Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	1854051	1854051	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1854051A>T	uc001aik.2	-	10	1643	c.793T>A	c.(793-795)TGG>AGG	p.W265R	uc001ail.2_Missense_Mutation_p.W265R					RecName: Full=Uncharacterized protein C1orf222;																		GGTGGCACCCAGGAGATGCTG	0.637													15	59	---	---	---	---	PASS
ARHGEF16	27237	broad.mit.edu	37	1	3396367	3396367	+	Intron	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3396367C>G	uc001akg.3	+						ARHGEF16_uc001aki.2_Intron|ARHGEF16_uc001akj.2_Intron|ARHGEF16_uc010nzh.1_Intron	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16						activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TGGCCACTGCCCTATGCAGAC	0.672													26	70	---	---	---	---	PASS
CHD5	26038	broad.mit.edu	37	1	6169932	6169932	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6169932C>T	uc001amb.1	-	38	5601	c.5501G>A	c.(5500-5502)TGC>TAC	p.C1834Y	CHD5_uc001alz.1_Missense_Mutation_p.C691Y|CHD5_uc001ama.1_RNA	NM_015557	NP_056372	Q8TDI0	CHD5_HUMAN	chromodomain helicase DNA binding protein 5	1834					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|DNA binding|zinc ion binding			central_nervous_system(3)|breast(3)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)|skin(1)|pancreas(1)	12	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		CTCGGCGAGGCACTCCACTTC	0.657													10	118	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12309329	12309329	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12309329C>T	uc001atv.2	+	6	638	c.497C>T	c.(496-498)CCC>CTC	p.P166L	VPS13D_uc001atw.2_Missense_Mutation_p.P166L	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	166					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		GTCACCAATCCCTCCCATCCT	0.403													26	87	---	---	---	---	PASS
SPEN	23013	broad.mit.edu	37	1	16257530	16257530	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16257530G>C	uc001axk.1	+	11	4999	c.4795G>C	c.(4795-4797)GAA>CAA	p.E1599Q	SPEN_uc010obp.1_Missense_Mutation_p.E1558Q	NM_015001	NP_055816	Q96T58	MINT_HUMAN	spen homolog, transcriptional regulator	1599	Potential.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|Notch signaling pathway	nucleus	nucleotide binding|protein binding|RNA binding			ovary(6)|breast(3)|lung(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GAAAGAAAAAGAAAAAGACCA	0.418													8	153	---	---	---	---	PASS
C1orf89	79363	broad.mit.edu	37	1	16559053	16559053	+	Missense_Mutation	SNP	C	T	T	rs142028968	byFrequency	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16559053C>T	uc001ayd.2	-	4	901	c.479G>A	c.(478-480)CGC>CAC	p.R160H		NM_030907	NP_112169	Q9BU20	RSG1_HUMAN	hypothetical protein LOC79363	160	Small GTPase-like.				cellular protein localization|cilium assembly|exocytosis|protein transport|regulation of exocytosis|regulation of vesicle fusion|small GTPase mediated signal transduction	cilium|microtubule basal body	GTP binding	p.R160H(1)			0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.2e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)		ACCTGCTATGCGGGCCAGCTG	0.587													4	127	---	---	---	---	PASS
ZNF436	80818	broad.mit.edu	37	1	23689210	23689210	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23689210T>A	uc001bgt.2	-	3	1046	c.665A>T	c.(664-666)CAC>CTC	p.H222L	ZNF436_uc001bgu.2_Missense_Mutation_p.H222L	NM_030634	NP_085137	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	222	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		ATTACATTTGTGAGGCTTCTC	0.468													54	199	---	---	---	---	PASS
CSF3R	1441	broad.mit.edu	37	1	36941154	36941154	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36941154A>T	uc001caw.1	-	4	363	c.185T>A	c.(184-186)CTG>CAG	p.L62Q	CSF3R_uc001cav.1_Missense_Mutation_p.L62Q|CSF3R_uc001cax.1_Missense_Mutation_p.L62Q|CSF3R_uc001cay.1_Missense_Mutation_p.L62Q	NM_000760	NP_000751	Q99062	CSF3R_HUMAN	colony stimulating factor 3 receptor isoform a	62	Ig-like C2-type.|Extracellular (Potential).				cell adhesion|defense response	extracellular region|integral to plasma membrane	cytokine receptor activity			central_nervous_system(2)|ovary(1)	3		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)			Filgrastim(DB00099)|Pegfilgrastim(DB00019)	CAGTCTCCACAGAATCTGTGG	0.602													17	104	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39893115	39893115	+	Intron	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39893115A>G	uc010oiu.1	+						MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			CTTGTTCTATATATTTGTGTA	0.373													72	163	---	---	---	---	PASS
GPX7	2882	broad.mit.edu	37	1	53073986	53073986	+	Silent	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53073986A>T	uc001cue.2	+	3	492	c.453A>T	c.(451-453)CCA>CCT	p.P151P		NM_015696	NP_056511	Q96SL4	GPX7_HUMAN	glutathione peroxidase 7 precursor	151					response to oxidative stress	extracellular region	glutathione peroxidase activity				0					Glutathione(DB00143)	TAGTAGCCCCAGATGGAAAGG	0.557													50	113	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57349309	57349309	+	Silent	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57349309A>T	uc001cyo.2	+	6	942	c.810A>T	c.(808-810)TCA>TCT	p.S270S		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	270	MACPF.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						TATCCCACTCACAAGACACTT	0.408													28	85	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65858250	65858250	+	Silent	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65858250C>G	uc001dcd.1	+	12	1598	c.1434C>G	c.(1432-1434)GTC>GTG	p.V478V	DNAJC6_uc001dcc.1_Silent_p.V509V|DNAJC6_uc010opc.1_Silent_p.V465V|DNAJC6_uc001dce.1_Silent_p.V535V	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	478	Pro-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						CTCATGGAGTCAAGAAGCCCA	0.532													17	69	---	---	---	---	PASS
IFI44L	10964	broad.mit.edu	37	1	79102885	79102885	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79102885T>A	uc010oro.1	+	6	1224	c.1045T>A	c.(1045-1047)TGT>AGT	p.C349S	IFI44L_uc010orp.1_Missense_Mutation_p.C86S|IFI44L_uc010orq.1_Missense_Mutation_p.C86S	NM_006820	NP_006811	Q53G44	IF44L_HUMAN	interferon-induced protein 44-like	349						cytoplasm					0						AGTATTAAACTGTGGTGAGTC	0.224													21	65	---	---	---	---	PASS
IFI44	10561	broad.mit.edu	37	1	79120789	79120789	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79120789T>C	uc001dip.3	+	4	709	c.585T>C	c.(583-585)ATT>ATC	p.I195I	IFI44_uc010orr.1_Silent_p.I195I|IFI44_uc010ors.1_5'UTR	NM_006417	NP_006408	Q8TCB0	IFI44_HUMAN	interferon-induced, hepatitis C-associated	195					response to virus	cytoplasm				ovary(1)|central_nervous_system(1)	2						TGGGTCCAATTGGAGCTGGGA	0.468													28	218	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79392575	79392575	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79392575C>G	uc001diq.3	-	8	1235	c.1079G>C	c.(1078-1080)CGA>CCA	p.R360P		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	360	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GCTTACCTTTCGATGACTTAA	0.353													28	62	---	---	---	---	PASS
SYDE2	84144	broad.mit.edu	37	1	85624609	85624609	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85624609C>T	uc009wcm.2	-	7	3458	c.3409G>A	c.(3409-3411)GAA>AAA	p.E1137K		NM_032184	NP_115560	Q5VT97	SYDE2_HUMAN	synapse defective 1, Rho GTPase, homolog 2	1137					activation of Rho GTPase activity|small GTPase mediated signal transduction	cytosol	Rho GTPase activator activity			ovary(1)|central_nervous_system(1)	2				all cancers(265;0.0126)|Epithelial(280;0.0336)		ATTGGCTGTTCAATCATTACT	0.348													23	57	---	---	---	---	PASS
BCAR3	8412	broad.mit.edu	37	1	94047862	94047862	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94047862C>T	uc001dpz.2	-	7	1957	c.1682G>A	c.(1681-1683)TGC>TAC	p.C561Y	BCAR3_uc001dqa.2_Missense_Mutation_p.C561Y|BCAR3_uc001dqb.2_Missense_Mutation_p.C561Y|BCAR3_uc001dpx.3_Missense_Mutation_p.C237Y|BCAR3_uc001dpy.2_Missense_Mutation_p.C470Y|BCAR3_uc009wdm.1_Missense_Mutation_p.C237Y	NM_003567	NP_003558	O75815	BCAR3_HUMAN	breast cancer antiestrogen resistance 3	561	Ras-GEF.				response to drug|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|lung(1)|central_nervous_system(1)	3		all_lung(203;0.00145)|Lung NSC(277;0.00662)		all cancers(265;0.0126)|GBM - Glioblastoma multiforme(16;0.0467)|Epithelial(280;0.166)		GCTTACCCTGCAGTCCATGCT	0.537													32	194	---	---	---	---	PASS
TMEM167B	56900	broad.mit.edu	37	1	109637031	109637031	+	Intron	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109637031C>T	uc001dwn.2	+						TMEM167B_uc009weu.2_Intron	NM_020141	NP_064526	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B precursor							Golgi membrane|integral to membrane					0						CTCTCTTTTGCCTGCTAGCCG	0.453													41	130	---	---	---	---	PASS
TRIM33	51592	broad.mit.edu	37	1	114969855	114969855	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114969855C>G	uc001eew.2	-	8	1448	c.1364G>C	c.(1363-1365)GGA>GCA	p.G455A	TRIM33_uc010owr.1_Missense_Mutation_p.G63A|TRIM33_uc010ows.1_Missense_Mutation_p.G63A|TRIM33_uc001eex.2_Missense_Mutation_p.G455A	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform	455					negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACGTATTGCTCCATTAGCAGC	0.363			T	RET	papillary thyroid								28	213	---	---	---	---	PASS
AMPD1	270	broad.mit.edu	37	1	115229390	115229390	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115229390C>A	uc001efe.1	-	4	441	c.357G>T	c.(355-357)CAG>CAT	p.Q119H	AMPD1_uc001eff.1_Missense_Mutation_p.Q115H	NM_000036	NP_000027	P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1 (isoform M)	119					purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			ovary(2)|large_intestine(1)|skin(1)	4	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CACCAGTAATCTGCACTCTCT	0.473													34	137	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115399274	115399274	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115399274T>C	uc001efr.2	+	3	398	c.189T>C	c.(187-189)GAT>GAC	p.D63D	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Silent_p.D63D|SYCP1_uc009wgw.2_Silent_p.D63D	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	63	Asp/Glu-rich (acidic).				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AAAACATTGATTCAGGTAGGA	0.318													20	65	---	---	---	---	PASS
CD101	9398	broad.mit.edu	37	1	117559882	117559882	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117559882G>T	uc010oxb.1	+	5	1457	c.1399G>T	c.(1399-1401)GGC>TGC	p.G467C	CD101_uc009whd.2_Missense_Mutation_p.G467C|CD101_uc010oxc.1_Missense_Mutation_p.G467C|CD101_uc010oxd.1_Missense_Mutation_p.G405C	NM_004258	NP_004249	Q93033	IGSF2_HUMAN	immunoglobulin superfamily, member 2 precursor	467	Extracellular (Potential).|Ig-like C2-type 4.				cell surface receptor linked signaling pathway	integral to membrane|plasma membrane	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GGGGCAGGATGGCATTGTGCA	0.587													19	91	---	---	---	---	PASS
GJA8	2703	broad.mit.edu	37	1	147380457	147380457	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147380457C>A	uc001epu.1	+	2	438	c.375C>A	c.(373-375)GAC>GAA	p.D125E		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	125	Cytoplasmic (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					GCGGCCCGGACCAGGGCAGCG	0.642													26	52	---	---	---	---	PASS
GJA8	2703	broad.mit.edu	37	1	147380458	147380458	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147380458C>A	uc001epu.1	+	2	439	c.376C>A	c.(376-378)CAG>AAG	p.Q126K		NM_005267	NP_005258	P48165	CXA8_HUMAN	connexin 50	126	Cytoplasmic (Potential).				cell communication|visual perception	connexon complex|integral to plasma membrane	channel activity			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.0276)					CGGCCCGGACCAGGGCAGCGT	0.647													27	55	---	---	---	---	PASS
VPS45	11311	broad.mit.edu	37	1	150048324	150048324	+	Silent	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150048324G>C	uc001etp.2	+	4	876	c.303G>C	c.(301-303)GTG>GTC	p.V101V	VPS45_uc010pbp.1_RNA|VPS45_uc010pbq.1_Silent_p.V65V|VPS45_uc010pbs.1_Silent_p.V65V|VPS45_uc001etq.2_5'Flank|VPS45_uc009wlm.1_Silent_p.V101V|VPS45_uc010pbr.1_Silent_p.V65V	NM_007259	NP_009190	Q9NRW7	VPS45_HUMAN	vacuolar protein sorting 45A	101					blood coagulation|intracellular protein transport|vesicle docking involved in exocytosis	endosome membrane|Golgi membrane|integral to membrane of membrane fraction				central_nervous_system(1)|skin(1)	2	Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			TCAGTAATGTGATCAGCAAGA	0.408													37	177	---	---	---	---	PASS
RPTN	126638	broad.mit.edu	37	1	152128744	152128744	+	Silent	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152128744T>A	uc001ezs.1	-	3	896	c.831A>T	c.(829-831)CTA>CTT	p.L277L		NM_001122965	NP_001116437	Q6XPR3	RPTN_HUMAN	repetin	277	Gln-rich.					proteinaceous extracellular matrix	calcium ion binding				0						ATTCCTGACCTAGCCTCTCAG	0.458													126	431	---	---	---	---	PASS
LCE3E	353145	broad.mit.edu	37	1	152538465	152538465	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152538465C>T	uc001faa.2	-	2	276	c.220G>A	c.(220-222)GGC>AGC	p.G74S		NM_178435	NP_848522	Q5T5B0	LCE3E_HUMAN	late cornified envelope 3E	74					keratinization					ovary(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		Lung(1;0.000294)|LUAD - Lung adenocarcinoma(1;0.00527)|LUSC - Lung squamous cell carcinoma(543;0.206)	UCEC - Uterine corpus endometrioid carcinoma (5;0.153)		TGACCACTGCCCCTGTCACAG	0.652													43	171	---	---	---	---	PASS
ATP8B2	57198	broad.mit.edu	37	1	154316369	154316369	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154316369G>T	uc001fex.2	+	18	1858	c.1858G>T	c.(1858-1860)GAG>TAG	p.E620*		NM_020452	NP_065185	P98198	AT8B2_HUMAN	ATPase, class I, type 8B, member 2 isoform a	606	Cytoplasmic (Potential).				ATP biosynthetic process	plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(1)|skin(1)	2	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTGCCTCCAGGAGTACGCAGG	0.393													39	85	---	---	---	---	PASS
CLK2	1196	broad.mit.edu	37	1	155240753	155240753	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155240753T>A	uc001fjy.2	-	2	306	c.16A>T	c.(16-18)AGG>TGG	p.R6W	RAG1AP1_uc010pey.1_Intron|CLK2_uc001fjw.2_Missense_Mutation_p.R6W|CLK2_uc001fjx.2_Translation_Start_Site|CLK2_uc009wqm.2_Missense_Mutation_p.R6W	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2	6						nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GAGTGGTACCTTCGAGGATGC	0.527								Other_conserved_DNA_damage_response_genes					39	123	---	---	---	---	PASS
PEAR1	375033	broad.mit.edu	37	1	156877949	156877949	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156877949T>A	uc001fqj.1	+	9	1048	c.932T>A	c.(931-933)TTT>TAT	p.F311Y	PEAR1_uc009wsl.1_Missense_Mutation_p.F112Y|PEAR1_uc001fqk.1_Translation_Start_Site	NM_001080471	NP_001073940	Q5VY43	PEAR1_HUMAN	platelet endothelial aggregation receptor 1	311	EGF-like 4.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GTGGGCCGCTTTGGGCAGGAC	0.726													4	26	---	---	---	---	PASS
FCRL3	115352	broad.mit.edu	37	1	157667071	157667071	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157667071G>T	uc001frb.2	-	6	995	c.703C>A	c.(703-705)CTC>ATC	p.L235I	FCRL3_uc001fqx.3_RNA|FCRL3_uc001fqy.3_RNA|FCRL3_uc001fqz.3_Missense_Mutation_p.L235I|FCRL3_uc009wsn.2_Intron|FCRL3_uc009wso.2_RNA|FCRL3_uc001fra.2_5'UTR|FCRL3_uc001frc.1_Missense_Mutation_p.L235I	NM_052939	NP_443171	Q96P31	FCRL3_HUMAN	Fc receptor-like 3 precursor	235	Ig-like C2-type 3.|Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(3)|breast(1)	4	all_hematologic(112;0.0378)					CCCAATCCGAGGGTCTGGCTA	0.577													49	215	---	---	---	---	PASS
FCRL1	115350	broad.mit.edu	37	1	157773749	157773749	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157773749G>T	uc001frg.2	-	3	318	c.205C>A	c.(205-207)CCC>ACC	p.P69T	FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Missense_Mutation_p.P69T|FCRL1_uc001fri.2_Missense_Mutation_p.P69T|FCRL1_uc001frj.2_RNA	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor	69	Extracellular (Potential).|Ig-like C2-type 1.					integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			TGGAGCTTGGGGGAGCTGCTC	0.562													51	208	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157804345	157804345	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157804345G>A	uc001frk.3	-	4	713	c.570C>T	c.(568-570)CGC>CGT	p.R190R		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	190	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GCTTGTTGCAGCGTTTTTGAG	0.592													39	132	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158647593	158647593	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158647593C>A	uc001fst.1	-	7	1043	c.844G>T	c.(844-846)GAG>TAG	p.E282*		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	282	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGTTCCTTCTCCTTGATCCAC	0.473													19	100	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158647594	158647594	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158647594C>A	uc001fst.1	-	7	1042	c.843G>T	c.(841-843)AAG>AAT	p.K281N		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	281	Spectrin 4.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GTTCCTTCTCCTTGATCCACT	0.478													18	100	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169541508	169541508	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169541508C>A	uc001ggg.1	-	3	469	c.324G>T	c.(322-324)AAG>AAT	p.K108N	F5_uc010plr.1_RNA	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor	108	F5/8 type A 1.|Plastocyanin-like 1.				cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TGCTCAAGGGCTTATCTGCCT	0.323													23	75	---	---	---	---	PASS
SELP	6403	broad.mit.edu	37	1	169581473	169581473	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169581473G>T	uc001ggi.3	-	6	1008	c.943C>A	c.(943-945)CCA>ACA	p.P315T	SELP_uc001ggh.2_Missense_Mutation_p.P150T|SELP_uc009wvr.2_Missense_Mutation_p.P315T	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	315	Extracellular (Potential).|Sushi 2.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	ACTGGGGCTGGGGCTGTCCAT	0.488													46	189	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175097181	175097181	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175097181G>C	uc001gkl.1	+	14	3172	c.3059G>C	c.(3058-3060)GGA>GCA	p.G1020A		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	1020	Fibronectin type-III 9.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATGCAGCTGGGACGGGAAGAC	0.547													30	147	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175328799	175328799	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175328799C>T	uc001gkp.1	-	13	3004	c.2923G>A	c.(2923-2925)GCA>ACA	p.A975T	TNR_uc009wwu.1_Missense_Mutation_p.A975T	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	975	Fibronectin type-III 8.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					CCCACTGGTGCCTTCCACTGC	0.493													43	130	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175331844	175331844	+	Missense_Mutation	SNP	G	A	A	rs150401432		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175331844G>A	uc001gkp.1	-	12	2890	c.2809C>T	c.(2809-2811)CGG>TGG	p.R937W	TNR_uc009wwu.1_Missense_Mutation_p.R937W	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	937	Fibronectin type-III 7.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix				pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TCCCTGCCCCGCACGCTGTTG	0.552													50	118	---	---	---	---	PASS
NCF2	4688	broad.mit.edu	37	1	183543663	183543663	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183543663G>T	uc001gqj.3	-	4	735	c.460C>A	c.(460-462)CCC>ACC	p.P154T	NCF2_uc010pod.1_Intron|NCF2_uc010poe.1_Intron|NCF2_uc001gqk.3_Missense_Mutation_p.P154T	NM_000433	NP_000424	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	154	TPR 3.				cellular defense response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex|nucleolus	electron carrier activity|protein C-terminus binding			ovary(3)	3						GAATGTCTGGGCTCAGACTTC	0.443													134	363	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276748	186276748	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276748G>A	uc001gru.3	+	7	1948	c.1897G>A	c.(1897-1899)GCA>ACA	p.A633T	PRG4_uc001grt.3_Missense_Mutation_p.A592T|PRG4_uc009wyl.2_Missense_Mutation_p.A540T|PRG4_uc009wym.2_Missense_Mutation_p.A499T|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	633	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CGAGAAGCTCGCACCCACCAC	0.687													8	23	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207787753	207787753	+	Nonsense_Mutation	SNP	C	T	T	rs55749440		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207787753C>T	uc001hfy.2	+	32	5370	c.5230C>T	c.(5230-5232)CGA>TGA	p.R1744*	CR1_uc001hfx.2_Nonsense_Mutation_p.R2194*	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	1744	Extracellular (Potential).|Sushi 27.				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						CTTTAGGTTCCGATTAAAAGG	0.423													4	85	---	---	---	---	PASS
SYT14	255928	broad.mit.edu	37	1	210273672	210273672	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210273672C>T	uc009xcv.2	+	6	1102	c.1030C>T	c.(1030-1032)CGG>TGG	p.R344W	SYT14_uc001hhs.3_Missense_Mutation_p.R389W|SYT14_uc001hht.3_Missense_Mutation_p.R344W|SYT14_uc001hhu.3_Intron|SYT14_uc010psn.1_Missense_Mutation_p.R389W|SYT14_uc010pso.1_Missense_Mutation_p.R306W	NM_153262	NP_694994	Q8NB59	SYT14_HUMAN	synaptotagmin XIV isoform 4	344	Cytoplasmic (Potential).|C2 1.					integral to membrane				ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TTATGCAGTTCGGTTTAGACT	0.348													40	144	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	210948737	210948737	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210948737G>T	uc001hib.2	-	10	2235	c.2065C>A	c.(2065-2067)CAT>AAT	p.H689N	KCNH1_uc001hic.2_Missense_Mutation_p.H662N	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	689	Cytoplasmic (Potential).|cNMP.|Calmodulin-binding.				myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		GAGAAGGAATGGGAGAAGGCC	0.483													28	91	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	215853703	215853703	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215853703C>A	uc001hku.1	-	62	12469	c.12082G>T	c.(12082-12084)GCC>TCC	p.A4028S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	4028	Fibronectin type-III 25.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TACAGGTGGGCTTGATGGCTT	0.398										HNSCC(13;0.011)			53	178	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216017726	216017726	+	Nonsense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216017726A>C	uc001hku.1	-	46	9555	c.9168T>G	c.(9166-9168)TAT>TAG	p.Y3056*		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	3056	Fibronectin type-III 17.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TATTATTTACATAGATAGAAT	0.418										HNSCC(13;0.011)			39	108	---	---	---	---	PASS
MARK1	4139	broad.mit.edu	37	1	220792066	220792066	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220792066T>C	uc001hmn.3	+	9	1475	c.878T>C	c.(877-879)GTC>GCC	p.V293A	MARK1_uc009xdw.2_Missense_Mutation_p.V293A|MARK1_uc010pun.1_Missense_Mutation_p.V293A|MARK1_uc001hmm.3_Missense_Mutation_p.V271A	NM_018650	NP_061120	Q9P0L2	MARK1_HUMAN	MAP/microtubule affinity-regulating kinase 1	293	Protein kinase.				intracellular protein kinase cascade	cytoplasm|microtubule cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(4)|central_nervous_system(2)|skin(2)|stomach(1)|lung(1)	10				GBM - Glioblastoma multiforme(131;0.0407)		AAATTATTAGTCCTGAATCCA	0.338													35	96	---	---	---	---	PASS
LIN9	286826	broad.mit.edu	37	1	226496871	226496871	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226496871C>G	uc001hqa.2	-	1	328	c.18G>C	c.(16-18)CAG>CAC	p.Q6H	LIN9_uc001hqb.2_Missense_Mutation_p.Q6H|LIN9_uc001hqc.2_Intron|LIN9_uc009xel.1_Missense_Mutation_p.Q6H	NM_173083	NP_775106	Q5TKA1	LIN9_HUMAN	lin-9 homolog	Error:Variant_position_missing_in_Q5TKA1_after_alignment					cell cycle|DNA replication	nucleoplasm					0	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		TTTTCAAAGGCTGCCCGCCGC	0.522													19	49	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236894586	236894586	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236894586G>T	uc001hyf.2	+	7	873	c.669G>T	c.(667-669)CTG>CTT	p.L223L	ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Silent_p.L223L|ACTN2_uc010pxu.1_Silent_p.L8L	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	223	CH 2.|Actin-binding.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AGAAGCACCTGGATATTCCTA	0.368													49	164	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240497454	240497454	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240497454G>T	uc010pyd.1	+	13	4915	c.4690G>T	c.(4690-4692)GAC>TAC	p.D1564Y	FMN2_uc010pye.1_Missense_Mutation_p.D1568Y|FMN2_uc010pyf.1_Missense_Mutation_p.D210Y|FMN2_uc010pyg.1_Missense_Mutation_p.D160Y	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	1564	FH2.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGAACCCCAGGACCTTTTTCA	0.353													116	381	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248039387	248039387	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248039387G>A	uc001ido.2	+	6	1105	c.1057G>A	c.(1057-1059)GGA>AGA	p.G353R	OR2W3_uc001idp.1_Intron	NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	353	B30.2/SPRY.					intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGTTCTGGTGGGAGAAGGAGC	0.572													36	123	---	---	---	---	PASS
RNF144A	9781	broad.mit.edu	37	2	7164553	7164553	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7164553G>T	uc002qys.2	+	7	1005	c.563G>T	c.(562-564)TGC>TTC	p.C188F	RNF144A_uc002qyt.2_Missense_Mutation_p.C37F	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	188	RING-type 2; degenerate.					Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		TGCCCCAAGTGCAAAGTCTAC	0.567													33	129	---	---	---	---	PASS
SLC5A6	8884	broad.mit.edu	37	2	27426649	27426649	+	Silent	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27426649G>C	uc002rjd.2	-	10	1483	c.1092C>G	c.(1090-1092)CTC>CTG	p.L364L	SLC5A6_uc010eyv.1_Silent_p.L364L	NM_021095	NP_066918	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium-dependent	364					biotin metabolic process|pantothenate metabolic process	integral to plasma membrane|membrane fraction	sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|Lipoic Acid(DB00166)	GTGGGTACCTGAGAGAGCCGC	0.577													4	71	---	---	---	---	PASS
TRMT61B	55006	broad.mit.edu	37	2	29084171	29084171	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29084171C>G	uc002rmm.2	-	3	838	c.806G>C	c.(805-807)GGA>GCA	p.G269A	TRMT61B_uc002rmn.2_Missense_Mutation_p.G269A|TRMT61B_uc010ezk.2_RNA	NM_017910	NP_060380	Q9BVS5	TR61B_HUMAN	tRNA methyltransferase 61 homolog B	269							tRNA (adenine-N1-)-methyltransferase activity				0						TCCTTGTGATCCAACTTAAGT	0.254													22	80	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31598422	31598422	+	Splice_Site	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31598422T>A	uc002rnv.1	-	15	1507	c.1428_splice	c.e15-1	p.K476_splice		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase						purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	TTCCAGAGCCTGCCAGAGAGC	0.567													18	47	---	---	---	---	PASS
ABCG8	64241	broad.mit.edu	37	2	44078926	44078926	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44078926C>T	uc002rtq.2	+	4	616	c.526C>T	c.(526-528)CCC>TCC	p.P176S	ABCG8_uc010yoa.1_Missense_Mutation_p.P176S	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8	176	ABC transporter.|Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATGCGGCTGCCCAGAACCTT	0.612													40	174	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50779808	50779808	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50779808C>T	uc010fbq.2	-	9	3273	c.1796G>A	c.(1795-1797)GGT>GAT	p.G599D	NRXN1_uc002rxb.3_Missense_Mutation_p.G231D|NRXN1_uc002rxe.3_Missense_Mutation_p.G559D|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TTTTATAGTACCTGACCCCAT	0.438													55	152	---	---	---	---	PASS
SMEK2	57223	broad.mit.edu	37	2	55825555	55825555	+	Missense_Mutation	SNP	C	A	A	rs147118353		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55825555C>A	uc002rzc.2	-	4	1293	c.918G>T	c.(916-918)TTG>TTT	p.L306F	SMEK2_uc002rzb.2_Missense_Mutation_p.L306F|SMEK2_uc002rzd.2_Missense_Mutation_p.L306F|SMEK2_uc002rza.2_Missense_Mutation_p.L182F	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1	306						microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TACTTACCTGCAACATGCTGA	0.328													22	72	---	---	---	---	PASS
PNO1	56902	broad.mit.edu	37	2	68385526	68385526	+	Silent	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68385526A>G	uc002seh.2	+	2	284	c.222A>G	c.(220-222)GAA>GAG	p.E74E	WDR92_uc002sed.1_5'Flank|WDR92_uc002see.1_5'Flank|WDR92_uc002sef.1_5'Flank|WDR92_uc002seg.1_5'Flank	NM_020143	NP_064528	Q9NRX1	PNO1_HUMAN	partner of NOB1	74						nucleolus	RNA binding				0						GGAAAGAAGAAACAAGGAAAA	0.408													29	216	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136857	80136857	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136857G>T	uc010ysh.1	+	6	995	c.990G>T	c.(988-990)AGG>AGT	p.R330S	CTNNA2_uc010yse.1_Missense_Mutation_p.R330S|CTNNA2_uc010ysf.1_Missense_Mutation_p.R330S|CTNNA2_uc010ysg.1_Missense_Mutation_p.R330S	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	330					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GGCGCGAGAGGATCGTGGCGG	0.627													29	103	---	---	---	---	PASS
KCNIP3	30818	broad.mit.edu	37	2	96040934	96040934	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96040934G>T	uc002sup.2	+	5	540	c.425G>T	c.(424-426)GGG>GTG	p.G142V	KCNIP3_uc002suq.2_Missense_Mutation_p.G116V	NM_013434	NP_038462	Q9Y2W7	CSEN_HUMAN	Kv channel interacting protein 3 isoform 1	142	EF-hand 2.				apoptosis|signal transduction|transcription, DNA-dependent	endoplasmic reticulum|Golgi apparatus|nucleus|plasma membrane	calcium ion binding|DNA binding|potassium channel activity|transcription corepressor activity|voltage-gated ion channel activity			breast(2)|ovary(1)	3				READ - Rectum adenocarcinoma(193;0.13)		GATGCGGACGGGAACGGGGCC	0.617													30	119	---	---	---	---	PASS
