Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
CPSF3L	54973	broad.mit.edu	37	1	1250995	1250995	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1250995C>G	uc001aee.1	-	5	491	c.433G>C	c.(433-435)GAT>CAT	p.D145H	CPSF3L_uc009vjy.1_RNA|CPSF3L_uc001aef.1_Missense_Mutation_p.D151H|CPSF3L_uc009vjz.1_Intron|CPSF3L_uc010nyj.1_Missense_Mutation_p.D116H|CPSF3L_uc001aeg.1_Missense_Mutation_p.D21H|CPSF3L_uc001aeh.1_Missense_Mutation_p.D44H|CPSF3L_uc001aei.1_Splice_Site_p.N47_splice|CPSF3L_uc001aej.1_Intron|CPSF3L_uc001aek.1_5'UTR	NM_017871	NP_060341	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor	145						Golgi apparatus|nucleus	hydrolase activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		AGCTCATCATCTACCTGTGGA	0.642													23	52	---	---	---	---	PASS
TAS1R3	83756	broad.mit.edu	37	1	1267268	1267268	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1267268G>C	uc010nyk.1	+	2	442	c.442G>C	c.(442-444)GAG>CAG	p.E148Q		NM_152228	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3 precursor	148	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste|sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)	Aspartame(DB00168)	CCACTCGTCAGAGCTCGCCAT	0.667													19	45	---	---	---	---	PASS
TAS1R3	83756	broad.mit.edu	37	1	1267812	1267812	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1267812G>A	uc010nyk.1	+	3	901	c.901G>A	c.(901-903)GAG>AAG	p.E301K		NM_152228	NP_689414	Q7RTX0	TS1R3_HUMAN	taste receptor, type 1, member 3 precursor	301	Extracellular (Potential).				detection of chemical stimulus involved in sensory perception of sweet taste|sensory perception of umami taste	plasma membrane	protein heterodimerization activity|taste receptor activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.88e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.146)	Aspartame(DB00168)	GGTGGCCAGCGAGGCCTGGCT	0.672													12	14	---	---	---	---	PASS
DVL1	1855	broad.mit.edu	37	1	1275204	1275204	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1275204G>T	uc001aer.3	-						DVL1_uc002quu.2_Intron|DVL1_uc009vka.2_Intron|DVL1_uc001aeu.1_Intron	NM_004421	NP_004412	O14640	DVL1_HUMAN	dishevelled 1						canonical Wnt receptor signaling pathway|dendrite morphogenesis|intracellular signal transduction|negative regulation of protein binding|negative regulation of protein kinase activity|neural tube development|neuromuscular junction development|neurotransmitter secretion|positive regulation of transcription, DNA-dependent|positive regulation of Wnt receptor signaling pathway|protein localization to nucleus|receptor clustering|transcription from RNA polymerase II promoter|Wnt receptor signaling pathway, planar cell polarity pathway	cytoplasmic membrane-bounded vesicle|cytosol|plasma membrane|synapse|synaptosome	frizzled binding|identical protein binding|protein kinase binding|signal transducer activity				0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.83e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.77e-21)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.0025)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.145)		TGCAGGGGTGGGGATTAGGGT	0.657													14	28	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3410404	3410404	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3410404C>G	uc001akl.2	-	34	4545	c.4318G>C	c.(4318-4320)GCA>CCA	p.A1440P	MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	1440						extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		TCACAGGGTGCCCCCCCGTCA	0.667													3	15	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10425165	10425165	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10425165G>A	uc001aqx.3	+	42	4576	c.4374G>A	c.(4372-4374)CAG>CAA	p.Q1458Q	KIF1B_uc001aqw.3_Silent_p.Q1412Q|KIF1B_uc001aqy.2_Silent_p.Q1432Q|KIF1B_uc001aqz.2_Silent_p.Q1458Q|KIF1B_uc001ara.2_Silent_p.Q1418Q|KIF1B_uc001arb.2_Silent_p.Q1444Q	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	1458					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TAGGTATGCAGAGAAGGAGAA	0.383													19	47	---	---	---	---	PASS
C1orf127	148345	broad.mit.edu	37	1	11008317	11008317	+	Silent	SNP	T	C	C	rs150211489		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11008317T>C	uc010oao.1	-	8	1433	c.1428A>G	c.(1426-1428)CCA>CCG	p.P476P	C1orf127_uc001arr.1_Silent_p.P458P|C1orf127_uc001ars.1_Silent_p.P450P	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	hypothetical protein LOC148345	476										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		CTGTCTGGCGTGGCCTCTCCA	0.662													38	87	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11298641	11298641	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11298641G>A	uc001asd.2	-	12	1941	c.1820C>T	c.(1819-1821)GCG>GTG	p.A607V		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	607					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GAAATGATCCGCACAGTGGCG	0.547													15	31	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12317132	12317132	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12317132C>T	uc001atv.2	+	9	1070	c.929C>T	c.(928-930)GCG>GTG	p.A310V	VPS13D_uc001atw.2_Missense_Mutation_p.A310V	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	310					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCCAAGGTGGCGATATCTAAG	0.443													18	58	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152640	18152640	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152640G>A	uc001bat.2	+	3	943	c.727G>A	c.(727-729)GGC>AGC	p.G243S		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	243						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		GCTCCCAGACGGCTCCCGCGT	0.632											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	23	61	---	---	---	---	PASS
TMCO4	255104	broad.mit.edu	37	1	20063855	20063855	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20063855C>G	uc001bcn.2	-						TMCO4_uc001bcm.2_Intron|TMCO4_uc001bco.1_Intron|TMCO4_uc001bcp.1_Intron	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		TGACAATAATCCATGCTCACC	0.527													30	79	---	---	---	---	PASS
TMCO4	255104	broad.mit.edu	37	1	20097876	20097876	+	Silent	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20097876A>C	uc001bcn.2	-	5	521	c.279T>G	c.(277-279)GGT>GGG	p.G93G	TMCO4_uc001bcm.2_Silent_p.G93G|TMCO4_uc001bco.1_Silent_p.G93G|TMCO4_uc001bcp.1_Silent_p.G93G|TMCO4_uc009vpn.1_Silent_p.G93G|TMCO4_uc001bcq.1_Silent_p.G93G	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4	93						integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		CTGCTCCTTCACCTCCCAGGC	0.547													7	103	---	---	---	---	PASS
EPHA8	2046	broad.mit.edu	37	1	22924692	22924692	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22924692A>G	uc001bfx.1	+	12	2290	c.2165A>G	c.(2164-2166)GAC>GGC	p.D722G		NM_020526	NP_065387	P29322	EPHA8_HUMAN	ephrin receptor EphA8 isoform 1 precursor	722	Cytoplasmic (Potential).|Protein kinase.					integral to plasma membrane	ATP binding|ephrin receptor activity			central_nervous_system(5)|breast(3)|lung(2)|large_intestine(1)|stomach(1)|skin(1)	13		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;7.29e-27)|Colorectal(126;1.61e-07)|COAD - Colon adenocarcinoma(152;1.14e-05)|GBM - Glioblastoma multiforme(114;1.74e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000554)|KIRC - Kidney renal clear cell carcinoma(1967;0.00272)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GGCTCTCTGGACACCTTCCTG	0.622													23	57	---	---	---	---	PASS
EPHB2	2048	broad.mit.edu	37	1	23240345	23240345	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:23240345C>T	uc009vqj.1	+	17	3295	c.3150C>T	c.(3148-3150)GAC>GAT	p.D1050D	EPHB2_uc001bge.2_3'UTR|EPHB2_uc001bgf.2_3'UTR|EPHB2_uc010odu.1_3'UTR	NM_017449	NP_059145	P29323	EPHB2_HUMAN	ephrin receptor EphB2 isoform 1 precursor	1050	Cytoplasmic (Potential).				axon guidance	integral to plasma membrane	ATP binding|transmembrane-ephrin receptor activity			ovary(3)|lung(1)|pancreas(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;3.7e-05)|all_lung(284;5.45e-05)|Renal(390;0.000228)|Breast(348;0.0027)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0258)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0348)|OV - Ovarian serous cystadenocarcinoma(117;3.67e-26)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|GBM - Glioblastoma multiforme(114;2.93e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000606)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.126)|Lung(427;0.153)		AAAGCAATGACTGTTCTTGCG	0.438									Hereditary_Prostate_Cancer				4	14	---	---	---	---	PASS
IL28RA	163702	broad.mit.edu	37	1	24484323	24484323	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24484323A>T	uc001bis.2	-	7	873	c.860T>A	c.(859-861)GTG>GAG	p.V287E	IL28RA_uc001bir.2_Intron|IL28RA_uc001bit.2_Silent_p.R243R|IL28RA_uc001biu.2_Missense_Mutation_p.V203E	NM_170743	NP_734464	Q8IU57	I28RA_HUMAN	interleukin 28 receptor, alpha isoform 1	287	Cytoplasmic (Potential).				cytokine-mediated signaling pathway|negative regulation of cell proliferation|regulation of defense response to virus by host	interleukin-28 receptor complex	protein binding|receptor activity				0		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00117)|all_lung(284;0.00151)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.21e-24)|Colorectal(126;6.61e-08)|COAD - Colon adenocarcinoma(152;3.56e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00918)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.185)		CAAGTCATTCACGGACTCTGG	0.537													48	127	---	---	---	---	PASS
