Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
TNFRSF1B	7133	broad.mit.edu	37	1	12251959	12251959	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12251959G>C	uc001att.2	+	4	525	c.436G>C	c.(436-438)GGC>CGC	p.G146R	TNFRSF1B_uc001atu.2_5'UTR|TNFRSF1B_uc009vnk.2_RNA	NM_001066	NP_001057	P20333	TNR1B_HUMAN	tumor necrosis factor receptor 2 precursor	146	TNFR-Cys 3.|Extracellular (Potential).				apoptosis	extracellular region|integral to membrane|membrane raft|plasma membrane	tumor necrosis factor receptor activity			liver(1)|central_nervous_system(1)|skin(1)	3	Ovarian(185;0.249)	Lung NSC(185;8.72e-05)|all_lung(284;9.92e-05)|Renal(390;0.000147)|Colorectal(325;0.000584)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;5.52e-07)|COAD - Colon adenocarcinoma(227;0.000345)|BRCA - Breast invasive adenocarcinoma(304;0.000353)|Kidney(185;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00302)|STAD - Stomach adenocarcinoma(313;0.00815)|READ - Rectum adenocarcinoma(331;0.0284)	Etanercept(DB00005)|Infliximab(DB00065)	GTGCCGCCCGGGCTTCGGCGT	0.682													20	26	---	---	---	---	PASS
GJA9	81025	broad.mit.edu	37	1	39341781	39341781	+	5'UTR	SNP	T	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39341781T>C	uc001cct.1	-	2					RRAGC_uc001ccr.2_5'Flank|MYCBP_uc001ccs.2_5'Flank	NM_030772	NP_110399	P57773	CXA9_HUMAN	gap junction protein, alpha 9, 59kDa						cell communication	connexon complex|integral to membrane					0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			GTTTATTTAGTCAGCCATCTT	0.418													7	204	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45484275	45484275	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45484275C>G	uc001cnd.2	-	14	3637	c.3409G>C	c.(3409-3411)GAG>CAG	p.E1137Q		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	1137							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					TCAATGAACTCTCCATAGTGG	0.517											OREG0013450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	123	164	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103491792	103491792	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103491792C>G	uc001dul.2	-	6	1195	c.877G>C	c.(877-879)GAG>CAG	p.E293Q	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Missense_Mutation_p.E293Q	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	293	Nonhelical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCTATTGTCTCCTCAGTTACA	0.448													60	129	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155764901	155764901	+	Nonsense_Mutation	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155764901C>A	uc001flz.2	-	12	1784	c.1687G>T	c.(1687-1689)GAA>TAA	p.E563*	GON4L_uc001fly.1_Nonsense_Mutation_p.E563*|GON4L_uc009wrh.1_Nonsense_Mutation_p.E563*|GON4L_uc001fma.1_Nonsense_Mutation_p.E563*|GON4L_uc001fmc.2_Nonsense_Mutation_p.E563*|GON4L_uc001fmd.3_Nonsense_Mutation_p.E563*|GON4L_uc009wri.2_Nonsense_Mutation_p.E149*|GON4L_uc009wrj.1_Nonsense_Mutation_p.E78*|GON4L_uc001fme.2_Nonsense_Mutation_p.E391*|GON4L_uc001fmf.2_Nonsense_Mutation_p.E257*	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	563	Asp-rich.				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCGAGGTCTTCCAGGAAATTA	0.413													79	95	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158597502	158597502	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158597502C>T	uc001fst.1	-	40	5776	c.5577G>A	c.(5575-5577)ATG>ATA	p.M1859I		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1859	Spectrin 18.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTTCATGCTTCATTAGCAAGC	0.398													21	188	---	---	---	---	PASS
IFI16	3428	broad.mit.edu	37	1	159002320	159002320	+	Nonsense_Mutation	SNP	A	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159002320A>T	uc001ftg.2	+	7	1458	c.1168A>T	c.(1168-1170)AAA>TAA	p.K390*	IFI16_uc010pis.1_Nonsense_Mutation_p.K334*|IFI16_uc001fth.2_5'UTR|IFI16_uc010pit.1_5'UTR	NM_005531	NP_005522	Q16666	IF16_HUMAN	interferon, gamma-inducible protein 16	390					cell proliferation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|monocyte differentiation|negative regulation of transcription, DNA-dependent|response to virus|transcription, DNA-dependent	cytoplasm|nuclear speck|nucleolus	double-stranded DNA binding|protein binding			ovary(1)	1	all_hematologic(112;0.0429)					TCAGATAAAGAAAAAAACAAA	0.378													35	27	---	---	---	---	PASS
KLHDC9	126823	broad.mit.edu	37	1	161069480	161069480	+	Silent	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161069480G>C	uc001fxr.2	+	3	952	c.780G>C	c.(778-780)CGG>CGC	p.R260R	KLHDC9_uc001fxq.2_Silent_p.R22R|KLHDC9_uc001fxs.2_Missense_Mutation_p.A267P	NM_152366	NP_689579	Q8NEP7	KLDC9_HUMAN	kelch/ankyrin repeat containing cyclin A1	260											0	all_cancers(52;1.28e-19)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ATGGACTACGGCATCACTCAT	0.542													179	250	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183514079	183514079	+	Missense_Mutation	SNP	A	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183514079A>T	uc001gqg.2	+	16	2124	c.2002A>T	c.(2002-2004)ACA>TCA	p.T668S	SMG7_uc010pob.1_Missense_Mutation_p.T651S|SMG7_uc001gqf.2_Missense_Mutation_p.T622S|SMG7_uc001gqh.2_Missense_Mutation_p.T622S|SMG7_uc001gqi.2_Missense_Mutation_p.T580S|SMG7_uc010poc.1_Missense_Mutation_p.T626S	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	668	Gln/Pro-rich.				mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCCGCCCCCAACATATGTTAT	0.433													115	146	---	---	---	---	PASS
SRGAP2	23380	broad.mit.edu	37	1	206619562	206619562	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206619562C>T	uc001hdy.2	+	15	2088	c.1755C>T	c.(1753-1755)ATC>ATT	p.I585I	SRGAP2_uc010prt.1_Silent_p.I508I|SRGAP2_uc001hdx.2_Silent_p.I585I|SRGAP2_uc010pru.1_Silent_p.I508I|SRGAP2_uc010prv.1_Silent_p.I509I	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	672	Rho-GAP.				axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					AAACCATCATCATCCAGCATG	0.587													153	195	---	---	---	---	PASS
MOSC1	64757	broad.mit.edu	37	1	220960480	220960480	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220960480C>T	uc001hms.2	+	1	442	c.194C>T	c.(193-195)CCT>CTT	p.P65L	MOSC1_uc001hmt.2_Missense_Mutation_p.P65L	NM_022746	NP_073583	Q5VT66	MOSC1_HUMAN	MOCO sulphurase C-terminal domain containing 1	65							molybdenum ion binding|oxidoreductase activity|pyridoxal phosphate binding				0				GBM - Glioblastoma multiforme(131;0.0358)		TGGATCTACCCTGTGAAATCC	0.741													4	3	---	---	---	---	PASS
DNAH6	1768	broad.mit.edu	37	2	84804425	84804425	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84804425C>T	uc010fgb.2	+	13	2106	c.1969C>T	c.(1969-1971)CAC>TAC	p.H657Y	DNAH6_uc002soo.2_Missense_Mutation_p.H236Y|DNAH6_uc002sop.2_Missense_Mutation_p.H236Y	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6	657	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						TCACAAACAGCACAAGGACGC	0.333													27	33	---	---	---	---	PASS
REV1	51455	broad.mit.edu	37	2	100055628	100055628	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100055628C>T	uc002tad.2	-	6	860	c.648G>A	c.(646-648)CCG>CCA	p.P216P	REV1_uc002tac.2_Silent_p.P216P|REV1_uc002tae.1_Silent_p.P195P	NM_016316	NP_057400	Q9UBZ9	REV1_HUMAN	REV1-like isoform 1	216					DNA replication|error-prone translesion synthesis|response to UV	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|magnesium ion binding|protein binding			ovary(2)	2						CTCTGGGATGCGGAATTCCAT	0.448								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	115	---	---	---	---	PASS
RAF1	5894	broad.mit.edu	37	3	12653511	12653511	+	Silent	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:12653511G>C	uc003bxf.3	-	3	673	c.258C>G	c.(256-258)CTC>CTG	p.L86L	RAF1_uc011aut.1_5'Flank|RAF1_uc011auu.1_Intron	NM_002880	NP_002871	P04049	RAF1_HUMAN	v-raf-1 murine leukemia viral oncogene homolog	86	RBD.				activation of MAPKK activity|apoptosis|axon guidance|cell proliferation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|negative regulation of apoptosis|negative regulation of cell proliferation|negative regulation of protein complex assembly|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of peptidyl-serine phosphorylation|Ras protein signal transduction|synaptic transmission	cytosol|mitochondrial outer membrane|plasma membrane	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity		ESRP1/RAF1(4)|SRGAP3/RAF1(4)	central_nervous_system(4)|prostate(4)|lung(2)|upper_aerodigestive_tract(1)|stomach(1)|liver(1)|ovary(1)	14					Sorafenib(DB00398)	CCCTCACCTTGAGTGCTTTCA	0.483			T	SRGAP3	pilocytic astrocytoma				Noonan_syndrome				151	186	---	---	---	---	PASS
DHX30	22907	broad.mit.edu	37	3	47884701	47884701	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47884701G>C	uc003cru.2	+	9	1321	c.895G>C	c.(895-897)GAG>CAG	p.E299Q	DHX30_uc003crt.2_Missense_Mutation_p.E260Q|DHX30_uc010hjr.1_Missense_Mutation_p.E327Q	NM_138615	NP_619520	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 30	299						mitochondrial nucleoid	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding			ovary(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CCGCAAAGCAGAGGCTGAGAA	0.567													73	90	---	---	---	---	PASS
MAP4	4134	broad.mit.edu	37	3	47958284	47958284	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47958284C>T	uc003csb.2	-	7	1559	c.1033G>A	c.(1033-1035)GCC>ACC	p.A345T	MAP4_uc003csc.3_Missense_Mutation_p.A345T|MAP4_uc011bbf.1_Missense_Mutation_p.A322T|MAP4_uc003csf.3_Missense_Mutation_p.A362T	NM_002375	NP_002366	P27816	MAP4_HUMAN	microtubule-associated protein 4 isoform 1	345	7.|17 X 14 AA tandem repeats.				negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)		ACATCCTTGGCTGGGGCTACC	0.473													216	275	---	---	---	---	PASS