IL1R2	7850	broad.mit.edu	37	2	102636172	102636172	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102636172G>T	uc002tbm.2	+	5	815	c.586G>T	c.(586-588)GAT>TAT	p.D196Y	IL1R2_uc002tbn.2_Missense_Mutation_p.D196Y|IL1R2_uc002tbo.1_Missense_Mutation_p.D196Y	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	196	Extracellular (Potential).|Ig-like C2-type 2.				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	ACTCGTACACGATGTGGCCCT	0.428													10	50	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125261909	125261909	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125261909C>A	uc002tno.2	+	8	1464	c.1100C>A	c.(1099-1101)CCC>CAC	p.P367H	CNTNAP5_uc010flu.2_Missense_Mutation_p.P368H	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	367	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		CAGATTGTGCCCATCACATTT	0.458													13	104	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125261910	125261910	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125261910C>A	uc002tno.2	+	8	1465	c.1101C>A	c.(1099-1101)CCC>CCA	p.P367P	CNTNAP5_uc010flu.2_Silent_p.P368P	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	367	Laminin G-like 2.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		AGATTGTGCCCATCACATTTG	0.463													12	105	---	---	---	---	PASS
ERCC3	2071	broad.mit.edu	37	2	128030506	128030506	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128030506C>A	uc002toh.1	-	11	1857	c.1762G>T	c.(1762-1764)GAA>TAA	p.E588*	ERCC3_uc002toe.1_Nonsense_Mutation_p.E343*|ERCC3_uc002tof.1_Nonsense_Mutation_p.E524*|ERCC3_uc002tog.1_Nonsense_Mutation_p.E524*	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent	588	Helicase C-terminal.				cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		TGCATCCTTTCCCCCTGAGAC	0.453			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				18	88	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566200	136566200	+	Silent	SNP	C	A	A	rs151165674		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566200C>A	uc002tuu.1	-	8	3728	c.3717G>T	c.(3715-3717)TCG>TCT	p.S1239S		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1239	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TGGAAGGCCACGAAGGGTCCT	0.562													31	186	---	---	---	---	PASS
MCM6	4175	broad.mit.edu	37	2	136617013	136617013	+	Splice_Site	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136617013C>A	uc002tuw.2	-	9	1297	c.1221_splice	c.e9-1	p.K407_splice		NM_005915	NP_005906	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|identical protein binding				0				BRCA - Breast invasive adenocarcinoma(221;0.166)	Atorvastatin(DB01076)	CTCCACGTGCCTGTTCAAGGT	0.438													10	51	---	---	---	---	PASS
CXCR4	7852	broad.mit.edu	37	2	136873423	136873423	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136873423C>T	uc002tuz.2	-	2	170	c.75G>A	c.(73-75)AAG>AAA	p.K25K	CXCR4_uc002tuy.2_Silent_p.K29K|CXCR4_uc010fnk.2_Silent_p.K10K	NM_003467	NP_003458	P61073	CXCR4_HUMAN	chemokine (C-X-C motif) receptor 4 isoform b	25	Extracellular.				activation of MAPK activity|apoptosis|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|entry into host cell|inflammatory response|initiation of viral infection|regulation of chemotaxis|response to hypoxia|response to virus	cell leading edge|cell surface|cytoplasmic membrane-bounded vesicle|integral to membrane|plasma membrane	actin binding|C-X-C chemokine receptor activity|coreceptor activity|myosin light chain binding|ubiquitin binding|ubiquitin protein ligase binding			upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.155)	Framycetin(DB00452)	AACAGGGTTCCTTCATGGAGT	0.428													34	139	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141643896	141643896	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141643896C>A	uc002tvj.1	-	24	4747	c.3775G>T	c.(3775-3777)GAA>TAA	p.E1259*	LRP1B_uc010fnl.1_Nonsense_Mutation_p.E441*	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1259	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ATGAATGCTTCAAAAGGATCT	0.284										TSP Lung(27;0.18)			11	94	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145158831	145158831	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145158831C>A	uc002tvu.2	-	7	1331	c.851G>T	c.(850-852)TGC>TTC	p.C284F	ZEB2_uc002tvv.2_Missense_Mutation_p.C278F|ZEB2_uc010zbm.1_Missense_Mutation_p.C255F|ZEB2_uc010fnp.2_Missense_Mutation_p.C192F|ZEB2_uc010fnq.1_Missense_Mutation_p.C313F	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	284	C2H2-type 3.					cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		ACACTCTGTGCATTTGAACTT	0.438													90	214	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162834234	162834234	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162834234C>T	uc002ubx.3	+	26	3531	c.3347C>T	c.(3346-3348)TCC>TTC	p.S1116F	SLC4A10_uc002uby.3_Missense_Mutation_p.S1086F|SLC4A10_uc010zcs.1_Missense_Mutation_p.S1097F	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	1116	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GTCATAAGCTCCCCTTCCTAA	0.323													13	124	---	---	---	---	PASS
PPIG	9360	broad.mit.edu	37	2	170465179	170465179	+	Splice_Site	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170465179A>G	uc002uez.2	+	7	510	c.290_splice	c.e7-2	p.D97_splice	PPIG_uc010fpx.2_Splice_Site_p.D82_splice|PPIG_uc010fpy.2_Splice_Site_p.D93_splice|PPIG_uc002ufa.2_Splice_Site_p.D97_splice|PPIG_uc002ufb.2_Splice_Site_p.D97_splice|PPIG_uc002ufc.1_Splice_Site_p.D97_splice|PPIG_uc002ufd.2_Splice_Site_p.D97_splice	NM_004792	NP_004783	Q13427	PPIG_HUMAN	peptidylprolyl isomerase G						protein folding|RNA splicing	nuclear matrix|nuclear speck	cyclosporin A binding|peptidyl-prolyl cis-trans isomerase activity			ovary(2)|central_nervous_system(1)	3					L-Proline(DB00172)	ACTTCTCTATAGACGAGAGTT	0.328													24	53	---	---	---	---	PASS
RAPGEF4	11069	broad.mit.edu	37	2	173891408	173891408	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173891408T>C	uc002uhv.3	+	24	2549	c.2362T>C	c.(2362-2364)TTC>CTC	p.F788L	RAPGEF4_uc002uhw.3_Missense_Mutation_p.F644L	NM_007023	NP_008954	Q8WZA2	RPGF4_HUMAN	Rap guanine nucleotide exchange factor (GEF) 4	788	Ras-GEF.				blood coagulation|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|regulation of insulin secretion|regulation of protein phosphorylation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cAMP-dependent protein kinase complex|membrane fraction|plasma membrane	cAMP binding|cAMP-dependent protein kinase regulator activity|Ras GTPase binding|Ras guanyl-nucleotide exchange factor activity			large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.194)			TTGGGAACTCTTCAACTGCGT	0.428													26	156	---	---	---	---	PASS
HOXD3	3232	broad.mit.edu	37	2	177033895	177033895	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177033895A>G	uc002ukt.1	+	2	229	c.53A>G	c.(52-54)CAG>CGG	p.Q18R		NM_006898	NP_008829	P31249	HXD3_HUMAN	homeobox D3	18					anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		TGCACAATGCAGAAGGCTGCT	0.527													21	130	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179414904	179414904	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414904G>A	uc010zfg.1	-	286	84181	c.83957C>T	c.(83956-83958)CCA>CTA	p.P27986L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P21681L|TTN_uc010zfi.1_Missense_Mutation_p.P21614L|TTN_uc010zfj.1_Missense_Mutation_p.P21489L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28913							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCGAGGCACTGGTCTTCCTTG	0.413													95	223	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179442322	179442322	+	Intron	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179442322G>T	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGTAAAATGGACCTACCGTA	0.323													17	35	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179641375	179641375	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179641375A>T	uc010zfg.1	-	28	5440	c.5216T>A	c.(5215-5217)CTC>CAC	p.L1739H	TTN_uc010zfh.1_Missense_Mutation_p.L1693H|TTN_uc010zfi.1_Missense_Mutation_p.L1693H|TTN_uc010zfj.1_Missense_Mutation_p.L1693H|TTN_uc002unb.2_Missense_Mutation_p.L1739H|uc002unc.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	1739							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCATCATGGAGCCACTCCAC	0.478													8	96	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185800578	185800578	+	Missense_Mutation	SNP	C	A	A	rs147922206		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185800578C>A	uc002uph.2	+	4	1049	c.455C>A	c.(454-456)TCC>TAC	p.S152Y		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	152						intracellular	zinc ion binding	p.S152F(1)		ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						AATGAAATTTCCCAACGAGTT	0.368													27	106	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801937	185801937	+	Missense_Mutation	SNP	A	T	T	rs144621375		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801937A>T	uc002uph.2	+	4	2408	c.1814A>T	c.(1813-1815)CAT>CTT	p.H605L		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	605						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TTATGTCAGCATCATCATATG	0.328													69	139	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196759835	196759835	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196759835G>C	uc002utj.3	-	30	4862	c.4761C>G	c.(4759-4761)TTC>TTG	p.F1587L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1587	AAA 2 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TCTCGGAAAAGAATGCAGTCA	0.368													21	80	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196765006	196765006	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196765006C>A	uc002utj.3	-	28	4649	c.4548G>T	c.(4546-4548)AAG>AAT	p.K1516N		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1516					ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						TGTTCTCTACCTTCAGATTCC	0.398													42	175	---	---	---	---	PASS
PTH2R	5746	broad.mit.edu	37	2	209358071	209358071	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209358071G>T	uc002vdb.2	+	13	1553	c.1340G>T	c.(1339-1341)AGA>ATA	p.R447I	PTH2R_uc010zjb.1_Missense_Mutation_p.R458I|PTH2R_uc010fuo.1_Intron	NM_005048	NP_005039	P49190	PTH2R_HUMAN	parathyroid hormone 2 receptor precursor	447	Cytoplasmic (Potential).					integral to plasma membrane	parathyroid hormone receptor activity			ovary(1)|breast(1)|skin(1)	3				Epithelial(149;0.0684)|Lung(261;0.0785)|LUSC - Lung squamous cell carcinoma(261;0.0836)		GGCAGCCGCAGATGCGGCTCA	0.592													10	31	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211444504	211444504	+	Intron	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211444504T>A	uc002vee.3	+						CPS1_uc010fur.2_Intron	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b						carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		GGTATAATCATCATCTTTAGC	0.308													21	97	---	---	---	---	PASS
DES	1674	broad.mit.edu	37	2	220286269	220286269	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220286269G>C	uc002vll.2	+	6	1317	c.1231G>C	c.(1231-1233)GGA>CGA	p.G411R		NM_001927	NP_001918	P17661	DESM_HUMAN	desmin	411	Rod.|Coil 2B.				cytoskeleton organization|muscle filament sliding|regulation of heart contraction	cytosol|Z disc	protein binding|structural constituent of cytoskeleton			central_nervous_system(2)	2		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCTGCTGGAGGGAGAGGAGAG	0.622													9	78	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227662673	227662673	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227662673C>A	uc002voh.3	-	1	834	c.782G>T	c.(781-783)AGT>ATT	p.S261I		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	261	IRS-type PTB.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GAACTCATCACTCATGGCCCG	0.642											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	98	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228846552	228846552	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228846552G>A	uc002vpq.2	-	12	5031	c.4984C>T	c.(4984-4986)CAT>TAT	p.H1662Y	SPHKAP_uc002vpp.2_Missense_Mutation_p.H1633Y|SPHKAP_uc010zlx.1_3'UTR	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1662						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GACTTCCGATGAACCAGCTGC	0.493													14	75	---	---	---	---	PASS
COPS7B	64708	broad.mit.edu	37	2	232672190	232672190	+	Intron	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232672190C>T	uc002vsg.1	+						COPS7B_uc010fxy.1_Intron|COPS7B_uc002vsh.1_Intron|COPS7B_uc002vsi.1_Intron|COPS7B_uc002vsj.1_Intron|COPS7B_uc002vsk.1_Intron	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CTATATCTCCCCACCAGGTTA	0.512													5	37	---	---	---	---	PASS
SCLY	51540	broad.mit.edu	37	2	238978060	238978060	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238978060G>T	uc010fyv.2	+	4	490	c.426G>T	c.(424-426)TCG>TCT	p.S142S	SCLY_uc002vxm.3_Silent_p.S109S|SCLY_uc002vxn.2_Silent_p.S142S|SCLY_uc010znq.1_Intron|SCLY_uc010znr.1_Intron	NM_016510	NP_057594	Q96I15	SCLY_HUMAN	selenocysteine lyase	142					cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		TTACTTCCTCGGTGGAACACG	0.597													13	47	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38674754	38674754	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38674754C>G	uc003cio.2	-	2	239	c.45G>C	c.(43-45)AGG>AGC	p.R15S	SCN5A_uc003cin.2_Missense_Mutation_p.R15S|SCN5A_uc003cil.3_Missense_Mutation_p.R15S|SCN5A_uc010hhi.2_Missense_Mutation_p.R15S|SCN5A_uc010hhk.2_Missense_Mutation_p.R15S|SCN5A_uc011ayr.1_Missense_Mutation_p.R15S	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha	15					blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	CCCGTGTGAACCTGCGGAAGC	0.627													15	48	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38835283	38835283	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38835283T>C	uc003ciq.2	-	1	219	c.219A>G	c.(217-219)GAA>GAG	p.E73E		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	73					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	CCCCGATCAGTTCTGCTGGGA	0.552													96	169	---	---	---	---	PASS
TTC21A	199223	broad.mit.edu	37	3	39153986	39153986	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39153986A>T	uc003cjc.2	+	5	650	c.473A>T	c.(472-474)GAC>GTC	p.D158V	TTC21A_uc003cja.2_Missense_Mutation_p.D158V|TTC21A_uc010hho.1_Intron|TTC21A_uc003cjb.2_Intron|TTC21A_uc003cje.2_Missense_Mutation_p.D158V|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Intron	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	158	TPR 3.						binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CTGACCTCAGACAAGCCCCAC	0.522													20	47	---	---	---	---	PASS
NBEAL2	23218	broad.mit.edu	37	3	47037075	47037075	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47037075C>T	uc003cqp.2	+	13	2029	c.1850C>T	c.(1849-1851)GCA>GTA	p.A617V	NBEAL2_uc003cqq.1_Missense_Mutation_p.A583V|NBEAL2_uc010hjm.1_Missense_Mutation_p.A178V	NM_015175	NP_055990	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	617							binding			ovary(1)	1		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		ATGGATACAGCACCTACCCCT	0.637													20	42	---	---	---	---	PASS
FLNB	2317	broad.mit.edu	37	3	58090918	58090918	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58090918C>A	uc003djj.2	+	11	1887	c.1722C>A	c.(1720-1722)TCC>TCA	p.S574S	FLNB_uc010hne.2_Silent_p.S574S|FLNB_uc003djk.2_Silent_p.S574S|FLNB_uc010hnf.2_Silent_p.S574S|FLNB_uc003djl.2_Silent_p.S405S|FLNB_uc003djm.2_Silent_p.S405S	NM_001457	NP_001448	O75369	FLNB_HUMAN	filamin B isoform 2	574	Filamin 4.				actin cytoskeleton organization|cell differentiation|cytoskeletal anchoring at plasma membrane|signal transduction	cell cortex|integral to membrane|nucleus|sarcomere	actin binding			breast(8)|ovary(5)|lung(3)|skin(2)|central_nervous_system(1)	19				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		TGGTAGAATCCATTGGCTCTG	0.582													8	118	---	---	---	---	PASS
FAM19A1	407738	broad.mit.edu	37	3	68587941	68587941	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:68587941G>T	uc003dnd.2	+	4	510	c.294G>T	c.(292-294)ATG>ATT	p.M98I	FAM19A1_uc003dne.2_Missense_Mutation_p.M98I|FAM19A1_uc003dng.2_Missense_Mutation_p.M98I	NM_213609	NP_998774	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine	98						endoplasmic reticulum|extracellular region				ovary(1)	1		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		GGTGTGAGATGGAGCCTTGCC	0.458													18	67	---	---	---	---	PASS
TMF1	7110	broad.mit.edu	37	3	69072406	69072406	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69072406T>C	uc003dnn.2	-	17	3451	c.3204A>G	c.(3202-3204)GAA>GAG	p.E1068E	TMF1_uc011bfx.1_Silent_p.E1071E	NM_007114	NP_009045	P82094	TMF1_HUMAN	TATA element modulatory factor 1	1068	Potential.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	Golgi membrane|nucleus	DNA binding|protein binding|transcription cofactor activity				0		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;4.48e-05)|Epithelial(33;0.000274)|LUSC - Lung squamous cell carcinoma(21;0.0123)|KIRC - Kidney renal clear cell carcinoma(39;0.211)|Kidney(39;0.247)		CTAATCGAAGTTCTTCTGCCT	0.299													9	42	---	---	---	---	PASS
OR5H6	79295	broad.mit.edu	37	3	97983348	97983348	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97983348C>T	uc003dsi.1	+	1	220	c.220C>T	c.(220-222)CCA>TCA	p.P74S		NM_001005479	NP_001005479	Q8NGV6	OR5H6_HUMAN	olfactory receptor, family 5, subfamily H,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3						CCTTCATATCCCAATGTACTT	0.418													75	393	---	---	---	---	PASS
HHLA2	11148	broad.mit.edu	37	3	108072579	108072579	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108072579G>T	uc003dwy.3	+	4	537	c.370G>T	c.(370-372)GGA>TGA	p.G124*	HHLA2_uc011bhl.1_Nonsense_Mutation_p.G60*|HHLA2_uc010hpu.2_Nonsense_Mutation_p.G124*|HHLA2_uc003dwz.2_Nonsense_Mutation_p.G124*	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	124	Ig-like V-type 1.					integral to membrane				ovary(1)	1						CTGCTATGTAGGAACAGCAAT	0.393													5	49	---	---	---	---	PASS
HHLA2	11148	broad.mit.edu	37	3	108072580	108072580	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108072580G>T	uc003dwy.3	+	4	538	c.371G>T	c.(370-372)GGA>GTA	p.G124V	HHLA2_uc011bhl.1_Missense_Mutation_p.G60V|HHLA2_uc010hpu.2_Missense_Mutation_p.G124V|HHLA2_uc003dwz.2_Missense_Mutation_p.G124V	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	124	Ig-like V-type 1.					integral to membrane				ovary(1)	1						TGCTATGTAGGAACAGCAATT	0.388													5	48	---	---	---	---	PASS
HHLA2	11148	broad.mit.edu	37	3	108074178	108074178	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108074178T>A	uc003dwy.3	+	5	802	c.635T>A	c.(634-636)ATT>AAT	p.I212N	HHLA2_uc011bhl.1_Missense_Mutation_p.I148N|HHLA2_uc010hpu.2_Missense_Mutation_p.I212N|HHLA2_uc003dwz.2_Missense_Mutation_p.I212N	NM_007072	NP_009003	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2 precursor	212	Ig-like C1-type.					integral to membrane				ovary(1)	1						GAATGTACAATTGAAAATTCA	0.413													31	160	---	---	---	---	PASS
RETNLB	84666	broad.mit.edu	37	3	108474755	108474755	+	Intron	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108474755G>C	uc003dxh.2	-							NM_032579	NP_115968	Q9BQ08	RETNB_HUMAN	resistin like beta precursor						cell proliferation	extracellular region	hormone activity			skin(1)	1						AGCCATCCCTGCATGAGCACA	0.507													18	87	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121217424	121217424	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121217424C>T	uc003eee.3	-	13	2182	c.2053G>A	c.(2053-2055)GAG>AAG	p.E685K		NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	685					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CCCACTAGCTCTGCCACCCTT	0.433								DNA_polymerases_(catalytic_subunits)					30	126	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121350949	121350949	+	Silent	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121350949T>A	uc003eeh.3	-	13	1448	c.1323A>T	c.(1321-1323)GGA>GGT	p.G441G	HCLS1_uc011bjj.1_Silent_p.G404G	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1	441	SH3.				erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		CCAACCTACCTCCTTGGTAAT	0.433													37	201	---	---	---	---	PASS
PARP9	83666	broad.mit.edu	37	3	122247311	122247311	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122247311G>A	uc010hri.2	-	11	2610	c.2465C>T	c.(2464-2466)ACC>ATC	p.T822I	PARP9_uc003eff.3_Missense_Mutation_p.T787I|PARP9_uc011bjs.1_Missense_Mutation_p.T787I|PARP9_uc003efg.2_Missense_Mutation_p.T367I|PARP9_uc003efi.2_Missense_Mutation_p.T787I|PARP9_uc003efh.2_Missense_Mutation_p.T822I	NM_001146102	NP_001139574	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	822	PARP catalytic.				cell migration	cytosol|nucleus	NAD+ ADP-ribosyltransferase activity|protein binding			ovary(1)|pancreas(1)|prostate(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0519)		ATATTCCTGGGTGCATGTCCA	0.458													35	152	---	---	---	---	PASS
CCDC14	64770	broad.mit.edu	37	3	123634001	123634001	+	Silent	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123634001T>A	uc011bjx.1	-	13	2578	c.2487A>T	c.(2485-2487)GTA>GTT	p.V829V	CCDC14_uc003egv.3_Silent_p.V470V|CCDC14_uc003egx.3_Silent_p.V629V|CCDC14_uc010hrt.2_Silent_p.V788V|CCDC14_uc003egy.3_Silent_p.V629V|CCDC14_uc003egz.2_Intron	NM_022757	NP_073594	Q49A88	CCD14_HUMAN	coiled-coil domain containing 14	829						centrosome					0		Lung NSC(201;0.0371)|Prostate(884;0.0405)|Myeloproliferative disorder(1037;0.205)		Lung(219;0.00942)|GBM - Glioblastoma multiforme(114;0.159)		AGGAACAGATTACAGGTGTAC	0.433													16	56	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125874343	125874343	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125874343G>T	uc003eim.1	-	5	722	c.532C>A	c.(532-534)CAG>AAG	p.Q178K	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'UTR|ALDH1L1_uc010hsf.1_Missense_Mutation_p.Q204K|ALDH1L1_uc003eip.1_Intron|ALDH1L1_uc011bkj.1_Missense_Mutation_p.Q3K	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	178	GART.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	CTCACGGCCTGCACCTGGGGA	0.617													24	88	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129389565	129389565	+	Silent	SNP	G	A	A	rs115654568	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389565G>A	uc003emz.3	-	5	1620	c.1119C>T	c.(1117-1119)GCC>GCT	p.A373A	TMCC1_uc003emy.3_Silent_p.A49A|TMCC1_uc011blc.1_Silent_p.A194A|TMCC1_uc010htg.2_Silent_p.A259A	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	373						integral to membrane				skin(1)	1						GAATGAGTGAGGCAATCTCTC	0.532													22	113	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130311431	130311431	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130311431G>A	uc010htl.2	+	13	4350	c.4319G>A	c.(4318-4320)GGA>GAA	p.G1440E	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1440	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GGTACTAAGGGATGCTATGGC	0.413													13	66	---	---	---	---	PASS
SLCO2A1	6578	broad.mit.edu	37	3	133661470	133661470	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133661470G>T	uc003eqa.3	-	11	1878	c.1604C>A	c.(1603-1605)CCC>CAC	p.P535H	SLCO2A1_uc003eqb.3_Missense_Mutation_p.P459H|SLCO2A1_uc011blv.1_Missense_Mutation_p.P354H	NM_005630	NP_005621	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family,	535	Helical; Name=10; (Potential).				sodium-independent organic anion transport	integral to plasma membrane|membrane fraction	prostaglandin transmembrane transporter activity|protein binding			central_nervous_system(1)	1						CATGTAGAGGGGGTTGTGGGA	0.582													9	86	---	---	---	---	PASS
CLDN18	51208	broad.mit.edu	37	3	137717748	137717748	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137717748T>G	uc003ero.1	+	1	91	c.38T>G	c.(37-39)GTT>GGT	p.V13G		NM_001002026	NP_001002026	P56856	CLD18_HUMAN	claudin 18 isoform 2	13	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity			upper_aerodigestive_tract(1)|ovary(1)	2						GGGTTCGTGGTTTCACTGATT	0.557													56	180	---	---	---	---	PASS
CPA3	1359	broad.mit.edu	37	3	148601448	148601448	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148601448C>A	uc003ewm.2	+	9	879	c.827C>A	c.(826-828)GCA>GAA	p.A276E		NM_001870	NP_001861	P15088	CBPA3_HUMAN	carboxypeptidase A3 precursor	276					proteolysis	stored secretory granule|transport vesicle	metallocarboxypeptidase activity|zinc ion binding			breast(1)|skin(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			CGGGGCTCTGCACCAGAGTCC	0.473													35	158	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154145492	154145492	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154145492G>T	uc003faa.2	-	2	1087	c.987C>A	c.(985-987)CAC>CAA	p.H329Q		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	329	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GGACCACCATGTGCATCTGCA	0.498													9	107	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155212314	155212314	+	Intron	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155212314T>A	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTCCTGGCAGTTTTTAATCGA	0.358													13	116	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164908235	164908235	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164908235C>A	uc003fej.3	-	2	828	c.384G>T	c.(382-384)AAG>AAT	p.K128N	SLITRK3_uc003fek.2_Missense_Mutation_p.K128N	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	128	LRR 3.|Extracellular (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						GATATAGTCTCTTTAAAATCT	0.353										HNSCC(40;0.11)			28	103	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165491250	165491250	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165491250G>A	uc003fem.3	-	4	1889	c.1729C>T	c.(1729-1731)CGC>TGC	p.R577C	BCHE_uc003fen.3_RNA	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	577					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	TTGTTCCAGCGATGGAATCCT	0.318													12	98	---	---	---	---	PASS
MCF2L2	23101	broad.mit.edu	37	3	182947497	182947497	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182947497A>C	uc003fli.1	-	17	2092	c.2002T>G	c.(2002-2004)TTT>GTT	p.F668V	MCF2L2_uc003flj.1_Missense_Mutation_p.F668V|MCF2L2_uc011bqr.1_RNA	NM_015078	NP_055893	Q86YR7	MF2L2_HUMAN	Rho family guanine-nucleotide exchange factor	668	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			ovary(2)|large_intestine(2)|breast(1)	5	all_cancers(143;1.26e-12)|Ovarian(172;0.0355)		all cancers(12;3.35e-44)|Epithelial(37;6.48e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			CCAAAGAGAAAGTCCTTGTTA	0.353													19	260	---	---	---	---	PASS
ATP13A4	84239	broad.mit.edu	37	3	193232568	193232568	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193232568G>C	uc003ftd.2	-	2	261	c.153C>G	c.(151-153)TAC>TAG	p.Y51*	ATP13A4_uc003fte.1_Nonsense_Mutation_p.Y51*|ATP13A4_uc011bsr.1_5'UTR	NM_032279	NP_115655	Q4VNC1	AT134_HUMAN	ATPase type 13A4	51	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(2)	2	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		CTGGTCTCCAGTAAAACACCA	0.507													95	126	---	---	---	---	PASS
GP5	2814	broad.mit.edu	37	3	194118758	194118758	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194118758T>A	uc003ftv.1	-	2	285	c.254A>T	c.(253-255)CAC>CTC	p.H85L		NM_004488	NP_004479	P40197	GPV_HUMAN	glycoprotein V (platelet) precursor	85	LRR 1.|Extracellular (Potential).				blood coagulation, intrinsic pathway|cell adhesion|platelet activation	integral to plasma membrane				skin(2)|breast(1)	3	all_cancers(143;6.64e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;7.38e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.06e-05)		GGCGGAAATGTGGCTGTCGGA	0.602													15	127	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196387449	196387449	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196387449A>G	uc003fwv.2	+	3	1039	c.935A>G	c.(934-936)AAC>AGC	p.N312S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	312	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		AACGTGACCAACATCACCACC	0.597													25	155	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196387891	196387891	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196387891G>T	uc003fwv.2	+	3	1481	c.1377G>T	c.(1375-1377)AGG>AGT	p.R459S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	459	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		TGGATTTCAGGAATATGGCAT	0.567													40	264	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	853487	853487	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:853487G>A	uc003gbm.3	-	24	3389	c.3190C>T	c.(3190-3192)CAG>TAG	p.Q1064*	GAK_uc003gbn.3_Nonsense_Mutation_p.Q985*|GAK_uc010ibi.2_Nonsense_Mutation_p.Q245*|GAK_uc010ibj.2_RNA|GAK_uc003gbl.3_Nonsense_Mutation_p.Q917*	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	1064					cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		GGGGCCGGCTGACCTCCAGGA	0.617													20	110	---	---	---	---	PASS
WHSC1	7468	broad.mit.edu	37	4	1920071	1920071	+	Silent	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1920071A>T	uc003gdz.3	+	5	1307	c.1131A>T	c.(1129-1131)TCA>TCT	p.S377S	WHSC1_uc003geb.3_Silent_p.S377S|WHSC1_uc003gec.3_Silent_p.S377S|WHSC1_uc003ged.3_Silent_p.S377S|WHSC1_uc003gee.3_RNA|WHSC1_uc003gef.3_RNA|WHSC1_uc003gdx.2_Silent_p.S377S|WHSC1_uc003gdy.1_Silent_p.S377S|WHSC1_uc010icd.1_Silent_p.S377S|WHSC1_uc003gea.1_Silent_p.S377S|WHSC1_uc010ice.1_Silent_p.S377S|WHSC1_uc003geh.1_Silent_p.S377S	NM_001042424	NP_001035889	O96028	NSD2_HUMAN	Wolf-Hirschhorn syndrome candidate 1 protein	377					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|cytoplasm|nuclear membrane|nucleolus	DNA binding|histone-lysine N-methyltransferase activity|zinc ion binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9		all_epithelial(65;1.34e-05)	OV - Ovarian serous cystadenocarcinoma(23;0.00606)	STAD - Stomach adenocarcinoma(129;0.232)		CAGAATCCTCAGGAGTCAGTG	0.517			T	IGH@	MM								36	108	---	---	---	---	PASS
POLN	353497	broad.mit.edu	37	4	2130962	2130962	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2130962G>T	uc003ger.2	-	16	1811	c.1811C>A	c.(1810-1812)ACG>AAG	p.T604K	POLN_uc010icg.1_Missense_Mutation_p.T52K|POLN_uc010ich.1_Missense_Mutation_p.T136K	NM_181808	NP_861524	Q7Z5Q5	DPOLN_HUMAN	DNA-directed DNA polymerase nu	604					DNA repair|DNA replication	nucleus	DNA binding|DNA-directed DNA polymerase activity			kidney(2)|ovary(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(23;0.0955)			CGGGGAGATCGTGAGAATCTT	0.393								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					11	73	---	---	---	---	PASS
CYTL1	54360	broad.mit.edu	37	4	5018600	5018600	+	Missense_Mutation	SNP	C	T	T	rs138259359		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5018600C>T	uc003gig.2	-	3	315	c.290G>A	c.(289-291)CGG>CAG	p.R97Q		NM_018659	NP_061129	Q9NRR1	CYTL1_HUMAN	cytokine-like 1 precursor	97					signal transduction	extracellular space|soluble fraction	receptor binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.164)		GTACAGCTTCCGTGCTTTGTC	0.493													51	291	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5141673	5141673	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5141673G>C	uc003gih.1	+	2	158	c.94G>C	c.(94-96)GGG>CGG	p.G32R	STK32B_uc010ida.1_5'UTR	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	32	ATP (By similarity).|Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CATTGGTAAAGGGAGTTTTGG	0.408													56	207	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5141674	5141674	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5141674G>T	uc003gih.1	+	2	159	c.95G>T	c.(94-96)GGG>GTG	p.G32V	STK32B_uc010ida.1_5'UTR	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	32	ATP (By similarity).|Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						ATTGGTAAAGGGAGTTTTGGA	0.408													53	209	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5620295	5620295	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5620295C>A	uc003gij.2	-	15	2670	c.2616G>T	c.(2614-2616)CGG>CGT	p.R872R	EVC2_uc011bwb.1_Silent_p.R312R|EVC2_uc003gik.2_Silent_p.R792R	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	872						integral to membrane				large_intestine(3)|ovary(2)	5						GAACTCGGGCCCGGATCTTGG	0.602													26	64	---	---	---	---	PASS
