300	---	---	---	---	PASS
TAS2R4	50832	broad.mit.edu	37	7	141478538	141478538	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141478538T>C	uc003vwq.1	+	1	250	c.250T>C	c.(250-252)TTT>CTT	p.F84L		NM_016944	NP_058640	Q9NYW5	TA2R4_HUMAN	taste receptor T2R4	84	Helical; Name=3; (Potential).				sensory perception of taste	cilium membrane	taste receptor activity				0	Melanoma(164;0.0171)			BRCA - Breast invasive adenocarcinoma(188;0.196)		GTCTGCTTTTTTTGTGTTGTG	0.428													118	233	---	---	---	---	PASS
ZNF282	8427	broad.mit.edu	37	7	148910796	148910796	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148910796C>G	uc003wfm.2	+	7	1175	c.1070C>G	c.(1069-1071)TCT>TGT	p.S357C	ZNF282_uc011kun.1_Missense_Mutation_p.S357C|ZNF282_uc003wfn.2_Missense_Mutation_p.S297C|ZNF282_uc003wfo.2_Intron	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	357					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		ACAACAGAGTCTCTCATCTCA	0.498													19	29	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149486368	149486368	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149486368G>A	uc010lpk.2	+	30	4344	c.4344G>A	c.(4342-4344)CCG>CCA	p.P1448P		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	1448	LDL-receptor class A 2.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CGGATGAGCCGAGCTATCCGT	0.687													12	28	---	---	---	---	PASS
GIMAP6	474344	broad.mit.edu	37	7	150324861	150324861	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150324861G>T	uc003whn.2	-	3	1249	c.825C>A	c.(823-825)ATC>ATA	p.I275I	GIMAP6_uc003whm.2_Silent_p.I195I	NM_024711	NP_078987	Q6P9H5	GIMA6_HUMAN	GTPase, IMAP family member 6	275							GTP binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATTCCTTCTGGATCTGGGACA	0.567													100	90	---	---	---	---	PASS
GIMAP2	26157	broad.mit.edu	37	7	150389460	150389460	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150389460G>A	uc003who.2	+	3	174	c.86G>A	c.(85-87)GGC>GAC	p.G29D	GIMAP1_uc003whp.2_Intron	NM_015660	NP_056475	Q9UG22	GIMA2_HUMAN	GTPase, IMAP family member 2	29	GTP (Potential).					integral to membrane	GTP binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCCTGGTGGGCAAAACAGGA	0.507													13	78	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	152009027	152009027	+	Nonsense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152009027G>A	uc003wla.2	-	5	814	c.595C>T	c.(595-597)CGA>TGA	p.R199*		NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	199					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TGAGGAGATCGTTCTCTGAAA	0.348			N		medulloblastoma								41	144	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2820851	2820851	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2820851C>A	uc011kwk.1	-	60	9740	c.9350G>T	c.(9349-9351)GGC>GTC	p.G3117V	CSMD1_uc011kwj.1_Missense_Mutation_p.G2446V|CSMD1_uc010lrg.2_Missense_Mutation_p.G1008V	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	3117	Sushi 25.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TATGCTGGAGCCCCAGCGGAA	0.562													57	147	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3263612	3263612	+	Missense_Mutation	SNP	A	T	T	rs115440730	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3263612A>T	uc011kwk.1	-	15	2596	c.2206T>A	c.(2206-2208)TCC>ACC	p.S736T	CSMD1_uc011kwj.1_Missense_Mutation_p.S128T	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	736	Sushi 4.|Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CAGGTAATGGACTCGGATCCC	0.552													6	56	---	---	---	---	PASS
DEFB136	613210	broad.mit.edu	37	8	11832058	11832058	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11832058A>G	uc011kxm.1	-	1	51	c.51T>C	c.(49-51)CCT>CCC	p.P17P		NM_001033018	NP_001028190	Q30KP8	DB136_HUMAN	beta-defensin 136 precursor	17					defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)		TCTTACCTGAAGGCAGTAAGA	0.483													41	220	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	12957578	12957578	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12957578G>T	uc003wwm.2	-	9	2712	c.2268C>A	c.(2266-2268)CCC>CCA	p.P756P	DLC1_uc003wwk.1_Silent_p.P319P|DLC1_uc003wwl.1_Silent_p.P353P|DLC1_uc011kxx.1_Silent_p.P245P	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	756					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						TAACAGGGCTGGGCGTGCTGA	0.582													4	59	---	---	---	---	PASS
TMEM66	51669	broad.mit.edu	37	8	29927357	29927357	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29927357C>A	uc003xhs.2	-	3	685	c.501G>T	c.(499-501)TCG>TCT	p.S167S	TMEM66_uc003xht.2_Silent_p.S167S|TMEM66_uc003xhu.2_Silent_p.S131S|TMEM66_uc003xhv.2_5'UTR	NM_016127	NP_057211	Q96BY9	TMM66_HUMAN	transmembrane protein 66 precursor	167						integral to membrane					0				KIRC - Kidney renal clear cell carcinoma(542;0.0993)|Kidney(114;0.119)		AGGAATCCGCCGAGGACCACT	0.438													13	108	---	---	---	---	PASS
PROSC	11212	broad.mit.edu	37	8	37623233	37623233	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37623233A>C	uc003xkh.2	+	3	289	c.212A>C	c.(211-213)CAG>CCG	p.Q71P		NM_007198	NP_009129	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog	71							pyridoxal phosphate binding			central_nervous_system(1)	1		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)|Pyridoxal Phosphate(DB00114)	TTTTAGGTTCAGGAACTGCTA	0.393													84	313	---	---	---	---	PASS
PCMTD1	115294	broad.mit.edu	37	8	52732955	52732955	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52732955G>T	uc003xqx.3	-	6	1371	c.1030C>A	c.(1030-1032)CCT>ACT	p.P344T	PCMTD1_uc011ldm.1_Missense_Mutation_p.P214T|PCMTD1_uc003xqw.3_Missense_Mutation_p.P344T|PCMTD1_uc011ldn.1_Missense_Mutation_p.P156T|PCMTD1_uc010lya.2_Missense_Mutation_p.P268T	NM_052937	NP_443169	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate)	344						cytoplasm	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity				0		Lung NSC(129;0.0795)|all_lung(136;0.144)				AAAGATTCAGGGAGGGGCAGC	0.308													4	150	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87656009	87656009	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87656009G>T	uc003ydx.2	-	10	1194	c.1148C>A	c.(1147-1149)ACT>AAT	p.T383N	CNGB3_uc010maj.2_Missense_Mutation_p.T245N	NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	383	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						CACCCATCTAGTAGTGCCAAT	0.343													39	236	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89179936	89179936	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89179936G>T	uc003yeb.3	-	4	953	c.671C>A	c.(670-672)TCA>TAA	p.S224*	MMP16_uc003yec.2_Nonsense_Mutation_p.S224*	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	224	Extracellular (Potential).				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						TGGCTCATCTGAGTCAAAATG	0.413													61	88	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100836079	100836079	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100836079C>T	uc003yiv.2	+	51	9389	c.9278C>T	c.(9277-9279)TCC>TTC	p.S3093F	VPS13B_uc003yiw.2_Missense_Mutation_p.S3068F	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	3093					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TTCTGCATTTCCTCCATGGTA	0.289													14	415	---	---	---	---	PASS
RRM2B	50484	broad.mit.edu	37	8	103251071	103251071	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103251071C>G	uc003ykn.2	-	1	276	c.32G>C	c.(31-33)GGG>GCG	p.G11A	RRM2B_uc003yko.2_5'Flank|RRM2B_uc010mbv.1_Missense_Mutation_p.G11A|RRM2B_uc010mbw.1_Missense_Mutation_p.G11A|RRM2B_uc010mbx.1_RNA|RRM2B_uc010mby.1_RNA	NM_015713	NP_056528	Q7LG56	RIR2B_HUMAN	ribonucleotide reductase M2 B (TP53 inducible)	11					deoxyribonucleoside diphosphate metabolic process|DNA repair|nucleobase, nucleoside and nucleotide interconversion	nucleoplasm	ribonucleoside-diphosphate reductase activity|transition metal ion binding			ovary(2)	2	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000728)			CTGATCCAGCCCGGCCGCTTC	0.617								Direct_reversal_of_damage|Modulation_of_nucleotide_pools					40	44	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105105769	105105769	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105105769G>T	uc003yls.2	+	21	3033	c.2792G>T	c.(2791-2793)AGT>ATT	p.S931I	RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Missense_Mutation_p.S1004I|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			AGTGATGTAAGTGATATATCT	0.428										HNSCC(12;0.0054)			26	264	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109241403	109241403	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109241403C>T	uc003ymu.2	-	6	521	c.493G>A	c.(493-495)GCT>ACT	p.A165T	EIF3E_uc003ymt.2_Missense_Mutation_p.A116T|EIF3E_uc003ymv.2_Missense_Mutation_p.A72T|EIF3E_uc010mci.1_Missense_Mutation_p.A165T	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	165	Sufficient for interaction with TRIM27.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GAACTTAAAGCATTTCTATCT	0.348													71	83	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113662392	113662392	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113662392T>A	uc003ynu.2	-	19	3350	c.3191A>T	c.(3190-3192)GAT>GTT	p.D1064V	CSMD3_uc003yns.2_Missense_Mutation_p.D336V|CSMD3_uc003ynt.2_Missense_Mutation_p.D1024V|CSMD3_uc011lhx.1_Missense_Mutation_p.D960V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1064	Extracellular (Potential).|Sushi 5.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GTTATTACCATCACAGGTTGG	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			75	95	---	---	---	---	PASS
WDYHV1	55093	broad.mit.edu	37	8	124440252	124440252	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124440252G>C	uc003yqn.1	+	2	297	c.172G>C	c.(172-174)GAG>CAG	p.E58Q	WDYHV1_uc011lij.1_5'UTR|WDYHV1_uc003yqo.1_5'Flank	NM_018024	NP_060494	Q96HA8	NTAQ1_HUMAN	WDYHV motif containing 1	58					protein modification process	cytosol|nucleus	protein binding|protein N-terminal glutamine amidohydrolase activity			ovary(1)|skin(1)	2						CATATCTAATGAGAGGAAGAT	0.303													45	288	---	---	---	---	PASS
SQLE	6713	broad.mit.edu	37	8	126011677	126011677	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126011677C>A	uc011liq.1	+	1	958	c.32C>A	c.(31-33)ACC>AAC	p.T11N		NM_003129	NP_003120	Q14534	ERG1_HUMAN	squalene epoxidase	11					cholesterol biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome	flavin adenine dinucleotide binding|squalene monooxygenase activity			ovary(1)|breast(1)	2	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)		Butenafine(DB01091)|Naftifine(DB00735)|Terbinafine(DB00857)	GCCACTTTCACCTATTTTTAT	0.522													22	32	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131792917	131792917	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131792917T>C	uc003ytd.3	-	18	3731	c.3475A>G	c.(3475-3477)AGT>GGT	p.S1159G	ADCY8_uc010mds.2_Missense_Mutation_p.S1028G	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1159	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			TCCTGTTCACTGATACCCTTC	0.507										HNSCC(32;0.087)			18	244	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131949360	131949360	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131949360G>T	uc003ytd.3	-	5	1696	c.1440C>A	c.(1438-1440)CAC>CAA	p.H480Q	ADCY8_uc010mds.2_Missense_Mutation_p.H480Q	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	480	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CAACACAGCAGTGGGCATGGT	0.517										HNSCC(32;0.087)			58	86	---	---	---	---	PASS
RANBP6	26953	broad.mit.edu	37	9	6012658	6012658	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6012658T>G	uc003zjr.2	-	1	2961	c.2950A>C	c.(2950-2952)ATA>CTA	p.I984L	RANBP6_uc011lmf.1_Missense_Mutation_p.I632L|RANBP6_uc003zjs.2_Missense_Mutation_p.I572L	NM_012416	NP_036548	O60518	RNBP6_HUMAN	RAN binding protein 6	984	HEAT 7.				protein transport	cytoplasm|nucleus	binding			ovary(3)	3		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		ATCTTCCCTATTGCTGAGATA	0.363													3	130	---	---	---	---	PASS
CER1	9350	broad.mit.edu	37	9	14720297	14720297	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14720297C>T	uc003zlj.2	-	2	640	c.595G>A	c.(595-597)GCG>ACG	p.A199T		NM_005454	NP_005445	O95813	CER1_HUMAN	cerberus 1 precursor	199	CTCK.				BMP signaling pathway	extracellular space	cytokine activity				0				GBM - Glioblastoma multiforme(50;3.16e-06)		GAGTGCTGCGCGGCTCCAGGA	0.488													21	59	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	67952026	67952026	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67952026G>A	uc004aeu.2	+						ANKRD20A3_uc010mnn.2_Intron	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3												0						GGTGAGAACCGTATTTTATTT	0.269													38	142	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109687239	109687239	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109687239A>C	uc004bcz.2	+	3	1335	c.1046A>C	c.(1045-1047)AAG>ACG	p.K349T	ZNF462_uc010mto.2_Missense_Mutation_p.K197T|ZNF462_uc004bda.2_Missense_Mutation_p.K197T	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	349					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						ATGAAGCCGAAGTCACCTCAC	0.478													16	44	---	---	---	---	PASS
ACTL7B	10880	broad.mit.edu	37	9	111617377	111617377	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111617377G>A	uc004bdi.2	-	1	899	c.834C>T	c.(832-834)CGC>CGT	p.R278R		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	278						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1						CGTAGTCCACGCGCAGCTCCT	0.627													17	45	---	---	---	---	PASS
SLC31A2	1318	broad.mit.edu	37	9	115925107	115925107	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115925107A>G	uc004bgq.2	+	4	459	c.342A>G	c.(340-342)GTA>GTG	p.V114V		NM_001860	NP_001851	O15432	COPT2_HUMAN	solute carrier family 31 (copper transporters),	114	Helical; (Potential).					integral to plasma membrane	copper ion transmembrane transporter activity				0						TGCTGGCCGTAATGTCCTACA	0.493													64	156	---	---	---	---	PASS
KIF12	113220	broad.mit.edu	37	9	116854706	116854706	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116854706G>T	uc004bif.2	-	15	1547	c.1309C>A	c.(1309-1311)CGA>AGA	p.R437R	KIF12_uc004big.2_RNA	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12	570	Pro-rich.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						GCCAGGACTCGGGTCTGAGTC	0.612													4	94	---	---	---	---	PASS
MEGF9	1955	broad.mit.edu	37	9	123367532	123367532	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123367532C>T	uc004bkj.1	-	8	1856	c.1856G>A	c.(1855-1857)GGC>GAC	p.G619D	MEGF9_uc011lyb.1_Missense_Mutation_p.G574D	NM_001080497	NP_001073966	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	582	Cytoplasmic (Potential).					integral to membrane	calcium ion binding				0						CACTTCATTGCCATCATCTTC	0.468													55	129	---	---	---	---	PASS
MEGF9	1955	broad.mit.edu	37	9	123367533	123367533	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123367533C>G	uc004bkj.1	-	8	1855	c.1855G>C	c.(1855-1857)GGC>CGC	p.G619R	MEGF9_uc011lyb.1_Missense_Mutation_p.G574R	NM_001080497	NP_001073966	Q9H1U4	MEGF9_HUMAN	multiple EGF-like-domains 9	582	Cytoplasmic (Potential).					integral to membrane	calcium ion binding				0						ACTTCATTGCCATCATCTTCC	0.468													55	134	---	---	---	---	PASS
CALML5	51806	broad.mit.edu	37	10	5541104	5541104	+	Missense_Mutation	SNP	C	A	A	rs147358772		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5541104C>A	uc001iic.2	-	1	430	c.298G>T	c.(298-300)GTG>TTG	p.V100L		NM_017422	NP_059118	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	100	EF-hand 3.|3 (Potential).				epidermis development|signal transduction		calcium ion binding|protein binding				0						AGCTCGTCCACGGTGATGTGG	0.726													5	22	---	---	---	---	PASS
PRPF18	8559	broad.mit.edu	37	10	13629156	13629156	+	Intron	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13629156A>T	uc001imp.2	+						PRPF18_uc001imq.2_Intron	NM_003675	NP_003666	Q99633	PRP18_HUMAN	PRP18 pre-mRNA processing factor 18 homolog						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex				central_nervous_system(1)	1						GCTGGTGGTGAGGACCCTGCG	0.582													63	128	---	---	---	---	PASS
FAM171A1	221061	broad.mit.edu	37	10	15296787	15296787	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15296787C>A	uc001iob.2	-	4	517	c.510G>T	c.(508-510)ACG>ACT	p.T170T		NM_001010924	NP_001010924	Q5VUB5	F1711_HUMAN	hypothetical protein LOC221061 precursor	170	Extracellular (Potential).					integral to membrane				ovary(2)|breast(1)|skin(1)	4						AGCTGGCGGCCGTGAGAAACG	0.542													8	69	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15600085	15600085	+	Silent	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15600085A>C	uc001ioc.1	-	26	2754	c.2754T>G	c.(2752-2754)CCT>CCG	p.P918P	ITGA8_uc010qcb.1_Silent_p.P903P	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	918	Extracellular (Potential).				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						GTATTTTTGCAGGGCTCTGTC	0.453													30	164	---	---	---	---	PASS
RSU1	6251	broad.mit.edu	37	10	16737123	16737123	+	Silent	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16737123T>A	uc001iok.2	-	7	932	c.630A>T	c.(628-630)GTA>GTT	p.V210V	RSU1_uc001iol.2_Silent_p.V210V|RSU1_uc001iom.2_Silent_p.V157V	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2	210					cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		CTGCTTTGAATACCTGCTTCT	0.463													33	52	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25840014	25840014	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25840014G>C	uc001isj.2	+	6	1574	c.1514G>C	c.(1513-1515)AGG>ACG	p.R505T		NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	505	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						AAACTTCACAGGTATATACAT	0.408													36	209	---	---	---	---	PASS
ACBD5	91452	broad.mit.edu	37	10	27507019	27507019	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27507019T>C	uc010qdp.1	-	7	910	c.719A>G	c.(718-720)CAG>CGG	p.Q240R	ACBD5_uc010qdm.1_Missense_Mutation_p.Q238R|ACBD5_uc010qdn.1_Missense_Mutation_p.Q131R|ACBD5_uc010qdo.1_Intron|ACBD5_uc001ito.2_Missense_Mutation_p.Q205R|ACBD5_uc001itp.2_Missense_Mutation_p.Q131R|ACBD5_uc001itq.2_Missense_Mutation_p.Q131R|ACBD5_uc001itr.1_Missense_Mutation_p.Q29R	NM_145698	NP_663736	Q5T8D3	ACBD5_HUMAN	acyl-Coenzyme A binding domain containing 5	249					transport	integral to membrane|peroxisomal membrane	fatty-acyl-CoA binding				0						AATGTCATTCTGTATATCCTG	0.388													46	265	---	---	---	---	PASS