BAP1	8314	broad.mit.edu	37	3	52440372	52440372	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52440372C>T	uc003ddx.2	-	9	795	c.680G>A	c.(679-681)CGC>CAC	p.R227H	BAP1_uc003ddw.2_5'Flank|BAP1_uc010hmg.2_5'Flank|BAP1_uc010hmh.2_5'Flank	NM_004656	NP_004647	Q92560	BAP1_HUMAN	BRCA1 associated protein-1	227					monoubiquitinated histone H2A deubiquitination|negative regulation of cell proliferation|protein K48-linked deubiquitination|regulation of cell cycle|regulation of cell growth|ubiquitin-dependent protein catabolic process	cytoplasm|nucleolus|PR-DUB complex	chromatin binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity	p.R227C(1)		pleura(32)|eye(28)|lung(2)|ovary(2)|breast(1)	65				BRCA - Breast invasive adenocarcinoma(193;1.72e-05)|Kidney(197;0.0018)|KIRC - Kidney renal clear cell carcinoma(197;0.00203)|OV - Ovarian serous cystadenocarcinoma(275;0.0277)		CAGGTTGAAGCGGATGTCGTG	0.627			N|Mis|F|S|O		uveal melanoma|breast|NSCLC								22	23	---	---	---	---	PASS
HLTF	6596	broad.mit.edu	37	3	148777580	148777580	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148777580C>A	uc003ewq.1	-	13	1518	c.1300G>T	c.(1300-1302)GTT>TTT	p.V434F	HLTF_uc003ewr.1_Missense_Mutation_p.V434F|HLTF_uc003ews.1_Missense_Mutation_p.V433F|HLTF_uc010hve.1_Missense_Mutation_p.V433F	NM_139048	NP_620636	Q14527	HLTF_HUMAN	helicase-like transcription factor	434					chromatin modification|transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TCTTCTATAACCTTAGAAGAT	0.318													69	118	---	---	---	---	PASS
SLC33A1	9197	broad.mit.edu	37	3	155560270	155560270	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155560270A>G	uc003fan.3	-	2	1295	c.914T>C	c.(913-915)ATA>ACA	p.I305T	SLC33A1_uc003fao.1_Missense_Mutation_p.I305T	NM_004733	NP_004724	O00400	ACATN_HUMAN	acetyl-coenzyme A transporter	305	Helical; (Potential).				cell death|transmembrane transport	endoplasmic reticulum membrane|Golgi membrane|integral to plasma membrane|membrane fraction	acetyl-CoA transporter activity			ovary(2)|large_intestine(1)|pancreas(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGGCATTTTTATAATTGCAAA	0.313													55	57	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164767660	164767660	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164767660T>C	uc003fei.2	-	14	1578	c.1516A>G	c.(1516-1518)ATG>GTG	p.M506V		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	506	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	ACTTCATTCATGTCCTGAATG	0.284										HNSCC(35;0.089)			59	82	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936070	178936070	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936070G>A	uc003fjk.2	+	10	1769	c.1612G>A	c.(1612-1614)GAT>AAT	p.D538N		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	538	PI3K helical.				epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.D538G(1)|p.D538N(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TTCTACACGAGATCCTCTCTC	0.333		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			45	53	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			48	60	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193039551	193039551	+	Nonsense_Mutation	SNP	G	A	A	rs139981143		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193039551G>A	uc011bsq.1	-	16	1834	c.1834C>T	c.(1834-1836)CAG>TAG	p.Q612*		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	612					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCAGCTAGCTGAGCGATCACG	0.502													61	72	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1803564	1803564	+	Missense_Mutation	SNP	C	T	T	rs121913482		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1803564C>T	uc003gdr.3	+	7	998	c.742C>T	c.(742-744)CGC>TGC	p.R248C	FGFR3_uc003gdu.2_Missense_Mutation_p.R248C|FGFR3_uc003gds.3_Missense_Mutation_p.R248C|FGFR3_uc003gdq.3_Missense_Mutation_p.R248C|FGFR3_uc010icb.1_Missense_Mutation_p.R90C|FGFR3_uc003gdt.1_Missense_Mutation_p.R90C	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	248	Extracellular (Potential).		R -> C (in KERSEB, bladder cancer, keratinocytic non-epidermolytic nevus and TD1; severe and lethal; also found as somatic mutation in one patient with multiple myeloma).		bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding	p.R248C(291)|p.R248_S249insC(2)|p.R248_S249del(1)		urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CCCCACAGAGCGCTCCCCGCA	0.567		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				8	6	---	---	---	---	PASS
N4BP2	55728	broad.mit.edu	37	4	40122763	40122763	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40122763T>C	uc003guy.3	+	9	3370	c.3032T>C	c.(3031-3033)GTA>GCA	p.V1011A	N4BP2_uc010ifq.2_Missense_Mutation_p.V931A|N4BP2_uc010ifr.2_Missense_Mutation_p.V931A	NM_018177	NP_060647	Q86UW6	N4BP2_HUMAN	Nedd4 binding protein 2	1011						cytoplasm	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|endonuclease activity|protein binding			lung(3)|breast(2)|kidney(2)|ovary(1)	8						GGAAAAGAAGTAGGCATGTGC	0.378													75	76	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125593004	125593004	+	Missense_Mutation	SNP	T	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125593004T>C	uc003ifg.3	-	3	1694	c.1428A>G	c.(1426-1428)ATA>ATG	p.I476M	ANKRD50_uc011cgo.1_Missense_Mutation_p.I297M|ANKRD50_uc010inw.2_Missense_Mutation_p.I476M	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	476										central_nervous_system(1)	1						TACCATTCCATATCATCCACA	0.413													129	133	---	---	---	---	PASS
FBXW7	55294	broad.mit.edu	37	4	153249384	153249384	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153249384C>T	uc003ims.2	-	9	1543	c.1394G>A	c.(1393-1395)CGT>CAT	p.R465H	FBXW7_uc011cii.1_Missense_Mutation_p.R465H|FBXW7_uc003imt.2_Missense_Mutation_p.R465H|FBXW7_uc011cih.1_Missense_Mutation_p.R289H|FBXW7_uc003imq.2_Missense_Mutation_p.R385H|FBXW7_uc003imr.2_Missense_Mutation_p.R347H	NM_033632	NP_361014	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7 isoform	465	WD 3.		R -> H (in a colorectal cancer sample; somatic mutation).|R -> C (in a acute lymphoblastic leukemia cell line).		interspecies interaction between organisms|lipid homeostasis|negative regulation of DNA endoreduplication|negative regulation of hepatocyte proliferation|negative regulation of Notch signaling pathway|negative regulation of triglyceride biosynthetic process|positive regulation of epidermal growth factor receptor activity|positive regulation of ERK1 and ERK2 cascade|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|protein stabilization|protein ubiquitination|regulation of lipid storage|regulation of protein localization|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|sister chromatid cohesion|vasculature development	nucleolus|nucleolus|nucleoplasm|nucleoplasm|SCF ubiquitin ligase complex	protein binding|protein binding	p.R465C(52)|p.R465H(36)|p.R465L(2)		haematopoietic_and_lymphoid_tissue(125)|large_intestine(99)|stomach(16)|lung(14)|endometrium(13)|ovary(9)|biliary_tract(8)|upper_aerodigestive_tract(5)|central_nervous_system(3)|kidney(3)|skin(3)|pancreas(3)|breast(2)|prostate(2)|cervix(1)|NS(1)|bone(1)	308	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				ATGCATACAACGCACAGTGGA	0.408			Mis|N|D|F		colorectal|endometrial|T-ALL								168	235	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140221266	140221266	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140221266C>T	uc003lhs.2	+	1	360	c.360C>T	c.(358-360)GAC>GAT	p.D120D	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Silent_p.D120D	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	120	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCATGTGGACGTGGAGGTGA	0.567													9	249	---	---	---	---	PASS
NCR2	9436	broad.mit.edu	37	6	41304003	41304003	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41304003G>C	uc003oqh.2	+	2	318	c.231G>C	c.(229-231)TGG>TGC	p.W77C	NCR2_uc003oqi.2_Missense_Mutation_p.W77C|NCR2_uc003oqj.2_Missense_Mutation_p.W77C	NM_004828	NP_004819	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	77	Extracellular (Potential).|Ig-like.				cellular defense response	integral to plasma membrane	transmembrane receptor activity			ovary(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					CGATGGCTTGGACCTCTCGAT	0.527													63	57	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43189468	43189468	+	Silent	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43189468C>G	uc003ouk.2	+	35	6873	c.6798C>G	c.(6796-6798)CTC>CTG	p.L2266L	CUL9_uc003oul.2_Silent_p.L2238L|CUL9_uc010jyk.2_Silent_p.L1418L|CUL9_uc003oun.2_Silent_p.L61L	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	2266					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						GGCGCTGCCTCAAGTCCTGGA	0.597													30	41	---	---	---	---	PASS
DOPEY1	23033	broad.mit.edu	37	6	83863335	83863335	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83863335C>G	uc003pjs.1	+	31	6495	c.6235C>G	c.(6235-6237)CAC>GAC	p.H2079D	DOPEY1_uc011dyy.1_Missense_Mutation_p.H2070D|DOPEY1_uc010kbl.1_Missense_Mutation_p.H2070D|DOPEY1_uc003pjt.2_RNA	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	2079					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CCTCAGAAATCACAGGTACTA	0.303													51	89	---	---	---	---	PASS
MOXD1	26002	broad.mit.edu	37	6	132693969	132693969	+	Silent	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132693969G>A	uc003qdf.2	-	3	678	c.579C>T	c.(577-579)GAC>GAT	p.D193D	MOXD1_uc003qde.2_Silent_p.D125D	NM_015529	NP_056344	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1 isoform 2	193	Lumenal (Potential).				catecholamine metabolic process	endoplasmic reticulum membrane|integral to membrane	copper ion binding|dopamine beta-monooxygenase activity			ovary(1)	1	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		AAACACTTACGTCCTGATTTA	0.383													97	125	---	---	---	---	PASS