TBC1D14	57533	broad.mit.edu	37	4	6925386	6925386	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6925386G>T	uc011bwg.1	+	2	349	c.270G>T	c.(268-270)CAG>CAT	p.Q90H	TBC1D14_uc003gjs.3_Missense_Mutation_p.Q90H	NM_001113361	NP_001106832	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14 isoform a	90						intracellular	Rab GTPase activator activity			ovary(1)|pancreas(1)	2						GGAGGAAGCAGTCCGACTCCG	0.682													40	104	---	---	---	---	PASS
PPARGC1A	10891	broad.mit.edu	37	4	23803878	23803878	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:23803878C>G	uc003gqs.2	-	11	2230	c.2110G>C	c.(2110-2112)GAG>CAG	p.E704Q	PPARGC1A_uc003gqt.2_RNA	NM_013261	NP_037393	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor	704	RRM.				androgen receptor signaling pathway|brown fat cell differentiation|cellular glucose homeostasis|digestion|fatty acid oxidation|gluconeogenesis|mitochondrion organization|mRNA processing|neuron death|positive regulation of fatty acid oxidation|positive regulation of gluconeogenesis|positive regulation of histone acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|protein complex assembly|protein stabilization|response to muscle activity|response to starvation|RNA splicing|temperature homeostasis|transcription initiation from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	androgen receptor binding|DNA binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|RNA binding|RNA polymerase II transcription cofactor activity|transcription factor binding			ovary(2)|lung(2)|kidney(2)|skin(2)	8		Breast(46;0.0503)				GTGCACTCCTCAATTTCACCA	0.423													20	162	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36179599	36179599	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36179599T>C	uc003gsq.1	-	9	2045	c.1707A>G	c.(1705-1707)CTA>CTG	p.L569L	ARAP2_uc003gsr.1_Silent_p.L569L	NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH	569	PH 1.				regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						GTGCATTTAATAGTATGCTGA	0.368													34	87	---	---	---	---	PASS
WDR19	57728	broad.mit.edu	37	4	39219646	39219646	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39219646G>C	uc003gtv.2	+	14	1554	c.1400G>C	c.(1399-1401)CGG>CCG	p.R467P	WDR19_uc003gtu.1_Missense_Mutation_p.G466R|WDR19_uc011byi.1_Missense_Mutation_p.R307P|WDR19_uc003gtw.1_Missense_Mutation_p.R64P	NM_025132	NP_079408	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	467					cell projection organization	microtubule basal body|motile cilium|photoreceptor connecting cilium	binding			large_intestine(1)	1						CGTGAGACTCGGCTTTTCCCA	0.373													56	353	---	---	---	---	PASS
TEC	7006	broad.mit.edu	37	4	48147470	48147470	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48147470C>A	uc003gxz.2	-	13	1299	c.1208G>T	c.(1207-1209)GGT>GTT	p.G403V		NM_003215	NP_003206	P42680	TEC_HUMAN	tec protein tyrosine kinase	403	Protein kinase.				intracellular protein kinase cascade	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|stomach(1)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)	9						GCACATTGCACCTTCCCGAAT	0.448													58	202	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	4	69337231	69337231	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69337231C>G	uc003hdz.3	+	5	444	c.380C>G	c.(379-381)TCT>TGT	p.S127C		NM_014058	NP_054777			transmembrane protease, serine 11E																		AGATTTCACTCTACTGAGGAT	0.348													73	538	---	---	---	---	PASS
UGT2B15	7366	broad.mit.edu	37	4	69513034	69513034	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69513034C>A	uc011cal.1	-	6	1419	c.1381G>T	c.(1381-1383)GCA>TCA	p.A461S		NM_001076	NP_001067	P54855	UDB15_HUMAN	UDP glycosyltransferase 2B15 precursor	461					steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity				0						CAGAAGACTGCTCGATCCAGG	0.423													78	208	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71508517	71508517	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71508517G>A	uc011caw.1	+	9	1655	c.1374G>A	c.(1372-1374)TGG>TGA	p.W458*		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	458					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			CCAGCCCCTGGAGAAACTCTC	0.388													22	74	---	---	---	---	PASS
ENAM	10117	broad.mit.edu	37	4	71509842	71509842	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71509842C>G	uc011caw.1	+	9	2980	c.2699C>G	c.(2698-2700)CCT>CGT	p.P900R		NM_031889	NP_114095	Q9NRM1	ENAM_HUMAN	enamelin precursor	900					bone mineralization|odontogenesis	proteinaceous extracellular matrix	structural constituent of tooth enamel			ovary(3)	3			Lung(101;0.235)			GGTCTTGCACCTGGGGAGAAC	0.517													39	110	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73003863	73003863	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73003863C>A	uc003hgg.2	+						NPFFR2_uc010iig.1_Intron|NPFFR2_uc003hgi.2_Intron|NPFFR2_uc003hgh.2_Intron	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1						detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ATAGGTAAGTCTGCACCAAAC	0.373													11	56	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73179413	73179413	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73179413G>C	uc003hgk.1	-	12	1763	c.1726C>G	c.(1726-1728)CGC>GGC	p.R576G	ADAMTS3_uc003hgl.2_5'Flank	NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	576	TSP type-1 1.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			TTGCACTGGCGTGTTCTGAAA	0.378													13	107	---	---	---	---	PASS
NUDT9	53343	broad.mit.edu	37	4	88356355	88356355	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88356355G>T	uc003hqq.2	+	2	653	c.330G>T	c.(328-330)TGG>TGT	p.W110C	NUDT9_uc003hqr.2_Missense_Mutation_p.W60C|NUDT9_uc010ikl.2_Missense_Mutation_p.W110C	NM_024047	NP_076952	Q9BW91	NUDT9_HUMAN	nudix-type motif 9 isoform a	110						mitochondrion	ADP-ribose diphosphatase activity				0		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GACCCAGGTGGGCAGATCCTC	0.453													30	60	---	---	---	---	PASS
IBSP	3381	broad.mit.edu	37	4	88732843	88732843	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88732843A>C	uc003hqx.3	+	7	833	c.735A>C	c.(733-735)AGA>AGC	p.R245S		NM_004967	NP_004958	P21815	SIAL_HUMAN	integrin-binding sialoprotein precursor	245					biomineral tissue development|cell adhesion|ossification						0		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000333)|COAD - Colon adenocarcinoma(81;0.154)		AAGTCTATAGAACCACTTCCC	0.502													18	49	---	---	---	---	PASS
ADH6	130	broad.mit.edu	37	4	100129813	100129813	+	Intron	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100129813A>G	uc003hup.3	-						uc003hum.1_Intron|ADH6_uc003huo.2_Intron|ADH6_uc011cef.1_Intron|ADH6_uc010ile.2_Intron	NM_000672	NP_000663	P28332	ADH6_HUMAN	class V alcohol dehydrogenase isoform 2						ethanol oxidation|response to ethanol|xenobiotic metabolic process	cytosol	alcohol dehydrogenase (NAD) activity|electron carrier activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(123;3.58e-08)	Abacavir(DB01048)|NADH(DB00157)	TTCACTCCAGAGGATTACATA	0.348													92	198	---	---	---	---	PASS
TBCK	93627	broad.mit.edu	37	4	107156479	107156479	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:107156479C>G	uc010ilv.2	-	15	1761	c.1396G>C	c.(1396-1398)GAC>CAC	p.D466H	TBCK_uc003hyb.2_Missense_Mutation_p.D209H|TBCK_uc003hye.2_Missense_Mutation_p.D427H|TBCK_uc003hyc.2_Missense_Mutation_p.D403H|TBCK_uc003hyd.2_Missense_Mutation_p.D294H|TBCK_uc003hyf.2_Missense_Mutation_p.D466H	NM_001163435	NP_001156907	Q8TEA7	TBCK_HUMAN	TBC domain-containing protein kinase-like	466	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			large_intestine(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)	5						GGAGGAATGTCAACTCTTGCT	0.348													14	47	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114199653	114199653	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114199653A>G	uc003ibe.3	+	17	1920	c.1820A>G	c.(1819-1821)GAC>GGC	p.D607G	ANK2_uc003ibd.3_Missense_Mutation_p.D586G|ANK2_uc003ibf.3_Missense_Mutation_p.D607G|ANK2_uc003ibc.2_Missense_Mutation_p.D583G|ANK2_uc011cgb.1_Missense_Mutation_p.D622G	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	607	ANK 18.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCTCATTATGACAACCAGAAG	0.493											OREG0016024	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	77	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114239775	114239775	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114239775G>T	uc003ibe.3	+	26	2999	c.2899G>T	c.(2899-2901)GGT>TGT	p.G967C	ANK2_uc003ibd.3_Missense_Mutation_p.G946C|ANK2_uc003ibf.3_Missense_Mutation_p.G967C|ANK2_uc011cgc.1_Missense_Mutation_p.G176C|ANK2_uc003ibg.3_Translation_Start_Site|ANK2_uc003ibc.2_Missense_Mutation_p.G943C|ANK2_uc011cgb.1_Missense_Mutation_p.G982C	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	967	ZU5.|Interaction with SPTBN1.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TATTCATTCAGGGTGAGTAAA	0.428													16	28	---	---	---	---	PASS
SMAD1	4086	broad.mit.edu	37	4	146479017	146479017	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:146479017C>T	uc003ikc.2	+	7	1745	c.1329C>T	c.(1327-1329)CCC>CCT	p.P443P	SMAD1_uc003ikd.2_Silent_p.P443P|SMAD1_uc010iov.2_Silent_p.P443P|SMAD1_uc011cic.1_Silent_p.P404P	NM_005900	NP_005891	Q15797	SMAD1_HUMAN	Sma- and Mad-related protein 1	443	MH2.				BMP signaling pathway|embryonic pattern specification|primary miRNA processing|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway	cytosol|integral to membrane|nuclear inner membrane	co-SMAD binding|I-SMAD binding|identical protein binding|protein kinase binding|sequence-specific DNA binding transcription factor activity|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity			ovary(1)	1	all_hematologic(180;0.151)					TGCACGGCCCCCTCCAGTGGC	0.488											OREG0016348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	80	167	---	---	---	---	PASS
DCLK2	166614	broad.mit.edu	37	4	151153969	151153969	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151153969G>T	uc003ilm.3	+	10	1655	c.1555G>T	c.(1555-1557)GAG>TAG	p.E519*	DCLK2_uc003iln.3_Nonsense_Mutation_p.E518*|DCLK2_uc003ilo.3_Nonsense_Mutation_p.E536*|DCLK2_uc003ilp.3_RNA	NM_001040260	NP_001035350	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2 isoform a	519	Protein kinase.				intracellular signal transduction	cytoplasm|cytoskeleton	ATP binding|protein serine/threonine kinase activity			ovary(3)	3	all_hematologic(180;0.151)					CATCAAACCAGAGAATCTCTT	0.443													91	228	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186379985	186379985	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186379985C>A	uc003ixu.3	-	6	1832	c.1756G>T	c.(1756-1758)GAA>TAA	p.E586*	CCDC110_uc003ixv.3_Nonsense_Mutation_p.E549*|CCDC110_uc011ckt.1_Nonsense_Mutation_p.E586*	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	586	Potential.					nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		TCTAACATTTCTTTTTCATCT	0.308													47	54	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	143301	143301	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143301C>T	uc003jak.2	+	2	599	c.549C>T	c.(547-549)CCC>CCT	p.P183P		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	183					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GAGACTTCCCCAGCCAGGTGC	0.672													50	194	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9630156	9630156	+	5'UTR	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9630156A>G	uc003jem.1	-	1						NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1						chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						TTAGGaataaaaaattattta	0.338													18	36	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13885213	13885213	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13885213G>A	uc003jfd.2	-	19	2910	c.2868C>T	c.(2866-2868)CGC>CGT	p.R956R		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	956	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGAGTAACTCGCGGGCTTCTT	0.443									Kartagener_syndrome				31	136	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32074332	32074332	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32074332C>A	uc003jhl.2	+	18	3508	c.3120C>A	c.(3118-3120)GAC>GAA	p.D1040E	PDZD2_uc003jhm.2_Missense_Mutation_p.D1040E|PDZD2_uc011cnx.1_Missense_Mutation_p.D866E	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	1040					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GCTCAGTGGACTTAGAGGAGA	0.592													29	150	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41058234	41058234	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41058234G>T	uc003jmj.3	-	7	1177	c.687C>A	c.(685-687)TAC>TAA	p.Y229*	HEATR7B2_uc003jmi.3_5'UTR	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	229	HEAT 2.						binding			ovary(6)|central_nervous_system(2)	8						GGCCCAGGGCGTATCCACGGA	0.517													54	56	---	---	---	---	PASS
CMYA5	202333	broad.mit.edu	37	5	79054627	79054627	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79054627C>A	uc003kgc.2	+	7	11234	c.11162C>A	c.(11161-11163)ACA>AAA	p.T3721K		NM_153610	NP_705838	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3721	Fibronectin type-III 1.					perinuclear region of cytoplasm				ovary(6)|pancreas(2)|lung(1)	9		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		GCCACCAGCACAACAATTGCA	0.373													29	80	---	---	---	---	PASS
ANKRD34B	340120	broad.mit.edu	37	5	79854552	79854552	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:79854552C>A	uc010jam.2	-	4	1637	c.1287G>T	c.(1285-1287)AGG>AGT	p.R429S	ANKRD34B_uc003kgw.2_Silent_p.G429G|ANKRD34B_uc010jan.2_Missense_Mutation_p.R429S	NM_001004441	NP_001004441	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	429				R -> G (in Ref. 1; CAH18341).		cytoplasm|nucleus				pancreas(1)	1		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		CTGAACCTCGCCTTTCTAAAA	0.468													72	136	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101572647	101572647	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101572647G>T	uc003knm.2	-	13	2377	c.2090C>A	c.(2089-2091)ACA>AAA	p.T697K		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	697	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		TGACACATCTGTGGCTGATGG	0.328													45	100	---	---	---	---	PASS
SLC27A6	28965	broad.mit.edu	37	5	128301899	128301899	+	Silent	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128301899G>C	uc003kuy.2	+	2	465	c.69G>C	c.(67-69)CTG>CTC	p.L23L	SLC27A6_uc003kuz.2_Silent_p.L23L	NM_014031	NP_054750	Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid	23	Helical; (Potential).				long-chain fatty acid transport|transmembrane transport|very long-chain fatty acid metabolic process	integral to membrane|sarcolemma	fatty acid transporter activity|long-chain fatty acid-CoA ligase activity|nucleotide binding				0		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		AGAAACTCCTGTTCCCTTACT	0.502													41	103	---	---	---	---	PASS
C5orf15	56951	broad.mit.edu	37	5	133295551	133295551	+	Silent	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133295551T>A	uc003kyo.2	-	2	431	c.300A>T	c.(298-300)GCA>GCT	p.A100A		NM_020199	NP_064584	Q8NC54	KCT2_HUMAN	keratinocytes associated transmembrane protein 2	100	Extracellular (Potential).					integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			GGACCACAGATGCTCCTCCAC	0.468													25	35	---	---	---	---	PASS
PCDHA8	56140	broad.mit.edu	37	5	140222998	140222998	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140222998G>C	uc003lhs.2	+	1	2092	c.2092G>C	c.(2092-2094)GTG>CTG	p.V698L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhr.1_Missense_Mutation_p.V698L	NM_018911	NP_061734	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8 isoform 1 precursor	698	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			upper_aerodigestive_tract(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGATGTCAACGTGTACCTGAT	0.642													30	69	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140573390	140573390	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140573390C>T	uc003lix.2	+	1	1439	c.1265C>T	c.(1264-1266)ACC>ATC	p.T422I		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	422	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ATCACTATCACCGTCACTGAC	0.517													46	95	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140736415	140736415	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140736415C>A	uc003ljq.1	+	1	1648	c.1648C>A	c.(1648-1650)CTC>ATC	p.L550I	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Missense_Mutation_p.L550I	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	550	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCACTGAGCCTCTTTGTGCT	0.562													119	268	---	---	---	---	PASS
PCDHGB7	56099	broad.mit.edu	37	5	140797688	140797688	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140797688G>A	uc003lkn.1	+	1	407	c.262G>A	c.(262-264)GAC>AAC	p.D88N	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkm.2_Missense_Mutation_p.D88N|PCDHGA11_uc003lko.1_5'Flank|PCDHGA11_uc003lkp.1_5'Flank|PCDHGA11_uc003lkq.1_5'Flank	NM_018927	NP_061750	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7 isoform 1	88	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTTGTGAAGGACCGAATAGA	0.493													40	110	---	---	---	---	PASS
ABLIM3	22885	broad.mit.edu	37	5	148627364	148627364	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148627364G>T	uc003lpy.2	+	18	1822	c.1571G>T	c.(1570-1572)CGG>CTG	p.R524L	ABLIM3_uc003lpz.1_Missense_Mutation_p.R524L|ABLIM3_uc003lqa.1_Missense_Mutation_p.R421L|ABLIM3_uc003lqb.2_Missense_Mutation_p.R413L|ABLIM3_uc003lqc.1_Missense_Mutation_p.R491L|ABLIM3_uc003lqd.1_Missense_Mutation_p.R429L|ABLIM3_uc003lqf.2_Missense_Mutation_p.R413L|ABLIM3_uc003lqe.1_Missense_Mutation_p.R413L	NM_014945	NP_055760	O94929	ABLM3_HUMAN	actin binding LIM protein family, member 3	524					axon guidance|cytoskeleton organization	cytoplasm	actin binding|zinc ion binding			ovary(2)|skin(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAATTGGCCGGCTGATTCTG	0.572													21	73	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153190660	153190660	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153190660G>T	uc003lva.3	+	16	2961	c.2596G>T	c.(2596-2598)GGA>TGA	p.G866*	GRIA1_uc003luy.3_Nonsense_Mutation_p.G866*|GRIA1_uc003luz.3_Nonsense_Mutation_p.G771*|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Nonsense_Mutation_p.G786*|GRIA1_uc011dcx.1_Nonsense_Mutation_p.G797*|GRIA1_uc011dcy.1_Nonsense_Mutation_p.G876*|GRIA1_uc011dcz.1_Nonsense_Mutation_p.G876*	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	866	Cytoplasmic (Potential).			AGA -> TAP (in Ref. 1; AAA58613).	synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CAGCGGGGCAGGAGCCAGCAG	0.572													33	24	---	---	---	---	PASS
GABRG2	2566	broad.mit.edu	37	5	161524751	161524751	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161524751C>A	uc003lyz.3	+	4	793	c.435C>A	c.(433-435)ATC>ATA	p.I145I	GABRG2_uc010jjc.2_Silent_p.I145I|GABRG2_uc003lyy.3_Silent_p.I145I|GABRG2_uc011dej.1_Silent_p.I50I	NM_000816	NP_000807	P18507	GBRG2_HUMAN	gamma-aminobutyric acid A receptor, gamma 2	145	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|protein binding			ovary(4)|skin(1)	5	Renal(175;0.000319)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0734)|OV - Ovarian serous cystadenocarcinoma(192;0.135)|Epithelial(171;0.136)		TGGGGAAAATCTGGATTCCAG	0.423													7	159	---	---	---	---	PASS
ODZ2	57451	broad.mit.edu	37	5	167655043	167655043	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167655043C>A	uc010jjd.2	+	25	5401	c.5401C>A	c.(5401-5403)CTG>ATG	p.L1801M	ODZ2_uc003lzr.3_Missense_Mutation_p.L1571M|ODZ2_uc003lzt.3_Missense_Mutation_p.L1174M|ODZ2_uc010jje.2_Missense_Mutation_p.L1065M	NM_001122679	NP_001116151			odz, odd Oz/ten-m homolog 2											ovary(6)|central_nervous_system(4)	10	Renal(175;0.00124)|Lung NSC(126;0.136)|all_lung(126;0.242)	Medulloblastoma(196;0.0241)|all_neural(177;0.026)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0444)|OV - Ovarian serous cystadenocarcinoma(192;0.0694)|Epithelial(171;0.124)		CAACATCTCCCTGCCTATGGA	0.532													3	42	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169494609	169494609	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169494609C>A	uc003maf.2	+	45	4643	c.4563C>A	c.(4561-4563)ACC>ACA	p.T1521T	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.T1013T|DOCK2_uc003mah.2_Silent_p.T77T	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1521	DHR-2.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTGATGAGACCCTCCCCATCA	0.502													34	127	---	---	---	---	PASS
FOXI1	2299	broad.mit.edu	37	5	169533463	169533463	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169533463C>T	uc003mai.3	+	1	547	c.502C>T	c.(502-504)CAG>TAG	p.Q168*	FOXI1_uc003maj.3_Nonsense_Mutation_p.Q168*	NM_012188	NP_036320	Q12951	FOXI1_HUMAN	forkhead box I1 isoform a	168	Fork-head.				epidermal cell fate specification|otic placode formation|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|transcription regulatory region DNA binding			breast(3)|central_nervous_system(1)	4	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCCGGCTGGCAGAACTCCAT	0.617									Pendred_syndrome				11	43	---	---	---	---	PASS
RANBP17	64901	broad.mit.edu	37	5	170610348	170610348	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:170610348G>A	uc003mba.2	+	18	1968	c.1952G>A	c.(1951-1953)GGC>GAC	p.G651D	RANBP17_uc003mbb.2_5'UTR|RANBP17_uc003mbd.2_Missense_Mutation_p.G14D|RANBP17_uc010jjs.2_RNA|RANBP17_uc003mbc.2_Missense_Mutation_p.G14D	NM_022897	NP_075048	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	651					mRNA transport|protein import into nucleus|transmembrane transport	cytoplasm|nuclear pore	GTP binding|protein transporter activity			ovary(2)|central_nervous_system(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CCTTTTCTTGGCATCAGTGAC	0.388			T	TRD@	ALL								31	76	---	---	---	---	PASS
FKSG83	83954	broad.mit.edu	37	6	27293586	27293586	+	Silent	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27293586A>G	uc010jqt.2	+	1	1009	c.525A>G	c.(523-525)AGA>AGG	p.R175R	FKSG83_uc010jqs.1_3'UTR	NM_032030	NP_114419	Q3KNW7	Q3KNW7_HUMAN	FKSG83	175						integral to membrane	pheromone receptor activity				0						TGCATCAAAGAAATCCTGATA	0.244													16	23	---	---	---	---	PASS
OR12D3	81797	broad.mit.edu	37	6	29342388	29342388	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29342388T>C	uc003nme.2	-	1	681	c.677A>G	c.(676-678)AAG>AGG	p.K226R		NM_030959	NP_112221	Q9UGF7	O12D3_HUMAN	olfactory receptor, family 12, subfamily D,	226	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3						GGACCTGTTCTTAAACAGAAG	0.438													45	111	---	---	---	---	PASS
GNL1	2794	broad.mit.edu	37	6	30523898	30523898	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30523898C>A	uc003nqh.2	-						GNL1_uc011dmi.1_5'Flank|GNL1_uc011dmj.1_5'Flank|GNL1_uc011dmk.1_Intron|PRR3_uc003nqi.1_5'Flank|PRR3_uc003nqj.1_5'Flank	NM_005275	NP_005266	P36915	GNL1_HUMAN	guanine nucleotide binding protein-like 1						response to DNA damage stimulus|signal transduction|T cell mediated immunity	extracellular space|intracellular	GTP binding|structural molecule activity			ovary(3)	3						CCTCCCGCTCCCGCACTGACC	0.662													15	61	---	---	---	---	PASS
GRM4	2914	broad.mit.edu	37	6	34101084	34101084	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34101084C>T	uc003oir.3	-	1	360	c.190G>A	c.(190-192)GGC>AGC	p.G64S	GRM4_uc011dsn.1_Missense_Mutation_p.G64S|GRM4_uc010jvh.2_Missense_Mutation_p.G64S|GRM4_uc010jvi.2_5'UTR|GRM4_uc010jvk.1_5'UTR	NM_000841	NP_000832	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4 precursor	64	Extracellular (Potential).				activation of MAPK activity|inhibition of adenylate cyclase activity by metabotropic glutamate receptor signaling pathway|neuroprotection|neurotransmitter secretion|positive regulation of MAPKKK cascade	cytoplasmic vesicle|integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)|skin(1)	6					L-Glutamic Acid(DB00142)	CAGGGCTTGCCCTCTGAGCCC	0.607													7	73	---	---	---	---	PASS
ANKS1A	23294	broad.mit.edu	37	6	34957033	34957033	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34957033G>T	uc003ojx.3	+	9	1384	c.1242G>T	c.(1240-1242)CCG>CCT	p.P414P	ANKS1A_uc011dss.1_Intron|ANKS1A_uc011dst.1_5'UTR|ANKS1A_uc010jvp.1_5'UTR	NM_015245	NP_056060	Q92625	ANS1A_HUMAN	ankyrin repeat and sterile alpha motif domain	414						cytoplasm	protein binding			ovary(3)|upper_aerodigestive_tract(1)	4						CAAAGCCACCGCCCGATGAAG	0.413													63	215	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39847238	39847238	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39847238G>T	uc003oow.2	+	14	1986	c.1830G>T	c.(1828-1830)TGG>TGT	p.W610C	DAAM2_uc010jxc.2_Missense_Mutation_p.W610C|DAAM2_uc003oox.2_Missense_Mutation_p.W610C	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of	610	FH2.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CCTTCAACTGGGTGAAGCTGA	0.607													24	150	---	---	---	---	PASS
DAAM2	23500	broad.mit.edu	37	6	39855255	39855255	+	Intron	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39855255G>A	uc003oow.2	+						DAAM2_uc003oox.2_Intron|uc003ooz.1_5'Flank	NM_015345	NP_056160	Q86T65	DAAM2_HUMAN	dishevelled associated activator of						actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)|skin(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					TGACTTGTTGGTTGCAGAAAG	0.557													22	27	---	---	---	---	PASS
UBR2	23304	broad.mit.edu	37	6	42641542	42641542	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42641542G>T	uc011dur.1	+	37	4100	c.4100G>T	c.(4099-4101)AGG>ATG	p.R1367M	UBR2_uc011dus.1_Missense_Mutation_p.R1012M|UBR2_uc003osh.2_RNA|UBR2_uc011dut.1_Translation_Start_Site	NM_015255	NP_056070	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin	1367					cellular response to leucine|chromatin silencing|histone H2A ubiquitination|negative regulation of TOR signaling cascade	nucleus|plasma membrane	leucine binding|zinc ion binding			ovary(3)|pancreas(1)	4	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			GACTGTCTTAGGTCATTGACG	0.393													23	116	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72678775	72678775	+	Intron	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72678775G>A	uc003pga.2	+							NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1						calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCGTGAGTATGGCATTGGTTT	0.468													34	168	---	---	---	---	PASS
BCKDHB	594	broad.mit.edu	37	6	80837262	80837262	+	Splice_Site	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:80837262A>T	uc003pjd.2	+	2	264	c.197_splice	c.e2-2	p.G66_splice	BCKDHB_uc003pje.2_Splice_Site_p.G66_splice	NM_000056	NP_000047	P21953	ODBB_HUMAN	branched chain keto acid dehydrogenase E1 beta						branched chain family amino acid catabolic process	mitochondrial alpha-ketoglutarate dehydrogenase complex	3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) activity|carboxy-lyase activity|protein binding				0		all_cancers(76;1.38e-05)|Acute lymphoblastic leukemia(125;1.15e-05)|all_hematologic(105;0.00118)|all_epithelial(107;0.0149)		BRCA - Breast invasive adenocarcinoma(397;0.0291)		TGATTTTCACAGGGCAAACTC	0.343													34	224	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97053784	97053784	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97053784G>T	uc003pos.1	+	5	746	c.341G>T	c.(340-342)CGC>CTC	p.R114L	FHL5_uc003pot.1_Missense_Mutation_p.R114L	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	114	LIM zinc-binding 2.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		ACAGGTTCCCGCAAAATGGAA	0.353													16	96	---	---	---	---	PASS
KLHL32	114792	broad.mit.edu	37	6	97561755	97561755	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97561755C>A	uc010kcm.1	+	7	1196	c.724C>A	c.(724-726)CAT>AAT	p.H242N	KLHL32_uc003poy.2_Missense_Mutation_p.H242N|KLHL32_uc011ead.1_Missense_Mutation_p.H206N|KLHL32_uc003poz.2_Intron|KLHL32_uc011eae.1_Missense_Mutation_p.H173N|KLHL32_uc003ppa.2_Intron	NM_052904	NP_443136	Q96NJ5	KLH32_HUMAN	kelch-like 32	242										ovary(3)|skin(1)	4		all_cancers(76;1.19e-06)|Acute lymphoblastic leukemia(125;5.83e-10)|all_hematologic(75;3.67e-07)|all_epithelial(107;0.00778)|Colorectal(196;0.122)		BRCA - Breast invasive adenocarcinoma(108;0.0558)		GGATACTCTCCATACAGTTGC	0.537													34	208	---	---	---	---	PASS
TSPYL1	7259	broad.mit.edu	37	6	116600879	116600879	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116600879G>T	uc003pwp.3	-	1	402	c.115C>A	c.(115-117)CAA>AAA	p.Q39K	DSE_uc011ebf.1_Intron|DSE_uc003pwq.1_5'UTR|DSE_uc003pwr.2_5'Flank|DSE_uc003pws.2_5'Flank	NM_003309	NP_003300	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	39					nucleosome assembly	nucleolus					0		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		GCCTCGCTTTGGTCGCGGAGC	0.652													18	111	---	---	---	---	PASS
RFX6	222546	broad.mit.edu	37	6	117241515	117241515	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117241515A>T	uc003pxm.2	+	12	1288	c.1225A>T	c.(1225-1227)ATG>TTG	p.M409L		NM_173560	NP_775831	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	409					glucose homeostasis|pancreatic A cell differentiation|pancreatic D cell differentiation|pancreatic E cell differentiation|positive regulation of transcription, DNA-dependent|regulation of insulin secretion|transcription, DNA-dependent|type B pancreatic cell differentiation	nucleus	protein binding|transcription regulatory region DNA binding			ovary(1)|pancreas(1)|skin(1)	3						CGTTAATTCTATGGTGTCTGA	0.403													80	268	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132204869	132204869	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132204869G>T	uc011ecf.1	+	22	2286	c.2266G>T	c.(2266-2268)GCT>TCT	p.A756S		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	756	Nuclease.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	ATATTCTGAAGCTTTGCTTAC	0.274													32	147	---	---	---	---	PASS