ZNF33A	7581	broad.mit.edu	37	10	38343954	38343954	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38343954A>G	uc001izh.2	+	5	1077	c.899A>G	c.(898-900)TAT>TGT	p.Y300C	ZNF33A_uc001izg.2_Missense_Mutation_p.Y301C|ZNF33A_uc010qev.1_Missense_Mutation_p.Y307C|ZNF33A_uc001izi.1_Intron	NM_006974	NP_008905	Q06730	ZN33A_HUMAN	zinc finger protein 33A isoform b	300						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						ATGAAACACTATGATTGTGGT	0.383													36	174	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50723928	50723928	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50723928G>T	uc001jht.2	-	2	1488	c.1233C>A	c.(1231-1233)TGC>TGA	p.C411*	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Nonsense_Mutation_p.C879*|PGBD3_uc001jhu.2_Nonsense_Mutation_p.C879*	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	411										pancreas(1)|breast(1)|skin(1)	3						CATTCCATCTGCAGACAATAT	0.408													50	163	---	---	---	---	PASS
PGBD3	267004	broad.mit.edu	37	10	50723929	50723929	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50723929C>T	uc001jht.2	-	2	1487	c.1232G>A	c.(1231-1233)TGC>TAC	p.C411Y	ERCC6_uc001jhs.3_Intron|PGBD3_uc009xoe.2_Missense_Mutation_p.C879Y|PGBD3_uc001jhu.2_Missense_Mutation_p.C879Y	NM_170753	NP_736609	Q8N328	PGBD3_HUMAN	hypothetical protein LOC267004	411										pancreas(1)|breast(1)|skin(1)	3						ATTCCATCTGCAGACAATATT	0.413													48	165	---	---	---	---	PASS
OGDHL	55753	broad.mit.edu	37	10	50957775	50957775	+	Silent	SNP	G	A	A	rs35599320		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50957775G>A	uc001jie.2	-	8	1126	c.984C>T	c.(982-984)GAC>GAT	p.D328D	OGDHL_uc009xog.2_Silent_p.D355D|OGDHL_uc010qgt.1_Silent_p.D271D|OGDHL_uc010qgu.1_Silent_p.D119D|OGDHL_uc009xoh.2_Silent_p.D119D	NM_018245	NP_060715	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like isoform a	328					glycolysis	mitochondrial matrix	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			pancreas(1)	1						CACCCACCTCGTCCGCCGCCT	0.647													8	7	---	---	---	---	PASS
CCDC6	8030	broad.mit.edu	37	10	61574417	61574417	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61574417C>T	uc001jks.3	-	4	1315	c.679G>A	c.(679-681)GAA>AAA	p.E227K		NM_005436	NP_005427	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	227	5.|5 X 29 AA tandem repeats.|Potential.					cytoplasm|cytoskeleton	SH3 domain binding|structural constituent of cytoskeleton			ovary(3)|breast(1)	4				Kidney(211;0.0597)		AACCGCTTTTCAGCTTCAAGC	0.383													30	101	---	---	---	---	PASS
DDIT4	54541	broad.mit.edu	37	10	74034470	74034470	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:74034470G>C	uc001jsx.1	+	3	425	c.223G>C	c.(223-225)GGG>CGG	p.G75R		NM_019058	NP_061931	Q9NX09	DDIT4_HUMAN	RTP801	75					apoptosis					pancreas(1)	1						TTACCTGGATGGGGTGTCGTT	0.587													85	151	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87373301	87373301	+	Missense_Mutation	SNP	C	T	T	rs143982305		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87373301C>T	uc001kdl.1	-	15	2565	c.2464G>A	c.(2464-2466)GAC>AAC	p.D822N	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.D393N	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	822	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GATTTGCCGTCGGCCTGGGCG	0.657										Multiple Myeloma(13;0.14)			10	61	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89692898	89692898	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89692898A>C	uc001kfb.2	+	6	1413	c.382A>C	c.(382-384)AAG>CAG	p.K128Q		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	128	Phosphatase tensin-type.			K->M: 85% reduction in phosphatase activity towards PtdIns(3,4,5)P3.|K->R: Does not reduce phosphatase activity towards PtdIns(3,4,5)P3.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.K128N(4)|p.K128_R130del(3)|p.?(2)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.K128fs*47(1)|p.A121_F145del(1)|p.G127fs*5(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TAAAGCTGGAAAGGGACGAAC	0.418		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			74	114	---	---	---	---	PASS
CYP26A1	1592	broad.mit.edu	37	10	94834612	94834612	+	Missense_Mutation	SNP	T	C	C	rs148053802		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94834612T>C	uc001kil.2	+	3	536	c.491T>C	c.(490-492)CTG>CCG	p.L164P	CYP26A1_uc001kik.1_Missense_Mutation_p.L95P|CYP26A1_uc001kim.1_Missense_Mutation_p.L62P	NM_000783	NP_000774	O43174	CP26A_HUMAN	cytochrome P450, family 26, subfamily A,	164					negative regulation of retinoic acid receptor signaling pathway|retinoic acid catabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|oxygen binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		Colorectal(252;0.122)				GGCAGCAGCCTGGAGCAGTGG	0.652													11	58	---	---	---	---	PASS
PKD2L1	9033	broad.mit.edu	37	10	102089039	102089039	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102089039C>A	uc001kqx.1	-	2	661	c.278G>T	c.(277-279)CGG>CTG	p.R93L	PKD2L1_uc009xwm.1_Missense_Mutation_p.R46L	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	93	Cytoplasmic (Potential).				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		ATAAAGTTCCCGGTTCTCAGC	0.502													47	100	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118228838	118228838	+	Intron	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118228838C>G	uc001lcl.3	+							NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor						lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		CCGTAAGTATCATAGCTAAGT	0.234													33	44	---	---	---	---	PASS
OR51L1	119682	broad.mit.edu	37	11	5020437	5020437	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5020437G>T	uc010qyu.1	+	1	225	c.225G>T	c.(223-225)ATG>ATT	p.M75I		NM_001004755	NP_001004755	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L,	75	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACCTGGGGATGTCCCTGTCTA	0.463													25	144	---	---	---	---	PASS
OR52A5	390054	broad.mit.edu	37	11	5153675	5153675	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153675G>T	uc010qyx.1	-	1	198	c.198C>A	c.(196-198)GCC>GCA	p.A66A		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	66	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CTGCCAACATGGCCAAAAAAA	0.383													14	74	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5842543	5842543	+	Intron	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5842543G>C	uc001mbq.1	-							NM_033093	NP_149084	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform delta						interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		ACATAGAATAGACATATTGTT	0.269													15	71	---	---	---	---	PASS
OR2D3	120775	broad.mit.edu	37	11	6943116	6943116	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6943116C>A	uc010rav.1	+	1	884	c.884C>A	c.(883-885)ACA>AAA	p.T295K		NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D,	295	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GTGTTCTATACAGCGGTGACT	0.408													16	137	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7059857	7059857	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7059857G>T	uc001mfb.1	+	2	363	c.40G>T	c.(40-42)GGG>TGG	p.G14W		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	14	DAPIN.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TCCTGATTTTGGGCTGCTATT	0.403													22	175	---	---	---	---	PASS
OR5P2	120065	broad.mit.edu	37	11	7818326	7818326	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7818326A>G	uc001mfp.1	-	1	164	c.164T>C	c.(163-165)ATG>ACG	p.M55T		NM_153444	NP_703145	Q8WZ92	OR5P2_HUMAN	olfactory receptor, family 5, subfamily P,	55	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				Epithelial(150;8.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AAAGAAATACATAGGATGATG	0.408													14	68	---	---	---	---	PASS
USP47	55031	broad.mit.edu	37	11	11969555	11969555	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11969555T>G	uc001mjs.2	+	21	3918	c.3155T>G	c.(3154-3156)TTT>TGT	p.F1052C	USP47_uc001mjr.2_Missense_Mutation_p.F984C|USP47_uc009ygi.2_5'Flank	NM_017944	NP_060414	Q96K76	UBP47_HUMAN	ubiquitin specific protease 47	1072					base-excision repair|cellular response to UV|monoubiquitinated protein deubiquitination|negative regulation of apoptosis|negative regulation of caspase activity|negative regulation of G2/M transition of mitotic cell cycle|negative regulation of transcription, DNA-dependent|positive regulation of cell growth|response to drug|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	ubiquitin thiolesterase activity|ubiquitin-specific protease activity|WD40-repeat domain binding			ovary(1)|skin(1)	2				Epithelial(150;0.000339)		TTAGAGCCCTTTGTTGGAGTT	0.393													29	173	---	---	---	---	PASS
ELP4	26610	broad.mit.edu	37	11	31531381	31531381	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31531381C>T	uc001mtb.2	+	1	85	c.50C>T	c.(49-51)GCA>GTA	p.A17V	IMMP1L_uc001msy.1_5'Flank|IMMP1L_uc001msz.1_5'Flank|ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Missense_Mutation_p.A17V|ELP4_uc010rdz.1_Missense_Mutation_p.A17V|IMMP1L_uc009yjo.2_5'Flank|IMMP1L_uc009yjp.2_5'Flank	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog	17					histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					ACTGGGTCTGCAGTGGCGACA	0.597													8	50	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49168457	49168457	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49168457C>T	uc001ngy.2	-	19	2365	c.2104G>A	c.(2104-2106)GGG>AGG	p.G702R	FOLH1_uc001ngx.2_Silent_p.Q101Q|FOLH1_uc001ngz.2_Missense_Mutation_p.G671R|FOLH1_uc009yly.2_Missense_Mutation_p.G687R|FOLH1_uc009ylz.2_Missense_Mutation_p.G656R|FOLH1_uc009yma.2_Missense_Mutation_p.G394R	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	702	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	AATGACTCCCCTGCATACTTG	0.423													14	105	---	---	---	---	PASS
OR5D13	390142	broad.mit.edu	37	11	55541644	55541644	+	Missense_Mutation	SNP	C	T	T	rs76632744	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541644C>T	uc010ril.1	+	1	731	c.731C>T	c.(730-732)GCC>GTC	p.A244V		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				TCCACCTGTGCCTCCCACCTG	0.423													17	108	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587827	55587827	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587827C>A	uc010rin.1	+	1	722	c.722C>A	c.(721-723)ACC>AAC	p.T241N		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	241	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				GCCTTCTCCACCTGTGCCTCC	0.507													7	87	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55657498	55657498	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55657498G>A	uc010rip.1	+	6	934	c.842G>A	c.(841-843)AGC>AAC	p.S281N	SPRYD5_uc010riq.1_Missense_Mutation_p.S138N	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	281	B30.2/SPRY.					intracellular	zinc ion binding				0		all_epithelial(135;0.226)				CTGCTGGACAGCCTCAGTGGA	0.502													10	50	---	---	---	---	PASS
OR8K5	219453	broad.mit.edu	37	11	55927594	55927594	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55927594G>T	uc010rja.1	-	1	200	c.200C>A	c.(199-201)GCT>GAT	p.A67D		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	67	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				ATCAACAAAAGCCAAATGTCT	0.393													14	131	---	---	---	---	PASS
OR8K1	390157	broad.mit.edu	37	11	56113543	56113543	+	Missense_Mutation	SNP	C	A	A	rs140629640		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56113543C>A	uc010rjg.1	+	1	29	c.29C>A	c.(28-30)ACG>AAG	p.T10K		NM_001002907	NP_001002907	Q8NGG5	OR8K1_HUMAN	olfactory receptor, family 8, subfamily K,	10	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)	2	Esophageal squamous(21;0.00448)					CACAATCACACGGCAGTGACC	0.373										HNSCC(65;0.19)			17	71	---	---	---	---	PASS
UBE2L6	9246	broad.mit.edu	37	11	57319921	57319921	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57319921G>T	uc001nkn.1	-	4	468	c.372C>A	c.(370-372)GAC>GAA	p.D124E	UBE2L6_uc001nko.1_Missense_Mutation_p.D58E	NM_004223	NP_004214	O14933	UB2L6_HUMAN	ubiquitin-conjugating enzyme E2L 6 isoform 1	124					negative regulation of type I interferon production	cytosol	protein binding|ubiquitin-protein ligase activity			ovary(1)	1						GGTCAGCGAGGTCCATCCGCA	0.567													35	258	---	---	---	---	PASS
MS4A10	341116	broad.mit.edu	37	11	60557884	60557884	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60557884C>T	uc001npz.1	+	2	172	c.76C>T	c.(76-78)CAG>TAG	p.Q26*		NM_206893	NP_996776	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member	26	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|skin(1)	2						CAGCCCAGTCCAGCCCTGGCA	0.592													23	126	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62490109	62490109	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62490109C>G	uc001nuw.2	-	6	1252	c.1059G>C	c.(1057-1059)CAG>CAC	p.Q353H	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	353	B30.2/SPRY.				cell killing	nucleus	ATP binding|nucleic acid binding				0						CCCCAAAAGTCTGGCCAAATT	0.428													14	117	---	---	---	---	PASS
POLA2	23649	broad.mit.edu	37	11	65062070	65062070	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65062070C>T	uc001odj.2	+	15	1749	c.1407C>T	c.(1405-1407)TTC>TTT	p.F469F	POLA2_uc010rod.1_Silent_p.F261F|POLA2_uc001odk.2_Silent_p.F166F	NM_002689	NP_002680	Q14181	DPOA2_HUMAN	DNA-directed DNA polymerase alpha 2	469					DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	nucleoplasm	DNA binding				0					Dacarbazine(DB00851)	GAGTGATCTTCGGCTTGACAT	0.493													11	114	---	---	---	---	PASS
CTSW	1521	broad.mit.edu	37	11	65648993	65648993	+	Splice_Site	SNP	T	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65648993T>G	uc001ogc.1	+	3	328	c.286_splice	c.e3+2	p.E96_splice	CTSW_uc001ogb.1_Splice_Site_p.E96_splice	NM_001335	NP_001326	P56202	CATW_HUMAN	cathepsin W preproprotein						immune response|proteolysis		cysteine-type endopeptidase activity			central_nervous_system(1)	1				READ - Rectum adenocarcinoma(159;0.168)		ACCTCACAGGTACCATTAACC	0.577													116	719	---	---	---	---	PASS
NPAS4	266743	broad.mit.edu	37	11	66191103	66191103	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66191103C>T	uc001ohx.1	+	6	1039	c.863C>T	c.(862-864)ACT>ATT	p.T288I	NPAS4_uc010rpc.1_Missense_Mutation_p.T78I	NM_178864	NP_849195	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	288	PAC.				transcription, DNA-dependent		DNA binding|signal transducer activity				0						CAGGCCAAGACTGGAGGCTGG	0.522													13	90	---	---	---	---	PASS
TCIRG1	10312	broad.mit.edu	37	11	67818063	67818063	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67818063G>T	uc001one.2	+	19	2454	c.2346G>T	c.(2344-2346)GTG>GTT	p.V782V	TCIRG1_uc001ong.2_Silent_p.V566V|TCIRG1_uc001onh.2_Silent_p.V484V|TCIRG1_uc001oni.2_Silent_p.V286V|TCIRG1_uc009ysd.2_Intron	NM_006019	NP_006010	Q13488	VPP3_HUMAN	T-cell, immune regulator 1 isoform a	782	Helical; (Potential).				ATP hydrolysis coupled proton transport|cellular defense response|cellular iron ion homeostasis|insulin receptor signaling pathway|positive regulation of cell proliferation|transferrin transport	apical plasma membrane|endosome membrane|integral to plasma membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	hydrogen ion transmembrane transporter activity			ovary(1)	1						CCTTTGCCGTGATGACCGTGG	0.667													17	93	---	---	---	---	PASS
MRGPRD	116512	broad.mit.edu	37	11	68748106	68748106	+	Missense_Mutation	SNP	G	A	A	rs147515740		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68748106G>A	uc010rqf.1	-	1	350	c.350C>T	c.(349-351)ACG>ATG	p.T117M		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	117	Helical; Name=3; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GCTGATGGCCGTCAGCAGGCT	0.592													7	42	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102592384	102592384	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102592384G>T	uc001phe.2	-	3	556	c.457C>A	c.(457-459)CAG>AAG	p.Q153K	MMP8_uc010rut.1_Missense_Mutation_p.Q88K|MMP8_uc010ruu.1_Missense_Mutation_p.Q130K	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	153					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		GCCTCTCCCTGTGAGATCCTG	0.463													22	62	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107309855	107309855	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107309855G>C	uc010rvp.1	-	6	655	c.625C>G	c.(625-627)CTT>GTT	p.L209V	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	209	Potential.						catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		TCAGGTGGAAGACCTGTCCCA	0.308													3	30	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108170460	108170460	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108170460G>T	uc001pkb.1	+	34	5410	c.5025G>T	c.(5023-5025)TTG>TTT	p.L1675F	ATM_uc009yxr.1_Missense_Mutation_p.L1675F|ATM_uc001pke.1_Missense_Mutation_p.L327F|ATM_uc001pkg.1_Missense_Mutation_p.L32F	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1	1675					cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		GAAGCTGCTTGGGAGAAGTGG	0.333			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			20	157	---	---	---	---	PASS
SCN3B	55800	broad.mit.edu	37	11	123516345	123516345	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123516345T>A	uc001pza.1	-	3	576	c.169A>T	c.(169-171)ACC>TCC	p.T57S	SCN3B_uc001pzb.1_Missense_Mutation_p.T57S	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN	voltage-gated sodium channel beta-3 subunit	57	Ig-like C2-type.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)		ACCACCGTGGTGGCCTCCACC	0.587													30	138	---	---	---	---	PASS