TMEM57	55219	broad.mit.edu	37	1	25824875	25824875	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25824875C>T	uc001bkk.2	+	11	2115	c.1913C>T	c.(1912-1914)CCC>CTC	p.P638L	TMEM57_uc009vru.2_Missense_Mutation_p.P411L|TMEM57_uc009vrv.2_Missense_Mutation_p.P280L	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	638						axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGTTTCCCCCCACTACTCT	0.537													38	108	---	---	---	---	PASS
CCDC21	64793	broad.mit.edu	37	1	26603162	26603162	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26603162G>C	uc001bls.1	+	13	2170	c.2039G>C	c.(2038-2040)TGC>TCC	p.C680S	CCDC21_uc001blr.2_Missense_Mutation_p.C680S|CCDC21_uc010ofa.1_Missense_Mutation_p.C629S|CCDC21_uc001blt.1_Missense_Mutation_p.C112S	NM_022778	NP_073615	Q6P2H3	CEP85_HUMAN	coiled-coil domain containing 21	680						centrosome|nucleolus|spindle pole					0		all_cancers(24;7e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.6e-26)|Colorectal(126;1.65e-08)|COAD - Colon adenocarcinoma(152;9.48e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00155)|GBM - Glioblastoma multiforme(114;0.00917)|READ - Rectum adenocarcinoma(331;0.0649)		TTGGCCAGTTGCCTTCAAGAT	0.607													16	30	---	---	---	---	PASS
MARCKSL1	65108	broad.mit.edu	37	1	32800483	32800483	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32800483G>T	uc001bvd.2	-	2	503	c.303C>A	c.(301-303)AGC>AGA	p.S101R		NM_023009	NP_075385	P49006	MRP_HUMAN	MARCKS-like 1	101						plasma membrane	calmodulin binding			ovary(1)	1		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				AGGACAGGCCGCTCAATTTGA	0.577													26	63	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34003178	34003178	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34003178G>T	uc001bxn.1	-	60	9260	c.9231C>A	c.(9229-9231)TCC>TCA	p.S3077S	CSMD2_uc001bxm.1_Silent_p.S3221S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3077	Extracellular (Potential).|Sushi 24.					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TCCTCCCACGGGACGGGACAC	0.597													11	29	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36474339	36474339	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36474339G>T	uc001bzp.2	+	7	1098	c.842G>T	c.(841-843)CGT>CTT	p.R281L	EIF2C3_uc001bzq.2_Missense_Mutation_p.R47L	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	281	PAZ.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				CGGAAATACCGTGTTTGTAAT	0.428													34	63	---	---	---	---	PASS
ADPRHL2	54936	broad.mit.edu	37	1	36558756	36558756	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36558756C>T	uc001bzt.2	+	6	914	c.861C>T	c.(859-861)TGC>TGT	p.C287C	ADPRHL2_uc001bzu.2_Silent_p.C133C	NM_017825	NP_060295	Q9NX46	ARHL2_HUMAN	ADP-ribosylhydrolase like 2	287						cytoplasm|nucleus	metal ion binding|poly(ADP-ribose) glycohydrolase activity			pancreas(1)	1		Myeloproliferative disorder(586;0.0393)				TCCTACGCTGCATGGAGCCAG	0.557													18	68	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38411480	38411480	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38411480G>A	uc001ccg.1	-	3	194	c.100C>T	c.(100-102)CGC>TGC	p.R34C	INPP5B_uc009vvk.1_5'UTR|INPP5B_uc001cch.2_5'UTR	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	34					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CCCAGGAGGCGGCTCTGCCGG	0.677													29	95	---	---	---	---	PASS
ZNF684	127396	broad.mit.edu	37	1	41007298	41007298	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41007298A>G	uc001cft.1	+	4	405	c.154A>G	c.(154-156)ACC>GCC	p.T52A		NM_152373	NP_689586	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	52	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			ATGTCCAATTACCAAAACAAA	0.493													7	17	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44424465	44424465	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44424465C>T	uc001ckx.2	+	11	2727	c.1932C>T	c.(1930-1932)CTC>CTT	p.L644L		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	644	HEAT 11.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				TGGGGCTTCTCTCCAACCTCT	0.572													29	81	---	---	---	---	PASS
ZCCHC11	23318	broad.mit.edu	37	1	52926837	52926837	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52926837T>C	uc001ctx.2	-	19	3524	c.3290A>G	c.(3289-3291)TAT>TGT	p.Y1097C	ZCCHC11_uc001cty.2_Missense_Mutation_p.Y1097C|ZCCHC11_uc001ctz.2_Missense_Mutation_p.Y1097C|ZCCHC11_uc009vze.1_Missense_Mutation_p.Y1097C|ZCCHC11_uc009vzf.1_Missense_Mutation_p.Y856C|ZCCHC11_uc001cua.1_Missense_Mutation_p.Y14C	NM_015269	NP_056084	Q5TAX3	TUT4_HUMAN	zinc finger, CCHC domain containing 11 isoform	1097					miRNA catabolic process|pre-miRNA processing|RNA 3'-end processing|stem cell maintenance	cytoplasm|nucleolus	nucleic acid binding|protein binding|protein binding|RNA uridylyltransferase activity|zinc ion binding			ovary(2)|skin(1)	3						ATATCCCAAATACTGCACTCT	0.289													37	96	---	---	---	---	PASS
SLC1A7	6512	broad.mit.edu	37	1	53558470	53558470	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53558470C>A	uc001cuy.2	-						SLC1A7_uc001cux.2_5'Flank	NM_006671	NP_006662	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter),							integral to membrane|plasma membrane	high-affinity glutamate transmembrane transporter activity|sodium:dicarboxylate symporter activity			ovary(2)|large_intestine(1)	3				Colorectal(1306;0.234)	L-Glutamic Acid(DB00142)	CTGGGGGCGGCGGGGCAGCCA	0.672													11	34	---	---	---	---	PASS
PARS2	25973	broad.mit.edu	37	1	55224731	55224731	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55224731C>T	uc001cxy.2	-	2	187	c.104G>A	c.(103-105)AGA>AAA	p.R35K		NM_152268	NP_689481	Q7L3T8	SYPM_HUMAN	prolyl-tRNA synthetase (mitochondrial)(putative)	35					prolyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|proline-tRNA ligase activity			ovary(2)	2					L-Proline(DB00172)	CCGCCCTCTTCTTGGGGCACA	0.562													12	28	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70504217	70504217	+	Missense_Mutation	SNP	C	A	A	rs141934258		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70504217C>A	uc001dep.2	+	19	2626	c.2596C>A	c.(2596-2598)CCC>ACC	p.P866T	LRRC7_uc009wbg.2_Missense_Mutation_p.P150T|LRRC7_uc001deq.2_Missense_Mutation_p.P107T	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	866						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						AGAGACAACCCCCACTACCAG	0.458													36	121	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70504751	70504751	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70504751G>C	uc001dep.2	+	19	3160	c.3130G>C	c.(3130-3132)GCC>CCC	p.A1044P	LRRC7_uc009wbg.2_Missense_Mutation_p.A328P|LRRC7_uc001deq.2_Missense_Mutation_p.A285P	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	1044						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						GGAAGTGAAAGCCGAAAAGAG	0.443													8	27	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507041	74507041	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507041C>A	uc001dfy.3	-	7	1766	c.1574G>T	c.(1573-1575)CGC>CTC	p.R525L	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	525										ovary(2)	2						CAAAAGAGTGCGCTCATTATT	0.358													35	138	---	---	---	---	PASS
LRRIQ3	127255	broad.mit.edu	37	1	74507042	74507042	+	Missense_Mutation	SNP	G	A	A	rs78197692	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74507042G>A	uc001dfy.3	-	7	1765	c.1573C>T	c.(1573-1575)CGC>TGC	p.R525C	LRRIQ3_uc001dfz.3_Intron	NM_001105659	NP_001099129	A6PVS8	LRIQ3_HUMAN	leucine-rich repeats and IQ motif containing 3	525										ovary(2)	2						AAAAGAGTGCGCTCATTATTT	0.363													35	142	---	---	---	---	PASS
FPGT	8790	broad.mit.edu	37	1	74670223	74670223	+	Silent	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74670223T>A	uc001dgb.1	+	4	529	c.492T>A	c.(490-492)GTT>GTA	p.V164V	TNNI3K_uc001dgc.1_Intron|TNNI3K_uc001dgd.2_Intron|TNNI3K_uc001dge.1_Intron|FPGT_uc010oqt.1_Intron|FPGT_uc010oqu.1_Intron|FPGT_uc010oqv.1_Intron	NM_003838	NP_003829	O14772	FPGT_HUMAN	fucose-1-phosphate guanyltransferase	164					fucose metabolic process	cytoplasm	fucose-1-phosphate guanylyltransferase activity|GTP binding			skin(1)	1						GAATTCTGGTTACCTGTGCAG	0.358													39	98	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79385867	79385867	+	Splice_Site	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79385867C>A	uc001diq.3	-	10	1617	c.1461_splice	c.e10+1	p.K487_splice		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain						neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		TGCCTACATACCTTATTAGTA	0.318													15	42	---	---	---	---	PASS
LPHN2	23266	broad.mit.edu	37	1	82434990	82434990	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82434990T>A	uc001dit.3	+	14	2782	c.2601T>A	c.(2599-2601)AAT>AAA	p.N867K	LPHN2_uc001dis.2_Intron|LPHN2_uc001diu.2_Missense_Mutation_p.N867K|LPHN2_uc001div.2_Missense_Mutation_p.N867K|LPHN2_uc009wcd.2_Missense_Mutation_p.N867K|LPHN2_uc001diw.2_Missense_Mutation_p.N451K|LPHN2_uc009wce.1_5'Flank	NM_012302	NP_036434	O95490	LPHN2_HUMAN	latrophilin 2 precursor	880	Cytoplasmic (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|latrotoxin receptor activity|sugar binding			ovary(3)|lung(3)|breast(2)|central_nervous_system(1)	9				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GTGACCGAAATACTATTCACA	0.408													46	145	---	---	---	---	PASS
