Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10425653	10425653	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10425653G>A	uc001aqx.3	+	43	4901	c.4699G>A	c.(4699-4701)GAT>AAT	p.D1567N	KIF1B_uc001aqw.3_Missense_Mutation_p.D1521N|KIF1B_uc001aqy.2_Missense_Mutation_p.D1541N|KIF1B_uc001aqz.2_Missense_Mutation_p.D1567N|KIF1B_uc001ara.2_Missense_Mutation_p.D1527N|KIF1B_uc001arb.2_Missense_Mutation_p.D1553N	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1567					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CAGTGGCTATGATTCAGGAGA	0.542													59	66	---	---	---	---	PASS
C1orf64	149563	broad.mit.edu	37	1	16332706	16332706	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16332706C>T	uc001axn.2	+	2	443	c.375C>T	c.(373-375)AGC>AGT	p.S125S		NM_178840	NP_849162	Q8NEQ6	CA064_HUMAN	hypothetical protein LOC149563	125										breast(2)	2		Colorectal(325;0.000435)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;2.08e-05)|BRCA - Breast invasive adenocarcinoma(304;9.19e-05)|Kidney(64;0.000165)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0114)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCAGTCAGCCCGCTCTGCC	0.642													29	31	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21031124	21031124	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21031124C>T	uc001bdr.3	-	5	1057	c.939G>A	c.(937-939)TCG>TCA	p.S313S	KIF17_uc001bds.3_Silent_p.S313S	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	313					microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TGTCCGCAGGCGACAGGCAGG	0.622													22	53	---	---	---	---	PASS
HMGCL	3155	broad.mit.edu	37	1	24144041	24144041	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24144041C>A	uc001bib.2	-	3	221	c.177G>T	c.(175-177)CTG>CTT	p.L59L	HMGCL_uc010oec.1_Silent_p.L59L|HMGCL_uc009vqr.2_Intron|HMGCL_uc001bic.2_Silent_p.L34L|HMGCL_uc009vqs.1_Silent_p.L59L|HMGCL_uc001bid.1_Silent_p.L59L	NM_000191	NP_000182	P35914	HMGCL_HUMAN	3-hydroxy-3-methylglutaryl CoA lyase isoform 1	59					acetoacetic acid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA lyase activity|metal ion binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.0044)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.38e-24)|Colorectal(126;5.58e-08)|COAD - Colon adenocarcinoma(152;3.12e-06)|GBM - Glioblastoma multiforme(114;4.9e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000982)|KIRC - Kidney renal clear cell carcinoma(1967;0.0034)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0856)|LUSC - Lung squamous cell carcinoma(448;0.188)		GCATGTCTATCAGCTTGATTT	0.448													45	46	---	---	---	---	PASS
C1orf172	126695	broad.mit.edu	37	1	27277975	27277975	+	Silent	SNP	G	A	A	rs142079202		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27277975G>A	uc001bni.1	-	2	986	c.897C>T	c.(895-897)CGC>CGT	p.R299R		NM_152365	NP_689578	Q8NAX2	CA172_HUMAN	hypothetical protein LOC126695	299										large_intestine(1)|ovary(1)	2		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.37e-51)|OV - Ovarian serous cystadenocarcinoma(117;2.22e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|STAD - Stomach adenocarcinoma(196;0.000588)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|READ - Rectum adenocarcinoma(331;0.0419)		GAATGATGCCGCGTACCAGGC	0.602													17	23	---	---	---	---	PASS
S100PBP	64766	broad.mit.edu	37	1	33292386	33292386	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:33292386C>T	uc001bvz.2	+	3	963	c.686C>T	c.(685-687)CCT>CTT	p.P229L	S100PBP_uc001bwa.1_Missense_Mutation_p.P229L|S100PBP_uc001bwb.1_Missense_Mutation_p.P229L|S100PBP_uc001bwc.2_Missense_Mutation_p.P229L|S100PBP_uc001bwd.2_RNA	NM_022753	NP_073590	Q96BU1	S1PBP_HUMAN	S100P binding protein isoform a	229						nucleus	calcium-dependent protein binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				AAAAATATGCCTGACAGTGAG	0.448													44	52	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34158654	34158654	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34158654C>T	uc001bxn.1	-	25	3837	c.3808G>A	c.(3808-3810)GAG>AAG	p.E1270K	CSMD2_uc001bxm.1_Missense_Mutation_p.E1310K|CSMD2_uc001bxo.1_Missense_Mutation_p.E183K	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1270	Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCTCCACACTCGGCTGAAAGA	0.557													90	105	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34190206	34190206	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34190206C>T	uc001bxn.1	-	18	2704	c.2675G>A	c.(2674-2676)AGC>AAC	p.S892N	CSMD2_uc001bxm.1_Missense_Mutation_p.S932N	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	892	Sushi 5.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CGAGTCACAGCTGAAGGTCAC	0.572													33	38	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34190229	34190229	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34190229G>C	uc001bxn.1	-	18	2681	c.2652C>G	c.(2650-2652)TAC>TAG	p.Y884*	CSMD2_uc001bxm.1_Nonsense_Mutation_p.Y924*	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	884	Sushi 5.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCGCGCCCACGTAGAAGTCAT	0.572													36	38	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36564304	36564304	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36564304G>C	uc001bzv.1	-	2	985	c.978C>G	c.(976-978)GAC>GAG	p.D326E	COL8A2_uc001bzw.1_Missense_Mutation_p.D261E	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	326	Triple-helical region.				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CTGGGCCCCTGTCCCCCTTGG	0.726													11	13	---	---	---	---	PASS
TIE1	7075	broad.mit.edu	37	1	43774651	43774651	+	Intron	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43774651C>A	uc001ciu.2	+						TIE1_uc010okd.1_Intron|TIE1_uc010oke.1_Intron|TIE1_uc009vwq.2_Intron|TIE1_uc010okf.1_Intron|TIE1_uc010okg.1_Intron|TIE1_uc010okc.1_Intron	NM_005424	NP_005415	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and						mesoderm development	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity			lung(3)|stomach(1)|salivary_gland(1)|ovary(1)|skin(1)	7	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTCCTTTCTCCCCAGACCGG	0.572													4	76	---	---	---	---	PASS
NSUN4	387338	broad.mit.edu	37	1	46812705	46812705	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46812705C>T	uc001cpr.1	+	3	659	c.550C>T	c.(550-552)CCT>TCT	p.P184S	NSUN4_uc010omc.1_Missense_Mutation_p.P135S|NSUN4_uc009vyf.1_Intron|NSUN4_uc009vyg.1_Missense_Mutation_p.P135S|NSUN4_uc001cpt.1_RNA|NSUN4_uc001cps.1_RNA	NM_199044	NP_950245	Q96CB9	NSUN4_HUMAN	NOL1/NOP2/Sun domain family 4 protein	184	S-adenosyl-L-methionine binding (By similarity).						methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)					ATGTGCAGCTCCTGGGGGAAA	0.597													42	41	---	---	---	---	PASS
CYP2J2	1573	broad.mit.edu	37	1	60359502	60359502	+	Intron	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60359502C>T	uc001czq.2	-							NM_000775	NP_000766	P51589	CP2J2_HUMAN	cytochrome P450, family 2, subfamily J,						epoxygenase P450 pathway|linoleic acid metabolic process|regulation of heart contraction|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	arachidonic acid 11,12-epoxygenase activity|arachidonic acid 14,15-epoxygenase activity|aromatase activity|electron carrier activity|heme binding|linoleic acid epoxygenase activity			ovary(1)	1	all_cancers(7;0.000396)					GCCCGCTTTCCTGTAAGACAA	0.448													8	197	---	---	---	---	PASS
LRRC40	55631	broad.mit.edu	37	1	70646896	70646896	+	Intron	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70646896T>C	uc001der.1	-							NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40											ovary(1)	1						AAAGATCCTTTAAAAAGAGAA	0.274													32	32	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74832987	74832987	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74832987G>T	uc001dgf.1	+	12	1276	c.1225G>T	c.(1225-1227)GAT>TAT	p.D409Y	TNNI3K_uc001dgc.1_Missense_Mutation_p.D510Y|TNNI3K_uc001dgd.2_Missense_Mutation_p.D510Y|TNNI3K_uc001dge.1_Missense_Mutation_p.D510Y	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	409	ANK 10.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						GAGACCACAAGATGAATTGCC	0.348													60	75	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75072431	75072431	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75072431T>C	uc001dgg.2	-	10	1562	c.1343A>G	c.(1342-1344)AAC>AGC	p.N448S	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.N242S	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	448	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						AGAGGTTTTGTTCTCCTTGAT	0.408													4	238	---	---	---	---	PASS
SAMD13	148418	broad.mit.edu	37	1	84791382	84791382	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84791382A>G	uc001djr.2	+	3	350	c.158A>G	c.(157-159)TAT>TGT	p.Y53C	SAMD13_uc010orw.1_Missense_Mutation_p.Y39C|SAMD13_uc010orx.1_Missense_Mutation_p.Y39C	NM_001010971	NP_001010971	Q5VXD3	SAM13_HUMAN	sterile alpha motif domain containing 13 isoform	59	SAM.										0				all cancers(265;0.00667)|Epithelial(280;0.0219)|OV - Ovarian serous cystadenocarcinoma(397;0.136)		GTCGTCAATTATTTCCGAACC	0.473													38	37	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98144648	98144648	+	Intron	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98144648C>A	uc001drv.2	-							NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	GTAAACTACTCACCTATTCCA	0.299													10	11	---	---	---	---	PASS
LPPR4	9890	broad.mit.edu	37	1	99771997	99771997	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99771997C>T	uc001dse.2	+	7	1829	c.1723C>T	c.(1723-1725)CGA>TGA	p.R575*	LPPR4_uc010oue.1_Nonsense_Mutation_p.R517*	NM_014839	NP_055654	Q7Z2D5	LPPR4_HUMAN	plasticity related gene 1	575							phosphatidate phosphatase activity			ovary(3)	3		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		CAGCCAGCCCCGAATCATGCA	0.552													39	41	---	---	---	---	PASS
FRRS1	391059	broad.mit.edu	37	1	100185123	100185123	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100185123C>A	uc001dsh.1	-	10	1689	c.1087G>T	c.(1087-1089)GGA>TGA	p.G363*		NM_001013660	NP_001013682	Q6ZNA5	FRRS1_HUMAN	stromal cell derived factor receptor 2 homolog	363	Cytochrome b561.				electron transport chain|transport	integral to membrane	ferric-chelate reductase activity|metal ion binding			skin(1)	1		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		GAATGGGATCCTCCTATGTTC	0.398													67	70	---	---	---	---	PASS
CHIA	27159	broad.mit.edu	37	1	111854968	111854968	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111854968G>T	uc001eas.2	+	4	315	c.212G>T	c.(211-213)TGG>TTG	p.W71L	CHIA_uc001ear.2_Intron|CHIA_uc001eaq.2_Intron|CHIA_uc009wgc.2_Intron|CHIA_uc001eat.2_Intron|CHIA_uc001eav.2_Intron|CHIA_uc001eau.2_Intron|CHIA_uc009wgd.2_Intron	NM_201653	NP_970615	Q9BZP6	CHIA_HUMAN	acidic chitinase isoform c	71	Chitooligosaccharide binding (Probable).				apoptosis|cell wall chitin metabolic process|chitin catabolic process|digestion|immune response|positive regulation of chemokine secretion|production of molecular mediator involved in inflammatory response|response to acid|response to fungus	cytoplasm|extracellular space	cation binding|chitin binding|chitinase activity|kinase binding|lysozyme activity|sugar binding			ovary(1)	1		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		ACCATCGAATGGAATGATGTG	0.483													71	68	---	---	---	---	PASS
HSD3B1	3283	broad.mit.edu	37	1	120054257	120054257	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120054257C>A	uc001ehv.1	+	3	422	c.277C>A	c.(277-279)CAC>AAC	p.H93N	HSD3B1_uc001ehw.2_Missense_Mutation_p.H95N	NM_000862	NP_000853	P14060	3BHS1_HUMAN	3 beta-hydroxysteroid dehydrogenase 1	93					androgen biosynthetic process|estrogen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.219)	all_lung(203;3.16e-06)|Lung NSC(69;2.19e-05)|all_epithelial(167;0.000624)		Lung(183;0.0106)|LUSC - Lung squamous cell carcinoma(189;0.0554)	NADH(DB00157)|Trilostane(DB01108)	CGGTGTCACTCACAGAGAGTC	0.507													37	50	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144856920	144856920	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144856920C>T	uc001elw.3	-	40	6856	c.6565G>A	c.(6565-6567)GCC>ACC	p.A2189T	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.A2083T|PDE4DIP_uc001elv.3_Missense_Mutation_p.A1196T	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	2189					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGTCTTAGGGCACTGTAGTCA	0.527			T	PDGFRB	MPD								21	66	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151105867	151105867	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151105867C>G	uc001ewu.2	-	19	2186	c.1886G>C	c.(1885-1887)TGT>TCT	p.C629S	SEMA6C_uc001ewv.2_Missense_Mutation_p.C661S|SEMA6C_uc001eww.2_Missense_Mutation_p.C621S|SEMA6C_uc010pcq.1_Intron	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	629	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGCGCGGCGACAAGCACAGGA	0.716													24	14	---	---	---	---	PASS
LELP1	149018	broad.mit.edu	37	1	153177230	153177230	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153177230C>G	uc001fbl.2	+	2	157	c.47C>G	c.(46-48)CCC>CGC	p.P16R		NM_001010857	NP_001010857	Q5T871	LELP1_HUMAN	late cornified envelope-like proline-rich 1	16										ovary(1)	1	all_lung(78;3.51e-31)|Lung NSC(65;1.34e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			AAGACTGAGCCCAAGAACTGC	0.448													151	150	---	---	---	---	PASS
S100A3	6274	broad.mit.edu	37	1	153520929	153520929	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153520929G>A	uc001fca.1	-	2	116	c.33C>T	c.(31-33)GCC>GCT	p.A11A	S100A4_uc001fby.2_5'Flank|S100A4_uc001fbz.2_5'Flank|uc009wog.1_RNA	NM_002960	NP_002951	P33764	S10A3_HUMAN	S100 calcium binding protein A3	11							calcium ion binding|protein binding				0	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			TGCACACGATGGCAGCTACCG	0.622													185	179	---	---	---	---	PASS
ARHGEF2	9181	broad.mit.edu	37	1	155922631	155922631	+	Intron	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155922631G>T	uc001fmt.2	-						ARHGEF2_uc001fmq.2_5'Flank|ARHGEF2_uc001fmr.2_Intron|ARHGEF2_uc001fms.2_Intron|ARHGEF2_uc001fmu.2_Intron	NM_001162383	NP_001155855	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor 2						actin filament organization|apoptosis|cell division|cell morphogenesis|induction of apoptosis by extracellular signals|intracellular protein transport|mitosis|negative regulation of microtubule depolymerization|nerve growth factor receptor signaling pathway|positive regulation of NF-kappaB transcription factor activity|regulation of cell proliferation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|Golgi apparatus|microtubule|ruffle membrane|spindle|tight junction	microtubule binding|Rac GTPase binding|Rac guanyl-nucleotide exchange factor activity|zinc ion binding			ovary(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGCAGATAAGGAACAAGTGAG	0.577													6	102	---	---	---	---	PASS
OR6Y1	391112	broad.mit.edu	37	1	158517052	158517052	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158517052G>T	uc010pil.1	-	1	844	c.844C>A	c.(844-846)CTC>ATC	p.L282I		NM_001005189	NP_001005189	Q8NGX8	OR6Y1_HUMAN	olfactory receptor, family 6, subfamily Y,	282	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_hematologic(112;0.0378)					ACAGTGTAGAGAACAGATACC	0.453													27	289	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158590027	158590027	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158590027C>A	uc001fst.1	-	44	6549	c.6350G>T	c.(6349-6351)AGC>ATC	p.S2117I		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	2117	Spectrin 20.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GGTATAAGGGCTGGAAGGCAC	0.507													62	178	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158609675	158609675	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158609675C>A	uc001fst.1	-	34	5059	c.4860G>T	c.(4858-4860)GAG>GAT	p.E1620D		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1620	Spectrin 16.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					AGAGCCAGAACTCAAAGTCCC	0.438													76	270	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158612629	158612629	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158612629G>T	uc001fst.1	-	32	4779	c.4580C>A	c.(4579-4581)TCC>TAC	p.S1527Y		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1527	Spectrin 15.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GTCTTTGTAGGATTCATCACA	0.443													75	241	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158906870	158906870	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158906870C>T	uc001ftb.2	+	2	415	c.170C>T	c.(169-171)CCA>CTA	p.P57L	PYHIN1_uc001fta.3_Missense_Mutation_p.P57L|PYHIN1_uc001ftc.2_Missense_Mutation_p.P57L|PYHIN1_uc001ftd.2_Missense_Mutation_p.P57L|PYHIN1_uc001fte.2_Missense_Mutation_p.P57L	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	57	DAPIN.				cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GAAAAGTTCCCAGGTGATGCC	0.348													89	96	---	---	---	---	PASS
FCGR2B	2213	broad.mit.edu	37	1	161642908	161642908	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161642908C>A	uc001gaz.1	+	4	627	c.535C>A	c.(535-537)CCC>ACC	p.P179T	FCGR2B_uc009wum.1_Missense_Mutation_p.P179T|FCGR2B_uc001gay.1_Missense_Mutation_p.P178T|FCGR2B_uc001gba.1_Missense_Mutation_p.P178T|FCGR2B_uc001gbb.1_Missense_Mutation_p.P179T|FCGR2B_uc009wun.1_Missense_Mutation_p.P172T	NM_004001	NP_003992	P31994	FCG2B_HUMAN	Fc fragment of IgG, low affinity IIb, receptor	179	Ig-like C2-type 2.|Extracellular (Potential).				immune response|interspecies interaction between organisms|regulation of immune response	integral to membrane|plasma membrane	IgG binding|receptor activity				0	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	CCGTTCGGATCCCAACTTCTC	0.493			T	?	ALL								16	77	---	---	---	---	PASS
F5	2153	broad.mit.edu	37	1	169551772	169551772	+	Intron	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169551772A>G	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	TGGAAATAAAATACAAAAACT	0.279													21	69	---	---	---	---	PASS
DNM3	26052	broad.mit.edu	37	1	172007553	172007553	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172007553A>G	uc001gie.2	+	7	1120	c.944A>G	c.(943-945)AAA>AGA	p.K315R	DNM3_uc001gid.3_Missense_Mutation_p.K315R|DNM3_uc009wwb.2_Missense_Mutation_p.K315R|DNM3_uc001gif.2_Missense_Mutation_p.K315R	NM_015569	NP_056384	Q9UQ16	DYN3_HUMAN	dynamin 3 isoform a	315					endocytosis|filopodium assembly|synapse assembly	dendritic spine|microtubule|perinuclear region of cytoplasm|postsynaptic density	GTP binding|GTPase activity|protein binding			breast(1)	1						GAAGCCTACAAAAATTTCAAA	0.418													156	143	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176659333	176659333	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176659333A>G	uc001gkz.2	+	5	3362	c.2198A>G	c.(2197-2199)CAT>CGT	p.H733R	PAPPA2_uc001gky.1_Missense_Mutation_p.H733R|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	733	Metalloprotease.	Zinc; catalytic (By similarity).			cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						ACCATGATCCATGAAGTGGGA	0.483													160	158	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176671778	176671778	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176671778T>A	uc001gkz.2	+	9	4436	c.3272T>A	c.(3271-3273)GTT>GAT	p.V1091D	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1091					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CAGTACCAAGTTCTAGCTGAA	0.512													70	58	---	---	---	---	PASS
C1orf125	126859	broad.mit.edu	37	1	179348620	179348620	+	Intron	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179348620G>C	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TATGATGAGTGAGTACTATGA	0.229													4	218	---	---	---	---	PASS
GLT25D2	23127	broad.mit.edu	37	1	183942789	183942789	+	Silent	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183942789C>G	uc001gqr.2	-	4	960	c.588G>C	c.(586-588)CGG>CGC	p.R196R	GLT25D2_uc010poj.1_Silent_p.R196R|GLT25D2_uc001gqs.2_Silent_p.R76R	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2	196					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						AATACAGGCCCCGAGACTCCA	0.438													49	344	---	---	---	---	PASS
FAM129A	116496	broad.mit.edu	37	1	184859326	184859326	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184859326G>T	uc001gra.2	-	4	543	c.349C>A	c.(349-351)CGA>AGA	p.R117R	FAM129A_uc009wyh.1_Intron|FAM129A_uc009wyi.1_Intron	NM_052966	NP_443198	Q9BZQ8	NIBAN_HUMAN	niban protein isoform 2	117					negative regulation of protein phosphorylation|positive regulation of protein phosphorylation|positive regulation of translation|response to endoplasmic reticulum stress	cytoplasm|nucleus|plasma membrane				ovary(3)|skin(1)	4						GGAAGAATTCGACATTTAGGA	0.448													28	85	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196448338	196448338	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196448338T>A	uc001gtd.1	-	5	415	c.355A>T	c.(355-357)ACA>TCA	p.T119S	KCNT2_uc001gte.1_Missense_Mutation_p.T119S|KCNT2_uc001gtf.1_Missense_Mutation_p.T119S|KCNT2_uc001gtg.1_RNA|KCNT2_uc009wyu.2_Missense_Mutation_p.T119S|KCNT2_uc009wyv.1_Missense_Mutation_p.T119S	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	119	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						AGTAATATTGTTTCAAACAGA	0.284													13	126	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030958	197030958	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030958A>T	uc001gtt.1	-	3	451	c.407T>A	c.(406-408)CTC>CAC	p.L136H		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	136	Sushi 2.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TCCATCAGAGAGACATTGAAC	0.373													33	128	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197030959	197030959	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197030959G>A	uc001gtt.1	-	3	450	c.406C>T	c.(406-408)CTC>TTC	p.L136F		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	136	Sushi 2.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						CCATCAGAGAGACATTGAACC	0.373													33	131	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197390734	197390734	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197390734C>G	uc001gtz.2	+	6	1911	c.1776C>G	c.(1774-1776)ATC>ATG	p.I592M	CRB1_uc010poz.1_Missense_Mutation_p.I523M|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Missense_Mutation_p.I480M|CRB1_uc010ppb.1_Missense_Mutation_p.I592M|CRB1_uc010ppc.1_Intron|CRB1_uc010ppd.1_Missense_Mutation_p.I73M|CRB1_uc001gub.1_Missense_Mutation_p.I241M	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	592	Extracellular (Potential).|Laminin G-like 1.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						AGAAATGCATCGCGAAAGCTC	0.468													60	206	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197407761	197407761	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197407761G>T	uc001gtz.2	+	10	3969	c.3834G>T	c.(3832-3834)CAG>CAT	p.Q1278H	CRB1_uc010poz.1_Missense_Mutation_p.Q1254H|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Missense_Mutation_p.Q1166H|CRB1_uc010ppb.1_Missense_Mutation_p.Q742H|CRB1_uc010ppd.1_Missense_Mutation_p.Q759H|CRB1_uc001gub.1_Missense_Mutation_p.Q927H	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	1278	Extracellular (Potential).|EGF-like 18.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CAGAGTTCCAGACTGAATTAA	0.433													86	102	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216219889	216219889	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216219889G>T	uc001hku.1	-	32	6596	c.6209C>A	c.(6208-6210)TCT>TAT	p.S2070Y		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2070	Extracellular (Potential).|Fibronectin type-III 7.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GAGCAGCAAAGAACTGGGAAG	0.423										HNSCC(13;0.011)			67	86	---	---	---	---	PASS
PSEN2	5664	broad.mit.edu	37	1	227079483	227079483	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227079483C>T	uc009xeo.1	+	11	1437	c.1010C>T	c.(1009-1011)CCC>CTC	p.P337L	PSEN2_uc009xep.1_Missense_Mutation_p.P336L|PSEN2_uc001hqk.2_RNA	NM_000447	NP_000438	P49810	PSN2_HUMAN	presenilin 2 isoform 1	337	Cytoplasmic (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|apoptosis|beta-amyloid metabolic process|calcium ion transport|induction of apoptosis by extracellular signals|intracellular signal transduction|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|positive regulation of catalytic activity	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear inner membrane|perinuclear region of cytoplasm|Z disc	aspartic-type endopeptidase activity|protein binding			lung(2)	2		Prostate(94;0.0771)				CCTTCATACCCCGAAGTCTTT	0.552													44	102	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237550610	237550610	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237550610C>T	uc001hyl.1	+	9	726	c.606C>T	c.(604-606)CAC>CAT	p.H202H		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	202	Cytoplasmic (By similarity).|MIR 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCAGCTTACACGTGGATGCCG	0.512													35	123	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237604660	237604660	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237604660G>C	uc001hyl.1	+	13	1167	c.1047G>C	c.(1045-1047)ATG>ATC	p.M349I		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	349	Cytoplasmic (By similarity).				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAGATGGCATGGGAACATCTG	0.403													46	121	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237804280	237804280	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237804280G>T	uc001hyl.1	+	47	7319	c.7199G>T	c.(7198-7200)GGA>GTA	p.G2400V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	2400	Cytoplasmic (By similarity).|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GACCTCTTGGGACGCTGTGCT	0.453													20	31	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237872795	237872795	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237872795G>C	uc001hyl.1	+	70	10278	c.10158G>C	c.(10156-10158)AAG>AAC	p.K3386N	RYR2_uc010pxz.1_Missense_Mutation_p.K341N	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3386					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AGTGGCTAAAGGAGCCTAACC	0.403													15	37	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240966240	240966240	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240966240G>T	uc001hyv.2	-	16	1653	c.1323C>A	c.(1321-1323)TCC>TCA	p.S441S	RGS7_uc010pyh.1_Silent_p.S415S|RGS7_uc010pyj.1_Silent_p.S357S|RGS7_uc001hyu.2_Silent_p.S441S|RGS7_uc009xgn.1_Silent_p.S388S|RGS7_uc001hyw.2_Silent_p.S441S|RGS7_uc001hyt.2_Silent_p.S273S	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	441	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			GATAGGCACTGGATCTTATAA	0.348													78	208	---	---	---	---	PASS
WDR64	128025	broad.mit.edu	37	1	241929537	241929537	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241929537A>G	uc001hzf.1	+	10	1248	c.1095A>G	c.(1093-1095)TTA>TTG	p.L365L	WDR64_uc001hzg.1_Silent_p.L111L	NM_144625	NP_653226	B1ANS9	WDR64_HUMAN	WD repeat domain 64	645	WD 9.									skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			CCATGGATTTATTACGAGTGA	0.368													69	108	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004961	248004961	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004961G>A	uc001idn.1	-	1	238	c.238C>T	c.(238-240)CTT>TTT	p.L80F		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	80	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GCTAGGAGAAGGGGCACAGTG	0.592													23	36	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248005047	248005047	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248005047T>G	uc001idn.1	-	1	152	c.152A>C	c.(151-153)CAG>CCG	p.Q51P		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCGCAGGCCCTGGCTCACCAC	0.532													16	51	---	---	---	---	PASS
TRIM58	25893	broad.mit.edu	37	1	248023976	248023976	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248023976C>A	uc001ido.2	+	2	526	c.478C>A	c.(478-480)CAG>AAG	p.Q160K		NM_015431	NP_056246	Q8NG06	TRI58_HUMAN	tripartite motif-containing 58	160						intracellular	zinc ion binding			skin(3)|ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)	7	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CGCCTTGACTCAGGAGGCCAA	0.488													34	45	---	---	---	---	PASS
OR2T8	343172	broad.mit.edu	37	1	248085122	248085122	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248085122A>T	uc010pzc.1	+	1	803	c.803A>T	c.(802-804)CAC>CTC	p.H268L		NM_001005522	NP_001005522	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T,	268	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			TCCACTAACCACGACAAGGTT	0.493													97	142	---	---	---	---	PASS
OR2L8	391190	broad.mit.edu	37	1	248112396	248112396	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248112396G>T	uc001idt.1	+	1	237	c.237G>T	c.(235-237)AAG>AAT	p.K79N	OR2L13_uc001ids.2_Intron	NM_001001963	NP_001001963	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L,	79	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTGTTCCTAAGATGGCATCTG	0.448													9	645	---	---	---	---	PASS
KCNS3	3790	broad.mit.edu	37	2	18112791	18112791	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:18112791G>T	uc002rcv.2	+	3	967	c.516G>T	c.(514-516)TGG>TGT	p.W172C	KCNS3_uc002rcw.2_Missense_Mutation_p.W172C	NM_002252	NP_002243	Q9BQ31	KCNS3_HUMAN	potassium voltage-gated channel	172	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of insulin secretion	Golgi apparatus|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity			ovary(4)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AGAAAATCTGGATTAGAATGG	0.507													27	50	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21230128	21230128	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21230128A>T	uc002red.2	-	26	9740	c.9612T>A	c.(9610-9612)TTT>TTA	p.F3204L		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3204	Heparin-binding.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AATGCCTGTCAAAGGATTTGA	0.318													23	106	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24930139	24930139	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24930139C>G	uc002rfk.2	+	11	2058	c.1800C>G	c.(1798-1800)AAC>AAG	p.N600K	NCOA1_uc010eye.2_Missense_Mutation_p.N600K|NCOA1_uc002rfi.2_Missense_Mutation_p.N449K|NCOA1_uc002rfj.2_Missense_Mutation_p.N600K|NCOA1_uc002rfl.2_Missense_Mutation_p.N600K	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	600	Ser-rich.								PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATCTGACAACAGCTCTAGTG	0.378			T	PAX3	alveolar rhadomyosarcoma								38	90	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24974895	24974895	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24974895C>A	uc002rfk.2	+	18	4009	c.3751C>A	c.(3751-3753)CCT>ACT	p.P1251T	NCOA1_uc010eye.2_Missense_Mutation_p.P1251T|NCOA1_uc002rfi.2_Missense_Mutation_p.P1100T|NCOA1_uc002rfj.2_Missense_Mutation_p.P1251T|NCOA1_uc002rfl.2_Missense_Mutation_p.P1251T|NCOA1_uc010eyf.2_Missense_Mutation_p.P144T	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	1251									PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCTCTAAGCCCTGGGAGCTC	0.473			T	PAX3	alveolar rhadomyosarcoma								57	123	---	---	---	---	PASS
FAM179A	165186	broad.mit.edu	37	2	29222153	29222153	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29222153G>C	uc010ezl.2	+	4	597	c.246G>C	c.(244-246)AAG>AAC	p.K82N	FAM179A_uc010ymm.1_Missense_Mutation_p.K82N	NM_199280	NP_954974	Q6ZUX3	F179A_HUMAN	hypothetical protein LOC165186	82							binding			ovary(3)|skin(1)	4						CCCCTTCCAAGGGCTGGCAGG	0.632													11	34	---	---	---	---	PASS
ALK	238	broad.mit.edu	37	2	29754882	29754882	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29754882C>A	uc002rmy.2	-	4	1960	c.1053G>T	c.(1051-1053)GTG>GTT	p.V351V		NM_004304	NP_004295	Q9UM73	ALK_HUMAN	anaplastic lymphoma kinase precursor	351	MAM 1.|Extracellular (Potential).				protein autophosphorylation|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|protein binding|transmembrane receptor protein tyrosine kinase activity		NPM1/ALK(632)|EML4/ALK(246)|CLTC/ALK(44)|TPM3/ALK(33)|ATIC/ALK(24)|RANBP2/ALK(16)|TPM4/ALK(12)|TFG/ALK(7)|MSN/ALK(6)|CARS/ALK(5)|VCL/ALK(4)|KIF5B/ALK(4)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|SQSTM1/ALK(2)	haematopoietic_and_lymphoid_tissue(726)|lung(262)|autonomic_ganglia(148)|soft_tissue(61)|breast(4)|kidney(4)|large_intestine(3)|skin(3)|ovary(3)|thyroid(2)|central_nervous_system(1)|pancreas(1)	1218	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)	GGTGCCTGTGCACCGAGACGG	0.597			T|Mis|A	NPM1|TPM3|TFG|TPM4|ATIC|CLTC|MSN|ALO17|CARS|EML4	ALCL|NSCLC|Neuroblastoma	neuroblastoma			Neuroblastoma_Familial_Clustering_of|Congenital_Central_Hypoventilation_Syndrome				52	94	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656957	40656957	+	Missense_Mutation	SNP	T	C	C	rs34034084		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656957T>C	uc002rrx.2	-	1	488	c.464A>G	c.(463-465)GAA>GGA	p.E155G	SLC8A1_uc002rry.2_Missense_Mutation_p.E155G|SLC8A1_uc002rrz.2_Missense_Mutation_p.E155G|SLC8A1_uc002rsa.2_Missense_Mutation_p.E155G|SLC8A1_uc002rsd.3_Missense_Mutation_p.E155G|SLC8A1_uc002rsb.1_Missense_Mutation_p.E155G|SLC8A1_uc010fan.1_Missense_Mutation_p.E155G|SLC8A1_uc002rsc.1_Missense_Mutation_p.E155G	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	155	Helical; (Potential).|Alpha-1.				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCCACACACTTCAATTACTGA	0.458													6	130	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43871901	43871901	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43871901A>G	uc010yny.1	+	2	172	c.89A>G	c.(88-90)CAA>CGA	p.Q30R	PLEKHH2_uc002rte.3_Missense_Mutation_p.Q30R|PLEKHH2_uc002rtf.3_Missense_Mutation_p.Q30R	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	30	Potential.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TTTAGAGTTCAAGCAAGCAAG	0.393													28	86	---	---	---	---	PASS