HBS1L	10767	broad.mit.edu	37	6	135363228	135363228	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135363228G>A	uc003qez.2	-	3	353	c.146C>T	c.(145-147)TCC>TTC	p.S49F	HBS1L_uc011ecy.1_5'UTR|HBS1L_uc011ecz.1_Intron|HBS1L_uc011eda.1_Intron|HBS1L_uc003qfa.2_Missense_Mutation_p.S49F	NM_006620	NP_006611	Q9Y450	HBS1L_HUMAN	Hsp70 subfamily B suppressor 1-like protein	49					signal transduction		GTP binding|GTPase activity|translation elongation factor activity			skin(2)	2	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		AGGCTCAACGGAAGGTTTGTC	0.343													21	58	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152638029	152638029	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152638029T>C	uc010kiw.2	-	87	17267	c.16665A>G	c.(16663-16665)GCA>GCG	p.A5555A	SYNE1_uc010kiv.2_Silent_p.A79A|SYNE1_uc003qos.3_Silent_p.A79A|SYNE1_uc003qot.3_Silent_p.A5484A|SYNE1_uc003qou.3_Silent_p.A5555A|SYNE1_uc010kiz.2_Silent_p.A1310A	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5555	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGAATTCCATGCAATAGTTC	0.333										HNSCC(10;0.0054)			28	86	---	---	---	---	PASS
MAS1	4142	broad.mit.edu	37	6	160328057	160328057	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160328057T>A	uc003qsz.2	+	1	84	c.70T>A	c.(70-72)TCA>ACA	p.S24T		NM_002377	NP_002368	P04201	MAS_HUMAN	MAS1 oncogene	24	Extracellular (Potential).				anatomical structure morphogenesis|cell proliferation|protein kinase C signaling cascade	integral to plasma membrane	angiotensin type II receptor activity			ovary(2)|lung(2)	4		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		CAGGAACGCCTCAGTCGGGAA	0.517													28	159	---	---	---	---	PASS
GPR31	2853	broad.mit.edu	37	6	167571221	167571221	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167571221C>A	uc011egq.1	-	1	99	c.99G>T	c.(97-99)GCG>GCT	p.A33A		NM_005299	NP_005290	O00270	GPR31_HUMAN	G protein-coupled receptor 31	33	Helical; Name=1; (Potential).					integral to plasma membrane	G-protein coupled receptor activity				0		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		ACAGCGCCACCGCGTTGCCCA	0.647													8	48	---	---	---	---	PASS
KIF25	3834	broad.mit.edu	37	6	168430290	168430290	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168430290C>T	uc003qwk.1	+	2	287	c.25C>T	c.(25-27)CAG>TAG	p.Q9*	KIF25_uc010kkt.1_RNA|KIF25_uc003qwl.1_Nonsense_Mutation_p.Q9*	NM_030615	NP_085118	Q9UIL4	KIF25_HUMAN	kinesin family member 25 isoform 1	9	Kinesin-motor.				microtubule-based movement|mitotic sister chromatid segregation	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(1)|pancreas(1)	2		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AGGTCAGCTTCAGCGTGAGAA	0.627													38	363	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169648707	169648707	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169648707G>A	uc003qwt.2	-	4	662	c.414C>T	c.(412-414)TCC>TCT	p.S138S		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	138	TSP N-terminal.|Heparin-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CGTCCTCCAGGGAGACCACAT	0.642													26	92	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20782677	20782677	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20782677G>T	uc003suw.3	+	16	2413	c.1867G>T	c.(1867-1869)GAC>TAC	p.D623Y	ABCB5_uc010kuh.2_Missense_Mutation_p.D1068Y	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	623	Cytoplasmic (Potential).|ABC transporter 2.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						GAGACTTTATGACCCCGTGCA	0.478													18	35	---	---	---	---	PASS
GRB10	2887	broad.mit.edu	37	7	50680468	50680468	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50680468C>A	uc003tpi.2	-	10	1195	c.1164G>T	c.(1162-1164)ACG>ACT	p.T388T	GRB10_uc003tph.3_Silent_p.T330T|GRB10_uc003tpj.2_Silent_p.T342T|GRB10_uc003tpk.2_Silent_p.T388T|GRB10_uc010kzb.2_Silent_p.T330T|GRB10_uc003tpl.2_Silent_p.T382T|GRB10_uc003tpm.2_Silent_p.T330T|GRB10_uc003tpn.2_Silent_p.T330T	NM_005311	NP_005302	Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10 isoform	388	PH.				insulin receptor signaling pathway|insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway	cytosol|plasma membrane	insulin receptor binding|insulin receptor binding|SH3/SH2 adaptor activity			lung(3)|ovary(2)|upper_aerodigestive_tract(1)	6	Glioma(55;0.08)|all_neural(89;0.245)					TCATCCAGCACGTCCTGGTTT	0.473									Russell-Silver_syndrome				28	30	---	---	---	---	PASS
DTX2	113878	broad.mit.edu	37	7	76134751	76134751	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76134751A>G	uc003uff.3	+	12	2258	c.1702A>G	c.(1702-1704)AGC>GGC	p.S568G	DTX2_uc011kgk.1_Missense_Mutation_p.S477G|DTX2_uc003ufg.3_Missense_Mutation_p.S568G|DTX2_uc003ufh.3_Missense_Mutation_p.S568G|DTX2_uc003ufj.3_Missense_Mutation_p.S521G|DTX2_uc003ufk.3_Missense_Mutation_p.S199G|DTX2_uc003ufm.3_Missense_Mutation_p.S281G|DTX2_uc003ufn.3_Missense_Mutation_p.S153G	NM_020892	NP_065943	Q86UW9	DTX2_HUMAN	deltex 2 isoform a	568					Notch signaling pathway	cytoplasm|nucleus	protein binding|zinc ion binding			ovary(1)|skin(1)	2						GGGCACGTCCAGCACCACGGG	0.502													8	29	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88963897	88963897	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88963897C>A	uc011khi.1	+	4	2139	c.1601C>A	c.(1600-1602)CCG>CAG	p.P534Q		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	534						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TATCAATATCCGAAACCAAAG	0.368										HNSCC(36;0.09)			35	64	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99796200	99796200	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99796200C>T	uc003utx.1	+	13	1502	c.1347C>T	c.(1345-1347)TAC>TAT	p.Y449Y	STAG3_uc010lgs.1_Silent_p.Y237Y|STAG3_uc011kjk.1_Silent_p.Y391Y|STAG3_uc003uub.1_5'Flank	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	449					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AATTTCTGTACTGGAAGTGAG	0.552													34	50	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915061	119915061	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915061C>A	uc003vjj.1	+	1	1340	c.375C>A	c.(373-375)ATC>ATA	p.I125I		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	125	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TTGGCCTCATCCCGGAAATCA	0.582													96	222	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915062	119915062	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915062C>A	uc003vjj.1	+	1	1341	c.376C>A	c.(376-378)CCG>ACG	p.P126T		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	126	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TGGCCTCATCCCGGAAATCAT	0.582													94	222	---	---	---	---	PASS
KLHDC10	23008	broad.mit.edu	37	7	129760629	129760629	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129760629G>T	uc003vpj.1	+	4	651	c.516G>T	c.(514-516)ACG>ACT	p.T172T	KLHDC10_uc003vpk.1_Silent_p.T143T|KLHDC10_uc010lmb.1_Silent_p.T69T	NM_014997	NP_055812	Q6PID8	KLD10_HUMAN	kelch domain containing 10	172	Kelch 2.										0						TTGGAGGTACGGGCATCCCAT	0.478													77	137	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144703169	144703169	+	IGR	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144703169G>T								TPK1 (170023 upstream) : None (None downstream)																							AGTCTGCCCTGAGCAGCTTAA	0.552													55	295	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149422441	149422441	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149422441G>A	uc003wfz.2	+	10	1561	c.1162G>A	c.(1162-1164)GAA>AAA	p.E388K	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_Missense_Mutation_p.E56K	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	388										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GGAAGCCCTGGAAGCCTGTCT	0.592													8	12	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149497030	149497030	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149497030C>A	uc010lpk.2	+	49	7070	c.7070C>A	c.(7069-7071)CCA>CAA	p.P2357Q		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	2357					cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGACCCTGCCACCAGGTATG	0.647													13	23	---	---	---	---	PASS
GIMAP8	155038	broad.mit.edu	37	7	150171294	150171294	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150171294T>C	uc003whj.2	+	4	1207	c.877T>C	c.(877-879)TGG>CGG	p.W293R		NM_175571	NP_783161	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	293						endoplasmic reticulum|Golgi apparatus|mitochondrion	GTP binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		GAGCAGAAGCTGGAGAAAAAA	0.458													50	105	---	---	---	---	PASS
GIMAP7	168537	broad.mit.edu	37	7	150217926	150217926	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150217926G>C	uc003whk.2	+	2	994	c.864G>C	c.(862-864)TGG>TGC	p.W288C		NM_153236	NP_694968	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	288							GTP binding			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CAGAAATATGGCATAGGTTTT	0.254													14	45	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158438254	158438254	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158438254C>A	uc003wnv.1	-	26	3382	c.3237G>T	c.(3235-3237)GTG>GTT	p.V1079V	NCAPG2_uc010lqu.1_Silent_p.V824V|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Silent_p.V1079V|NCAPG2_uc011kwe.1_Silent_p.V1079V|NCAPG2_uc011kwc.1_Silent_p.V533V|NCAPG2_uc011kwd.1_Silent_p.V522V	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	1079					cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CCGTGAGGCACACAATGCCTT	0.418													26	66	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2026941	2026941	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2026941G>T	uc003wpx.3	+	12	1527	c.1389G>T	c.(1387-1389)GCG>GCT	p.A463A	MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	463	Fibronectin type-III 1.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		TGAACAGTGCGGGCATCAGCC	0.537													65	313	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3565943	3565943	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3565943G>T	uc011kwk.1	-	7	1392	c.1002C>A	c.(1000-1002)AAC>AAA	p.N334K		NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	334	Extracellular (Potential).					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		CACAGACAGAGTTTTTATGGC	0.468													8	24	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8176148	8176148	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8176148C>T	uc003wsh.3	-	5	3737	c.3737G>A	c.(3736-3738)CGC>CAC	p.R1246H		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	1246	Protein kinase.						ATP binding|non-membrane spanning protein tyrosine kinase activity				0						ATCGAACTTGCGGTACTGGGA	0.622													4	63	---	---	---	---	PASS
DEFB136	613210	broad.mit.edu	37	8	11831460	11831460	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11831460G>T	uc011kxm.1	-	2	223	c.223C>A	c.(223-225)CCA>ACA	p.P75T		NM_001033018	NP_001028190	Q30KP8	DB136_HUMAN	beta-defensin 136 precursor	75					defense response to bacterium	extracellular region					0			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.163)		TGAACCCATGGATCTTTGGCT	0.458													46	202	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36746343	36746343	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36746343C>A	uc003xjw.2	+						KCNU1_uc010lvw.2_Intron|uc003xjx.2_Missense_Mutation_p.T104K			A8MYU2	KCNU1_HUMAN	Homo sapiens cDNA FLJ50072 complete cds, moderately similar to Mus musculus potassium channel, subfamily U, member 1 (Kcnu1), mRNA.							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CTTTTTATAACAGGAATGAAG	0.239													8	15	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41530291	41530291	+	Silent	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41530291G>C	uc003xok.2	-	38	4761	c.4677C>G	c.(4675-4677)ACC>ACG	p.T1559T	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Silent_p.T1559T|ANK1_uc003xoj.2_Silent_p.T1559T|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Silent_p.T1600T	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1559	55 kDa regulatory domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TCTCCAGCATGGTGTCATGCT	0.607													21	68	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42608376	42608376	+	Silent	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42608376A>G	uc003xpj.2	-	6	1477	c.1431T>C	c.(1429-1431)TTT>TTC	p.F477F	CHRNA6_uc011lcw.1_Silent_p.F462F	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	477	Helical; (Potential).					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CTGCAGTTCCAAATACACAGA	0.353													10	335	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61765996	61765996	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61765996G>T	uc003xue.2	+	31	7189	c.6712G>T	c.(6712-6714)GAA>TAA	p.E2238*		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2238	Glu-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAAAGGTTCCGAAGAGGATGA	0.527													66	54	---	---	---	---	PASS
COPS5	10987	broad.mit.edu	37	8	67971496	67971496	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67971496G>C	uc003xxe.2	-	2	659	c.328C>G	c.(328-330)CAG>GAG	p.Q110E	COPS5_uc003xxd.2_Missense_Mutation_p.Q46E|COPS5_uc003xxf.2_Missense_Mutation_p.Q155E|COPS5_uc010lyu.1_5'Flank|COPS5_uc010lyv.1_Missense_Mutation_p.Q110E	NM_006837	NP_006828	Q92905	CSN5_HUMAN	COP9 signalosome subunit 5	110	MPN.				cullin deneddylation|transcription from RNA polymerase II promoter	eukaryotic translation initiation factor 3 complex|signalosome	metal ion binding|metallopeptidase activity|protein binding|transcription coactivator activity|translation initiation factor activity			ovary(1)|skin(1)	2	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00389)|OV - Ovarian serous cystadenocarcinoma(28;0.00691)|all cancers(69;0.0205)|BRCA - Breast invasive adenocarcinoma(89;0.153)			GCAGCAGCCTGAGCATTTACT	0.408													7	163	---	---	---	---	PASS
DCAF4L2	138009	broad.mit.edu	37	8	88885963	88885963	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:88885963C>A	uc003ydz.2	-	1	334	c.237G>T	c.(235-237)GCG>GCT	p.A79A		NM_152418	NP_689631	Q8NA75	DC4L2_HUMAN	WD repeat domain 21C	79										ovary(1)	1						TGTTGGTATTCGCCAGTATGC	0.552													52	162	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110451248	110451248	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110451248C>A	uc003yne.2	+	32	3987	c.3883C>A	c.(3883-3885)CTT>ATT	p.L1295I		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1295	Extracellular (Potential).|IPT/TIG 6.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATTAGATGCCTTTTGCCCAA	0.393										HNSCC(38;0.096)			126	151	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113293416	113293416	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113293416T>A	uc003ynu.2	-	59	9654	c.9495A>T	c.(9493-9495)TTA>TTT	p.L3165F	CSMD3_uc003yns.2_Missense_Mutation_p.L2367F|CSMD3_uc003ynt.2_Missense_Mutation_p.L3125F|CSMD3_uc011lhx.1_Missense_Mutation_p.L2996F	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3165	Extracellular (Potential).|Sushi 23.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TACAGTTAGGTAAAGTTCCAG	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			33	121	---	---	---	---	PASS
TRPS1	7227	broad.mit.edu	37	8	116426604	116426604	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:116426604C>G	uc003ynz.2	-	6	3952	c.3493G>C	c.(3493-3495)GAT>CAT	p.D1165H	TRPS1_uc011lhy.1_Missense_Mutation_p.D1169H|TRPS1_uc003yny.2_Missense_Mutation_p.D1178H|TRPS1_uc010mcy.2_Missense_Mutation_p.D1165H	NM_014112	NP_054831	Q9UHF7	TRPS1_HUMAN	zinc finger transcription factor TRPS1	1165	Transcriptional repressor domain (By similarity).|Mediates interaction with RNF4 (By similarity).				negative regulation of transcription from RNA polymerase II promoter|NLS-bearing substrate import into nucleus|regulation of chondrocyte differentiation|skeletal system development|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|pancreas(1)|lung(1)|kidney(1)	7	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			ATCGCCAAATCTAGAGGAATG	0.473									Langer-Giedion_syndrome				53	54	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118175695	118175695	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118175695C>A	uc003yoh.2	+	6	985	c.755C>A	c.(754-756)ACA>AAA	p.T252K	SLC30A8_uc010mcz.2_Missense_Mutation_p.T203K|SLC30A8_uc011lia.1_Missense_Mutation_p.T203K|SLC30A8_uc003yog.2_Missense_Mutation_p.T203K	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	252	Helical; (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CCAATCTGCACATTCATCTTT	0.378													58	99	---	---	---	---	PASS
TRAPPC9	83696	broad.mit.edu	37	8	141449292	141449292	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141449292A>G	uc003yvj.2	-	3	723	c.589T>C	c.(589-591)TAC>CAC	p.Y197H	TRAPPC9_uc003yvh.2_Missense_Mutation_p.Y295H|TRAPPC9_uc003yvi.1_Missense_Mutation_p.Y197H	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	197					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						CGCTTCTTGTAATGTCTAGAA	0.473													35	137	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143958177	143958177	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143958177C>A	uc003yxi.2	-	4	727	c.720G>T	c.(718-720)ATG>ATT	p.M240I	CYP11B1_uc010mex.2_5'Flank|CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.M240I|CYP11B1_uc010mey.2_Missense_Mutation_p.M311I	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	240					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GGCTCCTGGGCATGAACATGA	0.622									Familial_Hyperaldosteronism_type_I				7	34	---	---	---	---	PASS
SH3GL2	6456	broad.mit.edu	37	9	17761492	17761492	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17761492C>A	uc003zna.2	+	3	460	c.172C>A	c.(172-174)CTT>ATT	p.L58I	SH3GL2_uc011lmx.1_Missense_Mutation_p.L23I|SH3GL2_uc011lmy.1_Missense_Mutation_p.L11I	NM_003026	NP_003017	Q99962	SH3G2_HUMAN	SH3-domain GRB2-like 2	58	BAR.|Binds and tubulates liposomes (By similarity).				axon guidance|central nervous system development|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|post-Golgi vesicle-mediated transport	cytosol|Golgi membrane|plasma membrane	identical protein binding|lipid binding			skin(1)	1				GBM - Glioblastoma multiforme(50;2.71e-10)|Lung(42;0.203)		AATTGAATACCTTCAACCCAA	0.353													28	119	---	---	---	---	PASS
KLHL9	55958	broad.mit.edu	37	9	21333639	21333639	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21333639C>A	uc003zoy.2	-	1	1791	c.1220G>T	c.(1219-1221)CGC>CTC	p.R407L	KLHL9_uc003zow.2_Intron|KLHL9_uc003zox.2_RNA	NM_018847	NP_061335	Q9P2J3	KLHL9_HUMAN	kelch-like 9	407	Kelch 3.				cytokinesis|mitosis|protein ubiquitination	Cul3-RING ubiquitin ligase complex|midbody		p.R407C(1)		ovary(3)|skin(1)	4				Lung(24;8.52e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.118)		AGCTGCACTGCGCCCACCAAC	0.448													25	128	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86585085	86585085	+	Silent	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86585085C>G	uc004ang.3	-	16	1577	c.1353G>C	c.(1351-1353)CTG>CTC	p.L451L	HNRNPK_uc011lsw.1_Silent_p.L211L|HNRNPK_uc004and.3_Silent_p.L211L|HNRNPK_uc004ank.3_Silent_p.L450L|HNRNPK_uc004anf.3_Silent_p.L451L|HNRNPK_uc004anh.3_Silent_p.L427L|HNRNPK_uc011lsx.1_Silent_p.L427L|HNRNPK_uc004ani.3_Silent_p.L450L|HNRNPK_uc004anj.3_Silent_p.L450L|HNRNPK_uc004ann.3_Silent_p.L426L|HNRNPK_uc004anl.3_Silent_p.L451L|HNRNPK_uc004anm.3_Silent_p.L451L|uc004ano.1_5'Flank|MIR7-1_hsa-mir-7-1|MI0000263_5'Flank	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	451	KH 3.				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						ACCTGTTCTGCAGCAAATACT	0.358													53	101	---	---	---	---	PASS
PTCH1	5727	broad.mit.edu	37	9	98236338	98236338	+	Intron	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98236338C>T	uc004avk.3	-						PTCH1_uc010mro.2_Intron|PTCH1_uc010mrp.2_Intron|PTCH1_uc010mrq.2_Intron|PTCH1_uc004avl.3_Intron|PTCH1_uc010mrr.2_Intron|PTCH1_uc004avm.3_Intron|PTCH1_uc010mrs.1_Intron	NM_000264	NP_000255	Q13635	PTC1_HUMAN	patched isoform L						embryonic limb morphogenesis|negative regulation of multicellular organism growth|protein processing|regulation of smoothened signaling pathway|smoothened signaling pathway	integral to plasma membrane	hedgehog receptor activity			skin(242)|central_nervous_system(72)|bone(33)|upper_aerodigestive_tract(11)|lung(6)|large_intestine(4)|breast(4)|oesophagus(3)|ovary(3)|vulva(1)	379		Medulloblastoma(1;7.87e-06)|all_neural(1;0.000555)|Acute lymphoblastic leukemia(62;0.136)				GGCTACTCCTCGTAAGGAAAC	0.418									Basal_Cell_Nevus_syndrome				5	6	---	---	---	---	PASS
SLC35D2	11046	broad.mit.edu	37	9	99114388	99114388	+	Silent	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99114388T>A	uc004awc.2	-	5	427	c.351A>T	c.(349-351)CTA>CTT	p.L117L	SLC35D2_uc010msd.2_RNA|SLC35D2_uc010mse.2_Intron|SLC35D2_uc010msf.2_Silent_p.L117L|SLC35D2_uc004awd.2_Intron|SLC35D2_uc004awe.2_Silent_p.L117L	NM_007001	NP_008932	Q76EJ3	S35D2_HUMAN	solute carrier family 35, member D2	117	Cytoplasmic (Potential).					Golgi membrane|integral to membrane	nucleotide-sugar transmembrane transporter activity				0		Acute lymphoblastic leukemia(62;0.0167)				TGAACATCGGTAGGCTGCCAG	0.383													10	31	---	---	---	---	PASS
OR13C9	286362	broad.mit.edu	37	9	107379751	107379751	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107379751C>A	uc011lvr.1	-	1	735	c.735G>T	c.(733-735)CTG>CTT	p.L245L		NM_001001956	NP_001001956	Q8NGT0	O13C9_HUMAN	olfactory receptor, family 13, subfamily C,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TGACCACAGTCAGATGGGCTG	0.413													54	90	---	---	---	---	PASS
PALM2-AKAP2	445815	broad.mit.edu	37	9	112898997	112898997	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112898997G>A	uc004bei.2	+	9	2061	c.1869G>A	c.(1867-1869)CGG>CGA	p.R623R	PALM2-AKAP2_uc004bek.3_Silent_p.R391R|PALM2-AKAP2_uc004bej.3_Silent_p.R391R|PALM2-AKAP2_uc004bel.1_Silent_p.R201R|AKAP2_uc011lwi.1_Silent_p.R249R|AKAP2_uc004bem.2_Silent_p.R249R|PALM2-AKAP2_uc010mtw.1_Silent_p.R209R|AKAP2_uc011lwj.1_Silent_p.R160R|PALM2-AKAP2_uc004ben.2_Silent_p.R160R	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	160							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						CCAGCTCACGGTGTTCTTCCC	0.572													14	48	---	---	---	---	PASS
TTF1	7270	broad.mit.edu	37	9	135277305	135277305	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135277305C>G	uc004cbl.2	-	2	956	c.904G>C	c.(904-906)GAG>CAG	p.E302Q	TTF1_uc011mcp.1_RNA|TTF1_uc004cbm.2_Intron	NM_007344	NP_031370	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase	302					negative regulation of DNA replication|regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription	nucleolus|nucleoplasm	DNA binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		GCCCCAACCTCACTGCCCACT	0.448													16	341	---	---	---	---	PASS
GBGT1	26301	broad.mit.edu	37	9	136029595	136029595	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136029595C>A	uc004ccw.2	-	7	694	c.413G>T	c.(412-414)CGT>CTT	p.R138L	RALGDS_uc011mcw.1_Intron|GBGT1_uc004ccx.2_Missense_Mutation_p.R91L|GBGT1_uc010nab.2_Silent_p.A150A|GBGT1_uc011mcx.1_Missense_Mutation_p.R121L|GBGT1_uc010nac.1_Missense_Mutation_p.R2L|GBGT1_uc004ccy.1_3'UTR	NM_021996	NP_068836	Q8N5D6	GBGT1_HUMAN	globoside	138	Lumenal (Potential).				carbohydrate metabolic process|glycolipid biosynthetic process	Golgi membrane|integral to membrane	metal ion binding				0				OV - Ovarian serous cystadenocarcinoma(145;3.49e-06)|Epithelial(140;2.59e-05)		CCGGTACCCACGCATGAAGAA	0.597													25	42	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139412363	139412363	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139412363T>A	uc004chz.2	-	8	1282	c.1282A>T	c.(1282-1284)AAG>TAG	p.K428*		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	428	Extracellular (Potential).|EGF-like 11; calcium-binding (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TTGATGCACTTGCCCGCATGC	0.667			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			24	52	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139916869	139916869	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139916869C>A	uc011mem.1	-	5	646	c.498G>T	c.(496-498)ACG>ACT	p.T166T	ABCA2_uc011mel.1_Silent_p.T167T|ABCA2_uc004ckl.1_Silent_p.T97T|ABCA2_uc004ckm.1_Silent_p.T197T|ABCA2_uc004cko.1_5'UTR|ABCA2_uc010nca.2_Silent_p.T97T	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	166					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACAAGTTTTGCGTCAGGAAAC	0.647													7	14	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27323831	27323831	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27323831T>C	uc001ith.2	-	24	3717	c.3545A>G	c.(3544-3546)GAA>GGA	p.E1182G	ANKRD26_uc001itg.2_Missense_Mutation_p.E869G|ANKRD26_uc009xku.1_Missense_Mutation_p.E1183G	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1182	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						ACTTTGCTTTTCACTCTCAGC	0.353													47	185	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	53893597	53893597	+	Intron	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:53893597T>A	uc001jjm.2	+						PRKG1_uc001jjo.2_Intron|PRKG1_uc009xow.1_Intron	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform						actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		ATTTTTCACATAGGGAAGATG	0.318													19	67	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55719602	55719602	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55719602C>T	uc001jju.1	-	23	3407	c.3012G>A	c.(3010-3012)TTG>TTA	p.L1004L	PCDH15_uc010qhq.1_Silent_p.L1009L|PCDH15_uc010qhr.1_Silent_p.L1004L|PCDH15_uc010qhs.1_Silent_p.L1016L|PCDH15_uc010qht.1_Silent_p.L1011L|PCDH15_uc010qhu.1_Silent_p.L1004L|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Silent_p.L1004L|PCDH15_uc010qhw.1_Silent_p.L967L|PCDH15_uc010qhx.1_Silent_p.L933L|PCDH15_uc010qhy.1_Silent_p.L1009L|PCDH15_uc010qhz.1_Silent_p.L1004L|PCDH15_uc010qia.1_Silent_p.L982L|PCDH15_uc010qib.1_Silent_p.L982L	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1004	Extracellular (Potential).|Cadherin 9.				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CAACCACCACCAACTTAAAAA	0.393										HNSCC(58;0.16)			8	81	---	---	---	---	PASS
TMEM26	219623	broad.mit.edu	37	10	63170096	63170096	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63170096G>A	uc001jlo.2	-	6	1460	c.1091C>T	c.(1090-1092)TCC>TTC	p.S364F	TMEM26_uc010qij.1_RNA|TMEM26_uc001jlp.1_RNA	NM_178505	NP_848600	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	364						integral to membrane					0	Prostate(12;0.0112)					GGTGTGGTGGGAGTCGTCGGA	0.572													12	66	---	---	---	---	PASS
HTR7	3363	broad.mit.edu	37	10	92502294	92502294	+	Intron	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:92502294A>C	uc001kha.2	-						HTR7_uc001kgz.2_Intron|HTR7_uc001khb.2_Intron	NM_019859	NP_062873	P34969	5HT7R_HUMAN	5-hydroxytryptamine receptor 7 isoform d						blood circulation|circadian rhythm	integral to plasma membrane	protein binding|serotonin receptor activity			ovary(1)	1					Eletriptan(DB00216)|Methysergide(DB00247)|Ziprasidone(DB00246)	GTCTAAAAAAAAGAGAGAGAA	0.308													40	90	---	---	---	---	PASS
CYP2C19	1557	broad.mit.edu	37	10	96602727	96602727	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96602727C>A	uc010qnz.1	+	7	1095	c.1095C>A	c.(1093-1095)AGC>AGA	p.S365R	CYP2C19_uc010qny.1_Missense_Mutation_p.S343R	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	365					exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	TCCCCACCAGCCTGCCCCATG	0.522													65	194	---	---	---	---	PASS
CYP2C19	1557	broad.mit.edu	37	10	96602728	96602728	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96602728C>A	uc010qnz.1	+	7	1096	c.1096C>A	c.(1096-1098)CTG>ATG	p.L366M	CYP2C19_uc010qny.1_Missense_Mutation_p.L344M	NM_000769	NP_000760	P33261	CP2CJ_HUMAN	cytochrome P450, family 2, subfamily C,	366					exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|steroid metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	(S)-limonene 6-monooxygenase activity|(S)-limonene 7-monooxygenase activity|4-hydroxyacetophenone monooxygenase activity|electron carrier activity|enzyme binding|heme binding|oxygen binding|steroid hydroxylase activity	p.L366Q(1)		ovary(4)|central_nervous_system(1)|skin(1)	6		Colorectal(252;0.09)		all cancers(201;6.02e-07)|KIRC - Kidney renal clear cell carcinoma(50;0.0672)|Kidney(138;0.0838)	Adinazolam(DB00546)|Aminophenazone(DB01424)|Amitriptyline(DB00321)|Amoxicillin(DB01060)|Arformoterol(DB01274)|Bortezomib(DB00188)|Carisoprodol(DB00395)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Desipramine(DB01151)|Desloratadine(DB00967)|Diclofenac(DB00586)|Diltiazem(DB00343)|Efavirenz(DB00625)|Esomeprazole(DB00736)|Famotidine(DB00927)|Felbamate(DB00949)|Finasteride(DB01216)|Flunitrazepam(DB01544)|Fluvoxamine(DB00176)|Formoterol(DB00983)|Fosphenytoin(DB01320)|Guanfacine(DB01018)|Imipramine(DB00458)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Loratadine(DB00455)|Melatonin(DB01065)|Mephenytoin(DB00532)|Methadone(DB00333)|Methylphenobarbital(DB00849)|Moclobemide(DB01171)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nicardipine(DB00622)|Nilutamide(DB00665)|Norgestrel(DB00506)|Omeprazole(DB00338)|Oxcarbazepine(DB00776)|Pantoprazole(DB00213)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Quinidine(DB00908)|Rabeprazole(DB01129)|Ranitidine(DB00863)|Ritonavir(DB00503)|Selegiline(DB01037)|Sertraline(DB01104)|Temazepam(DB00231)|Teniposide(DB00444)|Terfenadine(DB00342)|Thalidomide(DB01041)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tolbutamide(DB01124)|Topiramate(DB00273)|Tranylcypromine(DB00752)|Troglitazone(DB00197)|Troleandomycin(DB01361)|Voriconazole(DB00582)	CCCCACCAGCCTGCCCCATGC	0.522													65	193	---	---	---	---	PASS
CC2D2B	387707	broad.mit.edu	37	10	97778957	97778957	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:97778957C>A	uc001kll.2	+						uc001klg.1_Intron|uc001klj.1_Intron|CC2D2B_uc001klk.2_Intron|CC2D2B_uc010qop.1_Intron|uc009xvb.1_RNA	NM_001001732	NP_001001732	Q6DHV5	C2D2B_HUMAN	coiled-coil and C2 domain containing 2B isoform											ovary(1)	1		Colorectal(252;0.158)		Epithelial(162;7.08e-08)|all cancers(201;2.71e-06)		TTTTCTCATACAGGGGCATGT	0.308													17	122	---	---	---	---	PASS
SLC25A28	81894	broad.mit.edu	37	10	101370858	101370858	+	Silent	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101370858T>C	uc001kpx.2	-	4	972	c.843A>G	c.(841-843)CCA>CCG	p.P281P	SLC25A28_uc001kpy.2_Silent_p.P94P	NM_031212	NP_112489	Q96A46	MFRN2_HUMAN	solute carrier family 25, member 28	281	Solcar 3.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Colorectal(252;0.234)		Epithelial(162;2.57e-10)|all cancers(201;2.01e-08)		AAACGTCCAGTGGGGTTGTGG	0.562													28	64	---	---	---	---	PASS