MCOLN2	255231	broad.mit.edu	37	1	85412764	85412764	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85412764T>A	uc001dkm.2	-	7	1040	c.799A>T	c.(799-801)AGT>TGT	p.S267C	MCOLN2_uc001dkn.2_Splice_Site	NM_153259	NP_694991	Q8IZK6	MCLN2_HUMAN	mucolipin 2	267						integral to membrane	ion channel activity			ovary(3)|upper_aerodigestive_tract(1)	4				all cancers(265;0.0111)|Epithelial(280;0.0263)|OV - Ovarian serous cystadenocarcinoma(397;0.217)		TTGGCATCACTGTCAAAATAG	0.318													28	113	---	---	---	---	PASS
PKN2	5586	broad.mit.edu	37	1	89299084	89299084	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89299084G>A	uc001dmn.2	+	22	3250	c.2908G>A	c.(2908-2910)GAG>AAG	p.E970K	PKN2_uc010osp.1_Missense_Mutation_p.E954K|PKN2_uc010osq.1_Missense_Mutation_p.E813K|PKN2_uc009wcv.2_Missense_Mutation_p.E922K|PKN2_uc010osr.1_Missense_Mutation_p.E635K	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2	970	AGC-kinase C-terminal.				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TTCGGAAGAGGAGCAGGAAAT	0.403													24	58	---	---	---	---	PASS
HFM1	164045	broad.mit.edu	37	1	91816355	91816355	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91816355C>G	uc001doa.3	-	18	2246	c.2146G>C	c.(2146-2148)GTG>CTG	p.V716L	HFM1_uc009wdb.2_Intron|HFM1_uc010osu.1_Missense_Mutation_p.V395L|HFM1_uc010osv.1_Missense_Mutation_p.V400L	NM_001017975	NP_001017975	A2PYH4	HFM1_HUMAN	HFM1 protein	716	Helicase C-terminal.						ATP binding|ATP-dependent helicase activity|nucleic acid binding				0		all_lung(203;0.00961)|Lung NSC(277;0.0351)		all cancers(265;0.000481)|Epithelial(280;0.00863)|OV - Ovarian serous cystadenocarcinoma(397;0.126)|KIRC - Kidney renal clear cell carcinoma(1967;0.171)		ATCCATTCCACAGCAATATTC	0.328													34	92	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92185495	92185495	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92185495A>T	uc001doh.2	-	9	1834	c.1368T>A	c.(1366-1368)TGT>TGA	p.C456*	TGFBR3_uc009wde.2_Nonsense_Mutation_p.C233*|TGFBR3_uc010osy.1_Nonsense_Mutation_p.C414*|TGFBR3_uc001doi.2_Nonsense_Mutation_p.C455*|TGFBR3_uc001doj.2_Nonsense_Mutation_p.C455*	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	456	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TCTCATTGTCACATTTGACAG	0.507													37	114	---	---	---	---	PASS
GLMN	11146	broad.mit.edu	37	1	92728459	92728459	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92728459C>G	uc001dor.2	-	16	1549	c.1434G>C	c.(1432-1434)TTG>TTC	p.L478F	GLMN_uc009wdg.2_RNA|GLMN_uc001dos.2_Missense_Mutation_p.L464F	NM_053274	NP_444504	Q92990	GLMN_HUMAN	glomulin	478					muscle cell differentiation|negative regulation of T cell proliferation|positive regulation of cytokine secretion|positive regulation of interleukin-2 biosynthetic process|positive regulation of phosphorylation|regulation of gene expression, epigenetic|vasculogenesis	intracellular	hepatocyte growth factor receptor binding			skin(1)	1		all_lung(203;0.00827)|Lung NSC(277;0.0295)		all cancers(265;0.00702)|GBM - Glioblastoma multiforme(16;0.0381)|Epithelial(280;0.0989)		CCAAATACCTCAATAAATTTA	0.269									Multiple_Glomus_Tumors_(of_the_Skin)_Familial				3	30	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94568695	94568695	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94568695C>T	uc001dqh.2	-	5	550	c.446G>A	c.(445-447)AGA>AAA	p.R149K	ABCA4_uc010otn.1_Missense_Mutation_p.R149K	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	149	Extracellular.				phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TCGTATTCCTCTTCCTACATA	0.393													51	169	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	97771800	97771800	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97771800A>C	uc001drv.2	-	17	2249	c.2112T>G	c.(2110-2112)ATT>ATG	p.I704M		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	704					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	CAAAAAAAGGAATCTGAACAG	0.438													85	163	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98039315	98039315	+	Splice_Site	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98039315C>G	uc001drv.2	-	11	1476	c.1339_splice	c.e11+1	p.V447_splice		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1						'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	CAGCACTGTACCTTTAGGATC	0.383													42	113	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98058935	98058935	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98058935C>G	uc001drv.2	-	10	1104	c.967G>C	c.(967-969)GCC>CCC	p.A323P		NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	323					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	GAGTGACAGGCGCACATTCCT	0.453													14	45	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109812421	109812421	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109812421C>G	uc001dxa.3	+	22	7147	c.7086C>G	c.(7084-7086)CTC>CTG	p.L2362L		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	2362	Extracellular (Potential).|GPS.				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCGCTGTGCTCATGGACGTTT	0.667													4	201	---	---	---	---	PASS
C1orf103	55791	broad.mit.edu	37	1	111495334	111495334	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111495334G>C	uc001eaa.2	-	2	428	c.172C>G	c.(172-174)CTA>GTA	p.L58V	C1orf103_uc001dzz.2_5'UTR|C1orf103_uc001eab.2_Intron|C1orf103_uc001eac.1_Intron	NM_018372	NP_060842	Q5T3J3	LRIF1_HUMAN	receptor-interacting factor 1 isoform 1	58					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear matrix	protein binding				0		all_cancers(81;1.02e-05)|all_epithelial(167;1.87e-05)|all_lung(203;0.000234)|Lung NSC(277;0.000451)		Lung(183;0.0155)|Colorectal(144;0.0314)|all cancers(265;0.082)|LUSC - Lung squamous cell carcinoma(189;0.0826)|Epithelial(280;0.0891)|COAD - Colon adenocarcinoma(174;0.134)		GATTGAACTAGTGGTATAAGA	0.403													21	61	---	---	---	---	PASS
ADORA3	140	broad.mit.edu	37	1	112042946	112042946	+	Missense_Mutation	SNP	C	T	T	rs143962803	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112042946C>T	uc001ebh.3	-	2	1350	c.583G>A	c.(583-585)GCC>ACC	p.A195T	ADORA3_uc001ebg.3_Intron|ADORA3_uc001ebf.2_Intron	NM_000677	NP_000668	P33765	AA3R_HUMAN	adenosine A3 receptor isoform 2	195	Helical; Name=5; (By similarity).				activation of adenylate cyclase activity|inflammatory response|regulation of heart contraction	integral to plasma membrane	adenosine receptor activity, G-protein coupled			ovary(2)|large_intestine(1)|skin(1)	4		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)	AGATAGATGGCGCACATGACA	0.433													23	67	---	---	---	---	PASS
TRIM33	51592	broad.mit.edu	37	1	114970454	114970454	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114970454G>A	uc001eew.2	-	7	1302	c.1218C>T	c.(1216-1218)TCC>TCT	p.S406S	TRIM33_uc010owr.1_Silent_p.S14S|TRIM33_uc010ows.1_Silent_p.S14S|TRIM33_uc001eex.2_Silent_p.S406S	NM_015906	NP_056990	Q9UPN9	TRI33_HUMAN	tripartite motif-containing 33 protein isoform	406					negative regulation of BMP signaling pathway|negative regulation of transcription, DNA-dependent|protein ubiquitination|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	nucleus	co-SMAD binding|DNA binding|ligase activity|R-SMAD binding|zinc ion binding			lung(4)|central_nervous_system(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	11	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCACCTGCCGGGAAAGGCCTG	0.443			T	RET	papillary thyroid								30	74	---	---	---	---	PASS
SLC22A15	55356	broad.mit.edu	37	1	116605506	116605506	+	Intron	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116605506A>T	uc001egb.3	+							NM_018420	NP_060890	Q8IZD6	S22AF_HUMAN	solute carrier family 22, member 15						ion transport	integral to membrane	transmembrane transporter activity			large_intestine(2)	2	Lung SC(450;0.184)	all_cancers(81;3.17e-06)|all_epithelial(167;2.32e-06)|all_lung(203;9.81e-06)|Lung NSC(69;5.94e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GTCATCAGGTACGTGTCTCAC	0.453													153	417	---	---	---	---	PASS
SPAG17	200162	broad.mit.edu	37	1	118506562	118506562	+	Splice_Site	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118506562G>A	uc001ehk.2	-	48	6601	c.6533_splice	c.e48-1	p.T2178_splice		NM_206996	NP_996879	Q6Q759	SPG17_HUMAN	sperm associated antigen 17							cilium|flagellar axoneme|microtubule				upper_aerodigestive_tract(2)|ovary(2)|large_intestine(1)|skin(1)	6	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GTTAAAACAGGTAAAATACTT	0.328													41	124	---	---	---	---	PASS
SEC22B	9554	broad.mit.edu	37	1	145109637	145109637	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145109637G>A	uc001eml.1	+	5	439	c.299G>A	c.(298-300)GGA>GAA	p.G100E	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron	NM_004892	NP_004883	O75396	SC22B_HUMAN	SEC22 vesicle trafficking protein homolog B	100	Longin.|Cytoplasmic (Potential).				ER to Golgi vesicle-mediated transport|protein transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|Golgi membrane|integral to membrane|melanosome	protein binding				0						GAACAGCATGGAAAGAAGGTG	0.443													36	829	---	---	---	---	PASS