CHEK1	1111	broad.mit.edu	37	11	125523664	125523664	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125523664G>T	uc009zbo.2	+	12	2149	c.1257G>T	c.(1255-1257)AGG>AGT	p.R419S	CHEK1_uc010sbh.1_Missense_Mutation_p.R435S|CHEK1_uc010sbi.1_Intron|CHEK1_uc001qcf.3_Missense_Mutation_p.R419S|CHEK1_uc009zbp.2_Missense_Mutation_p.R419S|CHEK1_uc001qcg.3_Missense_Mutation_p.R419S|CHEK1_uc009zbq.2_Missense_Mutation_p.R375S|CHEK1_uc001qci.1_RNA|CHEK1_uc001qcj.2_Missense_Mutation_p.R67S	NM_001114122	NP_001107594	O14757	CHK1_HUMAN	checkpoint kinase 1	419	Autoinhibitory region.				cellular response to mechanical stimulus|DNA repair|DNA replication|gamete generation|negative regulation of cell proliferation|reciprocal meiotic recombination|regulation of cyclin-dependent protein kinase activity|replicative senescence	condensed nuclear chromosome|microtubule organizing center|nucleoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|skin(1)	6	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		CAACTGATAGGAGAAACAATA	0.254								Other_conserved_DNA_damage_response_genes					27	155	---	---	---	---	PASS
RPUSD4	84881	broad.mit.edu	37	11	126075365	126075365	+	Missense_Mutation	SNP	G	A	A	rs149309585		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126075365G>A	uc001qde.2	-	5	848	c.794C>T	c.(793-795)ACT>ATT	p.T265I	RPUSD4_uc010sbl.1_Missense_Mutation_p.T72I|RPUSD4_uc009zbz.2_Missense_Mutation_p.T234I|RPUSD4_uc009zby.2_RNA	NM_032795	NP_116184	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	265					pseudouridine synthesis		protein binding|pseudouridine synthase activity|RNA binding			breast(1)	1	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		ACTCTCACCAGTGATGGGCTG	0.577													22	56	---	---	---	---	PASS
GALNT8	26290	broad.mit.edu	37	12	4874620	4874620	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4874620C>A	uc001qne.1	+	10	1761	c.1669C>A	c.(1669-1671)CTG>ATG	p.L557M		NM_017417	NP_059113	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	557	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(1)|skin(1)	4						TGATCGCTGCCTGACAGACCC	0.433													4	198	---	---	---	---	PASS
ANO2	57101	broad.mit.edu	37	12	5853393	5853393	+	Silent	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5853393C>G	uc001qnm.2	-	12	1341	c.1269G>C	c.(1267-1269)GGG>GGC	p.G423G		NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2	428	Extracellular (Potential).					chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						CCTGCGCGGTCCCACAGGCTG	0.537													116	67	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6707131	6707131	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6707131C>T	uc001qpo.2	-	12	1985	c.1821G>A	c.(1819-1821)GAG>GAA	p.E607E	CHD4_uc001qpn.2_Silent_p.E600E|CHD4_uc001qpp.2_Silent_p.E604E	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	607					chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						GTTCCTCCATCTCTGCAAATT	0.502													68	511	---	---	---	---	PASS
TAS2R30	259293	broad.mit.edu	37	12	11286736	11286736	+	Silent	SNP	G	A	A	rs112605675		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11286736G>A	uc009zhs.1	-	1	108	c.108C>T	c.(106-108)GTC>GTT	p.V36V	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_001097643	NP_001091112			type 2 taste receptor member 30												0						TTTGTCTCTTGACCCACTCAA	0.388													25	186	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13214634	13214634	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13214634G>C	uc001rbi.2	+	4	681	c.658G>C	c.(658-660)GCT>CCT	p.A220P	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	220						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		AGGAAGCTTGGCTGAAACCAT	0.488													9	125	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15742454	15742454	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15742454A>C	uc001rcv.1	+	25	3650	c.3476A>C	c.(3475-3477)CAT>CCT	p.H1159P	PTPRO_uc001rcw.1_Missense_Mutation_p.H1131P|PTPRO_uc001rcx.1_Missense_Mutation_p.H348P|PTPRO_uc001rcy.1_Missense_Mutation_p.H348P|PTPRO_uc001rcz.1_Missense_Mutation_p.H320P|PTPRO_uc001rda.1_Missense_Mutation_p.H320P	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	1159	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				ATTCGGGATCATGAGTTTGTT	0.443													89	349	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21327532	21327532	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21327532T>G	uc001req.3	+	4	352	c.248T>G	c.(247-249)TTT>TGT	p.F83C		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	83	Helical; Name=2; (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	GTGATTGTATTTGTGAGTTAC	0.358													25	160	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26628297	26628297	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26628297C>G	uc001rhg.2	-	45	6691	c.6274G>C	c.(6274-6276)GAT>CAT	p.D2092H	ITPR2_uc009zjg.1_Missense_Mutation_p.D243H	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	2092	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CCACCCTCATCATCCCCATGG	0.373													13	166	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31286812	31286812	+	Splice_Site	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31286812C>A	uc010sjy.1	-	19	2682	c.2682_splice	c.e19+1	p.E894_splice						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CATATCCATACCTCTACTAAG	0.383													48	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31307356	31307356	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31307356T>C	uc010sjy.1	-	7	724	c.724A>G	c.(724-726)AAA>GAA	p.K242E						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		ATTTGGGTTTTCCCTTGCACA	0.383													3	54	---	---	---	---	PASS
SLC2A13	114134	broad.mit.edu	37	12	40265601	40265601	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40265601T>C	uc010skm.1	-	5	1248	c.1197A>G	c.(1195-1197)GCA>GCG	p.A399A	C12orf40_uc009zjv.1_Intron|SLC2A13_uc001rme.1_Silent_p.A46A	NM_052885	NP_443117	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose	399	Helical; Name=9; (Potential).					integral to membrane|plasma membrane	myo-inositol:hydrogen symporter activity			ovary(1)	1		Lung NSC(34;0.105)|all_lung(34;0.123)				GCCACCTACCTGCTAAACTAC	0.373										HNSCC(50;0.14)			22	82	---	---	---	---	PASS
AQP6	363	broad.mit.edu	37	12	50368590	50368590	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50368590G>C	uc001rvr.1	+	3	960	c.623G>C	c.(622-624)GGG>GCG	p.G208A	AQP6_uc001rvp.1_Missense_Mutation_p.G34A|AQP6_uc001rvq.1_RNA	NM_001652	NP_001643	Q13520	AQP6_HUMAN	aquaporin 6	208	Extracellular (Potential).				excretion|odontogenesis	integral to plasma membrane|transport vesicle membrane	anion channel activity|water channel activity				0						ATCATCATTGGGAAGTTCACA	0.602											OREG0021809	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	14	38	---	---	---	---	PASS
KRT6B	3854	broad.mit.edu	37	12	52841594	52841594	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52841594G>T	uc001sak.2	-	7	1440	c.1392C>A	c.(1390-1392)ACC>ACA	p.T464T		NM_005555	NP_005546	P04259	K2C6B_HUMAN	keratin 6B	464	Rod.|Coil 2.				ectoderm development	keratin filament	structural constituent of cytoskeleton			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.083)		GCTTGCGGTAGGTGGCGATCT	0.597													72	111	---	---	---	---	PASS
SP1	6667	broad.mit.edu	37	12	53804855	53804855	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53804855C>A	uc001scw.2	+	6	2286	c.2189C>A	c.(2188-2190)GCA>GAA	p.A730E	SP1_uc010sog.1_Missense_Mutation_p.A723E	NM_138473	NP_612482	P08047	SP1_HUMAN	Sp1 transcription factor isoform a	730	Domain D.|VZV IE62-binding.				positive regulation by host of viral transcription|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	double-stranded DNA binding|histone deacetylase binding|HMG box domain binding|protein C-terminus binding|protein homodimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|breast(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GACAGTGGGGCAGGTTCAGAA	0.557													4	203	---	---	---	---	PASS
OR6C75	390323	broad.mit.edu	37	12	55759232	55759232	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55759232T>C	uc010spk.1	+	1	338	c.338T>C	c.(337-339)CTG>CCG	p.L113P		NM_001005497	NP_001005497	A6NL08	O6C75_HUMAN	olfactory receptor, family 6, subfamily C,	113	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3						TTTTACCTTCTGGCTGCCATG	0.448													31	121	---	---	---	---	PASS
MDM1	56890	broad.mit.edu	37	12	68707531	68707531	+	Nonsense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68707531G>C	uc001stz.2	-	10	1638	c.1502C>G	c.(1501-1503)TCA>TGA	p.S501*	MDM1_uc010stc.1_Nonsense_Mutation_p.S466*|MDM1_uc009zqv.1_Nonsense_Mutation_p.S221*	NM_017440	NP_059136	Q8TC05	MDM1_HUMAN	mouse Mdm1 nuclear protein homolog isoform 1	501						nucleus				ovary(3)|skin(2)	5			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		AGAAGAATCTGACCTATAAAT	0.373													43	66	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72956688	72956688	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72956688C>G	uc001sxa.2	+	9	1805	c.1775C>G	c.(1774-1776)ACA>AGA	p.T592R		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	592	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						GATCAGTGGACACTCCAGATG	0.313													94	130	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99898341	99898341	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99898341C>G	uc001tge.1	-	10	1768	c.1351G>C	c.(1351-1353)GAG>CAG	p.E451Q	ANKS1B_uc001tgf.1_Missense_Mutation_p.E31Q|ANKS1B_uc009ztt.1_Missense_Mutation_p.E417Q	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	451						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		AGAAAGTTCTCATTTTCTGAA	0.373													32	30	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120622646	120622646	+	Missense_Mutation	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120622646A>C	uc001txo.2	-	3	179	c.166T>G	c.(166-168)TTG>GTG	p.L56V		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	56					regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGCAGAGTCAAGCAGAACAAT	0.423													8	140	---	---	---	---	PASS
CHFR	55743	broad.mit.edu	37	12	133435727	133435727	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133435727C>A	uc001ulf.2	-	8	958	c.874G>T	c.(874-876)GCT>TCT	p.A292S	CHFR_uc001ulc.1_RNA|CHFR_uc001ule.2_Missense_Mutation_p.A280S|CHFR_uc010tbs.1_Missense_Mutation_p.A292S|CHFR_uc001uld.2_Missense_Mutation_p.A251S|CHFR_uc010tbt.1_Missense_Mutation_p.A200S	NM_001161344	NP_001154816	Q96EP1	CHFR_HUMAN	checkpoint with forkhead and ring finger domains	292					cell division|mitosis|mitotic cell cycle checkpoint|modification-dependent protein catabolic process|protein polyubiquitination	PML body	nucleotide binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.00552)|all_epithelial(31;0.226)		OV - Ovarian serous cystadenocarcinoma(86;2.59e-08)|Epithelial(86;6.38e-07)|all cancers(50;1.56e-05)		GGCTTCCCAGCCGCTGCTCTG	0.592													39	40	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26434350	26434350	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26434350G>T	uc001uqk.2	+	31	3116	c.2974G>T	c.(2974-2976)GGT>TGT	p.G992C	ATP8A2_uc010tdi.1_Missense_Mutation_p.G927C|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Missense_Mutation_p.G542C	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	952	Extracellular (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		GTTGACAAGTGGTCATGCTAC	0.358													10	96	---	---	---	---	PASS
FRY	10129	broad.mit.edu	37	13	32711022	32711022	+	Silent	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32711022G>T	uc001utx.2	+	11	1588	c.1092G>T	c.(1090-1092)CTG>CTT	p.L364L	FRY_uc010tdw.1_RNA	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog	364					regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		TGTACCCCCTGGTGACCTGTT	0.458													15	100	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46917513	46917513	+	3'UTR	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46917513A>G	uc010acl.2	-	15					C13orf18_uc010tfy.1_3'UTR|C13orf18_uc001vbf.3_3'UTR|C13orf18_uc001vbg.3_3'UTR|C13orf18_uc010tfz.1_3'UTR|C13orf18_uc010acm.2_3'UTR|C13orf18_uc010acn.2_3'UTR|C13orf18_uc001vbe.3_Silent_p.P614P|C13orf18_uc001vbh.3_3'UTR|C13orf18_uc001vbi.3_3'UTR	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183												0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		CACAGTACTCAGGGGCATCAT	0.453													13	24	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61986903	61986903	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61986903T>C	uc001vid.3	-	2	1693	c.1329A>G	c.(1327-1329)GAA>GAG	p.E443E	PCDH20_uc010thj.1_Silent_p.E443E	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	416	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CGGGTTCCAGTTCTTTCAGAT	0.423													8	99	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61986932	61986932	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61986932C>A	uc001vid.3	-	2	1664	c.1300G>T	c.(1300-1302)GAG>TAG	p.E434*	PCDH20_uc010thj.1_Nonsense_Mutation_p.E434*	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	407	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		CCATCTATCTCGTTTGCTATG	0.418													21	102	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75936724	75936724	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75936724C>T	uc001vjl.1	-	2	865	c.518G>A	c.(517-519)AGC>AAC	p.S173N	TBC1D4_uc010aer.2_Missense_Mutation_p.S173N|TBC1D4_uc010aes.2_Missense_Mutation_p.S173N	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	173	PID 1.					cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		TTGCCTTATGCTGCTAATAAC	0.393													4	293	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78146334	78146334	+	Intron	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78146334A>T	uc001vki.2	+						SCEL_uc001vkj.2_Intron|SCEL_uc010thx.1_Intron	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1						embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		GGTAAGGGAAAGGTGTCAGGC	0.463													7	50	---	---	---	---	PASS
SLC10A2	6555	broad.mit.edu	37	13	103718330	103718330	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:103718330A>G	uc001vpy.3	-	1	867	c.270T>C	c.(268-270)TTT>TTC	p.F90F		NM_000452	NP_000443	Q12908	NTCP2_HUMAN	solute carrier family 10 (sodium/bile acid	90	Helical; (Potential).				bile acid metabolic process|organic anion transport	integral to plasma membrane	bile acid:sodium symporter activity			ovary(3)|skin(1)	4	all_neural(89;0.0662)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					GGAGGATGTCAAAGGCCACCG	0.542													15	127	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110804799	110804799	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110804799A>T	uc001vqw.3	-	51	4932	c.4810T>A	c.(4810-4812)TGC>AGC	p.C1604S	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1604	Collagen IV NC1.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TCCTCCAGGCAGGAGCCGGGG	0.597													11	38	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20296181	20296181	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20296181A>G	uc010tkv.1	+	1	574	c.574A>G	c.(574-576)ACA>GCA	p.T192A		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CTGCACCGACACATTTGTGGT	0.537													26	307	---	---	---	---	PASS
OR4K1	79544	broad.mit.edu	37	14	20404520	20404520	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20404520G>T	uc001vwj.1	+	1	695	c.695G>T	c.(694-696)GGG>GTG	p.G232V		NM_001004063	NP_001004063	Q8NGD4	OR4K1_HUMAN	olfactory receptor, family 4, subfamily K,	232	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00124)		TCCTCCAGTGGGTCATCTAAG	0.433													30	210	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23894206	23894206	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23894206G>A	uc001wjx.2	-	22	2557	c.2451C>T	c.(2449-2451)AAC>AAT	p.N817N		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	817					adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		AGGCCCGAATGTTCCACTGGA	0.542													34	107	---	---	---	---	PASS
G2E3	55632	broad.mit.edu	37	14	31058674	31058674	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31058674A>G	uc001wqk.2	+	4	375	c.221A>G	c.(220-222)AAT>AGT	p.N74S	G2E3_uc010tpe.1_Missense_Mutation_p.N28S|G2E3_uc010tpf.1_Missense_Mutation_p.N28S	NM_017769	NP_060239	Q7L622	G2E3_HUMAN	G2/M-phase specific E3 ubiquitin ligase	74					apoptosis|multicellular organismal development|protein modification process	Golgi apparatus|nucleolus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(2)|skin(1)	3						AAGGAAGTGAATAGAGCTTCT	0.308													42	172	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360885	42360885	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360885C>A	uc001wvm.2	+	4	3016	c.1818C>A	c.(1816-1818)ACC>ACA	p.T606T	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	606	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		GTAAAGCTACCAGTGACAATG	0.493										HNSCC(30;0.082)			12	55	---	---	---	---	PASS
FANCM	57697	broad.mit.edu	37	14	45636188	45636188	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45636188A>G	uc001wwd.3	+	11	1923	c.1824A>G	c.(1822-1824)ATA>ATG	p.I608M	FANCM_uc001wwc.2_Missense_Mutation_p.I608M|FANCM_uc010anf.2_Missense_Mutation_p.I582M|FANCM_uc001wwe.3_Missense_Mutation_p.I144M	NM_020937	NP_065988	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	608	Helicase C-terminal.				DNA repair	Fanconi anaemia nuclear complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|nuclease activity|protein binding			ovary(3)|lung(2)|breast(2)	7						AAAGAAGTATATATAAAGCTA	0.289								Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				3	243	---	---	---	---	PASS
ARID4A	5926	broad.mit.edu	37	14	58820393	58820393	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58820393A>G	uc001xdp.2	+	17	1927	c.1673A>G	c.(1672-1674)AAA>AGA	p.K558R	ARID4A_uc001xdo.2_Missense_Mutation_p.K558R|ARID4A_uc001xdq.2_Missense_Mutation_p.K558R|ARID4A_uc010apg.1_Missense_Mutation_p.K236R	NM_002892	NP_002883	P29374	ARI4A_HUMAN	retinoblastoma-binding protein 1 isoform I	558					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	transcriptional repressor complex	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|lung(1)	6						ACTGAAAGCAAATGTGACTCT	0.363													23	83	---	---	---	---	PASS
KIAA0586	9786	broad.mit.edu	37	14	58915141	58915141	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58915141C>T	uc001xdv.3	+	7	1164	c.891C>T	c.(889-891)TCC>TCT	p.S297S	KIAA0586_uc010trr.1_Silent_p.S338S|KIAA0586_uc001xdt.3_Silent_p.S253S|KIAA0586_uc001xdu.3_Silent_p.S282S|KIAA0586_uc010trs.1_Silent_p.S212S|KIAA0586_uc010trt.1_Silent_p.S157S|KIAA0586_uc010tru.1_Silent_p.S157S	NM_014749	NP_055564	E9PGW8	E9PGW8_HUMAN	talpid3 protein	297										ovary(1)	1						AAAAGTATTCCGTAAAACCAG	0.353													37	96	---	---	---	---	PASS