TIAM2	26230	broad.mit.edu	37	6	155577835	155577835	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155577835C>T	uc003qqb.2	+	29	5959	c.4686C>T	c.(4684-4686)ATC>ATT	p.I1562I	TIAM2_uc003qqe.2_Silent_p.I1562I|TIAM2_uc010kjj.2_Silent_p.I1124I|TIAM2_uc003qqf.2_Silent_p.I938I|TIAM2_uc011efl.1_Silent_p.I906I|TIAM2_uc003qqg.2_Silent_p.I874I|TIAM2_uc003qqh.2_Silent_p.I487I|uc003qqi.1_RNA	NM_012454	NP_036586	Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1562					apoptosis|cellular lipid metabolic process|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|filopodium|growth cone|lamellipodium	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			ovary(3)|breast(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ACAATCTCATCAAAGAGAGTG	0.552													43	53	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169634881	169634881	+	Nonsense_Mutation	SNP	G	T	T	rs139787473		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169634881G>T	uc003qwt.2	-	11	1847	c.1599C>A	c.(1597-1599)TGC>TGA	p.C533*		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	533	TSP type-1 3.				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CATCCCCCACGCAGGCCTTCC	0.662													41	70	---	---	---	---	PASS
MDH2	4191	broad.mit.edu	37	7	75689711	75689711	+	Silent	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75689711C>A	uc003ueo.2	+	5	536	c.450C>A	c.(448-450)ATC>ATA	p.I150I	MDH2_uc003uep.2_Silent_p.I43I|MDH2_uc011kgh.1_Intron	NM_005918	NP_005909	P40926	MDHM_HUMAN	mitochondrial malate dehydrogenase precursor	150					gluconeogenesis|malate metabolic process|tricarboxylic acid cycle	mitochondrial matrix|nucleus|plasma membrane	binding|L-malate dehydrogenase activity			ovary(1)|central_nervous_system(1)|skin(1)	3					NADH(DB00157)	CCATCCCCATCACAGCAGAAG	0.527													40	63	---	---	---	---	PASS
CSGALNACT1	55790	broad.mit.edu	37	8	19362750	19362750	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19362750G>A	uc011kyn.1	-	4	1660	c.596C>T	c.(595-597)CCC>CTC	p.P199L	CSGALNACT1_uc011kyo.1_Missense_Mutation_p.P199L|CSGALNACT1_uc003wzg.2_RNA|CSGALNACT1_uc011kyp.1_Missense_Mutation_p.P198L|CSGALNACT1_uc003wzh.2_RNA	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate	199	Lumenal (Potential).				anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		ACGGTGATTGGGGCTGTTCTC	0.527													65	89	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68968100	68968100	+	Missense_Mutation	SNP	A	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68968100A>G	uc003xxv.1	+	10	1156	c.1129A>G	c.(1129-1131)ATG>GTG	p.M377V	PREX2_uc003xxu.1_Missense_Mutation_p.M377V|PREX2_uc011lez.1_Missense_Mutation_p.M312V	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	377					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TACCTGGGTCATGATCTCTGA	0.363													57	96	---	---	---	---	PASS
PARP10	84875	broad.mit.edu	37	8	145059449	145059449	+	Silent	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145059449G>A	uc003zal.3	-	5	829	c.721C>T	c.(721-723)CTG>TTG	p.L241L	PARP10_uc003zak.3_5'UTR|PARP10_uc011lku.1_Silent_p.L253L|PARP10_uc011lkv.1_RNA|PARP10_uc003zam.2_Silent_p.L241L|PARP10_uc010mfn.1_Silent_p.L156L|PARP10_uc010mfo.1_Silent_p.S133S	NM_032789	NP_116178	Q53GL7	PAR10_HUMAN	poly (ADP-ribose) polymerase family, member 10	241						Golgi apparatus|nucleolus	NAD+ ADP-ribosyltransferase activity|nucleotide binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|breast(1)|pancreas(1)	6	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			acaaggctcagctctgagccc	0.269													28	32	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20862683	20862683	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20862683C>A	uc003zog.1	+	18	2390	c.2027C>A	c.(2026-2028)TCC>TAC	p.S676Y	KIAA1797_uc003zoh.1_Missense_Mutation_p.S112Y	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	676						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CTAGTTCCTTCCTTAACGGTC	0.413													93	14	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20862693	20862693	+	Silent	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20862693C>A	uc003zog.1	+	18	2400	c.2037C>A	c.(2035-2037)GTC>GTA	p.V679V	KIAA1797_uc003zoh.1_Silent_p.V115V	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	679						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		CCTTAACGGTCAATACAACTG	0.398													86	14	---	---	---	---	PASS
RUSC2	9853	broad.mit.edu	37	9	35561252	35561252	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35561252G>A	uc003zww.2	+	12	4679	c.4424G>A	c.(4423-4425)CGA>CAA	p.R1475Q	RUSC2_uc010mkq.2_RNA|RUSC2_uc003zwx.3_Missense_Mutation_p.R1475Q	NM_014806	NP_055621	Q8N2Y8	RUSC2_HUMAN	RUN and SH3 domain containing 2	1475	SH3.					cytosol				ovary(1)	1			Lung(28;0.000837)|LUSC - Lung squamous cell carcinoma(32;0.00109)|STAD - Stomach adenocarcinoma(86;0.194)			GACATCCTACGAGTGCTGGGG	0.642													4	120	---	---	---	---	PASS
ANKRD20A3	441425	broad.mit.edu	37	9	42368547	42368547	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:42368547G>A	uc004acd.2	+	1	245	c.133G>A	c.(133-135)GAC>AAC	p.D45N	ANKRD20A3_uc010mmv.2_Missense_Mutation_p.D45N	NM_001012419	NP_001012419	Q5VUR7	A20A3_HUMAN	ankyrin repeat domain 20 family, member A3	45											0						TGTCAAAGGCGACGCCGCGGA	0.677													25	103	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114176211	114176211	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114176211C>T	uc004bfe.1	-	21	2577	c.2577G>A	c.(2575-2577)CTG>CTA	p.L859L	KIAA0368_uc010muc.1_Silent_p.L681L	NM_001080398	NP_001073867			KIAA0368 protein												0						ATTTGGTAGCCAGCTTTTCTG	0.323													6	13	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116356725	116356725	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116356725G>C	uc004bhq.2	+	23	3305	c.3096G>C	c.(3094-3096)AAG>AAC	p.K1032N	RGS3_uc004bhs.2_Missense_Mutation_p.K922N|RGS3_uc004bht.2_Missense_Mutation_p.K751N|RGS3_uc010muy.2_Missense_Mutation_p.K425N|RGS3_uc004bhv.2_Missense_Mutation_p.K353N|RGS3_uc004bhw.2_Missense_Mutation_p.K2N|RGS3_uc011lxh.1_Missense_Mutation_p.K342N|RGS3_uc004bhx.2_Missense_Mutation_p.K353N|RGS3_uc004bhz.2_Missense_Mutation_p.K374N|RGS3_uc004bia.2_Missense_Mutation_p.K145N	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	1032					inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						AGGACATGAAGAACAAGCTGG	0.592													66	71	---	---	---	---	PASS
SFMBT2	57713	broad.mit.edu	37	10	7409620	7409620	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:7409620G>A	uc009xio.1	-	4	518	c.427C>T	c.(427-429)CCG>TCG	p.P143S	SFMBT2_uc001ijn.1_Missense_Mutation_p.P143S|SFMBT2_uc010qay.1_Missense_Mutation_p.P143S|SFMBT2_uc001ijo.1_Missense_Mutation_p.P143S	NM_001029880	NP_001025051	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	143	MBT 1.				regulation of transcription, DNA-dependent	nucleus				ovary(4)|upper_aerodigestive_tract(2)|large_intestine(1)|central_nervous_system(1)	8						CCGTCCGGCGGCATCAACACC	0.572													4	82	---	---	---	---	PASS
ARHGAP22	58504	broad.mit.edu	37	10	49661458	49661458	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49661458C>T	uc001jgt.2	-	8	1174	c.877G>A	c.(877-879)GAA>AAA	p.E293K	ARHGAP22_uc001jgs.2_Missense_Mutation_p.E203K|ARHGAP22_uc001jgu.2_Missense_Mutation_p.E309K|ARHGAP22_uc010qgl.1_Missense_Mutation_p.E250K|ARHGAP22_uc010qgm.1_Missense_Mutation_p.E299K|ARHGAP22_uc001jgv.2_5'UTR|ARHGAP22_uc001jgr.2_5'Flank	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2	293	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						GCCTGAACTTCATCCAGAAAC	0.517													41	68	---	---	---	---	PASS
CSTF2T	23283	broad.mit.edu	37	10	53458869	53458869	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53458869C>T	uc001jjp.2	-	1	487	c.441G>A	c.(439-441)ATG>ATA	p.M147I	PRKG1_uc001jjm.2_Intron|PRKG1_uc001jjn.2_Intron|PRKG1_uc001jjo.2_Intron	NM_015235	NP_056050	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit	147					mRNA processing	nucleus	nucleotide binding|RNA binding			ovary(1)	1				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		CACAGAGCTTCATCTGCTTCA	0.498													111	164	---	---	---	---	PASS
OR10A3	26496	broad.mit.edu	37	11	7960244	7960244	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7960244G>A	uc010rbi.1	-	1	824	c.824C>T	c.(823-825)TCA>TTA	p.S275L		NM_001003745	NP_001003745	P58181	O10A3_HUMAN	olfactory receptor, family 10, subfamily A,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1				Epithelial(150;1.38e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GTAAGCCAATGAGATCAGTTT	0.443													74	74	---	---	---	---	PASS
ALX4	60529	broad.mit.edu	37	11	44289129	44289129	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44289129C>T	uc001myb.2	-	3	925	c.821G>A	c.(820-822)CGT>CAT	p.R274H		NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4	274					hair follicle development						0						CTGCCCAAAACGCTCCCGCTT	0.597													84	100	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70171633	70171633	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70171633G>C	uc001opo.2	+	5	757	c.559G>C	c.(559-561)GAA>CAA	p.E187Q	PPFIA1_uc001opn.1_Missense_Mutation_p.E187Q|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_5'Flank	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	187	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			AGTAGCACTTGAAAGATGTAG	0.368													61	81	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70172894	70172894	+	Missense_Mutation	SNP	G	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70172894G>T	uc001opo.2	+	7	1098	c.900G>T	c.(898-900)ATG>ATT	p.M300I	PPFIA1_uc001opn.1_Missense_Mutation_p.M300I|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	300	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CTGAAGAAATGAACACAAAAT	0.398													100	148	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106849404	106849404	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106849404G>C	uc001pjg.1	-	3	818	c.428C>G	c.(427-429)TCC>TGC	p.S143C	GUCY1A2_uc010rvo.1_Missense_Mutation_p.S143C|GUCY1A2_uc009yxn.1_Missense_Mutation_p.S143C	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	143					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		TTCTTTGTTGGAGTGGTCTGC	0.323													58	66	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	1017901	1017901	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1017901C>T	uc001qio.3	+	28	7599	c.7092C>T	c.(7090-7092)ATC>ATT	p.I2364I	WNK1_uc001qip.3_Silent_p.I2116I|WNK1_uc001qir.3_Silent_p.I1537I	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2364					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATTTCAACATCAGCAATTTGC	0.547													33	56	---	---	---	---	PASS