PREPL	9581	broad.mit.edu	37	2	44573523	44573523	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44573523G>T	uc002ruf.2	-	2	261	c.226C>A	c.(226-228)CAG>AAG	p.Q76K	PREPL_uc002rug.2_Missense_Mutation_p.Q76K|PREPL_uc002ruh.2_Missense_Mutation_p.Q76K|PREPL_uc010fax.2_Missense_Mutation_p.Q76K|PREPL_uc002rui.3_5'UTR|PREPL_uc002ruj.1_5'UTR|PREPL_uc002ruk.1_Missense_Mutation_p.Q76K	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C	76					proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				TTAACAGGCTGAAGATCCTGG	0.318													4	175	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71740931	71740931	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71740931G>T	uc002sie.2	+	6	919	c.543G>T	c.(541-543)GGG>GGT	p.G181G	DYSF_uc010feg.2_Silent_p.G212G|DYSF_uc010feh.2_Silent_p.G181G|DYSF_uc002sig.3_Silent_p.G181G|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.G181G|DYSF_uc010fef.2_Silent_p.G212G|DYSF_uc010fei.2_Silent_p.G212G|DYSF_uc010fek.2_Silent_p.G213G|DYSF_uc010fej.2_Silent_p.G182G|DYSF_uc010fel.2_Silent_p.G182G|DYSF_uc010feo.2_Silent_p.G213G|DYSF_uc010fem.2_Silent_p.G182G|DYSF_uc010fen.2_Silent_p.G213G|DYSF_uc002sif.2_Silent_p.G182G	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	181	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GAGGCCCGGGGGCTCCCACCA	0.592													34	64	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71795349	71795349	+	Silent	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71795349G>C	uc002sie.2	+	26	3067	c.2691G>C	c.(2689-2691)ACG>ACC	p.T897T	DYSF_uc010feg.2_Silent_p.T928T|DYSF_uc010feh.2_Silent_p.T883T|DYSF_uc002sig.3_Silent_p.T883T|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.T897T|DYSF_uc010fef.2_Silent_p.T914T|DYSF_uc010fei.2_Silent_p.T914T|DYSF_uc010fek.2_Silent_p.T915T|DYSF_uc010fej.2_Silent_p.T884T|DYSF_uc010fel.2_Silent_p.T884T|DYSF_uc010feo.2_Silent_p.T929T|DYSF_uc010fem.2_Silent_p.T898T|DYSF_uc010fen.2_Silent_p.T915T|DYSF_uc002sif.2_Silent_p.T898T	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	897	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						GGGGCACAACGGGCCTCACCT	0.607													136	310	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77745694	77745694	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77745694A>T	uc002snr.2	-	3	1716	c.1301T>A	c.(1300-1302)CTC>CAC	p.L434H	LRRTM4_uc002snq.2_Missense_Mutation_p.L434H|LRRTM4_uc002sns.2_Missense_Mutation_p.L434H|LRRTM4_uc002snt.2_Missense_Mutation_p.L435H	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	434	Helical; (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		GGCCACTGAGAGAAAGAGAGC	0.502													39	84	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79971682	79971682	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79971682C>A	uc010ysh.1	+	2	277	c.272C>A	c.(271-273)GCT>GAT	p.A91D	CTNNA2_uc010yse.1_Missense_Mutation_p.A91D|CTNNA2_uc010ysf.1_Missense_Mutation_p.A91D|CTNNA2_uc010ysg.1_Missense_Mutation_p.A91D	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	91					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GAGTTGGTGGCTGCTGTAGAG	0.433													20	51	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80136740	80136740	+	Silent	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80136740C>G	uc010ysh.1	+	6	878	c.873C>G	c.(871-873)CCC>CCG	p.P291P	CTNNA2_uc010yse.1_Silent_p.P291P|CTNNA2_uc010ysf.1_Silent_p.P291P|CTNNA2_uc010ysg.1_Silent_p.P291P	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	291					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TCCTGGACCCCATGACGTTCA	0.552													47	112	---	---	---	---	PASS
ANKRD36B	57730	broad.mit.edu	37	2	98177143	98177143	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98177143G>T	uc010yvc.1	-	8	1130	c.850C>A	c.(850-852)CCT>ACT	p.P284T	ANKRD36B_uc010yve.1_RNA|ANKRD36B_uc010fif.2_RNA	NM_025190	NP_079466	Q8N2N9	AN36B_HUMAN	ankyrin repeat domain 36B	284											0						CCAGATATAGGTCCCTCCTTT	0.313													41	133	---	---	---	---	PASS
IL1R1	3554	broad.mit.edu	37	2	102791159	102791159	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102791159G>T	uc002tbq.2	+	10	1422	c.1104G>T	c.(1102-1104)AGG>AGT	p.R368S	IL1R1_uc010fix.2_Missense_Mutation_p.R368S|IL1R1_uc002tbp.2_Missense_Mutation_p.R368S|IL1R1_uc002tbr.2_Missense_Mutation_p.R368S	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	368	Cytoplasmic (Potential).				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	TTTGGTACAGGGATTCCTGCT	0.348													4	165	---	---	---	---	PASS
CCDC138	165055	broad.mit.edu	37	2	109411052	109411052	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109411052G>T	uc002ten.1	+	5	511	c.451G>T	c.(451-453)GCA>TCA	p.A151S	CCDC138_uc002teo.1_Missense_Mutation_p.A151S|CCDC138_uc002tep.1_5'UTR|CCDC138_uc010fjm.1_5'UTR	NM_144978	NP_659415	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	151											0						TTGTAGTGATGCAGGTGACTC	0.393													64	101	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111425421	111425421	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111425421T>A	uc002tgc.2	-	7	685	c.573A>T	c.(571-573)TCA>TCT	p.S191S	BUB1_uc010yxh.1_Silent_p.S171S|BUB1_uc010fkb.2_Silent_p.S191S|BUB1_uc002tgd.2_Silent_p.S191S	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	191					apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		CAGAAAGCTCTGAACCCTAAA	0.338													82	177	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120720314	120720314	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120720314C>T	uc002tmf.1	+	24	3174	c.2403C>T	c.(2401-2403)AAC>AAT	p.N801N	PTPN4_uc010flj.1_Silent_p.N514N|PTPN4_uc010yyr.1_Silent_p.N434N	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type	801	Tyrosine-protein phosphatase.					cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	CCCTATTTAACCAAGAGGTAA	0.413													16	102	---	---	---	---	PASS
GLI2	2736	broad.mit.edu	37	2	121746735	121746735	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121746735C>G	uc010flp.2	+	13	3275	c.3245C>G	c.(3244-3246)ACC>AGC	p.T1082S	GLI2_uc002tmq.1_Missense_Mutation_p.T754S|GLI2_uc002tmr.1_Missense_Mutation_p.T737S|GLI2_uc002tmt.3_Missense_Mutation_p.T754S|GLI2_uc002tmu.3_Missense_Mutation_p.T737S	NM_005270	NP_005261	P10070	GLI2_HUMAN	GLI-Kruppel family member GLI2	1082					axon guidance|branching morphogenesis of a tube|cell proliferation|cerebellar cortex morphogenesis|developmental growth|embryonic digestive tract development|epidermal cell differentiation|floor plate formation|heart development|hindgut morphogenesis|kidney development|lung development|negative regulation of transcription from RNA polymerase II promoter|odontogenesis of dentine-containing tooth|osteoblast development|osteoblast differentiation|pituitary gland development|positive regulation of DNA replication|positive regulation of T cell differentiation in thymus|positive regulation of transcription from RNA polymerase II promoter|proximal/distal pattern formation|skeletal system development|smoothened signaling pathway involved in ventral spinal cord interneuron specification|spinal cord ventral commissure morphogenesis	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|lung(2)|breast(1)|central_nervous_system(1)|pancreas(1)	13	Renal(3;0.0496)	Prostate(154;0.0623)				GACGAGGGCACCGGGCAGGTG	0.682													31	88	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125261888	125261888	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125261888G>T	uc002tno.2	+	8	1443	c.1079G>T	c.(1078-1080)TGC>TTC	p.C360F	CNTNAP5_uc010flu.2_Missense_Mutation_p.C361F	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	360	Laminin G-like 1.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		ACTTTTTCCTGCTCCGAACCA	0.458													7	83	---	---	---	---	PASS
CCNT2	905	broad.mit.edu	37	2	135711685	135711685	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135711685A>G	uc002tuc.1	+	9	1692	c.1660A>G	c.(1660-1662)AGA>GGA	p.R554G	CCNT2_uc002tub.1_Missense_Mutation_p.R554G|CCNT2_uc010zbf.1_Missense_Mutation_p.R379G|CCNT2_uc002tud.1_Missense_Mutation_p.R217G	NM_058241	NP_490595	O60583	CCNT2_HUMAN	cyclin T2 isoform b	554					cell cycle|cell division|interspecies interaction between organisms|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein kinase binding			ovary(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.107)		ACATATTAGCAGAGACCATAA	0.483													44	90	---	---	---	---	PASS
RAB3GAP1	22930	broad.mit.edu	37	2	135893449	135893449	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135893449G>C	uc002tuj.2	+	17	1895	c.1870G>C	c.(1870-1872)GGG>CGG	p.G624R	RAB3GAP1_uc010fnf.2_Missense_Mutation_p.G624R|RAB3GAP1_uc010fng.2_Missense_Mutation_p.G449R|RAB3GAP1_uc010fnh.1_RNA	NM_012233	NP_036365	Q15042	RB3GP_HUMAN	RAB3 GTPase-activating protein	624						centrosome|nucleus|soluble fraction	Rab GTPase activator activity|Rab GTPase binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.117)		CTATCAGCATGGGAAACTTAC	0.413													28	129	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141128387	141128387	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141128387C>A	uc002tvj.1	-	71	11872	c.10900G>T	c.(10900-10902)GAA>TAA	p.E3634*		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3634	Extracellular (Potential).|LDL-receptor class A 29.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AACTGATCTTCCTTACATTCA	0.388										TSP Lung(27;0.18)			36	121	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141128806	141128806	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141128806C>G	uc002tvj.1	-	70	11789	c.10817G>C	c.(10816-10818)TGT>TCT	p.C3606S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3606	Extracellular (Potential).|LDL-receptor class A 28.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TGCTGAAATACATCCATCACT	0.279										TSP Lung(27;0.18)			13	64	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141680640	141680640	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141680640C>G	uc002tvj.1	-	21	4185	c.3213G>C	c.(3211-3213)TGG>TGC	p.W1071C	LRP1B_uc010fnl.1_Missense_Mutation_p.W253C	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1071	Extracellular (Potential).|LDL-receptor class A 8.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATCACAGCGCCACAAATCAG	0.418										TSP Lung(27;0.18)			31	106	---	---	---	---	PASS
KCNJ3	3760	broad.mit.edu	37	2	155555413	155555413	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155555413G>C	uc002tyv.1	+	1	321	c.126G>C	c.(124-126)AAG>AAC	p.K42N	KCNJ3_uc010zce.1_Missense_Mutation_p.K42N	NM_002239	NP_002230	P48549	IRK3_HUMAN	potassium inwardly-rectifying channel J3	42	Cytoplasmic (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			upper_aerodigestive_tract(1)|pancreas(1)	2					Halothane(DB01159)	CCAAGAAGAAGCGGCAGCGGT	0.637													13	42	---	---	---	---	PASS
PKP4	8502	broad.mit.edu	37	2	159499163	159499163	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159499163C>T	uc002tzv.2	+	11	2121	c.1861C>T	c.(1861-1863)CGA>TGA	p.R621*	PKP4_uc002tzt.1_Nonsense_Mutation_p.R473*|PKP4_uc002tzu.2_Nonsense_Mutation_p.R621*|PKP4_uc002tzw.2_Nonsense_Mutation_p.R621*|PKP4_uc002tzx.2_Nonsense_Mutation_p.R278*|PKP4_uc002tzy.1_Nonsense_Mutation_p.R279*|PKP4_uc002tzz.1_Nonsense_Mutation_p.R619*|PKP4_uc002uaa.2_Nonsense_Mutation_p.R473*	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a	621	ARM 4.				cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						TGCCTTGTTGCGACTGTTGAG	0.413										HNSCC(62;0.18)			9	134	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162804067	162804067	+	Intron	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162804067C>T	uc002ubx.3	+						SLC4A10_uc002uby.3_Intron|SLC4A10_uc010zcs.1_Intron	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate						bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						GTTTTACTTCCTCTGGCAGGA	0.428													11	40	---	---	---	---	PASS
IFIH1	64135	broad.mit.edu	37	2	163174644	163174644	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163174644T>C	uc002uce.2	-	1	396	c.174A>G	c.(172-174)GCA>GCG	p.A58A	IFIH1_uc002ucf.2_Silent_p.A58A	NM_022168	NP_071451	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	58	CARD 1.				detection of virus|innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|regulation of apoptosis	cytosol|nucleus	ATP binding|DNA binding|double-stranded RNA binding|helicase activity|protein binding|ribonucleoprotein binding|zinc ion binding			ovary(1)	1						GCAGTTCAACTGCCTGCATGT	0.607													18	77	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166870371	166870371	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166870371C>A	uc010zcz.1	-	18	3573	c.3555G>T	c.(3553-3555)GTG>GTT	p.V1185V	SCN1A_uc002udo.3_Silent_p.V1065V|SCN1A_uc010fpk.2_Silent_p.V1037V	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	1196						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	TGCCTTCTTCCACATTGATTT	0.383													26	179	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179495637	179495637	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179495637C>G	uc010zfg.1	-	187	36568	c.36344G>C	c.(36343-36345)AGT>ACT	p.S12115T	TTN_uc010zfh.1_Missense_Mutation_p.S5810T|TTN_uc010zfi.1_Missense_Mutation_p.S5743T|TTN_uc010zfj.1_Missense_Mutation_p.S5618T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	13042							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACCTCCACACTGTGCAGGGG	0.498													21	84	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179615578	179615578	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179615578T>G	uc002unb.2	-	46	11773	c.11549A>C	c.(11548-11550)GAG>GCG	p.E3850A	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	9685							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTGGATGACTCTCCAATTGT	0.373													46	161	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196689162	196689162	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196689162T>A	uc002utj.3	-	49	9209	c.9108A>T	c.(9106-9108)CTA>CTT	p.L3036L		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3036	AAA 5 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						CAACATTTTCTAGCAACACTG	0.343													64	101	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197183868	197183868	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197183868T>A	uc002utm.1	-	9	1929	c.1746A>T	c.(1744-1746)ACA>ACT	p.T582T	HECW2_uc002utl.1_Silent_p.T226T	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	582					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CGGAAGTCCCTGTGTCTGCGC	0.587													16	63	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219877985	219877985	+	Missense_Mutation	SNP	C	T	T	rs146800134	byFrequency	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219877985C>T	uc002vjl.1	-	24	4037	c.3953G>A	c.(3952-3954)CGG>CAG	p.R1318Q		NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	1318						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTGACCTGCCGTGGGGGTAG	0.527													6	21	---	---	---	---	PASS
CCDC108	255101	broad.mit.edu	37	2	219903118	219903118	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219903118G>T	uc002vjl.1	-	4	420	c.336C>A	c.(334-336)GCC>GCA	p.A112A	CCDC108_uc010zkp.1_Silent_p.A101A|CCDC108_uc010zkq.1_Silent_p.A47A|CCDC108_uc002vjn.2_Silent_p.A47A	NM_194302	NP_919278	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108 isoform 1	112						integral to membrane	structural molecule activity			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGTGCTGCAGGCACTCATGG	0.438													11	34	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225729367	225729367	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225729367T>A	uc010fwz.1	-	13	1744	c.1505A>T	c.(1504-1506)CAT>CTT	p.H502L	DOCK10_uc002vob.2_Missense_Mutation_p.H496L|DOCK10_uc002vod.1_Missense_Mutation_p.H502L	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	502							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATTTCAGAATGTGGATTGCT	0.363													8	72	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225729368	225729368	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225729368G>T	uc010fwz.1	-	13	1743	c.1504C>A	c.(1504-1506)CAT>AAT	p.H502N	DOCK10_uc002vob.2_Missense_Mutation_p.H496N|DOCK10_uc002vod.1_Missense_Mutation_p.H502N	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	502							GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATTTCAGAATGTGGATTGCTT	0.363													8	70	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226378242	226378242	+	Missense_Mutation	SNP	G	T	T	rs61753537	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226378242G>T	uc002voe.2	+	3	552	c.377G>T	c.(376-378)GGC>GTC	p.G126V	KIAA1486_uc010fxa.1_Intron	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	126										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		TCGGTTGGGGGCACAGACGAT	0.577													12	51	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230657770	230657770	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230657770C>T	uc002vpw.1	-	26	3944	c.3835G>A	c.(3835-3837)GTG>ATG	p.V1279M	TRIP12_uc002vpx.1_Missense_Mutation_p.V1327M|TRIP12_uc002vpy.1_Missense_Mutation_p.V1009M	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1279					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		CACTGCTTCACATTTGCACAG	0.408													4	116	---	---	---	---	PASS
GPR55	9290	broad.mit.edu	37	2	231774970	231774970	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231774970C>A	uc002vrg.2	-	2	901	c.708G>T	c.(706-708)GTG>GTT	p.V236V	GPR55_uc002vrf.2_RNA|GPR55_uc010fxs.1_Silent_p.V236V	NM_005683	NP_005674	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	236	Helical; Name=6; (Potential).				activation of phospholipase C activity|bone resorption|negative regulation of osteoclast differentiation|positive regulation of ERK1 and ERK2 cascade|positive regulation of Rho protein signal transduction	integral to plasma membrane	cannabinoid receptor activity			ovary(1)	1		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GGAAGGAGACCACGAAGACAG	0.582													4	123	---	---	---	---	PASS
ALPI	248	broad.mit.edu	37	2	233322011	233322011	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233322011C>A	uc002vst.3	+	5	704	c.627C>A	c.(625-627)CTC>CTA	p.L209L	ALPI_uc002vsu.3_Silent_p.L120L	NM_001631	NP_001622	P09923	PPBI_HUMAN	intestinal alkaline phosphatase precursor	209					phosphorylation	anchored to membrane|integral to membrane|plasma membrane	alkaline phosphatase activity|metal ion binding|protein binding			central_nervous_system(1)	1		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CCACTCAGCTCATCTCCAACA	0.632													52	155	---	---	---	---	PASS
GIGYF2	26058	broad.mit.edu	37	2	233671354	233671354	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233671354C>T	uc002vti.3	+	17	2130	c.1793C>T	c.(1792-1794)CCC>CTC	p.P598L	GIGYF2_uc010zmj.1_Missense_Mutation_p.P598L|GIGYF2_uc002vtg.2_Missense_Mutation_p.P592L|GIGYF2_uc002vtj.3_Missense_Mutation_p.P619L|GIGYF2_uc002vtk.3_Missense_Mutation_p.P598L|GIGYF2_uc002vth.3_Missense_Mutation_p.P592L|GIGYF2_uc010zmk.1_RNA|GIGYF2_uc010zml.1_Missense_Mutation_p.P429L	NM_015575	NP_056390	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2 isoform b	598					cell death		protein binding			ovary(4)|central_nervous_system(3)	7		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GGTCCAGCTCCCCCTCCTCAT	0.428													6	198	---	---	---	---	PASS
ANO7	50636	broad.mit.edu	37	2	242142807	242142807	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242142807C>T	uc002wax.2	+	9	1048	c.945C>T	c.(943-945)GTC>GTT	p.V315V		NM_001001891	NP_001001891	Q6IWH7	ANO7_HUMAN	transmembrane protein 16G isoform NGEP long	315	Cytoplasmic (Potential).					cell junction|chloride channel complex|cytosol	chloride channel activity			pancreas(2)|central_nervous_system(1)	3						AGCGCCAAGTCCTTTTCCAGC	0.682													10	15	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1269545	1269545	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1269545C>A	uc003boz.2	+	4	493	c.226C>A	c.(226-228)CAC>AAC	p.H76N	CNTN6_uc010hbo.2_Missense_Mutation_p.H71N|CNTN6_uc011asj.1_Missense_Mutation_p.H4N|CNTN6_uc003bpa.2_Missense_Mutation_p.H76N	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	76	Ig-like C2-type 1.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TATGAGTTATCACTACAGGTT	0.403													65	87	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36893661	36893661	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36893661C>A	uc003cgj.2	-	4	3245	c.2943G>T	c.(2941-2943)CAG>CAT	p.Q981H		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	1531					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						ATTCAATGGGCTGAGTTTTCC	0.403													21	27	---	---	---	---	PASS
C3orf23	285343	broad.mit.edu	37	3	44409198	44409198	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44409198C>A	uc010him.2	+	5	815	c.570C>A	c.(568-570)CTC>CTA	p.L190L	C3orf23_uc003cnd.3_Silent_p.L190L|C3orf23_uc003cne.3_Silent_p.L46L	NM_173826	NP_776187	Q8N3R3	CC023_HUMAN	hypothetical protein LOC285343 isoform 1	190						mitochondrion				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				KIRC - Kidney renal clear cell carcinoma(197;0.0468)|Kidney(197;0.0585)		AAACAACTCTCACGTATGTAA	0.348													3	40	---	---	---	---	PASS
RTP3	83597	broad.mit.edu	37	3	46542189	46542189	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46542189C>A	uc003cps.1	+	2	567	c.499C>A	c.(499-501)CAG>AAG	p.Q167K		NM_031440	NP_113628	Q9BQQ7	RTP3_HUMAN	transmembrane protein 7	167	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		TGGGCCCATACAGGTTACAAG	0.517													42	45	---	---	---	---	PASS
WDR6	11180	broad.mit.edu	37	3	49050270	49050270	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49050270C>T	uc003cvj.2	+	2	1531	c.1393C>T	c.(1393-1395)CCT>TCT	p.P465S	WDR6_uc011bbx.1_Missense_Mutation_p.P336S|WDR6_uc011bby.1_Intron|WDR6_uc010hkn.2_Missense_Mutation_p.P409S|WDR6_uc011bbz.1_Missense_Mutation_p.P384S	NM_018031	NP_060501	Q9NNW5	WDR6_HUMAN	WD repeat domain 6 protein	435	WD 7.				cell cycle arrest|negative regulation of cell proliferation	cytoplasm				central_nervous_system(1)	1				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GACCCTGTTTCCTGGGAAGGT	0.592													14	19	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53783447	53783447	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53783447A>G	uc003dgv.3	+	27	3630	c.3467A>G	c.(3466-3468)CAG>CGG	p.Q1156R	CACNA1D_uc003dgu.3_Missense_Mutation_p.Q1176R|CACNA1D_uc003dgy.3_Missense_Mutation_p.Q1156R|CACNA1D_uc003dgw.3_Missense_Mutation_p.Q823R|CACNA1D_uc003dgx.1_Missense_Mutation_p.Q304R	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1156	Dihydropyridine binding (By similarity).|Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	GTTACATTTCAGGAACAAGGA	0.428													3	94	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96706460	96706460	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706460C>A	uc010how.1	+	3	780	c.737C>A	c.(736-738)GCT>GAT	p.A246D	EPHA6_uc003drp.1_Missense_Mutation_p.A246D	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	151	Ephrin-binding.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						GACACAATTGCTGCTGATGAG	0.398													83	522	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96706479	96706479	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706479C>A	uc010how.1	+	3	799	c.756C>A	c.(754-756)ACC>ACA	p.T252T	EPHA6_uc003drp.1_Silent_p.T252T	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	157	Ephrin-binding.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						AGAGTTTTACCCAGATGGATT	0.398													84	542	---	---	---	---	PASS
OR5K4	403278	broad.mit.edu	37	3	98073466	98073466	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98073466A>T	uc011bgv.1	+	1	769	c.769A>T	c.(769-771)ATG>TTG	p.M257L		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	257	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						TTGTCTTCTCATGTATATTGG	0.353													77	395	---	---	---	---	PASS
CBLB	868	broad.mit.edu	37	3	105586391	105586391	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105586391C>G	uc003dwc.2	-	2	353	c.31G>C	c.(31-33)GGT>CGT	p.G11R	CBLB_uc011bhi.1_Missense_Mutation_p.G33R|CBLB_uc003dwd.1_Missense_Mutation_p.G11R|CBLB_uc003dwe.1_Missense_Mutation_p.G11R|CBLB_uc011bhj.1_RNA	NM_170662	NP_733762	Q13191	CBLB_HUMAN	Cas-Br-M (murine) ecotropic retroviral	11					cell surface receptor linked signaling pathway|NLS-bearing substrate import into nucleus	cytoplasm|nucleus	calcium ion binding|ligase activity|signal transducer activity|zinc ion binding			lung(4)|ovary(3)|breast(1)|skin(1)	9						CCTCGACCACCAGGGTTTCTG	0.413			Mis S		AML								111	174	---	---	---	---	PASS
TRAT1	50852	broad.mit.edu	37	3	108572578	108572578	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108572578C>A	uc003dxi.1	+	6	559	c.415C>A	c.(415-417)CAA>AAA	p.Q139K	TRAT1_uc010hpx.1_Missense_Mutation_p.Q102K	NM_016388	NP_057472	Q6PIZ9	TRAT1_HUMAN	T-cell receptor interacting molecule	139	Cytoplasmic (Potential).				cellular defense response|negative regulation of receptor recycling|negative regulation of transport|positive regulation of calcium-mediated signaling|positive regulation of T cell receptor signaling pathway|T cell receptor signaling pathway	integral to plasma membrane|T cell receptor complex	phosphatidylinositol-4,5-bisphosphate 3-kinase activity|transmembrane receptor protein tyrosine kinase adaptor activity			skin(1)	1						TGGAGATGAGCAACTACATGC	0.458													17	142	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108723703	108723703	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108723703C>T	uc003dxl.2	-	20	2133	c.2046G>A	c.(2044-2046)TGG>TGA	p.W682*	MORC1_uc011bhn.1_Nonsense_Mutation_p.W661*	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	682					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						GTTGAGCTCTCCAGACAGTGG	0.368													298	452	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119134230	119134230	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119134230G>T	uc003ecj.3	+	12	3986	c.3454G>T	c.(3454-3456)GCA>TCA	p.A1152S		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1152					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TTACTGTAAAGCAGACCCCTG	0.537													10	149	---	---	---	---	PASS
HGD	3081	broad.mit.edu	37	3	120357315	120357315	+	Silent	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120357315A>C	uc003edw.2	-	12	1363	c.993T>G	c.(991-993)CCT>CCG	p.P331P	HGD_uc003edv.2_Silent_p.P190P	NM_000187	NP_000178	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	331					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding				0				GBM - Glioblastoma multiforme(114;0.158)		GGTAATAAGGAGGCCTGAAGG	0.478													101	165	---	---	---	---	PASS
SNX4	8723	broad.mit.edu	37	3	125216675	125216675	+	Intron	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125216675T>C	uc003eib.2	-						SNX4_uc011bkf.1_Intron	NM_003794	NP_003785	O95219	SNX4_HUMAN	sorting nexin 4						cell communication|endocytic recycling|endocytosis|protein transport	cytoplasmic dynein complex|early endosome membrane	phosphatidylinositol binding|protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4						AAAAGAAAAATACCTGTGTTA	0.284													39	191	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134644715	134644715	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134644715C>A	uc003eqt.2	+	2	336	c.116C>A	c.(115-117)GCG>GAG	p.A39E	EPHB1_uc010htz.1_RNA|EPHB1_uc011bly.1_Missense_Mutation_p.A39E	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	39	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						GCCAATCCTGCGTCCGGGGTG	0.463													12	32	---	---	---	---	PASS
DBR1	51163	broad.mit.edu	37	3	137893470	137893470	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137893470G>A	uc003erv.2	-	1	304	c.168C>T	c.(166-168)CCC>CCT	p.P56P	DBR1_uc003eru.2_Silent_p.P5P	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	56						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						GACGATACTTGGGCGGCACGG	0.692													8	29	---	---	---	---	PASS
TRIM42	287015	broad.mit.edu	37	3	140401982	140401982	+	Silent	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140401982C>G	uc003eto.1	+	2	1211	c.1020C>G	c.(1018-1020)GCC>GCG	p.A340A		NM_152616	NP_689829	Q8IWZ5	TRI42_HUMAN	tripartite motif-containing 42	340						intracellular	zinc ion binding			lung(2)|skin(2)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	7						TCTTCAGCGCCATCGCCAAGT	0.532													4	187	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142178192	142178192	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142178192C>G	uc003eux.3	-	43	7348	c.7226G>C	c.(7225-7227)TGT>TCT	p.C2409S	ATR_uc003euy.1_Missense_Mutation_p.C295S	NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	2409	PI3K/PI4K.				cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TGGTAGCATACACTGGCGAAG	0.398								Other_conserved_DNA_damage_response_genes					31	173	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142257406	142257406	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142257406C>A	uc003eux.3	-	19	3765	c.3643G>T	c.(3643-3645)GTA>TTA	p.V1215L		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1215					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						GCTACTATTACATGACTGAGA	0.388								Other_conserved_DNA_damage_response_genes					110	168	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147106642	147106642	+	3'UTR	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147106642G>T	uc003ewd.1	-	5					ZIC4_uc003ewc.1_3'UTR|ZIC4_uc011bno.1_3'UTR	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4							nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						CAACGCGGTGGACATCTGTAA	0.473													41	79	---	---	---	---	PASS
ZIC4	84107	broad.mit.edu	37	3	147120521	147120521	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147120521C>T	uc003ewd.1	-	2	337	c.64G>A	c.(64-66)GAG>AAG	p.E22K	ZIC4_uc011bno.1_Missense_Mutation_p.E72K	NM_032153	NP_115529	Q8N9L1	ZIC4_HUMAN	zinc finger protein of the cerebellum 4	22						nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|central_nervous_system(1)	2						TTACTTGACTCTTTAAGAGTG	0.313													141	242	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128383	147128383	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128383C>A	uc003ewe.2	+	1	1203	c.484C>A	c.(484-486)CAG>AAG	p.Q162K		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	162					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GGTCAACGGGCAGATGAGGCT	0.711													7	10	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128470	147128470	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128470G>T	uc003ewe.2	+	1	1290	c.571G>T	c.(571-573)GCG>TCG	p.A191S		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	191					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GCACTATGCTGCGCCGCAGCT	0.662													37	68	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178942613	178942613	+	Intron	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178942613A>T	uc003fjk.2	+							NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha						epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity			breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			GGGGATGGTAAGGAAGAGTAT	0.353		57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			50	228	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179426630	179426630	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179426630G>T	uc003fkh.2	+	6	771	c.690G>T	c.(688-690)CTG>CTT	p.L230L	USP13_uc003fkf.2_Silent_p.L230L	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	230	UBP-type.				ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GCTCTGTCCTGTGTGGAAAGT	0.537													109	191	---	---	---	---	PASS
DVL3	1857	broad.mit.edu	37	3	183885468	183885468	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183885468G>T	uc003fms.2	+	12	1439	c.1299G>T	c.(1297-1299)TGG>TGT	p.W433C	DVL3_uc011bqw.1_Missense_Mutation_p.W416C|DVL3_uc003fmt.2_Missense_Mutation_p.W104C|DVL3_uc003fmu.2_Missense_Mutation_p.W265C	NM_004423	NP_004414	Q92997	DVL3_HUMAN	dishevelled 3	433	DEP.				canonical Wnt receptor signaling pathway|intracellular signal transduction|positive regulation of JUN kinase activity|positive regulation of protein phosphorylation|positive regulation of transcription, DNA-dependent	cytoplasm	beta-catenin binding|frizzled binding|protease binding|protein heterodimerization activity|signal transducer activity			ovary(1)|lung(1)|breast(1)	3	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.08e-34)|OV - Ovarian serous cystadenocarcinoma(80;1.31e-22)			ACCGCATGTGGCTCAAGATTA	0.597													49	104	---	---	---	---	PASS
ZBTB49	166793	broad.mit.edu	37	4	4303783	4303783	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4303783G>T	uc003ghu.2	+	3	395	c.220G>T	c.(220-222)GGC>TGC	p.G74C	ZBTB49_uc003ghv.2_Intron|ZBTB49_uc010icy.2_RNA|ZBTB49_uc010icz.2_5'Flank	NM_145291	NP_660334	Q6ZSB9	ZBT49_HUMAN	zinc finger protein 509	74	BTB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						AAATGTCAGTGGCATAGGGCA	0.398													49	54	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46060535	46060535	+	Silent	SNP	G	T	T	rs142799145		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46060535G>T	uc003gxb.2	-	6	882	c.730C>A	c.(730-732)CGG>AGG	p.R244R		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	244	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		GTTGAGTTCCGTAACCCTACA	0.333													36	50	---	---	---	---	PASS
NMU	10874	broad.mit.edu	37	4	56471492	56471492	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56471492G>A	uc003hbc.2	-	7	491	c.385C>T	c.(385-387)CAG>TAG	p.Q129*	NMU_uc003hbd.1_Intron|NMU_uc010igv.1_RNA|NMU_uc010igw.1_Nonsense_Mutation_p.Q44*|NMU_uc010igx.1_Intron	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor	129					neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		GGAACGAGCTGCAGCAACGGA	0.498													66	95	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62598642	62598642	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62598642G>T	uc010ihh.2	+	5	738	c.565G>T	c.(565-567)GAT>TAT	p.D189Y	LPHN3_uc003hcq.3_Missense_Mutation_p.D189Y|LPHN3_uc010ihg.1_Missense_Mutation_p.D257Y|LPHN3_uc003hcs.1_Missense_Mutation_p.D18Y	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	189	Extracellular (Potential).|Olfactomedin-like.				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TTCATCCAAGGATGACTTCAT	0.473													4	64	---	---	---	---	PASS
TECRL	253017	broad.mit.edu	37	4	65145803	65145803	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65145803G>A	uc003hcv.2	-	12	1188	c.1079C>T	c.(1078-1080)CCA>CTA	p.P360L	TECRL_uc010ihi.2_RNA	NM_001010874	NP_001010874	Q5HYJ1	TECRL_HUMAN	steroid 5 alpha-reductase 2-like 2	360					lipid metabolic process	cytoplasm|integral to membrane	oxidoreductase activity, acting on the CH-CH group of donors				0						CAATATGAATGGAATCATTGC	0.274													22	25	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89526980	89526980	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89526980A>G	uc003hrw.1	+	3	172	c.6A>G	c.(4-6)TTA>TTG	p.L2L	HERC3_uc003hrv.2_Silent_p.L2L|HERC3_uc011cdn.1_Intron	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	2	RCC1 1.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		GAACAATGTTATGTTGGGGAT	0.393													34	45	---	---	---	---	PASS