PDZK1	5174	broad.mit.edu	37	1	145748527	145748527	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145748527C>A	uc001eon.1	+	4	497	c.400C>A	c.(400-402)CGG>AGG	p.R134R	NBPF10_uc001emp.3_Intron|PDZK1_uc001eoo.1_Silent_p.R134R|PDZK1_uc010oza.1_Silent_p.R134R	NM_002614	NP_002605	Q5T2W1	NHRF3_HUMAN	PDZ domain containing 1	134	PDZ 2.				carnitine transport|cell proliferation|drug transport|positive regulation of ion transmembrane transport	brush border membrane|cytoplasm	PDZ domain binding|transporter activity				0	all_hematologic(18;0.00473)|Acute lymphoblastic leukemia(18;0.0786)		KIRC - Kidney renal clear cell carcinoma(6;0.0764)|Kidney(552;0.118)|Colorectal(543;0.229)			GACCCAGCCCCGGCTCTGCTA	0.517													24	64	---	---	---	---	PASS
NBPF14	25832	broad.mit.edu	37	1	148004660	148004660	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148004660G>A	uc001eqq.2	-	22	2671	c.2654C>T	c.(2653-2655)TCA>TTA	p.S885L	LOC200030_uc010ozz.1_Intron|LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqf.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Missense_Mutation_p.S233L|NBPF14_uc010pac.1_Missense_Mutation_p.S458L	NM_015383	NP_056198	Q5TI25	NBPFE_HUMAN	hypothetical protein LOC25832	885	NBPF 10.					cytoplasm				ovary(1)	1	all_hematologic(923;0.032)					TTCCTCAAATGAGTAAAACAC	0.438													119	218	---	---	---	---	PASS
SEMA6C	10500	broad.mit.edu	37	1	151108492	151108492	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151108492A>T	uc001ewu.2	-	13	1554	c.1254T>A	c.(1252-1254)ACT>ACA	p.T418T	SEMA6C_uc001ewv.2_Silent_p.T418T|SEMA6C_uc001eww.2_Silent_p.T378T|SEMA6C_uc010pcq.1_Silent_p.T418T	NM_030913	NP_112175	Q9H3T2	SEM6C_HUMAN	semaphorin Y precursor	418	Extracellular (Potential).|Sema.					integral to membrane	receptor activity			ovary(1)|skin(1)	2	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CATACCTGCTAGTGAGAGTGA	0.562													42	27	---	---	---	---	PASS
PIP5K1A	8394	broad.mit.edu	37	1	151204164	151204164	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151204164G>C	uc001exj.2	+	5	707	c.255G>C	c.(253-255)TTG>TTC	p.L85F	PIP5K1A_uc001exi.2_Missense_Mutation_p.L72F|PIP5K1A_uc010pcu.1_Missense_Mutation_p.L73F|PIP5K1A_uc001exk.2_Missense_Mutation_p.L72F|PIP5K1A_uc010pcv.1_5'Flank	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	85	PIPK.				phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			CATCAGCCTTGAAAGGTGCCA	0.428													23	92	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152193338	152193338	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152193338C>T	uc001ezt.1	-	3	843	c.767G>A	c.(766-768)GGC>GAC	p.G256D		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	256	2.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGTCCGTAGCCAGAGGAGTG	0.542													116	388	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154091182	154091182	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154091182G>A	uc001fdw.2	-	11	1501	c.1429C>T	c.(1429-1431)CAT>TAT	p.H477Y	NUP210L_uc009woq.2_5'UTR|NUP210L_uc010peh.1_Missense_Mutation_p.H477Y	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1	477						integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCCATAGGATGATGAGGAAAT	0.338													39	184	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155207244	155207244	+	Missense_Mutation	SNP	C	T	T	rs78973108		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155207244C>T	uc001fjh.2	-	7	1037	c.887G>A	c.(886-888)CGA>CAA	p.R296Q	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Missense_Mutation_p.R183Q|GBA_uc010pfx.1_Missense_Mutation_p.R247Q|GBA_uc001fji.2_Missense_Mutation_p.R296Q|GBA_uc001fjj.2_Missense_Mutation_p.R296Q|GBA_uc001fjk.2_Missense_Mutation_p.R296Q|GBA_uc001fjl.2_Missense_Mutation_p.R296Q|GBA_uc010pfy.1_Missense_Mutation_p.R209Q|GBA_uc009wqk.1_Missense_Mutation_p.R209Q	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	296			R -> Q (in GD; type 2; also found in a patient with Parkinson disease).		carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	AATGAAGTCTCGCTGATGTTC	0.557									Gaucher_disease_type_I				24	64	---	---	---	---	PASS
C1orf92	149499	broad.mit.edu	37	1	156902656	156902656	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156902656C>T	uc001fqm.2	+	15	1747	c.1575C>T	c.(1573-1575)TTC>TTT	p.F525F	C1orf92_uc001fql.2_Missense_Mutation_p.S346L	NM_144702	NP_653303	Q8N4P6	LRC71_HUMAN	hypothetical protein LOC149499	525											0	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					AAAATTGCTTCGCCCCACAAT	0.493													6	19	---	---	---	---	PASS
CD5L	922	broad.mit.edu	37	1	157804447	157804447	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157804447C>A	uc001frk.3	-	4	611	c.468G>T	c.(466-468)CAG>CAT	p.Q156H		NM_005894	NP_005885	O43866	CD5L_HUMAN	CD5 molecule-like precursor	156	SRCR 2.				apoptosis|cellular defense response	extracellular space|membrane	scavenger receptor activity			ovary(1)	1	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACCACTGGTTCTGGTGCTTCA	0.622													32	148	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158605732	158605732	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158605732C>A	uc001fst.1	-	38	5602	c.5403G>T	c.(5401-5403)TGG>TGT	p.W1801C		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1801	Spectrin 17.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TGAGCTTCTCCCAGTGTTCAA	0.522													113	59	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158655035	158655035	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158655035C>T	uc001fst.1	-	2	326	c.127G>A	c.(127-129)GCT>ACT	p.A43T		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	43	Spectrin 1.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ccccTCTCAGCGACCCGCTCC	0.328													25	96	---	---	---	---	PASS
ITLN1	55600	broad.mit.edu	37	1	160851012	160851012	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160851012G>T	uc001fxc.2	-	5	612	c.496C>A	c.(496-498)CTG>ATG	p.L166M		NM_017625	NP_060095	Q8WWA0	ITLN1_HUMAN	intelectin precursor	166	Fibrinogen C-terminal.				positive regulation of glucose import|positive regulation of protein phosphorylation|response to nematode|signal transduction	anchored to membrane|brush border membrane|extracellular region|membrane raft	receptor binding|sugar binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)|central_nervous_system(1)	7	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TACCTCAGCAGGGAGCTGTTT	0.567													102	39	---	---	---	---	PASS
C1orf114	57821	broad.mit.edu	37	1	169390622	169390622	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169390622C>T	uc001gga.1	-	3	1215	c.1047G>A	c.(1045-1047)AAG>AAA	p.K349K	C1orf114_uc001gfz.1_Silent_p.K349K|C1orf114_uc009wvq.1_Silent_p.K349K|C1orf114_uc001ggb.2_Silent_p.K349K|C1orf114_uc001ggc.1_Silent_p.K349K	NM_021179	NP_067002	Q5TID7	CA114_HUMAN	hypothetical protein LOC57821	349	Potential.										0	all_hematologic(923;0.208)					GTTTTTCTCTCTTTTCTTCTA	0.348													18	92	---	---	---	---	PASS
SELL	6402	broad.mit.edu	37	1	169660918	169660918	+	3'UTR	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169660918G>T	uc001ggk.2	-	9					C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_3'UTR	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor						blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					CTTTCACCAAGGGCGATTTAA	0.328													3	20	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170931074	170931074	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170931074C>T	uc001ghg.2	+	6	462	c.332C>T	c.(331-333)ACG>ATG	p.T111M	C1orf129_uc009wvy.2_Translation_Start_Site|C1orf129_uc010plz.1_Missense_Mutation_p.T111M	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	111							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					AACATTCTTACGAGCTTGGTG	0.303													14	14	---	---	---	---	PASS
TNR	7143	broad.mit.edu	37	1	175331872	175331872	+	Silent	SNP	G	T	T	rs138173384		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175331872G>T	uc001gkp.1	-	12	2862	c.2781C>A	c.(2779-2781)ACC>ACA	p.T927T	TNR_uc009wwu.1_Silent_p.T927T	NM_003285	NP_003276	Q92752	TENR_HUMAN	tenascin R precursor	927	Fibronectin type-III 7.				axon guidance|cell adhesion|signal transduction	proteinaceous extracellular matrix		p.T927I(1)		pancreas(5)|ovary(4)|central_nervous_system(1)|skin(1)	11	Renal(580;0.146)					TTTCGTATTCGGTAGCTGGGT	0.527													33	92	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564279	176564279	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564279C>A	uc001gkz.2	+	3	2703	c.1539C>A	c.(1537-1539)TAC>TAA	p.Y513*	PAPPA2_uc001gky.1_Nonsense_Mutation_p.Y513*|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	513	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TCTCCCAGTACAATGGATACT	0.532													18	63	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180053187	180053187	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180053187G>T	uc001gnt.2	+	31	6542	c.6159G>T	c.(6157-6159)AGG>AGT	p.R2053S	CEP350_uc009wxl.2_Missense_Mutation_p.R2052S|CEP350_uc001gnv.2_Missense_Mutation_p.R188S|CEP350_uc001gnw.1_5'Flank	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	2053	Potential.					centrosome|nucleus|spindle				ovary(4)	4						TTGAAGGTAGGATCAGAGCTC	0.353													5	16	---	---	---	---	PASS