PSD	5662	broad.mit.edu	37	10	104164336	104164336	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104164336C>A	uc001kvg.1	-						PSD_uc001kve.1_Intron|PSD_uc001kvf.1_Intron|PSD_uc001kvh.1_Intron|PSD_uc009xxd.1_Intron	NM_002779	NP_002770	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing						regulation of ARF protein signal transduction	cytoplasm|plasma membrane|ruffle	ARF guanyl-nucleotide exchange factor activity|signal transducer activity			breast(2)|urinary_tract(1)	3				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		AGAGCTTGGGCTACCTGGGAG	0.512													26	76	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118314941	118314941	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118314941C>G	uc001lcm.2	+	8	776	c.733C>G	c.(733-735)CCA>GCA	p.P245A		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	245					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	AGATTTCTTTCCAAATGGAGG	0.388													31	183	---	---	---	---	PASS
SEC23IP	11196	broad.mit.edu	37	10	121677443	121677443	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121677443A>T	uc001leu.1	+	9	1712	c.1640A>T	c.(1639-1641)TAC>TTC	p.Y547F	SEC23IP_uc010qtc.1_Missense_Mutation_p.Y336F|SEC23IP_uc009xzk.1_5'Flank	NM_007190	NP_009121	Q9Y6Y8	S23IP_HUMAN	Sec23-interacting protein p125	547					Golgi organization|intracellular protein transport	endoplasmic reticulum|ER to Golgi transport vesicle membrane|ER-Golgi intermediate compartment	metal ion binding			ovary(3)	3		Lung NSC(174;0.109)|all_lung(145;0.142)|all_neural(114;0.234)		all cancers(201;0.00515)		AGCCCCACCTACTGTCAGACA	0.383													25	143	---	---	---	---	PASS
FAM24A	118670	broad.mit.edu	37	10	124672393	124672393	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124672393T>A	uc001lgv.2	+	3	362	c.241T>A	c.(241-243)TGC>AGC	p.C81S		NM_001029888	NP_001025059	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	81						extracellular region				ovary(2)	2		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		ATCTCTCCAGTGCTGTGAAGG	0.507													19	119	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127806717	127806717	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127806717G>T	uc001ljk.2	-	6	915	c.502C>A	c.(502-504)CCA>ACA	p.P168T	ADAM12_uc010qul.1_Missense_Mutation_p.P165T|ADAM12_uc001ljm.2_Missense_Mutation_p.P168T|ADAM12_uc001ljn.2_Missense_Mutation_p.P165T|ADAM12_uc001ljl.3_Missense_Mutation_p.P165T	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	168					cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		TTCTTCGCTGGGAAGAGTTTG	0.423													32	151	---	---	---	---	PASS
FAM196A	642938	broad.mit.edu	37	10	128974520	128974520	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128974520A>T	uc001lju.1	-	1	181	c.140T>A	c.(139-141)GTG>GAG	p.V47E	DOCK1_uc001ljt.2_Intron|DOCK1_uc010qun.1_Intron|FAM196A_uc010quo.1_Missense_Mutation_p.V47E|FAM196A_uc001ljv.1_Missense_Mutation_p.V47E|FAM196A_uc009yap.1_Missense_Mutation_p.V47E	NM_001039762	NP_001034851	Q6ZSG2	F196A_HUMAN	hypothetical protein LOC642938	47										ovary(2)	2						CTTAAACCGCACCTGCAGGGC	0.607													48	280	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135106147	135106147	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135106147C>G	uc001lmg.1	-	8	1427	c.1070G>C	c.(1069-1071)AGC>ACC	p.S357T	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Missense_Mutation_p.S385T|TUBGCP2_uc009ybk.1_Missense_Mutation_p.S357T|TUBGCP2_uc010qvd.1_Missense_Mutation_p.S227T|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	357					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		GTGGAGCAGGCTCAGCGTGGA	0.622													6	46	---	---	---	---	PASS
NUP98	4928	broad.mit.edu	37	11	3714580	3714580	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3714580T>G	uc001lyh.2	-	27	4484	c.4193A>C	c.(4192-4194)CAA>CCA	p.Q1398P	NUP98_uc001lyi.2_Missense_Mutation_p.Q1398P|NUP98_uc001lyg.2_Missense_Mutation_p.Q363P	NM_016320	NP_057404	P52948	NUP98_HUMAN	nucleoporin 98kD isoform 1	1415					carbohydrate metabolic process|DNA replication|glucose transport|interspecies interaction between organisms|mitotic prometaphase|mRNA transport|nuclear pore organization|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nucleoplasm|Nup107-160 complex	protein binding|structural constituent of nuclear pore|transporter activity			breast(4)|skin(3)|ovary(2)|central_nervous_system(1)|lung(1)|kidney(1)	12		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		CACGTTTATTTGCTTCTTTTC	0.458			T	HOXA9|NSD1|WHSC1L1|DDX10|TOP1|HOXD13|PMX1|HOXA13|HOXD11|HOXA11|RAP1GDS1|HOXC11	AML								24	146	---	---	---	---	PASS
OR52M1	119772	broad.mit.edu	37	11	4566615	4566615	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4566615G>T	uc010qyf.1	+	1	195	c.195G>T	c.(193-195)TTG>TTT	p.L65F		NM_001004137	NP_001004137	Q8NGK5	O52M1_HUMAN	olfactory receptor, family 52, subfamily M,	65	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACTTTTTCTTGTGCATGTTGG	0.522													42	92	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5345100	5345100	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5345100C>A	uc001mao.1	-	1	483	c.428G>T	c.(427-429)GGA>GTA	p.G143V	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	143	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CACTCCCACTCCTAACGCTAT	0.413													31	104	---	---	---	---	PASS
OR51B2	79345	broad.mit.edu	37	11	5345101	5345101	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5345101C>A	uc001mao.1	-	1	482	c.427G>T	c.(427-429)GGA>TGA	p.G143*	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron	NM_033180	NP_149420	Q9Y5P1	O51B2_HUMAN	olfactory receptor, family 51, subfamily B,	143	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		ACTCCCACTCCTAACGCTATG	0.408													33	106	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048063	6048063	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048063G>T	uc010qzw.1	-	1	872	c.872C>A	c.(871-873)CCT>CAT	p.P291H		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	291	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATGCAGGAGGAATAAGGTG	0.463													34	80	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7079636	7079636	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7079636T>C	uc001mfb.1	+	8	2911	c.2588T>C	c.(2587-2589)ATG>ACG	p.M863T		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	863	LRR 5.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GTAAAGCTTATGAGTGATGCC	0.388													59	133	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19901506	19901506	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19901506C>G	uc010rdm.1	+	5	964	c.603C>G	c.(601-603)CAC>CAG	p.H201Q	NAV2_uc001mpp.2_Missense_Mutation_p.H137Q|NAV2_uc001mpr.3_Missense_Mutation_p.H201Q	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	201	Gln-rich.					nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						agaagcagcaCCTCTCCTCAC	0.537													5	6	---	---	---	---	PASS
FIBIN	387758	broad.mit.edu	37	11	27016314	27016314	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27016314C>A	uc001mrd.2	+	1	687	c.241C>A	c.(241-243)CGG>AGG	p.R81R		NM_203371	NP_976249	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog precursor	81						extracellular region|Golgi apparatus					0						CCTCACCCTGCGGGAGGAGTT	0.657													13	28	---	---	---	---	PASS
EIF3M	10480	broad.mit.edu	37	11	32605423	32605423	+	5'UTR	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32605423G>A	uc001mtu.2	+	1					EIF3M_uc010ref.1_5'UTR	NM_006360	NP_006351	Q7L2H7	EIF3M_HUMAN	eukaryotic translation initiation factor 3,							eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)|breast(1)|skin(1)	3	Breast(20;0.109)					CGCTGTGCCCGGGCCTGCACC	0.662													12	27	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40135910	40135910	+	3'UTR	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40135910T>A	uc001mxa.1	-	2					LRRC4C_uc001mxc.1_3'UTR|LRRC4C_uc001mxd.1_3'UTR|LRRC4C_uc001mxb.1_3'UTR	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor						regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TTTGTAACTCTGTAAATGTTT	0.204													20	45	---	---	---	---	PASS
ACCS	84680	broad.mit.edu	37	11	44102757	44102757	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44102757G>T	uc009yks.1	+	12	1142	c.998G>T	c.(997-999)GGC>GTC	p.G333V	EXT2_uc010rfo.1_Intron|ACCS_uc001mxx.2_Missense_Mutation_p.G333V	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase	333							1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						CTCCGCTTTGGCACGCTGTAC	0.627													19	165	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47305939	47305939	+	Silent	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47305939G>C	uc001ner.1	+	12	2171	c.1980G>C	c.(1978-1980)CTG>CTC	p.L660L	MADD_uc001neq.2_Silent_p.L660L|MADD_uc001nev.1_Silent_p.L660L|MADD_uc001nes.1_Silent_p.L660L|MADD_uc001net.1_Silent_p.L660L|MADD_uc009yln.1_Silent_p.L660L|MADD_uc001neu.1_Silent_p.L660L|MADD_uc001nex.2_Silent_p.L660L|MADD_uc001nez.2_Silent_p.L660L|MADD_uc001new.2_Silent_p.L660L	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	660					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		TGGACCCTCTGACACATGCAG	0.597													26	166	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49175785	49175785	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49175785G>T	uc001ngy.2	-	16	2144	c.1883C>A	c.(1882-1884)TCA>TAA	p.S628*	FOLH1_uc001ngx.2_Nonsense_Mutation_p.S60*|FOLH1_uc001ngz.2_Nonsense_Mutation_p.S628*|FOLH1_uc009yly.2_Nonsense_Mutation_p.S613*|FOLH1_uc009ylz.2_Nonsense_Mutation_p.S613*|FOLH1_uc009yma.2_Nonsense_Mutation_p.S320*	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	628	Extracellular (Probable).	Charge relay system (Potential).			proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	CATACCAAATGATACACTGTA	0.313													7	212	---	---	---	---	PASS
OR5D14	219436	broad.mit.edu	37	11	55563077	55563077	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55563077C>T	uc010rim.1	+	1	46	c.46C>T	c.(46-48)CTT>TTT	p.L16F		NM_001004735	NP_001004735	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3		all_epithelial(135;0.196)				CACCTTTGCCCTTTTAGGTTT	0.408													92	193	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587837	55587837	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587837C>T	uc010rin.1	+	1	732	c.732C>T	c.(730-732)TCC>TCT	p.S244S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	244	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CCTGTGCCTCCCACCTGACTG	0.517													28	136	---	---	---	---	PASS
SPRYD5	84767	broad.mit.edu	37	11	55655637	55655637	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55655637A>G	uc010rip.1	+	4	729	c.637A>G	c.(637-639)AAT>GAT	p.N213D	SPRYD5_uc010riq.1_Missense_Mutation_p.N70D	NM_032681	NP_116070	Q9BSJ1	SPRY5_HUMAN	SPRY domain containing 5	213						intracellular	zinc ion binding				0		all_epithelial(135;0.226)				TCAGCAACTCAATGAAAGCAA	0.448													26	93	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944867	55944867	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944867C>T	uc010rjb.1	+	1	774	c.774C>T	c.(772-774)AGC>AGT	p.S258S		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					TAATCTTTAGCTACATTCAGC	0.453													74	210	---	---	---	---	PASS
CTNND1	1500	broad.mit.edu	37	11	57583454	57583454	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57583454A>T	uc001nmc.3	+	20	3447	c.2876A>T	c.(2875-2877)CAA>CTA	p.Q959L	CTNND1_uc001nlh.1_Intron|CTNND1_uc001nlu.3_Intron|CTNND1_uc001nlt.3_Intron|CTNND1_uc001nls.3_Missense_Mutation_p.Q831L|CTNND1_uc001nlw.3_Intron|CTNND1_uc001nmf.3_Intron|CTNND1_uc001nmd.3_Missense_Mutation_p.Q905L|CTNND1_uc001nlk.3_Intron|CTNND1_uc001nme.3_Missense_Mutation_p.Q953L|CTNND1_uc001nll.3_Intron|CTNND1_uc001nmg.3_Intron|CTNND1_uc001nlj.3_Missense_Mutation_p.Q899L|CTNND1_uc001nlr.3_Intron|CTNND1_uc001nlp.3_Missense_Mutation_p.Q878L|CTNND1_uc001nlx.3_Missense_Mutation_p.Q636L|CTNND1_uc001nlz.3_Intron|CTNND1_uc009ymn.2_Intron|CTNND1_uc001nlm.3_Intron|CTNND1_uc001nly.3_Missense_Mutation_p.Q630L|CTNND1_uc001nmb.3_Intron|CTNND1_uc001nma.3_Missense_Mutation_p.Q609L|CTNND1_uc001nmi.3_Missense_Mutation_p.Q858L|CTNND1_uc001nmh.3_Intron|CTNND1_uc001nlq.3_Intron|CTNND1_uc001nln.3_Intron|CTNND1_uc001nli.3_Missense_Mutation_p.Q932L|CTNND1_uc001nlo.3_Missense_Mutation_p.Q852L|CTNND1_uc001nlv.3_Intron	NM_001085458	NP_001078927	O60716	CTND1_HUMAN	catenin, delta 1 isoform 1ABC	959					adherens junction organization|cell junction assembly|negative regulation of canonical Wnt receptor signaling pathway|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytosol|midbody|nucleus	cadherin binding|protein binding|receptor binding			breast(4)|ovary(1)|kidney(1)	6		all_epithelial(135;0.155)				GAGGGGGGCCAAGTGTCTTAC	0.498													8	34	---	---	---	---	PASS
STX3	6809	broad.mit.edu	37	11	59564752	59564752	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59564752C>A	uc001nog.2	+						STX3_uc010rkx.1_Intron|STX3_uc010rky.1_Intron|STX3_uc009ymt.1_Intron	NM_004177	NP_004168	Q13277	STX3_HUMAN	syntaxin 3						cellular response to oxidative stress|intracellular protein transport|neuron projection development|neurotransmitter transport	apical plasma membrane|azurophil granule|cell-cell junction|growth cone|integral to membrane|plasma membrane enriched fraction|SNARE complex|specific granule	arachidonic acid binding|SNAP receptor activity			ovary(2)	2						ATTCCTCTCTCCAGAAATTGA	0.348													35	146	---	---	---	---	PASS
SLC22A9	114571	broad.mit.edu	37	11	63143203	63143203	+	Missense_Mutation	SNP	G	C	C	rs1801518		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63143203G>C	uc001nww.2	+	5	1185	c.917G>C	c.(916-918)AGT>ACT	p.S306T	SLC22A9_uc001nwx.2_RNA	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation	306	Cytoplasmic (Potential).				transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						GCACACAGGAGTGGAATGAAG	0.468													21	141	---	---	---	---	PASS
MARK2	2011	broad.mit.edu	37	11	63666289	63666289	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63666289G>A	uc001nxw.2	+	6	1037	c.458G>A	c.(457-459)CGA>CAA	p.R153Q	MARK2_uc001nxx.2_Missense_Mutation_p.R153Q|MARK2_uc001nxy.2_Missense_Mutation_p.R153Q|MARK2_uc001nxv.3_Missense_Mutation_p.R153Q|MARK2_uc001nxz.3_Missense_Mutation_p.R120Q|MARK2_uc009yoy.2_Missense_Mutation_p.R120Q	NM_001039469	NP_001034558	Q7KZI7	MARK2_HUMAN	MAP/microtubule affinity-regulating kinase 2	153	Protein kinase.				cell differentiation|establishment or maintenance of epithelial cell apical/basal polarity|intracellular protein kinase cascade|multicellular organismal development|response to oxidative stress	plasma membrane	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			stomach(1)|ovary(1)|lung(1)	3						AAAGAGGCTCGAGCCAAATTC	0.517													5	79	---	---	---	---	PASS
TIGD3	220359	broad.mit.edu	37	11	65124390	65124390	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65124390C>A	uc001odo.3	+	2	1274	c.1111C>A	c.(1111-1113)CCC>ACC	p.P371T		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	371					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						CGGCAAAACGCCCCCGTCCTC	0.637													66	162	---	---	---	---	PASS
BBS1	582	broad.mit.edu	37	11	66287220	66287220	+	Splice_Site	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66287220G>A	uc001oij.1	+	8	735	c.723_splice	c.e8+1	p.K241_splice	BBS1_uc001oii.1_Splice_Site_p.K278_splice|BBS1_uc010rpf.1_Splice_Site|BBS1_uc010rpg.1_Intron|BBS1_uc001oik.1_Splice_Site_p.K165_splice|BBS1_uc001oil.1_Splice_Site_p.K241_splice	NM_024649	NP_078925	Q8NFJ9	BBS1_HUMAN	Bardet-Biedl syndrome 1						nonmotile primary cilium assembly|photoreceptor cell maintenance|response to stimulus|retina homeostasis	BBSome|cilium membrane|cytoplasm	protein binding			ovary(1)	1						TTTAGCCAAGGTCAGCGTCAG	0.547									Bardet-Biedl_syndrome				13	67	---	---	---	---	PASS
INPPL1	3636	broad.mit.edu	37	11	71942192	71942192	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71942192C>T	uc001osf.2	+	12	1603	c.1456C>T	c.(1456-1458)CGC>TGC	p.R486C	INPPL1_uc001osg.2_Missense_Mutation_p.R244C	NM_001567	NP_001558	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	486					actin filament organization|cell adhesion|endocytosis	actin cortical patch|cytosol	actin binding|SH2 domain binding|SH3 domain binding			skin(2)|ovary(1)|breast(1)	4						GGACCTACTGCGCGGGGGCCT	0.602													11	352	---	---	---	---	PASS
ATG16L2	89849	broad.mit.edu	37	11	72539536	72539536	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72539536C>G	uc001otd.2	+	15	1645	c.1605C>G	c.(1603-1605)AAC>AAG	p.N535K	ATG16L2_uc001ote.2_Missense_Mutation_p.N429K|ATG16L2_uc009ytj.1_Missense_Mutation_p.H151D|ATG16L2_uc001otf.2_Missense_Mutation_p.N290K|ATG16L2_uc001otg.2_Missense_Mutation_p.N269K|ATG16L2_uc009ytk.2_Missense_Mutation_p.N290K	NM_033388	NP_203746	Q8NAA4	A16L2_HUMAN	ATG16 autophagy related 16-like 2	535	WD 5.				autophagy|protein transport	cytoplasm	protein binding				0			BRCA - Breast invasive adenocarcinoma(5;2.73e-06)			GTGTCAGCAACATCCGCCAGG	0.597													30	165	---	---	---	---	PASS
C11orf82	220042	broad.mit.edu	37	11	82644184	82644184	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82644184G>A	uc001ozt.2	+	6	2048	c.1804G>A	c.(1804-1806)GAT>AAT	p.D602N	C11orf82_uc010rsr.1_Missense_Mutation_p.D301N|C11orf82_uc010rss.1_Missense_Mutation_p.D301N|C11orf82_uc009yvd.2_Intron	NM_145018	NP_659455	Q8IXT1	NOXIN_HUMAN	nitric oxide-inducible gene protein	602					apoptosis|cell cycle arrest	cytoplasm|nucleus				ovary(2)	2						GAAGTATAATGATGTCTCTGA	0.308													28	80	---	---	---	---	PASS
HEPHL1	341208	broad.mit.edu	37	11	93806196	93806196	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93806196C>G	uc001pep.2	+	7	1395	c.1238C>G	c.(1237-1239)TCT>TGT	p.S413C	uc001pen.1_Intron	NM_001098672	NP_001092142	Q6MZM0	HPHL1_HUMAN	hephaestin-like 1 precursor	413	Plastocyanin-like 3.|Extracellular (Potential).				copper ion transport	integral to membrane	copper ion binding|oxidoreductase activity			ovary(3)	3		Acute lymphoblastic leukemia(157;2.34e-05)|all_hematologic(158;0.00824)				TTCAGTGACTCTGATCTCTAC	0.358													20	35	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102449824	102449824	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102449824C>T	uc001phc.2	-	9	1310	c.1297G>A	c.(1297-1299)GAA>AAA	p.E433K		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	433	Hemopexin-like 3.				proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		AATTCTTCTTCAGTATTCTTT	0.308													24	665	---	---	---	---	PASS
CLDN25	644672	broad.mit.edu	37	11	113650528	113650528	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113650528G>A	uc009yyw.1	+	1	11	c.11G>A	c.(10-12)AGT>AAT	p.S4N		NM_001101389	NP_001094859	C9JDP6	CLD25_HUMAN	claudin 25	4	Cytoplasmic (Potential).					integral to membrane|tight junction	structural molecule activity				0						ATGGCCTGGAGTTTCCGTGCA	0.547													61	119	---	---	---	---	PASS
DSCAML1	57453	broad.mit.edu	37	11	117303185	117303185	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117303185C>A	uc001prh.1	-	30	5244	c.5242G>T	c.(5242-5244)GAG>TAG	p.E1748*		NM_020693	NP_065744	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1688	Cytoplasmic (Potential).				axonogenesis|brain development|cell fate determination|dorsal/ventral pattern formation|embryonic skeletal system morphogenesis|homophilic cell adhesion	cell surface|integral to membrane|plasma membrane	protein homodimerization activity			ovary(3)|large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)	8	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TGGCTGAACTCAGCATCTGTC	0.502													30	79	---	---	---	---	PASS
TULP3	7289	broad.mit.edu	37	12	3046902	3046902	+	Intron	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3046902A>T	uc010seh.1	+						TULP3_uc009zec.1_Intron|TULP3_uc010seg.1_Intron|TULP3_uc001qlj.2_Intron|TULP3_uc010sei.1_Intron	NM_003324	NP_003315	O75386	TULP3_HUMAN	tubby like protein 3 isoform 1						G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			AAACGTGAGTAAGAATGTATT	0.358													31	27	---	---	---	---	PASS
ZNF384	171017	broad.mit.edu	37	12	6776898	6776898	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6776898C>T	uc010sfh.1	-	11	1924	c.1716G>A	c.(1714-1716)GAG>GAA	p.E572E	ZNF384_uc001qpz.2_Silent_p.E511E|ZNF384_uc001qqa.2_Silent_p.E511E|ZNF384_uc001qqb.2_Silent_p.E495E|ZNF384_uc001qqc.2_Silent_p.E511E|ZNF384_uc001qqd.2_Silent_p.E456E|ZNF384_uc001qqe.2_Silent_p.E495E	NM_001135734	NP_001129206	Q8TF68	ZN384_HUMAN	nuclear matrix transcription factor 4 isoform d	572					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/ZNF384(4)	haematopoietic_and_lymphoid_tissue(4)|central_nervous_system(3)|kidney(1)	8						TGGCCAGGTGCTCCACCTGGA	0.552			T	EWSR1|TAF15 	ALL								46	407	---	---	---	---	PASS
ACSM4	341392	broad.mit.edu	37	12	7457012	7457012	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7457012C>A	uc001qsx.1	+	1	85	c.85C>A	c.(85-87)CTT>ATT	p.L29I		NM_001080454	NP_001073923	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	29					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding				0						AGATCACCAGCTTTGGACGCC	0.473													157	174	---	---	---	---	PASS
A2ML1	144568	broad.mit.edu	37	12	9010650	9010650	+	Silent	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9010650C>G	uc001quz.3	+	26	3314	c.3216C>G	c.(3214-3216)CCC>CCG	p.P1072P	A2ML1_uc001qva.1_Silent_p.P652P|A2ML1_uc010sgm.1_Silent_p.P572P	NM_144670	NP_653271	A8K2U0	A2ML1_HUMAN	alpha-2-macroglobulin-like 1 precursor	916						extracellular space	endopeptidase inhibitor activity			ovary(2)|skin(1)	3						ACCAGCTCCCCAGTGGCTGCT	0.522													95	73	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26868762	26868762	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26868762C>G	uc001rhg.2	-	7	1048	c.631G>C	c.(631-633)GCT>CCT	p.A211P		NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	211	Cytoplasmic (Potential).|MIR 2.				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					CAATTGACAGCATTCACCTAT	0.328													23	95	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	44913981	44913981	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44913981C>A	uc001rog.2	-	19	2802	c.2207G>T	c.(2206-2208)TGC>TTC	p.C736F	NELL2_uc001rof.3_Missense_Mutation_p.C735F|NELL2_uc001roh.2_Missense_Mutation_p.C736F|NELL2_uc009zkd.2_Missense_Mutation_p.C688F|NELL2_uc010skz.1_Missense_Mutation_p.C786F|NELL2_uc010sla.1_Missense_Mutation_p.C759F	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	736	VWFC 4.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CACATCTGGGCAAGGCAGGGG	0.557													7	46	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	45097609	45097609	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45097609G>A	uc001rog.2	-	12	1813	c.1218C>T	c.(1216-1218)AAC>AAT	p.N406N	NELL2_uc001rof.3_Silent_p.N405N|NELL2_uc001roh.2_Silent_p.N406N|NELL2_uc009zkd.2_Silent_p.N405N|NELL2_uc010skz.1_Silent_p.N456N|NELL2_uc010sla.1_Silent_p.N429N|NELL2_uc001roi.1_Silent_p.N406N|NELL2_uc010slb.1_Silent_p.N405N|NELL2_uc001roj.2_Silent_p.N406N	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	406	EGF-like 1.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		TCTCCATGCAGTTATGCCTTT	0.353													42	74	---	---	---	---	PASS
VDR	7421	broad.mit.edu	37	12	48238763	48238763	+	Silent	SNP	C	T	T	rs4987032		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48238763C>T	uc001rqm.2	-	11	1332	c.1050G>A	c.(1048-1050)GCG>GCA	p.A350A	VDR_uc001rql.2_Silent_p.A400A|VDR_uc001rqn.2_Silent_p.A350A|VDR_uc010slq.1_Silent_p.A318A	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor	350	Ligand-binding.				decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CCTCAATCAGCGCGGCGTCCT	0.652													20	125	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48371186	48371186	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48371186C>A	uc001rqu.2	-	46	3371	c.3190G>T	c.(3190-3192)GTG>TTG	p.V1064L	COL2A1_uc001rqt.2_5'Flank|COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.V995L	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	1064	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GGAGCTCCCACAGCACCAGTC	0.582													14	34	---	---	---	---	PASS
DDX23	9416	broad.mit.edu	37	12	49230390	49230390	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49230390G>A	uc001rsm.2	-	10	1289	c.1198C>T	c.(1198-1200)CCA>TCA	p.P400S		NM_004818	NP_004809	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	400	Q motif.					catalytic step 2 spliceosome|nucleoplasm|U5 snRNP	ATP binding|ATP-dependent RNA helicase activity|nucleic acid binding|protein binding			kidney(3)|ovary(1)|lung(1)|skin(1)	6						AAGATGTGTGGGGGCAGAGAA	0.512													35	204	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49431142	49431142	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49431142G>A	uc001rta.3	-	34	9997	c.9997C>T	c.(9997-9999)CAG>TAG	p.Q3333*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3333	Gln-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCTGGTGGCTGGGTGGGCATC	0.617			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			12	15	---	---	---	---	PASS
TUBA1A	7846	broad.mit.edu	37	12	49579509	49579509	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49579509G>A	uc009zlf.2	-	4	912	c.640C>T	c.(640-642)CGT>TGT	p.R214C	TUBA1B_uc001rto.2_Intron|TUBA1A_uc001rtp.2_Missense_Mutation_p.R214C|TUBA1A_uc001rtq.2_Missense_Mutation_p.R61C|TUBA1A_uc001rtr.2_Missense_Mutation_p.R61C|TUBA1A_uc009zlg.2_Missense_Mutation_p.R61C	NM_006009	NP_006000	Q71U36	TBA1A_HUMAN	tubulin, alpha 1a	214					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|structural molecule activity				0						AGGTTTCTACGACAGATGTCA	0.473													65	161	---	---	---	---	PASS
SPATS2	65244	broad.mit.edu	37	12	49918540	49918540	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49918540G>C	uc001rud.2	+	13	2176	c.1187G>C	c.(1186-1188)AGT>ACT	p.S396T	SPATS2_uc001rue.2_RNA|SPATS2_uc009zli.1_Missense_Mutation_p.S396T|SPATS2_uc001ruf.2_Missense_Mutation_p.S396T|SPATS2_uc001rug.2_Missense_Mutation_p.S396T	NM_023071	NP_075559	Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	396	Ser-rich.					cytoplasm				breast(1)	1						AGTAGCCCAAGTGATGCCTCT	0.478													34	216	---	---	---	---	PASS
MCRS1	10445	broad.mit.edu	37	12	49958314	49958314	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49958314C>A	uc001ruk.1	-	6	698	c.507G>T	c.(505-507)CGG>CGT	p.R169R	MCRS1_uc001rui.1_Silent_p.R182R|MCRS1_uc001ruj.1_Silent_p.R156R|MCRS1_uc001rul.1_Silent_p.R169R|MCRS1_uc009zlj.1_5'UTR|MCRS1_uc001rum.1_Silent_p.R156R|MCRS1_uc001run.1_Silent_p.R169R	NM_006337	NP_006328	Q96EZ8	MCRS1_HUMAN	microspherule protein 1 isoform 1	169					DNA recombination|DNA repair|protein modification process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|MLL1 complex|nucleolus	protein binding			large_intestine(1)	1						CCTGGACCTCCCGAAGGGTGA	0.597													9	30	---	---	---	---	PASS
ANKRD52	283373	broad.mit.edu	37	12	56648716	56648716	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56648716G>T	uc001skm.3	-	6	573	c.483C>A	c.(481-483)AAC>AAA	p.N161K	ANKRD52_uc001skn.1_RNA	NM_173595	NP_775866	Q8NB46	ANR52_HUMAN	ankyrin repeat domain 52	161	ANK 5.						protein binding			ovary(2)	2						TGGCTCCCTTGTTGAGGAGCA	0.498													15	124	---	---	---	---	PASS
PTPRR	5801	broad.mit.edu	37	12	71050497	71050497	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:71050497G>T	uc001swi.1	-	13	2283	c.1867C>A	c.(1867-1869)CTT>ATT	p.L623I	PTPRR_uc001swf.1_RNA|PTPRR_uc001swg.1_RNA|PTPRR_uc001swh.1_Missense_Mutation_p.L378I|PTPRR_uc009zrs.2_Missense_Mutation_p.L472I|PTPRR_uc010stq.1_Missense_Mutation_p.L511I	NM_002849	NP_002840	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	623	Tyrosine-protein phosphatase.|Cytoplasmic (Potential).				in utero embryonic development	cell surface|Golgi apparatus|integral to membrane|nucleus|perinuclear region of cytoplasm|plasma membrane	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			skin(2)|ovary(1)	3			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TCCATACGAAGCTGGCAGACA	0.458													45	212	---	---	---	---	PASS
RAB21	23011	broad.mit.edu	37	12	72176356	72176356	+	Silent	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72176356A>T	uc001swt.2	+	6	705	c.453A>T	c.(451-453)GCA>GCT	p.A151A		NM_014999	NP_055814	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	151					protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0						TAAGGTATGCAGAATCTGTGG	0.299													27	73	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72332809	72332809	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72332809C>T	uc009zrw.1	+	1	184	c.43C>T	c.(43-45)CGG>TGG	p.R15W	TPH2_uc001swy.2_5'Flank	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	15					aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	ATACTGGGCACGGAGAGGGTT	0.498											OREG0021996	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	126	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80699411	80699411	+	IGR	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80699411C>G								PPP1R12A (370176 upstream) : PTPRQ (138715 downstream)																							AATGATATGACCACATCTAAT	0.338													14	56	---	---	---	---	PASS
DUSP6	1848	broad.mit.edu	37	12	89745570	89745570	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:89745570G>A	uc001tay.2	-	1	727	c.247C>T	c.(247-249)CGG>TGG	p.R83W	DUSP6_uc001taz.2_Missense_Mutation_p.R83W	NM_001946	NP_001937	Q16828	DUS6_HUMAN	dual specificity phosphatase 6 isoform a	83	Rhodanese.				dorsal/ventral pattern formation|inactivation of MAPK activity|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of ERK1 and ERK2 cascade|nerve growth factor receptor signaling pathway|positive regulation of apoptosis|regulation of endodermal cell fate specification|regulation of fibroblast growth factor receptor signaling pathway|regulation of heart growth|response to nitrosative stress|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity				0						AAGCGGTCCCGGTCCTCGCCG	0.682													8	13	---	---	---	---	PASS
KERA	11081	broad.mit.edu	37	12	91449570	91449570	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:91449570G>A	uc001tbl.2	-	2	1108	c.489C>T	c.(487-489)AGC>AGT	p.S163S		NM_007035	NP_008966	O60938	KERA_HUMAN	keratocan precursor	163	LRR 4.				response to stimulus|visual perception	proteinaceous extracellular matrix				skin(1)	1						TCTCCAGATTGCTAAAGGTCC	0.403													53	296	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	100043063	100043063	+	Intron	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100043063T>A	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc009ztt.1_Intron|FAM71C_uc001tgn.2_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GTTCTCTCCCTAGGGATATGC	0.378													62	188	---	---	---	---	PASS
UHRF1BP1L	23074	broad.mit.edu	37	12	100453798	100453798	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100453798G>A	uc001tgq.2	-	13	1802	c.1573C>T	c.(1573-1575)CAG>TAG	p.Q525*	UHRF1BP1L_uc001tgp.2_Nonsense_Mutation_p.Q175*	NM_015054	NP_055869	A0JNW5	UH1BL_HUMAN	UHRF1 (ICBP90) binding protein 1-like isoform a	525										ovary(2)	2						GCATTCAGCTGGCTATAGAGG	0.343													30	82	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101595996	101595996	+	Intron	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101595996A>G	uc001thz.3	-							NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),						apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						TACAGAATCTAGGGGGGAGAA	0.333													11	64	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104100769	104100769	+	Intron	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104100769A>T	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GACCAAGGTGAGCACCGTCCT	0.597													8	38	---	---	---	---	PASS