FAM190A	401145	broad.mit.edu	37	4	91389384	91389384	+	Splice_Site	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:91389384G>T	uc003hsv.3	+	5	1944	c.1604_splice	c.e5-1	p.V535_splice	FAM190A_uc010ikv.2_Splice_Site|FAM190A_uc003hsw.2_Splice_Site_p.V535_splice	NM_001145065	NP_001138537	Q9C0I3	F190A_HUMAN	KIAA1680 protein isoform 1											large_intestine(1)|ovary(1)	2						TTTTTGAACAGTTTGCCGGGA	0.363													14	23	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110864470	110864470	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110864470G>A	uc003hzy.3	+	3	840	c.388G>A	c.(388-390)GTT>ATT	p.V130I	EGF_uc011cfu.1_Missense_Mutation_p.V130I|EGF_uc011cfv.1_Missense_Mutation_p.V130I	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	130	LDL-receptor class B 2.|Extracellular (Potential).				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	AAATGAAGAAGTTATTTGGTC	0.284													50	69	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123150382	123150382	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123150382C>T	uc003ieh.2	+	23	3074	c.3029C>T	c.(3028-3030)GCT>GTT	p.A1010V	KIAA1109_uc003iei.1_Missense_Mutation_p.A763V|KIAA1109_uc010ins.1_Missense_Mutation_p.A353V	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	1010					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CATGGTTGTGCTACAAATATA	0.348													71	81	---	---	---	---	PASS
ADAD1	132612	broad.mit.edu	37	4	123329103	123329103	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123329103C>T	uc003ieo.2	+	8	997	c.765C>T	c.(763-765)TAC>TAT	p.Y255Y	ADAD1_uc003iep.2_Silent_p.Y255Y|ADAD1_uc003ieq.2_Silent_p.Y237Y	NM_139243	NP_640336	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1	255	A to I editase.				multicellular organismal development|RNA processing	nucleus	adenosine deaminase activity|double-stranded RNA binding				0						CAGGTGAATACAATTACAGCC	0.408													38	51	---	---	---	---	PASS
NR3C2	4306	broad.mit.edu	37	4	149357300	149357300	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149357300G>A	uc003ilj.3	-	2	1047	c.713C>T	c.(712-714)TCC>TTC	p.S238F	NR3C2_uc003ilk.3_Missense_Mutation_p.S238F|NR3C2_uc010iph.2_RNA	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	238	Modulating.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	AACATTAGGGGAGCATGTCAG	0.537													32	42	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158262492	158262492	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158262492T>G	uc003ipm.3	+	12	2380	c.1921T>G	c.(1921-1923)TTA>GTA	p.L641V	GRIA2_uc011cit.1_Missense_Mutation_p.L594V|GRIA2_uc003ipl.3_Missense_Mutation_p.L641V|GRIA2_uc003ipk.3_Missense_Mutation_p.L594V|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	641	Helical; (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	CACGGCTAACTTAGCTGCCTT	0.448													4	212	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164394289	164394289	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164394289C>T	uc003iqp.3	-	1	759	c.598G>A	c.(598-600)GCA>ACA	p.A200T		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	200						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TAGATGTCTGCGCCATGCTCA	0.522													29	90	---	---	---	---	PASS
KIAA0947	23379	broad.mit.edu	37	5	5473764	5473764	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5473764G>C	uc003jdm.3	+	16	6538	c.6316G>C	c.(6316-6318)GGT>CGT	p.G2106R		NM_015325	NP_056140	Q9Y2F5	K0947_HUMAN	hypothetical protein LOC23379	2106										ovary(1)|central_nervous_system(1)	2						TGAAAAATTTGGTGAAGACCT	0.398													40	44	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24487930	24487930	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24487930C>T	uc003jgr.1	-	12	2541	c.2209G>A	c.(2209-2211)GCC>ACC	p.A737T	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	737	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		CCTTCATAGGCATAGGTTGCA	0.473										HNSCC(23;0.051)			75	203	---	---	---	---	PASS
RNASEN	29102	broad.mit.edu	37	5	31508727	31508727	+	Splice_Site	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31508727C>A	uc003jhg.2	-	9	1946	c.1587_splice	c.e9+1	p.Q529_splice	RNASEN_uc003jhh.2_Splice_Site_p.Q492_splice|RNASEN_uc003jhi.2_Splice_Site_p.Q492_splice|RNASEN_uc010iui.1_Splice_Site_p.Q452_splice	NM_013235	NP_037367	Q9NRR4	RNC_HUMAN	ribonuclease III, nuclear isoform 1						gene silencing by RNA|ribosome biogenesis|RNA processing	nucleolus|nucleoplasm	double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity				0						AAAACACGCACCTGGCCTGGA	0.448													65	128	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576935	33576935	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576935G>T	uc003jia.1	-	19	3359	c.3196C>A	c.(3196-3198)CAG>AAG	p.Q1066K	ADAMTS12_uc010iuq.1_Missense_Mutation_p.Q981K	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1066	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TCTTGCCACTGTTTCCCACCC	0.547										HNSCC(64;0.19)			60	92	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35875689	35875689	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35875689A>T	uc003jjs.2	+	7	965	c.876A>T	c.(874-876)AAA>AAT	p.K292N	IL7R_uc011coo.1_Missense_Mutation_p.K261M|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	292	Cytoplasmic (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			AACCAAGAAAAGTGAGTGTTT	0.413													23	86	---	---	---	---	PASS
LIFR	3977	broad.mit.edu	37	5	38489285	38489285	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38489285A>T	uc010ive.1	-	16	2562	c.2230T>A	c.(2230-2232)TGG>AGG	p.W744R	LIFR_uc003jli.2_Missense_Mutation_p.W744R	NM_001127671	NP_001121143	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor	744	Fibronectin type-III 6.|Extracellular (Potential).				positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)					ATGTCTTCCCATTTTACTAAT	0.363			T	PLAG1	salivary adenoma								16	105	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45267186	45267186	+	Intron	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45267186A>T	uc003jok.2	-							NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic							integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AGAAAACTAGAGTACCTATTC	0.358													74	104	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50683495	50683495	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50683495A>T	uc003jor.2	+	3	938	c.390A>T	c.(388-390)CGA>CGT	p.R130R		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	130	LIM zinc-binding 2.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TCTTCTGCCGAGCAGACCACG	0.632													28	33	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63256748	63256748	+	Missense_Mutation	SNP	C	T	T	rs34158987		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63256748C>T	uc011cqt.1	-	1	799	c.799G>A	c.(799-801)GTG>ATG	p.V267M		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	267	Cytoplasmic (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	TTGCTCTCCACGCCCAGCCTC	0.667													5	100	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76249897	76249897	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76249897C>T	uc003ker.2	+	3	499	c.219C>T	c.(217-219)ACC>ACT	p.T73T	CRHBP_uc010izx.2_Silent_p.T73T	NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein	73					female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TCACCTTCACCGCCGACCGGC	0.662													28	29	---	---	---	---	PASS
VCAN	1462	broad.mit.edu	37	5	82815811	82815811	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82815811T>C	uc003kii.3	+	7	2042	c.1686T>C	c.(1684-1686)CTT>CTC	p.L562L	VCAN_uc003kij.3_Intron|VCAN_uc010jau.2_Silent_p.L562L|VCAN_uc003kik.3_Intron	NM_004385	NP_004376	P13611	CSPG2_HUMAN	versican isoform 1 precursor	562	GAG-alpha (glucosaminoglycan attachment domain).				cell adhesion|cell recognition|glial cell migration	extracellular space|proteinaceous extracellular matrix	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(7)|skin(6)|lung(2)|central_nervous_system(1)	16		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)		ACAGAACACTTACAGTTGGAT	0.413													9	159	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90136422	90136422	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90136422C>T	uc003kju.2	+	78	16735	c.16639C>T	c.(16639-16641)CGT>TGT	p.R5547C	GPR98_uc003kjt.2_Missense_Mutation_p.R3253C|GPR98_uc003kjw.2_Missense_Mutation_p.R1208C	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	5547	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity	p.R5547H(1)		ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		AACAATTGGTCGTACCATCAT	0.388													26	72	---	---	---	---	PASS
AQPEP	206338	broad.mit.edu	37	5	115339035	115339035	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115339035A>T	uc003kro.2	+	12	2159	c.1995A>T	c.(1993-1995)TTA>TTT	p.L665F	AQPEP_uc003krp.2_RNA|AQPEP_uc003krq.2_RNA|AQPEP_uc003krr.2_RNA|AQPEP_uc003krs.2_RNA	NM_173800	NP_776161	Q6Q4G3	AMPQ_HUMAN	laeverin	665	Lumenal (Potential).				proteolysis	integral to membrane	metallopeptidase activity|zinc ion binding				0						ATGATAAATTAGGTTGGAAGA	0.289													68	93	---	---	---	---	PASS
DDX46	9879	broad.mit.edu	37	5	134121181	134121181	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134121181C>G	uc003kzw.2	+	11	1537	c.1369C>G	c.(1369-1371)CTG>GTG	p.L457V	DDX46_uc003kzv.1_RNA	NM_014829	NP_055644	Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	457	Helicase ATP-binding.				mRNA processing|RNA splicing	Cajal body|nuclear speck	ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AACTCGAGAACTGGCTTTACA	0.403													7	154	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515253	140515253	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515253A>G	uc003liq.2	+	1	454	c.237A>G	c.(235-237)ATA>ATG	p.I79M		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	79	Extracellular (Potential).|Cadherin 1.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGCTTGATATAAAGACCGGCA	0.498													53	79	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140711782	140711782	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140711782A>C	uc003lji.1	+	1	1531	c.1531A>C	c.(1531-1533)ACT>CCT	p.T511P	PCDHGA1_uc011dan.1_Missense_Mutation_p.T511P	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	511	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACTCCGACACTGGGGTCCT	0.557													113	106	---	---	---	---	PASS
PCDHGB1	56104	broad.mit.edu	37	5	140731777	140731777	+	Silent	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140731777C>G	uc003ljo.1	+	1	1950	c.1950C>G	c.(1948-1950)CTC>CTG	p.L650L	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGA4_uc003ljq.1_5'Flank|PCDHGB1_uc011daq.1_Silent_p.L650L|PCDHGA4_uc003ljp.1_5'Flank	NM_018922	NP_061745	Q9Y5G3	PCDGD_HUMAN	protocadherin gamma subfamily B, 1 isoform 1	650	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCCGCCACTCTCCGCCACCG	0.687													33	42	---	---	---	---	PASS
ATP10B	23120	broad.mit.edu	37	5	160059348	160059348	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:160059348G>A	uc003lym.1	-	13	2255	c.1408C>T	c.(1408-1410)CTG>TTG	p.L470L	ATP10B_uc003lyn.2_Silent_p.L28L	NM_025153	NP_079429	O94823	AT10B_HUMAN	ATPase, class V, type 10B	470	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TCTGAGTCCAGCTCCTTTGGG	0.512													50	69	---	---	---	---	PASS
CCDC99	54908	broad.mit.edu	37	5	169018201	169018201	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169018201A>T	uc003mae.3	+	3	588	c.309A>T	c.(307-309)GGA>GGT	p.G103G	CCDC99_uc010jjj.2_Silent_p.G32G|CCDC99_uc011deq.1_5'UTR|CCDC99_uc010jjk.2_5'UTR	NM_017785	NP_060255	Q96EA4	SPDLY_HUMAN	coiled-coil domain containing 99	103	Potential.				cell division|establishment of mitotic spindle orientation|mitotic metaphase plate congression|mitotic prometaphase|protein localization to kinetochore	condensed chromosome outer kinetochore|cytosol|microtubule organizing center|nucleus|spindle pole	kinetochore binding|protein binding			ovary(1)|liver(1)	2	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GAAGCCATGGACAGGAAGTGA	0.358													37	42	---	---	---	---	PASS
STC2	8614	broad.mit.edu	37	5	172744980	172744980	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172744980C>T	uc003mco.1	-	4	2089	c.779G>A	c.(778-780)GGT>GAT	p.G260D	STC2_uc003mcn.1_Missense_Mutation_p.G175D	NM_003714	NP_003705	O76061	STC2_HUMAN	stanniocalcin 2 precursor	260					cell surface receptor linked signaling pathway|cell-cell signaling	extracellular region	hormone activity			skin(2)|ovary(1)	3	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			ACCTCGCTCACCCTTGGCACC	0.657													25	78	---	---	---	---	PASS
CPEB4	80315	broad.mit.edu	37	5	173317599	173317599	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:173317599A>G	uc003mcs.3	+	1	2269	c.863A>G	c.(862-864)TAC>TGC	p.Y288C	CPEB4_uc010jju.1_Missense_Mutation_p.Y288C|CPEB4_uc010jjv.2_Missense_Mutation_p.Y288C|CPEB4_uc011dfg.1_Missense_Mutation_p.Y288C|CPEB4_uc003mct.3_5'Flank|CPEB4_uc003mcu.3_5'Flank	NM_030627	NP_085130	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding	288							nucleotide binding|RNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGGAGCAGCTACCAGAGTCCG	0.582													120	170	---	---	---	---	PASS
ZNF354B	117608	broad.mit.edu	37	5	178310363	178310363	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178310363G>A	uc003mjl.2	+	5	1136	c.910G>A	c.(910-912)GGT>AGT	p.G304S	ZNF354B_uc003mjm.2_Missense_Mutation_p.G304S	NM_058230	NP_478137	Q96LW1	Z354B_HUMAN	zinc finger protein 354B	304	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_cancers(89;0.000639)|all_epithelial(37;0.000109)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAAAGAATGTGGTAAATCCTT	0.393													48	47	---	---	---	---	PASS
PHACTR1	221692	broad.mit.edu	37	6	13182901	13182901	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13182901A>T	uc010jpc.2	+	7	979	c.647A>T	c.(646-648)GAC>GTC	p.D216V	PHACTR1_uc011dir.1_Missense_Mutation_p.D216V|PHACTR1_uc003nag.1_Missense_Mutation_p.D216V|PHACTR1_uc003nah.1_Missense_Mutation_p.D216V	NM_030948	NP_112210	Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	216						cell junction|cytoplasm|synapse	actin binding|protein phosphatase inhibitor activity				0	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			CAACCGTCAGACATCATGGAT	0.602													58	91	---	---	---	---	PASS
RANBP9	10048	broad.mit.edu	37	6	13632623	13632623	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:13632623A>T	uc003nbb.2	-	12	1985	c.1926T>A	c.(1924-1926)ACT>ACA	p.T642T	RANBP9_uc003nba.2_Silent_p.T301T	NM_005493	NP_005484	Q96S59	RANB9_HUMAN	RAN binding protein 9	642	Interaction with FMR1.				axon guidance|microtubule nucleation|protein complex assembly	cytosol|microtubule associated complex|nucleus	Ran GTPase binding			lung(1)|skin(1)	2	Breast(50;0.00669)|Ovarian(93;0.0634)	all_hematologic(90;0.117)	Epithelial(50;0.223)			TTTTGTTTGCAGTGTTCTTGC	0.388													93	109	---	---	---	---	PASS
HIST1H2AB	8335	broad.mit.edu	37	6	26033762	26033762	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26033762C>A	uc003nft.1	-	1	35	c.35G>T	c.(34-36)CGC>CTC	p.R12L	HIST1H3B_uc003nfs.1_5'Flank	NM_003513	NP_003504	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	12					nucleosome assembly	nucleosome|nucleus	DNA binding				0						AGCCTTGGCGCGAGCTTTACC	0.532													40	55	---	---	---	---	PASS
HIST1H2AB	8335	broad.mit.edu	37	6	26033764	26033764	+	Silent	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26033764A>C	uc003nft.1	-	1	33	c.33T>G	c.(31-33)GCT>GCG	p.A11A	HIST1H3B_uc003nfs.1_5'Flank	NM_003513	NP_003504	P04908	H2A1B_HUMAN	histone cluster 1, H2ab	11					nucleosome assembly	nucleosome|nucleus	DNA binding				0						CCTTGGCGCGAGCTTTACCGC	0.527													40	55	---	---	---	---	PASS
BTN2A2	10385	broad.mit.edu	37	6	26392893	26392893	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26392893G>A	uc003nhq.2	+	8	1356	c.1270G>A	c.(1270-1272)GGA>AGA	p.G424R	BTN2A2_uc011dkg.1_3'UTR|BTN2A2_uc003nhr.2_Missense_Mutation_p.G308R|BTN2A2_uc011dkh.1_Missense_Mutation_p.G214R|BTN2A2_uc003nhs.2_Intron|BTN2A2_uc003nht.2_Missense_Mutation_p.G424R|BTN2A2_uc011dki.1_3'UTR	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	424	B30.2/SPRY.|Cytoplasmic (Potential).				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						GGAGATGTTTGGAAACCAATA	0.562													32	30	---	---	---	---	PASS
ZNF323	64288	broad.mit.edu	37	6	28294603	28294603	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28294603C>G	uc003nla.2	-	4	961	c.561G>C	c.(559-561)GAG>GAC	p.E187D	ZNF323_uc003nld.2_Missense_Mutation_p.E187D|ZNF323_uc010jra.2_Missense_Mutation_p.E187D|ZNF323_uc003nlb.2_Missense_Mutation_p.E28D|ZNF323_uc010jrb.2_Missense_Mutation_p.E28D|ZNF323_uc003nlc.2_Missense_Mutation_p.E187D	NM_001135216	NP_001128688	Q96LW9	ZN323_HUMAN	zinc finger protein 323	187					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2						TTGATGCCAACTCCTGGTTCT	0.343													47	53	---	---	---	---	PASS
LTA	4049	broad.mit.edu	37	6	31540819	31540819	+	Intron	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31540819C>A	uc011dnu.1	+						LTA_uc003nue.1_Intron|LTA_uc003nuf.2_Intron|LTA_uc003nuh.2_Intron|LTA_uc003nug.2_Intron|LTA_uc010jsr.2_Intron|TNF_uc003nui.2_5'Flank	NM_001159740	NP_001153212	P01374	TNFB_HUMAN	lymphotoxin alpha precursor						cell-cell signaling|induction of apoptosis|signal transduction	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0					Etanercept(DB00005)	TGGTAAACATCCACCTGACCT	0.592													13	19	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43181259	43181259	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43181259G>T	uc003ouk.2	+	28	5517	c.5442G>T	c.(5440-5442)GGG>GGT	p.G1814G	CUL9_uc003oul.2_Silent_p.G1814G|CUL9_uc010jyk.2_Silent_p.G966G|CUL9_uc003oun.2_5'Flank	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	1814					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						TCACCTCAGGGAATGGCCCTT	0.632													4	76	---	---	---	---	PASS
PRSS35	167681	broad.mit.edu	37	6	84233821	84233821	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84233821G>T	uc003pjz.2	+	2	824	c.661G>T	c.(661-663)GAG>TAG	p.E221*	PRSS35_uc010kbm.2_Nonsense_Mutation_p.E221*	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	221	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		GGGTACCAGAGAGCATCTGCG	0.532													19	36	---	---	---	---	PASS
EPHA7	2045	broad.mit.edu	37	6	94066583	94066583	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:94066583C>A	uc003poe.2	-	5	1417	c.1176G>T	c.(1174-1176)CAG>CAT	p.Q392H	EPHA7_uc003pof.2_Missense_Mutation_p.Q392H|EPHA7_uc011eac.1_Missense_Mutation_p.Q392H	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor	392	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		CTAATCCAGTCTGCTGGGGCA	0.458													31	29	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100868658	100868658	+	Intron	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100868658G>A	uc003pqj.3	-						SIM1_uc010kcu.2_Intron	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AAACAGCAATGCACTTACCTG	0.418													45	50	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101095237	101095237	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101095237C>G	uc003pqk.2	-	21	3672	c.3343G>C	c.(3343-3345)GTC>CTC	p.V1115L	ASCC3_uc011eai.1_Missense_Mutation_p.V1017L	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	1115	SEC63 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		TTGTCAATGACTTTACTAAGA	0.408													48	54	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105177640	105177640	+	Intron	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105177640C>T	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron|HACE1_uc010kcx.1_Intron|HACE1_uc003pqt.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		CATGTTGATGCTTTAAAAGAA	0.338													5	62	---	---	---	---	PASS
OSTM1	28962	broad.mit.edu	37	6	108395464	108395464	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108395464C>A	uc003psd.2	-	1	478	c.392G>T	c.(391-393)CGA>CTA	p.R131L		NM_014028	NP_054747	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	131	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		CCCCGCGGCTCGGCTGATGTT	0.602													17	21	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121427234	121427234	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121427234G>C	uc003pyo.1	-	30	3468	c.3400C>G	c.(3400-3402)CTA>GTA	p.L1134V		NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	1134	Rab-GAP TBC.				multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		GCCTTCAGTAGCATTTCAATA	0.388													6	246	---	---	---	---	PASS
C6orf170	221322	broad.mit.edu	37	6	121625726	121625726	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121625726G>C	uc003pyo.1	-	7	883	c.815C>G	c.(814-816)CCT>CGT	p.P272R	C6orf170_uc003pyq.1_RNA	NM_152730	NP_689943	Q96NH3	BROMI_HUMAN	hypothetical protein LOC221322	272					multicellular organismal development	cilium|cytoplasm	Rab GTPase activator activity			central_nervous_system(2)|ovary(1)	3				GBM - Glioblastoma multiforme(226;0.00521)		TGAAAGAGTAGGAATATGATT	0.289													40	52	---	---	---	---	PASS
STL	7955	broad.mit.edu	37	6	125231797	125231797	+	RNA	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:125231797A>G	uc003pzq.2	-	7		c.2937T>C				NR_026876				Homo sapiens mRNA; cDNA DKFZp451I132 (from clone DKFZp451I132).												0						ctagttagagaagcagagatg	0.164			T	ETV6	B-ALL								10	18	---	---	---	---	PASS
INTS1	26173	broad.mit.edu	37	7	1513289	1513289	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1513289T>G	uc003skn.2	-	42	5971	c.5870A>C	c.(5869-5871)AAC>ACC	p.N1957T	INTS1_uc003skm.1_Missense_Mutation_p.N94T	NM_001080453	NP_001073922	Q8N201	INT1_HUMAN	integrator complex subunit 1	1957					snRNA processing	integral to membrane|integrator complex|nuclear membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CACAAACTTGTTGATGAAGGC	0.567											OREG0017827	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	22	---	---	---	---	PASS
TMEM184A	202915	broad.mit.edu	37	7	1589575	1589575	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1589575G>C	uc003skv.3	-	6	876	c.559C>G	c.(559-561)CTG>GTG	p.L187V	TMEM184A_uc003skt.3_5'UTR|TMEM184A_uc003skw.3_5'UTR	NM_001097620	NP_001091089	Q6ZMB5	T184A_HUMAN	transmembrane protein 184A	187	Helical; (Potential).					integral to membrane					0		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;5.88e-15)		CAGAACTGCAGAGTGGCCTGG	0.657													43	50	---	---	---	---	PASS
ICA1	3382	broad.mit.edu	37	7	8198194	8198194	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8198194C>G	uc003srm.2	-	7	735	c.668G>C	c.(667-669)AGA>ACA	p.R223T	ICA1_uc010ktr.2_Missense_Mutation_p.R223T|ICA1_uc003srl.2_Missense_Mutation_p.R211T|ICA1_uc003srn.3_Missense_Mutation_p.R149T|ICA1_uc003srp.3_Missense_Mutation_p.R222T|ICA1_uc010kts.2_RNA|ICA1_uc003srq.2_Missense_Mutation_p.R223T|ICA1_uc003srr.2_Missense_Mutation_p.R222T|ICA1_uc003sro.3_Missense_Mutation_p.R223T|ICA1_uc011jxg.1_Missense_Mutation_p.R223T|ICA1_uc003srs.1_Missense_Mutation_p.R223T	NM_022307	NP_071682	Q05084	ICA69_HUMAN	islet cell autoantigen 1	223	AH.				neurotransmitter transport	cell junction|cytosol|Golgi membrane|nucleus|secretory granule membrane|synaptic vesicle membrane|transport vesicle membrane				central_nervous_system(1)	1		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GAGATTGCATCTGCTCGCTCC	0.358													48	158	---	---	---	---	PASS
TWISTNB	221830	broad.mit.edu	37	7	19748537	19748537	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:19748537C>A	uc003sup.1	-	1	124	c.103G>T	c.(103-105)GCC>TCC	p.A35S		NM_001002926	NP_001002926	Q3B726	RPA43_HUMAN	TWIST neighbor	35						microtubule cytoskeleton|nucleolus	DNA-directed RNA polymerase activity			ovary(1)	1						CAAGCAGCGGCATAAGTCGGC	0.652											OREG0017879	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	55	---	---	---	---	PASS
NOD1	10392	broad.mit.edu	37	7	30496374	30496374	+	Missense_Mutation	SNP	G	A	A	rs6947097	byFrequency	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30496374G>A	uc003tav.2	-	4	687	c.164C>T	c.(163-165)GCG>GTG	p.A55V	NOD1_uc010kvs.2_Missense_Mutation_p.A55V|NOD1_uc003tax.2_RNA|NOD1_uc003tay.2_RNA|NOD1_uc010kvt.2_RNA|NOD1_uc010kvu.2_RNA	NM_006092	NP_006083	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain	55	CARD.				activation of MAPK activity|detection of bacterium|induction of apoptosis|inflammatory response|innate immune response|interleukin-8 biosynthetic process|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|positive regulation of dendritic cell antigen processing and presentation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein oligomerization|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	basolateral plasma membrane|cytosol	ATP binding|CARD domain binding|caspase activator activity|peptidoglycan binding|protein homodimerization activity			ovary(1)|skin(1)	2						CACAATCTCCGCATCTTCGGC	0.567													80	72	---	---	---	---	PASS
ADCYAP1R1	117	broad.mit.edu	37	7	31123762	31123762	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31123762G>A	uc003tca.1	+	7	558	c.335G>A	c.(334-336)GGA>GAA	p.G112E	ADCYAP1R1_uc003tcb.1_Missense_Mutation_p.G91E|ADCYAP1R1_uc003tcc.1_Missense_Mutation_p.G112E|ADCYAP1R1_uc003tcd.1_Missense_Mutation_p.G112E|ADCYAP1R1_uc003tce.1_Missense_Mutation_p.G112E|ADCYAP1R1_uc003tcf.1_5'Flank	NM_001118	NP_001109	P41586	PACR_HUMAN	adenylate cyclase activating polypeptide 1	112	Extracellular (Potential).				activation of adenylate cyclase activity|cell differentiation|nerve growth factor receptor signaling pathway|spermatogenesis	integral to plasma membrane	vasoactive intestinal polypeptide receptor activity			ovary(1)	1						GCAGACATGGGAGTGGTGAGC	0.483													21	82	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38475876	38475876	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38475876G>C	uc003tgu.2	-	12	1199	c.1130C>G	c.(1129-1131)TCT>TGT	p.S377C	AMPH_uc003tgv.2_Missense_Mutation_p.S377C|AMPH_uc003tgt.2_Missense_Mutation_p.S130C	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	377					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TGATACCTGAGACATGGGTGA	0.463													27	114	---	---	---	---	PASS
VPS41	27072	broad.mit.edu	37	7	38908827	38908827	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38908827C>A	uc003tgy.2	-	3	113	c.87G>T	c.(85-87)AAG>AAT	p.K29N	VPS41_uc003tgz.2_Missense_Mutation_p.K29N|VPS41_uc010kxn.2_Missense_Mutation_p.K29N	NM_014396	NP_055211	P49754	VPS41_HUMAN	vacuolar protein sorting 41 isoform 1	29					Golgi vesicle transport|intracellular protein transport|vesicle-mediated transport	cytosol|Golgi-associated vesicle|HOPS complex|membrane fraction	zinc ion binding			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4						CATACTTCAGCTTGGGTTCCT	0.418													87	146	---	---	---	---	PASS
H2AFV	94239	broad.mit.edu	37	7	44875239	44875239	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44875239T>C	uc003tma.2	-	4	369	c.214A>G	c.(214-216)AAT>GAT	p.N72D	H2AFV_uc003tlz.2_Missense_Mutation_p.N72D|H2AFV_uc011kca.1_5'Flank|H2AFV_uc003tmb.2_Missense_Mutation_p.N34D|H2AFV_uc003tmc.2_Intron|H2AFV_uc003tmd.2_Missense_Mutation_p.N46D	NM_012412	NP_036544	Q71UI9	H2AV_HUMAN	H2A histone family, member V isoform 1	72					nucleosome assembly	nucleosome|nucleus	DNA binding				0						TTAGAAGCATTACCTGCCAGC	0.433													12	94	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47454736	47454736	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47454736T>C	uc003tnv.2	-	11	909	c.542A>G	c.(541-543)CAT>CGT	p.H181R	TNS3_uc003tnw.2_Missense_Mutation_p.H181R|TNS3_uc010kyo.1_Missense_Mutation_p.H181R	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	181	C2 tensin-type.					focal adhesion	protein binding			ovary(4)	4						GATGACAAAATGCAGGAACAG	0.567													17	66	---	---	---	---	PASS
COBL	23242	broad.mit.edu	37	7	51111274	51111274	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51111274G>A	uc003tpr.3	-	8	1397	c.1212C>T	c.(1210-1212)ACC>ACT	p.T404T	COBL_uc003tps.2_Silent_p.T461T|COBL_uc011kcl.1_Silent_p.T404T|COBL_uc010kzc.2_Silent_p.T404T|COBL_uc003tpp.3_Silent_p.T190T|COBL_uc003tpq.3_Silent_p.T345T	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog	404										skin(3)|ovary(2)	5	Glioma(55;0.08)					CTGAGTCCTCGGTCGTGTCCT	0.602													10	127	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57194380	57194380	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57194380C>A	uc010kzo.2	-	3	356	c.85G>T	c.(85-87)GAA>TAA	p.E29*		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	29	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding	p.E29K(1)		ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			CATTGCCATTCCTCCAGAGAG	0.438													41	124	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64166913	64166913	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64166913G>T	uc003ttd.2	+	7	1017	c.231G>T	c.(229-231)CAG>CAT	p.Q77H	ZNF107_uc003tte.2_Missense_Mutation_p.Q77H	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	77	C2H2-type 1; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				AAATATTCCAGTGTAATAAAT	0.333													3	97	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82784768	82784768	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784768C>A	uc003uhx.2	-	2	1478	c.1189G>T	c.(1189-1191)GTT>TTT	p.V397F	PCLO_uc003uhv.2_Missense_Mutation_p.V397F	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GTCTTTCCAACTCCAGGAGGC	0.587													109	124	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87170789	87170789	+	Intron	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87170789A>T	uc003uiz.1	-						ABCB1_uc011khc.1_Intron	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1						G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	ACCTGTGAGAAAACATTTAAA	0.378													71	103	---	---	---	---	PASS
MGC26647	219557	broad.mit.edu	37	7	88424072	88424072	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88424072C>A	uc003ujv.2	-	2	367	c.185G>T	c.(184-186)AGA>ATA	p.R62I	ZNF804B_uc011khi.1_Intron	NM_152706	NP_689919	Q8TBZ9	CG062_HUMAN	hypothetical protein LOC219557	62											0	Esophageal squamous(14;0.00802)|all_hematologic(106;0.109)|Lung NSC(181;0.168)|all_lung(186;0.169)		STAD - Stomach adenocarcinoma(171;0.229)			AACATCTTTTCTTTCTACATT	0.388													111	165	---	---	---	---	PASS
SLC26A3	1811	broad.mit.edu	37	7	107430025	107430025	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107430025T>A	uc003ver.2	-	6	890	c.679A>T	c.(679-681)AAA>TAA	p.K227*	SLC26A3_uc003ves.2_Nonsense_Mutation_p.K192*	NM_000111	NP_000102	P40879	S26A3_HUMAN	solute carrier family 26, member 3	227					excretion	integral to membrane|membrane fraction	inorganic anion exchanger activity|secondary active sulfate transmembrane transporter activity|sequence-specific DNA binding transcription factor activity|transcription cofactor activity			ovary(3)|skin(1)	4						AAAATGAATTTGAGTTGGGAA	0.388													25	84	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113519605	113519605	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113519605A>G	uc010ljy.1	-	4	1573	c.1542T>C	c.(1540-1542)GGT>GGC	p.G514G		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	514					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						CATCATCCTTACCATTGCCAT	0.338													36	104	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915681	119915681	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915681C>T	uc003vjj.1	+	1	1960	c.995C>T	c.(994-996)ACC>ATC	p.T332I		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	332	Helical; Name=Segment S5; (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					TTCTCGCTCACCATGGCTATC	0.507													89	105	---	---	---	---	PASS
HYAL4	23553	broad.mit.edu	37	7	123517197	123517197	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:123517197C>T	uc003vlc.2	+	5	2072	c.1434C>T	c.(1432-1434)AGC>AGT	p.S478S	HYAL4_uc011knz.1_3'UTR	NM_012269	NP_036401	Q2M3T9	HYAL4_HUMAN	hyaluronoglucosaminidase 4	478	Cytoplasmic (Potential).				fusion of sperm to egg plasma membrane|glycosaminoglycan catabolic process	integral to membrane	hyalurononglucosaminidase activity			skin(1)	1						GTTATCGAAGCATTCAGTTGT	0.383													81	153	---	---	---	---	PASS
LRGUK	136332	broad.mit.edu	37	7	133876430	133876430	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133876430C>A	uc003vrm.1	+	12	1374	c.1358C>A	c.(1357-1359)CCT>CAT	p.P453H		NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain	453	Guanylate kinase-like.						ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						ACAAGACCACCTTACTTTGGA	0.338													4	215	---	---	---	---	PASS
SLC37A3	84255	broad.mit.edu	37	7	140051150	140051150	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140051150T>C	uc003vvo.2	-	9	971	c.805A>G	c.(805-807)ATC>GTC	p.I269V	SLC37A3_uc003vvp.2_Missense_Mutation_p.I269V|SLC37A3_uc010lnh.2_Missense_Mutation_p.I269V|SLC37A3_uc011kqz.1_RNA|SLC37A3_uc011kra.1_3'UTR|SLC37A3_uc011krb.1_3'UTR	NM_207113	NP_996996	Q8NCC5	SPX3_HUMAN	solute carrier family 37 (glycerol-3-phosphate	269					carbohydrate transport|transmembrane transport	integral to membrane				ovary(3)	3	Melanoma(164;0.0142)					TCATCTTGGATTGAATAATTC	0.438													101	122	---	---	---	---	PASS
ZNF786	136051	broad.mit.edu	37	7	148768904	148768904	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148768904C>A	uc003wfh.2	-	4	1097	c.960G>T	c.(958-960)CGG>CGT	p.R320R	ZNF786_uc011kuk.1_Silent_p.R283R|ZNF786_uc003wfi.2_Silent_p.R234R	NM_152411	NP_689624	Q8N393	ZN786_HUMAN	zinc finger protein 786	320					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(3)|skin(1)	4	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CCGGCCCCTCCCGGCTGTGCT	0.721													6	15	---	---	---	---	PASS