FAM90A1	55138	broad.mit.edu	37	12	8376647	8376647	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8376647C>T	uc001qui.2	-	5	847	c.288G>A	c.(286-288)TTG>TTA	p.L96L	FAM90A1_uc001quh.2_Silent_p.L96L	NM_018088	NP_060558	Q86YD7	F90A1_HUMAN	hypothetical protein LOC55138	96							nucleic acid binding|zinc ion binding			ovary(1)	1				Kidney(36;0.0866)		TATCCTTGTTCAAGGGCCCAG	0.542													148	159	---	---	---	---	PASS
STYK1	55359	broad.mit.edu	37	12	10772780	10772780	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10772780C>G	uc001qys.2	-	11	1753	c.1232G>C	c.(1231-1233)AGA>ACA	p.R411T		NM_018423	NP_060893	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	411						integral to membrane|plasma membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8						GCTCTCCACTCTGATGCCGGC	0.458										HNSCC(73;0.22)			200	250	---	---	---	---	PASS
KRAS	3845	broad.mit.edu	37	12	25378645	25378645	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:25378645C>G	uc001rgp.1	-	4	534	c.353G>C	c.(352-354)TGT>TCT	p.C118S	KRAS_uc001rgq.1_Missense_Mutation_p.C118S	NM_033360	NP_203524	P01116	RASK_HUMAN	c-K-ras2 protein isoform a precursor	118	GTP.				activation of MAPKK activity|axon guidance|blood coagulation|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|Ras protein signal transduction	plasma membrane	GTP binding|GTPase activity|protein binding			large_intestine(12391)|pancreas(3285)|lung(2847)|biliary_tract(521)|ovary(443)|endometrium(339)|haematopoietic_and_lymphoid_tissue(318)|stomach(203)|thyroid(149)|prostate(85)|soft_tissue(77)|small_intestine(62)|upper_aerodigestive_tract(59)|cervix(49)|urinary_tract(48)|skin(38)|liver(31)|breast(28)|testis(17)|oesophagus(15)|central_nervous_system(9)|peritoneum(6)|salivary_gland(6)|kidney(5)|gastrointestinal_tract_(site_indeterminate)(5)|thymus(5)|eye(4)|autonomic_ganglia(2)|bone(2)|genital_tract(1)|penis(1)|adrenal_gland(1)	21052	all_cancers(2;1e-35)|all_epithelial(2;1.97e-38)|all_lung(3;2.1e-23)|Lung NSC(3;1.16e-22)|Acute lymphoblastic leukemia(6;0.00231)|all_hematologic(7;0.00259)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;1.23e-21)|Epithelial(3;1.31e-20)|all cancers(3;5.45e-18)|STAD - Stomach adenocarcinoma(2;2.68e-05)			AGGCAAATCACATTTATTTCC	0.353		119	Mis		pancreatic|colorectal|lung|thyroid|AML|others				Cardiofaciocutaneous_syndrome|Noonan_syndrome	TSP Lung(1;<1E-08)|Multiple Myeloma(2;<1E-6)			103	109	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49427255	49427255	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49427255G>A	uc001rta.3	-	39	11233	c.11233C>T	c.(11233-11235)CAG>TAG	p.Q3745*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3745	Potential.|Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AGAAGGtgctgctgctgctgt	0.463			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			6	7	---	---	---	---	PASS
KCNH3	23416	broad.mit.edu	37	12	49951431	49951431	+	Nonsense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49951431C>T	uc001ruh.1	+	15	3207	c.2947C>T	c.(2947-2949)CAG>TAG	p.Q983*	KCNH3_uc010smj.1_Nonsense_Mutation_p.Q923*	NM_012284	NP_036416	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H	983	Pro-rich.|Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	two-component sensor activity|voltage-gated potassium channel activity				0						CCCAGCGTCTCAGAGCTCCCC	0.692													44	69	---	---	---	---	PASS
BBS10	79738	broad.mit.edu	37	12	76741254	76741254	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76741254C>G	uc001syd.1	-	2	595	c.511G>C	c.(511-513)GAG>CAG	p.E171Q		NM_024685	NP_078961	Q8TAM1	BBS10_HUMAN	Bardet-Biedl syndrome 10	171					cellular protein metabolic process|nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	cilium	ATP binding			ovary(1)|skin(1)	2						AAGAGCAACTCTAAAGAGCTC	0.353									Bardet-Biedl_syndrome				67	71	---	---	---	---	PASS
CCDC60	160777	broad.mit.edu	37	12	119909929	119909929	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:119909929G>A	uc001txe.2	+	3	766	c.301G>A	c.(301-303)GAA>AAA	p.E101K	uc001txf.2_Intron	NM_178499	NP_848594	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	101										ovary(2)|upper_aerodigestive_tract(1)	3	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		CCAGCCAGCCGAAAAGATCTC	0.423													180	244	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133324434	133324434	+	Missense_Mutation	SNP	T	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133324434T>G	uc001ukx.2	-	5	1281	c.1214A>C	c.(1213-1215)AAC>ACC	p.N405T	ANKLE2_uc001uky.3_Missense_Mutation_p.N343T	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	405						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		GTCGGGGGTGTTGAGGTACAG	0.498													52	73	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25049640	25049640	+	Silent	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25049640G>A	uc001upl.2	-	15	1990	c.1884C>T	c.(1882-1884)ATC>ATT	p.I628I	PARP4_uc010tdc.1_Silent_p.I628I	NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	628	VIT.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		TTCTCCCTTTGATGTGGACAT	0.463													98	152	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32944665	32944665	+	Missense_Mutation	SNP	G	A	A	rs80359095		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32944665G>A	uc001uub.1	+	19	8685	c.8458G>A	c.(8458-8460)GTA>ATA	p.V2820I		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	2820					cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTGTGTTGATGTAATTATTCA	0.328			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			72	106	---	---	---	---	PASS
KL	9365	broad.mit.edu	37	13	33590885	33590885	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33590885G>A	uc001uus.2	+	1	315	c.307G>A	c.(307-309)GAC>AAC	p.D103N	KL_uc001uur.1_Intron	NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor	103	Glycosyl hydrolase-1 1.|Extracellular (Potential).				aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		ACCCCCGGGAGACTCCCGGAA	0.711													20	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22946686	22946686	+	Intron	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22946686C>T	uc001wbw.2	+						uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc001wdf.2_Intron|uc010ajk.1_Intron|uc001wdg.1_Intron|uc010ajl.1_Intron|uc001wdj.2_Intron|uc010ajo.1_Intron|uc010ajp.1_Intron|uc001wds.1_Intron|uc001wdv.3_Intron|uc001wec.2_Intron|uc001wed.1_RNA|uc001wee.3_5'Flank|uc010tmt.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		CAAAGCCCCTCAGCACAGTGT	0.468													17	16	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75287820	75287820	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75287820G>C	uc001xqj.3	+	17	6215	c.6091G>C	c.(6091-6093)GAG>CAG	p.E2031Q	YLPM1_uc001xql.3_RNA|YLPM1_uc001xqm.1_Missense_Mutation_p.E514Q	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	1836					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GAAAGATGCAGAGGAAGAGGA	0.333													4	4	---	---	---	---	PASS
MIR329-2	574409	broad.mit.edu	37	14	101493428	101493428	+	5'Flank	SNP	T	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101493428T>G	hsa-mir-329-2|MI0001726	+						MIR494_hsa-mir-494|MI0003134_5'Flank|uc010txm.1_5'Flank|hsa-mir-1193|MI0014205_5'Flank																	0						TTCTTGTCAGTGTTACTTGGT	0.433													84	104	---	---	---	---	PASS
ZNF839	55778	broad.mit.edu	37	14	102792953	102792953	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102792953C>T	uc001ylo.2	+	2	922	c.572C>T	c.(571-573)TCC>TTC	p.S191F	ZNF839_uc010awk.1_Missense_Mutation_p.S307F|ZNF839_uc001ylp.2_RNA|ZNF839_uc001ylq.1_Missense_Mutation_p.S191F|ZNF839_uc001ylr.2_Missense_Mutation_p.S191F	NM_018335	NP_060805	A8K0R7	ZN839_HUMAN	zinc finger protein 839	191						intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)	2						TCGAGCTGCTCCCTGAGGCCC	0.483													20	23	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105409053	105409053	+	Silent	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105409053C>G	uc010axc.1	-	7	12855	c.12735G>C	c.(12733-12735)CTG>CTC	p.L4245L	AHNAK2_uc001ypx.2_Silent_p.L4145L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4245						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGGCCTTTCAGGTCCAGCT	0.637													157	186	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105409191	105409191	+	Silent	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105409191C>T	uc010axc.1	-	7	12717	c.12597G>A	c.(12595-12597)GTG>GTA	p.V4199V	AHNAK2_uc001ypx.2_Silent_p.V4099V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4199						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CCGGGAGTTTCACGTCCACTT	0.642													118	181	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106757880	106757880	+	RNA	SNP	C	T	T	rs146488407	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106757880C>T	uc010tyt.1	-	472		c.16185G>A								Parts of antibodies, mostly variable regions.												0						AACCCAGAGACGGTGCAGGTC	0.552													47	64	---	---	---	---	PASS