DDX24	57062	broad.mit.edu	37	14	94545633	94545633	+	Silent	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94545633T>A	uc001ycj.2	-	2	555	c.456A>T	c.(454-456)CCA>CCT	p.P152P	DDX24_uc010twq.1_Silent_p.P109P|DDX24_uc010twr.1_Intron|IFI27L1_uc001ycl.2_5'Flank|IFI27L1_uc001yck.2_5'Flank	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24	152					RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		TCTTCTTTTTTGGAGCAGTTT	0.478													34	163	---	---	---	---	PASS
SERPINA4	5267	broad.mit.edu	37	14	95033443	95033443	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95033443C>A	uc001ydk.2	+	3	852	c.786C>A	c.(784-786)CCC>CCA	p.P262P	SERPINA4_uc010avd.2_Silent_p.P299P|SERPINA4_uc001ydl.2_Silent_p.P262P	NM_006215	NP_006206	P29622	KAIN_HUMAN	serine (or cysteine) proteinase inhibitor, clade	262					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity			ovary(3)|skin(1)	4				COAD - Colon adenocarcinoma(157;0.211)		GATACTTGCCCTGCTCGGTGC	0.493													12	78	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95563058	95563058	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95563058G>A	uc001ydw.2	-						DICER1_uc010avh.1_Intron|DICER1_uc001ydv.2_Intron|DICER1_uc001ydx.2_Intron|DICER1_uc001ydy.1_Intron	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1						negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TGTCTGAAACGAGGGGGAATG	0.398			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				4	19	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106110201	106110201	+	RNA	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106110201C>T	uc010tyt.1	-	3642		c.61050G>A			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_RNA					Parts of antibodies, mostly variable regions.												0						CCACCACGCACGTGACCTCAG	0.607													28	64	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106174934	106174934	+	RNA	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106174934G>A	uc010tyt.1	-	3631		c.59400C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron					Parts of antibodies, mostly variable regions.												0						GGCAGGCGATGACCACGTTCC	0.647													4	79	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106586173	106586173	+	RNA	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106586173C>A	uc010tyt.1	-	1286		c.28057G>T			uc001ysv.2_RNA					Parts of antibodies, mostly variable regions.												0						CCCCGGCTCTCAGGCTGTTCA	0.522													51	128	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369097	22369097	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369097A>G	uc010tzu.1	+	1	522	c.522A>G	c.(520-522)TTA>TTG	p.L174L	LOC727924_uc001yua.2_Intron|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCAATGAGTTAGACAGTTACT	0.502													31	486	---	---	---	---	PASS
TUBGCP5	114791	broad.mit.edu	37	15	22868847	22868847	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22868847C>T	uc001yur.3	+	20	2849	c.2719C>T	c.(2719-2721)CAC>TAC	p.H907Y	TUBGCP5_uc001yuq.2_Missense_Mutation_p.H907Y	NM_052903	NP_443135	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	907					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			skin(1)	1		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		CAAGATTCTACACAGTACAGG	0.403													31	74	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25322260	25322260	+	Intron	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25322260T>C	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-12_uc001yxv.1_RNA|SNORD116-13_uc001yxw.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						ATGAAAACTCTATACCATCAT	0.428													12	134	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28358712	28358712	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28358712G>A	uc001zbj.2	-						HERC2_uc001zbi.2_Intron	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCTGGGGGTCGGCATACCATC	0.582													3	52	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28427543	28427543	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28427543G>A	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGAGCAGGCCGTACCTTGGAG	0.542													12	42	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34032171	34032171	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34032171G>A	uc001zhi.2	+	51	7865	c.7795G>A	c.(7795-7797)GAC>AAC	p.D2599N	RYR3_uc010bar.2_Missense_Mutation_p.D2599N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2599	3.|Cytoplasmic (By similarity).|4 X approximate repeats.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGGCAACTTTGACCCAAAACC	0.458													14	27	---	---	---	---	PASS
ACTC1	70	broad.mit.edu	37	15	35083437	35083437	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35083437C>A	uc001ziu.1	-	6	1111	c.868G>T	c.(868-870)GAT>TAT	p.D290Y	uc001zit.1_Intron	NM_005159	NP_005150	P68032	ACTC_HUMAN	cardiac muscle alpha actin 1 proprotein	290					apoptosis|cardiac muscle tissue morphogenesis|cardiac myofibril assembly|muscle filament sliding|skeletal muscle thin filament assembly	actomyosin, actin part|cytosol|I band	ATP binding|ATPase activity|myosin binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(180;2.3e-08)		all cancers(64;5.83e-19)|GBM - Glioblastoma multiforme(113;1.98e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0244)		TTGCGGATATCAATGTCACAC	0.393													34	276	---	---	---	---	PASS
TUBGCP4	27229	broad.mit.edu	37	15	43690255	43690255	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43690255A>G	uc001zro.2	+	13	1539	c.1299A>G	c.(1297-1299)AGA>AGG	p.R433R	TUBGCP4_uc001zrn.2_Silent_p.R432R|TUBGCP4_uc010bdh.2_RNA	NM_014444	NP_055259	Q9UGJ1	GCP4_HUMAN	tubulin, gamma complex associated protein 4	433					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	structural constituent of cytoskeleton			ovary(3)	3		all_cancers(109;1.27e-10)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.72e-06)|all_lung(180;1.59e-05)|Melanoma(134;0.0728)		GBM - Glioblastoma multiforme(94;3.53e-07)		CTCAGGCAAGAGAAGGGCCTT	0.443													87	142	---	---	---	---	PASS
STRC	161497	broad.mit.edu	37	15	43896852	43896852	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43896852G>C	uc001zsf.2	-	20	4201	c.4123C>G	c.(4123-4125)CTT>GTT	p.L1375V	STRC_uc010bdl.2_Missense_Mutation_p.L602V|STRC_uc001zse.2_5'UTR	NM_153700	NP_714544	Q7RTU9	STRC_HUMAN	stereocilin precursor	1375					sensory perception of sound	cell surface					0		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CCATACCCAAGAACAGACTCC	0.507													4	108	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	71633782	71633782	+	Intron	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71633782G>C	uc002atb.1	+						THSD4_uc002atd.1_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TGTGCAGCAAGAATTCAGCAC	0.483													23	144	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72020962	72020962	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72020962G>T	uc002atb.1	+	8	1511	c.1432G>T	c.(1432-1434)GGA>TGA	p.G478*	THSD4_uc002atd.1_Nonsense_Mutation_p.G152*|THSD4_uc010ukg.1_Nonsense_Mutation_p.G118*|THSD4_uc002ate.2_Nonsense_Mutation_p.G118*	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	478						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						ATACGAGGGCGGAGGGACCAT	0.502													29	223	---	---	---	---	PASS
THSD4	79875	broad.mit.edu	37	15	72020963	72020963	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72020963G>A	uc002atb.1	+	8	1512	c.1433G>A	c.(1432-1434)GGA>GAA	p.G478E	THSD4_uc002atd.1_Missense_Mutation_p.G152E|THSD4_uc010ukg.1_Missense_Mutation_p.G118E|THSD4_uc002ate.2_Missense_Mutation_p.G118E	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	478						proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						TACGAGGGCGGAGGGACCATG	0.507													31	222	---	---	---	---	PASS
CSK	1445	broad.mit.edu	37	15	75091700	75091700	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75091700C>T	uc010bkb.1	+	6	513	c.330C>T	c.(328-330)ACC>ACT	p.T110T	CSK_uc002ays.2_Silent_p.T110T|CSK_uc010bkc.1_5'UTR	NM_001127190	NP_001120662	P41240	CSK_HUMAN	c-src tyrosine kinase	110	SH2.				blood coagulation|epidermal growth factor receptor signaling pathway|T cell costimulation|T cell receptor signaling pathway	centrosome|cytosol|Golgi apparatus	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein C-terminus binding			lung(2)|central_nervous_system(1)	3						GGGAGAGCACCAACTACCCCG	0.627													15	65	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89400049	89400049	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89400049C>A	uc010upo.1	+	12	4607	c.4233C>A	c.(4231-4233)AGC>AGA	p.S1411R	ACAN_uc010upp.1_Missense_Mutation_p.S1411R|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1411					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGGAGATCAGCGGGCTTCCTT	0.537													50	112	---	---	---	---	PASS
ANPEP	290	broad.mit.edu	37	15	90334210	90334210	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90334210C>A	uc002bop.3	-	19	2935	c.2643G>T	c.(2641-2643)CAG>CAT	p.Q881H		NM_001150	NP_001141	P15144	AMPN_HUMAN	membrane alanine aminopeptidase precursor	881	Extracellular.|Metalloprotease.				angiogenesis|cell differentiation|interspecies interaction between organisms	cytosol|ER-Golgi intermediate compartment|integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|receptor activity|zinc ion binding			ovary(3)|skin(1)	4	Lung NSC(78;0.0221)|all_lung(78;0.0448)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.169)		Ezetimibe(DB00973)	TCCAGTTGCTCTGGACAAAGT	0.582													41	80	---	---	---	---	PASS
RGMA	56963	broad.mit.edu	37	15	93588839	93588839	+	Nonsense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93588839T>A	uc002bss.1	-	4	1014	c.742A>T	c.(742-744)AAG>TAG	p.K248*	RGMA_uc002bsq.1_Nonsense_Mutation_p.K232*|RGMA_uc010boi.1_Nonsense_Mutation_p.K139*|RGMA_uc002bsr.1_Nonsense_Mutation_p.K139*|RGMA_uc010urc.1_Nonsense_Mutation_p.K256*	NM_020211	NP_064596	Q96B86	RGMA_HUMAN	RGM domain family, member A precursor	248					axon guidance	anchored to membrane|endoplasmic reticulum|plasma membrane					0	Lung NSC(78;0.0542)|all_lung(78;0.0786)		BRCA - Breast invasive adenocarcinoma(143;0.0312)|OV - Ovarian serous cystadenocarcinoma(32;0.108)			CCACCGTTCTTAGAGCCATCC	0.582													6	96	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98509152	98509152	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98509152A>T	uc010bom.2	+	3	561	c.402A>T	c.(400-402)AAA>AAT	p.K134N	ARRDC4_uc002bui.3_Missense_Mutation_p.K47N	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	134					signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TTACTGGGAAATATGGAAGCA	0.418													11	173	---	---	---	---	PASS
FAM169B	283777	broad.mit.edu	37	15	98984300	98984300	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98984300C>T	uc002buk.1	-	6	709	c.459G>A	c.(457-459)AAG>AAA	p.K153K		NM_182562	NP_872368	Q8N8A8	F169B_HUMAN	hypothetical protein LOC283777	153											0						ATCACCATACCTTGCTGCCGT	0.557													21	48	---	---	---	---	PASS
IFT140	9742	broad.mit.edu	37	16	1652378	1652378	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1652378C>A	uc002cmb.2	-	4	724	c.362G>T	c.(361-363)GGG>GTG	p.G121V		NM_014714	NP_055529	Q96RY7	IF140_HUMAN	intraflagellar transport 140	121	WD 3.									ovary(3)|pancreas(1)|skin(1)	5		Hepatocellular(780;0.219)				CACCCTGTCCCCAGACAGCAG	0.542													12	52	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2153483	2153483	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2153483C>A	uc002cos.1	-	23	8784	c.8575G>T	c.(8575-8577)GCC>TCC	p.A2859S	PKD1_uc002cot.1_Missense_Mutation_p.A2859S|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2859	Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GGGATCTGGGCGCCGGCCTGT	0.627													4	69	---	---	---	---	PASS
RAB26	25837	broad.mit.edu	37	16	2202841	2202841	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2202841C>A	uc002cou.2	+	6	623	c.489C>A	c.(487-489)CAC>CAA	p.H163Q	RAB26_uc010bsf.2_Missense_Mutation_p.H97Q|TRAF7_uc002cow.2_5'Flank	NM_014353	NP_055168	Q9ULW5	RAB26_HUMAN	RAB26, member RAS oncogene family	163					exocrine system development|protein transport|regulation of exocytosis|small GTPase mediated signal transduction	intrinsic to plasma membrane	GTP binding|protein binding				0						CCGAGATCCACGAGTACGCCC	0.682													4	21	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2347370	2347370	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2347370C>A	uc002cpy.1	-	17	2935	c.2223G>T	c.(2221-2223)CTG>CTT	p.L741L	ABCA3_uc010bsk.1_Silent_p.L683L|ABCA3_uc010bsl.1_Silent_p.L741L	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	741	ABC transporter 1.				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				CGCAGCACTGCAGCTCCCCCT	0.642													29	58	---	---	---	---	PASS
ABAT	18	broad.mit.edu	37	16	8862807	8862807	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8862807G>T	uc002czc.3	+	11	959	c.793G>T	c.(793-795)GAG>TAG	p.E265*	ABAT_uc002czd.3_Nonsense_Mutation_p.E265*|ABAT_uc010buh.2_Nonsense_Mutation_p.E207*|ABAT_uc010bui.2_Nonsense_Mutation_p.E265*	NM_020686	NP_065737	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase precursor	265					behavioral response to cocaine|gamma-aminobutyric acid catabolic process|neurotransmitter catabolic process|neurotransmitter secretion	4-aminobutyrate transaminase complex|mitochondrial matrix	(S)-3-amino-2-methylpropionate transaminase activity|4-aminobutyrate transaminase activity|protein homodimerization activity|pyridoxal phosphate binding|succinate-semialdehyde dehydrogenase binding			upper_aerodigestive_tract(1)	1					Divalproex sodium(DB00510)|Isoniazid(DB00951)|L-Alanine(DB00160)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Pyruvic acid(DB00119)|Tiagabine(DB00906)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	GAACCAACAGGAGGAGGCCCG	0.557													36	195	---	---	---	---	PASS
GDE1	51573	broad.mit.edu	37	16	19519024	19519024	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19519024T>C	uc002dgh.2	-	4	785	c.621A>G	c.(619-621)CCA>CCG	p.P207P	GDE1_uc002dgi.2_Silent_p.P97P	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	207	Lumenal (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						AGATAACTTCTGGCAAGAAAG	0.368													44	138	---	---	---	---	PASS
C16orf62	57020	broad.mit.edu	37	16	19580760	19580760	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19580760G>C	uc002dgn.1	+	3	144	c.132G>C	c.(130-132)AAG>AAC	p.K44N	C16orf62_uc002dgo.1_Missense_Mutation_p.K44N|C16orf62_uc010vas.1_5'UTR|C16orf62_uc002dgm.1_Missense_Mutation_p.K44N	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020	44						integral to membrane				ovary(1)	1						CAGAGTCAAAGACAAAGAAAG	0.532													16	48	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27561509	27561509	+	Intron	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27561509G>T	uc002dow.2	+						GTF3C1_uc002dov.1_5'Flank|GTF3C1_uc002dou.2_5'Flank	NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247											ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						GTGAGTGTCTGTGGGCCCCTC	0.647													16	55	---	---	---	---	PASS
CD19	930	broad.mit.edu	37	16	28948961	28948961	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28948961C>T	uc002drs.2	+	11	1451	c.1389C>T	c.(1387-1389)AAC>AAT	p.N463N	uc010vct.1_Intron|CD19_uc010byo.1_Silent_p.N463N	NM_001770	NP_001761	P15391	CD19_HUMAN	CD19 antigen precursor	463	Cytoplasmic (Potential).				cellular defense response	external side of plasma membrane|integral to plasma membrane	protein binding|receptor signaling protein activity			ovary(2)|central_nervous_system(1)	3						CTTATGAGAACGAGGATGAAG	0.587													16	94	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30732749	30732749	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30732749G>A	uc002dze.1	+	21	3878	c.3493G>A	c.(3493-3495)GCA>ACA	p.A1165T	SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Missense_Mutation_p.A1022T|SRCAP_uc010bzz.1_Missense_Mutation_p.A735T	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	1165	Pro-rich.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			TCCGACTCCTGCACCACAGCG	0.602													20	95	---	---	---	---	PASS
SETD1A	9739	broad.mit.edu	37	16	30980721	30980721	+	Missense_Mutation	SNP	C	T	T	rs150435865		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30980721C>T	uc002ead.1	+	11	3552	c.2866C>T	c.(2866-2868)CGC>TGC	p.R956C		NM_014712	NP_055527	O15047	SET1A_HUMAN	SET domain containing 1A	956	Glu-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nuclear speck|Set1C/COMPASS complex	histone-lysine N-methyltransferase activity|nucleotide binding|protein binding|RNA binding			ovary(2)|skin(1)	3						GGGCAAGCACCGCAAGTCCTT	0.662													13	33	---	---	---	---	PASS
MYST1	84148	broad.mit.edu	37	16	31131695	31131695	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31131695C>T	uc002eay.2	+	3	340	c.322C>T	c.(322-324)CGG>TGG	p.R108W	MYST1_uc002eax.2_Missense_Mutation_p.R108W	NM_032188	NP_115564	Q9H7Z6	MYST1_HUMAN	MYST histone acetyltransferase 1 isoform 1	108	Chromo.				histone H4-K16 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex|MSL complex	histone acetyltransferase activity|metal ion binding|methylated histone residue binding|transcription factor binding			ovary(1)	1						AGACAAGAACCGGCTGGCGCT	0.577													26	84	---	---	---	---	PASS