ASB10	136371	broad.mit.edu	37	7	150873210	150873210	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150873210C>A	uc003wjm.1	-	5	1654	c.1528G>T	c.(1528-1530)GTG>TTG	p.V510L	ASB10_uc003wjl.1_Missense_Mutation_p.V472L|ASB10_uc003wjn.1_Missense_Mutation_p.V450L	NM_001142459	NP_001135931	Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box-containing 10	465					intracellular signal transduction						0			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TAGTAGAGCACGCCCTCAAAA	0.672													20	27	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154561232	154561232	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154561232C>A	uc003wlk.2	+	9	1118	c.989C>A	c.(988-990)ACT>AAT	p.T330N	DPP6_uc003wli.2_Missense_Mutation_p.T266N|DPP6_uc003wlm.2_Missense_Mutation_p.T268N|DPP6_uc011kvq.1_Missense_Mutation_p.T223N	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	330	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			GAGCTCCCAACTTACACCGGC	0.527													49	32	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154672604	154672604	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154672604G>T	uc003wlk.2	+	21	2214	c.2085G>T	c.(2083-2085)ATG>ATT	p.M695I	DPP6_uc003wli.2_Missense_Mutation_p.M631I|DPP6_uc003wlm.2_Missense_Mutation_p.M633I|DPP6_uc011kvq.1_Missense_Mutation_p.M588I	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	695	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ACAGGACGATGCTGAAGGAGC	0.562													16	117	---	---	---	---	PASS
TNKS	8658	broad.mit.edu	37	8	9605566	9605566	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9605566C>T	uc003wss.2	+	18	2681	c.2676C>T	c.(2674-2676)TAC>TAT	p.Y892Y	TNKS_uc011kww.1_Silent_p.Y655Y|TNKS_uc010lrt.1_RNA	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related	892	ANK 14.				mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		TGATAAAATACAACACGTGTG	0.438													56	87	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10470776	10470776	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10470776G>T	uc003wtc.2	-	4	1061	c.832C>A	c.(832-834)CCT>ACT	p.P278T		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	278					intracellular signal transduction					ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		CTAGGACCAGGCCTTTCTGGC	0.667													47	56	---	---	---	---	PASS
PNOC	5368	broad.mit.edu	37	8	28196728	28196728	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28196728C>G	uc010lva.2	+	3	506	c.298C>G	c.(298-300)CGA>GGA	p.R100G	PNOC_uc003xgp.2_Missense_Mutation_p.R100G|PNOC_uc011lau.1_Missense_Mutation_p.R36G	NM_006228	NP_006219	Q13519	PNOC_HUMAN	prepronociceptin precursor	100					neuropeptide signaling pathway|sensory perception|synaptic transmission	extracellular region	neuropeptide hormone activity|opioid peptide activity			central_nervous_system(1)	1		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)		GCGAATGCCCCGAGTCCGGAG	0.632													29	30	---	---	---	---	PASS
PNOC	5368	broad.mit.edu	37	8	28196729	28196729	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28196729G>A	uc010lva.2	+	3	507	c.299G>A	c.(298-300)CGA>CAA	p.R100Q	PNOC_uc003xgp.2_Missense_Mutation_p.R100Q|PNOC_uc011lau.1_Missense_Mutation_p.R36Q	NM_006228	NP_006219	Q13519	PNOC_HUMAN	prepronociceptin precursor	100					neuropeptide signaling pathway|sensory perception|synaptic transmission	extracellular region	neuropeptide hormone activity|opioid peptide activity			central_nervous_system(1)	1		Ovarian(32;0.000953)		KIRC - Kidney renal clear cell carcinoma(542;0.104)|Kidney(114;0.125)|Colorectal(74;0.145)|BRCA - Breast invasive adenocarcinoma(99;0.245)		CGAATGCCCCGAGTCCGGAGC	0.632													31	30	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42612075	42612075	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42612075T>C	uc003xpj.2	-	4	416	c.370A>G	c.(370-372)AAC>GAC	p.N124D	CHRNA6_uc011lcw.1_Missense_Mutation_p.N109D	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	124	Extracellular.					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCATACTTGTTATAGAGAACA	0.448													10	111	---	---	---	---	PASS
FNTA	2339	broad.mit.edu	37	8	42924730	42924730	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42924730A>T	uc003xps.2	+	4	482	c.434A>T	c.(433-435)CAG>CTG	p.Q145L	FNTA_uc003xpt.2_Missense_Mutation_p.Q54L|FNTA_uc003xpu.2_Missense_Mutation_p.Q78L|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	145	PFTA 1.				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			AAGTCACTTCAGAAGGATCTA	0.333													6	90	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51465633	51465633	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51465633C>A	uc010lxy.1	+	13	1075	c.704C>A	c.(703-705)GCT>GAT	p.A235D	SNTG1_uc003xqs.1_Missense_Mutation_p.A235D|SNTG1_uc010lxz.1_Missense_Mutation_p.A235D|SNTG1_uc011ldl.1_RNA	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1	235					cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				CAAGTCATTGCTGTGGATGGG	0.423													12	87	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52366272	52366272	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52366272C>A	uc003xqu.3	-	10	1157	c.1056G>T	c.(1054-1056)ATG>ATT	p.M352I		NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	352	Ig-like C2-type 2.				hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGCCTGTGGCCATACATTCCA	0.502													3	70	---	---	---	---	PASS
TRIM55	84675	broad.mit.edu	37	8	67040638	67040638	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67040638C>T	uc003xvv.2	+	2	494	c.268C>T	c.(268-270)CAT>TAT	p.H90Y	TRIM55_uc003xvu.2_Missense_Mutation_p.H90Y|TRIM55_uc003xvw.2_Missense_Mutation_p.H90Y|TRIM55_uc003xvx.2_Missense_Mutation_p.H90Y	NM_184085	NP_908973	Q9BYV6	TRI55_HUMAN	tripartite motif-containing 55 isoform 1	90						cytoplasm|microtubule|nucleus	signal transducer activity|zinc ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			TTTGGATAGACATGGGGTATA	0.507													49	200	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	68956792	68956792	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68956792G>T	uc003xxv.1	+	8	937	c.910G>T	c.(910-912)GTG>TTG	p.V304L	PREX2_uc003xxu.1_Missense_Mutation_p.V304L|PREX2_uc011lez.1_Missense_Mutation_p.V239L	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	304	PH.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						CAACACGGAGGTGATGGAAGT	0.408													29	77	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77767351	77767351	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77767351T>A	uc003yav.2	+	10	8446	c.8059T>A	c.(8059-8061)TAC>AAC	p.Y2687N	ZFHX4_uc003yau.1_Missense_Mutation_p.Y2732N|ZFHX4_uc003yaw.1_Missense_Mutation_p.Y2687N	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2687						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CTATTTTGATTACCCATCTTT	0.423										HNSCC(33;0.089)			12	38	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768456	77768456	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768456G>T	uc003yav.2	+	10	9551	c.9164G>T	c.(9163-9165)GGA>GTA	p.G3055V	ZFHX4_uc003yau.1_Missense_Mutation_p.G3100V|ZFHX4_uc003yaw.1_Missense_Mutation_p.G3055V	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3055	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCTACCCCGGACTCCCCGGC	0.542										HNSCC(33;0.089)			40	65	---	---	---	---	PASS
SLC10A5	347051	broad.mit.edu	37	8	82606863	82606863	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:82606863A>T	uc011lfs.1	-	1	345	c.345T>A	c.(343-345)ATT>ATA	p.I115I		NM_001010893	NP_001010893	Q5PT55	NTCP5_HUMAN	solute carrier family 10 (sodium/bile acid	115	Extracellular (Potential).					integral to membrane	bile acid:sodium symporter activity				0						TGATTTCTTCAATGAGTCTTT	0.358													69	103	---	---	---	---	PASS
RALYL	138046	broad.mit.edu	37	8	85686874	85686874	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:85686874T>C	uc003ycq.3	+	4	733	c.317T>C	c.(316-318)CTT>CCT	p.L106P	RALYL_uc003ycr.3_Missense_Mutation_p.L106P|RALYL_uc003ycs.3_Missense_Mutation_p.L106P|RALYL_uc010lzy.2_Missense_Mutation_p.L106P|RALYL_uc003yct.3_Missense_Mutation_p.L119P|RALYL_uc003ycu.3_Missense_Mutation_p.L33P|RALYL_uc003ycv.3_Missense_Mutation_p.L18P	NM_001100392	NP_001093862	Q86SE5	RALYL_HUMAN	RALY RNA binding protein-like isoform 2	106							identical protein binding|nucleotide binding|RNA binding			ovary(1)	1						AAGAGGCCCCTTTCTGCACTT	0.358													13	34	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87738769	87738769	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87738769C>G	uc003ydx.2	-	3	374	c.328G>C	c.(328-330)GGT>CGT	p.G110R		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	110	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						CTGTTTGGACCTTCTTTCCCG	0.453													73	255	---	---	---	---	PASS
RIMS2	9699	broad.mit.edu	37	8	105080743	105080743	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105080743C>A	uc003yls.2	+	20	2865	c.2624C>A	c.(2623-2625)ACT>AAT	p.T875N	RIMS2_uc003ylp.2_Intron|RIMS2_uc003ylw.2_Missense_Mutation_p.T948N|RIMS2_uc003ylq.2_Intron|RIMS2_uc003ylr.2_Intron	NM_014677	NP_055492	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					intracellular protein transport	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(6)|lung(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	15			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCGATAGGTACTATGGATATA	0.378										HNSCC(12;0.0054)			6	11	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105367345	105367345	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105367345C>T	uc003ylx.1	+	3	1319	c.1270C>T	c.(1270-1272)CTG>TTG	p.L424L		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	424	Cytoplasmic.				osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GCATGCAAAGCTGCTTAAAAA	0.463													23	125	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109241385	109241385	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109241385C>T	uc003ymu.2	-	6	539	c.511G>A	c.(511-513)GGA>AGA	p.G171R	EIF3E_uc003ymt.2_Missense_Mutation_p.G122R|EIF3E_uc003ymv.2_Missense_Mutation_p.G78R|EIF3E_uc010mci.1_Missense_Mutation_p.G171R	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	171	Sufficient for interaction with TRIM27.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GCCAGCTTTCCCCAGAGTGAA	0.348													34	151	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110439245	110439245	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110439245G>C	uc003yne.2	+	25	2964	c.2860G>C	c.(2860-2862)GTG>CTG	p.V954L		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	954	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CCCCGCTGCTGTGTCAGCTGC	0.453										HNSCC(38;0.096)			80	110	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110520439	110520439	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110520439C>A	uc003yne.2	+	70	11445	c.11341C>A	c.(11341-11343)CGA>AGA	p.R3781R		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	3781	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CACAGAAACTCGAAGACTTTC	0.393										HNSCC(38;0.096)			4	246	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113275908	113275908	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113275908T>C	uc003ynu.2	-	61	9981	c.9822A>G	c.(9820-9822)GTA>GTG	p.V3274V	CSMD3_uc003yns.2_Silent_p.V2476V|CSMD3_uc003ynt.2_Silent_p.V3234V|CSMD3_uc011lhx.1_Silent_p.V3105V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3274	Sushi 25.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TACCATTCCCTACACAGGTCA	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	76	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113293450	113293450	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113293450T>A	uc003ynu.2	-	59	9620	c.9461A>T	c.(9460-9462)CAG>CTG	p.Q3154L	CSMD3_uc003yns.2_Missense_Mutation_p.Q2356L|CSMD3_uc003ynt.2_Missense_Mutation_p.Q3114L|CSMD3_uc011lhx.1_Missense_Mutation_p.Q2985L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3154	Extracellular (Potential).|Sushi 23.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGCTGTGCACTGTCTAACTGA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			37	127	---	---	---	---	PASS
ASAP1	50807	broad.mit.edu	37	8	131226848	131226848	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131226848T>G	uc003yta.1	-	4	387	c.359A>C	c.(358-360)AAG>ACG	p.K120T	ASAP1_uc011liw.1_Missense_Mutation_p.K113T	NM_018482	NP_060952	Q9ULH1	ASAP1_HUMAN	development and differentiation enhancing factor	120					cilium morphogenesis|filopodium assembly|regulation of ARF GTPase activity|signal transduction	cytoplasm|membrane	ARF GTPase activator activity|cytoskeletal adaptor activity|SH3 domain binding|zinc ion binding			ovary(4)	4						AGTAGAAAACTTGACAAACGC	0.368													47	85	---	---	---	---	PASS
TMEM71	137835	broad.mit.edu	37	8	133764104	133764104	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133764104G>C	uc003ytp.2	-	4	470	c.241C>G	c.(241-243)CTG>GTG	p.L81V	TMEM71_uc003ytn.2_Missense_Mutation_p.L81V|TMEM71_uc003yto.2_Missense_Mutation_p.L81V	NM_144649	NP_653250	Q6P5X7	TMM71_HUMAN	transmembrane protein 71 isoform 1	81						integral to membrane				ovary(2)	2	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			TTGTCGCACAGGAAGCTGTCT	0.473													41	146	---	---	---	---	PASS
TG	7038	broad.mit.edu	37	8	133883582	133883582	+	Intron	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133883582T>A	uc003ytw.2	+							NM_003235	NP_003226	P01266	THYG_HUMAN	thyroglobulin precursor						hormone biosynthetic process|signal transduction|thyroid gland development|thyroid hormone generation	extracellular space	hormone activity			ovary(8)|breast(4)|pancreas(1)|central_nervous_system(1)|skin(1)	15	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CATTGCTCCTTGTACCCACAG	0.507													33	51	---	---	---	---	PASS
COL22A1	169044	broad.mit.edu	37	8	139614365	139614365	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139614365C>G	uc003yvd.2	-	60	4625	c.4178G>C	c.(4177-4179)GGA>GCA	p.G1393A	COL22A1_uc011ljo.1_Missense_Mutation_p.G673A	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1393	Pro-rich.|Gly-rich.|Collagen-like 14.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CACCCTTTCTCCTTTGAATCC	0.587										HNSCC(7;0.00092)			18	89	---	---	---	---	PASS
MAPK15	225689	broad.mit.edu	37	8	144803248	144803248	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144803248G>A	uc003yzj.2	+	10	1037	c.996G>A	c.(994-996)GTG>GTA	p.V332V		NM_139021	NP_620590	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	332					protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding			lung(2)	2	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGCTCTCTGTGCCTGAGTACC	0.662													6	16	---	---	---	---	PASS
ZNF16	7564	broad.mit.edu	37	8	146157623	146157623	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146157623C>T	uc003zet.2	-	4	737	c.550G>A	c.(550-552)GAC>AAC	p.D184N	ZNF16_uc003zeu.2_Missense_Mutation_p.D184N	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16	184					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		CCACCCATGTCATATGGATGT	0.493													107	197	---	---	---	---	PASS
IFNA14	3448	broad.mit.edu	37	9	21239831	21239831	+	Missense_Mutation	SNP	C	T	T	rs149155133		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21239831C>T	uc010mis.2	-	1	148	c.104G>A	c.(103-105)AGG>AAG	p.R35K	IFNA14_uc003zoo.1_RNA	NM_002172	NP_002163	P01570	IFN14_HUMAN	interferon, alpha 14 precursor	35					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CAAAGTCCTCCTGTTATTCAG	0.493													55	79	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971036	21971036	+	Missense_Mutation	SNP	C	A	A	rs121913381		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971036C>A	uc003zpk.2	-	2	534	c.322G>T	c.(322-324)GAT>TAT	p.D108Y	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.R163L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	108			D -> Y (in a head and neck tumor).|D -> H (in a bladder tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.D108Y(14)|p.?(13)|p.D108H(9)|p.D108N(5)|p.H83fs*2(2)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCCAGGCATCGCGCACGTCC	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			15	6	---	---	---	---	PASS
TESK1	7016	broad.mit.edu	37	9	35609124	35609124	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35609124G>A	uc003zxa.2	+	10	1602	c.1266G>A	c.(1264-1266)CCG>CCA	p.P422P	TESK1_uc003zwz.1_RNA|TESK1_uc010mks.2_Silent_p.P262P	NM_006285	NP_006276	Q15569	TESK1_HUMAN	testis-specific protein kinase 1	422					cell junction assembly|spermatogenesis	cytosol	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			stomach(2)|breast(2)|lung(1)|ovary(1)|skin(1)	7			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGACCACTCCGGAGACCCTGG	0.637													4	152	---	---	---	---	PASS
FRMPD1	22844	broad.mit.edu	37	9	37740469	37740469	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37740469C>T	uc004aag.1	+	15	1988	c.1944C>T	c.(1942-1944)AGC>AGT	p.S648S	FRMPD1_uc004aah.1_Silent_p.S648S|FRMPD1_uc011lqm.1_Silent_p.S470S|FRMPD1_uc011lqn.1_Silent_p.S517S	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	648						cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		AGGAGAGAAGCGGGATTGAAA	0.572													23	22	---	---	---	---	PASS
ECM2	1842	broad.mit.edu	37	9	95279975	95279975	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95279975C>A	uc004ash.2	-	3	540	c.475G>T	c.(475-477)GCT>TCT	p.A159S	CENPP_uc004arz.2_Intron|CENPP_uc010mqx.2_Intron|ECM2_uc004asf.3_Missense_Mutation_p.A159S|ECM2_uc011lty.1_Missense_Mutation_p.A159S|ECM2_uc004asg.2_Missense_Mutation_p.A159S|ECM2_uc011ltz.1_Missense_Mutation_p.A159S|ECM2_uc004asi.2_Missense_Mutation_p.A159S	NM_001393	NP_001384	O94769	ECM2_HUMAN	extracellular matrix protein 2 precursor	159					cell-matrix adhesion		integrin binding			ovary(1)|skin(1)	2						GTACCAGTAGCGGAGCAGACC	0.403													113	322	---	---	---	---	PASS
CYLC2	1539	broad.mit.edu	37	9	105765446	105765446	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105765446A>G	uc004bbs.2	+	3	151	c.81A>G	c.(79-81)TCA>TCG	p.S27S		NM_001340	NP_001331	Q14093	CYLC2_HUMAN	cylicin 2	27	31 X 3 AA repeats of K-K-X.				cell differentiation|multicellular organismal development|spermatogenesis	cytoskeletal calyx	structural constituent of cytoskeleton			skin(1)	1		all_hematologic(171;0.125)				GCAAAAAATCATGGAATCAGC	0.403													42	118	---	---	---	---	PASS
SLC46A2	57864	broad.mit.edu	37	9	115652553	115652553	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115652553A>G	uc004bgk.2	-	1	641	c.409T>C	c.(409-411)TAC>CAC	p.Y137H		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	137	Extracellular (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1						GCCGCCCCGTACAGCACCTCC	0.687													7	31	---	---	---	---	PASS
KIF12	113220	broad.mit.edu	37	9	116859726	116859726	+	Intron	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116859726G>C	uc004bif.2	-						KIF12_uc004big.2_Intron	NM_138424	NP_612433	Q96FN5	KIF12_HUMAN	kinesin family member 12						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						CCTGGGAGGGGAGGGAGGAGG	0.622													16	18	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119976961	119976961	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119976961G>A	uc004bjs.1	-	3	792	c.691C>T	c.(691-693)CGA>TGA	p.R231*	ASTN2_uc004bjr.1_Nonsense_Mutation_p.R231*|ASTN2_uc004bjt.1_Nonsense_Mutation_p.R231*	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	231	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TGCCAACGTCGCTGGGCGTAC	0.622													21	50	---	---	---	---	PASS
MRRF	92399	broad.mit.edu	37	9	125047469	125047469	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125047469T>C	uc004bmb.2	+	4	477	c.362T>C	c.(361-363)GTG>GCG	p.V121A	MRRF_uc004bmc.2_Missense_Mutation_p.V121A|MRRF_uc011lyq.1_Missense_Mutation_p.V142A|MRRF_uc010mvz.1_RNA|MRRF_uc010mwa.2_Missense_Mutation_p.V121A|MRRF_uc011lyr.1_Missense_Mutation_p.V69A|MRRF_uc004bmd.2_Missense_Mutation_p.V121A|MRRF_uc004bme.2_RNA	NM_138777	NP_620132	Q96E11	RRFM_HUMAN	mitochondrial ribosome recycling factor isoform	121					ribosome disassembly|translation	mitochondrion	sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3						AAGATTGCTGTGGTAACTGCT	0.308													36	69	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136270036	136270036	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136270036T>C	uc004cdk.2	+	17	1917	c.1856T>C	c.(1855-1857)GTC>GCC	p.V619A	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	619							ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ATGCTGCTGGTCCACCTGGCT	0.637													30	220	---	---	---	---	PASS
NELF	26012	broad.mit.edu	37	9	140351966	140351966	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140351966G>A	uc004cna.2	-	3	753	c.521C>T	c.(520-522)GCT>GTT	p.A174V	C9orf167_uc011mew.1_Intron|NELF_uc011mex.1_5'Flank|NELF_uc010nci.2_5'Flank|NELF_uc011mey.1_RNA|NELF_uc011mez.1_Missense_Mutation_p.A174V|NELF_uc004cmz.2_Missense_Mutation_p.A174V|NELF_uc004cnc.2_Missense_Mutation_p.A174V|NELF_uc004cnb.2_Missense_Mutation_p.A174V	NM_001130969	NP_001124441	Q6X4W1	NELF_HUMAN	nasal embryonic LHRH factor isoform a	174						nucleus|plasma membrane					0	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000222)|Epithelial(140;0.000888)		GGGGCCAGGAGCCAGCTGGGC	0.706													15	8	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15573047	15573047	+	Splice_Site	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15573047A>T	uc001ioc.1	-	28	2982	c.2982_splice	c.e28+1	p.A994_splice	ITGA8_uc010qcb.1_Splice_Site_p.V979_splice	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor						cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						AAAGATACTCACTACTATGCT	0.348													50	79	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15702878	15702878	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15702878A>G	uc001ioc.1	-	9	891	c.891T>C	c.(889-891)TAT>TAC	p.Y297Y	ITGA8_uc010qcb.1_Silent_p.Y282Y	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	297	Extracellular (Potential).|FG-GAP 4.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						CAGTACTCACATATCCAAAAT	0.239													33	59	---	---	---	---	PASS
PTPLA	9200	broad.mit.edu	37	10	17636217	17636217	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17636217T>C	uc001ipg.2	-	6	806	c.771A>G	c.(769-771)GCA>GCG	p.A257A		NM_014241	NP_055056	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like, member A	257	Helical; (Potential).				fatty acid biosynthetic process|multicellular organismal development|signal transduction	endoplasmic reticulum membrane|integral to membrane	lyase activity|protein tyrosine phosphatase activity			central_nervous_system(1)|skin(1)	2						GTATATATGATGCCATGGTTA	0.289													26	115	---	---	---	---	PASS
ANUBL1	93550	broad.mit.edu	37	10	46147483	46147483	+	Splice_Site	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46147483T>C	uc001jcp.3	-	4	503	c.261_splice	c.e4-1	p.N87_splice	ANUBL1_uc001jcm.3_Splice_Site_p.N87_splice|ANUBL1_uc009xmu.2_Splice_Site_p.N13_splice|ANUBL1_uc001jcn.3_Splice_Site_p.N13_splice|ANUBL1_uc001jco.3_Splice_Site_p.N87_splice|ANUBL1_uc001jcq.2_Splice_Site|ANUBL1_uc001jcr.2_Splice_Site_p.N87_splice	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog								zinc ion binding				0						TCTGAAATGCTGTGGATAGTT	0.363													42	28	---	---	---	---	PASS
RBP3	5949	broad.mit.edu	37	10	48388747	48388747	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48388747C>T	uc001jez.2	-	1	2245	c.2131G>A	c.(2131-2133)GAG>AAG	p.E711K		NM_002900	NP_002891	P10745	RET3_HUMAN	retinol-binding protein 3 precursor	711	4 X approximate tandem repeats.|3.				lipid metabolic process|proteolysis|transport|visual perception	interphotoreceptor matrix	retinal binding|serine-type peptidase activity			large_intestine(1)|central_nervous_system(1)	2					Vitamin A(DB00162)	GGTGCTTCCTCTACCACCAGC	0.632													27	29	---	---	---	---	PASS
C10orf72	196740	broad.mit.edu	37	10	50227712	50227712	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50227712C>A	uc001jhf.2	-	8	975	c.946G>T	c.(946-948)GAG>TAG	p.E316*		NM_001031746	NP_001026916	Q8IW00	CJ072_HUMAN	hypothetical protein LOC196740 isoform 1	316	Cytoplasmic (Potential).					integral to membrane|plasma membrane					0						TTGTTCTCCTCGAAGAGGATC	0.522													39	52	---	---	---	---	PASS
PRKG1	5592	broad.mit.edu	37	10	52751280	52751280	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52751280C>G	uc001jjm.2	+	1	336	c.142C>G	c.(142-144)CCA>GCA	p.P48A	PRKG1_uc010qhp.1_Missense_Mutation_p.P48A	NM_001098512	NP_001091982	Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I isoform	48	Dimerization.				actin cytoskeleton organization|platelet activation|signal transduction	cytosol	ATP binding|cGMP binding|cGMP-dependent protein kinase activity			lung(2)|stomach(1)|ovary(1)|central_nervous_system(1)|skin(1)	6		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		GTCGGTGCTCCCAGTGCCCTC	0.612													6	5	---	---	---	---	PASS
DUPD1	338599	broad.mit.edu	37	10	76818229	76818229	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76818229G>T	uc001jwq.1	-	1	44	c.44C>A	c.(43-45)TCA>TAA	p.S15*		NM_001003892	NP_001003892	Q68J44	DUPD1_HUMAN	dual specificity phosphatase and pro isomerase	15						cytoplasm	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)	2	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CTTGGCAGATGAGTAGGCATT	0.537													32	33	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87484343	87484343	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87484343C>T	uc001kdl.1	-	11	1725	c.1624G>A	c.(1624-1626)GGG>AGG	p.G542R	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.G113R	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	542	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	ATTAGAATCCCCACTGAATAG	0.517										Multiple Myeloma(13;0.14)			46	61	---	---	---	---	PASS
WAPAL	23063	broad.mit.edu	37	10	88197313	88197313	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:88197313A>C	uc001kdo.2	-	19	4002	c.3560T>G	c.(3559-3561)TTG>TGG	p.L1187W	WAPAL_uc009xsv.2_Missense_Mutation_p.L446W|WAPAL_uc001kdn.2_Missense_Mutation_p.L1224W|WAPAL_uc009xsw.2_Missense_Mutation_p.L1181W	NM_015045	NP_055860	Q7Z5K2	WAPL_HUMAN	wings apart-like homolog	1187					cell division|interspecies interaction between organisms|mitosis|negative regulation of chromatin binding|negative regulation of DNA replication|negative regulation of sister chromatid cohesion|protein localization to chromatin|regulation of cohesin localization to chromatin	chromatin|cohesin complex|cytoplasm	protein binding			ovary(1)	1						GCAATGTTCCAAATATTCAAT	0.408													33	45	---	---	---	---	PASS
OPALIN	93377	broad.mit.edu	37	10	98113195	98113195	+	Intron	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98113195A>T	uc001kmj.2	-						OPALIN_uc010qor.1_Intron|OPALIN_uc001kmi.2_Intron|OPALIN_uc001kmk.2_Intron|OPALIN_uc010qos.1_Intron	NM_033207	NP_149984	Q96PE5	OPALI_HUMAN	transmembrane protein 10 isoform a							Golgi apparatus|integral to membrane|plasma membrane					0						TCCAGGCaggatgacctacca	0.303													70	88	---	---	---	---	PASS
PKD2L1	9033	broad.mit.edu	37	10	102052796	102052796	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102052796G>T	uc001kqx.1	-	11	2172	c.1789C>A	c.(1789-1791)CTG>ATG	p.L597M	PKD2L1_uc009xwm.1_Missense_Mutation_p.L550M	NM_016112	NP_057196	Q9P0L9	PK2L1_HUMAN	polycystic kidney disease 2-like 1	597	Cytoplasmic (Potential).				signal transduction	integral to membrane	calcium activated cation channel activity|calcium ion binding|cytoskeletal protein binding			ovary(4)	4		Colorectal(252;0.117)		Epithelial(162;6.15e-10)|all cancers(201;5.14e-08)		TCCTTCCTCAGACGCAGTCTT	0.552													54	56	---	---	---	---	PASS
CNNM2	54805	broad.mit.edu	37	10	104678750	104678750	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104678750C>T	uc001kwm.2	+	1	637	c.513C>T	c.(511-513)GGC>GGT	p.G171G	CNNM2_uc001kwn.2_Silent_p.G171G|CNNM2_uc001kwl.2_Silent_p.G171G	NM_017649	NP_060119	Q9H8M5	CNNM2_HUMAN	cyclin M2 isoform 1	171					ion transport	integral to membrane				ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		GCACCTCGGGCATCATCGAGA	0.592													81	118	---	---	---	---	PASS
GPR123	84435	broad.mit.edu	37	10	134886386	134886386	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134886386A>G	uc001llw.2	+	3	420	c.420A>G	c.(418-420)GCA>GCG	p.A140A				Q86SQ6	GP123_HUMAN	RecName: Full=Probable G-protein coupled receptor 123;	Error:Variant_position_missing_in_Q86SQ6_after_alignment						integral to membrane|plasma membrane	G-protein coupled receptor activity				0		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		GCGGCCGTGCAGATGGGAAGG	0.592													7	8	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1024909	1024909	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1024909G>A	uc001lsw.2	-	24	3211	c.3160C>T	c.(3160-3162)CGC>TGC	p.R1054C		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1054	VWFD 3.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCCCAGGAGCGCCGGAAGGCA	0.662													13	43	---	---	---	---	PASS
STIM1	6786	broad.mit.edu	37	11	4091374	4091374	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4091374G>T	uc001lyv.2	+	6	1300	c.732G>T	c.(730-732)ATG>ATT	p.M244I	STIM1_uc009yef.2_Missense_Mutation_p.M244I|STIM1_uc009yeg.2_Missense_Mutation_p.M71I	NM_003156	NP_003147	Q13586	STIM1_HUMAN	stromal interaction molecule 1 precursor	244	Cytoplasmic (Potential).				activation of store-operated calcium channel activity|calcium ion transport|detection of calcium ion|platelet activation	integral to endoplasmic reticulum membrane|integral to plasma membrane|microtubule	calcium ion binding|microtubule plus-end binding			pancreas(1)	1		Breast(177;0.00159)|Medulloblastoma(188;0.00258)|all_neural(188;0.0233)		BRCA - Breast invasive adenocarcinoma(625;0.114)|LUSC - Lung squamous cell carcinoma(625;0.141)		TGAAGAAGATGATGAAGGACT	0.527													4	127	---	---	---	---	PASS
OR51T1	401665	broad.mit.edu	37	11	4903906	4903906	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4903906C>T	uc010qyp.1	+	1	858	c.858C>T	c.(856-858)AGC>AGT	p.S286S		NM_001004759	NP_001004759	Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T,	259	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|large_intestine(1)	3		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACTGATCAGCCTCTCTTTGG	0.498													24	88	---	---	---	---	PASS
OR51G1	79324	broad.mit.edu	37	11	4945281	4945281	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4945281G>T	uc010qyr.1	-	1	289	c.289C>A	c.(289-291)CCT>ACT	p.P97T		NM_001005237	NP_001005237	Q8NGK1	O51G1_HUMAN	olfactory receptor, family 51, subfamily G,	97	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.58e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAACAGGCAGGGATGCCAATC	0.498													28	61	---	---	---	---	PASS
MMP26	56547	broad.mit.edu	37	11	5012677	5012677	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5012677T>A	uc001lzv.2	+	4	564	c.546T>A	c.(544-546)CCT>CCA	p.P182P		NM_021801	NP_068573	Q9NRE1	MMP26_HUMAN	matrix metalloproteinase 26 preproprotein	182					collagen catabolic process|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0		Medulloblastoma(188;0.0025)|Breast(177;0.0204)|all_neural(188;0.0227)		Epithelial(150;1.33e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0287)|LUSC - Lung squamous cell carcinoma(625;0.191)		CTGGAAATCCTGGAGTTGTCC	0.483													109	158	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023408	6023408	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023408G>C	uc010qzv.1	-	1	971	c.971C>G	c.(970-972)CCT>CGT	p.P324R		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	272	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GACATCTGGAGGAATTCTCTT	0.527													12	50	---	---	---	---	PASS
OR2D3	120775	broad.mit.edu	37	11	6942221	6942221	+	5'Flank	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6942221A>G	uc010rav.1	+							NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TTGATGTCACAGACCCAAAAA	0.338													31	39	---	---	---	---	PASS
STK33	65975	broad.mit.edu	37	11	8494723	8494723	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8494723C>A	uc001mgi.1	-	2	1245	c.326G>T	c.(325-327)GGA>GTA	p.G109V	STK33_uc001mgj.1_Missense_Mutation_p.G109V|STK33_uc001mgk.1_Missense_Mutation_p.G109V|STK33_uc010rbn.1_Missense_Mutation_p.G68V|STK33_uc001mgl.3_Intron|STK33_uc009yfp.2_Intron	NM_030906	NP_112168	Q9BYT3	STK33_HUMAN	serine/threonine kinase 33	109						Golgi apparatus|nucleus|perinuclear region of cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|pancreas(1)|central_nervous_system(1)|skin(1)	7				Epithelial(150;2.13e-06)|BRCA - Breast invasive adenocarcinoma(625;0.239)		AATAGCAGCTCCATTCTCAAT	0.378													92	175	---	---	---	---	PASS
MICALCL	84953	broad.mit.edu	37	11	12315632	12315632	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12315632T>A	uc001mkg.1	+	3	945	c.654T>A	c.(652-654)GGT>GGA	p.G218G		NM_032867	NP_116256	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	218					cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm	mitogen-activated protein kinase binding			skin(1)	1				Epithelial(150;0.00177)		CTGAGAATGGTAGAGGAGGCC	0.577													37	82	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16010543	16010543	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16010543C>A	uc001mme.2	-	14	2038	c.2005G>T	c.(2005-2007)GGA>TGA	p.G669*	SOX6_uc001mmd.2_Nonsense_Mutation_p.G632*|SOX6_uc001mmf.2_Nonsense_Mutation_p.G629*|SOX6_uc001mmg.2_Nonsense_Mutation_p.G636*	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	656	HMG box.				muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CTGCACTCACCTAAGATTTTG	0.493											OREG0020800	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	42	141	---	---	---	---	PASS
NUCB2	4925	broad.mit.edu	37	11	17331130	17331130	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17331130G>A	uc001mmw.2	+	6	636	c.391G>A	c.(391-393)GAC>AAC	p.D131N	NUCB2_uc001mms.1_Missense_Mutation_p.D132N|NUCB2_uc001mmt.1_Missense_Mutation_p.D131N|NUCB2_uc001mmv.1_Missense_Mutation_p.D131N|NUCB2_uc009ygz.2_Missense_Mutation_p.D131N	NM_005013	NP_005004	P80303	NUCB2_HUMAN	nucleobindin 2 precursor	131						cytosol|ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|plasma membrane	calcium ion binding|DNA binding				0						TATAGGCATGGACCACCAAGC	0.308													55	237	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22215035	22215035	+	5'UTR	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22215035G>A	uc001mqi.2	+	1					ANO5_uc001mqj.2_5'UTR	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						ACGAGCTGGCGAAGATGGGCG	0.637													9	18	---	---	---	---	PASS