CD276	80381	broad.mit.edu	37	15	73994714	73994714	+	Missense_Mutation	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73994714C>G	uc002avv.1	+	3	432	c.198C>G	c.(196-198)ATC>ATG	p.I66M	CD276_uc010bjd.1_Translation_Start_Site|CD276_uc002avu.1_Missense_Mutation_p.I66M|CD276_uc002avw.1_Missense_Mutation_p.I66M|CD276_uc010ulb.1_Intron|CD276_uc002avx.2_5'Flank	NM_001024736	NP_001019907	Q5ZPR3	CD276_HUMAN	CD276 antigen isoform a	66	Ig-like V-type 1.|Extracellular (Potential).				cell proliferation|immune response|positive regulation of interferon-gamma biosynthetic process|positive regulation of T cell proliferation|regulation of immune response|T cell activation	external side of plasma membrane|integral to membrane	receptor binding			skin(1)	1						TCAACCTCATCTGGCAGCTGA	0.637													39	36	---	---	---	---	PASS
CREBBP	1387	broad.mit.edu	37	16	3788618	3788618	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3788618G>A	uc002cvv.2	-	26	4540	c.4336C>T	c.(4336-4338)CGC>TGC	p.R1446C	CREBBP_uc002cvw.2_Missense_Mutation_p.R1408C	NM_004380	NP_004371	Q92793	CBP_HUMAN	CREB binding protein isoform a	1446	Cys/His-rich.				cellular lipid metabolic process|homeostatic process|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|protein complex assembly|response to hypoxia	cytoplasm|nuclear body	histone acetyltransferase activity|MyoD binding|p53 binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity|zinc ion binding	p.R1446H(3)|p.R1446L(2)|p.R1446C(2)		haematopoietic_and_lymphoid_tissue(97)|ovary(14)|lung(6)|skin(6)|breast(2)|NS(1)|pancreas(1)	127		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		ACGGCTGTGCGGAGGCAACGT	0.413			T|N|F|Mis|O	MLL|MORF|RUNXBP2	ALL|AML|DLBCL|B-NHL 		Rubinstein-Taybi syndrome		Rubinstein-Taybi_syndrome				32	28	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58593842	58593842	+	Intron	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58593842C>G	uc002env.2	-						CNOT1_uc002enw.2_Intron|CNOT1_uc002enu.3_Intron|CNOT1_uc002enx.2_Intron|CNOT1_uc002enz.1_Intron|SNORA50_uc002eoa.1_5'Flank	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCTTATGTCTCAAGAGTCTAC	0.373													49	74	---	---	---	---	PASS
TSNAXIP1	55815	broad.mit.edu	37	16	67858617	67858617	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67858617G>C	uc002euj.2	+	6	845	c.451G>C	c.(451-453)GAG>CAG	p.E151Q	TSNAXIP1_uc010cep.2_Missense_Mutation_p.E15Q|TSNAXIP1_uc010vjz.1_Intron|TSNAXIP1_uc002euf.3_Intron|TSNAXIP1_uc010vka.1_Missense_Mutation_p.E205Q|TSNAXIP1_uc010vkb.1_Missense_Mutation_p.E136Q|TSNAXIP1_uc002eug.3_5'UTR|TSNAXIP1_uc002euh.3_5'UTR|TSNAXIP1_uc002eui.3_Intron|TSNAXIP1_uc002euk.2_5'UTR	NM_018430	NP_060900	Q2TAA8	TXIP1_HUMAN	translin-associated factor X interacting protein	151	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	perinuclear region of cytoplasm					0		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00432)|Epithelial(162;0.0192)|all cancers(182;0.125)		GCTCAAGAAAGAGAAGATGAA	0.468													36	53	---	---	---	---	PASS
KIAA0753	9851	broad.mit.edu	37	17	6483097	6483097	+	Silent	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6483097G>A	uc002gde.3	-	19	3233	c.2874C>T	c.(2872-2874)TTC>TTT	p.F958F	KIAA0753_uc010vtd.1_Silent_p.F414F|KIAA0753_uc010clo.2_Silent_p.F659F|KIAA0753_uc010vte.1_Silent_p.F659F	NM_014804	NP_055619	Q2KHM9	K0753_HUMAN	hypothetical protein LOC9851	958						centrosome					0				COAD - Colon adenocarcinoma(228;0.157)		ATTCTGAGGTGAACACAGCTT	0.498													108	112	---	---	---	---	PASS
SHBG	6462	broad.mit.edu	37	17	7534110	7534110	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7534110G>C	uc002gie.2	+	3	354	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	SHBG_uc010cmo.2_Missense_Mutation_p.E48Q|SHBG_uc010cmp.2_Missense_Mutation_p.E48Q|SHBG_uc010cmq.2_Missense_Mutation_p.E48Q|SHBG_uc010cmr.2_Missense_Mutation_p.E48Q|SHBG_uc010cms.2_Missense_Mutation_p.E48Q|SHBG_uc010cmt.2_Missense_Mutation_p.E48Q|SHBG_uc010cmu.2_Missense_Mutation_p.E48Q|SAT2_uc002gib.1_5'Flank|SAT2_uc002gic.2_5'Flank|SHBG_uc010cmz.2_Missense_Mutation_p.E48Q|SHBG_uc010cmv.2_Missense_Mutation_p.E48Q|SHBG_uc010cmw.2_Missense_Mutation_p.E48Q|SHBG_uc010cmx.2_Missense_Mutation_p.E48Q|SHBG_uc010cmy.2_Missense_Mutation_p.E48Q|SHBG_uc002gid.3_Missense_Mutation_p.E48Q|SHBG_uc010cnd.2_Missense_Mutation_p.E106Q|SHBG_uc010cna.2_Missense_Mutation_p.E106Q|SHBG_uc010vue.1_Missense_Mutation_p.E106Q|SHBG_uc010vuf.1_Missense_Mutation_p.E106Q|SHBG_uc010cnb.2_Missense_Mutation_p.E106Q|SHBG_uc010cnc.2_Missense_Mutation_p.E106Q	NM_001040	NP_001031	P04278	SHBG_HUMAN	sex hormone-binding globulin isoform 1	106	Laminin G-like 1.				hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)	CGGCAGGCCTGAGATCCAACT	0.557													75	61	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11597320	11597320	+	Intron	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11597320G>A	uc002gne.2	+						DNAH9_uc010coo.2_Intron	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2						cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		GGGCAGGTGAGGGTCCGCCCA	0.483													88	127	---	---	---	---	PASS
PIGL	9487	broad.mit.edu	37	17	16120682	16120682	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16120682G>C	uc002gpv.2	+	1	174	c.142G>C	c.(142-144)GCG>CCG	p.A48P	NCOR1_uc002gpo.2_5'Flank|PIGL_uc010vwd.1_Missense_Mutation_p.A48P|NCOR1_uc002gps.1_5'Flank|NCOR1_uc010coz.1_5'Flank|NCOR1_uc010cpb.1_5'Flank|NCOR1_uc010cpa.1_5'Flank|NCOR1_uc002gpu.2_5'Flank	NM_004278	NP_004269	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis,	48	Cytoplasmic (Potential).				C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	N-acetylglucosaminylphosphatidylinositol deacetylase activity				0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		GCTGGTCATAGCGCACCCTGA	0.597													59	78	---	---	---	---	PASS
RAD51L3	5892	broad.mit.edu	37	17	33434099	33434099	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33434099G>C	uc002hir.2	-	5	644	c.388C>G	c.(388-390)CAA>GAA	p.Q130E	RFFL_uc002hiq.2_Intron|RAD51L3_uc010ctj.2_5'Flank|RAD51L3_uc010wcd.1_Missense_Mutation_p.Q150E|RAD51L3_uc002his.2_Intron|RAD51L3_uc010ctk.2_Missense_Mutation_p.Q11E|RAD51L3_uc010wce.1_Missense_Mutation_p.Q11E|RAD51L3_uc002hit.2_Missense_Mutation_p.Q11E|RAD51L3_uc002hiu.2_Intron|RAD51L3_uc010wcf.1_RNA|RAD51L3_uc002hiw.1_RNA|RAD51L3_uc002hiv.1_Intron|RAD51L3_uc010ctl.1_Intron|RAD51L3_uc010ctm.1_Intron	NM_002878	NP_002869	O75771	RA51D_HUMAN	RAD51-like 3 isoform 1	130					DNA repair|reciprocal meiotic recombination	nucleus	ATP binding|DNA binding|DNA-dependent ATPase activity|protein binding				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		AGGACGTTTTGCTGCAGGCCA	0.552								Direct_reversal_of_damage|Homologous_recombination					76	95	---	---	---	---	PASS
CCL16	6360	broad.mit.edu	37	17	34305249	34305249	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34305249C>T	uc002hkl.2	-	2	194	c.127G>A	c.(127-129)GAG>AAG	p.E43K	CCL16_uc002hkm.2_RNA	NM_004590	NP_004581	O15467	CCL16_HUMAN	small inducible cytokine A16 precursor	43					cell-cell signaling|immune response|inflammatory response	extracellular space	chemoattractant activity|chemokine activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		AACACTTTCTCATAATACTTC	0.502													162	227	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74620297	74620297	+	Silent	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74620297C>G	uc002lmi.2	+	14	2511	c.2313C>G	c.(2311-2313)CTC>CTG	p.L771L	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	771					cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CCCAGCAGCTCCAACAGCATC	0.493													87	168	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1470100	1470100	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1470100C>T	uc002lsr.1	+	15	7008	c.6800C>T	c.(6799-6801)TCG>TTG	p.S2267L	APC2_uc002lss.1_Missense_Mutation_p.S1849L|APC2_uc002lst.1_Missense_Mutation_p.S2267L|APC2_uc002lsu.1_Missense_Mutation_p.S2266L|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	2267					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCAGCCGCTCGGCCCGAGTA	0.736													4	12	---	---	---	---	PASS
PLIN3	10226	broad.mit.edu	37	19	4839538	4839538	+	Missense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4839538G>A	uc002mbj.2	-	8	1148	c.971C>T	c.(970-972)TCC>TTC	p.S324F	PLIN3_uc002mbk.2_Missense_Mutation_p.S312F|PLIN3_uc002mbl.3_Missense_Mutation_p.S323F	NM_005817	NP_005808	O60664	PLIN3_HUMAN	mannose 6 phosphate receptor binding protein 1	324					vesicle-mediated transport	endosome membrane|Golgi apparatus|lipid particle	protein binding				0					Galsulfase(DB01279)|Idursulfase(DB01271)	GAGCGCCCGGGACTCGACCTG	0.597													25	13	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9069097	9069097	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9069097C>A	uc002mkp.2	-	3	18553	c.18349G>T	c.(18349-18351)GAT>TAT	p.D6117Y		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	6119	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						AATGTAGGATCATAGTAGGTG	0.493													22	37	---	---	---	---	PASS