ACAD10	80724	broad.mit.edu	37	12	112191650	112191650	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112191650C>T	uc001tsq.2	+	19	3092	c.2892C>T	c.(2890-2892)CGC>CGT	p.R964R	ACAD10_uc009zvx.2_Silent_p.R995R|ACAD10_uc001tss.1_Intron	NM_025247	NP_079523	Q6JQN1	ACD10_HUMAN	acyl-Coenzyme A dehydrogenase family, member 10	964							acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|hydrolase activity|transferase activity, transferring phosphorus-containing groups			ovary(2)	2						CGCAGTCGCGCGTGGAGATTG	0.657											OREG0022130	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	40	---	---	---	---	PASS
BCL7A	605	broad.mit.edu	37	12	122481907	122481907	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122481907G>T	uc001ubp.2	+	4	524	c.387G>T	c.(385-387)GAG>GAT	p.E129D	BCL7A_uc001ubo.2_Missense_Mutation_p.E129D	NM_001024808	NP_001019979	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A isoform b	129					negative regulation of transcription, DNA-dependent					ovary(1)|lung(1)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		ACGGCACCGAGGCCAAGGTGG	0.647			T	MYC	BNHL								25	136	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123076003	123076003	+	Intron	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123076003G>C	uc001ucv.2	+						KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore						cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AACTTGGTGTGAGTATTCTTT	0.289													72	186	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123089137	123089137	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123089137T>C	uc001ucv.2	+	49	5291	c.5128T>C	c.(5128-5130)TTC>CTC	p.F1710L	KNTC1_uc010taf.1_Intron	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	1710					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGCTTTGAAATTCTGCCTTTA	0.318													16	54	---	---	---	---	PASS
SLC15A4	121260	broad.mit.edu	37	12	129285415	129285415	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129285415G>C	uc001uhu.2	-	6	1451	c.1398C>G	c.(1396-1398)ATC>ATG	p.I466M	SLC15A4_uc001uhv.2_RNA	NM_145648	NP_663623	Q8N697	S15A4_HUMAN	solute carrier family 15, member 4	466	Helical; (Potential).				oligopeptide transport|protein transport	integral to membrane|lysosomal membrane	peptide:hydrogen symporter activity				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.69e-06)|Epithelial(86;1.17e-05)|all cancers(50;5.07e-05)		TACTTGCAAAGATCTCGCTGA	0.542													26	74	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130827641	130827641	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130827641C>A	uc001uik.2	+	3	275	c.185C>A	c.(184-186)TCA>TAA	p.S62*	PIWIL1_uc001uij.1_Nonsense_Mutation_p.S62*	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	62					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ACAGCCAAGTCACAAGGTGAA	0.433													20	44	---	---	---	---	PASS
ATP12A	479	broad.mit.edu	37	13	25280467	25280467	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25280467G>T	uc001upp.2	+	15	2222	c.2035G>T	c.(2035-2037)GTG>TTG	p.V679L	ATP12A_uc010aaa.2_Missense_Mutation_p.V685L	NM_001676	NP_001667	P54707	AT12A_HUMAN	hydrogen/potassium-exchanging ATPase 12A	679	Cytoplasmic (Potential).				ATP biosynthetic process	hydrogen:potassium-exchanging ATPase complex	ATP binding|hydrogen:potassium-exchanging ATPase activity|metal ion binding			ovary(2)|central_nervous_system(2)|large_intestine(1)|breast(1)	6		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)	Esomeprazole(DB00736)|Pantoprazole(DB00213)	CAAGGCCGCTGTGGTGACTGG	0.557													16	81	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35672485	35672485	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35672485G>T	uc001uvb.2	+	12	1829	c.1623G>T	c.(1621-1623)ATG>ATT	p.M541I		NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	541						cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CAGTAGCCATGCAAGAACAGA	0.368													6	9	---	---	---	---	PASS
STOML3	161003	broad.mit.edu	37	13	39541076	39541076	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39541076G>T	uc001uwx.2	-	7	900	c.762C>A	c.(760-762)AGC>AGA	p.S254R	STOML3_uc010tez.1_Missense_Mutation_p.S245R	NM_145286	NP_660329	Q8TAV4	STML3_HUMAN	stomatin-like 3 isoform 1	254	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(1)	1		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TGGCTACCGTGCTCAAGGTCT	0.507													38	81	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39596551	39596551	+	Splice_Site	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39596551T>A	uc001uwy.2	-	9	1517	c.644_splice	c.e9-1	p.S215_splice	C13orf23_uc001uwz.2_Splice_Site_p.S193_splice	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1											ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		TATAAGCACCTAAAATAAAAA	0.363													46	117	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92380805	92380805	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92380805G>T	uc010tif.1	+	4	1406	c.1040G>T	c.(1039-1041)CGC>CTC	p.R347L		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	347						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ATTTGTGGCCGCCCTGTAAGA	0.418													63	137	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96555254	96555254	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96555254C>A	uc001vmt.2	-	21	2526	c.2356G>T	c.(2356-2358)GAG>TAG	p.E786*		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	786					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						GCTGTGTTCTCTTCATTTATT	0.338													43	100	---	---	---	---	PASS
OR11H4	390442	broad.mit.edu	37	14	20711839	20711839	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20711839C>G	uc010tld.1	+	1	889	c.889C>G	c.(889-891)CCT>GCT	p.P297A		NM_001004479	NP_001004479	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H,	297	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		TCTTTTTAATCCTCTGATCTA	0.398													33	161	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23873957	23873957	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23873957C>T	uc001wjv.2	-	7	672	c.605G>A	c.(604-606)GGT>GAT	p.G202D	MYH6_uc010akp.1_Missense_Mutation_p.G202D	NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	202	Myosin head-like.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GCCACGGTCACCTATGGCTGC	0.592													16	53	---	---	---	---	PASS
C14orf28	122525	broad.mit.edu	37	14	45373614	45373614	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45373614G>T	uc001wvo.2	+	4	897	c.631G>T	c.(631-633)GAA>TAA	p.E211*	C14orf28_uc001wvp.1_Nonsense_Mutation_p.E211*	NM_001017923	NP_001017923	Q4W4Y0	CN028_HUMAN	hypothetical protein LOC122525	211										ovary(1)	1						TGGCTTAAGAGAATTTTCCCA	0.388													45	253	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50623787	50623787	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50623787T>A	uc001wxs.3	-	12	2085	c.1987A>T	c.(1987-1989)AAA>TAA	p.K663*	SOS2_uc010tql.1_Nonsense_Mutation_p.K630*|SOS2_uc010tqm.1_RNA|SOS2_uc001wxt.2_Nonsense_Mutation_p.K351*	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	663	N-terminal Ras-GEF.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					TGCTCGCCTTTCTCTATTGCC	0.363													13	52	---	---	---	---	PASS
C14orf101	54916	broad.mit.edu	37	14	57052579	57052579	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:57052579G>T	uc001xcm.2	+	3	415	c.293G>T	c.(292-294)TGT>TTT	p.C98F	C14orf101_uc001xcj.2_RNA|C14orf101_uc001xck.2_Missense_Mutation_p.C98F|C14orf101_uc010aot.1_Missense_Mutation_p.C98F|C14orf101_uc001xcl.1_RNA|C14orf101_uc001xcn.2_RNA|C14orf101_uc010trf.1_5'UTR	NM_017799	NP_060269	Q9NX78	CN101_HUMAN	hypothetical protein LOC54916	98	Helical; (Potential).					integral to membrane				breast(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(311;0.226)		AATCTTCTCTGTGGCTTATTT	0.413													31	225	---	---	---	---	PASS
GALNTL1	57452	broad.mit.edu	37	14	69813862	69813862	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69813862C>A	uc010aqu.1	+	13	1470	c.1377C>A	c.(1375-1377)ATC>ATA	p.I459I	GALNTL1_uc001xla.1_Silent_p.I459I|GALNTL1_uc001xlb.1_Silent_p.I459I	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	459	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		GAATGGGGATCTGCAGAGGGT	0.592											OREG0022763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	64	---	---	---	---	PASS
LTBP2	4053	broad.mit.edu	37	14	75017795	75017795	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75017795C>A	uc001xqa.2	-	7	2045	c.1658G>T	c.(1657-1659)CGG>CTG	p.R553L		NM_000428	NP_000419	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding	553	TB 1.				protein secretion|protein targeting|transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|growth factor binding			liver(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		CAGGTAACACCGGCCCAGCAG	0.637													12	73	---	---	---	---	PASS
ISM2	145501	broad.mit.edu	37	14	77944917	77944917	+	Splice_Site	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77944917C>G	uc001xtz.2	-	5	1188	c.1114_splice	c.e5+1	p.G372_splice	ISM2_uc001xua.2_Splice_Site_p.L256_splice|ISM2_uc001xty.2_Splice_Site_p.G284_splice|ISM2_uc010tvl.1_Splice_Site_p.G291_splice	NM_199296	NP_954993	Q6H9L7	ISM2_HUMAN	isthmin 2 homolog isoform 1							extracellular region				skin(1)	1						GCTCATCTCACCAGGACAGGA	0.637													26	73	---	---	---	---	PASS
TSHR	7253	broad.mit.edu	37	14	81574807	81574807	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81574807C>A	uc001xvd.1	+						TSHR_uc001xvb.1_3'UTR|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	GTGAGTAAGACATACAAAAGA	0.299			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						18	124	---	---	---	---	PASS
KCNK10	54207	broad.mit.edu	37	14	88789090	88789090	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88789090C>A	uc001xwo.2	-						KCNK10_uc001xwn.2_Intron	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10						signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						GAAACACCCACCTTTAGGATC	0.403													37	58	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102504837	102504837	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102504837A>T	uc001yks.2	+	58	11113	c.10949A>T	c.(10948-10950)AAC>ATC	p.N3650I		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	3650	AAA 5 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						CCGGTGCTGAACCGTGAAGTG	0.537													15	91	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105417279	105417279	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105417279G>T	uc010axc.1	-	7	4629	c.4509C>A	c.(4507-4509)TTC>TTA	p.F1503L	AHNAK2_uc001ypx.2_Missense_Mutation_p.F1403L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1503						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CAGACACCCCGAACGACGGCA	0.602													11	91	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106321578	106321578	+	Intron	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106321578C>T	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysj.2_Intron|uc001ysk.1_Intron|uc001ysl.1_Intron|uc001ysm.1_Intron|uc001ysn.1_Intron|uc001yso.1_Intron					Parts of antibodies, mostly variable regions.												0						GGGGACAGGTCACTCACCGGG	0.647													4	18	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106453066	106453066	+	RNA	SNP	G	T	T	rs113318051		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106453066G>T	uc010tyt.1	-	1974		c.37773C>A								Parts of antibodies, mostly variable regions.												0						CTTACCTGTGGCTGCTGCCAC	0.552													30	37	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25222129	25222129	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25222129G>T	uc001ywp.1	+	10	1263	c.373G>T	c.(373-375)GCT>TCT	p.A125S	SNRPN_uc001ywq.1_Missense_Mutation_p.A125S|SNRPN_uc001ywr.1_Missense_Mutation_p.A125S|SNRPN_uc001yws.1_Missense_Mutation_p.A125S|SNRPN_uc001ywt.1_Missense_Mutation_p.A125S|SNRPN_uc001ywv.1_Missense_Mutation_p.A128S|SNRPN_uc001yww.1_Missense_Mutation_p.A125S|SNRPN_uc001ywx.1_Missense_Mutation_p.A125S|SNRPN_uc001ywz.1_Intron|PAR-SN_uc001yxa.1_Intron|SNRPN_uc001ywy.1_3'UTR	NM_022807	NP_073718	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	125					RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		CCAGGCCCCTGCTGGATTGGC	0.587									Prader-Willi_syndrome				22	97	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28116342	28116342	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28116342C>A	uc001zbh.3	-	21	2312	c.2202G>T	c.(2200-2202)CTG>CTT	p.L734L	OCA2_uc010ayv.2_Silent_p.L710L	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	734	Helical; (Potential).				eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GGGACGACGCCAGGGCTGAGA	0.577									Oculocutaneous_Albinism				6	77	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33925293	33925293	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33925293C>A	uc001zhi.2	+	24	3081	c.3011C>A	c.(3010-3012)ACC>AAC	p.T1004N	RYR3_uc010bar.2_Missense_Mutation_p.T1004N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1004	2.|4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAAGGATGGACCTATGGCATC	0.413													12	70	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41796998	41796998	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41796998C>T	uc001zoa.3	-	17	2271	c.2093G>A	c.(2092-2094)GGC>GAC	p.G698D	LTK_uc001zob.3_Missense_Mutation_p.G637D|LTK_uc010ucx.1_Missense_Mutation_p.G568D|LTK_uc010bcg.2_Missense_Mutation_p.G396D	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	698	Protein kinase.|Cytoplasmic (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TGTGAAGATGCCCTCCAGGAA	0.597										TSP Lung(18;0.14)			14	103	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41865899	41865899	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41865899G>T	uc001zof.1	+	18	2392	c.2168G>T	c.(2167-2169)TGG>TTG	p.W723L		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	723	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		GTGACCATGTGGGAGATCATG	0.572													19	207	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41865900	41865900	+	Missense_Mutation	SNP	G	T	T	rs138665905		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41865900G>T	uc001zof.1	+	18	2393	c.2169G>T	c.(2167-2169)TGG>TGT	p.W723C		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	723	Protein kinase.|Cytoplasmic (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TGACCATGTGGGAGATCATGA	0.572													19	206	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42156021	42156021	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42156021C>A	uc001zos.2	-							NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5						actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		GCCCACCTGGCCAAGGGGTGG	0.617													24	114	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42439472	42439472	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42439472C>A	uc001zoz.2	-	13	1332	c.1269G>T	c.(1267-1269)CAG>CAT	p.Q423H	PLA2G4F_uc010bcq.2_5'Flank|PLA2G4F_uc001zoy.2_Missense_Mutation_p.Q55H|PLA2G4F_uc010bcr.2_Missense_Mutation_p.Q174H|PLA2G4F_uc001zpa.2_Missense_Mutation_p.Q174H|PLA2G4F_uc010bcs.2_Missense_Mutation_p.Q210H	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	423	PLA2c.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		AGACGTGAACCTGGGCACGCT	0.622													17	89	---	---	---	---	PASS
USP50	373509	broad.mit.edu	37	15	50822029	50822029	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50822029G>A	uc001zyq.3	-	6	1096	c.916C>T	c.(916-918)CGG>TGG	p.R306W		NM_203494	NP_987090	E9PP86	E9PP86_HUMAN	ubiquitin specific protease 50	301					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			lung(1)|breast(1)	2				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		GGATATTTCCGGAAAATTGAG	0.368													15	102	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59344503	59344503	+	Splice_Site	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59344503G>A	uc002afv.2	+	3	1160	c.881_splice	c.e3-1	p.G294_splice	RNF111_uc002afs.2_Splice_Site_p.G294_splice|RNF111_uc002aft.2_Splice_Site_p.G294_splice|RNF111_uc002afu.2_Splice_Site_p.G294_splice|RNF111_uc002afw.2_Splice_Site_p.G294_splice	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111						multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		TTTGTTTCCAGGAAGTATTGA	0.368													35	170	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425284	74425284	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425284C>T	uc002axd.2	+	4	958	c.189C>T	c.(187-189)ATC>ATT	p.I63I	ISLR2_uc002axe.2_Silent_p.I63I|ISLR2_uc010bjg.2_Silent_p.I63I|ISLR2_uc010bjf.2_Silent_p.I63I	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	63	LRR 1.|Extracellular (Potential).				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						CGAACAAGATCACTGTGCTGC	0.647													26	104	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425431	74425431	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425431C>T	uc002axd.2	+	4	1105	c.336C>T	c.(334-336)TCC>TCT	p.S112S	ISLR2_uc002axe.2_Silent_p.S112S|ISLR2_uc010bjg.2_Silent_p.S112S|ISLR2_uc010bjf.2_Silent_p.S112S	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	112	LRR 3.|Extracellular (Potential).				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						ACTTCATATCCAGCTTTCCGT	0.637													16	136	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425535	74425535	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425535C>T	uc002axd.2	+	4	1209	c.440C>T	c.(439-441)CCC>CTC	p.P147L	ISLR2_uc002axe.2_Missense_Mutation_p.P147L|ISLR2_uc010bjg.2_Missense_Mutation_p.P147L|ISLR2_uc010bjf.2_Missense_Mutation_p.P147L	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	147	Extracellular (Potential).				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						GGTGCGCTACCCGACCTGCGT	0.637													15	117	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425602	74425602	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425602G>T	uc002axd.2	+	4	1276	c.507G>T	c.(505-507)GCG>GCT	p.A169A	ISLR2_uc002axe.2_Silent_p.A169A|ISLR2_uc010bjg.2_Silent_p.A169A|ISLR2_uc010bjf.2_Silent_p.A169A	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	169	Extracellular (Potential).|LRR 5.				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						CCTTCGACGCGCTTAGCGCGC	0.667													50	127	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425682	74425682	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425682C>T	uc002axd.2	+	4	1356	c.587C>T	c.(586-588)GCC>GTC	p.A196V	ISLR2_uc002axe.2_Missense_Mutation_p.A196V|ISLR2_uc010bjg.2_Missense_Mutation_p.A196V|ISLR2_uc010bjf.2_Missense_Mutation_p.A196V	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	196	Extracellular (Potential).|LRRCT.				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						CAGGCCTGGGCCGCGAGCACC	0.692													13	141	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425689	74425689	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425689C>T	uc002axd.2	+	4	1363	c.594C>T	c.(592-594)AGC>AGT	p.S198S	ISLR2_uc002axe.2_Silent_p.S198S|ISLR2_uc010bjg.2_Silent_p.S198S|ISLR2_uc010bjf.2_Silent_p.S198S	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	198	Extracellular (Potential).|LRRCT.				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						GGGCCGCGAGCACCCGGGTGT	0.682													13	142	---	---	---	---	PASS
ISLR2	57611	broad.mit.edu	37	15	74425918	74425918	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74425918C>T	uc002axd.2	+	4	1592	c.823C>T	c.(823-825)CAG>TAG	p.Q275*	ISLR2_uc002axe.2_Nonsense_Mutation_p.Q275*|ISLR2_uc010bjg.2_Nonsense_Mutation_p.Q275*|ISLR2_uc010bjf.2_Nonsense_Mutation_p.Q275*	NM_001130136	NP_001123608	Q6UXK2	ISLR2_HUMAN	immunoglobulin superfamily containing	275	Ig-like.|Extracellular (Potential).				positive regulation of axon extension	cell surface|integral to membrane|plasma membrane					0						ATGGCAACTTCAGATCCCCGG	0.463													5	69	---	---	---	---	PASS
CYP1A1	1543	broad.mit.edu	37	15	75013047	75013047	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75013047T>A	uc002ayp.3	-	7	1444	c.1322A>T	c.(1321-1323)AAG>ATG	p.K441M	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Missense_Mutation_p.K177M|CYP1A1_uc010bjx.2_Missense_Mutation_p.K177M|CYP1A1_uc002ayq.3_Missense_Mutation_p.K441M|CYP1A1_uc010bjy.2_Missense_Mutation_p.K412M	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	441					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)	ACTTAACACCTTGTCGATAGC	0.522									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				36	231	---	---	---	---	PASS
ZSCAN2	54993	broad.mit.edu	37	15	85164479	85164479	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85164479G>A	uc002bkr.2	+	3	1279	c.1053G>A	c.(1051-1053)ACG>ACA	p.T351T	ZSCAN2_uc010bmz.1_Silent_p.T349T|ZSCAN2_uc010bna.2_Silent_p.T201T|ZSCAN2_uc010uox.1_Intron|ZSCAN2_uc010uoy.1_Intron|ZSCAN2_uc010uoz.1_Intron	NM_181877	NP_870992	Q7Z7L9	ZSCA2_HUMAN	zinc finger protein 29 isoform 1	351	C2H2-type 5.				cell differentiation|multicellular organismal development|spermatogenesis|viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		GCCTTAACACGCATCAGGGGA	0.507													48	217	---	---	---	---	PASS
WDR93	56964	broad.mit.edu	37	15	90286557	90286557	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90286557G>A	uc002boj.2	+	17	2097	c.1996G>A	c.(1996-1998)GAG>AAG	p.E666K	WDR93_uc010bnr.2_Missense_Mutation_p.E638K|WDR93_uc010upz.1_Missense_Mutation_p.E383K	NM_020212	NP_064597	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	666					electron transport chain	mitochondrial inner membrane	oxidoreductase activity, acting on NADH or NADPH			ovary(2)	2	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			AGAGAAGGAGGAGGAGCACTG	0.587													5	129	---	---	---	---	PASS
SEMA4B	10509	broad.mit.edu	37	15	90771643	90771643	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90771643G>T	uc002boy.2	+	15	2565	c.2282G>T	c.(2281-2283)TGC>TTC	p.C761F	SEMA4B_uc002boz.2_Missense_Mutation_p.C761F|SEMA4B_uc010uqd.1_Missense_Mutation_p.C599F|SEMA4B_uc002bpa.2_Missense_Mutation_p.C599F|SEMA4B_uc010bnv.1_Intron	NM_020210	NP_064595			semaphorin 4B precursor											ovary(1)|breast(1)|kidney(1)	3	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			CCCAAGACCTGCCCTGTGGTG	0.637													5	25	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91312729	91312729	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91312729C>T	uc002bpr.2	+	12	2565	c.2468C>T	c.(2467-2469)TCT>TTT	p.S823F	BLM_uc010uqh.1_Missense_Mutation_p.S823F|BLM_uc010uqi.1_Missense_Mutation_p.S448F|BLM_uc010bnx.2_Missense_Mutation_p.S823F|BLM_uc002bps.1_Missense_Mutation_p.S385F	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein	823	Helicase ATP-binding.				double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AAGTTTCCTTCTGTTCCGGTG	0.438			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				13	162	---	---	---	---	PASS
ADAMTS17	170691	broad.mit.edu	37	15	100871232	100871232	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100871232G>C	uc002bvv.1	-	3	557	c.478C>G	c.(478-480)CAG>GAG	p.Q160E	ADAMTS17_uc002bvx.1_5'UTR	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	160					proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		ATTAGCACCTGCTCCTGCCCA	0.597													39	104	---	---	---	---	PASS
LMF1	64788	broad.mit.edu	37	16	919971	919971	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:919971C>T	uc002ckj.2	-	9	1332	c.1328G>A	c.(1327-1329)TGC>TAC	p.C443Y	LMF1_uc010brg.2_5'Flank|LMF1_uc010brh.2_Missense_Mutation_p.C226Y|LMF1_uc010bri.2_Missense_Mutation_p.C206Y|LMF1_uc002ckk.2_Missense_Mutation_p.C226Y	NM_022773	NP_073610	Q96S06	LMF1_HUMAN	lipase maturation factor 1	443	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0		Hepatocellular(780;0.00308)				ACCTGGCTTGCACTTGAACTC	0.662													19	30	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1394641	1394641	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1394641G>T	uc002clk.1	+	19	1804	c.1804G>T	c.(1804-1806)GAC>TAC	p.D602Y	BAIAP3_uc002clj.2_Missense_Mutation_p.D584Y|BAIAP3_uc010uuz.1_Missense_Mutation_p.D567Y|BAIAP3_uc010uva.1_Missense_Mutation_p.D539Y|BAIAP3_uc010uvc.1_Missense_Mutation_p.D531Y	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	602					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				TGTGCTGGCTGACGCCGTCTA	0.647													94	226	---	---	---	---	PASS
TBC1D24	57465	broad.mit.edu	37	16	2549416	2549416	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2549416A>C	uc002cql.2	+	5	1341	c.1201A>C	c.(1201-1203)AAG>CAG	p.K401Q	TBC1D24_uc002cqk.2_Missense_Mutation_p.K395Q|TBC1D24_uc002cqm.2_Intron|TBC1D24_uc010bsm.2_Intron	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	401	TLD.				neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						GACCACGCAGAAGGAGGTGAG	0.622													6	22	---	---	---	---	PASS
CIITA	4261	broad.mit.edu	37	16	10996530	10996530	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10996530C>G	uc002dai.3	+	8	777	c.644C>G	c.(643-645)TCC>TGC	p.S215C	CIITA_uc002daj.3_Missense_Mutation_p.S216C|CIITA_uc002dak.3_Missense_Mutation_p.S166C|CIITA_uc002dag.2_Missense_Mutation_p.S215C|CIITA_uc002dah.2_Missense_Mutation_p.S167C|CIITA_uc010bup.1_Missense_Mutation_p.S215C	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	215					interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						TTCTCCAGTTCCTCGTTGAGC	0.468			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								30	73	---	---	---	---	PASS
LITAF	9516	broad.mit.edu	37	16	11650373	11650373	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11650373T>A	uc002daz.2	-	2	447	c.214A>T	c.(214-216)AAT>TAT	p.N72Y	LITAF_uc002dba.2_Missense_Mutation_p.N72Y|LITAF_uc002dbb.2_Missense_Mutation_p.N72Y|LITAF_uc002dbc.2_Missense_Mutation_p.N72Y|LITAF_uc002dbd.2_Missense_Mutation_p.N72Y|LITAF_uc002dbe.3_Missense_Mutation_p.N72Y	NM_004862	NP_004853	Q99732	LITAF_HUMAN	lipopolysaccharide-induced TNF-alpha factor	72					apoptosis|positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|lysosomal membrane	signal transducer activity|WW domain binding			liver(1)	1						GTACTTGGATTGTTATTGGGG	0.577													8	52	---	---	---	---	PASS
TMC5	79838	broad.mit.edu	37	16	19475265	19475265	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19475265C>T	uc002dgc.3	+	8	2153	c.1404C>T	c.(1402-1404)TTC>TTT	p.F468F	TMC5_uc010vaq.1_Silent_p.F468F|TMC5_uc002dgb.3_Silent_p.F468F|TMC5_uc010var.1_Silent_p.F468F|TMC5_uc002dgd.1_Silent_p.F222F|TMC5_uc002dge.3_Silent_p.F222F|TMC5_uc002dgf.3_Silent_p.F151F|TMC5_uc002dgg.3_Silent_p.F109F	NM_001105248	NP_001098718	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5 isoform a	468	Helical; (Potential).					integral to membrane				skin(1)	1						TCCTGAACTTCAGCTTCATCA	0.458													8	134	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20471532	20471532	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20471532C>A	uc010bwe.2	+	3	335	c.96C>A	c.(94-96)TCC>TCA	p.S32S	ACSM2A_uc010bwd.1_RNA|ACSM2A_uc010vax.1_Intron|ACSM2A_uc002dhf.3_Silent_p.S32S|ACSM2A_uc002dhg.3_Silent_p.S32S|ACSM2A_uc010vay.1_Intron	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	32					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						AACTGGTGTCCCTGCAGTGGG	0.512													47	78	---	---	---	---	PASS
CDR2	1039	broad.mit.edu	37	16	22385551	22385551	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22385551C>A	uc002dkn.2	-							NM_001802	NP_001793	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2							nucleus	protein binding			skin(1)	1				GBM - Glioblastoma multiforme(48;0.0188)		cccgcccTCACCTTGCTGGAG	0.413													6	60	---	---	---	---	PASS
SCNN1G	6340	broad.mit.edu	37	16	23208724	23208724	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23208724G>C	uc002dlm.1	+	6	1192	c.1053G>C	c.(1051-1053)ATG>ATC	p.M351I		NM_001039	NP_001030	P51170	SCNNG_HUMAN	sodium channel, nonvoltage-gated 1, gamma	351	Extracellular (By similarity).				excretion|sensory perception of taste	apical plasma membrane|integral to plasma membrane	ligand-gated sodium channel activity|WW domain binding			ovary(2)|skin(2)|large_intestine(1)|pancreas(1)	6				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	AGACAGCAATGGTCACCTCTA	0.463													17	69	---	---	---	---	PASS
HS3ST4	9951	broad.mit.edu	37	16	26147398	26147398	+	Silent	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147398A>T	uc002dof.2	+	2	1592	c.1200A>T	c.(1198-1200)CCA>CCT	p.P400P		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	400	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		TAAAGAAGCCAGAAGACAGCA	0.473													18	53	---	---	---	---	PASS
MMP15	4324	broad.mit.edu	37	16	58077461	58077461	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58077461C>T	uc002ena.2	+	9	2473	c.1500C>T	c.(1498-1500)TAC>TAT	p.Y500Y		NM_002428	NP_002419	P51511	MMP15_HUMAN	matrix metalloproteinase 15 preproprotein	500	Hemopexin-like 3.|Extracellular (Potential).				protein modification process|proteolysis	extracellular matrix|integral to plasma membrane	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|protein binding|zinc ion binding			central_nervous_system(2)|breast(1)	3						ACCCTGGGTACCCCAAGCCCA	0.617													7	58	---	---	---	---	PASS
RANBP10	57610	broad.mit.edu	37	16	67765377	67765377	+	Missense_Mutation	SNP	T	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67765377T>G	uc002eud.2	-	7	1003	c.887A>C	c.(886-888)CAA>CCA	p.Q296P	RANBP10_uc010ceo.2_Missense_Mutation_p.Q67P|RANBP10_uc010vju.1_Missense_Mutation_p.Q240P|RANBP10_uc010vjv.1_Missense_Mutation_p.Q179P|RANBP10_uc010vjw.1_5'Flank|RANBP10_uc010vjx.1_Missense_Mutation_p.Q296P|RANBP10_uc010vjy.1_Missense_Mutation_p.Q164P	NM_020850	NP_065901	Q6VN20	RBP10_HUMAN	RAN binding protein 10	296	CTLH.									ovary(1)	1		Acute lymphoblastic leukemia(13;4.34e-06)|all_hematologic(13;0.000643)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00522)|Epithelial(162;0.025)|all cancers(182;0.157)		AACCTTACTTTGTCTGTTCTT	0.488													17	68	---	---	---	---	PASS
DPEP3	64180	broad.mit.edu	37	16	68012234	68012234	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68012234G>A	uc002evc.3	-	4	791	c.697C>T	c.(697-699)CTG>TTG	p.L233L	DPEP3_uc010cex.2_Silent_p.L233L	NM_022357	NP_071752	Q9H4B8	DPEP3_HUMAN	dipeptidase 3 isoform a	208					meiosis	anchored to membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			breast(3)	3		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0117)|Epithelial(162;0.0481)|all cancers(182;0.236)		AAACTGCGCAGCACAGAGAGG	0.552													10	97	---	---	---	---	PASS