LAMC2	3918	broad.mit.edu	37	1	183200120	183200120	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183200120C>G	uc001gqa.2	+	12	2053	c.1739C>G	c.(1738-1740)TCA>TGA	p.S580*	LAMC2_uc001gpz.3_Nonsense_Mutation_p.S580*|LAMC2_uc010poa.1_Nonsense_Mutation_p.S280*	NM_005562	NP_005553	Q13753	LAMC2_HUMAN	laminin, gamma 2 isoform a precursor	580	Laminin EGF-like 8; truncated.				cell adhesion|epidermis development|hemidesmosome assembly		heparin binding			skin(2)|ovary(1)	3						CCCATGGGCTCAGAGCCTGTA	0.483													82	44	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186031077	186031077	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186031077C>T	uc001grq.1	+	47	7636	c.7407C>T	c.(7405-7407)ATC>ATT	p.I2469I		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2469	Ig-like C2-type 22.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						AAAGAAAAATCTTTGGGCTTT	0.393													12	47	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186106956	186106956	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186106956G>C	uc001grq.1	+	89	14005	c.13776G>C	c.(13774-13776)TGG>TGC	p.W4592C	HMCN1_uc001grs.1_Missense_Mutation_p.W161C	NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	4592	TSP type-1 2.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGTCGGAATGGAGTCTTTGGG	0.483													17	109	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067721	190067721	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067721G>A	uc001gse.1	-	8	1960	c.1728C>T	c.(1726-1728)TTC>TTT	p.F576F	FAM5C_uc010pot.1_Silent_p.F474F	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	576						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GGCTGCCTCCGAAGGGATTGA	0.463													144	52	---	---	---	---	PASS
RGS1	5996	broad.mit.edu	37	1	192547471	192547471	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:192547471G>C	uc001gsi.1	+	4	466	c.400G>C	c.(400-402)GAA>CAA	p.E134Q	RGS1_uc010pou.1_Missense_Mutation_p.E134Q	NM_002922	NP_002913	Q08116	RGS1_HUMAN	regulator of G-protein signalling 1	134	RGS.				immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|negative regulation of signal transduction	cytoplasm|plasma membrane	calmodulin binding|GTPase activator activity|signal transducer activity				0		Breast(1374;0.188)				CTGTAAAGCAGAAGAGATATA	0.363													54	215	---	---	---	---	PASS
GLRX2	51022	broad.mit.edu	37	1	193074708	193074708	+	5'Flank	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193074708C>A	uc001gsz.1	-						GLRX2_uc001gta.1_Missense_Mutation_p.V21L	NM_197962	NP_932066	Q9NS18	GLRX2_HUMAN	glutaredoxin 2 isoform 2						apoptosis|cell differentiation|cell redox homeostasis|DNA protection|electron transport chain|glutathione metabolic process|protein thiol-disulfide exchange|regulation of signal transduction|regulation of transcription, DNA-dependent|response to hydrogen peroxide|response to organic substance|response to redox state|response to temperature stimulus|transport	mitochondrion|nucleus	2 iron, 2 sulfur cluster binding|arsenate reductase (glutaredoxin) activity|electron carrier activity|glutathione disulfide oxidoreductase activity|metal ion binding|protein disulfide oxidoreductase activity				0					Glutathione(DB00143)	GCGAGTGCCACCCACGTGTAA	0.602													8	30	---	---	---	---	PASS
KCNT2	343450	broad.mit.edu	37	1	196227412	196227412	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196227412C>T	uc001gtd.1	-	26	3183	c.3123G>A	c.(3121-3123)CTG>CTA	p.L1041L	KCNT2_uc009wyt.1_RNA|KCNT2_uc001gte.1_Silent_p.L974L|KCNT2_uc001gtf.1_Silent_p.L1017L|KCNT2_uc001gtg.1_RNA|KCNT2_uc001gth.1_Silent_p.L545L	NM_198503	NP_940905	Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1041	Cytoplasmic (Potential).					voltage-gated potassium channel complex	ATP binding|calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(5)|breast(1)|skin(1)	7						TGTAGAGGTTCAGTCGCTGCT	0.453													105	41	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197060090	197060090	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197060090C>G	uc001gtu.2	-	23	9783	c.9526G>C	c.(9526-9528)GAA>CAA	p.E3176Q	ASPM_uc001gtv.2_Missense_Mutation_p.E1591Q|ASPM_uc001gtw.3_Missense_Mutation_p.E1024Q	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	3176					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTCAGACATTCTTGACCTTCA	0.368													37	92	---	---	---	---	PASS
NAV1	89796	broad.mit.edu	37	1	201751848	201751848	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201751848G>T	uc001gwu.2	+	6	2555	c.2208G>T	c.(2206-2208)CGG>CGT	p.R736R	NAV1_uc001gwv.1_Silent_p.R244R|NAV1_uc001gww.1_Silent_p.R345R|NAV1_uc001gwx.2_Silent_p.R345R|NAV1_uc001gwy.1_Silent_p.R117R	NM_020443	NP_065176	Q8NEY1	NAV1_HUMAN	neuron navigator 1	736	Potential.				cell differentiation|nervous system development	cytoplasm|microtubule	nucleoside-triphosphatase activity|nucleotide binding			central_nervous_system(3)|ovary(1)	4						AGACAGATCGGGAAAAGGAGA	0.552													28	50	---	---	---	---	PASS
C4BPA	722	broad.mit.edu	37	1	207297617	207297617	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207297617C>T	uc001hfo.2	+	6	806	c.612C>T	c.(610-612)GAC>GAT	p.D204D		NM_000715	NP_000706	P04003	C4BPA_HUMAN	complement component 4 binding protein, alpha	204	Sushi 3.				complement activation, classical pathway|innate immune response	extracellular region	protein binding			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ACAGCTGTGACCCCCGCTTCT	0.493													28	99	---	---	---	---	PASS
C1orf107	27042	broad.mit.edu	37	1	210001471	210001471	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210001471G>A	uc001hhr.1	+	1	139	c.63G>A	c.(61-63)AAG>AAA	p.K21K	C1orf107_uc009xcu.1_5'UTR	NM_014388	NP_055203	Q68CQ4	DIEXF_HUMAN	digestive-organ expansion factor homolog	21					multicellular organismal development	nucleus					0				OV - Ovarian serous cystadenocarcinoma(81;0.0367)		AAAAGCAGAAGAAACATCTTC	0.552											OREG0014221	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	25	98	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216246460	216246460	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216246460C>T	uc001hku.1	-	28	6142	c.5755G>A	c.(5755-5757)GGT>AGT	p.G1919S		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1919	Fibronectin type-III 5.|Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGGAGACCACCCTCGTAAACA	0.468										HNSCC(13;0.011)			37	21	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216850616	216850616	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216850616C>T	uc001hkw.1	-	2	440	c.274G>A	c.(274-276)GGA>AGA	p.G92R	ESRRG_uc001hky.1_Missense_Mutation_p.G69R|ESRRG_uc009xdp.1_Missense_Mutation_p.G69R|ESRRG_uc001hkz.1_Missense_Mutation_p.G69R|ESRRG_uc010puc.1_Missense_Mutation_p.G69R|ESRRG_uc001hla.1_Missense_Mutation_p.G69R|ESRRG_uc001hlb.1_Missense_Mutation_p.G69R|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Missense_Mutation_p.G69R|ESRRG_uc001hld.1_Missense_Mutation_p.G69R|ESRRG_uc001hkx.1_Missense_Mutation_p.G97R|ESRRG_uc009xdo.1_Missense_Mutation_p.G69R|ESRRG_uc001hle.1_Missense_Mutation_p.G69R	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	92					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	CCACTACCTCCCAGGATAGGA	0.527													47	111	---	---	---	---	PASS
TGFB2	7042	broad.mit.edu	37	1	218520187	218520187	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:218520187G>A	uc001hlm.2	+	1	797	c.144G>A	c.(142-144)CTG>CTA	p.L48L	TGFB2_uc001hll.2_Silent_p.L48L|TGFB2_uc001hln.2_Silent_p.L48L|TGFB2_uc010pue.1_RNA|TGFB2_uc001hlo.2_RNA	NM_003238	NP_003229	P61812	TGFB2_HUMAN	transforming growth factor, beta 2 isoform 2	48					activation of protein kinase activity|angiogenesis|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cardioblast differentiation|catagen|cell cycle arrest|cell death|cell growth|cell-cell junction organization|cell-cell signaling|collagen fibril organization|dopamine biosynthetic process|embryonic digestive tract development|eye development|glial cell migration|hair follicle morphogenesis|hemopoiesis|menstrual cycle phase|negative regulation of alkaline phosphatase activity|negative regulation of cell growth|negative regulation of epithelial cell proliferation|negative regulation of immune response|negative regulation of macrophage cytokine production|neuron development|neutrophil chemotaxis|odontogenesis|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of cardioblast differentiation|positive regulation of catagen|positive regulation of cell adhesion mediated by integrin|positive regulation of cell cycle|positive regulation of cell division|positive regulation of cell growth|positive regulation of cell proliferation|positive regulation of epithelial cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of heart contraction|positive regulation of immune response|positive regulation of integrin biosynthetic process|positive regulation of neuron apoptosis|positive regulation of ossification|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of protein secretion|positive regulation of stress-activated MAPK cascade|regulation of transforming growth factor-beta2 production|response to hypoxia|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein import into nucleus|somatic stem cell division|transforming growth factor beta receptor signaling pathway	axon|extracellular matrix|extracellular space|neuronal cell body|platelet alpha granule lumen	beta-amyloid binding|cytokine activity|growth factor activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling protein serine/threonine kinase activity|type II transforming growth factor beta receptor binding				0				all cancers(67;0.0459)|OV - Ovarian serous cystadenocarcinoma(81;0.049)|GBM - Glioblastoma multiforme(131;0.0776)		TGAGCAAGCTGAAGCTCACCA	0.592													44	94	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227400839	227400839	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227400839C>T	uc001hqr.2	-	3	1295	c.352G>A	c.(352-354)GAG>AAG	p.E118K	CDC42BPA_uc001hqs.2_Missense_Mutation_p.E118K|CDC42BPA_uc009xes.2_Missense_Mutation_p.E118K|CDC42BPA_uc010pvs.1_Missense_Mutation_p.E118K	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	118	Protein kinase.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				ACTCTTACCTCAGCTCTTTTC	0.259													5	75	---	---	---	---	PASS