N4BP1	9683	broad.mit.edu	37	16	48596134	48596134	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:48596134G>A	uc002efp.2	-	2	657	c.420C>T	c.(418-420)CTC>CTT	p.L140L		NM_153029	NP_694574	O75113	N4BP1_HUMAN	Nedd4 binding protein 1	140					negative regulation of proteasomal ubiquitin-dependent protein catabolic process|negative regulation of protein ubiquitination	nucleolus|PML body					0		all_cancers(37;0.179)|all_lung(18;0.11)				TATTTTCAAAGAGCTTTACAA	0.433													27	115	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	71054178	71054178	+	Missense_Mutation	SNP	T	C	C	rs6416709		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71054178T>C	uc002ezr.2	-	22	3357	c.3229A>G	c.(3229-3231)ATA>GTA	p.I1077V		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	1077										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				ATGTTCTTTATGGCCAAGGGC	0.418													4	56	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75263896	75263896	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75263896T>A	uc002fdv.2	-	7	2249	c.2126A>T	c.(2125-2127)CAG>CTG	p.Q709L	BCAR1_uc002fdt.2_Missense_Mutation_p.Q162L|BCAR1_uc002fdu.2_Missense_Mutation_p.Q499L|BCAR1_uc010cgu.2_Missense_Mutation_p.Q698L|BCAR1_uc010vna.1_Missense_Mutation_p.Q707L|BCAR1_uc010vnb.1_Missense_Mutation_p.Q755L|BCAR1_uc002fdw.2_Missense_Mutation_p.Q709L|BCAR1_uc010vnc.1_Missense_Mutation_p.Q561L|BCAR1_uc010vnd.1_Missense_Mutation_p.Q727L|BCAR1_uc002fdx.2_Missense_Mutation_p.Q727L	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	709					actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGACACCTCCTGTTCCAGTCG	0.672													57	52	---	---	---	---	PASS
ZC3H18	124245	broad.mit.edu	37	16	88691683	88691683	+	Intron	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88691683C>G	uc002fky.2	+						ZC3H18_uc010voz.1_Intron|ZC3H18_uc010chw.2_Intron|ZC3H18_uc002fkz.2_5'Flank	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		CAGGTCATCCCCATCACCCTG	0.637													4	3	---	---	---	---	PASS
TMEM102	284114	broad.mit.edu	37	17	7339208	7339208	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7339208G>T	uc002ggx.1	+	2	291	c.18G>T	c.(16-18)TGG>TGT	p.W6C	FGF11_uc010vtw.1_Intron|TMEM102_uc002ggy.1_Missense_Mutation_p.W6C	NM_178518	NP_848613	Q8N9M5	TM102_HUMAN	transmembrane protein 102	6	Extracellular (Potential).				regulation of apoptosis|response to cytokine stimulus|signal transduction	cell surface|integral to membrane|intracellular	protein binding				0		Prostate(122;0.173)				CCGCAGTCTGGGGGAGTGCCC	0.557													12	52	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7579312	7579312	+	Silent	SNP	C	A	A	rs55863639		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579312C>A	uc002gim.2	-	4	569	c.375G>T	c.(373-375)ACG>ACT	p.T125T	TP53_uc002gig.1_Silent_p.T125T|TP53_uc002gih.2_Silent_p.T125T|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Silent_p.T125T|TP53_uc010cni.1_Silent_p.T125T|TP53_uc002gij.2_Silent_p.T125T|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Silent_p.T86T|TP53_uc010cnk.1_Silent_p.T140T	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	125	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		T -> A (in a sporadic cancer; somatic mutation).|T -> M (in sporadic cancers; somatic mutation).|T -> R (in sporadic cancers; somatic mutation).|T -> P (in a sporadic cancer; somatic mutation).|T -> K (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.T125T(15)|p.0?(7)|p.T125M(7)|p.T125K(3)|p.T125R(3)|p.?(2)|p.V73fs*9(1)|p.T125P(1)|p.G105_T125del21(1)|p.Y126fs*11(1)|p.T125fs*45(1)|p.T125fs*24(1)|p.T125A(1)|p.P13fs*18(1)|p.T125_Y126insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGCAACTGACCGTGCAAGTCA	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			46	77	---	---	---	---	PASS
ABHD15	116236	broad.mit.edu	37	17	27893101	27893101	+	Intron	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27893101C>A	uc002hed.1	-						TP53I13_uc002hee.2_5'Flank	NM_198147	NP_937790	Q6UXT9	ABH15_HUMAN	abhydrolase domain containing 15 precursor							extracellular region	carboxylesterase activity				0						CTCCGTTACCCACCTGCTGAG	0.612													39	58	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32956213	32956213	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32956213C>T	uc002hif.2	+	5	1386	c.1058C>T	c.(1057-1059)CCC>CTC	p.P353L		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	353	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCCATCCTGCCCCTGGCCATG	0.577													10	30	---	---	---	---	PASS
KCNH6	81033	broad.mit.edu	37	17	61621687	61621687	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61621687A>T	uc002jay.2	+	12	2499	c.2419A>T	c.(2419-2421)AGC>TGC	p.S807C	KCNH6_uc010wpl.1_Missense_Mutation_p.S648C|KCNH6_uc010wpm.1_Missense_Mutation_p.S771C|KCNH6_uc002jaz.1_Missense_Mutation_p.S718C	NM_030779	NP_110406	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H,	807	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent|signal transduction					skin(1)	1					Ibutilide(DB00308)	CCCAAGGCACAGCCCCCAAAG	0.607													34	44	---	---	---	---	PASS
GH2	2689	broad.mit.edu	37	17	61958285	61958285	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61958285C>A	uc002jco.1	-	4	365	c.303G>T	c.(301-303)CTG>CTT	p.L101L	GH2_uc002jcj.2_Silent_p.L101L|CSH2_uc002jck.2_Intron|GH2_uc002jcl.1_Silent_p.L101L|GH2_uc002jcm.1_Silent_p.L101L|GH2_uc002jcn.1_Silent_p.L86L	NM_002059	NP_002050	P01242	SOM2_HUMAN	growth hormone 2 isoform 1	101						extracellular region	hormone activity			upper_aerodigestive_tract(2)|pancreas(1)	3						AGATGCGGAGCAGCTCTAGGT	0.647													47	59	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62021219	62021219	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62021219G>A	uc002jds.1	-							NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha						muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	AAGTATAGTGGGATAGGGCTT	0.542													28	32	---	---	---	---	PASS
PRKAR1A	5573	broad.mit.edu	37	17	66519945	66519945	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66519945A>T	uc002jhg.2	+	4	608	c.428A>T	c.(427-429)GAT>GTT	p.D143V	PRKAR1A_uc002jhh.2_Missense_Mutation_p.D143V|PRKAR1A_uc002jhi.2_Missense_Mutation_p.D143V|PRKAR1A_uc002jhj.2_Missense_Mutation_p.D143V|PRKAR1A_uc002jhk.2_Missense_Mutation_p.D19V|PRKAR1A_uc002jhl.2_Missense_Mutation_p.D143V|PRKAR1A_uc002jhm.2_Missense_Mutation_p.D143V	NM_212471	NP_997636	P10644	KAP0_HUMAN	cAMP-dependent protein kinase, regulatory	143	cAMP 1.				activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|regulation of transcription from RNA polymerase II promoter|transmembrane transport|water transport	cAMP-dependent protein kinase complex|cytosol	cAMP binding|cAMP-dependent protein kinase regulator activity|protein binding			adrenal_gland(4)|lung(3)|thyroid(2)|soft_tissue(2)|breast(1)	12	Breast(10;1.64e-13)					CATCTTGATGATAATGAGAGA	0.373			T|Mis|N|F|S	RET	papillary thyroid	myxoma|endocrine|papillary thyroid			Carney_Complex|Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial|Cardiac_Myxomas_Familial_Clustering_of				37	98	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5419732	5419732	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5419732G>A	uc002kmt.1	-	12	1570	c.1484C>T	c.(1483-1485)TCG>TTG	p.S495L	EPB41L3_uc010wzh.1_Missense_Mutation_p.S513L|EPB41L3_uc002kmu.1_Missense_Mutation_p.S513L|EPB41L3_uc010dkq.1_Missense_Mutation_p.S404L|EPB41L3_uc002kms.1_5'UTR|EPB41L3_uc010wze.1_5'UTR|EPB41L3_uc010wzf.1_5'UTR|EPB41L3_uc010wzg.1_5'UTR|EPB41L3_uc010dkr.2_Missense_Mutation_p.S74L	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	495	Hydrophilic.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						CCGGATGGCCGAGATGGGCGT	0.363													30	103	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50278670	50278670	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50278670G>T	uc002lfe.1	+	2	925	c.338G>T	c.(337-339)GGA>GTA	p.G113V	DCC_uc010xdr.1_5'UTR	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	113	Extracellular (Potential).|Ig-like C2-type 1.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CCAGATGAGGGACTTTACCAA	0.413													22	86	---	---	---	---	PASS
NARS	4677	broad.mit.edu	37	18	55276599	55276599	+	Missense_Mutation	SNP	T	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55276599T>G	uc002lgs.2	-	7	797	c.569A>C	c.(568-570)AAG>ACG	p.K190T	NARS_uc002lgt.2_Missense_Mutation_p.K189T|NARS_uc010xea.1_Intron|NARS_uc010xeb.1_RNA|NARS_uc010xec.1_Missense_Mutation_p.K190T|NARS_uc010xed.1_Missense_Mutation_p.K157T	NM_004539	NP_004530	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	190					asparaginyl-tRNA aminoacylation	cytosol|soluble fraction	asparagine-tRNA ligase activity|ATP binding|nucleic acid binding|protein binding				0		Colorectal(73;0.227)			L-Asparagine(DB00174)	CTGCTTGCCCTTTGGGGTAAG	0.398													24	152	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63547658	63547658	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63547658C>T	uc002ljz.2	+	12	2211	c.1886C>T	c.(1885-1887)ACT>ATT	p.T629I	CDH7_uc002lkb.2_Missense_Mutation_p.T629I	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	629	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				CTTATCGTCACTATGAGAAGA	0.443													6	86	---	---	---	---	PASS
OR4F17	81099	broad.mit.edu	37	19	110698	110698	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:110698T>C	uc002loc.1	+	1	20	c.20T>C	c.(19-21)TTT>TCT	p.F7S	OR4F17_uc002lob.1_Missense_Mutation_p.F7S	NM_001005240	NP_001005240	Q8NGA8	O4F17_HUMAN	olfactory receptor, family 4, subfamily F,	7	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		all_cancers(10;1.05e-30)|all_epithelial(18;3.04e-19)|Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;2.49e-05)|all_lung(49;4.36e-05)|Breast(49;0.000304)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAATTCATTTTTCTGGGTCTC	0.393													15	527	---	---	---	---	PASS
ATCAY	85300	broad.mit.edu	37	19	3907875	3907875	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3907875C>A	uc002lyy.3	+	5	932	c.502C>A	c.(502-504)CTG>ATG	p.L168M	ATCAY_uc010xhz.1_Missense_Mutation_p.L174M|ATCAY_uc010dts.2_5'Flank	NM_033064	NP_149053	Q86WG3	ATCAY_HUMAN	caytaxin	168					transport		protein binding			breast(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00485)|STAD - Stomach adenocarcinoma(1328;0.183)		CCGTATAGACCTGCACATGAT	0.672													11	18	---	---	---	---	PASS
ACSBG2	81616	broad.mit.edu	37	19	6151739	6151739	+	Nonsense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6151739G>T	uc002mef.1	+	4	546	c.319G>T	c.(319-321)GGA>TGA	p.G107*	ACSBG2_uc002mee.1_5'UTR|ACSBG2_uc002meg.1_Nonsense_Mutation_p.G107*|ACSBG2_uc002meh.1_Nonsense_Mutation_p.G107*|ACSBG2_uc002mei.1_Nonsense_Mutation_p.G57*|ACSBG2_uc010xiz.1_Nonsense_Mutation_p.G107*	NM_030924	NP_112186	Q5FVE4	ACBG2_HUMAN	bubblegum-related acyl-CoA synthetase 2	107					cell differentiation|fatty acid metabolic process|multicellular organismal development|spermatogenesis	membrane|microsome|mitochondrion	acyl-CoA thioesterase activity|ATP binding|long-chain fatty acid-CoA ligase activity			ovary(1)	1						GCGTTTCCACGGAGTTGGTAT	0.453													2	14	---	---	---	---	PASS
MLLT1	4298	broad.mit.edu	37	19	6230582	6230582	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6230582C>A	uc002mek.2	-	4	583	c.419G>T	c.(418-420)GGG>GTG	p.G140V		NM_005934	NP_005925	Q03111	ENL_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	140					regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleolus	DNA binding|protein binding			skin(1)	1						CACACTCACCCCGCCGGCCCG	0.697			T	MLL	AL								17	26	---	---	---	---	PASS
ZNF358	140467	broad.mit.edu	37	19	7585294	7585294	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7585294G>T	uc002mgn.2	+	2	1336	c.1166G>T	c.(1165-1167)AGC>ATC	p.S389I	MCOLN1_uc010dvh.1_5'Flank|MCOLN1_uc002mgo.2_5'Flank|MCOLN1_uc002mgp.2_5'Flank	NM_018083	NP_060553	Q9NW07	ZN358_HUMAN	zinc finger protein 358	389	C2H2-type 9.				embryonic forelimb morphogenesis|neural tube development|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						CAGGCCTCCAGCCTCACCAAG	0.498													3	8	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10476245	10476245	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10476245C>A	uc002moc.3	-	7	1337	c.959G>T	c.(958-960)GGC>GTC	p.G320V	TYK2_uc010dxe.2_Missense_Mutation_p.G135V|TYK2_uc002mod.2_Missense_Mutation_p.G320V	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	320	FERM.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			GCCACCAGTGCCTGTCACCAG	0.672													25	63	---	---	---	---	PASS
RFXANK	8625	broad.mit.edu	37	19	19308072	19308072	+	Intron	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19308072C>A	uc002nls.2	+						RFXANK_uc002nlt.2_Intron|RFXANK_uc002nlu.2_Intron|RFXANK_uc002nlv.2_Intron|RFXANK_uc002nlw.2_Intron	NM_003721	NP_003712	O14593	RFXK_HUMAN	regulatory factor X-associated							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(2)	2			Epithelial(12;0.00228)			TGCGTGTCCACACACATGTGC	0.577													19	40	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30936440	30936440	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30936440C>A	uc002nsu.1	+	2	2109	c.1971C>A	c.(1969-1971)CGC>CGA	p.R657R	ZNF536_uc010edd.1_Silent_p.R657R	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	657					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AGCGGGACCGCAAGGGCGAGG	0.687													61	79	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31768908	31768908	+	Silent	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31768908G>A	uc002nsy.3	-	2	1856	c.1791C>T	c.(1789-1791)AGC>AGT	p.S597S		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	597					negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GGGACGTCTGGCTGCTGGGTG	0.552													46	209	---	---	---	---	PASS
PEPD	5184	broad.mit.edu	37	19	33878831	33878831	+	Missense_Mutation	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33878831G>A	uc002nur.3	-	14	1444	c.1309C>T	c.(1309-1311)CGC>TGC	p.R437C	PEPD_uc010xrr.1_Missense_Mutation_p.R396C|PEPD_uc010xrs.1_Missense_Mutation_p.R373C|PEPD_uc002nuq.3_Missense_Mutation_p.R116C	NM_000285	NP_000276	P12955	PEPD_HUMAN	prolidase isoform 1	437					cellular amino acid metabolic process|collagen catabolic process|proteolysis		aminopeptidase activity|dipeptidase activity|manganese ion binding|metallocarboxypeptidase activity			ovary(2)	2	Esophageal squamous(110;0.137)					AGGACCTCGCGGTTAAGGAAG	0.657													3	6	---	---	---	---	PASS
ZNF790	388536	broad.mit.edu	37	19	37314233	37314233	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37314233T>C	uc002oew.2	-	4	302	c.183A>G	c.(181-183)AAA>AAG	p.K61K	uc002oev.1_Intron	NM_206894	NP_996777	Q6PG37	ZN790_HUMAN	zinc finger protein 790	61	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|skin(1)	2	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCCAGGGCTCTTTCCCTTTCT	0.458													19	74	---	---	---	---	PASS
PLEKHG2	64857	broad.mit.edu	37	19	39914665	39914665	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39914665C>T	uc010xuz.1	+	19	3217	c.2892C>T	c.(2890-2892)CTC>CTT	p.L964L	PLEKHG2_uc010xuy.1_Silent_p.L905L|PLEKHG2_uc002olj.2_Intron|PLEKHG2_uc010xva.1_Silent_p.L742L	NM_022835	NP_073746	Q9H7P9	PKHG2_HUMAN	common-site lymphoma/leukemia guanine nucleotide	964					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			skin(2)|pancreas(1)|breast(1)	4	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CCCTGCACCTCCAGGTGCCGG	0.557													31	107	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41594559	41594559	+	Intron	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41594559G>T	uc002opt.2	+							NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,						xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	TCATGAAGGTGTCCTAAGGCA	0.592													34	88	---	---	---	---	PASS
HNRNPUL1	11100	broad.mit.edu	37	19	41785042	41785042	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41785042C>T	uc002oqb.3	+	6	1136	c.847C>T	c.(847-849)CGT>TGT	p.R283C	CYP2F1_uc010xvw.1_Intron|HNRNPUL1_uc002opz.3_Missense_Mutation_p.R183C|HNRNPUL1_uc002oqa.3_Missense_Mutation_p.R183C|HNRNPUL1_uc010ehm.2_Missense_Mutation_p.R283C|HNRNPUL1_uc002oqc.3_Intron|HNRNPUL1_uc002oqe.3_Intron|HNRNPUL1_uc002oqd.3_Missense_Mutation_p.R183C|HNRNPUL1_uc010ehn.2_Missense_Mutation_p.R183C|HNRNPUL1_uc010eho.2_Missense_Mutation_p.R183C|HNRNPUL1_uc010xvy.1_Missense_Mutation_p.R183C|HNRNPUL1_uc010ehp.2_Missense_Mutation_p.R139C|HNRNPUL1_uc010ehl.1_Missense_Mutation_p.R183C	NM_007040	NP_008971	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	283	B30.2/SPRY.|Necessary for interaction with TP53.				nuclear mRNA splicing, via spliceosome|regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	enzyme binding|RNA binding			central_nervous_system(1)|skin(1)	2						CCACGTGGTCCGTATCGGCTG	0.547													56	153	---	---	---	---	PASS
CEACAM4	1089	broad.mit.edu	37	19	42132258	42132258	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42132258C>A	uc002orh.1	-	2	252	c.141G>T	c.(139-141)GAG>GAT	p.E47D	CEACAM4_uc010xwd.1_Missense_Mutation_p.E47D	NM_001817	NP_001808	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion	47	Extracellular (Potential).|Ig-like V-type.					integral to plasma membrane|membrane fraction					0						CATCCTTTCCCTCTGCAGCAC	0.507													58	136	---	---	---	---	PASS
CADM4	199731	broad.mit.edu	37	19	44127512	44127512	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44127512T>C	uc002oxc.1	-	9	1186	c.1137A>G	c.(1135-1137)GGA>GGG	p.G379G		NM_145296	NP_660339	Q8NFZ8	CADM4_HUMAN	cell adhesion molecule 4 precursor	379	Cytoplasmic (Potential).				cell adhesion	integral to membrane					0		Prostate(69;0.0199)				TCCTCTTGTGTCCGTCGCTGC	0.607													63	234	---	---	---	---	PASS
KCNN4	3783	broad.mit.edu	37	19	44280704	44280704	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44280704T>C	uc002oxl.2	-	2	640	c.244A>G	c.(244-246)AAA>GAA	p.K82E	KCNN4_uc010eiz.2_5'Flank|KCNN4_uc010eja.1_RNA	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated	82					defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	TGGACCTCTTTGGCATGAAAG	0.602													18	70	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44934632	44934632	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44934632G>C	uc002oze.1	-	6	758	c.324C>G	c.(322-324)ATC>ATG	p.I108M	ZNF229_uc010ejk.1_Translation_Start_Site|ZNF229_uc010ejl.1_Missense_Mutation_p.I102M	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	108	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				CCTCTTCCCAGATTTTGCATG	0.428													37	131	---	---	---	---	PASS
RSPH6A	81492	broad.mit.edu	37	19	46313864	46313864	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46313864C>A	uc002pdm.2	-	2	1028	c.885G>T	c.(883-885)GAG>GAT	p.E295D	RSPH6A_uc002pdl.2_Missense_Mutation_p.E31D	NM_030785	NP_110412	Q9H0K4	RSH6A_HUMAN	radial spokehead-like 1	295						intracellular				ovary(1)|central_nervous_system(1)	2						CACTCACCACCTCCTCCTCCA	0.617													99	244	---	---	---	---	PASS