CDH1	999	broad.mit.edu	37	16	68835620	68835620	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68835620C>T	uc002ewg.1	+	3	335	c.211C>T	c.(211-213)CTC>TTC	p.L71F	CDH1_uc010vlj.1_RNA|CDH1_uc010cfg.1_Missense_Mutation_p.L71F	NM_004360	NP_004351	P12830	CADH1_HUMAN	cadherin 1, type 1 preproprotein	71				SL -> P (in Ref. 3; AAA61259).	adherens junction organization|cellular component disassembly involved in apoptosis|cellular response to indole-3-methanol|cellular response to lithium ion|homophilic cell adhesion|negative regulation of cell-cell adhesion|positive regulation of transcription factor import into nucleus|positive regulation of transcription, DNA-dependent|regulation of immune response	actin cytoskeleton|aggresome|apical junction complex|catenin complex|cell-cell adherens junction|endosome|focal adhesion|Golgi apparatus|integral to membrane|internal side of plasma membrane|lateral plasma membrane|perinuclear region of cytoplasm	cell adhesion molecule binding|gamma-catenin binding			breast(148)|stomach(71)|biliary_tract(8)|endometrium(3)|soft_tissue(2)|large_intestine(2)|urinary_tract(2)|oesophagus(2)|ovary(2)|thyroid(1)|central_nervous_system(1)|lung(1)	243		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CTATTTTTCCCTCGACACCCG	0.458			Mis|N|F|S		lobular breast|gastric	gastric			Hereditary_Diffuse_Gastric_Cancer				41	198	---	---	---	---	PASS
CHST5	23563	broad.mit.edu	37	16	75563353	75563353	+	Nonsense_Mutation	SNP	G	C	C	rs146332168	byFrequency	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75563353G>C	uc002fei.2	-	3	2325	c.930C>G	c.(928-930)TAC>TAG	p.Y310*	CHST5_uc002fej.1_Nonsense_Mutation_p.Y316*	NM_024533	NP_078809	Q9GZS9	CHST5_HUMAN	carbohydrate (N-acetylglucosamine 6-O)	310	Lumenal (Potential).				N-acetylglucosamine metabolic process|protein sulfation	integral to membrane|intrinsic to Golgi membrane	N-acetylglucosamine 6-O-sulfotransferase activity				0						CGGTGAAGGCGTAGAGTGCGC	0.677													17	86	---	---	---	---	PASS
BCMO1	53630	broad.mit.edu	37	16	81314536	81314536	+	Silent	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81314536A>G	uc002fgn.1	+	8	1394	c.1176A>G	c.(1174-1176)CAA>CAG	p.Q392Q	BCMO1_uc010vnp.1_Silent_p.Q323Q	NM_017429	NP_059125	Q9HAY6	BCDO1_HUMAN	beta-carotene 15,15'-monooxygenase	392					retinoid metabolic process|steroid metabolic process	cytosol	beta-carotene 15,15'-monooxygenase activity|metal ion binding|monooxygenase activity				0						AAGATGGCCAAGTCTACTGCC	0.443													4	57	---	---	---	---	PASS
DPEP1	1800	broad.mit.edu	37	16	89704357	89704357	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89704357G>T	uc010cin.2	+	10	1246	c.1043G>T	c.(1042-1044)AGG>ATG	p.R348M	DPEP1_uc002fnr.3_Missense_Mutation_p.R348M|DPEP1_uc002fns.3_Missense_Mutation_p.R348M	NM_001128141	NP_001121613	P16444	DPEP1_HUMAN	dipeptidase 1 precursor	348					proteolysis	anchored to membrane|apical plasma membrane|microvillus membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity|protein binding			large_intestine(1)	1		all_lung(18;0.0054)|all_hematologic(23;0.094)		BRCA - Breast invasive adenocarcinoma(80;0.0258)	Cilastatin(DB01597)	AACCTGCTGAGGGTCTTCGAG	0.642													4	25	---	---	---	---	PASS
PITPNA	5306	broad.mit.edu	37	17	1438521	1438521	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1438521G>C	uc002fst.3	-	8	856	c.600C>G	c.(598-600)TTC>TTG	p.F200L	PITPNA_uc010cjt.2_Missense_Mutation_p.F84L|PITPNA_uc010cju.2_Missense_Mutation_p.F98L	NM_006224	NP_006215	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	200					axon guidance|lipid metabolic process|visual perception	cytoplasm	phosphatidylcholine transmembrane transporter activity|phosphatidylinositol transporter activity|protein binding			ovary(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		CCCACCACTTGAACTTGACGG	0.502													18	85	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	C	C	rs121912666		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578190T>C	uc002gim.2	-	6	853	c.659A>G	c.(658-660)TAT>TGT	p.Y220C	TP53_uc002gig.1_Missense_Mutation_p.Y220C|TP53_uc002gih.2_Missense_Mutation_p.Y220C|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.Y88C|TP53_uc010cng.1_Missense_Mutation_p.Y88C|TP53_uc002gii.1_Missense_Mutation_p.Y88C|TP53_uc010cnh.1_Missense_Mutation_p.Y220C|TP53_uc010cni.1_Missense_Mutation_p.Y220C|TP53_uc002gij.2_Missense_Mutation_p.Y220C|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.Y127C|TP53_uc002gio.2_Missense_Mutation_p.Y88C|TP53_uc010vug.1_Missense_Mutation_p.Y181C	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	220	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		Y -> N (in sporadic cancers; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> D (in sporadic cancers; somatic mutation).|Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.Y220C(205)|p.Y220N(12)|p.Y220H(9)|p.Y220S(9)|p.0?(7)|p.Y220fs*27(4)|p.Y220*(3)|p.Y220D(2)|p.Y127C(2)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.?(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*1(1)|p.Y220fs*2(1)|p.V218fs*26(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		AGGCGGCTCATAGGGCACCAC	0.557		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	42	---	---	---	---	PASS
TRIM16	10626	broad.mit.edu	37	17	15532053	15532053	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15532053C>T	uc002gox.2	-	9	2128	c.1571G>A	c.(1570-1572)TGC>TAC	p.C524Y	TRIM16_uc002gor.1_Intron|TRIM16_uc002gow.2_Missense_Mutation_p.C308Y|TRIM16_uc002goy.2_Missense_Mutation_p.C394Y	NM_006470	NP_006461	O95361	TRI16_HUMAN	tripartite motif-containing 16	524	B30.2/SPRY.				histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TGAAAATTTGCAGGCAAACTT	0.517													5	126	---	---	---	---	PASS
C17orf66	256957	broad.mit.edu	37	17	34182401	34182401	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34182401A>T	uc002hke.1	-	15	1528	c.1379T>A	c.(1378-1380)TTA>TAA	p.L460*	C17orf66_uc010wck.1_RNA|C17orf66_uc010wcl.1_Nonsense_Mutation_p.L420*	NM_152781	NP_689994	A2RTY3	CQ066_HUMAN	hypothetical protein LOC256957	460							binding			breast(2)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0184)		ACAAAGGATTAATGTTTCTTG	0.493													41	75	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38451705	38451705	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38451705G>A	uc002huj.1	+	8	1391	c.1181G>A	c.(1180-1182)TGC>TAC	p.C394Y		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	394					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						CTGGATGTTTGCAGGTGAGTT	0.403													66	116	---	---	---	---	PASS
KRTAP1-3	81850	broad.mit.edu	37	17	39190672	39190672	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39190672G>T	uc002hvv.2	-	1	436	c.402C>A	c.(400-402)TGC>TGA	p.C134*		NM_030966	NP_112228	Q8IUG1	KRA13_HUMAN	keratin associated protein 1-3	144						extracellular region|keratin filament	structural constituent of epidermis				0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GGTGCAGCTGGCAGCAGGTTG	0.672													24	39	---	---	---	---	PASS
FKBP10	60681	broad.mit.edu	37	17	39975846	39975846	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39975846C>A	uc002hxv.2	+	6	1307	c.982C>A	c.(982-984)CAG>AAG	p.Q328K	FKBP10_uc002hxw.1_Missense_Mutation_p.Q31K	NM_021939	NP_068758	Q96AY3	FKB10_HUMAN	FK506 binding protein 10 precursor	328	PPIase FKBP-type 3.				protein folding	endoplasmic reticulum lumen|membrane	calcium ion binding|FK506 binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1		Breast(137;0.00122)		BRCA - Breast invasive adenocarcinoma(366;0.148)		CGGGATGGACCAGGGGCTGCA	0.617													8	22	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44770427	44770427	+	Silent	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44770427A>C	uc002iku.2	+	10	1208	c.1104A>C	c.(1102-1104)CTA>CTC	p.L368L	NSF_uc010wke.1_Silent_p.L274L|NSF_uc010wkf.1_Silent_p.L274L|NSF_uc010wkg.1_Silent_p.L363L	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	368					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		ACAACATCCTAGTCATTGGTA	0.393													18	140	---	---	---	---	PASS
ANKRD40	91369	broad.mit.edu	37	17	48777095	48777095	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48777095G>A	uc002iso.2	-	3	698	c.443C>T	c.(442-444)CCC>CTC	p.P148L		NM_052855	NP_443087	Q6AI12	ANR40_HUMAN	ankyrin repeat domain 40	148	Pro-rich.										0			BRCA - Breast invasive adenocarcinoma(22;2.03e-09)			GGGTGTGGAGGGGCCCCCATT	0.582													38	80	---	---	---	---	PASS
NUP85	79902	broad.mit.edu	37	17	73230817	73230817	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73230817G>A	uc002jng.1	+	17	1961	c.1701G>A	c.(1699-1701)CGG>CGA	p.R567R	NUP85_uc010dgd.1_Silent_p.R522R|NUP85_uc010wrv.1_Silent_p.R521R|NUP85_uc002jnh.1_Silent_p.R170R	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85	567					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			TGACGTCTCGGATTGCCCCTC	0.522													9	268	---	---	---	---	PASS
NUP85	79902	broad.mit.edu	37	17	73230872	73230872	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73230872G>A	uc002jng.1	+	17	2016	c.1756G>A	c.(1756-1758)GAA>AAA	p.E586K	NUP85_uc010dgd.1_Missense_Mutation_p.E541K|NUP85_uc010wrv.1_Missense_Mutation_p.E540K|NUP85_uc002jnh.1_Missense_Mutation_p.E189K	NM_024844	NP_079120	Q9BW27	NUP85_HUMAN	nucleoporin 85	586					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|nuclear membrane|Nup107-160 complex|spindle	protein binding			ovary(1)	1	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			GCCCCTTTTGGAACAGAAACA	0.517													8	215	---	---	---	---	PASS
CANT1	124583	broad.mit.edu	37	17	76993027	76993027	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76993027C>A	uc002jwn.2	-						CANT1_uc002jwk.2_Intron|CANT1_uc002jwj.2_Intron|CANT1_uc002jwl.2_Intron|CANT1_uc002jwm.1_5'Flank	NM_001159772	NP_001153244	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1						positive regulation of I-kappaB kinase/NF-kappaB cascade	endoplasmic reticulum membrane|Golgi cisterna membrane|integral to membrane	calcium ion binding|nucleoside-diphosphatase activity|signal transducer activity				0			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGGCCCTGAGCTCCCACTCCC	0.587			T	ETV4	prostate								131	322	---	---	---	---	PASS
MBD3L1	85509	broad.mit.edu	37	19	8953366	8953366	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8953366T>A	uc002mko.2	+	1	98	c.12T>A	c.(10-12)AGT>AGA	p.S4R		NM_145208	NP_660209	Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like	4	Transcription repressor.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						TGGCCAAGAGTTCACAGAGGA	0.423													25	57	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9578580	9578580	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9578580T>A	uc002mlp.1	-	10	1253	c.1043A>T	c.(1042-1044)TAT>TTT	p.Y348F	ZNF560_uc010dwr.1_Missense_Mutation_p.Y242F	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	348	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						CTTACATTCATAGGGGTTTTT	0.368													46	182	---	---	---	---	PASS
C3P1	388503	broad.mit.edu	37	19	10157507	10157507	+	RNA	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10157507A>T	uc010dwx.1	+	9		c.1341A>T				NR_027300				Synthetic construct DNA, clone: pF1KB7402, Homo sapiens LOC388503 gene, without stop codon, in Flexi system.												0						TCTGCCAAAGAGTAAATCGGG	0.527													19	47	---	---	---	---	PASS
ZNF563	147837	broad.mit.edu	37	19	12433537	12433537	+	Intron	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12433537C>A	uc002mtp.2	-						ZNF563_uc002mtq.2_Intron	NM_145276	NP_660319	Q8TA94	ZN563_HUMAN	zinc finger protein 563						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGAAACATCCCACATAGATAG	0.418													39	100	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17749883	17749883	+	Intron	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17749883G>T	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						GACCCATCTGGAGTCTCACCG	0.333													5	5	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19349112	19349112	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19349112C>T	uc002nlz.2	+	11	3400	c.3301C>T	c.(3301-3303)CGC>TGC	p.R1101C	NCAN_uc010ecc.1_Missense_Mutation_p.R665C|NCAN_uc002nma.2_5'Flank	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	1101	C-type lectin.				axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			CCACTGTTACCGCTATTTTGC	0.657													53	93	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22171626	22171626	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22171626C>G	uc002nqp.2	-	2	238	c.89G>C	c.(88-90)AGA>ACA	p.R30T	ZNF208_uc002nqo.1_Missense_Mutation_p.R30T|ZNF208_uc002nqq.2_RNA	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CATCACATTTCTATATAAATT	0.388													98	188	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941436	22941436	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941436G>C	uc010xrh.1	-	5	1002	c.1002C>G	c.(1000-1002)TGC>TGG	p.C334W		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				CTTCACATTTGCAGGGTTTCT	0.378													45	66	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31768009	31768009	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31768009T>A	uc002nsy.3	-	2	2755	c.2690A>T	c.(2689-2691)AAC>ATC	p.N897I		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	897	Homeobox; atypical.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					GGGGTTCCAGTTTGACTGGCG	0.622													20	39	---	---	---	---	PASS
CHST8	64377	broad.mit.edu	37	19	34263302	34263302	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34263302C>A	uc002nus.3	+	5	1114	c.609C>A	c.(607-609)TCC>TCA	p.S203S	CHST8_uc002nut.3_Silent_p.S203S|CHST8_uc002nuu.2_Silent_p.S203S	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)	203	PAPS (By similarity).|Lumenal (Potential).				carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					CCGGCTGCTCCAATTGGAAGC	0.687													43	46	---	---	---	---	PASS
ZNF599	148103	broad.mit.edu	37	19	35250252	35250252	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35250252G>C	uc010edn.1	-	4	1842	c.1454C>G	c.(1453-1455)GCA>GGA	p.A485G	ZNF599_uc010edm.1_Missense_Mutation_p.A448G	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	zinc finger protein 599	485	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			AAAGGCTTTTGCACATTCTTT	0.428													32	284	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35823442	35823442	+	Intron	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35823442G>T	uc010edt.2	+						CD22_uc010xst.1_Intron|CD22_uc010edu.2_Intron|CD22_uc010edv.2_Intron|CD22_uc002nzb.3_Intron	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor						cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	TCTGATCACTGTGGTGAGTTC	0.363													54	61	---	---	---	---	PASS
FFAR3	2865	broad.mit.edu	37	19	35850518	35850518	+	Missense_Mutation	SNP	C	A	A	rs147416906		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35850518C>A	uc002nzd.2	+	2	801	c.726C>A	c.(724-726)AAC>AAA	p.N242K	FFAR3_uc010xsu.1_Intron	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	242	Helical; Name=6; (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			GGCCCTACAACGTGTCCCATG	0.632													58	181	---	---	---	---	PASS
ZNF260	339324	broad.mit.edu	37	19	37005989	37005989	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37005989C>A	uc002oee.1	-	4	996	c.152G>T	c.(151-153)GGA>GTA	p.G51V	ZNF260_uc002oed.1_Missense_Mutation_p.G48V|ZNF260_uc010eey.1_Missense_Mutation_p.G48V|ZNF260_uc002oef.1_Missense_Mutation_p.G48V	NM_001012756	NP_001012774	Q3ZCT1	ZN260_HUMAN	zinc finger protein 260	51					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.162)					AGATTTCTCTCCAGTATGCAT	0.368													119	156	---	---	---	---	PASS
ZNF527	84503	broad.mit.edu	37	19	37870113	37870113	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37870113T>C	uc010efk.1	+	3	236	c.125T>C	c.(124-126)GTC>GCC	p.V42A	ZNF527_uc002ogf.3_Missense_Mutation_p.V42A|ZNF527_uc010xtq.1_RNA|ZNF527_uc002oge.2_Missense_Mutation_p.V42A	NM_032453	NP_115829	Q8NB42	ZN527_HUMAN	zinc finger protein 527	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TACAGAGATGTCATGTTGGAG	0.438													74	189	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40433896	40433896	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40433896G>T	uc002omp.3	-	2	381	c.373C>A	c.(373-375)CCT>ACT	p.P125T		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	125	IgGFc-binding.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCTGTGTCAGGCTTGGCATTT	0.567													39	59	---	---	---	---	PASS
MEGF8	1954	broad.mit.edu	37	19	42863288	42863288	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42863288G>T	uc002otl.3	+	30	5816	c.5181G>T	c.(5179-5181)GGG>GGT	p.G1727G	MEGF8_uc002otm.3_Silent_p.G1335G	NM_001410	NP_001401	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	1794	Extracellular (Potential).					integral to membrane	calcium ion binding|structural molecule activity			ovary(1)	1		Prostate(69;0.00682)				CCCTGTTAGGGGACACCATGG	0.657													3	13	---	---	---	---	PASS
ZNF227	7770	broad.mit.edu	37	19	44740736	44740736	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44740736G>T	uc002oyu.2	+	6	2358	c.2153G>T	c.(2152-2154)TGT>TTT	p.C718F	ZNF227_uc010xwu.1_Missense_Mutation_p.C667F|ZNF227_uc002oyv.2_Missense_Mutation_p.C718F|ZNF227_uc010xwv.1_Missense_Mutation_p.C667F|ZNF227_uc010xww.1_Missense_Mutation_p.C639F|ZNF227_uc002oyw.2_Missense_Mutation_p.C690F|ZNF227_uc010ejh.2_Missense_Mutation_p.C711F|ZNF235_uc002oyx.1_Intron|ZNF235_uc010eji.2_3'UTR	NM_182490	NP_872296	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	718	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0435)				CCCCATATATGTGAGGAGTGT	0.468													39	190	---	---	---	---	PASS
ZNF615	284370	broad.mit.edu	37	19	52497156	52497156	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52497156C>A	uc002pye.1	-	6	1465	c.1173G>T	c.(1171-1173)CAG>CAT	p.Q391H	ZNF615_uc002pyf.1_Missense_Mutation_p.Q402H|ZNF615_uc002pyg.1_Missense_Mutation_p.Q283H|ZNF615_uc002pyh.1_Missense_Mutation_p.Q402H|ZNF615_uc010epi.1_Missense_Mutation_p.Q398H|ZNF615_uc010ydg.1_Missense_Mutation_p.Q396H	NM_198480	NP_940882	Q8N8J6	ZN615_HUMAN	zinc finger protein 615	391	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		TATGAGTTTGCTGATGTGTGA	0.393													47	137	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52714673	52714673	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52714673G>A	uc002pyp.2	+	4	590	c.431G>A	c.(430-432)CGC>CAC	p.R144H	PPP2R1A_uc010ydk.1_Missense_Mutation_p.R89H|PPP2R1A_uc010epm.1_Missense_Mutation_p.R184H|PPP2R1A_uc002pyq.2_5'UTR	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	144	PP2A subunit B binding.|SV40 small T antigen binding.|HEAT 4.|Polyoma small and medium T antigens Binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		TTCACCTCCCGCACCTCGGCC	0.642			Mis		clear cell ovarian carcinoma								63	66	---	---	---	---	PASS
ZNF528	84436	broad.mit.edu	37	19	52909268	52909268	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52909268A>T	uc002pzh.2	+	5	550	c.124A>T	c.(124-126)AGG>TGG	p.R42W	ZNF528_uc002pzi.2_5'UTR	NM_032423	NP_115799	Q3MIS6	ZN528_HUMAN	zinc finger protein 528	42	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(134;0.00249)|OV - Ovarian serous cystadenocarcinoma(262;0.00817)		GGAGAATTATAGGAACCTGGT	0.507													86	271	---	---	---	---	PASS
ZNF331	55422	broad.mit.edu	37	19	54081100	54081100	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54081100A>G	uc002qbx.1	+	7	2720	c.1286A>G	c.(1285-1287)CAT>CGT	p.H429R	ZNF331_uc002qby.1_Missense_Mutation_p.H429R|ZNF331_uc002qbz.1_Missense_Mutation_p.H429R|ZNF331_uc002qca.1_Missense_Mutation_p.H429R|ZNF331_uc010eqr.1_Missense_Mutation_p.H429R|ZNF331_uc002qcb.1_Missense_Mutation_p.H429R|ZNF331_uc002qcc.1_Missense_Mutation_p.H429R|ZNF331_uc002qcd.1_Missense_Mutation_p.H429R	NM_018555	NP_061025	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	429	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|lung(1)	6				GBM - Glioblastoma multiforme(134;0.00555)		CTTACACAACATCAGAAAACG	0.493			T	?	follicular thyroid adenoma								22	58	---	---	---	---	PASS
CNOT3	4849	broad.mit.edu	37	19	54656311	54656311	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54656311G>T	uc002qdj.1	+	15	2163	c.1852G>T	c.(1852-1854)GAA>TAA	p.E618*	CNOT3_uc010yel.1_Nonsense_Mutation_p.E618*|CNOT3_uc002qdi.2_Nonsense_Mutation_p.E531*|CNOT3_uc002qdk.1_Nonsense_Mutation_p.E618*|CNOT3_uc010ere.1_RNA|CNOT3_uc002qdl.2_Nonsense_Mutation_p.E73*	NM_014516	NP_055331	O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	618	Pro-rich.				nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GCAGGCCATGGAAGAGGCCGC	0.627													22	84	---	---	---	---	PASS
LILRA2	11027	broad.mit.edu	37	19	55087569	55087569	+	Silent	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55087569G>T	uc002qgg.3	+	6	1337	c.1248G>T	c.(1246-1248)GTG>GTT	p.V416V	LILRA2_uc010ern.2_Silent_p.V416V|LILRA2_uc002qgf.2_Silent_p.V416V|LILRA2_uc010yfe.1_Silent_p.V416V|LILRA2_uc010yff.1_Silent_p.V404V|LILRA2_uc010ero.2_Silent_p.V404V|LILRA2_uc010yfg.1_Intron	NM_001130917	NP_001124389	Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor,	416	Extracellular (Potential).				defense response	integral to membrane	antigen binding|receptor activity			ovary(1)	1				GBM - Glioblastoma multiforme(193;0.0963)		TGGAGCTCGTGGTCTCAGGTG	0.607													62	123	---	---	---	---	PASS
NLRP7	199713	broad.mit.edu	37	19	55450872	55450872	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55450872C>A	uc002qih.3	-	4	1391	c.1315G>T	c.(1315-1317)GGG>TGG	p.G439W	NLRP7_uc002qig.3_Missense_Mutation_p.G439W|NLRP7_uc002qii.3_Missense_Mutation_p.G439W|NLRP7_uc010esk.2_Missense_Mutation_p.G439W|NLRP7_uc010esl.2_Missense_Mutation_p.G467W	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7	439	NACHT.						ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		TCCTGCACCCCGAGCCTTTCC	0.662													20	87	---	---	---	---	PASS
ZNF524	147807	broad.mit.edu	37	19	56113998	56113998	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56113998C>T	uc002qlk.1	+	2	603	c.520C>T	c.(520-522)CTG>TTG	p.L174L	FIZ1_uc002qlj.3_5'Flank	NM_153219	NP_694951	Q96C55	ZN524_HUMAN	zinc finger protein 524	174	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		CCGCTGCCCGCTGTGCCCCCG	0.726													3	7	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2398084	2398084	+	Silent	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2398084C>T	uc002wfy.1	+	10	1604	c.1543C>T	c.(1543-1545)CTG>TTG	p.L515L	TGM6_uc010gal.1_Silent_p.L515L	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	515					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	GAGACTGGCCCTGTGCTTGGC	0.647													21	34	---	---	---	---	PASS
C20orf7	79133	broad.mit.edu	37	20	13765713	13765713	+	5'UTR	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13765713A>T	uc002wom.2	+	1					ESF1_uc002woj.2_5'Flank|ESF1_uc002wok.1_5'Flank|C20orf7_uc002wol.1_5'UTR|C20orf7_uc002won.2_5'UTR|C20orf7_uc002woo.2_RNA	NM_024120	NP_077025	Q5TEU4	CT007_HUMAN	hypothetical protein LOC79133 isoform 1						mitochondrial respiratory chain complex I assembly	extrinsic to mitochondrial inner membrane	methyltransferase activity				0		Myeloproliferative disorder(85;0.00878)				TCGCAGCTGGAGATGCTGCGG	0.612													9	17	---	---	---	---	PASS
EMILIN3	90187	broad.mit.edu	37	20	39990768	39990768	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:39990768G>A	uc002xjy.1	-	4	1665	c.1441C>T	c.(1441-1443)CTA>TTA	p.L481L		NM_052846	NP_443078	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	481	Potential.					proteinaceous extracellular matrix				ovary(1)	1		Myeloproliferative disorder(115;0.00425)				AATGTTGCTAGGCGCTCCTCG	0.632													36	105	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42694707	42694707	+	Missense_Mutation	SNP	A	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42694707A>T	uc002xlf.3	+	6	1279	c.1262A>T	c.(1261-1263)CAG>CTG	p.Q421L	TOX2_uc010ggo.2_Missense_Mutation_p.Q439L|TOX2_uc002xle.3_Missense_Mutation_p.Q397L|TOX2_uc010ggp.2_Missense_Mutation_p.Q397L|TOX2_uc002xlg.2_Intron|TOX2_uc010zwk.1_Missense_Mutation_p.Q317L	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	421	Pro-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			ATGGCACTCCAGGTGCAGCTG	0.672													15	24	---	---	---	---	PASS
JPH2	57158	broad.mit.edu	37	20	42788378	42788378	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42788378G>T	uc002xli.1	-	2	1922	c.1049C>A	c.(1048-1050)ACC>AAC	p.T350N		NM_020433	NP_065166	Q9BR39	JPH2_HUMAN	junctophilin 2 isoform 1	350	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional sarcoplasmic reticulum membrane|plasma membrane					0		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GCGGCGCTTGGTGTCCTTGAC	0.662													13	42	---	---	---	---	PASS
SPATA2	9825	broad.mit.edu	37	20	48522404	48522404	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48522404C>G	uc010gie.2	-	3	1665	c.1315G>C	c.(1315-1317)GGC>CGC	p.G439R	SPATA2_uc002xuw.2_Missense_Mutation_p.G439R|SPATA2_uc010zyn.1_Missense_Mutation_p.G302R	NM_001135773	NP_001129245	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	439					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|nucleus				central_nervous_system(1)|skin(1)	2	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CGGTCGAGGCCCTGAGTCTGG	0.662													29	107	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57829194	57829194	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57829194C>A	uc002yan.2	+	5	4430	c.4430C>A	c.(4429-4431)TCC>TAC	p.S1477Y		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1477						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					TCCTTTGGGTCCAAAGGAACT	0.498													56	88	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61942764	61942764	+	Missense_Mutation	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61942764G>T	uc011aau.1	+	12	1512	c.1412G>T	c.(1411-1413)CGG>CTG	p.R471L	COL20A1_uc011aav.1_Missense_Mutation_p.R292L	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	471	Fibronectin type-III 3.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CCTCCGCCCCGGGCGCTGACC	0.682													4	7	---	---	---	---	PASS
KRTAP13-3	337960	broad.mit.edu	37	21	31798006	31798006	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31798006G>A	uc002yob.1	-	1	225	c.225C>T	c.(223-225)CCC>CCT	p.P75P		NM_181622	NP_853653	Q3SY46	KR133_HUMAN	keratin associated protein 13-3	75	3.|5 X 10 AA approximate repeats.					intermediate filament				ovary(1)|lung(1)	2						AGGTGTGGCAGGGGCTGGACT	0.567													31	72	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36705391	36705391	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36705391A>C	uc003apg.2	-	15	2010	c.1779T>G	c.(1777-1779)AAT>AAG	p.N593K	MYH9_uc003aph.1_Missense_Mutation_p.N457K	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle	593	Myosin head-like.				actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CGATGTTGTCATTCAGGGGAT	0.572			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				15	50	---	---	---	---	PASS
SELO	83642	broad.mit.edu	37	22	50654264	50654264	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50654264G>A	uc011arr.1	+	6	1528	c.1470G>A	c.(1468-1470)CTG>CTA	p.L490L	SELO_uc010hap.2_Silent_p.L301L|SELO_uc003bjy.2_Silent_p.L170L|SELO_uc003bjz.2_Missense_Mutation_p.E243K	NM_031454	NP_113642	Q9BVL4	SELO_HUMAN	selenoprotein O	490											0		all_cancers(38;1.14e-10)|all_epithelial(38;2.12e-09)|all_lung(38;7.01e-05)|Breast(42;0.000523)|Lung NSC(38;0.0018)|Ovarian(80;0.0365)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.105)		TGGAGGAGCTGAGGCTGGCCT	0.567													8	130	---	---	---	---	PASS
MAPK11	5600	broad.mit.edu	37	22	50705455	50705455	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50705455C>A	uc003bkr.2	-	7	576	c.518G>T	c.(517-519)CGC>CTC	p.R173L	MAPK11_uc010hax.2_5'UTR|MAPK11_uc011ars.1_RNA|MAPK11_uc010hay.1_RNA|MAPK11_uc011art.1_3'UTR|MAPK11_uc010haz.2_Missense_Mutation_p.R65L	NM_002751	NP_002742	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	173	Protein kinase.				activation of MAPK activity|innate immune response|mRNA metabolic process|muscle cell differentiation|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of muscle cell differentiation|Ras protein signal transduction|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|MAP kinase activity|protein binding			lung(1)|breast(1)	2		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GTCCGCCTGGCGCGCCAGCCC	0.662													17	43	---	---	---	---	PASS
ACE2	59272	broad.mit.edu	37	X	15591560	15591560	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15591560C>A	uc004cxa.1	-	11	1639	c.1471G>T	c.(1471-1473)GTG>TTG	p.V491L	ACE2_uc004cxb.2_Missense_Mutation_p.V491L	NM_021804	NP_068576	Q9BYF1	ACE2_HUMAN	angiotensin I converting enzyme 2 precursor	491	Extracellular (Potential).				angiotensin-mediated drinking behavior|proteolysis|receptor biosynthetic process|regulation of cell proliferation|virion attachment, binding of host cell surface receptor	cell surface|extracellular space|integral to membrane|membrane raft|plasma membrane	carboxypeptidase activity|glycoprotein binding|metallopeptidase activity|peptidyl-dipeptidase activity|viral receptor activity|zinc ion binding			ovary(3)	3	Hepatocellular(33;0.183)				Moexipril(DB00691)	TCATGGGGCACAGGTTCCACC	0.428													55	69	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21508631	21508631	+	Missense_Mutation	SNP	C	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21508631C>G	uc004czx.1	+	6	652	c.616C>G	c.(616-618)CTG>GTG	p.L206V	CNKSR2_uc004czw.2_Missense_Mutation_p.L206V|CNKSR2_uc011mjn.1_Missense_Mutation_p.L206V|CNKSR2_uc011mjo.1_Missense_Mutation_p.L206V	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	206					regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						GTCAGATCCTCTGGTTTCACA	0.418													20	107	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27997796	27997796	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27997796C>A	uc004dbx.1	-	1	1771	c.1656G>T	c.(1654-1656)GTG>GTT	p.V552V		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	552										ovary(3)|skin(1)	4						ACAGGTGACGCACGAAGAACC	0.478													56	88	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49065032	49065032	+	Missense_Mutation	SNP	C	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49065032C>T	uc004dnb.2	-	43	5161	c.5099G>A	c.(5098-5100)AGG>AAG	p.R1700K	CACNA1F_uc010nip.2_Missense_Mutation_p.R1689K	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1700	Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	GGGAGTCCCCCTGTCATCATC	0.587													16	13	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53563496	53563496	+	Silent	SNP	G	A	A	rs3761631		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53563496G>A	uc004dsp.2	-	79	12672	c.12270C>T	c.(12268-12270)ACC>ACT	p.T4090T	HUWE1_uc004dsn.2_Silent_p.T2898T	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	4090	HECT.				base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						TGATGGTGTAGGTGACTCGAT	0.502													49	52	---	---	---	---	PASS