GJC2	57165	broad.mit.edu	37	1	228345504	228345504	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228345504G>C	uc001hsk.2	+	2	220	c.45G>C	c.(43-45)GAG>GAC	p.E15D		NM_020435	NP_065168	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	15	Cytoplasmic (Potential).				cell death	connexon complex|integral to membrane					0		Prostate(94;0.0405)				TGCTGGAGGAGATCCACAACC	0.677													5	10	---	---	---	---	PASS
RAB4A	5867	broad.mit.edu	37	1	229422230	229422230	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229422230C>G	uc001hth.2	+						RAB4A_uc001hti.2_Intron|RAB4A_uc001htj.2_Intron	NM_004578	NP_004569	P20338	RAB4A_HUMAN	RAB4A, member RAS oncogene family								GDP binding|GTP binding|GTPase activity			ovary(1)	1	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.178)				TTTTATCTTTCAGATTTTTTG	0.279													8	31	---	---	---	---	PASS
HEATR1	55127	broad.mit.edu	37	1	236746418	236746418	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236746418C>G	uc001hyd.1	-	18	2445	c.2320G>C	c.(2320-2322)GAG>CAG	p.E774Q	HEATR1_uc009xgh.1_Missense_Mutation_p.E17Q	NM_018072	NP_060542	Q9H583	HEAT1_HUMAN	protein BAP28	774					rRNA processing	nucleolus|ribonucleoprotein complex	protein binding			ovary(2)|skin(1)	3	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			CTGTTGAGCTCTTCTACATAA	0.423													60	325	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237693748	237693748	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237693748T>C	uc001hyl.1	+	25	2964	c.2844T>C	c.(2842-2844)TGT>TGC	p.C948C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	948	Cytoplasmic (By similarity).|1.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CATTAGGATGTCATGTGGGTA	0.373													4	18	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237758839	237758839	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237758839G>A	uc001hyl.1	+	34	4598	c.4478G>A	c.(4477-4479)AGC>AAC	p.S1493N		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1493	Cytoplasmic (By similarity).|B30.2/SPRY 3.|4 X approximate repeats.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCGGGTGAGAGCATGAGCCCC	0.473													38	21	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241094078	241094078	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241094078G>A	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTGCGGAATGAAAAGAAGTG	0.373													42	167	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242024771	242024771	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242024771A>G	uc001hzh.2	+	10	1548	c.1008A>G	c.(1006-1008)GAA>GAG	p.E336E	EXO1_uc001hzi.2_Silent_p.E336E|EXO1_uc001hzj.2_Silent_p.E336E|EXO1_uc009xgq.2_Silent_p.E336E	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	336	Interaction with MSH3.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			ATACTTTTGAACAGATCGATG	0.333								Direct_reversal_of_damage|Editing_and_processing_nucleases					67	35	---	---	---	---	PASS
PLD5	200150	broad.mit.edu	37	1	242383356	242383356	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242383356G>T	uc001hzn.1	-	5	796	c.669C>A	c.(667-669)TTC>TTA	p.F223L	PLD5_uc001hzl.3_Missense_Mutation_p.F161L|PLD5_uc001hzm.3_Missense_Mutation_p.F13L|PLD5_uc001hzo.1_Missense_Mutation_p.F131L			Q8N7P1	PLD5_HUMAN	RecName: Full=Inactive phospholipase D5;          Short=Inactive PLD 5; AltName: Full=Inactive choline phosphatase 5; AltName: Full=Inactive phosphatidylcholine-hydrolyzing phospholipase D5; AltName: Full=PLDc;	223	PLD phosphodiesterase 1.					integral to membrane	catalytic activity			ovary(6)	6	Melanoma(84;0.242)		OV - Ovarian serous cystadenocarcinoma(106;0.0329)			CCACGATCCAGAAGGAGGACT	0.522													56	29	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243480085	243480085	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243480085G>C	uc001hzw.2	+	9	1114	c.958G>C	c.(958-960)GTT>CTT	p.V320L	SDCCAG8_uc010pyk.1_Missense_Mutation_p.V175L|SDCCAG8_uc010pyl.1_Missense_Mutation_p.V132L|SDCCAG8_uc001hzx.2_Missense_Mutation_p.V132L	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	320	Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GTCTGCACTAGTTTCCGTAAG	0.408													67	39	---	---	---	---	PASS
HNRNPU	3192	broad.mit.edu	37	1	245027496	245027496	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245027496G>C	uc001iaz.1	-	1	332	c.114C>G	c.(112-114)CTC>CTG	p.L38L	HNRNPU_uc001iba.1_Silent_p.L38L|HNRNPU_uc001ibb.1_Intron	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	38	SAP.|Asp/Glu-rich (acidic).				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			GCGCAGCCTGGAGTCGCTCCA	0.642													7	14	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247013588	247013588	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247013588C>G	uc001ibu.1	-	32	5727	c.5720G>C	c.(5719-5721)AGA>ACA	p.R1907T	AHCTF1_uc001ibv.1_Missense_Mutation_p.R1916T|AHCTF1_uc009xgs.1_Missense_Mutation_p.R768T|AHCTF1_uc001ibw.1_RNA	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	1907	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			ATTAGTACTTCTCAATTTTCT	0.333													68	174	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004562	248004562	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004562G>A	uc001idn.1	-	1	637	c.637C>T	c.(637-639)CTG>TTG	p.L213L		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	213	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CCCAGTGTCAGAAAAAAACAA	0.512													16	85	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248262725	248262725	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248262725G>T	uc001ids.2	+	3	385	c.48G>T	c.(46-48)CTG>CTT	p.L16L		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	16	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TGTTGGGTCTGCTTCCCCCAA	0.363													119	81	---	---	---	---	PASS
OR2T12	127064	broad.mit.edu	37	1	248458198	248458198	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248458198G>A	uc010pzj.1	-	1	683	c.683C>T	c.(682-684)TCT>TTT	p.S228F		NM_001004692	NP_001004692	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T,	228	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			GGCTTCTGTAGAGCGCATGAG	0.512													26	83	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487683	248487683	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487683A>T	uc010pzk.1	-	1	188	c.188T>A	c.(187-189)CTC>CAC	p.L63H		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	63	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAGTTGGCTGAGGAGGAAGTA	0.532													298	122	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685325	248685325	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685325C>T	uc001ien.1	+	1	378	c.378C>T	c.(376-378)GTC>GTT	p.V126V		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATGCTGCTGTCTGCCGGCCAC	0.592													25	62	---	---	---	---	PASS
SH3BP5L	80851	broad.mit.edu	37	1	249106516	249106516	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:249106516C>A	uc001iew.1	-	7	1317	c.765G>T	c.(763-765)ACG>ACT	p.T255T	SH3BP5L_uc010pzp.1_Silent_p.T148T|SH3BP5L_uc010pzq.1_Silent_p.T223T|SH3BP5L_uc001iev.1_Silent_p.T136T	NM_030645	NP_085148	Q7L8J4	3BP5L_HUMAN	SH3-binding domain protein 5-like	255	Potential.										0	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			CGGAGTAGCGCGTCTTGGCCT	0.667													23	18	---	---	---	---	PASS