FANCF	2188	broad.mit.edu	37	11	22646492	22646492	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22646492G>T	uc001mql.1	-	1	896	c.865C>A	c.(865-867)CTT>ATT	p.L289I		NM_022725	NP_073562	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	289				L->A: Strongly reduced monoubiquitination of FANCD2; when associated with A-287; A- 339; A-341 and A-344.	DNA repair	nucleoplasm	protein binding			skin(1)	1						CCTTTCTGAAGGTCATAGTGC	0.542			N|F			AML|leukemia		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	122	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033959	30033959	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033959C>A	uc001msk.2	-	2	1419	c.267G>T	c.(265-267)CGG>CGT	p.R89R		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	89						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TCTTCTCAGACCGCTGTCGCC	0.622													30	54	---	---	---	---	PASS
RAG2	5897	broad.mit.edu	37	11	36614556	36614556	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36614556G>C	uc001mwv.3	-	2	1351	c.1163C>G	c.(1162-1164)GCA>GGA	p.A388G	RAG1_uc001mwt.2_RNA|C11orf74_uc010rfd.1_5'Flank|C11orf74_uc001mww.1_5'Flank|C11orf74_uc001mwx.1_5'Flank|C11orf74_uc001mwy.1_5'Flank|C11orf74_uc001mwz.1_5'Flank|C11orf74_uc010rfe.1_5'Flank	NM_000536	NP_000527	P55895	RAG2_HUMAN	recombination activating gene 2	388					chromatin modification|pre-B cell allelic exclusion|somatic diversification of immunoglobulins|T cell differentiation in thymus|V(D)J recombination	nucleus	chromatin binding|DNA binding|endonuclease activity|methylated histone residue binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-4,5-bisphosphate binding|zinc ion binding			skin(3)|ovary(1)|pancreas(1)	5	all_lung(20;0.226)	all_hematologic(20;0.00756)				ATTTGCTTCTGCACTGAAACA	0.398									Familial_Hemophagocytic_Lymphohistiocytosis				65	109	---	---	---	---	PASS
ACCSL	390110	broad.mit.edu	37	11	44069984	44069984	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44069984G>C	uc001mxw.1	+	1	454	c.398G>C	c.(397-399)CGC>CCC	p.R133P	ACCSL_uc009ykr.2_5'UTR	NM_001031854	NP_001027025	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase	133							1-aminocyclopropane-1-carboxylate synthase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			ovary(5)	5						TTTGTCAACCGCGACCTATCC	0.488													20	123	---	---	---	---	PASS
MADD	8567	broad.mit.edu	37	11	47296439	47296439	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47296439G>T	uc001ner.1	+	3	579	c.388G>T	c.(388-390)GAG>TAG	p.E130*	MADD_uc001neq.2_Nonsense_Mutation_p.E130*|MADD_uc001nev.1_Nonsense_Mutation_p.E130*|MADD_uc001nes.1_Nonsense_Mutation_p.E130*|MADD_uc001net.1_Nonsense_Mutation_p.E130*|MADD_uc009yln.1_Nonsense_Mutation_p.E130*|MADD_uc001neu.1_Nonsense_Mutation_p.E130*|MADD_uc001nex.2_Nonsense_Mutation_p.E130*|MADD_uc001nez.2_Nonsense_Mutation_p.E130*|MADD_uc001new.2_Nonsense_Mutation_p.E130*	NM_003682	NP_003673	Q8WXG6	MADD_HUMAN	MAP-kinase activating death domain-containing	130					activation of MAPK activity|apoptosis|cell surface receptor linked signaling pathway|regulation of apoptosis|regulation of cell cycle	cytoplasm|integral to membrane|plasma membrane	death receptor binding|protein kinase activator activity|Rab guanyl-nucleotide exchange factor activity			ovary(5)|skin(4)|central_nervous_system(2)	11				Lung(87;0.182)		TGCCTCAGAAGAGGGTGGCAC	0.602													4	84	---	---	---	---	PASS
OR4B1	119765	broad.mit.edu	37	11	48239284	48239284	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48239284G>A	uc010rhs.1	+	1	923	c.923G>A	c.(922-924)AGG>AAG	p.R308K		NM_001005470	NP_001005470	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B,	308	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|pancreas(1)	4						AATCCAGGGAGGGAGTGAAAA	0.403													25	40	---	---	---	---	PASS
OR4C11	219429	broad.mit.edu	37	11	55371530	55371530	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55371530C>A	uc010rii.1	-	1	320	c.320G>T	c.(319-321)TGC>TTC	p.C107F		NM_001004700	NP_001004700	Q6IEV9	OR4CB_HUMAN	olfactory receptor, family 4, subfamily C,	107	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						GATCTCCATGCAGCCAAATAA	0.448													54	80	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419153	55419153	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419153C>A	uc001nhs.1	+	1	774	c.774C>A	c.(772-774)CGC>CGA	p.R258R		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	258	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				TGTACATGCGCCCTGATACGA	0.468													122	144	---	---	---	---	PASS
OR4S2	219431	broad.mit.edu	37	11	55419154	55419154	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55419154C>A	uc001nhs.1	+	1	775	c.775C>A	c.(775-777)CCT>ACT	p.P259T		NM_001004059	NP_001004059	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S,	259	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.0748)				GTACATGCGCCCTGATACGAC	0.468													121	147	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433452	55433452	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433452T>A	uc001nht.3	+	3	1075	c.810T>A	c.(808-810)GCT>GCA	p.A270A	OR4C6_uc010rik.1_Silent_p.A270A	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	270	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						AGGCAATGGCTGTGTCAGACT	0.473													23	116	---	---	---	---	PASS
OR8I2	120586	broad.mit.edu	37	11	55861250	55861250	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55861250C>A	uc010rix.1	+	1	467	c.467C>A	c.(466-468)TCG>TAG	p.S156*		NM_001003750	NP_001003750	Q8N0Y5	OR8I2_HUMAN	olfactory receptor, family 8, subfamily I,	156	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(1)	1	Esophageal squamous(21;0.00693)					TTCACAAGCTCGCTGATATCT	0.433													39	149	---	---	---	---	PASS
OR5T3	390154	broad.mit.edu	37	11	56020637	56020637	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56020637G>C	uc010rjd.1	+	1	962	c.962G>C	c.(961-963)AGT>ACT	p.S321T		NM_001004747	NP_001004747	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T,	321	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(21;0.00448)					ATCATCTATAGTTTGAGGAAC	0.308													9	95	---	---	---	---	PASS
OR10Q1	219960	broad.mit.edu	37	11	57995796	57995796	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57995796G>T	uc010rkd.1	-	1	552	c.552C>A	c.(550-552)TGC>TGA	p.C184*		NM_001004471	NP_001004471	Q8NGQ4	O10Q1_HUMAN	olfactory receptor, family 10, subfamily Q,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(21;0.0589)				GAGGCACATCGCAGAGGAAGT	0.642													3	50	---	---	---	---	PASS
OR5A1	219982	broad.mit.edu	37	11	59211269	59211269	+	Missense_Mutation	SNP	G	A	A	rs149491111	byFrequency	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59211269G>A	uc001nnx.1	+	1	628	c.628G>A	c.(628-630)GGA>AGA	p.G210R		NM_001004728	NP_001004728	Q8NGJ0	OR5A1_HUMAN	olfactory receptor, family 5, subfamily A,	210	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)	2						GGTCACTGTCGGAGGAACATC	0.532													76	143	---	---	---	---	PASS
RAD9A	5883	broad.mit.edu	37	11	67160217	67160217	+	Silent	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67160217T>G	uc001okr.2	+	3	291	c.198T>G	c.(196-198)CCT>CCG	p.P66P	RAD9A_uc001oks.2_5'Flank	NM_004584	NP_004575	Q99638	RAD9A_HUMAN	RAD9 homolog	66	Possesses 3'-5' exonuclease activity.				DNA damage checkpoint|DNA repair|DNA replication|DNA replication checkpoint	nucleoplasm	3'-5' exonuclease activity|exodeoxyribonuclease III activity|histone deacetylase binding|protein kinase binding|SH3 domain binding				0			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			CAGCCACCCCTGGTCAGGACC	0.612								Direct_reversal_of_damage|Other_conserved_DNA_damage_response_genes					24	94	---	---	---	---	PASS
ANO1	55107	broad.mit.edu	37	11	69950238	69950238	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69950238C>A	uc001opj.2	+	4	979	c.674C>A	c.(673-675)TCC>TAC	p.S225Y	ANO1_uc001opk.1_Missense_Mutation_p.S197Y|ANO1_uc001opl.1_RNA	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel	225	Cytoplasmic (Potential).				multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						TATCCCTTCTCCCGGGAGAAG	0.517													12	16	---	---	---	---	PASS
RSF1	51773	broad.mit.edu	37	11	77404559	77404559	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77404559C>A	uc001oyn.2	-	8	2933	c.2813G>T	c.(2812-2814)TGC>TTC	p.C938F	RSF1_uc001oym.2_Missense_Mutation_p.C686F	NM_016578	NP_057662	Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	938	PHD-type.				CenH3-containing nucleosome assembly at centromere|negative regulation of DNA binding|negative regulation of transcription, DNA-dependent|nucleosome positioning|positive regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription initiation, DNA-dependent	RSF complex	histone binding|protein binding|zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TACATGTTGGCAAGGTGGGCA	0.418													15	19	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78380569	78380569	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78380569G>A	uc001ozl.3	-	32	7284	c.6821C>T	c.(6820-6822)GCT>GTT	p.A2274V	ODZ4_uc001ozk.3_Missense_Mutation_p.A499V|ODZ4_uc009yvb.1_Missense_Mutation_p.A858V	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2274	Extracellular (Potential).|YD 21.				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						GAGCAGGCCAGCTGAGTTGTA	0.612													34	147	---	---	---	---	PASS
SYTL2	54843	broad.mit.edu	37	11	85425553	85425553	+	Intron	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:85425553A>G	uc010rth.1	-						SYTL2_uc010rtg.1_Intron|SYTL2_uc010rti.1_Intron|SYTL2_uc010rtj.1_Intron|SYTL2_uc001pav.2_5'UTR|SYTL2_uc010rte.1_Intron|SYTL2_uc001pax.2_Intron|SYTL2_uc001paz.2_Intron|SYTL2_uc001pba.2_Intron|SYTL2_uc001pay.2_Intron|SYTL2_uc001paw.2_Intron|SYTL2_uc009yvj.2_Intron|SYTL2_uc001pbd.2_Intron|SYTL2_uc001pbb.2_Intron|SYTL2_uc001pbc.2_Intron|SYTL2_uc010rtf.1_Intron	NM_001162951	NP_001156423	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2 isoform g						intracellular protein transport|vesicle docking involved in exocytosis	exocytic vesicle|extrinsic to plasma membrane|melanosome|membrane fraction	neurexin binding|phosphatidylinositol-4,5-bisphosphate binding|phosphatidylserine binding|Rab GTPase binding			ovary(2)|large_intestine(1)	3		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGTGGAAACTAAACAGCAGCA	0.343													21	84	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92087084	92087084	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92087084G>A	uc001pdj.3	+	1	1823	c.1806G>A	c.(1804-1806)GCG>GCA	p.A602A		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	602	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGTCTCAGCGATCGATATCG	0.393										TCGA Ovarian(4;0.039)			9	40	---	---	---	---	PASS
CNTN5	53942	broad.mit.edu	37	11	100126584	100126584	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:100126584C>A	uc001pga.2	+	17	2437	c.2098C>A	c.(2098-2100)CCA>ACA	p.P700T	CNTN5_uc001pfz.2_Missense_Mutation_p.P700T|CNTN5_uc001pgb.2_Missense_Mutation_p.P626T|CNTN5_uc010ruk.1_5'UTR	NM_014361	NP_055176	O94779	CNTN5_HUMAN	contactin 5 isoform long	700	Fibronectin type-III 1.				cell adhesion	anchored to membrane|plasma membrane	protein binding			skin(3)|ovary(2)|pancreas(2)|breast(1)	8		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		CAACCACAGCCCAATCTCCTC	0.512													33	125	---	---	---	---	PASS
TRPC6	7225	broad.mit.edu	37	11	101359755	101359755	+	Silent	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101359755T>A	uc001pgk.3	-	4	1631	c.1206A>T	c.(1204-1206)ACA>ACT	p.T402T	TRPC6_uc009ywy.2_Intron|TRPC6_uc009ywz.1_Intron	NM_004621	NP_004612	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel,	402	Cytoplasmic (Potential).				axon guidance|platelet activation|positive regulation of calcium ion transport via store-operated calcium channel activity	integral to membrane|plasma membrane	protein binding			skin(2)|ovary(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGACCGCCATTGTCTGCTGTC	0.458													10	79	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102595563	102595563	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102595563T>C	uc001phe.2	-	1	123	c.24A>G	c.(22-24)CCA>CCG	p.P8P	MMP8_uc010rut.1_5'Flank|MMP8_uc010ruu.1_5'UTR	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	8					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		AGAGCAGAAATGGAAGCGTCT	0.458													181	194	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105923774	105923774	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105923774C>A	uc001pja.2	-	4	2282	c.1642G>T	c.(1642-1644)GGA>TGA	p.G548*	KBTBD3_uc001pjb.2_Nonsense_Mutation_p.G548*|KBTBD3_uc009yxm.2_Nonsense_Mutation_p.G469*	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	544										ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		TCTTCAATTCCAATTGCACCT	0.398													39	100	---	---	---	---	PASS
MPZL3	196264	broad.mit.edu	37	11	118110946	118110946	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118110946T>C	uc001psm.2	-	2	222	c.220A>G	c.(220-222)AGC>GGC	p.S74G	MPZL3_uc010rxy.1_Missense_Mutation_p.S62G|MPZL3_uc010rxz.1_RNA|MPZL3_uc009yzy.2_Intron	NM_198275	NP_938016	Q6UWV2	MPZL3_HUMAN	myelin protein zero-like 3 precursor	74	Ig-like V-type.				cell adhesion	integral to membrane					0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TGGCTGCTGCTGGGAGGGCGA	0.418													21	195	---	---	---	---	PASS
ARHGEF12	23365	broad.mit.edu	37	11	120280091	120280091	+	Intron	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120280091G>T	uc001pxl.1	+						ARHGEF12_uc009zat.2_Intron|ARHGEF12_uc010rzn.1_Intron|ARHGEF12_uc009zau.1_Intron	NM_015313	NP_056128	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12						apoptosis|axon guidance|G-protein coupled receptor protein signaling pathway|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane	G-protein-coupled receptor binding|GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(2)|breast(2)|skin(2)|ovary(1)	7		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CTTTTCTCCCGCTCTTGTGCA	0.398			T	MLL	AML								19	78	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135457	124135457	+	IGR	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135457C>G								OR8G2 (39147 upstream) : OR8D1 (44280 downstream)																							TCCTTGTCCCCAGCCTGACCA	0.438													82	250	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252601	124252601	+	Silent	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252601G>T	uc010sai.1	-	1	639	c.639C>A	c.(637-639)ACC>ACA	p.T213T		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	213	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		AAATGAGGATGGTACAACTGG	0.433													71	212	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252884	124252884	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252884G>T	uc010sai.1	-	1	356	c.356C>A	c.(355-357)GCA>GAA	p.A119E		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GCGATCATATGCCATTGAAGT	0.403													34	38	---	---	---	---	PASS
OR8B3	390271	broad.mit.edu	37	11	124266892	124266892	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124266892G>T	uc010saj.1	-	1	356	c.356C>A	c.(355-357)GCA>GAA	p.A119E	OR8B2_uc001qab.3_Intron	NM_001005467	NP_001005467	Q8NGG8	OR8B3_HUMAN	olfactory receptor, family 8, subfamily B,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		GCGATCATATGCCATTGAGGT	0.393													4	58	---	---	---	---	PASS
ITFG2	55846	broad.mit.edu	37	12	2929370	2929370	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2929370G>A	uc001qlb.1	+	5	589	c.525G>A	c.(523-525)AAG>AAA	p.K175K	ITFG2_uc010seb.1_5'UTR|ITFG2_uc010sec.1_RNA	NM_018463	NP_060933	Q969R8	ITFG2_HUMAN	integrin alpha FG-GAP repeat containing 2	175											0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGTCCCTCAAGAAATGGATGC	0.602													5	26	---	---	---	---	PASS
KCNA1	3736	broad.mit.edu	37	12	5021420	5021420	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5021420G>T	uc001qnh.2	+	2	1981	c.876G>T	c.(874-876)AGG>AGT	p.R292S		NM_000217	NP_000208	Q09470	KCNA1_HUMAN	potassium voltage-gated channel subfamily A	292	Helical; Voltage-sensor; Name=Segment S4; (Potential).				synaptic transmission	juxtaparanode region of axon|voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium ion transmembrane transporter activity			ovary(1)|skin(1)	2					Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	CCATCCTCAGGGTCATCCGCT	0.552													54	102	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7649411	7649411	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7649411G>T	uc001qsz.3	-	5	1225	c.1097C>A	c.(1096-1098)TCT>TAT	p.S366Y	CD163_uc001qta.3_Missense_Mutation_p.S366Y|CD163_uc009zfw.2_Missense_Mutation_p.S366Y	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	366	SRCR 3.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TAACTTACCAGAACATGTCAC	0.343													60	144	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9316787	9316787	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9316787A>G	uc001qvl.2	-	20	2585	c.2556T>C	c.(2554-2556)TAT>TAC	p.Y852Y	PZP_uc009zgl.2_Intron|PZP_uc010sgo.1_RNA|PZP_uc009zgm.1_Intron	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						CACAGATACAATAGGATTCTT	0.468													105	186	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21196331	21196331	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21196331T>A	uc010sin.1	+	6	650	c.650T>A	c.(649-651)GTG>GAG	p.V217E	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Missense_Mutation_p.V264E	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	217						membrane	transporter activity				0						GGTTTCCTTGTGTCTGGAATA	0.358													110	170	---	---	---	---	PASS
SLCO1A2	6579	broad.mit.edu	37	12	21453281	21453281	+	Splice_Site	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21453281C>A	uc001rer.2	-	7	1161	c.910_splice	c.e7+1	p.D304_splice	SLCO1A2_uc001res.2_Splice_Site_p.D304_splice|SLCO1A2_uc010siq.1_Splice_Site_p.D172_splice|SLCO1A2_uc010sio.1_Splice_Site_p.D172_splice|SLCO1A2_uc010sip.1_Splice_Site_p.D172_splice|SLCO1A2_uc001ret.2_Splice_Site_p.D302_splice|SLCO1A2_uc001reu.2_Splice_Site_p.D284_splice	NM_021094	NP_066580	P46721	SO1A2_HUMAN	organic anion transporting polypeptide A						bile acid metabolic process|sodium-independent organic anion transport	integral to membrane|plasma membrane	bile acid transmembrane transporter activity|organic anion transmembrane transporter activity			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						TGTATATTTGCCTTTAGTGAT	0.299													28	76	---	---	---	---	PASS
DDX11	1663	broad.mit.edu	37	12	31241998	31241998	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31241998A>G	uc001rjt.1	+	7	956	c.705A>G	c.(703-705)ACA>ACG	p.T235T	DDX11_uc010sjw.1_Silent_p.T235T|DDX11_uc010sjx.1_RNA|DDX11_uc001rjr.1_Silent_p.T235T|DDX11_uc001rjs.1_Silent_p.T235T|DDX11_uc001rju.1_5'UTR|DDX11_uc001rjv.1_Silent_p.T235T|DDX11_uc001rjw.1_Silent_p.T209T|DDX11_uc001rjx.1_5'UTR|DDX11_uc009zjn.1_RNA	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11	235	Helicase ATP-binding.				G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					GTAGTCGGACACACTCCCAGC	0.522										Multiple Myeloma(12;0.14)			14	303	---	---	---	---	PASS
ADCY6	112	broad.mit.edu	37	12	49168312	49168312	+	Intron	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49168312C>G	uc001rsh.3	-						ADCY6_uc001rsj.3_Intron|ADCY6_uc001rsi.3_Intron|ADCY6_uc010slw.1_Intron	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						CTAGAGGCATCAAGAGACCAA	0.572													51	42	---	---	---	---	PASS
DPY19L2	283417	broad.mit.edu	37	12	63964606	63964606	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63964606C>G	uc001srp.1	-	20	2113	c.1932G>C	c.(1930-1932)ATG>ATC	p.M644I	DPY19L2_uc010sso.1_Missense_Mutation_p.M91I	NM_173812	NP_776173	Q6NUT2	D19L2_HUMAN	dpy-19-like 2	644					multicellular organismal development|spermatid development	integral to membrane				central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;2.77e-05)	GBM - Glioblastoma multiforme(28;0.044)		TGATGCTTGCCATTGTAGGCA	0.373													52	60	---	---	---	---	PASS
CPM	1368	broad.mit.edu	37	12	69265737	69265737	+	Splice_Site	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69265737C>G	uc001sup.2	-	4	320	c.259_splice	c.e4-1	p.T87_splice	CPM_uc001sur.2_Splice_Site_p.T87_splice|CPM_uc001suq.2_Splice_Site_p.T87_splice	NM_198320	NP_938079	P14384	CBPM_HUMAN	carboxypeptidase M precursor						anatomical structure morphogenesis|proteolysis	anchored to membrane|cytoplasm|nucleus|plasma membrane	metallocarboxypeptidase activity|zinc ion binding				0	all_epithelial(5;1.09e-35)|Lung NSC(4;1.47e-33)|all_lung(4;1.02e-31)|Breast(13;1.59e-06)		all cancers(2;2.69e-50)|GBM - Glioblastoma multiforme(2;7.34e-41)|BRCA - Breast invasive adenocarcinoma(5;5.38e-10)|Lung(24;4.61e-05)|LUAD - Lung adenocarcinoma(15;0.000376)|STAD - Stomach adenocarcinoma(21;0.00372)|Kidney(9;0.143)			GCCCAACAGTCTATATGTGTT	0.443													53	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80730221	80730221	+	IGR	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80730221C>G								PPP1R12A (400986 upstream) : PTPRQ (107905 downstream)																							CAGAACTGAGCATTATTACAT	0.318													32	24	---	---	---	---	PASS
CCDC38	120935	broad.mit.edu	37	12	96312661	96312661	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96312661T>G	uc001tek.1	-	3	365	c.131A>C	c.(130-132)AAG>ACG	p.K44T		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	44										skin(1)	1						TACCGTTTCCTTTGCTGCCAT	0.358													58	50	---	---	---	---	PASS
DDX54	79039	broad.mit.edu	37	12	113599121	113599121	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113599121G>T	uc001tup.2	-	19	2395	c.2367C>A	c.(2365-2367)GAC>GAA	p.D789E	DDX54_uc001tuq.3_Missense_Mutation_p.D789E	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	789					estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						GGCCTCGCCGGTCAGATGCCC	0.572													53	33	---	---	---	---	PASS
SDS	10993	broad.mit.edu	37	12	113831701	113831701	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113831701G>A	uc001tvg.2	-	7	896	c.774C>T	c.(772-774)TTC>TTT	p.F258F		NM_006843	NP_006834	P20132	SDHL_HUMAN	serine dehydratase	258					gluconeogenesis|L-serine catabolic process|pyruvate biosynthetic process	cytoplasm	L-serine ammonia-lyase activity|L-threonine ammonia-lyase activity|protein homodimerization activity|pyridoxal phosphate binding			pancreas(1)	1					L-Serine(DB00133)|Pyridoxal Phosphate(DB00114)	ACATACCCACGAACTTCTCAA	0.567													72	56	---	---	---	---	PASS
CABP1	9478	broad.mit.edu	37	12	121098054	121098054	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121098054C>T	uc001tyu.2	+	3	808	c.741C>T	c.(739-741)TGC>TGT	p.C247C	CABP1_uc001tyv.2_Silent_p.C104C|CABP1_uc001tyw.2_Silent_p.C44C|CABP1_uc001tyx.2_Silent_p.C89C	NM_001033677	NP_001028849	Q9NZU7	CABP1_HUMAN	calcium binding protein 1 isoform 3	247	1.|EF-hand 1.					cell cortex|cell junction|Golgi apparatus|perinuclear region of cytoplasm|postsynaptic density|postsynaptic membrane	calcium ion binding|calcium-dependent protein binding|enzyme inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACATCAACTGCCGGGATCTGG	0.572													12	83	---	---	---	---	PASS
MPHOSPH9	10198	broad.mit.edu	37	12	123687280	123687280	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123687280C>A	uc001uel.2	-	6	1323	c.1216G>T	c.(1216-1218)GTC>TTC	p.V406F	MPHOSPH9_uc010tal.1_Intron|MPHOSPH9_uc010tam.1_RNA|MPHOSPH9_uc001uem.2_Intron	NM_022782	NP_073619	Q99550	MPP9_HUMAN	M-phase phosphoprotein 9	406					M phase of mitotic cell cycle	centriole|Golgi membrane					0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000182)|Epithelial(86;0.00046)|BRCA - Breast invasive adenocarcinoma(302;0.169)		GCAACCATGACAGTGTTTTCT	0.448													26	152	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133324531	133324531	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133324531C>T	uc001ukx.2	-	5	1184	c.1117G>A	c.(1117-1119)GTC>ATC	p.V373I	ANKLE2_uc001uky.3_Missense_Mutation_p.V311I	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	373						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TTCTCCAGGACGTCCAGAGTC	0.547													25	108	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20000609	20000609	+	Missense_Mutation	SNP	C	G	G	rs141691551	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20000609C>G	uc001umd.2	-	19	1562	c.1351G>C	c.(1351-1353)GGT>CGT	p.G451R	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Missense_Mutation_p.G340R|TPTE2_uc001ume.2_Missense_Mutation_p.G374R|TPTE2_uc009zzm.2_Missense_Mutation_p.G122R|TPTE2_uc010tcm.1_RNA|TPTE2_uc010tcl.1_Missense_Mutation_p.G122R	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	451	C2 tensin-type.					endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		AGAGGTGGACCGTCATATACA	0.338													25	119	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26144967	26144967	+	Silent	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26144967T>G	uc001uqk.2	+	17	1678	c.1536T>G	c.(1534-1536)CCT>CCG	p.P512P	ATP8A2_uc010tdi.1_Silent_p.P472P|ATP8A2_uc010tdj.1_RNA|ATP8A2_uc010aaj.1_Silent_p.P22P|ATP8A2_uc001uql.1_Silent_p.P472P	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,	472	Cytoplasmic (Potential).				ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CGGTTGTTCCTGAGAAGGATG	0.587													4	112	---	---	---	---	PASS
MAB21L1	4081	broad.mit.edu	37	13	36049898	36049898	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36049898G>A	uc001uvc.2	-	1	935	c.378C>T	c.(376-378)CGC>CGT	p.R126R	NBEA_uc001uvb.2_Intron|NBEA_uc010abi.2_Intron|NBEA_uc010tee.1_Intron|NBEA_uc010tef.1_5'Flank|NBEA_uc010teg.1_5'Flank	NM_005584	NP_005575	Q13394	MB211_HUMAN	mab-21-like protein 1	126					anatomical structure morphogenesis	nucleus				ovary(2)	2		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		ACCGGATTTTGCGCGCCGAGA	0.592													15	49	---	---	---	---	PASS
SIAH3	283514	broad.mit.edu	37	13	46358134	46358134	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46358134G>A	uc001vap.2	-	2	276	c.194C>T	c.(193-195)CCT>CTT	p.P65L		NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN	seven in absentia homolog 3	65	SIAH-type; degenerate.|His-rich.				multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2						GAGATGGTGAGGGTGGAAGCT	0.398													8	49	---	---	---	---	PASS
TBC1D4	9882	broad.mit.edu	37	13	75915705	75915705	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75915705G>T	uc001vjl.1	-	6	1774	c.1427C>A	c.(1426-1428)GCC>GAC	p.A476D	TBC1D4_uc010aer.2_Missense_Mutation_p.A476D|TBC1D4_uc010aes.2_Missense_Mutation_p.A476D	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	476						cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		CACCAGCTTGGCTCTTGGTGG	0.433													21	44	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76407256	76407256	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76407256A>G	uc001vjv.2	+	13	3080	c.2320A>G	c.(2320-2322)ATA>GTA	p.I774V	LMO7_uc010thv.1_Missense_Mutation_p.I725V|LMO7_uc001vjt.1_Missense_Mutation_p.I673V|LMO7_uc010thw.1_Missense_Mutation_p.I624V|LMO7_uc001vjw.1_Missense_Mutation_p.I680V	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	1059	PDZ.					cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		TGGGTTTACAATAAAATGGGA	0.393													34	45	---	---	---	---	PASS
LIG4	3981	broad.mit.edu	37	13	108862550	108862550	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108862550T>A	uc001vqn.2	-	2	1340	c.1067A>T	c.(1066-1068)GAG>GTG	p.E356V	LIG4_uc001vqo.2_Missense_Mutation_p.E356V|LIG4_uc010agg.1_Missense_Mutation_p.E289V|LIG4_uc010agf.2_Missense_Mutation_p.E356V|LIG4_uc001vqp.2_Missense_Mutation_p.E356V	NM_002312	NP_002303	P49917	DNLI4_HUMAN	DNA ligase IV	356					cell cycle|cell division|cell proliferation|central nervous system development|chromosome organization|DNA ligation involved in DNA recombination|DNA ligation involved in DNA repair|DNA replication|double-strand break repair via nonhomologous end joining|in utero embryonic development|initiation of viral infection|isotype switching|negative regulation of neuron apoptosis|neuron apoptosis|nucleotide-excision repair, DNA gap filling|positive regulation of fibroblast proliferation|positive regulation of neurogenesis|pro-B cell differentiation|provirus integration|response to gamma radiation|response to X-ray|single strand break repair|somatic stem cell maintenance|T cell differentiation in thymus|T cell receptor V(D)J recombination	condensed chromosome|cytoplasm|DNA ligase IV complex|DNA-dependent protein kinase-DNA ligase 4 complex|focal adhesion|nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding|protein C-terminus binding				0	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					ATCAGAATCCTCTACCATTCT	0.328								NHEJ					30	148	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22356168	22356168	+	Intron	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22356168G>T	uc001wbw.2	+						uc010tmg.1_Intron|uc010tmh.1_Intron|uc010aiv.1_Silent_p.V10V|uc001wby.2_Intron					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TTTTACTAGTGATCCTGTGGC	0.368													5	34	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23884917	23884917	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884917T>C	uc001wjx.2	-	35	5184	c.5078A>G	c.(5077-5079)GAG>GGG	p.E1693G		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1693	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTCTGTCTGCTCCACCACGGC	0.632													16	72	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360908	42360908	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360908C>A	uc001wvm.2	+	4	3039	c.1841C>A	c.(1840-1842)TCA>TAA	p.S614*	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	614	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		ATTCAATCTTCAGAAACTTGT	0.478										HNSCC(30;0.082)			19	53	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47426643	47426643	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47426643A>C	uc001wwj.3	-	9	2012	c.1816T>G	c.(1816-1818)TAT>GAT	p.Y606D	MDGA2_uc001wwi.3_Missense_Mutation_p.Y377D|MDGA2_uc010ani.2_Missense_Mutation_p.Y166D	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	606	Ig-like 6.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TAAACCCCATAGTTTTCATTG	0.398													17	88	---	---	---	---	PASS
C14orf183	196913	broad.mit.edu	37	14	50559321	50559321	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50559321C>T	uc010tqk.1	-	1	41	c.41G>A	c.(40-42)AGA>AAA	p.R14K		NM_001014830	NP_001014830	Q8WXQ3	CN183_HUMAN	hypothetical protein LOC196913	14											0						ACGTTTGGCTCTGACATCCAT	0.368													26	68	---	---	---	---	PASS
CDKL1	8814	broad.mit.edu	37	14	50799106	50799106	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50799106C>T	uc001wxz.2	-	8	871	c.843G>A	c.(841-843)CAG>CAA	p.Q281Q	ATP5S_uc010ant.1_Intron	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	280	Protein kinase.					cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)					GATGCAACAGCTGTTCACATG	0.383													40	134	---	---	---	---	PASS
NIN	51199	broad.mit.edu	37	14	51245526	51245526	+	Intron	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:51245526G>A	uc001wym.2	-						NIN_uc001wyi.2_Intron|NIN_uc001wyj.2_Intron|NIN_uc001wyk.2_Intron|NIN_uc010tqp.1_Intron|NIN_uc001wyo.2_Intron|NIN_uc001wyp.1_Intron	NM_182946	NP_891991	Q8N4C6	NIN_HUMAN	ninein isoform 5						centrosome localization	centrosome|microtubule	calcium ion binding|GTP binding|protein binding			skin(3)|ovary(1)|kidney(1)|central_nervous_system(1)	6	all_epithelial(31;0.00244)|Breast(41;0.127)					TCCAGTGCTAGAGAAGGCAAG	0.502			T	PDGFRB	MPD								32	93	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58605813	58605813	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58605813T>A	uc001xdc.2	-	2	375	c.264A>T	c.(262-264)AAA>AAT	p.K88N	C14orf37_uc010tro.1_Missense_Mutation_p.K126N|C14orf37_uc001xdd.2_Missense_Mutation_p.K88N|C14orf37_uc001xde.2_Missense_Mutation_p.K88N	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	88	Extracellular (Potential).					integral to membrane	binding				0						TCGAGAATGCTTTATTTAATG	0.473													35	108	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65266561	65266561	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65266561G>T	uc001xht.2	-	8	1022	c.968C>A	c.(967-969)ACT>AAT	p.T323N	SPTB_uc001xhr.2_Missense_Mutation_p.T323N|SPTB_uc001xhs.2_Missense_Mutation_p.T323N|SPTB_uc001xhu.2_Missense_Mutation_p.T323N	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	323	Spectrin 1.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GTTCAGGACAGTGATGGTCTG	0.557											OREG0022735	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	86	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92959967	92959967	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92959967G>C	uc001yak.2	+	17	1837	c.1813G>C	c.(1813-1815)GAT>CAT	p.D605H	SLC24A4_uc001yai.2_Missense_Mutation_p.D558H|SLC24A4_uc010twm.1_Missense_Mutation_p.D603H|SLC24A4_uc001yaj.2_Missense_Mutation_p.D586H|SLC24A4_uc010auj.2_3'UTR|SLC24A4_uc010twn.1_Missense_Mutation_p.D378H|SLC24A4_uc001yan.2_Missense_Mutation_p.D316H	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	622	Extracellular (Potential).					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		CCGGGAAGACGATTAGCGCTG	0.547													15	31	---	---	---	---	PASS
DLK1	8788	broad.mit.edu	37	14	101201173	101201173	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101201173C>A	uc001yhs.3	+	5	1245	c.1092C>A	c.(1090-1092)ATC>ATA	p.I364I	DLK1_uc001yhu.3_Silent_p.I291I	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog precursor	364	Cytoplasmic (Potential).				multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)				TCAACATCATCTTCCCCGAGA	0.572													52	169	---	---	---	---	PASS
DLK1	8788	broad.mit.edu	37	14	101201174	101201174	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:101201174T>G	uc001yhs.3	+	5	1246	c.1093T>G	c.(1093-1095)TTC>GTC	p.F365V	DLK1_uc001yhu.3_Missense_Mutation_p.F292V	NM_003836	NP_003827	P80370	DLK1_HUMAN	delta-like 1 homolog precursor	365	Cytoplasmic (Potential).				multicellular organismal development	extracellular space|integral to membrane|soluble fraction				ovary(2)|breast(1)|skin(1)	4		Melanoma(154;0.155)				CAACATCATCTTCCCCGAGAA	0.577													52	171	---	---	---	---	PASS