CSNK2A1	1457	broad.mit.edu	37	20	472947	472947	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:472947C>T	uc002wdw.1	-	9	965	c.572G>A	c.(571-573)CGA>CAA	p.R191Q	CSNK2A1_uc002wdx.1_Missense_Mutation_p.R191Q|CSNK2A1_uc002wdy.1_Missense_Mutation_p.R55Q	NM_177559	NP_808227	P68400	CSK21_HUMAN	casein kinase II alpha 1 subunit isoform a	191	Protein kinase.				axon guidance|Wnt receptor signaling pathway	cytosol|NuRD complex|plasma membrane|Sin3 complex	ATP binding|protein N-terminus binding|protein serine/threonine kinase activity			ovary(1)	1		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			GGAAGCAACTCGGACATTATA	0.413													4	47	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1902369	1902369	+	Intron	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1902369C>T	uc002wfq.2	+						SIRPA_uc010zps.1_Intron|SIRPA_uc002wfr.2_Intron|SIRPA_uc002wfs.2_Intron|SIRPA_uc002wft.2_Intron	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor						blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GTAGAAGACCCTCACCCAGCC	0.607													58	15	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42744725	42744725	+	Silent	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42744725C>A	uc002xli.1	-	4	2463	c.1590G>T	c.(1588-1590)GCG>GCT	p.A530A		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	530	Pro-rich.|Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TGCGGCGGCCCGCGCCCTCGG	0.761													5	2	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60908748	60908748	+	Nonsense_Mutation	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60908748G>A	uc002ycq.2	-	24	2960	c.2893C>T	c.(2893-2895)CAG>TAG	p.Q965*		NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor	965	Domain IV 1 (domain IV B).				angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCCACGGGCTGACTCTGTGCT	0.692													4	1	---	---	---	---	PASS
CHRNA4	1137	broad.mit.edu	37	20	61982391	61982391	+	Intron	SNP	G	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61982391G>T	uc002yes.2	-						CHRNA4_uc002yet.1_Intron|CHRNA4_uc011aaw.1_Intron|CHRNA4_uc010gke.1_Intron|CHRNA4_uc002yev.1_Intron|CHRNA4_uc010gkf.1_Intron	NM_000744	NP_000735	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 subunit						B cell activation|behavioral response to nicotine|calcium ion transport|cognition|DNA repair|membrane depolarization|regulation of action potential|regulation of dopamine secretion|regulation of inhibitory postsynaptic membrane potential|response to hypoxia|response to oxidative stress|sensory perception of pain|synaptic transmission, cholinergic	cell junction|dendrite|external side of plasma membrane|membrane fraction|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(1)|skin(1)	2	all_cancers(38;1.71e-10)				Nicotine(DB00184)|Varenicline(DB01273)	TGGGCAGGAAGAGAGCGAAGG	0.378													34	30	---	---	---	---	PASS
MCM3AP	8888	broad.mit.edu	37	21	47666692	47666692	+	Missense_Mutation	SNP	C	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47666692C>T	uc002zir.1	-	21	4435	c.4399G>A	c.(4399-4401)GAG>AAG	p.E1467K	MCM3APAS_uc002zim.2_Intron|MCM3APAS_uc002zin.2_Intron|MCM3AP_uc002zio.1_5'UTR|MCM3AP_uc002zip.1_Missense_Mutation_p.E208K|MCM3AP_uc002ziq.1_Missense_Mutation_p.E394K|MCM3APAS_uc002zis.1_Intron	NM_003906	NP_003897	O60318	MCM3A_HUMAN	minichromosome maintenance complex component 3	1467					DNA replication|protein import into nucleus	cytosol|nucleus	DNA binding|nucleotide binding			large_intestine(2)|lung(1)|ovary(1)|skin(1)	5	Breast(49;0.112)					GCCATGTCCTCACTCTTCATT	0.602													140	214	---	---	---	---	PASS
GPM6B	2824	broad.mit.edu	37	X	13792652	13792652	+	3'UTR	SNP	C	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13792652C>G	uc004cvz.2	-	7					GPM6B_uc004cvx.2_Intron|GPM6B_uc011min.1_3'UTR|GPM6B_uc004cwa.2_3'UTR|GPM6B_uc004cvw.2_Intron|GPM6B_uc011mim.1_Intron|GPM6B_uc004cvy.2_3'UTR	NM_005278	NP_005269	Q13491	GPM6B_HUMAN	glycoprotein M6B isoform 3						cell differentiation|nervous system development	integral to membrane					0						CTCTAAAACTCCTTATGCAAT	0.368													84	7	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53581603	53581603	+	Missense_Mutation	SNP	G	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53581603G>C	uc004dsp.2	-	61	8887	c.8485C>G	c.(8485-8487)CCC>GCC	p.P2829A	HUWE1_uc004dsn.2_Missense_Mutation_p.P1653A	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2829					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CTTATAGTGGGAGCTGGGGAT	0.458													41	2	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100494030	100494030	+	Missense_Mutation	SNP	C	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100494030C>A	uc004egz.2	+	6	868	c.499C>A	c.(499-501)CAG>AAG	p.Q167K	DRP2_uc011mrh.1_Missense_Mutation_p.Q89K	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	167	Spectrin 1.				central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						GGAGTCAGCTCAGGCCTTCCT	0.473													130	12	---	---	---	---	PASS
L1CAM	3897	broad.mit.edu	37	X	153152490	153152490	+	5'Flank	SNP	G	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153152490G>A	uc004fje.1	-									P32004	L1CAM_HUMAN	Homo sapiens L1CAM mRNA for L1 cell adhesion molecule, partial cds.						axon guidance|blood coagulation|cell death|leukocyte migration	integral to membrane				ovary(8)|central_nervous_system(1)	9	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACCTCACAGGCGAGGAAGCA	0.632													14	0	---	---	---	---	PASS
ARID1A	8289	broad.mit.edu	37	1	27056345	27056346	+	Frame_Shift_Ins	INS	-	AC	AC			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27056345_27056346insAC	uc001bmv.1	+	2	1714_1715	c.1341_1342insAC	c.(1339-1344)TATACAfs	p.Y447fs	ARID1A_uc001bmt.1_Frame_Shift_Ins_p.Y447fs|ARID1A_uc001bmu.1_Frame_Shift_Ins_p.Y447fs|ARID1A_uc001bmw.1_Frame_Shift_Ins_p.Y64fs	NM_006015	NP_006006	O14497	ARI1A_HUMAN	AT rich interactive domain 1A isoform a	447_448					androgen receptor signaling pathway|chromatin-mediated maintenance of transcription|estrogen receptor signaling pathway|glucocorticoid receptor signaling pathway|nervous system development|nucleosome mobilization|transcription, DNA-dependent	nBAF complex|npBAF complex|SWI/SNF complex	DNA binding|protein binding	p.Y447*(1)		ovary(124)|pancreas(5)|central_nervous_system(3)|endometrium(3)|kidney(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	142		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCTCTCTTATACACAGCAGGT	0.554			Mis|N|F|S|D		clear cell ovarian carcinoma|RCC								66	38	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	48209043	48209044	+	IGR	INS	-	GGA	GGA	rs143555360	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:48209043_48209044insGGA								FOXD2 (302681 upstream) : SKINTL (358343 downstream)																							gtggtggtggtagtggtggtgg	0.000													6	3	---	---	---	---	
CTBS	1486	broad.mit.edu	37	1	85040032	85040033	+	Frame_Shift_Ins	INS	-	CA	CA	rs150466708	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85040032_85040033insCA	uc001dka.2	-	1	131_132	c.66_67insTG	c.(64-69)CTAGCGfs	p.L22fs	CTBS_uc001dkc.2_Translation_Start_Site|CTBS_uc001dkd.2_Translation_Start_Site|CTBS_uc001dkb.2_Translation_Start_Site	NM_004388	NP_004379	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl- precursor	22_23						lysosome	cation binding				0				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		gccagcagcgcTAGACCCGGGA	0.599													6	5	---	---	---	---	
SNX7	51375	broad.mit.edu	37	1	99156895	99156895	+	Intron	DEL	T	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99156895delT	uc010ouc.1	+						SNX7_uc001dsa.2_Intron|SNX7_uc010oud.1_Intron	NM_015976	NP_057060	Q9UNH6	SNX7_HUMAN	sorting nexin 7 isoform a						cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		TCAATGTACATTTTTTTTTTA	0.219													4	3	---	---	---	---	
LYPLAL1	127018	broad.mit.edu	37	1	219352736	219352742	+	Intron	DEL	TTGCAGT	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:219352736_219352742delTTGCAGT	uc001hlq.3	+						LYPLAL1_uc001hlr.3_Intron|LYPLAL1_uc001hls.3_Splice_Site|LYPLAL1_uc001hlt.3_Intron|LYPLAL1_uc009xds.2_Intron	NM_138794	NP_620149	Q5VWZ2	LYPL1_HUMAN	lysophospholipase-like 1							cytoplasm	lysophospholipase activity				0				GBM - Glioblastoma multiforme(131;0.055)|all cancers(67;0.105)|OV - Ovarian serous cystadenocarcinoma(81;0.116)		GTATTCTTTATTGCAGTTACACTGTTG	0.348													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242084480	242084480	+	IGR	DEL	C	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242084480delC								EXO1 (31433 upstream) : MAP1LC3C (74312 downstream)																							aagactctgtcagaaagaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139569394	139569405	+	IGR	DEL	CCTCCCTCCCTC	-	-	rs10201237		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139569394_139569405delCCTCCCTCCCTC								NXPH2 (31583 upstream) : None (None downstream)																							ttccttccttcctccctccctcccttccttcc	0.000													3	4	---	---	---	---	
TEX264	51368	broad.mit.edu	37	3	51728004	51728015	+	Intron	DEL	TTCCTTCCTTCC	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51728004_51728015delTTCCTTCCTTCC	uc010hls.2	+						TEX264_uc003dbk.3_Intron|TEX264_uc010hlt.2_Intron|TEX264_uc003dbl.3_Intron|TEX264_uc003dbm.3_Intron	NM_001129884	NP_001123356	Q9Y6I9	TX264_HUMAN	testis expressed 264 precursor							extracellular region					0				BRCA - Breast invasive adenocarcinoma(193;8.53e-05)|Kidney(197;0.000594)|KIRC - Kidney renal clear cell carcinoma(197;0.000759)		ATCCCTttctttccttccttccttccttcctt	0.156													9	4	---	---	---	---	
POLQ	10721	broad.mit.edu	37	3	121238522	121238523	+	Intron	INS	-	A	A	rs80321773		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121238522_121238523insA	uc003eee.3	-							NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta						DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		gactccgtctcaaaaaaaaaaa	0.099								DNA_polymerases_(catalytic_subunits)					6	3	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196795255	196795255	+	Intron	DEL	A	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196795255delA	uc003fxo.3	-						DLG1_uc011bub.1_Intron|DLG1_uc011buc.1_Intron|DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		TTTCCACACCAAAAAAAAAAT	0.308													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	30195260	30195261	+	IGR	DEL	TC	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:30195260_30195261delTC								None (None upstream) : PCDH7 (526776 downstream)																							cctccctttttctttccttcct	0.059													4	2	---	---	---	---	