SNTG2	54221	broad.mit.edu	37	2	1161261	1161261	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1161261G>A	uc002qwq.2	+	7	567	c.439G>A	c.(439-441)GAA>AAA	p.E147K	SNTG2_uc010ewi.2_Intron	NM_018968	NP_061841	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2	147	PDZ.				central nervous system development	cytoplasm|cytoskeleton|sarcolemma|syntrophin complex	actin binding|PDZ domain binding			ovary(1)|large_intestine(1)|breast(1)	3	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		TGCTGGCGATGAAGTTACCAT	0.438													14	89	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1652885	1652885	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1652885C>T	uc002qxa.2	-	17	2731	c.2667G>A	c.(2665-2667)ATG>ATA	p.M889I		NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	889					extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCAGCGAAGTCATGCCGCTGC	0.627													7	40	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1893045	1893045	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1893045T>C	uc002qxe.2	-	16	3315	c.2488A>G	c.(2488-2490)AGG>GGG	p.R830G	MYT1L_uc002qxd.2_Missense_Mutation_p.R828G|MYT1L_uc010ewl.1_RNA	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	830					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCGTCTATCCTCCGGGGTTTC	0.532													26	122	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15415804	15415804	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15415804G>A	uc002rcc.1	-	44	5554	c.5528C>T	c.(5527-5529)CCA>CTA	p.P1843L	NBAS_uc010exl.1_Missense_Mutation_p.P915L|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	1843										ovary(2)|liver(1)|skin(1)	4						CAGAGAGCTTGGGGAAAGCAT	0.458													29	113	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15761252	15761252	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15761252G>C	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		TGAGTTAAAAGAGTCAAATGT	0.229													19	78	---	---	---	---	PASS
MATN3	4148	broad.mit.edu	37	2	20205673	20205673	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20205673C>A	uc002rdl.2	-	2	685	c.622G>T	c.(622-624)GCT>TCT	p.A208S	MATN3_uc010exu.1_Missense_Mutation_p.A208S	NM_002381	NP_002372	O15232	MATN3_HUMAN	matrilin 3 precursor	208	VWFA.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGGGCCCGAGCCGCCACCTCA	0.602													13	20	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21242603	21242603	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21242603C>T	uc002red.2	-	19	3119	c.2991G>A	c.(2989-2991)GGG>GGA	p.G997G		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	997					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ACCTGGTGTCCCCGGTCAGCG	0.527													7	46	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21250864	21250864	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21250864G>A	uc002red.2	-	14	2031	c.1903C>T	c.(1903-1905)CGG>TGG	p.R635W		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	635	Vitellogenin.				cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TGATAGTTCCGAGAGAATTTT	0.368													62	240	---	---	---	---	PASS
HADHB	3032	broad.mit.edu	37	2	26496613	26496613	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26496613A>G	uc002rgz.2	+	6	600	c.349A>G	c.(349-351)AGA>GGA	p.R117G	HADHB_uc010ykv.1_Missense_Mutation_p.R95G|HADHB_uc010ykw.1_Missense_Mutation_p.R102G|HADHB_uc002rha.2_Missense_Mutation_p.R117G|HADHB_uc010ykx.1_Missense_Mutation_p.R43G	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	117			R -> G (in TFP deficiency).		fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAATGTGGCTAGAGAGGTGAG	0.348													29	52	---	---	---	---	PASS
TCF23	150921	broad.mit.edu	37	2	27372107	27372107	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27372107C>T	uc010ylg.1	+	1	106	c.106C>T	c.(106-108)CGC>TGC	p.R36C		NM_175769	NP_786951	Q7RTU1	TCF23_HUMAN	transcription factor 23	36					cell differentiation|muscle organ development|regulation of transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGAGGAGCCGCCTCAGCAG	0.652													3	14	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27446828	27446828	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27446828G>C	uc002rji.2	+	8	1201	c.1039G>C	c.(1039-1041)GAA>CAA	p.E347Q	CAD_uc010eyw.2_Missense_Mutation_p.E347Q	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	347	Glutamine amidotransferase type-1.|GATase (Glutamine amidotransferase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	TTCAGATATGGAACTGCTTTT	0.507													84	405	---	---	---	---	PASS
YIPF4	84272	broad.mit.edu	37	2	32517379	32517379	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32517379C>G	uc002rok.2	+	3	634	c.367C>G	c.(367-369)CTT>GTT	p.L123V		NM_032312	NP_115688	Q9BSR8	YIPF4_HUMAN	Yip1 domain family, member 4	123	Helical; (Potential).					endoplasmic reticulum|integral to membrane	protein binding				0	Acute lymphoblastic leukemia(172;0.155)					GGCTGTTGTTCTTTTCTTTTC	0.318													21	127	---	---	---	---	PASS
LTBP1	4052	broad.mit.edu	37	2	33411937	33411937	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33411937C>G	uc002ros.2	+	6	1216	c.1216C>G	c.(1216-1218)CCA>GCA	p.P406A	LTBP1_uc002rot.2_Missense_Mutation_p.P80A|LTBP1_uc002rou.2_Missense_Mutation_p.P80A|LTBP1_uc002rov.2_Missense_Mutation_p.P80A|LTBP1_uc010ymz.1_Missense_Mutation_p.P80A|LTBP1_uc010yna.1_Missense_Mutation_p.P80A	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding	406	EGF-like 2.				negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				TTGCCATCTTCCATGTATGAA	0.433													9	62	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33783912	33783912	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33783912G>T	uc002rox.2	+	18	2506	c.1879G>T	c.(1879-1881)GAC>TAC	p.D627Y	RASGRP3_uc010ync.1_Missense_Mutation_p.D627Y|RASGRP3_uc002roy.2_Missense_Mutation_p.D626Y	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	627					MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					TGGCTGGGGGGACTCGGGGTC	0.552													13	97	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37227735	37227735	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37227735G>T	uc002rpp.1	-	33	5635	c.5539C>A	c.(5539-5541)CAA>AAA	p.Q1847K	HEATR5B_uc002rpo.1_Missense_Mutation_p.Q160K|HEATR5B_uc010ezy.1_Missense_Mutation_p.Q342K	NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1847							binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TTACCTGGTTGAGAATATTCC	0.383													5	161	---	---	---	---	PASS
C2orf56	55471	broad.mit.edu	37	2	37475350	37475350	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37475350C>A	uc002rqa.3	+	10	1258	c.1183C>A	c.(1183-1185)CCA>ACA	p.P395T	C2orf56_uc002rqc.3_Missense_Mutation_p.P297T|C2orf56_uc010ynk.1_Missense_Mutation_p.P324T|C2orf56_uc010ynl.1_Missense_Mutation_p.P368T|C2orf56_uc010fah.2_RNA	NM_144736	NP_653337	Q7L592	MIDA_HUMAN	hypothetical protein LOC55471 isoform 1	395					mitochondrial respiratory chain complex I assembly	mitochondrion	enzyme binding|methyltransferase activity			central_nervous_system(1)	1		all_hematologic(82;0.21)				GTTAATGAATCCAAAGAAGAT	0.363													28	148	---	---	---	---	PASS
PLEKHH2	130271	broad.mit.edu	37	2	43937375	43937375	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43937375C>T	uc010yny.1	+	13	2203	c.2120C>T	c.(2119-2121)TCT>TTT	p.S707F	PLEKHH2_uc002rte.3_Missense_Mutation_p.S707F|PLEKHH2_uc002rtf.3_Missense_Mutation_p.S706F	NM_172069	NP_742066	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H	707	PH 1.					cytoplasm|cytoskeleton|integral to membrane	binding			skin(2)|central_nervous_system(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CTGGAAAAATCTGGTTATTTA	0.348													38	146	---	---	---	---	PASS
ABCG5	64240	broad.mit.edu	37	2	44065709	44065709	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44065709C>A	uc002rtn.2	-	1	250	c.110G>T	c.(109-111)AGC>ATC	p.S37I	ABCG5_uc002rto.2_5'UTR|ABCG5_uc002rtp.2_5'UTR|ABCG8_uc002rtq.2_5'Flank|ABCG8_uc010yoa.1_5'Flank	NM_022436	NP_071881	Q9H222	ABCG5_HUMAN	ATP-binding cassette sub-family G member 5	37	Cytoplasmic (Potential).				cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			ovary(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATGCCCAGGCTGTGAGGCTC	0.672													8	26	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48925888	48925888	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48925888G>T	uc002rwu.3	-	9	802	c.732C>A	c.(730-732)TCC>TCA	p.S244S	GTF2A1L_uc002rwt.2_Intron|LHCGR_uc002rwv.2_RNA	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	244	Extracellular (Potential).|LRR 6.				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	GCCTCTGAATGGACTCTAGGC	0.413									Familial_Male-Limited_Precocious_Puberty				31	58	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	51254958	51254958	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51254958C>T	uc010fbq.2	-	2	1931	c.454G>A	c.(454-456)GGC>AGC	p.G152S	NRXN1_uc002rxe.3_Missense_Mutation_p.G152S|NRXN1_uc002rxd.1_Missense_Mutation_p.G152S	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ACGAAAAGGCCGCTGAACACC	0.672													10	31	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54127089	54127089	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54127089C>G	uc002rxp.2	-	29	3407	c.3351G>C	c.(3349-3351)CAG>CAC	p.Q1117H	PSME4_uc010yop.1_Missense_Mutation_p.Q1003H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Q492H|PSME4_uc010fbv.1_Missense_Mutation_p.Q261H	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	1117					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TAAGCAATATCTGGTTGATAG	0.343													39	222	---	---	---	---	PASS
SMEK2	57223	broad.mit.edu	37	2	55804451	55804451	+	Missense_Mutation	SNP	C	A	A	rs143373895		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55804451C>A	uc002rzc.2	-	11	1981	c.1606G>T	c.(1606-1608)GAT>TAT	p.D536Y	SMEK2_uc002rzb.2_Missense_Mutation_p.G504C|SMEK2_uc002rzd.2_Missense_Mutation_p.D504Y|SMEK2_uc002rza.2_Missense_Mutation_p.G380C	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1	536						microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TCATACTTACCGGGACAAATT	0.204													13	60	---	---	---	---	PASS