BAG5	9529	broad.mit.edu	37	14	104027168	104027168	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104027168A>C	uc001yni.1	-	2	568	c.334T>G	c.(334-336)TTT>GTT	p.F112V	KLC1_uc010tyd.1_5'Flank|BAG5_uc001ynh.1_Missense_Mutation_p.F153V|BAG5_uc001ynj.1_Missense_Mutation_p.F112V|C14orf153_uc001ynl.3_5'Flank|C14orf153_uc010tyc.1_5'Flank	NM_004873	NP_004864	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5 isoform b	112	BAG 2.				apoptosis|negative regulation of protein refolding|negative regulation of ubiquitin-protein ligase activity|neuron death|protein folding|regulation of inclusion body assembly	inclusion body|perinuclear region of cytoplasm	chaperone binding|ubiquitin protein ligase binding			ovary(2)	2		Melanoma(154;0.155)	Epithelial(46;0.144)			CCATTATAAAATGGCACAATT	0.423													41	175	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105411766	105411766	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105411766T>A	uc010axc.1	-	7	10142	c.10022A>T	c.(10021-10023)GAC>GTC	p.D3341V	AHNAK2_uc001ypx.2_Missense_Mutation_p.D3241V	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3341						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGGCTCACGTCGGCCTCCGC	0.622													57	219	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107078598	107078598	+	RNA	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107078598C>A	uc010tyt.1	-	117		c.5692G>T								Parts of antibodies, mostly variable regions.												0						ATCCAGAAGCCTTGCAGGAGA	0.562													6	97	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	27128478	27128478	+	Intron	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27128478C>G	uc001zbb.2	-						GABRA5_uc001zbd.1_Intron	NM_021912	NP_068712	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CCTTCCTTTCCACTAGGAGTA	0.597													58	71	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27222257	27222257	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27222257G>C	uc001zbg.1	+	2	328	c.162G>C	c.(160-162)TTG>TTC	p.L54F	GABRG3_uc001zbf.2_Missense_Mutation_p.L54F	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	54	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		TCAACAAGTTGCTAAGAGAAT	0.358													57	56	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28391416	28391416	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28391416C>T	uc001zbj.2	-	71	11081	c.10975G>A	c.(10975-10977)GAC>AAC	p.D3659N		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3659					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		TTGACGCCGTCCATGACTGTG	0.562													45	45	---	---	---	---	PASS
ACAN	176	broad.mit.edu	37	15	89400853	89400853	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89400853A>T	uc010upo.1	+	12	5411	c.5037A>T	c.(5035-5037)GAA>GAT	p.E1679D	ACAN_uc010upp.1_Missense_Mutation_p.E1679D|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	1679					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTGAACTGGAAGGGAGGGGAA	0.517													7	212	---	---	---	---	PASS
OR4F15	390649	broad.mit.edu	37	15	102358988	102358988	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:102358988C>G	uc010uts.1	+	1	599	c.599C>G	c.(598-600)ACT>AGT	p.T200S		NM_001001674	NP_001001674	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F,	200	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			TTCATGGTCACTGTCAATAGT	0.438													5	263	---	---	---	---	PASS
CCNF	899	broad.mit.edu	37	16	2503520	2503520	+	Missense_Mutation	SNP	C	T	T	rs142982582		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2503520C>T	uc002cqd.1	+	15	1785	c.1697C>T	c.(1696-1698)TCG>TTG	p.S566L	CCNF_uc002cqe.1_Missense_Mutation_p.S258L	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F	566					cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				AGCTCTCCCTCGGGGCGGAGA	0.602													23	66	---	---	---	---	PASS
CLDN9	9080	broad.mit.edu	37	16	3063428	3063428	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3063428T>C	uc010uwo.1	+	1	972	c.65T>C	c.(64-66)CTG>CCG	p.L22P		NM_020982	NP_066192	O95484	CLD9_HUMAN	claudin 9	22	Helical; (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CTGGGGACCCTGGTGTCCTGC	0.667													20	24	---	---	---	---	PASS
USP7	7874	broad.mit.edu	37	16	8988925	8988925	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8988925C>T	uc002czl.2	-	28	3201	c.3002G>A	c.(3001-3003)GGA>GAA	p.G1001E	USP7_uc010uyk.1_Missense_Mutation_p.G902E|USP7_uc002czj.2_RNA|USP7_uc010uyj.1_Missense_Mutation_p.G902E|USP7_uc002czk.2_Missense_Mutation_p.G985E	NM_003470	NP_003461	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7	1001					interspecies interaction between organisms|multicellular organismal development|protein deubiquitination|regulation of sequence-specific DNA binding transcription factor activity|ubiquitin-dependent protein catabolic process	cytoplasm|PML body	cysteine-type endopeptidase activity|p53 binding|protein C-terminus binding|transcription factor binding|ubiquitin protein ligase binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(3)	3						TCCGAACGTTCCGAAGACCTC	0.522													89	181	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20494469	20494469	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20494469A>G	uc010bwe.2	+	14	1838	c.1599A>G	c.(1597-1599)TCA>TCG	p.S533S	ACSM2A_uc002dhf.3_Silent_p.S533S|ACSM2A_uc002dhg.3_Silent_p.S533S|ACSM2A_uc010vay.1_Silent_p.S454S|ACSM2A_uc002dhh.3_Silent_p.S163S	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	533					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						ATGTGAAGTCAGTGACAGCCC	0.473													76	71	---	---	---	---	PASS
AQP8	343	broad.mit.edu	37	16	25228740	25228740	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25228740C>A	uc002doc.2	+	2	316	c.234C>A	c.(232-234)CTC>CTA	p.L78L		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	78	Extracellular (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		CTTTGGGGCTCGTGATTGCCA	0.597													82	62	---	---	---	---	PASS
CNOT1	23019	broad.mit.edu	37	16	58585606	58585606	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58585606C>A	uc002env.2	-	23	3381	c.3088G>T	c.(3088-3090)GCT>TCT	p.A1030S	CNOT1_uc002enw.2_RNA|CNOT1_uc002enu.3_Missense_Mutation_p.A1025S|CNOT1_uc002enx.2_Missense_Mutation_p.A1030S|CNOT1_uc002enz.1_Missense_Mutation_p.A459S|CNOT1_uc010vik.1_Missense_Mutation_p.A26S	NM_016284	NP_057368	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1030					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol				ovary(4)|central_nervous_system(2)	6				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		GCAAGAGGAGCTTTTGCTGGA	0.413													4	189	---	---	---	---	PASS
DPEP2	64174	broad.mit.edu	37	16	68025838	68025838	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68025838C>T	uc010cey.2	-	4	729	c.565G>A	c.(565-567)GGT>AGT	p.G189S	DPEP2_uc002evd.3_Missense_Mutation_p.G189S|DPEP2_uc002eve.2_Missense_Mutation_p.G189S|DPEP2_uc002evf.2_RNA|DPEP2_uc002evg.2_3'UTR	NM_022355	NP_071750	Q9H4A9	DPEP2_HUMAN	dipeptidase 2 precursor	189					hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|proteolysis	anchored to membrane|plasma membrane	dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metalloexopeptidase activity			skin(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		GAGTGGCCACCCTCTACACCG	0.557													28	29	---	---	---	---	PASS
BCAR1	9564	broad.mit.edu	37	16	75263572	75263572	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75263572T>A	uc002fdv.2	-	7	2573	c.2450A>T	c.(2449-2451)AAC>ATC	p.N817I	BCAR1_uc002fdt.2_Missense_Mutation_p.N270I|BCAR1_uc002fdu.2_Missense_Mutation_p.N607I|BCAR1_uc010cgu.2_Missense_Mutation_p.N806I|BCAR1_uc010vna.1_Missense_Mutation_p.N815I|BCAR1_uc010vnb.1_Missense_Mutation_p.N863I|BCAR1_uc002fdw.2_Missense_Mutation_p.N817I|BCAR1_uc010vnc.1_Missense_Mutation_p.N669I|BCAR1_uc010vnd.1_Missense_Mutation_p.N835I|BCAR1_uc002fdx.2_Missense_Mutation_p.N835I	NM_014567	NP_055382	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	817					actin filament organization|B cell receptor signaling pathway|blood coagulation|cell adhesion|cell division|cell migration|cell proliferation|epidermal growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|insulin receptor signaling pathway|integrin-mediated signaling pathway|nerve growth factor receptor signaling pathway|platelet-derived growth factor receptor signaling pathway|positive regulation of cell migration|regulation of apoptosis|regulation of cell growth|T cell receptor signaling pathway	cytosol|focal adhesion|membrane fraction|ruffle	protein kinase binding|protein phosphatase binding|SH3 domain binding|signal transducer activity			central_nervous_system(5)|breast(2)|prostate(1)	8				BRCA - Breast invasive adenocarcinoma(221;0.169)		GCACAGCAGGTTGCTGTAGTG	0.652													12	24	---	---	---	---	PASS
KIAA0182	23199	broad.mit.edu	37	16	85688444	85688444	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85688444C>A	uc002fix.2	+	5	718	c.644C>A	c.(643-645)ACC>AAC	p.T215N	KIAA0182_uc002fiw.2_Missense_Mutation_p.T111N|KIAA0182_uc002fiy.2_Missense_Mutation_p.T142N	NM_014615	NP_055430	Q14687	GSE1_HUMAN	genetic suppressor element 1 isoform 1	215							protein binding			large_intestine(3)|ovary(1)|skin(1)	5						AGTACCGTGACCGAGGACTAC	0.687													7	23	---	---	---	---	PASS
ABR	29	broad.mit.edu	37	17	910418	910418	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:910418T>A	uc002fsd.2	-	22	2587	c.2477A>T	c.(2476-2478)GAC>GTC	p.D826V	ABR_uc002fse.2_Missense_Mutation_p.D780V|ABR_uc010vqf.1_Missense_Mutation_p.D277V|ABR_uc010vqg.1_Missense_Mutation_p.D608V|ABR_uc002fsg.2_Missense_Mutation_p.D789V|ABR_uc002fsf.2_Missense_Mutation_p.D363V	NM_021962	NP_068781	Q12979	ABR_HUMAN	active breakpoint cluster region-related	826	Rho-GAP.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		CGCCATGACGTCATGGGACCA	0.657													27	22	---	---	---	---	PASS
ATP2A3	489	broad.mit.edu	37	17	3844354	3844354	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3844354G>C	uc002fxb.1	-	14	2162	c.2011C>G	c.(2011-2013)CGC>GGC	p.R671G	ATP2A3_uc002fwx.1_Missense_Mutation_p.R671G|ATP2A3_uc002fwy.1_Missense_Mutation_p.R671G|ATP2A3_uc002fwz.1_Missense_Mutation_p.R671G|ATP2A3_uc002fxa.1_Missense_Mutation_p.R671G|ATP2A3_uc002fxc.1_Missense_Mutation_p.R671G|ATP2A3_uc002fxd.1_Missense_Mutation_p.R671G	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b	671	Cytoplasmic (By similarity).				ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		CGGGCGGTGCGGCAGGCCTGG	0.652													48	45	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10364342	10364342	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10364342A>G	uc002gmn.2	-	12	1149	c.1038T>C	c.(1036-1038)GCT>GCC	p.A346A	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	346	Myosin head-like.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						CCTTTTCATCAGCAGTGAAAC	0.483													47	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	14673539	14673539	+	IGR	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14673539C>G								HS3ST3B1 (424047 upstream) : PMP22 (459558 downstream)																							GTGGCTGGTCCCAGTTTTTTT	0.453													13	24	---	---	---	---	PASS
KRT12	3859	broad.mit.edu	37	17	39023052	39023052	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39023052C>T	uc002hvk.2	-	1	411	c.387G>A	c.(385-387)ATG>ATA	p.M129I		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	129	Rod.|Coil 1A.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				TAAGATTTTGCATAGTTTCTT	0.448													116	276	---	---	---	---	PASS
ETV4	2118	broad.mit.edu	37	17	41610575	41610575	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41610575A>G	uc002idw.2	-	7	653	c.525T>C	c.(523-525)CAT>CAC	p.H175H	ETV4_uc002idv.2_5'Flank|ETV4_uc010wih.1_Intron|ETV4_uc010czh.2_Silent_p.H174H|ETV4_uc010wii.1_Silent_p.H136H|ETV4_uc002idx.2_Silent_p.H175H|ETV4_uc010wij.1_Silent_p.H136H|ETV4_uc002idy.1_Silent_p.H136H	NM_001986	NP_001977	P43268	ETV4_HUMAN	ets variant gene 4 (E1A enhancer binding	175	Gln-rich.				positive regulation of transcription, DNA-dependent	nucleolus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		EWSR1/ETV4(6)	bone(4)|soft_tissue(2)|ovary(1)	7		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.0798)		CGAGGTACCCATGGCCAGGGT	0.577			T	EWSR1|TMPRSS2|DDX5|KLK2|CANT1	Ewing sarcoma|Prostate carcinoma								59	126	---	---	---	---	PASS
GRN	2896	broad.mit.edu	37	17	42428831	42428831	+	Intron	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42428831A>C	uc002igp.1	+						GRN_uc002igr.1_Intron	NM_002087	NP_002078	P28799	GRN_HUMAN	granulin precursor						signal transduction	extracellular space	cytokine activity|growth factor activity			ovary(2)|central_nervous_system(2)|skin(1)	5		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		TTACCCAGGTACCCAGGGGTG	0.642													24	45	---	---	---	---	PASS
WNT3	7473	broad.mit.edu	37	17	44851265	44851265	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44851265G>C	uc002ikv.2	-	2	210	c.91C>G	c.(91-93)CTG>GTG	p.L31V		NM_030753	NP_110380	P56703	WNT3_HUMAN	wingless-type MMTV integration site family,	31					canonical Wnt receptor signaling pathway involved in mesenchymal stem cell differentiation|canonical Wnt receptor signaling pathway involved in osteoblast differentiation|cellular response to retinoic acid|dorsal/ventral axis specification|embryonic forelimb morphogenesis|embryonic hindlimb morphogenesis|embryonic pattern specification|head morphogenesis|hemopoietic stem cell proliferation|inner ear morphogenesis|limb bud formation|mammary gland epithelium development|mesoderm formation|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|positive regulation of cell proliferation|Spemann organizer formation at the anterior end of the primitive streak|Wnt receptor signaling pathway, calcium modulating pathway	early endosome|extracellular space|late endosome|membrane fraction|membrane raft|plasma membrane|proteinaceous extracellular matrix	frizzled binding|frizzled-2 binding|signal transducer activity			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			TGCTGGCCCAGGGCCAGGGAC	0.622													6	33	---	---	---	---	PASS
SPAG9	9043	broad.mit.edu	37	17	49097545	49097545	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49097545C>G	uc002itc.2	-	8	1275	c.1066G>C	c.(1066-1068)GAT>CAT	p.D356H	SPAG9_uc002itb.2_Missense_Mutation_p.D342H|SPAG9_uc002itd.2_Missense_Mutation_p.D342H|SPAG9_uc002itf.2_Missense_Mutation_p.D177H|SPAG9_uc002ita.2_Missense_Mutation_p.D199H|SPAG9_uc002ite.2_Missense_Mutation_p.D186H	NM_001130528	NP_001124000	O60271	JIP4_HUMAN	sperm associated antigen 9 isoform 1	356					positive regulation of cell migration|positive regulation of muscle cell differentiation|retrograde transport, endosome to Golgi|spermatogenesis	acrosomal vesicle|integral to membrane|perinuclear region of cytoplasm				lung(4)|breast(1)	5			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			CCACTGAGATCTTTGTCCATA	0.403													3	125	---	---	---	---	PASS
PPM1E	22843	broad.mit.edu	37	17	56833427	56833427	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56833427C>A	uc002iwx.2	+	1	196	c.69C>A	c.(67-69)CGC>CGA	p.R23R	PPM1E_uc010ddd.2_5'UTR	NM_014906	NP_055721	Q8WY54	PPM1E_HUMAN	protein phosphatase 1E	23	Glu-rich.				protein dephosphorylation	cytoplasm|nucleolus|protein serine/threonine phosphatase complex	metal ion binding|protein serine/threonine phosphatase activity			breast(3)|lung(1)|skin(1)	5	Medulloblastoma(34;0.127)|all_neural(34;0.237)		BRCA - Breast invasive adenocarcinoma(1;5.76e-11)			GCGAGTTTCGCGGACCGTGCG	0.418													14	20	---	---	---	---	PASS
CSHL1	1444	broad.mit.edu	37	17	61987119	61987119	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61987119G>C	uc002jda.1	-	5	683	c.621C>G	c.(619-621)TTC>TTG	p.F207L	CSHL1_uc002jcz.1_Missense_Mutation_p.F184L|CSHL1_uc002jdb.1_Missense_Mutation_p.F113L|CSHL1_uc002jdc.1_Missense_Mutation_p.F124L|CSHL1_uc002jdd.1_Missense_Mutation_p.F145L|CSHL1_uc002jde.2_3'UTR|CSHL1_uc002jdf.2_3'UTR|CSHL1_uc002jdg.2_3'UTR|CSHL1_uc002jdh.2_3'UTR	NM_022579	NP_072101	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1	207						extracellular region	hormone activity|metal ion binding				0						CCATGCGCAGGAATGTCTCGA	0.597													43	102	---	---	---	---	PASS
FADS6	283985	broad.mit.edu	37	17	72888777	72888777	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72888777G>A	uc002jmd.1	-	2	242	c.230C>T	c.(229-231)GCA>GTA	p.A77V		NM_178128	NP_835229	Q8N9I5	FADS6_HUMAN	fatty acid desaturase domain family, member 6	83	Helical; (Potential).				fatty acid biosynthetic process	integral to membrane	oxidoreductase activity				0	all_lung(278;0.172)|Lung NSC(278;0.207)					GATGCCGGATGCAAAGACCAG	0.602													13	22	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73747045	73747045	+	Intron	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73747045C>T	uc002jpg.2	+						ITGB4_uc002jph.2_Intron|ITGB4_uc002jpi.3_Intron|ITGB4_uc002jpj.2_Intron	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor						cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGTATTCCCCGCTCCCTAGT	0.637													44	238	---	---	---	---	PASS
LAMA1	284217	broad.mit.edu	37	18	6961626	6961626	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6961626C>T	uc002knm.2	-	53	7679	c.7585G>A	c.(7585-7587)GGG>AGG	p.G2529R	LAMA1_uc002knl.2_5'UTR|LAMA1_uc010wzj.1_Missense_Mutation_p.G2005R	NM_005559	NP_005550	P25391	LAMA1_HUMAN	laminin, alpha 1 precursor	2529	Laminin G-like 3.				axon guidance|cell adhesion|cell surface receptor linked signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	extracellular space|laminin-1 complex|laminin-3 complex	extracellular matrix structural constituent|receptor binding			ovary(8)|large_intestine(4)|upper_aerodigestive_tract(2)|breast(2)|skin(2)|pancreas(2)|central_nervous_system(1)	21		Colorectal(10;0.172)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCACATCCCCGCCGAGGGCA	0.537													12	34	---	---	---	---	PASS
ROCK1	6093	broad.mit.edu	37	18	18622205	18622205	+	Intron	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:18622205T>G	uc002kte.2	-							NM_005406	NP_005397	Q13464	ROCK1_HUMAN	Rho-associated, coiled-coil containing protein						actin cytoskeleton organization|axon guidance|cellular component disassembly involved in apoptosis|cytokinesis|leukocyte tethering or rolling|membrane to membrane docking|Rho protein signal transduction	centriole|cytosol|Golgi membrane	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity			lung(2)|breast(2)|central_nervous_system(1)	5	Melanoma(1;0.165)					ACCTGAAAAATTGATAAAGAA	0.279													28	70	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22806795	22806795	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22806795G>A	uc002kvk.2	-	4	1334	c.1087C>T	c.(1087-1089)CTC>TTC	p.L363F	ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_Missense_Mutation_p.L363F|ZNF521_uc002kvl.2_Missense_Mutation_p.L143F	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521	363					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					TCCACTGAGAGGTTGGAATCT	0.582			T	PAX5	ALL								40	145	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31226214	31226214	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31226214G>T	uc010dmg.1	+	4	307	c.252G>T	c.(250-252)GAG>GAT	p.E84D	ASXL3_uc002kxq.2_Translation_Start_Site	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	84					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TACAGAAAGAGGAGTCGTCAT	0.383													22	38	---	---	---	---	PASS
POLI	11201	broad.mit.edu	37	18	51807181	51807181	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51807181C>G	uc002lfj.3	+	5	772	c.704C>G	c.(703-705)TCT>TGT	p.S235C	POLI_uc010xds.1_Intron|POLI_uc002lfk.3_Missense_Mutation_p.S132C|POLI_uc002lfl.1_Missense_Mutation_p.S167C|POLI_uc010dpg.2_5'Flank	NM_007195	NP_009126	Q9UNA4	POLI_HUMAN	DNA polymerase iota	235	UmuC.				DNA repair|DNA replication	nucleoplasm	damaged DNA binding|DNA-directed DNA polymerase activity|metal ion binding|protein binding			ovary(2)|kidney(1)	3				Colorectal(16;0.0234)|READ - Rectum adenocarcinoma(59;0.197)		AAATTAGTTTCTGGTGTCTTT	0.393								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					4	140	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59212338	59212338	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59212338G>A	uc010dps.1	+	9	1621	c.1609G>A	c.(1609-1611)GCT>ACT	p.A537T	CDH20_uc002lif.2_Missense_Mutation_p.A531T	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	537	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				GGCTCCTGAGGCTGCTAACAA	0.502													51	43	---	---	---	---	PASS
CD226	10666	broad.mit.edu	37	18	67614156	67614156	+	Missense_Mutation	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67614156T>A	uc010dqo.2	-	2	643	c.196A>T	c.(196-198)ACT>TCT	p.T66S	CD226_uc002lkm.3_Missense_Mutation_p.T66S	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor	66	Ig-like C2-type 1.|Extracellular (Potential).				cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				ATGCCATGAGTAGGGCTGAAA	0.453													23	29	---	---	---	---	PASS
ATP9B	374868	broad.mit.edu	37	18	77067172	77067172	+	Missense_Mutation	SNP	G	C	C	rs113878267	byFrequency	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77067172G>C	uc002lmx.2	+	15	1725	c.1711G>C	c.(1711-1713)GCA>CCA	p.A571P	ATP9B_uc002lmv.1_RNA|ATP9B_uc002lmw.1_Missense_Mutation_p.A571P|ATP9B_uc002lmz.1_Missense_Mutation_p.A265P	NM_198531	NP_940933	O43861	ATP9B_HUMAN	ATPase, class II, type 9B	571	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	aminophospholipid transporter activity|ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|cation-transporting ATPase activity|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(3)	3		Esophageal squamous(42;0.018)|Melanoma(33;0.0964)|Prostate(75;0.171)		OV - Ovarian serous cystadenocarcinoma(15;1.44e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0405)		GACTGAGTTCGCAGAGGCTGA	0.557													6	131	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1004634	1004634	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1004634G>A	uc002lqo.1	+	3	1134	c.1134G>A	c.(1132-1134)CGG>CGA	p.R378R		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	378	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	GGGACCCACGGGGCGCCCCGG	0.731													4	7	---	---	---	---	PASS
MIDN	90007	broad.mit.edu	37	19	1255693	1255693	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1255693G>T	uc002lrp.2	+	7	1644	c.1129G>T	c.(1129-1131)GGG>TGG	p.G377W		NM_177401	NP_796375	Q504T8	MIDN_HUMAN	midnolin	377						nucleolus					0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGCCCCCGGGTGAGTGGCC	0.692													6	7	---	---	---	---	PASS
NFIC	4782	broad.mit.edu	37	19	3382208	3382208	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3382208G>A	uc010xhi.1	+	2	591	c.529G>A	c.(529-531)GAC>AAC	p.D177N	NFIC_uc002lxo.2_Missense_Mutation_p.D168N|NFIC_uc010xhh.1_Missense_Mutation_p.D168N|NFIC_uc002lxp.2_Missense_Mutation_p.D177N|NFIC_uc010xhj.1_Missense_Mutation_p.D177N|NFIC_uc002lxq.1_Missense_Mutation_p.D129N	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2	177	CTF/NF-I.				DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		CAAGGAGCTGGACCTCTACCT	0.687													42	65	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10610247	10610247	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10610247C>A	uc002moq.1	-	2	619	c.463G>T	c.(463-465)GTC>TTC	p.V155F	KEAP1_uc002mor.1_Missense_Mutation_p.V155F	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	155					regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			CCGTTCATGACGTGGAGGACA	0.587													30	69	---	---	---	---	PASS
TNPO2	30000	broad.mit.edu	37	19	12817189	12817189	+	Intron	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12817189G>T	uc002muo.2	-						TNPO2_uc002mup.2_Intron|TNPO2_uc002muq.2_Intron|TNPO2_uc002mur.2_Intron	NM_001136196	NP_001129668	O14787	TNPO2_HUMAN	transportin 2 (importin 3, karyopherin beta 2b)						intracellular protein transport	cytoplasm|nucleus	nuclear localization sequence binding|protein binding|protein transporter activity			ovary(1)	1						GCACTGGTGGGAGGGAGGATG	0.592													4	99	---	---	---	---	PASS
CACNA1A	773	broad.mit.edu	37	19	13335510	13335510	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13335510C>T	uc010dze.2	-	38	5941	c.5705G>A	c.(5704-5706)CGC>CAC	p.R1902H	CACNA1A_uc010xnd.1_Missense_Mutation_p.R607H|CACNA1A_uc002mwx.3_Missense_Mutation_p.R607H|CACNA1A_uc010dzc.2_Missense_Mutation_p.R1427H|CACNA1A_uc002mwy.3_Missense_Mutation_p.R1901H|CACNA1A_uc002mwv.3_Missense_Mutation_p.R418H	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3	1902	Cytoplasmic (Potential).				cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	CAGGGCTGTGCGGATCAGAGC	0.607													5	25	---	---	---	---	PASS
OR10H2	26538	broad.mit.edu	37	19	15839471	15839471	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15839471G>T	uc002nbm.2	+	1	638	c.618G>T	c.(616-618)ATG>ATT	p.M206I		NM_013939	NP_039227	O60403	O10H2_HUMAN	olfactory receptor, family 10, subfamily H,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_hematologic(1;0.0517)|Acute lymphoblastic leukemia(2;0.074)					TATGTATCATGGCACTGCTGG	0.512													24	125	---	---	---	---	PASS
MYO9B	4650	broad.mit.edu	37	19	17311601	17311601	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17311601A>G	uc010eak.2	+	26	4678	c.4526A>G	c.(4525-4527)AAT>AGT	p.N1509S	MYO9B_uc002nfi.2_Missense_Mutation_p.N1509S|MYO9B_uc002nfj.1_Missense_Mutation_p.N1509S|MYO9B_uc002nfl.1_Missense_Mutation_p.N58S	NM_004145	NP_004136	Q13459	MYO9B_HUMAN	myosin IXB isoform 1	1509	Tail.				actin filament-based movement	cell cortex|cytosol|filamentous actin|myosin complex|perinuclear region of cytoplasm	actin binding|ADP binding|ATP binding|ATPase activity|calmodulin binding|metal ion binding|microfilament motor activity|Rho GTPase activator activity			breast(1)	1						ACCAACGCCAATGAGCTCAAG	0.572													25	126	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19337859	19337859	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19337859A>G	uc002nlz.2	+	7	1736	c.1637A>G	c.(1636-1638)AAT>AGT	p.N546S	NCAN_uc010ecc.1_Missense_Mutation_p.N110S	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	546					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			GATCTGACCAATGAGGTGGAT	0.602													11	61	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155187	22155187	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155187A>T	uc002nqp.2	-	5	2498	c.2349T>A	c.(2347-2349)CAT>CAA	p.H783Q	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TCTCTCCAGTATGAATTTTCT	0.373													29	66	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155416	22155416	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155416C>G	uc002nqp.2	-	5	2269	c.2120G>C	c.(2119-2121)TGT>TCT	p.C707S	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				ACATTCTTCACATTTGTAGGG	0.373													21	97	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22235430	22235430	+	5'UTR	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22235430T>A	uc010ecx.2	+	1					ZNF257_uc010ecy.2_5'UTR	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCTGGAAGCCTAGAAATGGTG	0.617													47	100	---	---	---	---	PASS
ZNF98	148198	broad.mit.edu	37	19	22574340	22574340	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22574340C>A	uc002nqt.2	-	4	1819	c.1697G>T	c.(1696-1698)AGA>ATA	p.R566I		NM_001098626	NP_001092096	A6NK75	ZNF98_HUMAN	zinc finger protein 98	566					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(12;0.0536)|all_lung(12;0.00187)|Lung NSC(12;0.0019)|all_epithelial(12;0.00542)|Hepatocellular(1079;0.244)				AGCACAATTTCTTTTATATTT	0.328													12	13	---	---	---	---	PASS
LRP3	4037	broad.mit.edu	37	19	33695549	33695549	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33695549G>T	uc010edh.2	+	4	359	c.266G>T	c.(265-267)CGC>CTC	p.R89L	LRP3_uc010xrp.1_5'UTR|LRP3_uc002nuk.3_5'UTR	NM_002333	NP_002324	O75074	LRP3_HUMAN	low density lipoprotein receptor-related protein	89	Extracellular (Potential).|CUB 1.				receptor-mediated endocytosis	coated pit|integral to membrane	receptor activity			pancreas(2)|ovary(1)	3	Esophageal squamous(110;0.137)					CGCAGCTTCCGCAACTTTGAC	0.687													63	233	---	---	---	---	PASS
NFKBID	84807	broad.mit.edu	37	19	36387039	36387039	+	Intron	SNP	T	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36387039T>A	uc002oci.1	-						NFKBID_uc002och.1_Intron|NFKBID_uc002ocj.1_Intron	NM_139239	NP_640332	Q8NI38	IKBD_HUMAN	nuclear factor of kappa light polypeptide gene						inflammatory response	nucleus					0						GCCTGCAGAATGGAGACAGTG	0.647													53	81	---	---	---	---	PASS
CATSPERG	57828	broad.mit.edu	37	19	38847171	38847171	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38847171G>T	uc002oih.3	+	10	1270	c.1183G>T	c.(1183-1185)GAG>TAG	p.E395*	CATSPERG_uc002oig.3_Nonsense_Mutation_p.E395*|CATSPERG_uc002oif.3_Nonsense_Mutation_p.E35*|CATSPERG_uc010efw.2_RNA	NM_021185	NP_067008	Q6ZRH7	CTSRG_HUMAN	cation channel, sperm-associated, gamma	395	Extracellular (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				ovary(1)|skin(1)	2						GTCTGTGTGCGAGCAGATAGG	0.612													4	191	---	---	---	---	PASS
SUPT5H	6829	broad.mit.edu	37	19	39964981	39964981	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39964981G>A	uc002olo.3	+	27	2938	c.2759G>A	c.(2758-2760)GGC>GAC	p.G920D	SUPT5H_uc002olp.3_Missense_Mutation_p.G920D|SUPT5H_uc002olq.3_Missense_Mutation_p.G916D|SUPT5H_uc002oln.3_Missense_Mutation_p.G920D|SUPT5H_uc002olr.3_Missense_Mutation_p.G920D|SUPT5H_uc002ols.1_Missense_Mutation_p.G543D	NM_001111020	NP_001104490	O00267	SPT5H_HUMAN	suppressor of Ty 5 homolog isoform a	920	10 X 8 AA approximate tandem repeats of P-[TS]-P-S-P-[QA]-[SG]-Y, motif CTR2.|CTR2-7; approximate.|Pro-rich.				cell cycle|chromatin remodeling|mRNA capping|negative regulation of transcription elongation, DNA-dependent|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription elongation from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|response to organic substance|retroviral genome replication|transcription elongation from RNA polymerase II promoter	nucleoplasm	enzyme binding|protein heterodimerization activity			ovary(3)|pancreas(1)	4	all_cancers(60;6.69e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;1.57e-06)|Ovarian(47;0.159)		Epithelial(26;3.9e-26)|all cancers(26;1.35e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			AGCCCAGCAGGCTACCAGAAT	0.637											OREG0025462	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	54	60	---	---	---	---	PASS
PPP1R13L	10848	broad.mit.edu	37	19	45899466	45899466	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45899466C>T	uc002pbn.2	-	6	940	c.863G>A	c.(862-864)TGG>TAG	p.W288*	PPP1R13L_uc002pbo.2_Nonsense_Mutation_p.W288*|PPP1R13L_uc002pbp.2_Nonsense_Mutation_p.W288*	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13	288	Pro-rich.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GCTCTCCCTCCAAGGCAACAG	0.692													11	11	---	---	---	---	PASS
SLC8A2	6543	broad.mit.edu	37	19	47935529	47935529	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47935529G>T	uc002pgx.2	-	9	2562	c.2284C>A	c.(2284-2286)CTC>ATC	p.L762I	SLC8A2_uc010xyq.1_Missense_Mutation_p.L518I|SLC8A2_uc010xyr.1_Missense_Mutation_p.L225I|SLC8A2_uc010ele.2_Missense_Mutation_p.L762I	NM_015063	NP_055878	Q9UPR5	NAC2_HUMAN	solute carrier family 8 member 2 precursor	762	Helical; (Potential).				cell communication|platelet activation	integral to membrane|plasma membrane	calcium:sodium antiporter activity|calmodulin binding			skin(3)|ovary(1)	4		all_cancers(25;3.05e-07)|all_lung(116;4.19e-06)|Lung NSC(112;7.16e-06)|all_epithelial(76;7.65e-06)|all_neural(266;0.0652)|Ovarian(192;0.086)|Breast(70;0.173)		OV - Ovarian serous cystadenocarcinoma(262;0.000501)|all cancers(93;0.00058)|Epithelial(262;0.0181)|GBM - Glioblastoma multiforme(486;0.0457)		AGGGCGGTGAGCAGGCCGATG	0.627													9	109	---	---	---	---	PASS
ZNF614	80110	broad.mit.edu	37	19	52521331	52521331	+	Silent	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52521331T>C	uc002pyj.2	-	4	570	c.168A>G	c.(166-168)GTA>GTG	p.V56V	ZNF614_uc002pyi.3_Silent_p.V56V|ZNF614_uc010epj.2_5'UTR	NM_025040	NP_079316	Q8N883	ZN614_HUMAN	zinc finger protein 614	56	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		ACTTGGAGAGTACATCTGGTT	0.398													80	97	---	---	---	---	PASS
SUV420H2	84787	broad.mit.edu	37	19	55853361	55853361	+	Silent	SNP	C	A	A	rs150127456		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55853361C>A	uc002qkj.3	+	2	305	c.57C>A	c.(55-57)ACC>ACA	p.T19T	SUV420H2_uc010esx.1_Silent_p.T19T|SUV420H2_uc002qkk.1_Silent_p.T19T|SUV420H2_uc002qkl.2_5'UTR	NM_032701	NP_116090	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2	19					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding				0	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		ACCTGGCCACCAGCCTCGTCC	0.662													70	100	---	---	---	---	PASS
NLRP11	204801	broad.mit.edu	37	19	56320536	56320536	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56320536C>T	uc010ygf.1	-	5	2151	c.1440G>A	c.(1438-1440)GAG>GAA	p.E480E	NLRP11_uc002qlz.2_Silent_p.E381E|NLRP11_uc002qmb.2_Silent_p.E381E|NLRP11_uc002qmc.2_RNA|NLRP11_uc010ete.1_RNA	NM_145007	NP_659444	P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	480							ATP binding			ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	6		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		GTTCTCTCTTCTCTTTATACT	0.398													104	156	---	---	---	---	PASS
NLRP8	126205	broad.mit.edu	37	19	56465914	56465914	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56465914A>G	uc002qmh.2	+	3	561	c.490A>G	c.(490-492)ATA>GTA	p.I164V	NLRP8_uc010etg.2_Missense_Mutation_p.I164V	NM_176811	NP_789781	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	164						cytoplasm	ATP binding			ovary(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|kidney(1)	13		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		GTTTTTCCCCATATGGGACAT	0.438													92	127	---	---	---	---	PASS
ZNF470	388566	broad.mit.edu	37	19	57089467	57089467	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57089467G>T	uc002qnl.3	+	6	2346	c.1670G>T	c.(1669-1671)AGA>ATA	p.R557I	ZNF470_uc010etn.2_Intron	NM_001001668	NP_001001668	Q6ECI4	ZN470_HUMAN	zinc finger protein 470	557	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0294)		CAGCACCAGAGAGTTCATACT	0.448													24	103	---	---	---	---	PASS
VN1R1	57191	broad.mit.edu	37	19	57967343	57967343	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57967343C>A	uc002qos.1	-	1	512	c.512G>T	c.(511-513)TGT>TTT	p.C171F	ZNF547_uc002qpm.3_Intron	NM_020633	NP_065684	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	171	Helical; Name=4; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		GAGGAGACAACAGAAGTCAAT	0.438													74	112	---	---	---	---	PASS