ALDH16A1	126133	broad.mit.edu	37	19	49967959	49967959	+	Missense_Mutation	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49967959A>G	uc002pnt.2	+	12	1624	c.1508A>G	c.(1507-1509)TAT>TGT	p.Y503C	ALDH16A1_uc010yar.1_Missense_Mutation_p.Y452C|ALDH16A1_uc010yas.1_Missense_Mutation_p.Y338C|ALDH16A1_uc010yat.1_Missense_Mutation_p.Y340C	NM_153329	NP_699160	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	503							oxidoreductase activity|protein binding			skin(1)	1		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		AACCTGAACTATGACACCTTT	0.622													114	294	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50208306	50208306	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50208306G>T	uc002ppj.2	+	8	1019	c.814G>T	c.(814-816)GCT>TCT	p.A272S	CPT1C_uc002ppl.3_Missense_Mutation_p.A238S|CPT1C_uc002ppi.2_Missense_Mutation_p.A189S|CPT1C_uc002ppk.2_Missense_Mutation_p.A261S|CPT1C_uc010eng.2_Missense_Mutation_p.A272S|CPT1C_uc010enh.2_Missense_Mutation_p.A272S|CPT1C_uc010ybc.1_Missense_Mutation_p.A110S|CPT1C_uc010eni.1_5'Flank	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	272	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		GGCAGCTCGCGCTGGGAATGC	0.647													36	106	---	---	---	---	PASS
AP2A1	160	broad.mit.edu	37	19	50303388	50303388	+	Missense_Mutation	SNP	C	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50303388C>G	uc002ppn.2	+	11	1647	c.1436C>G	c.(1435-1437)GCC>GGC	p.A479G	AP2A1_uc010enj.1_RNA|AP2A1_uc002ppo.2_Missense_Mutation_p.A479G|AP2A1_uc002ppp.1_5'Flank	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1	479					axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CAGGGCTATGCCGCCAAGACC	0.612													7	22	---	---	---	---	PASS
ZNF320	162967	broad.mit.edu	37	19	53385189	53385189	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53385189C>T	uc002qag.2	-	4	381	c.190G>A	c.(190-192)GGC>AGC	p.G64S	ZNF320_uc010eqh.1_5'Flank|ZNF320_uc010eqi.1_Intron|ZNF320_uc002qah.2_Missense_Mutation_p.G10S|ZNF320_uc002qai.2_Missense_Mutation_p.G64S	NM_207333	NP_997216	A2RRD8	ZN320_HUMAN	zinc finger protein 320	64	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		TCTGTATTGCCTTGCCCTGTT	0.373													101	249	---	---	---	---	PASS
PRKCG	5582	broad.mit.edu	37	19	54401253	54401253	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54401253C>A	uc002qcq.1	+	10	1262	c.980C>A	c.(979-981)CCT>CAT	p.P327H	PRKCG_uc010yef.1_Missense_Mutation_p.L298I|PRKCG_uc010yeg.1_Missense_Mutation_p.P327H|PRKCG_uc010yeh.1_Missense_Mutation_p.P214H	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma	327					activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		atcccctccccttccccTAGT	0.468													41	92	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54783386	54783386	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54783386C>A	uc002qfb.2	-	5	738	c.472G>T	c.(472-474)GAA>TAA	p.E158*	LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Nonsense_Mutation_p.E158*|LILRB2_uc010erj.2_RNA|LILRB2_uc002qfc.2_Nonsense_Mutation_p.E158*|LILRB2_uc010yet.1_Nonsense_Mutation_p.E42*|LILRB2_uc010yeu.1_RNA	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,	158	Extracellular (Potential).|Ig-like C2-type 2.				cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		TCTTCTCCTTCCTTACACAGA	0.622													41	89	---	---	---	---	PASS
SLC27A5	10998	broad.mit.edu	37	19	59010244	59010244	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59010244C>T	uc002qtc.2	-	9	1914	c.1804G>A	c.(1804-1806)GCC>ACC	p.A602T	SLC27A5_uc002qtb.2_RNA	NM_012254	NP_036386	Q9Y2P5	S27A5_HUMAN	solute carrier family 27 (fatty acid	602	Cytoplasmic (Probable).				bile acid and bile salt transport|bile acid biosynthetic process|very long-chain fatty acid metabolic process	endoplasmic reticulum membrane|integral to membrane	ATP binding|cholate-CoA ligase activity|long-chain fatty acid-CoA ligase activity				0		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.181)		TGGCCGGGGGCTAGCTGCACA	0.622													4	86	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13868588	13868588	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13868588C>T	uc010gcf.2	-	7	745	c.663G>A	c.(661-663)TTG>TTA	p.L221L	SEL1L2_uc002woq.3_Silent_p.L82L|SEL1L2_uc010zrl.1_Silent_p.L221L|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	221	Sel1-like 4.|Extracellular (Potential).					integral to membrane	binding			ovary(2)	2						GTTTACAAACCAAAATCATCT	0.358													32	124	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16509090	16509090	+	Intron	SNP	A	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16509090A>C	uc002wpg.1	-						KIF16B_uc010gch.1_Intron|KIF16B_uc010gci.1_Intron|KIF16B_uc010gcj.1_Intron	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23						cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						TTTTCCCTGCAATACAAATAA	0.328													15	155	---	---	---	---	PASS
PCSK2	5126	broad.mit.edu	37	20	17446118	17446118	+	Silent	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17446118T>A	uc002wpm.2	+	11	1670	c.1350T>A	c.(1348-1350)GGT>GGA	p.G450G	PCSK2_uc002wpl.2_Silent_p.G431G|PCSK2_uc010zrm.1_Silent_p.G415G|PCSK2_uc002wpn.2_Silent_p.G104G	NM_002594	NP_002585	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	450					enkephalin processing|insulin processing|islet amyloid polypeptide processing	extracellular space|membrane|soluble fraction|transport vesicle	serine-type endopeptidase activity			ovary(3)|central_nervous_system(2)|large_intestine(1)|pancreas(1)	7					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	TTGATGCAGGTGCCATGGTGA	0.567													13	60	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25481510	25481510	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25481510T>A	uc002wux.1	-	8	1072	c.998A>T	c.(997-999)CAG>CTG	p.Q333L	NINL_uc010gdn.1_Missense_Mutation_p.Q333L|NINL_uc010gdo.1_Intron|NINL_uc010ztf.1_Missense_Mutation_p.Q349L	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	333					G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						AATCCCCTCCTGGGTCCACAT	0.597													13	66	---	---	---	---	PASS
MYLK2	85366	broad.mit.edu	37	20	30419933	30419933	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30419933C>T	uc002wwq.2	+	12	1806	c.1704C>T	c.(1702-1704)CGC>CGT	p.R568R	MYLK2_uc002wws.2_Silent_p.R185R|MYLK2_uc010gdw.1_RNA	NM_033118	NP_149109	Q9H1R3	MYLK2_HUMAN	skeletal myosin light chain kinase	568					cardiac muscle tissue morphogenesis|regulation of muscle filament sliding		ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity|myosin light chain kinase activity			lung(2)|skin(2)|ovary(1)|central_nervous_system(1)	6			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGAAGAGGCGCTGGAAGGTAC	0.587													8	17	---	---	---	---	PASS
PLAGL2	5326	broad.mit.edu	37	20	30785030	30785030	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30785030T>C	uc002wxn.2	-	3	933	c.716A>G	c.(715-717)AAG>AGG	p.K239R		NM_002657	NP_002648	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	239	C2H2-type 6.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GTGGCTCTTCTTGACATGACG	0.582													19	31	---	---	---	---	PASS
PTPRT	11122	broad.mit.edu	37	20	41101061	41101061	+	Missense_Mutation	SNP	T	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:41101061T>A	uc002xkg.2	-	8	1479	c.1295A>T	c.(1294-1296)CAG>CTG	p.Q432L	PTPRT_uc010ggj.2_Missense_Mutation_p.Q432L	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	432	Extracellular (Potential).|Fibronectin type-III 2.				homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GTACTGCTGCTGGTTGAACAC	0.627													57	81	---	---	---	---	PASS
AURKA	6790	broad.mit.edu	37	20	54963223	54963223	+	Nonsense_Mutation	SNP	C	A	A	rs6069717		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54963223C>A	uc002xxd.1	-	4	597	c.31G>T	c.(31-33)GGA>TGA	p.G11*	AURKA_uc002xxe.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxf.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxg.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxh.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxi.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxj.1_Nonsense_Mutation_p.G11*|AURKA_uc002xxk.1_Nonsense_Mutation_p.G11*|AURKA_uc010zzd.1_RNA	NM_198433	NP_940835	O14965	AURKA_HUMAN	serine/threonine protein kinase 6	11					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|phosphatidylinositol-mediated signaling|regulation of protein stability|spindle organization	cytosol|nucleus|perinuclear region of cytoplasm|spindle microtubule|spindle pole centrosome	ATP binding|protein kinase binding|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(1)|large_intestine(1)|skin(1)	8			Colorectal(105;0.202)			TTAACAGGTCCTGAAATGCAG	0.383													12	231	---	---	---	---	PASS
OSBPL2	9885	broad.mit.edu	37	20	60835156	60835156	+	Nonsense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60835156C>T	uc002yck.1	+	3	359	c.157C>T	c.(157-159)CAA>TAA	p.Q53*	OSBPL2_uc002ycl.1_Nonsense_Mutation_p.Q41*|OSBPL2_uc011aah.1_Intron	NM_144498	NP_653081	Q9H1P3	OSBL2_HUMAN	oxysterol-binding protein-like protein 2 isoform	53					lipid transport		lipid binding			ovary(1)|central_nervous_system(1)	2	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			GAGGCCCTCTCAAGAGAACGG	0.438													20	141	---	---	---	---	PASS
ZGPAT	84619	broad.mit.edu	37	20	62340111	62340111	+	Missense_Mutation	SNP	G	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62340111G>C	uc002ygk.2	+	2	357	c.179G>C	c.(178-180)AGC>ACC	p.S60T	ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Missense_Mutation_p.S60T|ZGPAT_uc002ygj.2_Missense_Mutation_p.S60T|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Missense_Mutation_p.S60T|ZGPAT_uc002ygm.2_Missense_Mutation_p.S60T|ZGPAT_uc002ygn.3_RNA	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	60					negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GTCAGGAAGAGCAGCTTGTTG	0.657													20	111	---	---	---	---	PASS
NRIP1	8204	broad.mit.edu	37	21	16337882	16337882	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16337882C>A	uc002yjx.2	-	4	3230	c.2632G>T	c.(2632-2634)GTT>TTT	p.V878F		NM_003489	NP_003480	P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	878	Repression domain 3.				androgen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		androgen receptor binding|estrogen receptor binding|glucocorticoid receptor binding|transcription coactivator activity|transcription corepressor activity				0				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		GCAGCATCAACAATGTTGTTT	0.363													62	220	---	---	---	---	PASS
USP25	29761	broad.mit.edu	37	21	17242405	17242405	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:17242405A>T	uc002yjy.1	+	21	2831	c.2614A>T	c.(2614-2616)AGG>TGG	p.R872W	USP25_uc011aby.1_Missense_Mutation_p.R942W|USP25_uc002yjz.1_Missense_Mutation_p.R904W|USP25_uc010gla.1_Missense_Mutation_p.R267W	NM_013396	NP_037528	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	872					protein modification process|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)|liver(2)	5				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		TCAGGATTATAGGAAATTCAG	0.308													44	160	---	---	---	---	PASS
KRTAP13-4	284827	broad.mit.edu	37	21	31802905	31802905	+	Silent	SNP	G	T	T	rs150222104		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31802905G>T	uc011acw.1	+	1	312	c.312G>T	c.(310-312)TCG>TCT	p.S104S		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	104						intermediate filament					0						GCTGCTACTCGCTGGGAAATG	0.532													9	27	---	---	---	---	PASS
PWP2	5822	broad.mit.edu	37	21	45535237	45535237	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45535237A>T	uc002zeb.2	+	6	653	c.563A>T	c.(562-564)AAG>ATG	p.K188M		NM_005049	NP_005040	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog	188	WD 5.					cytoplasm|nucleolus	signal transducer activity			pancreas(1)	1				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		GGGGGACATAAGGATGCCATC	0.547													50	132	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47704633	47704633	+	Missense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47704633C>A	uc002zir.1	-	1	604	c.568G>T	c.(568-570)GCC>TCC	p.A190S	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	190					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					GAGAAAGGGGCCAGGCCTCCA	0.413													36	69	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47704634	47704634	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47704634C>A	uc002zir.1	-	1	603	c.567G>T	c.(565-567)CTG>CTT	p.L189L	C21orf57_uc002zit.1_5'Flank|C21orf57_uc002ziu.1_5'Flank|C21orf57_uc002ziv.2_5'Flank|C21orf57_uc002ziw.2_5'Flank|C21orf57_uc002zix.2_5'Flank|C21orf57_uc010gqh.2_5'Flank|C21orf57_uc002ziy.2_5'Flank	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	189					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					AGAAAGGGGCCAGGCCTCCAG	0.413													36	68	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47970476	47970476	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47970476G>T	uc002zjo.2	+	23	2841	c.2658G>T	c.(2656-2658)CAG>CAT	p.Q886H	DIP2A_uc011afy.1_Missense_Mutation_p.Q822H|DIP2A_uc011afz.1_Missense_Mutation_p.Q882H	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	886					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GCATCCACCAGGTGGGCGTGT	0.582													5	19	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26692894	26692894	+	Missense_Mutation	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26692894T>C	uc003acb.2	+	4	1166	c.1010T>C	c.(1009-1011)ATC>ACC	p.I337T	SEZ6L_uc003acc.2_Missense_Mutation_p.I337T|SEZ6L_uc011akc.1_Missense_Mutation_p.I337T|SEZ6L_uc003acd.2_Missense_Mutation_p.I337T|SEZ6L_uc011akd.1_Missense_Mutation_p.I337T|SEZ6L_uc003ace.2_Missense_Mutation_p.I337T|SEZ6L_uc003acf.1_Missense_Mutation_p.I110T|SEZ6L_uc010gvc.1_Missense_Mutation_p.I110T	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	337	CUB 1.|Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						CTGCTCTCCATCCGCGGGGTG	0.592													18	26	---	---	---	---	PASS
TAB1	10454	broad.mit.edu	37	22	39824179	39824179	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39824179C>T	uc003axt.2	+	10	1347	c.1298C>T	c.(1297-1299)ACC>ATC	p.T433I	TAB1_uc003axr.2_Missense_Mutation_p.T509I|TAB1_uc011aok.1_Missense_Mutation_p.T267I|TAB1_uc003axu.1_Missense_Mutation_p.T433I	NM_006116	NP_006107	Q15750	TAB1_HUMAN	mitogen-activated protein kinase kinase kinase 7	433					activation of MAPK activity|activation of MAPKKK activity|I-kappaB kinase/NF-kappaB cascade|innate immune response|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane	catalytic activity|protein binding			breast(1)	1						GCCACCCCCACCCTCACCAAG	0.642													11	54	---	---	---	---	PASS
AMELX	265	broad.mit.edu	37	X	11316885	11316885	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11316885C>T	uc004cut.2	+	5	430	c.362C>T	c.(361-363)CCG>CTG	p.P121L	ARHGAP6_uc004cup.1_Intron|ARHGAP6_uc004cuo.1_Intron|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_Missense_Mutation_p.P135L|AMELX_uc004cuu.2_Missense_Mutation_p.P105L	NM_001142	NP_001133	Q99217	AMELX_HUMAN	amelogenin (X chromosome) isoform 1 precursor	121					cell adhesion|cell proliferation|chondrocyte differentiation|enamel mineralization|epithelial to mesenchymal transition|ion homeostasis|odontogenesis of dentine-containing tooth|osteoblast differentiation|positive regulation of collagen biosynthetic process|positive regulation of tooth mineralization|signal transduction	proteinaceous extracellular matrix	cell surface binding|growth factor activity|hydroxyapatite binding|identical protein binding|structural constituent of tooth enamel				0						AACCTCCCTCCGCCCGCCCAG	0.662													4	9	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22208614	22208614	+	Missense_Mutation	SNP	A	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22208614A>T	uc004dah.2	+	15	1843	c.1640A>T	c.(1639-1641)CAG>CTG	p.Q547L	PHEX_uc011mjr.1_Missense_Mutation_p.Q547L|PHEX_uc011mjs.1_Missense_Mutation_p.Q450L	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	547	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						TCCACCAACCAGATCCGTGAG	0.423													31	70	---	---	---	---	PASS
MAGEB16	139604	broad.mit.edu	37	X	35820595	35820595	+	Silent	SNP	T	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35820595T>C	uc010ngt.1	+	2	561	c.282T>C	c.(280-282)GAT>GAC	p.D94D		NM_001099921	NP_001093391	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	94										lung(3)|ovary(2)|breast(1)|skin(1)	7						AAGAGGAAGATAGTCCAAGCT	0.488													4	9	---	---	---	---	PASS
CXorf59	286464	broad.mit.edu	37	X	36156569	36156569	+	Missense_Mutation	SNP	C	G	G	rs138587803		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:36156569C>G	uc004ddk.1	+	10	1434	c.1248C>G	c.(1246-1248)GAC>GAG	p.D416E		NM_173695	NP_775966	Q8N9S7	CX059_HUMAN	hypothetical protein LOC286464	416						integral to membrane				central_nervous_system(1)	1						TTGACTTTGACGTGGAAATAC	0.294													17	55	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37028587	37028587	+	Missense_Mutation	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37028587C>T	uc004ddl.1	+	1	2118	c.2104C>T	c.(2104-2106)CTC>TTC	p.L702F		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	702										ovary(3)	3						AGTGTCCCGTCTCCACCCAGA	0.642													12	22	---	---	---	---	PASS
BCOR	54880	broad.mit.edu	37	X	39932785	39932785	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:39932785G>T	uc004den.3	-	4	2106	c.1814C>A	c.(1813-1815)CCT>CAT	p.P605H	BCOR_uc004dep.3_Missense_Mutation_p.P605H|BCOR_uc004deo.3_Missense_Mutation_p.P605H|BCOR_uc004dem.3_Missense_Mutation_p.P605H|BCOR_uc004deq.3_Missense_Mutation_p.P605H	NM_001123385	NP_001116857	Q6W2J9	BCOR_HUMAN	BCL-6 interacting corepressor isoform c	605					heart development|histone H2A monoubiquitination|negative regulation of bone mineralization|negative regulation of histone H3-K36 methylation|negative regulation of histone H3-K4 methylation|negative regulation of tooth mineralization|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|palate development|specification of axis polarity|transcription, DNA-dependent	nucleus	heat shock protein binding|histone deacetylase binding|transcription corepressor activity|transcription factor binding|transcription regulatory region DNA binding			ovary(2)|kidney(1)|central_nervous_system(1)	4						GTGCTTGGCAGGAGTGGCCGG	0.582													15	32	---	---	---	---	PASS