WDFY3	23001	broad.mit.edu	37	4	85611498	85611499	+	Intron	INS	-	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85611498_85611499insT	uc003hpd.2	-							NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform							cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TTCTGATTTCCTTTTTTTTTCA	0.312													5	5	---	---	---	---	
EMCN	51705	broad.mit.edu	37	4	101337248	101337249	+	Intron	INS	-	AT	AT	rs144411699	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101337248_101337249insAT	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		tatatatatacgtgtgtgtgtg	0.193													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	71965936	71965939	+	IGR	DEL	GAAG	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:71965936_71965939delGAAG								ZNF366 (162687 upstream) : TNPO1 (146479 downstream)																							aggaaggaacgaaggaaggaagga	0.152													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165976	180165977	+	IGR	INS	-	C	C	rs150261063	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165976_180165977insC								FLT4 (89352 upstream) : OR2Y1 (146 downstream)																							gaaactctgttccccccgccac	0.178													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15125403	15125404	+	IGR	INS	-	AGGA	AGGA	rs60774390		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15125403_15125404insAGGA								CD83 (988257 upstream) : JARID2 (120330 downstream)																							ggaaggaaggaagggaaagaaa	0.000													4	2	---	---	---	---	
LOC222699	222699	broad.mit.edu	37	6	28185336	28185337	+	RNA	INS	-	T	T	rs113483443		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28185336_28185337insT	uc011dla.1	-	1		c.1371_1372insA				NR_002936				Homo sapiens pp14762 mRNA, complete cds.												0						tccttttcctcttttttttttt	0.361													5	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51893317	51893318	+	Intron	INS	-	T	T	rs5876250		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51893317_51893318insT	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTAACAACTAttttttttttt	0.153													4	3	---	---	---	---	
PKHD1	5314	broad.mit.edu	37	6	51923570	51923573	+	Intron	DEL	TCTA	-	-	rs66624918		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51923570_51923573delTCTA	uc003pah.1	-						PKHD1_uc003pai.2_Intron	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1						cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TCTCCAGCTCtctatctatctatc	0.333													4	2	---	---	---	---	
FBXO9	26268	broad.mit.edu	37	6	52957766	52957766	+	Intron	DEL	A	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52957766delA	uc003pbo.2	+						FBXO9_uc003pbk.2_Intron|FBXO9_uc003pbl.2_Intron|FBXO9_uc003pbm.2_Intron|FBXO9_uc003pbn.2_Intron	NM_012347	NP_036479	Q9UK97	FBX9_HUMAN	F-box only protein 9 isoform 1							ubiquitin ligase complex	ubiquitin-protein ligase activity			pancreas(1)	1	Lung NSC(77;0.103)					GAATTGCACTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
PCMT1	5110	broad.mit.edu	37	6	150092137	150092137	+	Intron	DEL	A	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150092137delA	uc003qne.2	+						PCMT1_uc003qna.2_Intron|PCMT1_uc003qnb.2_Intron|PCMT1_uc011eeg.1_Intron|PCMT1_uc003qnc.2_Intron|PCMT1_uc003qnd.2_Intron|PCMT1_uc003qnf.2_Intron	NM_005389	NP_005380			protein-L-isoaspartate (D-aspartate)											ovary(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.221)	OV - Ovarian serous cystadenocarcinoma(155;5.63e-13)|GBM - Glioblastoma multiforme(68;0.207)		tctgtctcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155028499	155028501	+	IGR	DEL	AAA	-	-	rs147940473		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155028499_155028501delAAA								CNKSR3 (196746 upstream) : RBM16 (26011 downstream)																							gactccatctaaaaaaaaaaaaa	0.172													4	2	---	---	---	---	
CASP2	835	broad.mit.edu	37	7	143000715	143000716	+	Intron	DEL	TT	-	-	rs111737095		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143000715_143000716delTT	uc003wco.2	+						CASP2_uc003wcp.2_Intron|CASP2_uc011kta.1_Intron|CASP2_uc003wcq.2_Intron|CASP2_uc011ktb.1_Intron	NM_032982	NP_116764	P42575	CASP2_HUMAN	caspase 2 isoform 1 preproprotein						apoptosis|cellular response to mechanical stimulus|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|protein maturation by peptide bond cleavage	cytosol	cysteine-type endopeptidase activity|enzyme binding|protein binding|protein domain specific binding			lung(2)|ovary(1)	3	Melanoma(164;0.059)					AGAGtaataatttttttttttt	0.475													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	151875059	151875060	+	Frame_Shift_Ins	INS	-	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151875059_151875060insT	uc003wla.2	-	38	7697_7698	c.7478_7479insA	c.(7477-7479)CCGfs	p.P2493fs	MLL3_uc003wkz.2_Frame_Shift_Ins_p.P1554fs|MLL3_uc003wky.2_Frame_Shift_Ins_p.P2fs	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	2493	Pro-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		GCTCTTGACTCGGCATGGTACC	0.361			N		medulloblastoma								122	87	---	---	---	---	
KIAA1797	54914	broad.mit.edu	37	9	20862670	20862671	+	Frame_Shift_Del	DEL	TC	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20862670_20862671delTC	uc003zog.1	+	18	2377_2378	c.2014_2015delTC	c.(2014-2016)TCTfs	p.S672fs	KIAA1797_uc003zoh.1_Frame_Shift_Del_p.S108fs	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	672						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		TGAACTATTTTCTCTAGTTCCT	0.421													54	116	---	---	---	---	
SNAPC4	6621	broad.mit.edu	37	9	139282720	139282720	+	Intron	DEL	A	-	-	rs72059229		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139282720delA	uc004chh.2	-							NM_003086	NP_003077	Q5SXM2	SNPC4_HUMAN	small nuclear RNA activating complex,						snRNA transcription from RNA polymerase II promoter|snRNA transcription from RNA polymerase III promoter	snRNA-activating protein complex	DNA binding|sequence-specific DNA binding transcription factor activity				0		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.31e-06)|Epithelial(140;7.13e-06)		actccatctcaaaaaaaaaaa	0.204													4	2	---	---	---	---	
PARD3	56288	broad.mit.edu	37	10	34964520	34964520	+	Intron	DEL	T	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:34964520delT	uc010qej.1	-						PARD3_uc010qek.1_Intron|PARD3_uc010qel.1_Intron|PARD3_uc010qem.1_Intron|PARD3_uc010qen.1_Intron|PARD3_uc010qeo.1_Intron|PARD3_uc010qep.1_Intron|PARD3_uc010qeq.1_Intron|PARD3_uc001ixq.1_Intron|PARD3_uc001ixr.1_Intron|PARD3_uc001ixu.1_Intron	NM_019619	NP_062565	Q8TEW0	PARD3_HUMAN	partitioning-defective protein 3 homolog						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|asymmetric cell division|axonogenesis|cell cycle|establishment of epithelial cell polarity|protein complex assembly|protein targeting to membrane|tight junction assembly	cell cortex|cytoskeleton|cytosol|endomembrane system|tight junction	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3-phosphate binding|phosphatidylinositol-4,5-bisphosphate binding|protein binding			ovary(1)	1		Breast(68;0.0707)				ATACCCCAACTTTTTTTTTTT	0.333													4	3	---	---	---	---	
CNNM2	54805	broad.mit.edu	37	10	104814354	104814355	+	Intron	INS	-	T	T			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104814354_104814355insT	uc001kwm.2	+						CNNM2_uc001kwn.2_Intron	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1						ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TTTGtgttttgttttttttgtt	0.401													11	7	---	---	---	---	
SMC3	9126	broad.mit.edu	37	10	112328526	112328526	+	Intron	DEL	T	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112328526delT	uc001kze.2	+							NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3						cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TAAAAGTACCTTTTTTTTTTT	0.284													4	2	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14101781	14101782	+	Intron	INS	-	T	T	rs11432678		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14101781_14101782insT	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		TAttttttttcttttttttttt	0.163													4	3	---	---	---	---	
PDE2A	5138	broad.mit.edu	37	11	72296159	72296160	+	Intron	DEL	TT	-	-	rs5792596		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72296159_72296160delTT	uc010rrc.1	-						PDE2A_uc001oso.2_Intron|PDE2A_uc010rra.1_Intron|PDE2A_uc001osn.2_Intron|PDE2A_uc010rrb.1_Intron|PDE2A_uc010rrd.1_Intron	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	AAGTGTTTTGTTTTTTTTTttt	0.282											OREG0021196	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	4	---	---	---	---	
ZNF259	8882	broad.mit.edu	37	11	116652729	116652729	+	Intron	DEL	A	-	-	rs76506005		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116652729delA	uc001ppp.2	-						ZNF259_uc009yzd.2_Intron|ZNF259_uc001ppq.2_Intron	NM_003904	NP_003895	O75312	ZPR1_HUMAN	zinc finger protein 259						cell proliferation|signal transduction	cytoplasm|nucleolus					0	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		ctctgtctccaaaaaaaaaaa	0.109													6	3	---	---	---	---	
EI24	9538	broad.mit.edu	37	11	125448376	125448377	+	Intron	DEL	CT	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125448376_125448377delCT	uc001qca.2	+						EI24_uc001qcb.2_Intron|EI24_uc010sbd.1_Intron|EI24_uc009zbl.2_Intron|EI24_uc001qcc.2_Intron|EI24_uc010sbe.1_Intron|EI24_uc010sbf.1_Intron	NM_004879	NP_004870	O14681	EI24_HUMAN	etoposide induced 2.4 isoform 1						apoptosis|autophagy|induction of apoptosis|negative regulation of cell growth	endoplasmic reticulum membrane|integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.64e-07)|OV - Ovarian serous cystadenocarcinoma(99;0.0975)		TTCGTTTTGGCttttttttttt	0.223													6	3	---	---	---	---	