TRIB3	57761	broad.mit.edu	37	20	368728	368728	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:368728T>C	uc002wdm.2	+	2	580	c.74T>C	c.(73-75)TTA>TCA	p.L25S	TRIB3_uc002wdn.2_Missense_Mutation_p.L52S	NM_021158	NP_066981	Q96RU7	TRIB3_HUMAN	tribbles 3	25					apoptosis|cellular lipid metabolic process|insulin receptor signaling pathway|negative regulation of fat cell differentiation|negative regulation of fatty acid biosynthetic process|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein binding|positive regulation of ubiquitin-protein ligase activity|regulation of glucose transport|regulation of MAP kinase activity|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	cytosol|nucleus|plasma membrane	ATP binding|protein kinase activity|protein kinase binding|protein kinase inhibitor activity|transcription corepressor activity|ubiquitin protein ligase binding|ubiquitin-protein ligase regulator activity			central_nervous_system(2)	2		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		GATGACAACTTAGATACCGAG	0.592													57	152	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1895862	1895862	+	Missense_Mutation	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1895862T>C	uc002wfq.2	+	3	557	c.197T>C	c.(196-198)ATC>ACC	p.I66T	SIRPA_uc010zps.1_Missense_Mutation_p.I46T|SIRPA_uc002wfr.2_Missense_Mutation_p.I66T|SIRPA_uc002wfs.2_Missense_Mutation_p.I66T|SIRPA_uc002wft.2_Missense_Mutation_p.I66T	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	66	Ig-like V-type.|Extracellular (Potential).				blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		GTGGGGCCCATCCAGTGGTTC	0.552													25	110	---	---	---	---	PASS
MCM8	84515	broad.mit.edu	37	20	5965480	5965480	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5965480C>A	uc002wmi.2	+	15	2164	c.1787C>A	c.(1786-1788)ACT>AAT	p.T596N	MCM8_uc002wmj.2_Missense_Mutation_p.T580N|MCM8_uc002wmk.2_Missense_Mutation_p.T636N|MCM8_uc002wml.2_Missense_Mutation_p.T596N|MCM8_uc010gbp.2_Missense_Mutation_p.T549N|MCM8_uc002wmm.2_Missense_Mutation_p.T134N	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	596	MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						CTGTTAGATACTCCAAATGAG	0.388													67	188	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7866512	7866512	+	Splice_Site	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7866512C>A	uc002wmw.1	-	6	838	c.814_splice	c.e6-1	p.I272_splice	HAO1_uc010gbu.2_Splice_Site_p.I272_splice	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1						cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						GAACATCAATCTGGGGAAAGA	0.468													49	188	---	---	---	---	PASS
TASP1	55617	broad.mit.edu	37	20	13415742	13415742	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13415742A>T	uc002woi.2	-	12	1162	c.1045T>A	c.(1045-1047)TGC>AGC	p.C349S	TASP1_uc010zri.1_RNA|TASP1_uc002woh.2_Missense_Mutation_p.C326S	NM_017714	NP_060184	Q9H6P5	TASP1_HUMAN	taspase 1 precursor	349					asparagine catabolic process via L-aspartate|positive regulation of transcription, DNA-dependent|protein maturation		threonine-type endopeptidase activity				0						GAACATCTGCATGAACGGAGG	0.428													9	29	---	---	---	---	PASS
ZNF133	7692	broad.mit.edu	37	20	18296593	18296593	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18296593G>A	uc010gcq.2	+	5	1403	c.1098G>A	c.(1096-1098)AGG>AGA	p.R366R	ZNF133_uc010zrv.1_Silent_p.R369R|ZNF133_uc010zrw.1_Silent_p.R303R|ZNF133_uc010gcr.2_Silent_p.R366R|ZNF133_uc010zrx.1_Silent_p.R271R|ZNF133_uc002wql.3_Silent_p.R365R|ZNF133_uc010gcs.2_Silent_p.R365R|ZNF133_uc010zry.1_Silent_p.R271R|ZNF133_uc002wqm.2_Silent_p.R366R	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	366	C2H2-type 6.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2						TCAGCGACAGGTCAAACCTCA	0.587													14	50	---	---	---	---	PASS
ENTPD6	955	broad.mit.edu	37	20	25193991	25193991	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25193991A>T	uc002wuj.2	+	5	726	c.546A>T	c.(544-546)ACA>ACT	p.T182T	ENTPD6_uc010zsy.1_Silent_p.T182T|ENTPD6_uc010gdj.1_Silent_p.T154T|ENTPD6_uc010zsz.1_Intron|ENTPD6_uc002wum.2_Silent_p.T165T|ENTPD6_uc010zta.1_Silent_p.T182T|ENTPD6_uc002wun.2_Silent_p.T182T|ENTPD6_uc002wuk.2_Silent_p.T181T|ENTPD6_uc002wul.2_Silent_p.T181T|ENTPD6_uc010ztb.1_Silent_p.T154T|ENTPD6_uc010ztc.1_Silent_p.T154T|ENTPD6_uc002wuo.2_5'UTR|ENTPD6_uc010ztd.1_5'UTR	NM_001247	NP_001238	O75354	ENTP6_HUMAN	ectonucleoside triphosphate diphosphohydrolase 6	182	Lumenal (Potential).					Golgi membrane|integral to membrane	nucleoside-diphosphatase activity				0						TCAAGGCCACAGCTGGCTTAC	0.567													42	127	---	---	---	---	PASS
FAM83C	128876	broad.mit.edu	37	20	33880012	33880012	+	Silent	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33880012C>G	uc010zux.1	-	1	214	c.96G>C	c.(94-96)CGG>CGC	p.R32R	FAM83C_uc002xcb.1_5'UTR	NM_178468	NP_848563	Q9BQN1	FA83C_HUMAN	hypothetical protein LOC128876	32										ovary(2)	2			BRCA - Breast invasive adenocarcinoma(18;0.00252)			GTGAGCTCTCCCGCCACCACG	0.746													2	4	---	---	---	---	PASS
MMP9	4318	broad.mit.edu	37	20	44640932	44640932	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44640932G>T	uc002xqz.2	+	7	1173	c.1154G>T	c.(1153-1155)TGG>TTG	p.W385L		NM_004994	NP_004985	P14780	MMP9_HUMAN	matrix metalloproteinase 9 preproprotein	385	Fibronectin type-II 3.				collagen catabolic process|macrophage differentiation|positive regulation of keratinocyte migration|proteolysis	extracellular space|proteinaceous extracellular matrix	collagen binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|pancreas(1)	2		Myeloproliferative disorder(115;0.0122)			Glucosamine(DB01296)|Marimastat(DB00786)|Minocycline(DB01017)|Simvastatin(DB00641)	GACAAGAAGTGGGGCTTCTGC	0.682													22	91	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47292764	47292764	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47292764G>A	uc002xtw.1	-	14	1655	c.1632C>T	c.(1630-1632)CCC>CCT	p.P544P		NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	544	DEP 2.				actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCTTGCTCCCGGGAAGCACTG	0.607													24	153	---	---	---	---	PASS
ATP9A	10079	broad.mit.edu	37	20	50221365	50221365	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50221365C>A	uc002xwg.1	-	27	2998	c.2998G>T	c.(2998-3000)GAG>TAG	p.E1000*	ATP9A_uc010gih.1_Nonsense_Mutation_p.E864*|ATP9A_uc002xwf.1_Nonsense_Mutation_p.E172*	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	1000	Extracellular (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						CCGATGAACTCGTGTAAGAAC	0.597													8	31	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027180	55027180	+	Silent	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027180A>T	uc002xxp.2	+	6	1173	c.948A>T	c.(946-948)GTA>GTT	p.V316V	CASS4_uc002xxq.3_Silent_p.V316V|CASS4_uc002xxr.2_Silent_p.V316V|CASS4_uc010zze.1_Silent_p.V262V|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	316					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						GCTTTCTTGTACCCAGAGGCA	0.458													18	91	---	---	---	---	PASS
CASS4	57091	broad.mit.edu	37	20	55027972	55027972	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55027972C>T	uc002xxp.2	+	6	1965	c.1740C>T	c.(1738-1740)GTC>GTT	p.V580V	CASS4_uc002xxq.3_Silent_p.V580V|CASS4_uc002xxr.2_Silent_p.V580V|CASS4_uc010zze.1_Silent_p.V526V|CASS4_uc010gio.2_Intron	NM_001164116	NP_001157588	Q9NQ75	CASS4_HUMAN	HEF-like protein isoform a	580					cell adhesion	cytoplasm|cytoskeleton|focal adhesion	two-component sensor activity			ovary(2)|skin(1)	3						CCTCCATTGTCATTGCCAATG	0.463													25	69	---	---	---	---	PASS
PCK1	5105	broad.mit.edu	37	20	56136456	56136456	+	5'UTR	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56136456C>T	uc002xyn.3	+	2					PCK1_uc010zzm.1_5'UTR	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1						gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CCCTTAGCAGCACTCTGCAGA	0.522													64	98	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57767486	57767486	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57767486G>T	uc002yan.2	+	1	1412	c.1412G>T	c.(1411-1413)CGC>CTC	p.R471L		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	471						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					GGCCCCGTGCGCTCCACCTGG	0.672													8	42	---	---	---	---	PASS
LAMA5	3911	broad.mit.edu	37	20	60888137	60888137	+	Intron	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60888137G>T	uc002ycq.2	-							NM_005560	NP_005551	O15230	LAMA5_HUMAN	laminin alpha 5 precursor						angiogenesis|cell proliferation|cell recognition|cytoskeleton organization|endothelial cell differentiation|focal adhesion assembly|integrin-mediated signaling pathway|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	integrin binding			ovary(1)|pancreas(1)|skin(1)	3	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)		Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GGGTGTGCCTGGCGCACCTGC	0.617													5	34	---	---	---	---	PASS
DIDO1	11083	broad.mit.edu	37	20	61525489	61525489	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61525489G>A	uc002ydr.1	-	12	2894	c.2630C>T	c.(2629-2631)TCT>TTT	p.S877F	DIDO1_uc002yds.1_Missense_Mutation_p.S877F|DIDO1_uc002ydt.1_Missense_Mutation_p.S877F|DIDO1_uc002ydu.1_Missense_Mutation_p.S877F	NM_033081	NP_149072	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1 isoform c	877					apoptosis|transcription, DNA-dependent	cytoplasm|nucleus	zinc ion binding			ovary(3)|skin(3)	6	Breast(26;5.68e-08)					TTTCTTAACAGAAGCTGACAA	0.512													56	143	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862994	10862994	+	IGR	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862994C>T								None (None upstream) : TPTE (43749 downstream)																							TCCATGAGCACAGCCTACATG	0.493													75	462	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10920131	10920131	+	Missense_Mutation	SNP	C	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10920131C>G	uc002yip.1	-	19	1491	c.1123G>C	c.(1123-1125)GAT>CAT	p.D375H	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D357H|TPTE_uc002yir.1_Missense_Mutation_p.D337H|TPTE_uc010gkv.1_Missense_Mutation_p.D237H	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	375	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGGGTTTTATCTGTTCGCCTT	0.383													15	140	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10943022	10943022	+	Splice_Site	SNP	T	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10943022T>C	uc002yip.1	-	12	935	c.567_splice	c.e12-1	p.R189_splice	TPTE_uc002yis.1_Splice_Site|TPTE_uc002yiq.1_Splice_Site_p.R171_splice|TPTE_uc002yir.1_Splice_Site_p.R151_splice|TPTE_uc010gkv.1_Splice_Site_p.R51_splice	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTGTCCATCTAAGAATAAAT	0.244													6	69	---	---	---	---	PASS
KRTAP13-4	284827	broad.mit.edu	37	21	31802740	31802740	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31802740G>A	uc011acw.1	+	1	147	c.147G>A	c.(145-147)AGG>AGA	p.R49R		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	49	1.|4 X 10 AA approximate repeats.					intermediate filament					0						CTCTCTACAGGGACTGTCAGA	0.627													19	77	---	---	---	---	PASS
KRTAP6-1	337966	broad.mit.edu	37	21	31986073	31986073	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31986073A>T	uc002yop.2	-	1	151	c.151T>A	c.(151-153)TAT>AAT	p.Y51N	KRTAP20-1_uc011ade.1_5'Flank	NM_181602	NP_853633	Q3LI64	KRA61_HUMAN	keratin associated protein 6-1	51						cytosol|intermediate filament					0						CGGGAGCCATAGCCATAGCCA	0.597													16	69	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47841961	47841961	+	Missense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47841961C>T	uc002zji.3	+	32	7209	c.7102C>T	c.(7102-7104)CCT>TCT	p.P2368S	PCNT_uc002zjj.2_Missense_Mutation_p.P2250S	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2368					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					TCCTGTGACCCCTGCTTCCAT	0.612													23	77	---	---	---	---	PASS
PRMT2	3275	broad.mit.edu	37	21	48068369	48068369	+	Splice_Site	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:48068369G>T	uc002zjx.2	+	6	642	c.328_splice	c.e6-1	p.K110_splice	PRMT2_uc002zjw.2_Splice_Site_p.K110_splice|PRMT2_uc002zjy.2_Splice_Site_p.K110_splice|PRMT2_uc010gqm.2_Splice_Site_p.K110_splice|PRMT2_uc011aga.1_Splice_Site_p.K110_splice|PRMT2_uc011agb.1_Splice_Site_p.K110_splice|PRMT2_uc011agc.1_Splice_Site_p.K110_splice|PRMT2_uc002zjz.1_Splice_Site	NM_206962	NP_996845	P55345	ANM2_HUMAN	HMT1 hnRNP methyltransferase-like 1						developmental cell growth|induction of apoptosis|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of androgen receptor signaling pathway	cytosol|nucleus	androgen receptor binding|estrogen receptor binding|histone-arginine N-methyltransferase activity|peroxisome proliferator activated receptor binding|progesterone receptor binding|protein homodimerization activity|retinoic acid receptor binding|signal transducer activity|thyroid hormone receptor binding|transcription coactivator activity			ovary(1)	1	Breast(49;0.247)	Lung NSC(3;0.245)		Epithelial(3;1.03e-07)|OV - Ovarian serous cystadenocarcinoma(3;4.68e-07)|all cancers(3;7.48e-07)|Colorectal(79;0.167)|Lung(125;0.203)|LUSC - Lung squamous cell carcinoma(216;0.23)|READ - Rectum adenocarcinoma(84;0.248)		ATTTCTTCCAGAAACTCCACT	0.502													16	51	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20132768	20132768	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20132768A>T	uc002zrq.2	+	11	2249	c.2143A>T	c.(2143-2145)AAG>TAG	p.K715*	ZDHHC8_uc002zrr.1_Intron|ZDHHC8_uc010gsa.2_Nonsense_Mutation_p.K521*	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	715	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					CCCTCAGCTGAAGACTCCCCC	0.632													55	274	---	---	---	---	PASS
SLC2A11	66035	broad.mit.edu	37	22	24224728	24224728	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24224728C>T	uc002zyn.3	+	7	867	c.768C>T	c.(766-768)TGC>TGT	p.C256C	SLC2A11_uc002zyl.1_Silent_p.C263C|SLC2A11_uc002zym.3_Silent_p.C263C|SLC2A11_uc002zyo.3_RNA|SLC2A11_uc011ajc.1_Silent_p.C263C|SLC2A11_uc002zyp.3_Silent_p.C259C	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c	256	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						GCCAGGGCTGCCGTGCCCGGC	0.701													4	17	---	---	---	---	PASS
SUSD2	56241	broad.mit.edu	37	22	24579183	24579183	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24579183G>T	uc002zzn.1	+	2	279	c.235G>T	c.(235-237)GTG>TTG	p.V79L		NM_019601	NP_062547	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2 precursor	79	Extracellular (Potential).				immune response	integral to membrane	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CAAGGACTTTGTGGTGCGGCA	0.637													9	68	---	---	---	---	PASS
TMEM211	255349	broad.mit.edu	37	22	25331384	25331384	+	Silent	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25331384G>A	uc003abk.1	-	3	331	c.306C>T	c.(304-306)CCC>CCT	p.P102P		NM_001001663	NP_001001663	Q6ICI0	TM211_HUMAN	transmembrane protein 211	173						integral to membrane					0						TGGTTGTGTGGGGCCAGCTGA	0.522													18	92	---	---	---	---	PASS
C22orf42	150297	broad.mit.edu	37	22	32546983	32546983	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32546983G>T	uc003amd.2	-	6	530	c.489C>A	c.(487-489)GAC>GAA	p.D163E		NM_001010859	NP_001010859	Q6IC83	CV042_HUMAN	chromosome 22 open reading frame 42	163										ovary(1)|skin(1)	2						ACGTACGGTGGTCGTGCTTGG	0.249													40	63	---	---	---	---	PASS
TRIOBP	11078	broad.mit.edu	37	22	38122339	38122339	+	Missense_Mutation	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38122339G>C	uc003atr.2	+	7	4047	c.3776G>C	c.(3775-3777)GGG>GCG	p.G1259A	TRIOBP_uc003atu.2_Missense_Mutation_p.G1087A|TRIOBP_uc003atq.1_Missense_Mutation_p.G1259A|TRIOBP_uc003ats.1_Missense_Mutation_p.G1087A	NM_001039141	NP_001034230	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein isoform 6	1259					actin modification|barbed-end actin filament capping	actin cytoskeleton|cytoplasm|nucleus	actin binding|GTP-Rho binding|myosin II binding|protein binding|ubiquitin protein ligase binding			central_nervous_system(1)	1	Melanoma(58;0.0574)					GCGCCTCCCGGGGAGACCAGG	0.721													12	26	---	---	---	---	PASS
PLA2G6	8398	broad.mit.edu	37	22	38529009	38529009	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38529009C>A	uc003auy.1	-	7	1042	c.906G>T	c.(904-906)ATG>ATT	p.M302I	PLA2G6_uc003auz.1_Missense_Mutation_p.M302I|PLA2G6_uc003ava.1_Missense_Mutation_p.M302I|PLA2G6_uc003avb.2_Missense_Mutation_p.M302I|PLA2G6_uc010gxk.1_RNA|PLA2G6_uc011ano.1_Missense_Mutation_p.M267I	NM_003560	NP_003551	O60733	PA2G6_HUMAN	phospholipase A2, group VI isoform a	302	ANK 5.				cardiolipin biosynthetic process|cell death|lipid catabolic process	centrosome|membrane				ovary(1)	1	Melanoma(58;0.045)				Quinacrine(DB01103)	GTTTCAGCAGCATGCGGGCCA	0.662													3	3	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17746069	17746069	+	Silent	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17746069C>T	uc004cxx.2	+	6	4118	c.3780C>T	c.(3778-3780)CGC>CGT	p.R1260R	NHS_uc011mix.1_Silent_p.R1281R|NHS_uc004cxy.2_Silent_p.R1104R|NHS_uc004cxz.2_Silent_p.R1083R|NHS_uc004cya.2_Silent_p.R983R	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1260						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					CTGCTGCCCGCCCAAATGATT	0.478													64	65	---	---	---	---	PASS
SMS	6611	broad.mit.edu	37	X	21990682	21990682	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21990682G>A	uc004dag.2	+	4	423	c.322G>A	c.(322-324)GTG>ATG	p.V108M	SMS_uc011mjq.1_Missense_Mutation_p.V12M|SMS_uc004daf.1_Intron	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase	108					methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	TACTGGGCGGGTGAAACGGTA	0.284													14	23	---	---	---	---	PASS
SMS	6611	broad.mit.edu	37	X	22012471	22012471	+	3'UTR	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22012471G>T	uc004dag.2	+	11					SMS_uc010nfs.2_RNA|SMS_uc010nft.2_Missense_Mutation_p.D80Y	NM_004595	NP_004586	P52788	SPSY_HUMAN	spermine synthase						methionine metabolic process|spermine biosynthetic process	cytosol	spermidine synthase activity|spermine synthase activity			ovary(1)	1					Spermine(DB00127)	AAACCCTGAAGATCAGTAGCC	0.413													35	35	---	---	---	---	PASS
FAM47B	170062	broad.mit.edu	37	X	34962363	34962363	+	Missense_Mutation	SNP	T	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34962363T>G	uc004ddi.1	+	1	1433	c.1415T>G	c.(1414-1416)CTA>CGA	p.L472R		NM_152631	NP_689844	Q8NA70	FA47B_HUMAN	hypothetical protein LOC170062	472										ovary(3)|breast(1)	4						GCTGGAGACCTAGGAGTTAAT	0.448													68	79	---	---	---	---	PASS
ERAS	3266	broad.mit.edu	37	X	48687603	48687603	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48687603G>A	uc004dky.1	+	1	321	c.70G>A	c.(70-72)GAA>AAA	p.E24K		NM_181532	NP_853510	Q7Z444	RASE_HUMAN	ES cell expressed Ras precursor	24					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity			lung(4)|urinary_tract(1)	5						CTTCCAGGGGGAAACCCACCG	0.657													12	5	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67932797	67932797	+	5'UTR	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67932797G>A	uc004dxa.2	+	3					STARD8_uc004dxb.2_Missense_Mutation_p.G41R|STARD8_uc004dxc.3_5'UTR	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						TCAAGCAACAGGATTCCCTCA	0.483													8	18	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962784	73962784	+	Silent	SNP	G	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962784G>C	uc004eby.2	-	3	2225	c.1608C>G	c.(1606-1608)CCC>CCG	p.P536P		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	536					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						TAATAACAGGGGGCTCCTTAC	0.413													61	55	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73962785	73962785	+	Missense_Mutation	SNP	G	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73962785G>T	uc004eby.2	-	3	2224	c.1607C>A	c.(1606-1608)CCC>CAC	p.P536H		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	536					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						AATAACAGGGGGCTCCTTACG	0.413													61	54	---	---	---	---	PASS
KIAA2022	340533	broad.mit.edu	37	X	73963889	73963889	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73963889C>A	uc004eby.2	-	3	1120	c.503G>T	c.(502-504)GGT>GTT	p.G168V		NM_001008537	NP_001008537	Q5QGS0	K2022_HUMAN	hypothetical protein LOC340533	168					base-excision repair, gap-filling|DNA replication proofreading|DNA replication, removal of RNA primer|nucleotide-excision repair, DNA gap filling|regulation of mitotic cell cycle|S phase of mitotic cell cycle	delta DNA polymerase complex	3'-5'-exodeoxyribonuclease activity|DNA-directed DNA polymerase activity			ovary(7)|large_intestine(4)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	15						ATTTAGATCACCAACTTTCAG	0.448													31	47	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78010584	78010584	+	Missense_Mutation	SNP	A	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78010584A>T	uc010nme.2	+	2	623	c.218A>T	c.(217-219)GAG>GTG	p.E73V		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	73	Cytoplasmic (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						ATGAGAAGTGAGACTGCTATT	0.383													134	145	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83371242	83371242	+	Missense_Mutation	SNP	A	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83371242A>C	uc004eej.1	-	12	1080	c.1003T>G	c.(1003-1005)TGG>GGG	p.W335G	RPS6KA6_uc011mqt.1_Missense_Mutation_p.W335G|RPS6KA6_uc011mqu.1_Missense_Mutation_p.W232G	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	335	AGC-kinase C-terminal.				axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						CTTACATCCCAGTCAATATTT	0.239													22	42	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91132998	91132998	+	Missense_Mutation	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91132998G>A	uc004efk.1	+	2	2604	c.1759G>A	c.(1759-1761)GGT>AGT	p.G587S	PCDH11X_uc004efl.1_Missense_Mutation_p.G587S|PCDH11X_uc004efo.1_Missense_Mutation_p.G587S|PCDH11X_uc010nmv.1_Missense_Mutation_p.G587S|PCDH11X_uc004efm.1_Missense_Mutation_p.G587S|PCDH11X_uc004efn.1_Missense_Mutation_p.G587S|PCDH11X_uc004efh.1_Missense_Mutation_p.G587S|PCDH11X_uc004efj.1_Missense_Mutation_p.G587S	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	587	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						TCCAAGGCATGGTACAGTAGG	0.388													75	67	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91873532	91873532	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91873532C>A	uc004efk.1	+	7	4482	c.3637C>A	c.(3637-3639)CCG>ACG	p.P1213T	PCDH11X_uc004efl.1_Missense_Mutation_p.P1203T|PCDH11X_uc004efo.1_Missense_Mutation_p.P1176T|PCDH11X_uc010nmv.1_3'UTR|PCDH11X_uc004efm.1_Missense_Mutation_p.P1205T|PCDH11X_uc004efn.1_Missense_Mutation_p.P1195T	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	1213	Cytoplasmic (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						CAGCCCACCACCGATACAGGT	0.597													89	87	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105153423	105153423	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153423A>G	uc004emd.2	+	13	2093	c.1790A>G	c.(1789-1791)CAT>CGT	p.H597R	NRK_uc010npc.1_Missense_Mutation_p.H265R	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	597							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						CAAGATCACCATGTGCTGTTG	0.532										HNSCC(51;0.14)			6	29	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118284549	118284549	+	5'Flank	SNP	G	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118284549G>A	uc004era.3	-							NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481											ovary(4)|skin(1)	5						TCATTTCCCCGCGTAGAGTTG	0.652													11	47	---	---	---	---	PASS
GRIA3	2892	broad.mit.edu	37	X	122387382	122387382	+	Missense_Mutation	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122387382A>G	uc004etq.3	+	4	790	c.497A>G	c.(496-498)GAC>GGC	p.D166G	GRIA3_uc004etr.3_Missense_Mutation_p.D166G|GRIA3_uc004ets.3_RNA|GRIA3_uc011muf.1_Missense_Mutation_p.D150G	NM_007325	NP_015564	P42263	GRIA3_HUMAN	glutamate receptor, ionotrophic, AMPA 3 isoform	166	Extracellular (Potential).				glutamate signaling pathway|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5					L-Glutamic Acid(DB00142)	TACCTCTATGACACAGAACGA	0.453													69	65	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123525965	123525965	+	Silent	SNP	A	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123525965A>G	uc004euj.2	-	27	5668	c.5604T>C	c.(5602-5604)AGT>AGC	p.S1868S	ODZ1_uc011muj.1_Silent_p.S1874S|ODZ1_uc010nqy.2_Silent_p.S1875S	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1868	Extracellular (Potential).|YD 7.				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TAATTTTCCCACTCTGGTCAT	0.358													67	74	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649618	136649618	+	Silent	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649618C>A	uc004fak.2	+	1	1273	c.768C>A	c.(766-768)ATC>ATA	p.I256I		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	256	C2H2-type 1; atypical.				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					GCAAGTGGATCGACGAGGCTC	0.617													29	49	---	---	---	---	PASS
F9	2158	broad.mit.edu	37	X	138630563	138630563	+	Missense_Mutation	SNP	T	A	A	rs104894807		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138630563T>A	uc004fas.1	+	5	462	c.433T>A	c.(433-435)TGT>AGT	p.C145S	F9_uc004fat.1_Missense_Mutation_p.C107S	NM_000133	NP_000124	P00740	FA9_HUMAN	coagulation factor IX preproprotein	145	EGF-like 2.				blood coagulation, extrinsic pathway|blood coagulation, intrinsic pathway|peptidyl-glutamic acid carboxylation|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|extracellular region|Golgi lumen|plasma membrane	calcium ion binding|serine-type endopeptidase activity			lung(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;0.000127)				Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Heparin(DB01109)|Menadione(DB00170)	CGAGCAGTTTTGTAAAAATAG	0.373													57	80	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138711968	138711968	+	Missense_Mutation	SNP	C	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138711968C>A	uc004fau.2	-	4	618	c.324G>T	c.(322-324)ATG>ATT	p.M108I	MCF2_uc004fav.2_Missense_Mutation_p.M108I|MCF2_uc011mwl.1_Missense_Mutation_p.M69I|MCF2_uc010nsh.1_Missense_Mutation_p.M108I|MCF2_uc011mwm.1_Missense_Mutation_p.M69I|MCF2_uc011mwn.1_Missense_Mutation_p.M253I|MCF2_uc004faw.2_Missense_Mutation_p.M168I|MCF2_uc011mwo.1_Missense_Mutation_p.M168I	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	108					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					ACATCTGAGCCATTTCTTTCA	0.403													160	164	---	---	---	---	PASS
SOX3	6658	broad.mit.edu	37	X	139586695	139586695	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:139586695C>T	uc004fbd.1	-	1	531	c.531G>A	c.(529-531)TGG>TGA	p.W177*		NM_005634	NP_005625	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	177	HMG box.				face development|hypothalamus development|negative regulation of neuron differentiation|pituitary gland development|regulation of transcription, DNA-dependent|sensory organ development|sex determination|transcription, DNA-dependent	nucleus	DNA binding			pancreas(1)	1	Acute lymphoblastic leukemia(192;7.65e-05)					TCAGCAGTTTCCAGTCGGCGC	0.602													5	124	---	---	---	---	PASS
CLCNKB	1188	broad.mit.edu	37	1	16379015	16379016	+	Intron	INS	-	GGGGCTGGGA	GGGGCTGGGA	rs112841009	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16379015_16379016insGGGGCTGGGA	uc001axw.3	+						FAM131C_uc010obz.1_Intron|CLCNKB_uc001axx.3_Intron|CLCNKB_uc001axy.3_Intron	NM_000085	NP_000076	P51801	CLCKB_HUMAN	chloride channel Kb isoform 1						excretion	chloride channel complex|integral to plasma membrane	voltage-gated chloride channel activity			skin(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		cctcggacatgggggctgacac	0.287													4	2	---	---	---	---	
SSBP3	23648	broad.mit.edu	37	1	54692653	54692655	+	3'UTR	DEL	AGG	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54692653_54692655delAGG	uc001cxe.2	-	18					SSBP3_uc001cxf.2_3'UTR|SSBP3_uc001cxg.2_3'UTR|SSBP3_uc001cxd.2_3'UTR	NM_145716	NP_663768	Q9BWW4	SSBP3_HUMAN	single stranded DNA binding protein 3 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	single-stranded DNA binding				0						TGGGAAAGGTAGGGGGCGTGGAT	0.453													4	3	---	---	---	---	
IQGAP3	128239	broad.mit.edu	37	1	156530966	156530966	+	Intron	DEL	T	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156530966delT	uc001fpf.2	-						IQGAP3_uc009wsb.1_Intron	NM_178229	NP_839943	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3						small GTPase mediated signal transduction	intracellular	calmodulin binding|Ras GTPase activator activity			ovary(5)|skin(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTATTAACCGttttttttttt	0.274													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	163053059	163053060	+	IGR	DEL	CA	-	-	rs35657995		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:163053059_163053060delCA								RGS4 (6468 upstream) : RGS5 (59038 downstream)																							CAAacacacgcacacacacaca	0.411													4	2	---	---	---	---	
C1orf125	126859	broad.mit.edu	37	1	179335499	179335500	+	Intron	INS	-	T	T	rs35129223		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179335499_179335500insT	uc001gmo.2	+						C1orf125_uc009wxg.2_Intron|C1orf125_uc001gmn.1_Intron|C1orf125_uc010pnl.1_Intron|C1orf125_uc001gmp.2_Intron	NM_144696	NP_653297	Q5T1B0	AXDN1_HUMAN	hypothetical protein LOC126859 isoform 1												0						TAGTTGTCATCTTTTTTTTTTT	0.431													3	3	---	---	---	---	
REN	5972	broad.mit.edu	37	1	204129854	204129854	+	Intron	DEL	G	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204129854delG	uc001haq.2	-							NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein						angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	GGCCCAGACAGGGGGACTCAG	0.557													113	51	---	---	---	---	
KCNH1	3756	broad.mit.edu	37	1	210928187	210928188	+	Intron	DEL	CA	-	-	rs33996429		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210928187_210928188delCA	uc001hib.2	-						KCNH1_uc001hic.2_Intron	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,						myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		Tacacacgggcacacacacaca	0.129													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215916729	215916730	+	Intron	DEL	TG	-	-	rs6540907		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215916729_215916730delTG	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		tatatatatatgtgtgtgtgtg	0.178										HNSCC(13;0.011)			13	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229207793	229207794	+	IGR	INS	-	GT	GT	rs141910686	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229207793_229207794insGT								RHOU (325384 upstream) : RAB4A (199085 downstream)																							catggtcttccgtgtgtgtgtg	0.000													2	6	---	---	---	---	
MATN3	4148	broad.mit.edu	37	2	20205423	20205424	+	Intron	INS	-	AAAG	AAAG	rs140894448	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20205423_20205424insAAAG	uc002rdl.2	-						MATN3_uc010exu.1_Intron	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCACCAAAAAAGAATAATACT	0.267													4	4	---	---	---	---	
ITSN2	50618	broad.mit.edu	37	2	24521896	24521896	+	Intron	DEL	T	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24521896delT	uc002rfe.2	-						ITSN2_uc002rff.2_Intron|ITSN2_uc002rfg.2_Intron|ITSN2_uc010eyd.2_Intron	NM_006277	NP_006268	Q9NZM3	ITSN2_HUMAN	intersectin 2 isoform 1						endocytosis|regulation of Rho protein signal transduction	cytoplasm	calcium ion binding|Rho guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			kidney(2)|ovary(1)|central_nervous_system(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCACGAGATCttttttttttt	0.184													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	32449463	32449464	+	IGR	INS	-	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32449463_32449464insT								SLC30A6 (2654 upstream) : NLRC4 (54 downstream)																							CTTTGGCATCCTTTTGCAAGAT	0.366													35	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85930718	85930725	+	IGR	DEL	TCCCTCCC	-	-	rs113231454		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85930718_85930725delTCCCTCCC								GNLY (4844 upstream) : ATOH8 (50184 downstream)																							tttccttccttccctccctccctccctc	0.034													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96413548	96413551	+	IGR	DEL	TTCT	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96413548_96413551delTTCT								TRIM43 (148081 upstream) : LOC729234 (262748 downstream)																							ccttccttccttctttccttcttt	0.000													4	2	---	---	---	---	
NCKAP5	344148	broad.mit.edu	37	2	133636237	133636238	+	Intron	DEL	AC	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133636237_133636238delAC	uc002ttp.2	-						NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1								protein binding				0						acgcacgcatacacacacacac	0.252													4	2	---	---	---	---	
CCDC150	284992	broad.mit.edu	37	2	197584489	197584490	+	Intron	INS	-	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197584489_197584490insA	uc002utp.1	+						CCDC150_uc010zgs.1_Intron|CCDC150_uc010zgt.1_Intron|CCDC150_uc002utq.1_Intron|CCDC150_uc002utr.1_Intron	NM_001080539	NP_001074008	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150												0						GCTTCCTTTACAAAAAAAAAAA	0.297													3	4	---	---	---	---	
C2orf67	151050	broad.mit.edu	37	2	211018091	211018091	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211018091delA	uc002vds.2	-						C2orf67_uc002vdt.2_Intron|C2orf67_uc002vdw.2_Intron|C2orf67_uc002vdy.1_3'UTR|C2orf67_uc002vdv.2_Intron|C2orf67_uc002vdx.1_Intron	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		aataaaaattaaaaaaaaaaa	0.119													9	4	---	---	---	---	
RAD18	56852	broad.mit.edu	37	3	8977449	8977450	+	Intron	INS	-	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:8977449_8977450insA	uc003brd.2	-						RAD18_uc003bre.2_Intron	NM_020165	NP_064550	Q9NS91	RAD18_HUMAN	postreplication repair protein hRAD18p						DNA repair	nucleus|replication fork	damaged DNA binding|ligase activity|ubiquitin protein ligase binding|Y-form DNA binding|zinc ion binding			skin(3)|ovary(2)	5				OV - Ovarian serous cystadenocarcinoma(96;0.0552)		TCTTATCTATCAAAAATGTATT	0.351								Rad6_pathway					11	9	---	---	---	---	
C3orf19	51244	broad.mit.edu	37	3	14702848	14702849	+	Intron	INS	-	T	T	rs141125865	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:14702848_14702849insT	uc003byw.2	+						C3orf19_uc010hei.1_Intron|C3orf19_uc010hej.2_Intron	NM_016474	NP_057558	Q6PII3	CC019_HUMAN	hypothetical protein LOC51244												0						CTTTTTCAAGATTTTTTTGTGT	0.401													4	2	---	---	---	---	