ITGB1BP2	26548	broad.mit.edu	37	X	70524054	70524054	+	Silent	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70524054C>A	uc004dzr.1	+	9	686	c.657C>A	c.(655-657)CGC>CGA	p.R219R	BCYRN1_uc011mpt.1_Intron|ITGB1BP2_uc004dzs.1_Silent_p.R201R	NM_012278	NP_036410	Q9UKP3	ITBP2_HUMAN	integrin beta 1 binding protein 2	219	CS.				muscle organ development|signal transduction		SH3 domain binding			ovary(1)	1	Renal(35;0.156)					CATCTTGCCGCCATGATTGGC	0.468													3	52	---	---	---	---	PASS
MUM1L1	139221	broad.mit.edu	37	X	105449469	105449469	+	Missense_Mutation	SNP	G	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105449469G>T	uc004emf.1	+	4	693	c.44G>T	c.(43-45)TGG>TTG	p.W15L	MUM1L1_uc004emg.1_Missense_Mutation_p.W15L	NM_152423	NP_689636	Q5H9M0	MUML1_HUMAN	melanoma associated antigen (mutated) 1-like 1	15										ovary(2)|pancreas(1)|skin(1)	4						GACCAGTTGTGGCCAGCAAAA	0.378													3	7	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111095583	111095583	+	Silent	SNP	A	G	G			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111095583A>G	uc004epl.1	-	5	2239	c.1320T>C	c.(1318-1320)TTT>TTC	p.F440F	TRPC5_uc004epm.1_Silent_p.F440F	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	440	Helical; (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						AGTTCATTGCAAAATCCATCA	0.423													35	58	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130413237	130413237	+	Intron	SNP	G	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130413237G>A	uc004ewd.2	-						IGSF1_uc004ewe.3_Intron|IGSF1_uc004ewf.2_Intron	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1						regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						TCCCCCACTTGTACTCACCAC	0.592													27	28	---	---	---	---	PASS
RPS4Y1	6192	broad.mit.edu	37	Y	2712180	2712180	+	Silent	SNP	C	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2712180C>T	uc004fqi.2	+	3	187	c.144C>T	c.(142-144)CTC>CTT	p.L48L		NM_001008	NP_000999	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1 Y isoform	48	S4 RNA-binding.				endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|polysome	rRNA binding|structural constituent of ribosome				0						TCGTCTTCCTCAGGAATAGAC	0.448													62	147	---	---	---	---	PASS
KDM5D	8284	broad.mit.edu	37	Y	21901521	21901521	+	Nonsense_Mutation	SNP	C	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:21901521C>A	uc004fug.2	-	6	838	c.550G>T	c.(550-552)GAG>TAG	p.E184*	KDM5D_uc011naz.1_Nonsense_Mutation_p.E184*|KDM5D_uc010nwy.2_Nonsense_Mutation_p.E127*|KDM5D_uc011nba.1_Nonsense_Mutation_p.E184*|KDM5D_uc004fuh.2_Intron	NM_004653	NP_004644	Q9BY66	KDM5D_HUMAN	jumonji, AT rich interactive domain 1D isoform	184					chromatin modification|spermatogenesis	nucleus	DNA binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1					Vitamin C(DB00126)	TCTTTTACCTCATTGTCAAAC	0.398													10	15	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16899956	16899957	+	Intron	INS	-	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16899956_16899957insA	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ATTTTTTCCCCAAAAAAATCTC	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	19314274	19314277	+	IGR	DEL	GAAA	-	-	rs72498264		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19314274_19314277delGAAA								IFFO2 (31448 upstream) : UBR4 (84327 downstream)																							aggaaggaaggaaagaaggaagga	0.191													5	5	---	---	---	---	
CATSPER4	378807	broad.mit.edu	37	1	26528181	26528182	+	Intron	INS	-	TT	TT	rs34161386		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26528181_26528182insTT	uc010oez.1	+						CATSPER4_uc009vsf.2_Intron	NM_198137	NP_937770	Q7RTX7	CTSR4_HUMAN	cation channel, sperm associated 4						cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|voltage-gated ion channel activity			ovary(1)	1		all_cancers(24;2.05e-18)|Colorectal(325;0.000147)|Renal(390;0.00211)|all_lung(284;0.00218)|Lung NSC(340;0.00239)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;3.52e-26)|Colorectal(126;1.34e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000755)|BRCA - Breast invasive adenocarcinoma(304;0.000995)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00878)|READ - Rectum adenocarcinoma(331;0.0649)		tctttctttccttttttttttt	0.188													4	2	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487406	67487407	+	Intron	DEL	AG	-	-	rs71711790		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487406_67487407delAG	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	acacagacacagacacacacac	0.248													4	2	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145299617	145299619	+	Intron	DEL	CAT	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145299617_145299619delCAT	uc001end.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_Intron|NBPF10_uc001emq.1_Intron	NM_001039703	NP_001034792	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC100132406												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ACCAGGGAAACATCATCTTCAAA	0.404													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	159612737	159612738	+	IGR	INS	-	GAAA	GAAA	rs147627740	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159612737_159612738insGAAA								APCS (54077 upstream) : CRP (69342 downstream)																							TTTTAAATCTTgaaagaaagaa	0.124													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	238655229	238655230	+	IGR	INS	-	A	A			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238655229_238655230insA								LOC339535 (5912 upstream) : CHRM3 (894635 downstream)																							TCGATGACACCAATGTCACTTG	0.505													13	9	---	---	---	---	
SDCCAG8	10806	broad.mit.edu	37	1	243434123	243434124	+	Intron	INS	-	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243434123_243434124insT	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		ggtagaaattcttttttttttt	0.025													8	4	---	---	---	---	
GPN1	11321	broad.mit.edu	37	2	27852150	27852151	+	Intron	INS	-	G	G	rs146892484	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27852150_27852151insG	uc010ymc.1	+						ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_5'Flank|CCDC121_uc002rld.2_5'Flank|CCDC121_uc002rle.2_5'Flank|GPN1_uc010ezf.2_Intron|GPN1_uc010yma.1_Intron|GPN1_uc010ymb.1_Intron|GPN1_uc010ymd.1_Intron|GPN1_uc010yme.1_Intron|GPN1_uc010ezg.1_5'UTR	NM_007266	NP_009197	Q9HCN4	GPN1_HUMAN	GPN-loop GTPase 1 isoform a							cytoplasm	GTP binding|nucleoside-triphosphatase activity|protein binding				0						GCATGGCTTTCGGGGGCTTCCC	0.589													5	4	---	---	---	---	
LCT	3938	broad.mit.edu	37	2	136558437	136558438	+	Intron	DEL	TG	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136558437_136558438delTG	uc002tuu.1	-							NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein						carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGACTGAGATTGTTAGTCCCTG	0.347													11	8	---	---	---	---	
MCM6	4175	broad.mit.edu	37	2	136610223	136610223	+	Intron	DEL	A	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136610223delA	uc002tuw.2	-							NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	GCTGTTCCAGAAAAAAAAAAA	0.284													6	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	142231614	142231614	+	Intron	DEL	T	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:142231614delT	uc002tvj.1	-						LRP1B_uc010fnl.1_Intron	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ccttccttcctttccttcctt	0.075										TSP Lung(27;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	193594161	193594172	+	IGR	DEL	AGGCAGGCAGGC	-	-	rs11689603		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193594161_193594172delAGGCAGGCAGGC								TMEFF2 (534517 upstream) : PCGEM1 (20399 downstream)																							gaaggaaggaaggcaggcaggcaggaaggaaa	0.175													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	103257382	103257382	+	IGR	DEL	T	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:103257382delT								None (None upstream) : None (None downstream)																							TTTACACAGCTTTTTTTTTTT	0.348													8	5	---	---	---	---	
NPHP3	27031	broad.mit.edu	37	3	132438748	132438749	+	Intron	DEL	AT	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132438748_132438749delAT	uc003epe.1	-						NCRNA00119_uc003epg.1_5'Flank|NPHP3_uc003epf.1_Intron|NCRNA00119_uc010htu.1_5'Flank	NM_153240	NP_694972	Q7Z494	NPHP3_HUMAN	nephrocystin 3						maintenance of organ identity|negative regulation of canonical Wnt receptor signaling pathway|photoreceptor cell maintenance|regulation of Wnt receptor signaling pathway, planar cell polarity pathway|Wnt receptor signaling pathway	cilium	protein binding			ovary(1)	1						atatatatacatatatatatat	0.248													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	149701114	149701114	+	IGR	DEL	G	-	-	rs34404328		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149701114delG								PFN2 (12373 upstream) : TSC22D2 (425674 downstream)																							CCAGAGAGCCGGCCCCGGTAG	0.577													2	4	---	---	---	---	
LPHN3	23284	broad.mit.edu	37	4	62123554	62123555	+	Intron	INS	-	GT	GT	rs142092957	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62123554_62123555insGT	uc003hcq.3	+						LPHN3_uc010ihg.1_Intron			Q9HAR2	LPHN3_HUMAN	RecName: Full=Latrophilin-3; AltName: Full=Calcium-independent alpha-latrotoxin receptor 3; AltName: Full=Lectomedin-3; Flags: Precursor;						neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TTGAATTAGAGgtgtgtgtgtg	0.307													4	2	---	---	---	---	
EMCN	51705	broad.mit.edu	37	4	101369980	101369999	+	Intron	DEL	CCTCCCTCCCTCCCTCCCTC	-	-	rs12644581		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101369980_101369999delCCTCCCTCCCTCCCTCCCTC	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		ttccttccttcctccctccctccctccctcccttccttgc	0.000													4	3	---	---	---	---	
FABP2	2169	broad.mit.edu	37	4	120243417	120243418	+	5'Flank	INS	-	TC	TC	rs144572173	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:120243417_120243418insTC	uc003icw.2	-							NM_000134	NP_000125	P12104	FABPI_HUMAN	intestinal fatty acid binding protein 2								fatty acid binding			ovary(1)	1						TTAATTCTTATTAATTAATTCT	0.282													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	150296120	150296121	+	IGR	DEL	TG	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:150296120_150296121delTG								NR3C2 (932477 upstream) : DCLK2 (703959 downstream)																							ACACTTTCTTtgtgtgtgtgtg	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185899235	185899236	+	IGR	DEL	TA	-	-	rs10545309		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185899235_185899236delTA								ACSL1 (152020 upstream) : HELT (40759 downstream)																							tcacaaagtgtatatatatata	0.035													4	2	---	---	---	---	
RICTOR	253260	broad.mit.edu	37	5	38990928	38990936	+	Intron	DEL	GATATATGA	-	-	rs71936429		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38990928_38990936delGATATATGA	uc003jlp.2	-						RICTOR_uc003jlo.2_Intron|RICTOR_uc010ivf.2_Intron|RICTOR_uc003jlq.1_Intron|RICTOR_uc011cpk.1_Intron	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR						actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					tgagatatatgatatatgagatatatgag	0.048													4	2	---	---	---	---	
BTF3	689	broad.mit.edu	37	5	72800092	72800093	+	Intron	INS	-	TTT	TTT	rs34051700		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72800092_72800093insTTT	uc003kcr.1	+						BTF3_uc003kcq.1_Intron|BTF3_uc003kcs.1_Intron|BTF3_uc003kct.1_Intron	NM_001037637	NP_001032726	P20290	BTF3_HUMAN	basic transcription factor 3 isoform A						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding				0		Lung NSC(167;0.00405)|Ovarian(174;0.0175)		OV - Ovarian serous cystadenocarcinoma(47;2.73e-54)		TTCATCTGttcttttttttttt	0.267													4	4	---	---	---	---	
FBN2	2201	broad.mit.edu	37	5	127707230	127707231	+	Intron	INS	-	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127707230_127707231insT	uc003kuu.2	-						FBN2_uc003kuv.2_Intron	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor						bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		ccttccttcTGtttttttttga	0.005													5	3	---	---	---	---	
FAM13B	51306	broad.mit.edu	37	5	137289730	137289731	+	Intron	INS	-	T	T	rs147698927		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137289730_137289731insT	uc003lbz.2	-						FAM13B_uc003lcb.2_Intron|FAM13B_uc003lca.2_Intron	NM_016603	NP_057687	Q9NYF5	FA13B_HUMAN	hypothetical protein LOC51306 isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						CAATCTCTCTCttttttttttt	0.262													4	2	---	---	---	---	
GEMIN5	25929	broad.mit.edu	37	5	154270615	154270616	+	Intron	INS	-	T	T	rs147642619		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154270615_154270616insT	uc003lvx.3	-						GEMIN5_uc011ddk.1_Intron	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5						ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			tgtgcccggGCTTTTTTTtttt	0.010													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32677622	32677631	+	IGR	DEL	TCCTTCCTTC	-	-	rs9280121		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32677622_32677631delTCCTTCCTTC								HLA-DQB1 (43156 upstream) : HLA-DQA2 (31532 downstream)																							ctttctttcttccttccttccttccttcct	0.010													4	3	---	---	---	---	
MACC1	346389	broad.mit.edu	37	7	20229372	20229373	+	Intron	DEL	AA	-	-	rs72309121		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20229372_20229373delAA	uc003sus.3	-						MACC1_uc010kug.2_Intron	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5						positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						acaaacacataaacacacacac	0.163													2	5	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	35057722	35057722	+	Intron	DEL	T	-	-	rs151162813		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35057722delT	uc003tem.3	-							NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						AGTATCTATATTTTTTTCACT	0.209													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	54556602	54556603	+	IGR	INS	-	CCTTCCTG	CCTTCCTG			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54556602_54556603insCCTTCCTG								HPVC1 (286488 upstream) : VSTM2A (53416 downstream)																							ctttcttccttccttcctgcct	0.193													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67206114	67206117	+	IGR	DEL	TTCT	-	-	rs56895053		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67206114_67206117delTTCT								STAG3L4 (419602 upstream) : None (None downstream)																							ccttccttccttctttccttcctt	0.113													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	29757677	29757678	+	IGR	INS	-	ATGC	ATGC	rs28630820		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29757677_29757678insATGC								C8orf75 (152052 upstream) : LOC286135 (21351 downstream)																							GAACAGAGGgtgtgtgtgtgtg	0.366													4	2	---	---	---	---	
RIMS2	9699	broad.mit.edu	37	8	104922218	104922219	+	Intron	INS	-	TA	TA	rs139210956	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:104922218_104922219insTA	uc003yls.2	+						RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Intron|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron|RIMS2_uc003ylt.2_5'Flank	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2						intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			ATAGCACTCACTATATATATAT	0.287										HNSCC(12;0.0054)			5	4	---	---	---	---	
ENPP2	5168	broad.mit.edu	37	8	120598168	120598169	+	Intron	DEL	AC	-	-	rs142862962		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120598168_120598169delAC	uc003yot.1	-						ENPP2_uc011lic.1_5'Flank|ENPP2_uc003yor.1_Intron|ENPP2_uc003yos.1_Intron|ENPP2_uc010mdd.1_Intron	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein						cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GATGAAAGAGacacacacacac	0.312													2	4	---	---	---	---	
TMEM71	137835	broad.mit.edu	37	8	133770870	133770870	+	Intron	DEL	T	-	-	rs11334814		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133770870delT	uc003ytp.2	-						TMEM71_uc003ytn.2_Intron|TMEM71_uc003yto.2_Intron	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1							integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AAAACGGTGATTTTTTTTTTT	0.294													3	5	---	---	---	---	
KDM4C	23081	broad.mit.edu	37	9	6805464	6805465	+	Intron	INS	-	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6805464_6805465insT	uc003zkh.2	+						KDM4C_uc010mhu.2_Intron|KDM4C_uc010mhw.2_Intron|KDM4C_uc011lmi.1_Intron|KDM4C_uc011lmj.1_Intron|KDM4C_uc003zkg.2_Intron|KDM4C_uc011lmk.1_Intron|KDM4C_uc010mhv.2_Intron	NM_015061	NP_055876	Q9H3R0	KDM4C_HUMAN	jumonji domain containing 2C isoform 1						positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	nuclear chromatin	androgen receptor binding|enzyme binding|histone demethylase activity (H3-K9 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			ovary(1)	1						AAATATTCATCTTTTTTTTTTT	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68380404	68380405	+	IGR	INS	-	G	G	rs144187147		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68380404_68380405insG								FAM27B (586215 upstream) : MIR1299 (621834 downstream)																							CTCCTTTGCCAGGGGCTGGGCA	0.728													4	5	---	---	---	---	
LOC100129066	100129066	broad.mit.edu	37	9	92286637	92286645	+	Intron	DEL	ATGGTGGTT	-	-	rs138909303	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92286637_92286645delATGGTGGTT	uc004aqs.2	+							NR_024280				Homo sapiens cDNA FLJ42342 fis, clone UTERU2000794.												0						ggtggtggtgatggtggttatggtggtga	0.033													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	8541891	8541894	+	IGR	DEL	TCTT	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8541891_8541894delTCTT								GATA3 (424729 upstream) : None (None downstream)																							tctttctttctctttctttctctc	0.039													5	6	---	---	---	---	