TAOK3	51347	broad.mit.edu	37	12	118627387	118627388	+	Intron	INS	-	T	T	rs56162033		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118627387_118627388insT	uc001twx.2	-						TAOK3_uc001twv.2_Intron|TAOK3_uc001tww.2_Intron|TAOK3_uc001twy.3_Intron	NM_016281	NP_057365	Q9H2K8	TAOK3_HUMAN	TAO kinase 3						MAPKKK cascade|negative regulation of JNK cascade|positive regulation of JNK cascade|protein autophosphorylation	mitochondrion|plasma membrane	ATP binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					acacacaAAGGTTTTTTTTTTT	0.183													4	2	---	---	---	---	
KL	9365	broad.mit.edu	37	13	33637746	33637746	+	Intron	DEL	A	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33637746delA	uc001uus.2	+							NM_004795	NP_004786	Q9UEF7	KLOT_HUMAN	klotho precursor						aging|carbohydrate metabolic process|insulin receptor signaling pathway|positive regulation of bone mineralization	extracellular space|extracellular space|integral to membrane|integral to plasma membrane|membrane fraction|soluble fraction	beta-glucosidase activity|beta-glucuronidase activity|cation binding|fibroblast growth factor binding|hormone activity|signal transducer activity|vitamin D binding			large_intestine(1)|ovary(1)|skin(1)	3	all_epithelial(80;0.133)	Ovarian(182;1.78e-06)|Breast(139;4.08e-05)|Hepatocellular(188;0.00886)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;7.13e-230)|all cancers(112;1.33e-165)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-113)|Epithelial(112;3.79e-112)|Lung(94;8.52e-27)|LUSC - Lung squamous cell carcinoma(192;1.4e-13)|Kidney(163;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(186;5.63e-08)|BRCA - Breast invasive adenocarcinoma(63;1.41e-05)		catctctactaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	56014150	56014151	+	IGR	INS	-	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56014150_56014151insA								TBPL2 (106887 upstream) : C14orf33 (10539 downstream)																							aacactgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
BTBD7	55727	broad.mit.edu	37	14	93708432	93708433	+	3'UTR	INS	-	A	A	rs72253031		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93708432_93708433insA	uc001ybo.2	-	11					BTBD7_uc010aur.2_3'UTR|BTBD7_uc010two.1_3'UTR|BTBD7_uc001ybp.2_3'UTR	NM_001002860	NP_001002860	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7 isoform 1											pancreas(1)	1		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GATGCAACATTAAAAAAAAAAA	0.327													2	6	---	---	---	---	
HAUS2	55142	broad.mit.edu	37	15	42851430	42851430	+	Intron	DEL	C	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42851430delC	uc001zqe.2	+						HAUS2_uc010udi.1_Intron|HAUS2_uc001zqf.2_Intron	NM_018097	NP_060567	Q9NVX0	HAUS2_HUMAN	centrosomal protein 27kDa isoform 1						cell division|centrosome organization|G2/M transition of mitotic cell cycle|mitosis|spindle assembly	centrosome|cytosol|HAUS complex|microtubule|spindle					0						ctctggtgatccacctgcctc	0.095													18	20	---	---	---	---	
ITGB3	3690	broad.mit.edu	37	17	45377700	45377701	+	Intron	INS	-	GC	GC	rs113076632		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45377700_45377701insGC	uc002ilj.2	+						ITGB3_uc010wkr.1_Intron	NM_000212	NP_000203	P05106	ITB3_HUMAN	integrin beta chain, beta 3 precursor						activation of protein kinase activity|angiogenesis involved in wound healing|axon guidance|cell-matrix adhesion|integrin-mediated signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of lipid storage|negative regulation of lipid transport|negative regulation of lipoprotein metabolic process|negative regulation of low-density lipoprotein particle receptor biosynthetic process|negative regulation of macrophage derived foam cell differentiation|platelet activation|platelet degranulation|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|regulation of bone resorption|smooth muscle cell migration|tube development	alphav-beta3 integrin-vitronectin complex|integrin complex|platelet alpha granule membrane	cell adhesion molecule binding|identical protein binding|platelet-derived growth factor receptor binding|receptor activity|vascular endothelial growth factor receptor 2 binding			central_nervous_system(5)|large_intestine(1)	6					Abciximab(DB00054)|Tirofiban(DB00775)	TTGTCTTACAGGCGCGCGCGCG	0.525													4	3	---	---	---	---	
NUP85	79902	broad.mit.edu	37	17	73229481	73229486	+	Intron	DEL	TCTTTC	-	-	rs10567128		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73229481_73229486delTCTTTC	uc002jng.1	+						NUP85_uc010dgd.1_Intron|NUP85_uc010wrv.1_Intron|NUP85_uc002jnh.1_Intron	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			tttctctctttctttctctttctctt	0.146													3	5	---	---	---	---	
SMCHD1	23347	broad.mit.edu	37	18	2688481	2688483	+	In_Frame_Del	DEL	TCT	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2688481_2688483delTCT	uc002klm.3	+	6	917_919	c.728_730delTCT	c.(727-732)GTCTTC>GTC	p.F245del		NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible	245					chromosome organization		ATP binding				0						AAGCAAGCTGTCTTCTTTGTTGG	0.350													117	82	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	11610673	11610674	+	IGR	INS	-	C	C			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:11610673_11610674insC								FAM38B (908694 upstream) : GNAL (78462 downstream)																							AAGACTGAAGACaaaaaaaaaa	0.302													7	5	---	---	---	---	
C18orf16	147429	broad.mit.edu	37	18	24445878	24445878	+	Intron	DEL	T	-	-	rs68070007		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:24445878delT	uc002kwb.2	+						C18orf16_uc010xbm.1_Intron|AQP4_uc002kwa.2_5'Flank	NR_026908				Homo sapiens cDNA FLJ30507 fis, clone BRAWH2000554.												0						ATTTACTTAATTTTTTTTTTT	0.299													4	3	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013987	3013987	+	Intron	DEL	T	-	-	rs67060467		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013987delT	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		gtaaaatgtattttttttttt	0.124													2	4	---	---	---	---	
FAM187B	148109	broad.mit.edu	37	19	35719750	35719750	+	5'Flank	DEL	T	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719750delT	uc002nyk.1	-							NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B							integral to membrane				ovary(2)	2						ACTGtttttcttttttttttt	0.249													3	3	---	---	---	---	
SPTBN4	57731	broad.mit.edu	37	19	41076449	41076450	+	Frame_Shift_Ins	INS	-	A	A			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41076449_41076450insA	uc002ony.2	+	33	7220_7221	c.7134_7135insA	c.(7132-7137)CCCAAGfs	p.P2378fs	SPTBN4_uc002onz.2_Frame_Shift_Ins_p.P2378fs|SPTBN4_uc010egx.2_Frame_Shift_Ins_p.P1121fs	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform	2378_2379					actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			gggaccggcccaagccgcgacg	0.332													5	3	---	---	---	---	
LPIN3	64900	broad.mit.edu	37	20	39987761	39987763	+	3'UTR	DEL	TTC	-	-	rs75257468		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39987761_39987763delTTC	uc002xjx.2	+	20					LPIN3_uc010ggh.2_3'UTR|LPIN3_uc010zwf.1_RNA	NM_022896	NP_075047	Q9BQK8	LPIN3_HUMAN	lipin 3						fatty acid metabolic process	nucleus	phosphatidate phosphatase activity			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(115;0.000739)				CCTTGCAGGGTtctttttttttt	0.281													5	3	---	---	---	---	
GTPBP5	26164	broad.mit.edu	37	20	60775592	60775593	+	Intron	INS	-	AAAT	AAAT	rs146828134	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60775592_60775593insAAAT	uc002yce.3	+						GTPBP5_uc011aab.1_Intron|GTPBP5_uc011aac.1_Intron|GTPBP5_uc011aad.1_Intron|GTPBP5_uc011aae.1_Intron|GTPBP5_uc011aaf.1_Intron	NM_015666	NP_056481	Q9H4K7	GTPB5_HUMAN	GTP binding protein 5						ribosome biogenesis	mitochondrion	GTP binding|GTPase activity|magnesium ion binding				0	Breast(26;3.52e-09)		BRCA - Breast invasive adenocarcinoma(19;2.5e-08)			TCAGTTCAAGGCGTTCCTTGAA	0.540													11	5	---	---	---	---	
PKNOX1	5316	broad.mit.edu	37	21	44438157	44438158	+	Intron	INS	-	AAAA	AAAA	rs60175567		TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44438157_44438158insAAAA	uc002zcq.1	+						PKNOX1_uc002zcp.1_Intron|PKNOX1_uc011aex.1_Intron|PKNOX1_uc002zcr.2_3'UTR	NM_004571	NP_004562	P55347	PKNX1_HUMAN	PBX/knotted 1 homeobox 1								sequence-specific DNA binding			large_intestine(2)	2						cctgtctctacaaaaaaaaaaa	0.144													10	11	---	---	---	---	
SHANK3	85358	broad.mit.edu	37	22	51159932	51159933	+	Frame_Shift_Ins	INS	-	G	G			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51159932_51159933insG	uc003bne.1	+	22	3719_3720	c.3719_3720insG	c.(3718-3720)CTGfs	p.L1240fs	SHANK3_uc003bnf.1_Frame_Shift_Ins_p.L687fs|SHANK3_uc010hbg.1_Frame_Shift_Ins_p.L422fs	NM_001080420	NP_001073889	F2Z3L0	F2Z3L0_HUMAN	SH3 and multiple ankyrin repeat domains 3	1240										central_nervous_system(1)	1		all_cancers(38;3.75e-11)|all_epithelial(38;1.82e-09)|Breast(42;0.000448)|all_lung(38;0.000665)|Lung NSC(38;0.0104)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.22)		CCCAGCAGGCTGGGGGGGGCCG	0.718													4	2	---	---	---	---	
HUWE1	10075	broad.mit.edu	37	X	53652847	53652852	+	Intron	DEL	GCCGGT	-	-	rs11091285	by1000genomes	TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53652847_53652852delGCCGGT	uc004dsp.2	-							NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1						base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						cggggccggggccggtgccgggactg	0.199													1	29	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58879928	58879928	+	IGR	DEL	C	-	-			TCGA-21-1078-01	TCGA-21-1078-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58879928delC								None (None upstream) : None (None downstream)																							ttattccattcgagaccgtag	0.035													3	3	---	---	---	---	