VENTXP7	391518	broad.mit.edu	37	3	21448049	21448049	+	RNA	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21448049delC	uc003ccd.2	+	1		c.832delC				NR_002311				Homo sapiens VENT homeobox (Xenopus laevis) pseudogene 7 (VENTXP7), non-coding RNA.												0						CTGTGCAGATCGCATCTGACG	0.592													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32975244	32975244	+	IGR	DEL	A	-	-	rs78314440		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32975244delA								TRIM71 (41474 upstream) : CCR4 (17822 downstream)																							caagactctgaaaaaaaaaaa	0.020													4	2	---	---	---	---	
KIF15	56992	broad.mit.edu	37	3	44887009	44887009	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44887009delA	uc003cnx.3	+						KIF15_uc010hiq.2_Intron|KIF15_uc010hir.2_Intron	NM_020242	NP_064627	Q9NS87	KIF15_HUMAN	kinesin family member 15						blood coagulation|cell proliferation|microtubule-based movement|mitosis	centrosome|cytosol|microtubule|plus-end kinesin complex|spindle	ATP binding|DNA binding|microtubule motor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		TCTGGCACCTAAAAAAAAAAG	0.378													4	2	---	---	---	---	
KPNA4	3840	broad.mit.edu	37	3	160253781	160253781	+	Intron	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160253781delC	uc003fdn.2	-							NM_002268	NP_002259	O00629	IMA4_HUMAN	karyopherin alpha 4						NLS-bearing substrate import into nucleus	cytoplasm|nuclear pore	protein binding				0			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CAATCCTGTGCCTAAAAACTG	0.269													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	119414257	119414259	+	IGR	DEL	AGG	-	-	rs113100030		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119414257_119414259delAGG								PRSS12 (140335 upstream) : CEP170L (23236 downstream)																							TGGATTGATAAGGAGGAGGGGAG	0.369													2	6	---	---	---	---	
GALNTL6	442117	broad.mit.edu	37	4	173943182	173943185	+	Intron	DEL	GAAG	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173943182_173943185delGAAG	uc003isv.2	+							NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6							Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						aggaaggaaagaaggaaggaagga	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	43588182	43588182	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43588182delA	uc003jod.1	-											Homo sapiens cDNA FLJ39349 fis, clone PEBLM1000071, moderately similar to Leptin receptor.																		actccgtctcaaaaaaaaaaa	0.214													4	2	---	---	---	---	
MCCC2	64087	broad.mit.edu	37	5	70939896	70939899	+	Intron	DEL	GTGC	-	-	rs71859051		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70939896_70939899delGTGC	uc003kbs.3	+						MCCC2_uc003kbt.3_Intron	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)						leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	gtgtgtgtgtgtgcgcgcgtgtgt	0.201													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	87232931	87232934	+	IGR	DEL	CTTC	-	-	rs72449897		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87232931_87232934delCTTC								CCNH (524095 upstream) : TMEM161B (258090 downstream)																							ttctttctttcttccttccttcct	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	14383195	14383197	+	IGR	DEL	TTT	-	-	rs68127716		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:14383195_14383197delTTT								CD83 (246049 upstream) : JARID2 (862537 downstream)																							cttcctttcctttttccttcctt	0.118													4	2	---	---	---	---	
OR10C1	442194	broad.mit.edu	37	6	29407970	29407970	+	Frame_Shift_Del	DEL	T	-	-	rs115316507	byFrequency	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29407970delT	uc011dlp.1	+	1	178	c.178delT	c.(178-180)TTCfs	p.F60fs	OR11A1_uc010jrh.1_Intron	NM_013941	NP_039229	Q96KK4	O10C1_HUMAN	olfactory receptor, family 10, subfamily C,	60	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCCTATGTACTTCTTCCTGCG	0.567													82	65	---	---	---	---	
BRPF3	27154	broad.mit.edu	37	6	36193259	36193259	+	Intron	DEL	A	-	-	rs41270094	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36193259delA	uc003olv.3	+						BRPF3_uc010jwb.2_Intron|BRPF3_uc011dtj.1_Intron|BRPF3_uc010jwc.2_Intron|BRPF3_uc011dtk.1_Intron|BRPF3_uc010jwd.2_Intron	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3						histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						TGTAGAGGGGAGGGGGGTTTT	0.537													4	3	---	---	---	---	
GLP1R	2740	broad.mit.edu	37	6	39053943	39053946	+	3'UTR	DEL	ACAC	-	-	rs34093988		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39053943_39053946delACAC	uc003ooj.3	+	13					GLP1R_uc003ooh.2_Intron|GLP1R_uc003ooi.2_Intron	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	GAAGGAAGGGacacacacacacac	0.500													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	79424144	79424145	+	IGR	DEL	AA	-	-	rs111390657		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79424144_79424145delAA								None (None upstream) : IRAK1BP1 (153044 downstream)																							AAACACTGACAAAAAAAAAAAA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	168042202	168042210	+	IGR	DEL	ACCACCATC	-	-	rs113050817	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168042202_168042210delACCACCATC								TCP10 (244204 upstream) : C6orf123 (143011 downstream)																							caccaccattaccaccatcaccaccatca	0.000													3	3	---	---	---	---	
ZNF12	7559	broad.mit.edu	37	7	6732518	6732519	+	Intron	DEL	AC	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6732518_6732519delAC	uc003sqt.1	-						ZNF12_uc011jxa.1_Intron|ZNF12_uc003sqs.1_Intron	NM_016265	NP_057349	P17014	ZNF12_HUMAN	zinc finger protein 12 isoform a						negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		acacacacaaacacacacacac	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	90076038	90076039	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs149264284	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90076038_90076039insCTTCCTTC								CLDN12 (30772 upstream) : CDK14 (19699 downstream)																							ctttctctcttcttccttcctt	0.059													4	3	---	---	---	---	
SGK223	157285	broad.mit.edu	37	8	8186101	8186102	+	Intron	INS	-	TTTCTA	TTTCTA	rs143704562	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8186101_8186102insTTTCTA	uc003wsh.3	-							NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin								ATP binding|non-membrane spanning protein tyrosine kinase activity				0						ATGTTACTTCTTTTCTATTTCT	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	28135952	28135955	+	IGR	DEL	GAAG	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28135952_28135955delGAAG								ELP3 (87285 upstream) : PNOC (38694 downstream)																							gggaaggaaagaaggaaggaagga	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53922743	53922743	+	IGR	DEL	T	-	-	rs151008077		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53922743delT								NPBWR1 (69290 upstream) : OPRK1 (215533 downstream)																							tttcttcttcttttttttttt	0.000													5	3	---	---	---	---	
RGS22	26166	broad.mit.edu	37	8	101078415	101078415	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101078415delG	uc003yjb.1	-	7	899	c.704delC	c.(703-705)CCAfs	p.P235fs	RGS22_uc003yja.1_Frame_Shift_Del_p.P54fs|RGS22_uc003yjc.1_Frame_Shift_Del_p.P223fs|RGS22_uc011lgz.1_RNA|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	235					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			TGAAATAGCTGGTGATTTAAG	0.343													90	58	---	---	---	---	
KCNQ3	3786	broad.mit.edu	37	8	133184645	133184646	+	Intron	DEL	AC	-	-	rs138308682		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133184645_133184646delAC	uc003ytj.2	-						KCNQ3_uc010mdt.2_Intron	NM_004519	NP_004510	O43525	KCNQ3_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			GCACATTAATacacacacacac	0.342													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	144474218	144474225	+	IGR	DEL	ACCCATCA	-	-	rs7461499	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144474218_144474225delACCCATCA								RHPN1 (7829 upstream) : MAFA (37290 downstream)																							ccatccatccacccatcaatccatccat	0.000													7	4	---	---	---	---	
RFX3	5991	broad.mit.edu	37	9	3356156	3356159	+	Intron	DEL	GGAA	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:3356156_3356159delGGAA	uc003zhr.2	-						RFX3_uc010mhd.2_Intron|RFX3_uc003zhs.1_Intron|RFX3_uc003zht.1_Intron|RFX3_uc010mhe.1_Intron	NM_134428	NP_602304	P48380	RFX3_HUMAN	regulatory factor X3 isoform b						cell maturation|ciliary cell motility|cilium assembly|cilium movement involved in determination of left/right asymmetry|endocrine pancreas development|negative regulation of transcription, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type B pancreatic cell development|regulation of insulin secretion	nuclear chromatin	protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4				GBM - Glioblastoma multiforme(50;0.00124)|Lung(2;0.0337)		tagaataagtggaaggaaggaagg	0.000													4	4	---	---	---	---	
RCL1	10171	broad.mit.edu	37	9	4803727	4803727	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4803727delA	uc003zis.2	+						RCL1_uc003zit.2_Intron|RCL1_uc010mhk.1_Intron	NM_005772	NP_005763	Q9Y2P8	RCL1_HUMAN	RNA terminal phosphate cyclase-like 1						ribosome biogenesis|RNA processing	nucleolus	RNA-3'-phosphate cyclase activity				0	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0206)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0244)		TGTGAAAGGTAAAAAAAAAAA	0.458													4	2	---	---	---	---	
MOBKL2B	79817	broad.mit.edu	37	9	27454966	27454967	+	Intron	INS	-	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27454966_27454967insT	uc003zqn.2	-							NM_024761	NP_079037	Q86TA1	MOL2B_HUMAN	MOB1, Mps One Binder kinase activator-like 2B								metal ion binding|protein binding			ovary(1)|pleura(1)	2		all_neural(11;9.12e-11)		Lung(218;6.54e-05)|LUSC - Lung squamous cell carcinoma(38;0.000397)		ggtccataaagttttttttttc	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	102150493	102150494	+	IGR	INS	-	CTTCCTTC	CTTCCTTC			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102150493_102150494insCTTCCTTC								SEC61B (157593 upstream) : NR4A3 (433643 downstream)																							ATTTGCCCTGTcttccttcctt	0.050													4	2	---	---	---	---	
ABCA1	19	broad.mit.edu	37	9	107592971	107592971	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107592971delA	uc004bcl.2	-							NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1						Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	actccatctcaaaaaaaaaaa	0.154													4	2	---	---	---	---	
VCL	7414	broad.mit.edu	37	10	75803109	75803110	+	Intron	INS	-	T	T	rs145684984		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75803109_75803110insT	uc001jwd.2	+						VCL_uc009xrr.2_Intron|VCL_uc010qky.1_Intron|VCL_uc001jwe.2_Intron|VCL_uc010qkz.1_Intron	NM_014000	NP_054706	P18206	VINC_HUMAN	vinculin isoform meta-VCL						adherens junction assembly|apical junction assembly|cell-matrix adhesion|cellular component movement|epithelial cell-cell adhesion|lamellipodium assembly|morphogenesis of an epithelium|muscle contraction|negative regulation of cell migration|platelet activation|platelet degranulation|protein localization at cell surface	costamere|cytosol|extracellular region|focal adhesion	actin binding|alpha-catenin binding|beta-catenin binding|beta-dystroglycan binding|cadherin binding|structural molecule activity		VCL/ALK(4)	kidney(4)|ovary(1)|central_nervous_system(1)	6	Prostate(51;0.0112)					TGACATAATAAttttttttttt	0.099													4	4	---	---	---	---	
MBL1P	8512	broad.mit.edu	37	10	81680656	81680656	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81680656delA	uc001kbf.2	+						MBL1P_uc001kbg.1_RNA					Homo sapiens mannose-binding protein-A pseudogene (MBL1P1) mRNA sequence.												0						GCTTTTGGGGAAAAAAAAAAG	0.542													4	4	---	---	---	---	
PTEN	5728	broad.mit.edu	37	10	89720828	89720828	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89720828delA	uc001kfb.2	+	9	2010	c.979delA	c.(979-981)AAAfs	p.K327fs		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	327	C2 tensin-type.			KANKDKANR->AAGADAANA: Reduces growth suppression activity and promotes anchorage-independent growth. Reduces binding to phospholipid membranes in vitro; phosphatase activity towards PtdIns(3,4,5)P3 is not affected.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.T319_K332del(1)|p.G165_*404del(1)|p.G165_K342del(1)|p.D326fs*4(1)|p.W274_F341del(1)|p.D326_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGATCTTGACAAAGCAAATAA	0.328		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			120	97	---	---	---	---	
CCDC147	159686	broad.mit.edu	37	10	106158934	106158935	+	Intron	DEL	GT	-	-	rs140937747		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106158934_106158935delGT	uc001kyh.2	+							NM_001008723	NP_001008723	Q5T655	CC147_HUMAN	coiled-coil domain containing 147											ovary(2)|central_nervous_system(2)|skin(1)	5		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TTCTTTATGAgtgtgtgtgtgt	0.317													4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	128821807	128821807	+	Intron	DEL	T	-	-	rs72037531		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:128821807delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		CCCTGTGGtcttttttttttt	0.289													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134206019	134206020	+	IGR	INS	-	G	G	rs142843997		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134206019_134206020insG								LRRC27 (11009 upstream) : PWWP2B (4682 downstream)																							atgatggtgatgtgataatggt	0.000													5	3	---	---	---	---	
HRAS	3265	broad.mit.edu	37	11	534404	534415	+	Intron	DEL	CCCAGGCCCAGC	-	-	rs45443193		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:534404_534415delCCCAGGCCCAGC	uc001lpv.2	-						HRAS_uc010qvw.1_Intron|HRAS_uc010qvx.1_Intron|HRAS_uc010qvy.1_Intron	NM_005343	NP_005334	P01112	RASH_HUMAN	v-Ha-ras Harvey rat sarcoma viral oncogene						activation of MAPKK activity|axon guidance|blood coagulation|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|mitotic cell cycle G1/S transition checkpoint|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of DNA replication|positive regulation of epithelial cell proliferation|Ras protein signal transduction|synaptic transmission	cytosol|Golgi membrane|plasma membrane	GTP binding|GTPase activity|protein C-terminus binding			urinary_tract(174)|thyroid(155)|skin(126)|upper_aerodigestive_tract(112)|soft_tissue(37)|prostate(29)|salivary_gland(24)|cervix(23)|stomach(14)|pituitary(10)|lung(9)|haematopoietic_and_lymphoid_tissue(9)|breast(6)|testis(5)|endometrium(4)|bone(3)|large_intestine(2)|oesophagus(2)|penis(2)|kidney(1)|adrenal_gland(1)|thymus(1)	749		all_cancers(49;4.37e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;7.63e-28)|Epithelial(43;7.29e-27)|OV - Ovarian serous cystadenocarcinoma(40;7.15e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Sulindac(DB00605)	CTCAGCCAGGCCCAGGCCCAGCCCCAGGCCCC	0.698		6	Mis		infrequent sarcomas|rare other types	rhadomyosarcoma|ganglioneuroblastoma|bladder			Costello_syndrome	HNSCC(11;0.0054)			3	3	---	---	---	---	
AMBRA1	55626	broad.mit.edu	37	11	46450139	46450140	+	Intron	INS	-	T	T	rs142253407	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46450139_46450140insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		tcttcttcttcttctttttttt	0.376													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	55647164	55647164	+	IGR	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55647164delA								OR5D16 (39952 upstream) : SPRYD5 (3609 downstream)																							TCCACTATCTAAATATTATTA	0.408													26	15	---	---	---	---	
APOA5	116519	broad.mit.edu	37	11	116661456	116661457	+	Frame_Shift_Ins	INS	-	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116661456_116661457insA	uc001ppr.2	-	3	496_497	c.488_489insT	c.(487-489)CTGfs	p.L163fs	ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Frame_Shift_Ins_p.L163fs|APOA5_uc009yzf.2_Frame_Shift_Ins_p.L163fs|APOA5_uc009yzg.2_Frame_Shift_Ins_p.L189fs	NM_052968	NP_443200	Q6Q788	APOA5_HUMAN	apolipoprotein AV precursor	163					acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding				0	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		CCACGCCCCCCAGCAACTGGGC	0.649													103	62	---	---	---	---	
ADAMTS8	11095	broad.mit.edu	37	11	130284669	130284670	+	Frame_Shift_Ins	INS	-	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130284669_130284670insC	uc001qgg.3	-	5	1680_1681	c.1322_1323insG	c.(1321-1323)GGCfs	p.G441fs	ADAMTS8_uc001qgf.2_5'Flank	NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	441	Disintegrin.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		GGGCCATGCGGCCCGGGAGGCC	0.653													42	29	---	---	---	---	
MLL2	8085	broad.mit.edu	37	12	49431484	49431484	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49431484delC	uc001rta.3	-	34	9655	c.9655delG	c.(9655-9657)GCTfs	p.A3219fs		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	3219					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AAGGTCAAAGCCCCACTCTCG	0.607			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			4	8	---	---	---	---	
GTSF1	121355	broad.mit.edu	37	12	54858845	54858845	+	Intron	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54858845delC	uc001sgb.2	-							NM_144594	NP_653195	Q8WW33	GTSF1_HUMAN	gametocyte specific factor 1								metal ion binding				0		Myeloproliferative disorder(1001;0.00452)				CAAATTATGACCCTACCTTTC	0.368													122	151	---	---	---	---	
UTP20	27340	broad.mit.edu	37	12	101763830	101763830	+	Intron	DEL	T	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101763830delT	uc001tia.1	+							NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis						endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						cgtgtctacataaaaaaaaaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	103367247	103367248	+	IGR	INS	-	TTCT	TTCT	rs147902551	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103367247_103367248insTTCT								ASCL1 (12960 upstream) : C12orf42 (264122 downstream)																							ctctgcctcccttctttccttc	0.040													3	3	---	---	---	---	
USP30	84749	broad.mit.edu	37	12	109519429	109519432	+	Intron	DEL	CACA	-	-	rs61164773	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109519429_109519432delCACA	uc010sxi.1	+						USP30_uc001tnu.3_Intron|USP30_uc001tnw.3_5'Flank	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30						ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						cgcatgcgcgcacacacacacaca	0.260													5	3	---	---	---	---	
LRRC43	254050	broad.mit.edu	37	12	122658231	122658231	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122658231delA	uc001ubw.3	+						LRRC43_uc009zxl.1_Intron|IL31_uc001ubv.2_Intron	NM_152759	NP_689972	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 2												0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		actctgtctcaaaaaaaaaaa	0.244													6	3	---	---	---	---	
DNAH10	196385	broad.mit.edu	37	12	124315343	124315343	+	Intron	DEL	T	-	-	rs7976816		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124315343delT	uc001uft.3	+							NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		aaaaaaaaaattagctgagcg	0.100													5	3	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133767906	133767906	+	Intron	DEL	A	-	-	rs75668420		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133767906delA	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		ctgtctcaacaaaaaaaaaaa	0.114													5	3	---	---	---	---	
STARD13	90627	broad.mit.edu	37	13	33751885	33751887	+	Intron	DEL	AAA	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33751885_33751887delAAA	uc001uuw.2	-						STARD13_uc001uuu.2_Intron|STARD13_uc001uuv.2_Intron|STARD13_uc001uux.2_Intron|STARD13_uc010tec.1_Intron|STARD13_uc010abh.1_Intron	NM_178006	NP_821074	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|lipid particle|mitochondrial membrane	GTPase activator activity|protein binding			ovary(2)|pancreas(1)|skin(1)	4	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		ggaaggaaggaaaaaaggaagga	0.074													4	2	---	---	---	---	
CLN5	1203	broad.mit.edu	37	13	77574519	77574519	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77574519delA	uc001vkc.2	+							NM_006493	NP_006484	O75503	CLN5_HUMAN	ceroid-lipofuscinosis, neuronal 5						brain development|cell death|lysosomal lumen acidification|neuron maturation|protein catabolic process	endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosomal membrane|perinuclear region of cytoplasm	protein binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0503)		gacctgtcttaaaaaaaaaaa	0.124													3	3	---	---	---	---	
MYCBP2	23077	broad.mit.edu	37	13	77644556	77644557	+	Intron	INS	-	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77644556_77644557insT	uc001vkf.2	-						MYCBP2_uc010aev.2_Intron|MYCBP2_uc001vke.2_Intron	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ttttcttgcaatttttttttta	0.000													4	2	---	---	---	---	
C14orf93	60686	broad.mit.edu	37	14	23457344	23457344	+	Intron	DEL	T	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23457344delT	uc001wib.1	-						C14orf93_uc001wic.1_Intron|C14orf93_uc001wid.1_Intron|C14orf93_uc001wig.2_Intron|C14orf93_uc001wih.2_Intron|C14orf93_uc001wie.2_Intron|C14orf93_uc001wia.3_Intron|C14orf93_uc001wif.2_Intron	NM_021944	NP_068763	Q9H972	CN093_HUMAN	hypothetical protein LOC60686 precursor							extracellular region				ovary(1)	1	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		AGATGAGGGCttttttttttt	0.269													8	5	---	---	---	---	
NYNRIN	57523	broad.mit.edu	37	14	24884692	24884693	+	Frame_Shift_Ins	INS	-	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24884692_24884693insG	uc001wpf.3	+	9	4055_4056	c.3737_3738insG	c.(3736-3738)GAGfs	p.E1246fs		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1246					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GAGGTGCGGGAGGGCCGCAGGG	0.629													25	19	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36463290	36463291	+	IGR	INS	-	TCCT	TCCT	rs66569553		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36463290_36463291insTCCT								BRMS1L (122122 upstream) : MBIP (304473 downstream)																							GACCATATTTAtccttccttcc	0.158													5	4	---	---	---	---	
ACOT4	122970	broad.mit.edu	37	14	74060211	74060211	+	Intron	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74060211delA	uc001xoo.2	+							NM_152331	NP_689544	Q8N9L9	ACOT4_HUMAN	acyl-CoA thioesterase 4						acyl-CoA metabolic process|dicarboxylic acid metabolic process|long-chain fatty acid metabolic process|saturated monocarboxylic acid metabolic process|short-chain fatty acid metabolic process|succinyl-CoA metabolic process|unsaturated monocarboxylic acid metabolic process|very long-chain fatty acid metabolic process	peroxisome	carboxylesterase activity|palmitoyl-CoA hydrolase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00331)		ctgactaattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SLC24A4	123041	broad.mit.edu	37	14	92839211	92839212	+	Intron	INS	-	CCTTCCTT	CCTTCCTT			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92839211_92839212insCCTTCCTT	uc001yak.2	+						SLC24A4_uc001yai.2_Intron|SLC24A4_uc010twm.1_Intron|SLC24A4_uc001yaj.2_Intron	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GGGTCACTGTCccttccttcct	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	103770193	103770194	+	IGR	DEL	AA	-	-	rs35374634		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103770193_103770194delAA								TNFAIP2 (166417 upstream) : EIF5 (30299 downstream)																							accccacctcaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CHRM5	1133	broad.mit.edu	37	15	34354755	34354756	+	Intron	INS	-	AA	AA	rs34062716		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34354755_34354756insAA	uc001zhk.1	+						CHRM5_uc001zhl.1_Intron	NM_012125	NP_036257	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5						cell proliferation|inhibition of adenylate cyclase activity by muscarinic acetylcholine receptor signaling pathway	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Atropine(DB00572)|Benzquinamide(DB00767)|Cryptenamine(DB00785)|Homatropine Methylbromide(DB00725)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Olanzapine(DB00334)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Thiethylperazine(DB00372)	gattctgtctcaaaaaaaaaaa	0.178											OREG0023033	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
C16orf62	57020	broad.mit.edu	37	16	19612830	19612830	+	Intron	DEL	T	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19612830delT	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc002dgp.1_Intron|C16orf62_uc010vas.1_Intron|C16orf62_uc002dgm.1_Intron	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020							integral to membrane				ovary(1)	1						ACAAAAAAAATGTGGCTTAAA	0.378											OREG0023661	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	4	---	---	---	---	
ITGAD	3681	broad.mit.edu	37	16	31405451	31405452	+	Intron	INS	-	A	A			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31405451_31405452insA	uc002ebv.1	+						ITGAD_uc010vfl.1_Intron|ITGAD_uc010cap.1_Intron	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						gactccatctcaaaaaaaaaaa	0.193													4	2	---	---	---	---	
MYO1C	4641	broad.mit.edu	37	17	1377722	1377727	+	Intron	DEL	AAAAAA	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1377722_1377727delAAAAAA	uc002fsp.2	-						MYO1C_uc002fsn.2_Intron|MYO1C_uc002fso.2_Intron|MYO1C_uc010vqj.1_Intron|MYO1C_uc010vqk.1_Intron	NM_001080779	NP_001074248	O00159	MYO1C_HUMAN	myosin IC isoform a						mRNA transport|protein transport|transmembrane transport	basal plasma membrane|cytoplasm|filamentous actin|lateral plasma membrane|nuclear pore|nucleolus|nucleoplasm|stereocilium membrane	actin binding|ATP binding|calmodulin binding|motor activity				0				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		accctgtctcaaaaaaaaaaaaaaaa	0.252													4	2	---	---	---	---	
ABI3	51225	broad.mit.edu	37	17	47299770	47299771	+	Intron	INS	-	G	G			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47299770_47299771insG	uc002iop.1	+						ABI3_uc002ioq.1_Intron	NM_016428	NP_057512	Q9P2A4	ABI3_HUMAN	NESH protein isoform 1						cellular component movement|regulation of cell migration	cytoplasm|lamellipodium	protein binding				0			Epithelial(5;6.37e-06)|all cancers(6;6.36e-05)			TAAGCTGGGGAGGGGTCCTGAA	0.574										HNSCC(55;0.14)			13	10	---	---	---	---	
NXPH3	11248	broad.mit.edu	37	17	47655757	47655757	+	Intron	DEL	G	-	-	rs36092852		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47655757delG	uc002ipa.2	+						NXPH3_uc010wlw.1_Intron	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor						neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					AAAGGACAATGGGGGGGGGGG	0.532													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74591634	74591634	+	IGR	DEL	A	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74591634delA								ST6GALNAC2 (9489 upstream) : ST6GALNAC1 (29213 downstream)																							actctgtctcaaaaaaaaaaa	0.164													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	108150	108151	+	5'Flank	INS	-	T	T	rs71284714		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:108150_108151insT	uc002kke.2	+											Homo sapiens Rho-associated, coiled-coil containing protein kinase 1, mRNA (cDNA clone IMAGE:5269982), complete cds.																		tctctgcactgttaaccgaggt	0.000													4	2	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	6071840	6071841	+	Intron	DEL	AG	-	-	rs7240128	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6071840_6071841delAG	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				agaaagagaaagagagagaggg	0.000													4	2	---	---	---	---	
ALPK2	115701	broad.mit.edu	37	18	56203118	56203118	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56203118delC	uc002lhj.3	-	5	4515	c.4301delG	c.(4300-4302)GGTfs	p.G1434fs	ALPK2_uc002lhk.1_Frame_Shift_Del_p.G765fs	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1434							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						ATTTGATTGACCCCCTTCTCT	0.502													64	50	---	---	---	---	
TXNL4A	10907	broad.mit.edu	37	18	77737811	77737815	+	Intron	DEL	TTTTG	-	-	rs71338078		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77737811_77737815delTTTTG	uc002lnp.2	-						TXNL4A_uc002lnr.2_Intron|TXNL4A_uc002lnq.2_Intron|TXNL4A_uc010drf.2_Intron|TXNL4A_uc010drg.2_Intron	NM_006701	NP_006692	P83876	TXN4A_HUMAN	thioredoxin-like 4A						cell division|mitosis|spliceosome assembly	nucleoplasm|spliceosomal complex	protein binding				0		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		TCAGGGCAAtttttgttttgttttt	0.137													4	4	---	---	---	---	
EEF2	1938	broad.mit.edu	37	19	3980012	3980013	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3980012_3980013delCA	uc002lze.2	-	10	1481_1482	c.1398_1399delTG	c.(1396-1401)TGTGGGfs	p.C466fs		NM_001961	NP_001952	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	466_467						cytosol|ribonucleoprotein complex	GTP binding|GTPase activity|protein binding|translation elongation factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		ACAATGTTCCCACAAGGCACAT	0.594													42	36	---	---	---	---	
TRIP10	9322	broad.mit.edu	37	19	6742791	6742791	+	Intron	DEL	A	-	-	rs151261595		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6742791delA	uc002mfs.2	+						TRIP10_uc010dux.1_Intron|TRIP10_uc002mfr.2_Intron|TRIP10_uc010duy.2_Intron|TRIP10_uc010duz.2_Intron	NM_004240	NP_004231	Q15642	CIP4_HUMAN	thyroid hormone receptor interactor 10						actin cytoskeleton organization|cell communication|endocytosis|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell projection|cytoskeleton|cytosol|Golgi apparatus|lysosome|perinuclear region of cytoplasm|phagocytic cup	GTPase activator activity|identical protein binding|lipid binding			ovary(1)	1						accctgtctcaaaaaaaaaaa	0.100													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13709248	13709251	+	IGR	DEL	AAGG	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13709248_13709251delAAGG								CACNA1A (91974 upstream) : CCDC130 (133323 downstream)																							gaaaaaagaaaaggaaggaaggag	0.034											OREG0025297	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
NPAS1	4861	broad.mit.edu	37	19	47524442	47524442	+	Intron	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47524442delC	uc002pfw.2	+						NPAS1_uc002pfx.2_Intron|NPAS1_uc002pfy.2_Intron	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		CAAAgccccgcccccctggcc	0.537													9	6	---	---	---	---	
KLK5	25818	broad.mit.edu	37	19	51448302	51448316	+	Intron	DEL	TCCTTCCTTTCTTTC	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51448302_51448316delTCCTTCCTTTCTTTC	uc002pue.2	-						KLK5_uc002puf.2_Intron|KLK5_uc002pug.2_Intron	NM_001077491	NP_001070959	Q9Y337	KLK5_HUMAN	kallikrein-related peptidase 5 preproprotein						epidermis development|positive regulation of G-protein coupled receptor protein signaling pathway|proteolysis	extracellular space	protein binding|serine-type endopeptidase activity				0		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00379)|GBM - Glioblastoma multiforme(134;0.00888)		tctttctccttccttcctttctttctccttccttc	0.005													4	3	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3297537	3297537	+	Intron	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3297537delC	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						AGCTAGGGttctttttttttt	0.279													18	9	---	---	---	---	
SLC23A2	9962	broad.mit.edu	37	20	4848272	4848273	+	Intron	DEL	AA	-	-	rs71332848		TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4848272_4848273delAA	uc002wlg.1	-						SLC23A2_uc010zqr.1_Intron|SLC23A2_uc002wlh.1_Intron	NM_005116	NP_005107	Q9UGH3	S23A2_HUMAN	solute carrier family 23 (nucleobase						L-ascorbic acid metabolic process|molecular hydrogen transport|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transepithelial L-ascorbic acid transport	apical plasma membrane|integral to plasma membrane|membrane fraction	nucleobase transmembrane transporter activity|sodium-dependent L-ascorbate transmembrane transporter activity|sodium-dependent multivitamin transmembrane transporter activity			ovary(2)	2						ATAAACACTTaaaaaaaaaaaa	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54903418	54903437	+	IGR	DEL	AAGGAAGGAAGGAAGGAAGA	-	-	rs56343240	by1000genomes	TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54903418_54903437delAAGGAAGGAAGGAAGGAAGA								MC3R (78547 upstream) : C20orf108 (30546 downstream)																							ggaaggaaggaaggaaggaaggaaggaagaaagaagaaaa	0.000													4	2	---	---	---	---	
PRODH	5625	broad.mit.edu	37	22	18910810	18910811	+	Intron	INS	-	CCCCG	CCCCG			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18910810_18910811insCCCCG	uc010grl.2	-						PRODH_uc002zoj.3_Intron|PRODH_uc002zol.3_Intron|PRODH_uc002zok.3_Intron	NM_016335	NP_057419	O43272	PROD_HUMAN	proline dehydrogenase 1						glutamate biosynthetic process|induction of apoptosis by oxidative stress|proline catabolic process	mitochondrial inner membrane|mitochondrial matrix	proline dehydrogenase activity			breast(1)	1					L-Proline(DB00172)	ACCCCACCCCACCCCGCCCATG	0.663													6	3	---	---	---	---	
MAGEB3	4114	broad.mit.edu	37	X	30254770	30254771	+	Frame_Shift_Ins	INS	-	C	C			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30254770_30254771insC	uc004dca.1	+	5	1466_1467	c.729_730insC	c.(727-732)GAGCCCfs	p.E243fs		NM_002365	NP_002356	O15480	MAGB3_HUMAN	melanoma antigen family B, 3	243_244	MAGE.										0						TATTTGGGGAGCCCAGAAAGCT	0.455													19	21	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	35644526	35644526	+	IGR	DEL	C	-	-			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35644526delC								FAM47B (681492 upstream) : MAGEB16 (171933 downstream)																							TAAGTTTGTACTTTTCCCGTG	0.458													6	4	---	---	---	---	
ZNF711	7552	broad.mit.edu	37	X	84525286	84525287	+	Intron	INS	-	T	T			TCGA-22-4599-01	TCGA-22-4599-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:84525286_84525287insT	uc004eeo.2	+						ZNF711_uc004eep.2_Intron|ZNF711_uc004eeq.2_Intron|ZNF711_uc011mqy.1_5'UTR	NM_021998	NP_068838	Q9Y462	ZN711_HUMAN	zinc finger protein 711						positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|zinc ion binding			ovary(3)|skin(1)	4						ATAGATAATTGTTTTTTTTTTT	0.307													4	2	---	---	---	---	