KIAA1462	57608	broad.mit.edu	37	10	30305328	30305331	+	3'UTR	DEL	AGGG	-	-	rs11292871	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30305328_30305331delAGGG	uc001iux.2	-	3					KIAA1462_uc001iuw.1_5'Flank|KIAA1462_uc001iuy.2_3'UTR|KIAA1462_uc001iuz.2_3'UTR	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608											ovary(4)	4						gaagaaaggaagggagggagggag	0.127													4	2	---	---	---	---	
KIF5B	3799	broad.mit.edu	37	10	32307648	32307649	+	Intron	INS	-	A	A	rs144717631	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:32307648_32307649insA	uc001iwe.3	-							NM_004521	NP_004512	P33176	KINH_HUMAN	kinesin family member 5B						stress granule disassembly|vesicle transport along microtubule	kinesin complex|microtubule|perinuclear region of cytoplasm|vesicle	ATP binding|microtubule binding|microtubule motor activity		KIF5B/ALK(4)	lung(4)|ovary(1)	5		Prostate(175;0.0137)				TGCTGTCTTTCaaaaaaaaaat	0.178													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467884	52467886	+	IGR	DEL	TCC	-	-	rs57441530		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467884_52467886delTCC								SGMS1 (82961 upstream) : ASAH2B (31810 downstream)																							CATCTTCACGTCCTTCTCTCACA	0.389													5	3	---	---	---	---	
KIF20B	9585	broad.mit.edu	37	10	91497021	91497021	+	Intron	DEL	T	-	-	rs72076248		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:91497021delT	uc001kgs.1	+						KIF20B_uc001kgr.1_Intron|KIF20B_uc001kgt.1_Intron|KIF20B_uc009xtw.1_5'Flank	NM_016195	NP_057279	Q96Q89	KI20B_HUMAN	M-phase phosphoprotein 1						cell cycle arrest|cell division|microtubule-based movement|mitosis|regulation of mitosis	centrosome|microtubule|nucleolus|nucleoplasm|spindle	ATP binding|ATPase activity|microtubule motor activity|WW domain binding			ovary(1)|pancreas(1)|skin(1)	3						GCTTATTTCATTTTTTTTTTT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	106059243	106059243	+	5'Flank	DEL	T	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106059243delT	uc001kyd.1	+											Homo sapiens cDNA FLJ37540 fis, clone BRCAN2026117.																		ttttttttccttttttttttt	0.179													4	2	---	---	---	---	
NRAP	4892	broad.mit.edu	37	10	115357132	115357132	+	Intron	DEL	A	-	-	rs113389465		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115357132delA	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		GATATGGAACATTTTACAGGT	0.383													2	4	---	---	---	---	
EBF3	253738	broad.mit.edu	37	10	131665635	131665635	+	Intron	DEL	C	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:131665635delC	uc001lki.1	-							NM_001005463	NP_001005463	Q9H4W6	COE3_HUMAN	early B-cell factor 3						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding|protein binding			central_nervous_system(1)|pancreas(1)	2		all_cancers(35;1.8e-08)|all_epithelial(44;8.26e-08)|Lung NSC(174;0.0091)|all_lung(145;0.0123)|Breast(234;0.039)|all_neural(114;0.0722)|Colorectal(57;0.0764)		OV - Ovarian serous cystadenocarcinoma(35;0.00513)		ATTGGACCATCGTCTTGGAAT	0.488													5	7	---	---	---	---	
AMBRA1	55626	broad.mit.edu	37	11	46450142	46450143	+	Intron	INS	-	T	T	rs2864834	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46450142_46450143insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		tcttcttcttcttttttttTTA	0.381													5	3	---	---	---	---	
DNAJB13	374407	broad.mit.edu	37	11	73680791	73680794	+	Intron	DEL	AAAC	-	-	rs34820619		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73680791_73680794delAAAC	uc001ouo.2	+							NM_153614	NP_705842	P59910	DJB13_HUMAN	testis spermatogenesis apoptosis-related protein						apoptosis|protein folding|spermatogenesis		heat shock protein binding|unfolded protein binding				0	Breast(11;7.42e-05)					CCCATGTCTTAAACAAAGTTTCTG	0.529													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	22328295	22328296	+	IGR	DEL	CT	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22328295_22328296delCT								CMAS (109694 upstream) : ST8SIA1 (18030 downstream)																							tccttccttcctCTCTCTCTCT	0.114													5	3	---	---	---	---	
LMBR1L	55716	broad.mit.edu	37	12	49494862	49494863	+	Intron	INS	-	A	A	rs145985167	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49494862_49494863insA	uc001rth.3	-						LMBR1L_uc001rtg.3_Intron|LMBR1L_uc001rti.3_Intron	NM_018113	NP_060583	Q6UX01	LMBRL_HUMAN	lipocalin-interacting membrane receptor						endocytosis	integral to membrane|plasma membrane	receptor activity			pancreas(1)	1						GCCCTCCTTTCAAATTAAGTCT	0.317													4	12	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101739211	101739212	+	Intron	INS	-	T	T			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101739211_101739212insT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						gcaatcctGACTTTTTTTTTTA	0.084													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	111262484	111262484	+	IGR	DEL	G	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111262484delG								PPP1CC (81727 upstream) : CCDC63 (22327 downstream)																							aaggaaggaaggaaggaggga	0.065													4	2	---	---	---	---	
CLIP1	6249	broad.mit.edu	37	12	122850224	122850225	+	Intron	INS	-	A	A	rs150479919		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122850224_122850225insA	uc001ucg.1	-						CLIP1_uc001uch.1_Intron|CLIP1_uc001uci.1_Intron|CLIP1_uc001ucj.1_5'Flank|CLIP1_uc010tae.1_Intron	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a						mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		CTGGGCTATTTAAAAAAAAAAA	0.252													3	5	---	---	---	---	
PARP4	143	broad.mit.edu	37	13	25069017	25069018	+	Intron	INS	-	TTTTT	TTTTT	rs139965809	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25069017_25069018insTTTTT	uc001upl.2	-						PARP4_uc010tdc.1_Intron	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4						cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ttttctttttcttttttttttg	0.099													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	43769943	43769943	+	IGR	DEL	T	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:43769943delT								None (None upstream) : None (None downstream)																							TGTGGGTTGATTTTTTTTTCT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	21270386	21270387	+	IGR	DEL	AG	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:21270386_21270387delAG								NF1P1 (135761 upstream) : LOC646214 (662127 downstream)																							aaagaaagaaagagggagggag	0.000													8	4	---	---	---	---	
CHRNA7	1139	broad.mit.edu	37	15	32450490	32450491	+	Intron	INS	-	TT	TT			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32450490_32450491insTT	uc001zft.2	+						uc001zfv.1_Intron|CHRNA7_uc010bae.1_Intron|CHRNA7_uc010baf.2_Intron|CHRNA7_uc010baj.1_Intron|CHRNA7_uc010bak.2_Intron	NM_000746	NP_000737	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7						activation of MAPK activity|calcium ion transport|cellular calcium ion homeostasis|memory|negative regulation of tumor necrosis factor production|positive regulation of angiogenesis|positive regulation of cell proliferation|response to hypoxia|response to nicotine	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|beta-amyloid binding|chloride channel regulator activity|nicotinic acetylcholine-activated cation-selective channel activity|protein homodimerization activity|toxin binding			ovary(1)	1		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Nicotine(DB00184)|Varenicline(DB01273)	caaccccccccttttttttttt	0.069													4	2	---	---	---	---	
DUOX1	53905	broad.mit.edu	37	15	45434984	45434987	+	Intron	DEL	AGGG	-	-	rs67057268		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45434984_45434987delAGGG	uc001zus.1	+						DUOX1_uc001zut.1_Intron|DUOX1_uc010bee.1_Intron	NM_017434	NP_059130	Q9NRD9	DUOX1_HUMAN	dual oxidase 1 precursor						cuticle development|cytokine-mediated signaling pathway|hormone biosynthetic process|hydrogen peroxide biosynthetic process|hydrogen peroxide catabolic process|response to cAMP|superoxide anion generation	apical plasma membrane|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|NADP binding|peroxidase activity			ovary(5)|skin(2)|breast(1)	8		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		gaaggaaggaagggagggaggaag	0.225													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	48198789	48198790	+	IGR	DEL	AC	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48198789_48198790delAC								SEMA6D (132370 upstream) : SLC24A5 (214379 downstream)																							tttcttgcttacacacacacac	0.010													3	3	---	---	---	---	
CCPG1	9236	broad.mit.edu	37	15	55783154	55783155	+	Intron	INS	-	A	A	rs74830467		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55783154_55783155insA	uc002acy.2	-						DYX1C1_uc010ugh.1_Intron|DYX1C1_uc010ugi.1_Intron|DYX1C1_uc002adb.2_Intron|DYX1C1_uc002adc.2_Intron|DYX1C1_uc002add.2_Intron	NM_020739	NP_065790	Q9ULG6	CCPG1_HUMAN	cell cycle progression 1 isoform 2						cell cycle	integral to membrane				ovary(1)	1				all cancers(107;0.0354)		tcggtctcaagaaaaaaaaaaa	0.163													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86742646	86742647	+	IGR	INS	-	CTTCCTCTCTTCCTTCCTTC	CTTCCTCTCTTCCTTCCTTC	rs11270969		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86742646_86742647insCTTCCTCTCTTCCTTCCTTC								FOXL1 (127343 upstream) : FBXO31 (620297 downstream)																							TCAGGGAATTGcttcctctctt	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21549913	21549914	+	IGR	DEL	CT	-	-	rs112001794		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21549913_21549914delCT								C17orf51 (72182 upstream) : FAM27L (275456 downstream)																							TCAATGAAACCTTCTGTGGCAG	0.515													4	2	---	---	---	---	
SARM1	23098	broad.mit.edu	37	17	26686182	26686182	+	Intron	DEL	A	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26686182delA	uc010wah.1	+						POLDIP2_uc002haz.2_5'Flank|POLDIP2_uc010wag.1_5'Flank|TMEM199_uc002hba.2_Intron	NM_152464	NP_689677	Q6SZW1	SARM1_HUMAN	transmembrane protein 199						innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		AATTGAGATCAAAAAAAAAAA	0.383													4	2	---	---	---	---	
TMEM132E	124842	broad.mit.edu	37	17	32965285	32965286	+	3'UTR	INS	-	A	A	rs28442132	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32965285_32965286insA	uc002hif.2	+	10						NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor							integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		ACCCCCCCCCCCAACGGGGTCA	0.639											OREG0024325	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
PLEKHM1	9842	broad.mit.edu	37	17	43560000	43560000	+	Intron	DEL	A	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43560000delA	uc002ija.2	-						PLEKHM1_uc010wjm.1_Intron|PLEKHM1_uc002ijb.2_Intron|PLEKHM1_uc010wjn.1_Intron|PLEKHM1_uc002ijd.1_5'Flank	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M						intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					AACTGCAACCAAAAAGGCCTT	0.493													4	2	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73227384	73227385	+	Intron	DEL	AC	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73227384_73227385delAC	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron|NUP85_uc002jnh.1_Intron	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CTCTTGTGGGACGCGGCCTGTG	0.450													95	74	---	---	---	---	
RECQL5	9400	broad.mit.edu	37	17	73626922	73626923	+	Intron	INS	-	T	T	rs56158987		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73626922_73626923insT	uc010dgl.2	-						RECQL5_uc010dgk.2_Intron|RECQL5_uc002jot.3_5'Flank|LOC643008_uc002jow.2_5'Flank	NM_004259	NP_004250	O94762	RECQ5_HUMAN	RecQ protein-like 5 isoform 1						DNA recombination|DNA repair	cytoplasm|nuclear membrane|nucleolus|nucleoplasm	ATP binding|ATP-dependent helicase activity|DNA helicase activity|nucleic acid binding			kidney(3)	3	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTCATCTGTGGGGGGGGGGGG	0.649								Other_identified_genes_with_known_or_suspected_DNA_repair_function					5	5	---	---	---	---	
RNF157	114804	broad.mit.edu	37	17	74160693	74160693	+	Intron	DEL	A	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74160693delA	uc002jqz.2	-						RNF157_uc002jra.2_Intron	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157								zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			TTCTTTGATTaaaaaaaaaaa	0.224													4	2	---	---	---	---	
SPPL2B	56928	broad.mit.edu	37	19	2341094	2341102	+	Intron	DEL	CTCCCTGGA	-	-	rs76166147		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2341094_2341102delCTCCCTGGA	uc002lvs.2	+						SPPL2B_uc010dsw.1_In_Frame_Del_p.PPW318del|SPPL2B_uc010dsy.1_In_Frame_Del_p.PPW318del|SPPL2B_uc010dsz.1_In_Frame_Del_p.PPW346del|SPPL2B_uc002lvr.2_Intron|SPPL2B_uc010dta.1_In_Frame_Del_p.PPW198del|SPPL2B_uc002lvu.2_In_Frame_Del_p.PPW140del	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2							Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCCCTGCCCTCCCTGGAGGCCGCCCCA	0.703													4	2	---	---	---	---	
NANOS3	342977	broad.mit.edu	37	19	13986003	13986003	+	5'Flank	DEL	T	-	-	rs77913995		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13986003delT	uc002mxj.3	+							NM_001098622	NP_001092092	P60323	NANO3_HUMAN	nanos homolog 3						anti-apoptosis|germ cell development|multicellular organismal development|oogenesis|regulation of cell cycle|regulation of translation|spermatogenesis	cytoplasmic mRNA processing body|nucleus|stress granule	RNA binding|zinc ion binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			TAAAATCCCCttttttttttt	0.269													5	3	---	---	---	---	
ANKRD27	84079	broad.mit.edu	37	19	33099414	33099414	+	Intron	DEL	A	-	-	rs7258141	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33099414delA	uc002ntn.1	-							NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)						early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					TTACCTCTTTAAAAAAAAAaa	0.224													4	3	---	---	---	---	
ZNF829	374899	broad.mit.edu	37	19	37393061	37393061	+	Intron	DEL	A	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37393061delA	uc002ofa.1	-						ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATAAAATTGCAAAAAAAAAAG	0.328													5	3	---	---	---	---	
VRK3	51231	broad.mit.edu	37	19	50485050	50485051	+	Intron	INS	-	AC	AC	rs150610662	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50485050_50485051insAC	uc002prg.2	-						VRK3_uc002prh.1_Intron|VRK3_uc002pri.1_Intron|VRK3_uc010ens.2_Intron|VRK3_uc010ybl.1_Intron|VRK3_uc010ybm.1_Intron|VRK3_uc002prj.1_3'UTR|VRK3_uc002prk.1_3'UTR	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1							nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		cacacacacagacacacacaca	0.297													4	2	---	---	---	---	
ZNF528	84436	broad.mit.edu	37	19	52919096	52919096	+	Frame_Shift_Del	DEL	G	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52919096delG	uc002pzh.2	+	7	1417	c.991delG	c.(991-993)GGCfs	p.G331fs	ZNF528_uc002pzi.2_Frame_Shift_Del_p.G98fs	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	331	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		TAATAAATGTGGCAAGGTCTT	0.373													93	45	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45502690	45502691	+	IGR	INS	-	A	A	rs74735132		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45502690_45502691insA								SLC2A10 (137707 upstream) : EYA2 (20572 downstream)																							aactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ZNFX1	57169	broad.mit.edu	37	20	47870567	47870567	+	Intron	DEL	T	-	-	rs11353174		TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47870567delT	uc002xui.2	-							NM_021035	NP_066363	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1								metal ion binding			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			ttcttttttcttttttttttt	0.194													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54903428	54903428	+	IGR	DEL	G	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54903428delG								MC3R (78557 upstream) : C20orf108 (30555 downstream)																							aaggaaggaaggaaggaagaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40499417	40499418	+	IGR	INS	-	TTG	TTG			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40499417_40499418insTTG								ETS2 (302541 upstream) : PSMG1 (47972 downstream)																							tttttttgttttgttttgtttt	0.307													5	3	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1467599	1467600	+	Intron	INS	-	TTTC	TTTC			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1467599_1467600insTTTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	ctttctttctgtttctgtttct	0.045													4	2	---	---	---	---	
PHEX	5251	broad.mit.edu	37	X	22129815	22129816	+	Intron	DEL	TG	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22129815_22129816delTG	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						CTATTGTTTTTGTGTGTGTGTG	0.317													7	4	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652829	53652852	+	Intron	DEL	GCCGGGGCCGGGGCCGGGGCCGGT	-	-	rs78801842	by1000genomes	TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652829_53652852delGCCGGGGCCGGGGCCGGGGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggggccggggccggggccggtgccgggactg	0.219													3	27	---	---	---	---	
MED12	9968	broad.mit.edu	37	X	70341836	70341837	+	Intron	INS	-	C	C			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70341836_70341837insC	uc004dyy.2	+						MED12_uc011mpq.1_Intron|MED12_uc004dyz.2_Intron|MED12_uc004dza.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TTGGGGGTTTTCACCAGCCTCT	0.505													4	2	---	---	---	---	
IGSF1	3547	broad.mit.edu	37	X	130419264	130419264	+	Frame_Shift_Del	DEL	T	-	-			TCGA-18-3417-01	TCGA-18-3417-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130419264delT	uc004ewd.2	-	5	794	c.556delA	c.(556-558)ATTfs	p.I186fs	IGSF1_uc004ewe.3_Frame_Shift_Del_p.I175fs|IGSF1_uc004ewf.2_Frame_Shift_Del_p.I166fs|IGSF1_uc004ewg.2_Frame_Shift_Del_p.I186fs	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	186	Ig-like C2-type 2.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						AGGTTGTCAATGGAGAATATG	0.522													66	51	---	---	---	---	