MAGED2	10916	broad.mit.edu	37	X	54836517	54836517	+	Silent	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54836517A>C	uc004dtk.1	+	3	502	c.408A>C	c.(406-408)ACA>ACC	p.T136T	MAGED2_uc004dtl.1_Silent_p.T136T|MAGED2_uc004dtm.1_Silent_p.T98T|MAGED2_uc010nkc.1_Silent_p.T136T|MAGED2_uc004dtn.1_Silent_p.T136T|MAGED2_uc004dto.1_Silent_p.T110T	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	136										ovary(2)|breast(1)	3						AGGTCAATACAAAGGCTCAGG	0.552													9	11	---	---	---	---	PASS
GDPD2	54857	broad.mit.edu	37	X	69646855	69646855	+	Silent	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69646855C>A	uc004dyh.2	+	8	947	c.696C>A	c.(694-696)GCC>GCA	p.A232A	GDPD2_uc010nkx.1_Silent_p.A232A|GDPD2_uc010nky.1_Silent_p.A18A|GDPD2_uc011mpk.1_Silent_p.A232A|GDPD2_uc011mpl.1_Silent_p.A153A|GDPD2_uc011mpm.1_Silent_p.A153A	NM_017711	NP_060181	Q9HCC8	GDPD2_HUMAN	osteoblast differentiation promoting factor	232	GDPD.|Extracellular (Potential).				glycerol metabolic process|lipid metabolic process	cytoplasm|cytoskeleton|integral to membrane|plasma membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol inositolphosphodiesterase activity|metal ion binding			ovary(2)	2	Renal(35;0.156)					ACCGAGGGGCCCCCATGGTGA	0.617													29	26	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433581	72433581	+	Missense_Mutation	SNP	T	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433581T>A	uc004ebi.2	-	1	1104	c.748A>T	c.(748-750)AAC>TAC	p.N250Y	NAP1L2_uc011mqj.1_Missense_Mutation_p.N108Y	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	250					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					GTATCAACGTTTTTTAAAACA	0.363													11	68	---	---	---	---	PASS
KLHL4	56062	broad.mit.edu	37	X	86869436	86869436	+	Splice_Site	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86869436G>T	uc004efb.2	+	3	773	c.591_splice	c.e3-1	p.R197_splice	KLHL4_uc004efa.2_Splice_Site_p.R197_splice	NM_019117	NP_061990	Q9C0H6	KLHL4_HUMAN	kelch-like 4 isoform 1							cytoplasm|microtubule cytoskeleton|nucleolus	actin binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CCTATTTCCAGGTTGGTTCTC	0.368													26	41	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177593	89177593	+	Missense_Mutation	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177593A>G	uc004efe.2	+	2	558	c.509A>G	c.(508-510)GAG>GGG	p.E170G		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	170						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						ATGTCAAGAGAGAAGCAACCA	0.587													14	31	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177791	89177791	+	Missense_Mutation	SNP	A	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177791A>C	uc004efe.2	+	2	756	c.707A>C	c.(706-708)AAG>ACG	p.K236T		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	236						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						CTAGAGAAGAAGCAAGAGCCT	0.483													22	46	---	---	---	---	PASS
TEX13A	56157	broad.mit.edu	37	X	104464163	104464163	+	Missense_Mutation	SNP	G	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:104464163G>C	uc004ema.2	-	5	825	c.713C>G	c.(712-714)ACA>AGA	p.T238R	IL1RAPL2_uc004elz.1_Intron|TEX13A_uc004emb.2_Missense_Mutation_p.Q239E	NM_031274	NP_112564	Q9BXU3	TX13A_HUMAN	testis expressed sequence 13A	238						intracellular	zinc ion binding			ovary(2)	2						CAGCTTCTCTGTGGTCTCCAT	0.627													14	17	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110497519	110497519	+	Missense_Mutation	SNP	T	C	C			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110497519T>C	uc004epc.1	-	3	446	c.278A>G	c.(277-279)CAG>CGG	p.Q93R	CAPN6_uc011msu.1_5'UTR	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	93	Calpain catalytic.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						ATGAGACTCCTGAACAGCCAA	0.458													38	66	---	---	---	---	PASS
LUZP4	51213	broad.mit.edu	37	X	114541191	114541191	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114541191C>A	uc004eqa.2	+	4	798	c.764C>A	c.(763-765)ACT>AAT	p.T255N	LUZP4_uc004eqb.2_Missense_Mutation_p.T173N	NM_016383	NP_057467	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	255						nucleus				ovary(2)	2						CTCATAGCCACTCAGAAAGAT	0.473													8	100	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118151659	118151659	+	3'UTR	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118151659G>T	uc004eqw.2	+	11					LONRF3_uc004eqx.2_3'UTR|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_3'UTR	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						ACTAGTGAGTGGATTGCCGAA	0.488													37	51	---	---	---	---	PASS
LONRF3	79836	broad.mit.edu	37	X	118151664	118151664	+	3'UTR	SNP	G	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118151664G>T	uc004eqw.2	+	11					LONRF3_uc004eqx.2_3'UTR|LONRF3_uc004eqy.2_RNA|LONRF3_uc004eqz.2_3'UTR	NM_001031855	NP_001027026	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger						proteolysis		ATP-dependent peptidase activity|protein binding|zinc ion binding			breast(1)|central_nervous_system(1)	2						TGAGTGGATTGCCGAAGAGGA	0.483													34	50	---	---	---	---	PASS
NKAP	79576	broad.mit.edu	37	X	119077307	119077307	+	Missense_Mutation	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119077307G>A	uc004esh.2	-	1	429	c.262C>T	c.(262-264)CGG>TGG	p.R88W		NM_024528	NP_078804	Q8N5F7	NKAP_HUMAN	NFKB activating protein	88	Ser-rich.				negative regulation of transcription, DNA-dependent|Notch signaling pathway|positive regulation of alpha-beta T cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|protein binding			ovary(2)	2						GGGATGCCCCGGGGCGCAGAG	0.652													14	23	---	---	---	---	PASS
SH2D1A	4068	broad.mit.edu	37	X	123504098	123504098	+	Missense_Mutation	SNP	C	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123504098C>A	uc004euf.3	+	3	619	c.274C>A	c.(274-276)CAA>AAA	p.Q92K	SH2D1A_uc004euh.3_Missense_Mutation_p.Q92K|SH2D1A_uc004eug.3_RNA|SH2D1A_uc010nqw.2_RNA|SH2D1A_uc004eui.3_RNA|SH2D1A_uc010nqx.2_RNA	NM_002351	NP_002342	O60880	SH21A_HUMAN	SH2 domain protein 1A isoform 1	92	SH2.				cell-cell signaling|cellular defense response	cytoplasm	SH3/SH2 adaptor activity				0						GAAGCCAGATCAAGGCATTGT	0.378									X-linked_Lymphoproliferative_syndrome				79	93	---	---	---	---	PASS
UBE2NL	389898	broad.mit.edu	37	X	142967583	142967583	+	Silent	SNP	G	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:142967583G>A	uc004fca.2	+	1	411	c.381G>A	c.(379-381)GTG>GTA	p.V127V		NM_001012989	NP_001013007	Q5JXB2	UE2NL_HUMAN	ubiquitin-conjugating enzyme E2N-like	127							acid-amino acid ligase activity				0	Acute lymphoblastic leukemia(192;6.56e-05)					ATGATGTAGTGGAGCAGTGGA	0.448													48	88	---	---	---	---	PASS
VAMP7	6845	broad.mit.edu	37	X	155127868	155127868	+	Silent	SNP	A	G	G			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155127868A>G	uc004fnr.2	+	4	471	c.297A>G	c.(295-297)CCA>CCG	p.P99P	VAMP7_uc004fnt.2_Silent_p.P58P|VAMP7_uc011naa.1_Silent_p.P60P|VAMP7_uc011nab.1_5'UTR|VAMP7_uc004fns.2_Silent_p.P99P|VAMP7_uc011nac.1_Silent_p.P32P	NM_005638	NP_005629	P51809	VAMP7_HUMAN	vesicle-associated membrane protein 7 isoform 1	99	Longin.|Cytoplasmic (Potential).				calcium ion-dependent exocytosis|endosome to lysosome transport|eosinophil degranulation|ER to Golgi vesicle-mediated transport|neutrophil degranulation|phagocytosis, engulfment|post-Golgi vesicle-mediated transport|protein transport|vesicle fusion	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|phagocytic vesicle membrane|plasma membrane|SNARE complex|transport vesicle membrane	protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CAGCACTTCCATATGCCATGA	0.393													64	151	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55521900	55521906	+	Intron	DEL	GGGCGGA	-	-	rs67578329		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55521900_55521906delGGGCGGA	uc001cyf.1	+						PCSK9_uc010oom.1_Intron	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9						cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						Cgcgggtagggggcggagggcggaggg	0.478													5	4	---	---	---	---	
ZC3H11A	9877	broad.mit.edu	37	1	203802746	203802747	+	Intron	INS	-	TTTTTT	TTTTTT	rs59117283		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203802746_203802747insTTTTTT	uc001hac.2	+						ZC3H11A_uc001had.2_Intron|ZC3H11A_uc001hae.2_Intron|ZC3H11A_uc001haf.2_Intron|ZC3H11A_uc010pqm.1_Intron|ZC3H11A_uc001hag.1_Intron	NM_014827	NP_055642	O75152	ZC11A_HUMAN	zinc finger CCCH-type containing 11A								nucleic acid binding|protein binding|zinc ion binding			lung(1)|central_nervous_system(1)	2	all_cancers(21;0.0904)|all_epithelial(62;0.234)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ATAGGTTTGGGTTTTTTTTTTT	0.257													8	4	---	---	---	---	
SNAP47	116841	broad.mit.edu	37	1	227946501	227946502	+	Intron	INS	-	CC	CC	rs139094765	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227946501_227946502insCC	uc001hrf.2	+						SNAP47_uc001hqz.2_Intron|SNAP47_uc001hra.2_Intron|SNAP47_uc001hrd.2_Intron|SNAP47_uc001hre.2_Intron|SNAP47_uc001hrg.1_Intron	NM_053052	NP_444280	Q5SQN1	SNP47_HUMAN	synaptosomal-associated protein, 47kDa							endomembrane system|membrane|perinuclear region of cytoplasm				ovary(1)	1						TGTTCTCACTGCTGGCCCCCAG	0.475													6	4	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9515236	9515237	+	Intron	DEL	AA	-	-	rs112747713		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9515236_9515237delAA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						ccatctctacaaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ANTXR1	84168	broad.mit.edu	37	2	69318251	69318252	+	Intron	DEL	AA	-	-	rs72475753		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69318251_69318252delAA	uc002sfg.2	+						ANTXR1_uc002sfe.2_Intron|ANTXR1_uc002sff.2_Intron|ANTXR1_uc002sfd.2_Intron	NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor						actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						TTTGGAAGttaaaaaaaaaaaa	0.252									Familial_Infantile_Hemangioma				6	3	---	---	---	---	
ATG9A	79065	broad.mit.edu	37	2	220092238	220092238	+	Intron	DEL	A	-	-	rs34195462		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220092238delA	uc002vke.1	-						ATG9A_uc002vkd.1_5'Flank|ATG9A_uc002vkf.1_Intron|ANKZF1_uc010zkv.1_5'Flank|ANKZF1_uc010zkw.1_5'Flank|ANKZF1_uc002vkg.2_5'Flank|ANKZF1_uc002vkh.2_5'Flank|ANKZF1_uc002vki.2_5'Flank	NM_001077198	NP_001070666	Q7Z3C6	ATG9A_HUMAN	APG9 autophagy 9-like 1						autophagic vacuole assembly|protein transport	autophagic vacuole membrane|cytoplasmic vesicle|Golgi apparatus|integral to membrane|late endosome membrane				skin(1)	1		Renal(207;0.0474)		Epithelial(149;1.37e-06)|all cancers(144;0.000222)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		catctcaaacaaaaaaaaaaG	0.199													6	3	---	---	---	---	
EPHA4	2043	broad.mit.edu	37	2	222429296	222429297	+	Intron	INS	-	T	T	rs144228279	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:222429296_222429297insT	uc002vmq.2	-						EPHA4_uc002vmr.2_Intron|EPHA4_uc010zlm.1_Intron|EPHA4_uc010zln.1_Intron	NM_004438	NP_004429	P54764	EPHA4_HUMAN	ephrin receptor EphA4 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(6)|large_intestine(2)|central_nervous_system(2)|urinary_tract(1)|skin(1)	12		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		TATTGAGGAAGTTTTTTTTTTG	0.351													10	12	---	---	---	---	
USP40	55230	broad.mit.edu	37	2	234438246	234438247	+	Intron	INS	-	T	T	rs146758446	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234438246_234438247insT	uc010zmr.1	-						USP40_uc010zmt.1_Intron	NM_018218	NP_060688	Q9NVE5	UBP40_HUMAN	ubiquitin thioesterase 40						ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(1)|lung(1)|breast(1)	3		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0539)		Epithelial(121;1.71e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000407)|Lung(119;0.00277)|LUSC - Lung squamous cell carcinoma(224;0.00646)		aaggactgtcctaggagctagg	0.104													4	4	---	---	---	---	
EOMES	8320	broad.mit.edu	37	3	27759338	27759338	+	Intron	DEL	C	-	-	rs9866625	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27759338delC	uc003cdx.2	-						EOMES_uc003cdy.3_Intron|EOMES_uc010hfn.2_Intron|EOMES_uc011axc.1_Intron	NM_005442	NP_005433	O95936	EOMES_HUMAN	eomesodermin						CD8-positive, alpha-beta T cell differentiation involved in immune response|cell differentiation involved in embryonic placenta development|endoderm formation|mesoderm formation|mesodermal to mesenchymal transition involved in gastrulation|positive regulation of transcription, DNA-dependent	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|breast(1)	4						AAAAAAAAAACCCTAATGTTG	0.413													9	4	---	---	---	---	
RFT1	91869	broad.mit.edu	37	3	53154133	53154142	+	Intron	DEL	TTAACTGCAC	-	-	rs142901692		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53154133_53154142delTTAACTGCAC	uc003dgj.2	-						RFT1_uc003dgk.2_Intron	NM_052859	NP_443091	Q96AA3	RFT1_HUMAN	RFT1 homolog						carbohydrate transport|dolichol-linked oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane	lipid transporter activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(193;6.98e-05)|Kidney(197;0.0017)|KIRC - Kidney renal clear cell carcinoma(197;0.00192)|OV - Ovarian serous cystadenocarcinoma(275;0.104)		ACTCTCTTGATTAACTGCACTTTCTATTCA	0.376													9	5	---	---	---	---	
LSAMP	4045	broad.mit.edu	37	3	116163562	116163563	+	Intron	DEL	AC	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:116163562_116163563delAC	uc003ebt.2	-						LSAMP_uc011bis.1_Intron|LSAMP_uc010hqq.1_RNA	NM_002338	NP_002329	Q13449	LSAMP_HUMAN	limbic system-associated membrane protein						cell adhesion|nervous system development	anchored to membrane|plasma membrane					0		all_cancers(1;0.00189)|all_epithelial(1;0.0366)|Myeloproliferative disorder(1037;0.17)|all_neural(597;0.208)|Lung NSC(201;0.215)		GBM - Glioblastoma multiforme(114;0.00117)|LUSC - Lung squamous cell carcinoma(41;0.0407)|Lung(219;0.152)		TAAAACAGGGacacacacacac	0.317													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	126379647	126379647	+	5'Flank	DEL	G	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126379647delG	uc003eje.1	+											RecName: Full=Putative uncharacterized protein C3orf46;																		AGGCGGCTGTGGGATGTTTCC	0.527													10	6	---	---	---	---	
EPHB1	2047	broad.mit.edu	37	3	134902089	134902090	+	Intron	INS	-	CTTC	CTTC	rs144173551	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134902089_134902090insCTTC	uc003eqt.2	+						EPHB1_uc003equ.2_Intron	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						tccctccctttcttccttcctt	0.050													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49156244	49156253	+	IGR	DEL	ACTCGGGTTG	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49156244_49156253delACTCGGGTTG								CWH43 (92151 upstream) : None (None downstream)																							attccgttccactcgggttgattccattcc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49241350	49241350	+	IGR	DEL	G	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49241350delG								CWH43 (177257 upstream) : None (None downstream)																							AGTTAAACAAGAAACATTATC	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	7372833	7372835	+	IGR	DEL	CCT	-	-	rs143913542		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7372833_7372835delCCT								PAPD7 (615672 upstream) : ADCY2 (23508 downstream)																							accaccaccacctccaccatcac	0.000													5	3	---	---	---	---	
FAM8A1	51439	broad.mit.edu	37	6	17606429	17606429	+	Intron	DEL	T	-	-	rs112417120		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:17606429delT	uc003ncc.2	+							NM_016255	NP_057339	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1							integral to membrane					0	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			TTCAAGATGAttttttttttt	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134747283	134747286	+	IGR	DEL	TCTT	-	-	rs67886112		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134747283_134747286delTCTT								SGK1 (108087 upstream) : ALDH8A1 (491243 downstream)																							tccctctccctctttctttctttc	0.034													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	17947394	17947395	+	Intron	INS	-	TT	TT			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17947394_17947395insTT	uc003wyp.1	+											full-length cDNA clone CS0DL011YP14 of B cells (Ramos cell line) Cot 25-normalized of Homo sapiens (human).																		CAGTAATGCTAttctttttttt	0.134													4	2	---	---	---	---	
DOCK5	80005	broad.mit.edu	37	8	25265381	25265385	+	Intron	DEL	AAAAA	-	-	rs67164560		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25265381_25265385delAAAAA	uc003xeg.2	+						PPP2R2A_uc003xek.2_Intron|DOCK5_uc003xej.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		accctgtctcaaaaaaaaaaaaaaa	0.146													4	3	---	---	---	---	
LINGO2	158038	broad.mit.edu	37	9	28189692	28189695	+	Intron	DEL	AGGG	-	-	rs71512429		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28189692_28189695delAGGG	uc003zqu.1	-						LINGO2_uc010mjf.1_Intron|LINGO2_uc003zqv.1_Intron	NM_152570	NP_689783	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		ggaggaaggaagggagggaggaag	0.137													4	2	---	---	---	---	
LRP4	4038	broad.mit.edu	37	11	46912172	46912172	+	Intron	DEL	T	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46912172delT	uc001ndn.3	-							NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein						endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		ACAGAATGAAtttttttttta	0.229													6	3	---	---	---	---	
NAA40	79829	broad.mit.edu	37	11	63706429	63706435	+	5'Flank	DEL	GGGGGGG	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63706429_63706435delGGGGGGG	uc009yoz.2	+						NAA40_uc010rmw.1_5'Flank|NAA40_uc010rmx.1_5'Flank	NM_024771	NP_079047	Q86UY6	NAA40_HUMAN	N-acetyltransferase 11								N-acetyltransferase activity				0						GCGGTTGGGCGGGGGGGGGGGGGGAAG	0.560													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	101605111	101605112	+	IGR	INS	-	GT	GT	rs61915448		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101605111_101605112insGT								TRPC6 (150452 upstream) : ANGPTL5 (156294 downstream)																							caagactgtgagtgtgtgtgtg	0.119													18	9	---	---	---	---	
CHD4	1108	broad.mit.edu	37	12	6682041	6682042	+	Intron	INS	-	A	A			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6682041_6682042insA	uc001qpo.2	-						CHD4_uc001qpn.2_Intron|CHD4_uc001qpp.2_Intron	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4						chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TCCATCTCTTTAAAAAAAAAAA	0.243													4	2	---	---	---	---	
APOBEC1	339	broad.mit.edu	37	12	7805100	7805100	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7805100delG	uc001qtb.2	-	3	410	c.376delC	c.(376-378)CAAfs	p.Q126fs	APOBEC1_uc001qtc.2_Frame_Shift_Del_p.Q81fs|APOBEC1_uc010sgf.1_Frame_Shift_Del_p.Q126fs	NM_001644	NP_001635	P41238	ABEC1_HUMAN	apolipoprotein B mRNA editing enzyme	126					cytidine to uridine editing|DNA demethylation|lipid metabolic process|mRNA modification|mRNA processing|negative regulation of methylation-dependent chromatin silencing	nucleoplasm	cytidine deaminase activity|RNA binding|zinc ion binding				0						TGCCGATTTTGTTGATCCATG	0.438													104	99	---	---	---	---	
KLRF1	51348	broad.mit.edu	37	12	9994746	9994747	+	Intron	INS	-	TG	TG	rs139435558	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9994746_9994747insTG	uc010sgw.1	+						KLRF1_uc009zgw.2_Intron|KLRF1_uc009zgx.2_Intron|KLRF1_uc001qwm.2_Intron|KLRF1_uc009zgy.2_Intron|KLRF1_uc009zgz.2_Intron|KLRF1_uc009zha.2_Intron	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,						cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						CAACTTGCAATTGTGTGTGTGT	0.178													9	6	---	---	---	---	
TMBIM6	7009	broad.mit.edu	37	12	50151816	50151817	+	Intron	INS	-	A	A	rs80171037		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50151816_50151817insA	uc001rux.2	+						TMBIM6_uc010sml.1_Intron|TMBIM6_uc001ruy.2_Intron|TMBIM6_uc001ruz.2_Intron	NM_003217	NP_003208	P55061	BI1_HUMAN	testis enhanced gene transcript (BAX inhibitor						apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus					0						GCTATTTCTATAAAAAAAAAAA	0.351													10	5	---	---	---	---	
TIMELESS	8914	broad.mit.edu	37	12	56822987	56822988	+	Intron	INS	-	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56822987_56822988insT	uc001slf.2	-						TIMELESS_uc001slg.2_Intron	NM_003920	NP_003911	Q9UNS1	TIM_HUMAN	timeless homolog						cell division|circadian rhythm|detection of abiotic stimulus|mitosis|morphogenesis of an epithelium|negative regulation of transcription, DNA-dependent|regulation of S phase|response to DNA damage stimulus|transcription, DNA-dependent	nuclear chromatin				ovary(5)|breast(2)|pancreas(1)	8						CACCGTCATAAttttttttttt	0.203													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	33311972	33311973	+	IGR	INS	-	G	G	rs139114660	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33311972_33311973insG								AKAP6 (9705 upstream) : NPAS3 (96486 downstream)																							aagagagacaaaaggaaggaag	0.000													2	4	---	---	---	---	
SNW1	22938	broad.mit.edu	37	14	78185057	78185057	+	Intron	DEL	T	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78185057delT	uc001xuf.2	-						SNW1_uc010tvm.1_Intron|SNW1_uc010asu.2_Intron|SNW1_uc010tvn.1_Intron	NM_012245	NP_036377	Q13573	SNW1_HUMAN	SKI-interacting protein						negative regulation of transcription, DNA-dependent|nuclear mRNA splicing, via spliceosome|regulation of transcription from RNA polymerase II promoter	catalytic step 2 spliceosome|nucleoplasm	Notch binding			ovary(1)	1			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		CTTTGGAttcttttttttttt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	49264007	49264007	+	IGR	DEL	A	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49264007delA								SHC4 (8366 upstream) : SECISBP2L (16960 downstream)																							CATGTCCATCAGGGTGACCCA	0.413													4	2	---	---	---	---	
ALDH1A2	8854	broad.mit.edu	37	15	58467393	58467393	+	Intron	DEL	C	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58467393delC	uc010ugw.1	-						AQP9_uc010ugx.1_Intron|AQP9_uc002aez.2_Intron	NM_170697	NP_733798	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 3						negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	AATCGTTTTACCTTTACAAGG	0.378													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98845069	98845070	+	IGR	INS	-	GAGGAGGAA	GAGGAGGAA	rs141877439	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98845069_98845070insGAGGAGGAA								ARRDC4 (328002 upstream) : FAM169B (135321 downstream)																							aggaggaagaggaggaggagga	0.129													4	3	---	---	---	---	
PRSS21	10942	broad.mit.edu	37	16	2867531	2867532	+	Intron	INS	-	G	G	rs111876704		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2867531_2867532insG	uc002crt.2	+						PRSS21_uc002crs.2_Intron|PRSS21_uc002crr.2_Intron	NM_006799	NP_006790	Q9Y6M0	TEST_HUMAN	testisin isoform 1						proteolysis	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	serine-type endopeptidase activity			ovary(1)|skin(1)	2						GAGGGGGTAGAGGGGGGCCTTT	0.698													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21831680	21831680	+	Intron	DEL	A	-	-	rs3830664		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21831680delA	uc002diq.3	+						RRN3P1_uc010vbl.1_5'Flank|RRN3P1_uc002djl.2_RNA					Homo sapiens cDNA FLJ59829 complete cds.																		CCCGACAAACAACGTGTGAAG	0.647													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46424769	46424769	+	IGR	DEL	A	-	-	rs74585274		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46424769delA								None (None upstream) : ANKRD26P1 (78480 downstream)																							tggaatcatcaaatggaatcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	22253308	22253308	+	IGR	DEL	T	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:22253308delT								FLJ36000 (340238 upstream) : None (None downstream)																							ataactgcacttctttgaggc	0.000													10	6	---	---	---	---	
DCAKD	79877	broad.mit.edu	37	17	43101655	43101664	+	3'UTR	DEL	GTGTGTGTGT	-	-	rs10578787	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43101655_43101664delGTGTGTGTGT	uc002ihx.2	-	4					DCAKD_uc010daa.1_3'UTR|DCAKD_uc010dab.1_3'UTR	NM_024819	NP_079095	Q8WVC6	DCAKD_HUMAN	dephospho-CoA kinase domain containing						coenzyme A biosynthetic process		ATP binding|dephospho-CoA kinase activity				0		Prostate(33;0.155)				CGGAGAGTCCgtgtgtgtgtgtgtgtgtgt	0.410													4	3	---	---	---	---	
SNF8	11267	broad.mit.edu	37	17	47013393	47013394	+	Intron	INS	-	T	T	rs80064953		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47013393_47013394insT	uc002ioj.2	-						SNF8_uc002iok.2_Intron	NM_007241	NP_009172	Q96H20	SNF8_HUMAN	EAP30 subunit of ELL complex						cellular membrane organization|endosome transport|protein transport|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytosol|late endosome membrane|transcription factor complex	transcription factor binding				0						TTTGTTTTTTGTTTTTTTTTTT	0.183													8	4	---	---	---	---	
VAV1	7409	broad.mit.edu	37	19	6856887	6856888	+	Intron	DEL	GT	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6856887_6856888delGT	uc002mfu.1	+						VAV1_uc010xjh.1_Intron|VAV1_uc010dva.1_Intron|VAV1_uc002mfv.1_Intron	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						gaggtaatgggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7440297	7440297	+	IGR	DEL	A	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7440297delA								INSR (146286 upstream) : ARHGEF18 (7423 downstream)																							aggaaggaagaaaaggaagga	0.100													5	3	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13397814	13397814	+	Intron	DEL	A	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13397814delA	uc010dze.2	-						CACNA1A_uc010dzc.2_Intron|CACNA1A_uc002mwy.3_Intron|CACNA1A_uc010xne.1_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	AAGAACCAACAACTGATTTAG	0.418													22	13	---	---	---	---	
MAST3	23031	broad.mit.edu	37	19	18235741	18235742	+	Intron	INS	-	CC	CC	rs150126286	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18235741_18235742insCC	uc002nhz.3	+							NM_015016	NP_055831	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase								ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			large_intestine(2)|ovary(2)|stomach(1)	5						catggtggaaacccccccccta	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	22780274	22780275	+	Intron	INS	-	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22780274_22780275insT	uc002nqu.3	+											Homo sapiens cDNA FLJ60031 complete cds, moderately similar to Golgin subfamily A member 2.																		ttaagattgtggaagaactgtt	0.238													25	13	---	---	---	---	
ZNF99	7652	broad.mit.edu	37	19	22951831	22951832	+	Intron	INS	-	A	A	rs34074141		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22951831_22951832insA	uc010xrh.1	-							NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				aactctgtttcaaaaaaaaaaa	0.134													11	5	---	---	---	---	
TEAD2	8463	broad.mit.edu	37	19	49845484	49845485	+	Intron	INS	-	CCACATCAGTT	CCACATCAGTT	rs149352076	by1000genomes	TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49845484_49845485insCCACATCAGTT	uc002pnj.2	-						uc002pnb.1_5'Flank|TEAD2_uc002png.2_Intron|TEAD2_uc002pnh.2_Intron|TEAD2_uc002pni.2_Intron|TEAD2_uc010yao.1_Intron|TEAD2_uc010emw.2_Intron	NM_003598	NP_003589	Q15562	TEAD2_HUMAN	TEA domain family member 2						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|ovary(1)	3		all_lung(116;7.65e-05)|Lung NSC(112;0.000132)|all_neural(266;0.0506)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00093)|GBM - Glioblastoma multiforme(486;0.0467)		TGACATCCCCACCCTGGGTGAA	0.327													7	4	---	---	---	---	
SLC23A2	9962	broad.mit.edu	37	20	4848272	4848273	+	Intron	DEL	AA	-	-	rs71332848		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4848272_4848273delAA	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						ATAAACACTTaaaaaaaaaaaa	0.361													3	3	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45228901	45228901	+	Intron	DEL	A	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228901delA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ggaaggaaggaaaggaaagga	0.020													3	5	---	---	---	---	
DDX27	55661	broad.mit.edu	37	20	47840109	47840110	+	Intron	INS	-	T	T	rs75755283		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47840109_47840110insT	uc002xuh.2	+							NM_017895	NP_060365	Q96GQ7	DDX27_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 27							nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			kidney(2)	2			BRCA - Breast invasive adenocarcinoma(12;0.000899)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			TCCTTTCTTTCTTTTTTTTTTT	0.223													9	4	---	---	---	---	
ZNF831	128611	broad.mit.edu	37	20	57768092	57768092	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57768092delC	uc002yan.2	+	1	2018	c.2018delC	c.(2017-2019)ACCfs	p.T673fs		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	673						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					ACAGTCCCCACCCAAGACAGG	0.612													41	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	32608213	32608213	+	IGR	DEL	G	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32608213delG								RFPL2 (7495 upstream) : SLC5A4 (6252 downstream)																							AGTGGGGGCTGGGGGTAGGGG	0.617													6	3	---	---	---	---	
NUP50	10762	broad.mit.edu	37	22	45577017	45577018	+	Intron	DEL	CC	-	-	rs66468525		TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45577017_45577018delCC	uc003bfr.2	+						NUP50_uc003bfs.2_Intron|NUP50_uc011aqn.1_Intron|NUP50_uc003bft.2_Intron|NUP50_uc011aqo.1_Intron	NM_007172	NP_009103	Q9UKX7	NUP50_HUMAN	nucleoporin 50kDa isoform b						carbohydrate metabolic process|glucose transport|intracellular transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore|nucleoplasm	protein binding				0		Ovarian(80;0.00965)|all_neural(38;0.0244)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CTTCTGGCATCCCCCCCCCCCC	0.406													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	112765840	112765840	+	IGR	DEL	C	-	-			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:112765840delC								AMOT (681797 upstream) : None (None downstream)																							AGACATTGTGCCTAACACAGC	0.478													14	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13637596	13637597	+	IGR	INS	-	T	T			TCGA-22-1016-01	TCGA-22-1016-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13637596_13637597insT								None (None upstream) : None (None downstream)																							GGCATAGATACGTTTGAAGAGA	0.351													4	2	---	---	---	---	