XPO1	7514	broad.mit.edu	37	2	61753653	61753653	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61753653T>C	uc002sbj.2	-	3	858	c.130A>G	c.(130-132)AGA>GGA	p.R44G	XPO1_uc010fcl.2_Missense_Mutation_p.R40G|XPO1_uc010ypn.1_Missense_Mutation_p.R40G|XPO1_uc002sbk.2_5'UTR	NM_003400	NP_003391	O14980	XPO1_HUMAN	exportin 1	44	Necessary for HTLV-1 Rex-mediated mRNA export.				intracellular protein transport|mitotic prometaphase|mRNA metabolic process|mRNA transport|viral genome transport in host cell|viral infectious cycle	annulate lamellae|Cajal body|cytosol|kinetochore|nuclear envelope|nucleolus|ribonucleoprotein complex	protein binding|protein transporter activity|RNA binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	4			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TGAGCCATTCTTTGCTAAAAT	0.303													16	80	---	---	---	---	PASS
CD207	50489	broad.mit.edu	37	2	71060876	71060876	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71060876C>A	uc002shg.2	-	3	513	c.466G>T	c.(466-468)GAG>TAG	p.E156*		NM_015717	NP_056532	Q9UJ71	CLC4K_HUMAN	CD207 antigen, langerin	156	Potential.|Extracellular (Potential).				defense response to virus	endocytic vesicle|integral to membrane	mannose binding			ovary(1)|lung(1)	2						CTTTTTAACTCTGGGATTTGG	0.438													21	104	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71753408	71753408	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71753408C>A	uc002sie.2	+	12	1488	c.1112C>A	c.(1111-1113)CCC>CAC	p.P371H	DYSF_uc010feg.2_Missense_Mutation_p.P402H|DYSF_uc010feh.2_Missense_Mutation_p.P371H|DYSF_uc002sig.3_Missense_Mutation_p.P371H|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.P371H|DYSF_uc010fef.2_Missense_Mutation_p.P402H|DYSF_uc010fei.2_Missense_Mutation_p.P402H|DYSF_uc010fek.2_Missense_Mutation_p.P403H|DYSF_uc010fej.2_Missense_Mutation_p.P372H|DYSF_uc010fel.2_Missense_Mutation_p.P372H|DYSF_uc010feo.2_Missense_Mutation_p.P403H|DYSF_uc010fem.2_Missense_Mutation_p.P372H|DYSF_uc010fen.2_Missense_Mutation_p.P403H|DYSF_uc002sif.2_Missense_Mutation_p.P372H	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	371	Cytoplasmic (Potential).|C2 3.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						CTGCTCCGGCCCACAGGCGTA	0.592													37	341	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73635786	73635786	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73635786G>A	uc002sje.1	+	3	475	c.364G>A	c.(364-366)GTA>ATA	p.V122I	ALMS1_uc002sjf.1_Intron	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	121					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						GCAACAGATAGTATATCAAGG	0.358													45	68	---	---	---	---	PASS
ALMS1	7840	broad.mit.edu	37	2	73716778	73716778	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73716778G>T	uc002sje.1	+	12	7806	c.7695G>T	c.(7693-7695)CGG>CGT	p.R2565R	ALMS1_uc002sjf.1_Silent_p.R2521R|ALMS1_uc002sjg.2_Silent_p.R1951R|ALMS1_uc002sjh.1_Silent_p.R1951R	NM_015120	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2563					G2/M transition of mitotic cell cycle	centrosome|cilium|cytosol|microtubule basal body|spindle pole				skin(3)|ovary(2)|breast(2)|pancreas(1)|lung(1)	9						AGAGTCCACGGGGAATGGGAT	0.373													7	229	---	---	---	---	PASS
NAT8B	51471	broad.mit.edu	37	2	73927788	73927788	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73927788G>A	uc002sjk.1	-	3	680	c.645C>T	c.(643-645)TTC>TTT	p.F215F		NM_016347	NP_057431	Q9UHF3	NAT8B_HUMAN	N-acetyltransferase 8B	215					gastrulation with mouth forming second	integral to membrane	N-acetyltransferase activity				0						GGTGATAGATGAAATGAACTG	0.403													13	63	---	---	---	---	PASS
STAMBP	10617	broad.mit.edu	37	2	74087236	74087236	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74087236G>A	uc002sjs.2	+	9	1226	c.1176G>A	c.(1174-1176)CAG>CAA	p.Q392Q	STAMBP_uc002sjt.2_Silent_p.Q392Q|STAMBP_uc002sju.2_Silent_p.Q392Q|STAMBP_uc002sjv.2_Silent_p.Q392Q	NM_201647	NP_964010	O95630	STABP_HUMAN	STAM binding protein	392					JAK-STAT cascade|positive regulation of cell proliferation	early endosome|membrane|nucleus	metal ion binding|metallopeptidase activity|protein binding			ovary(1)|lung(1)|breast(1)|pancreas(1)	4						CCTGTCGCCAGAAAGGATTTC	0.433													28	109	---	---	---	---	PASS
ACTG2	72	broad.mit.edu	37	2	74128523	74128523	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74128523C>T	uc002sjw.2	+	2	207	c.85C>T	c.(85-87)CGG>TGG	p.R29W	ACTG2_uc010fex.1_Missense_Mutation_p.R29W|ACTG2_uc010fey.2_Missense_Mutation_p.R29W|ACTG2_uc010yrn.1_Missense_Mutation_p.R29W	NM_001615	NP_001606	P63267	ACTH_HUMAN	actin, gamma 2 propeptide	29					muscle contraction	cytoskeleton|cytosol	ATP binding				0						TGATGCCCCCCGGGCTGTCTT	0.617													23	94	---	---	---	---	PASS
MTHFD2	10797	broad.mit.edu	37	2	74425790	74425790	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74425790T>C	uc002skk.2	+	1	101	c.22T>C	c.(22-24)TCT>CCT	p.S8P	MTHFD2_uc002skj.2_5'UTR|MTHFD2_uc010yro.1_5'UTR|MTHFD2_uc010ffb.2_Missense_Mutation_p.S8P|MTHFD2_uc010yrp.1_5'UTR	NM_006636	NP_006627	P13995	MTDC_HUMAN	methylenetetrahydrofolate dehydrogenase 2	8					folic acid-containing compound biosynthetic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	magnesium ion binding|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NAD+) activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|phosphate binding|protein binding				0					NADH(DB00157)|Tetrahydrofolic acid(DB00116)	TTCTCTAATGTCTGCTTTGGC	0.687													14	32	---	---	---	---	PASS
INO80B	83444	broad.mit.edu	37	2	74682983	74682983	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74682983C>T	uc002slg.2	+	3	335	c.290C>T	c.(289-291)TCA>TTA	p.S97L	INO80B_uc002slf.1_Missense_Mutation_p.S84L|INO80B_uc010yrr.1_Missense_Mutation_p.S84L|WBP1_uc002slh.1_RNA|INO80B_uc002sli.1_RNA|INO80B_uc010yrs.1_Missense_Mutation_p.S115L|WBP1_uc002slj.1_5'Flank|WBP1_uc002slk.1_5'Flank|WBP1_uc002sll.1_5'Flank	NM_031288	NP_112578	Q9C086	IN80B_HUMAN	high mobility group AT-hook 1-like 4	97					DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex|nucleolus	metal ion binding|protein binding			pancreas(1)	1						GGGCCTCGCTCACCCTCTCCC	0.547													35	166	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746506	77746506	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746506G>C	uc002snr.2	-	3	904	c.489C>G	c.(487-489)CAC>CAG	p.H163Q	LRRTM4_uc002snq.2_Missense_Mutation_p.H163Q|LRRTM4_uc002sns.2_Missense_Mutation_p.H163Q|LRRTM4_uc002snt.2_Missense_Mutation_p.H164Q	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	163	LRR 5.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TAGATCTCAAGTGCAAAATGA	0.408													36	86	---	---	---	---	PASS
REG1B	5968	broad.mit.edu	37	2	79314036	79314036	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79314036G>T	uc002sny.2	-	3	197	c.85C>A	c.(85-87)CTG>ATG	p.L29M	REG1B_uc010ffv.1_Missense_Mutation_p.L29M|REG1B_uc010ffw.2_Missense_Mutation_p.L29M	NM_006507	NP_006498	P48304	REG1B_HUMAN	regenerating islet-derived 1 beta precursor	29					cell proliferation	extracellular region	sugar binding			central_nervous_system(1)|skin(1)	2						GGATTAGGCAGCTCTGTCTGG	0.493													69	140	---	---	---	---	PASS
REG1A	5967	broad.mit.edu	37	2	79350321	79350321	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79350321G>C	uc002snz.2	+	6	584	c.481G>C	c.(481-483)GTC>CTC	p.V161L	REG1A_uc010ysd.1_Missense_Mutation_p.V161L	NM_002909	NP_002900	P05451	REG1A_HUMAN	regenerating islet-derived 1 alpha precursor	161	C-type lectin.				positive regulation of cell proliferation	extracellular region	growth factor activity|sugar binding				0						GTTCTCCTTTGTCTGCAAGTT	0.418													17	77	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385884	79385884	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385884G>C	uc002sod.1	-	2	343	c.88C>G	c.(88-90)CAG>GAG	p.Q30E	REG3A_uc002soe.1_Missense_Mutation_p.Q30E|REG3A_uc002sof.1_Missense_Mutation_p.Q30E	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	30					acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						AGTTCCCTCTGGGGTTCTTCA	0.552													11	25	---	---	---	---	PASS
C2orf89	129293	broad.mit.edu	37	2	85051322	85051322	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85051322C>T	uc010ysl.1	-	6	1178	c.1089G>A	c.(1087-1089)AAG>AAA	p.K363K	C2orf89_uc002sou.3_Silent_p.K314K	NM_001080824	NP_001074293	Q86V40	CB089_HUMAN	hypothetical protein LOC129293 precursor	363	Extracellular (Potential).					integral to membrane				ovary(1)	1						TCTTTTTACTCTTCCCTCTGT	0.547													8	33	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88484972	88484972	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88484972C>A	uc002ssz.3	+	8	1356	c.1203C>A	c.(1201-1203)TAC>TAA	p.Y401*	THNSL2_uc002ssv.2_Intron|THNSL2_uc002ssw.3_Intron|THNSL2_uc002ssx.3_Intron|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Nonsense_Mutation_p.Y401*|THNSL2_uc010fhe.2_Intron	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	401					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						ACTACCATTACCAGCAGATAG	0.592													8	26	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88874576	88874576	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88874576C>T	uc002stc.3	-	13	2627	c.2425G>A	c.(2425-2427)GAA>AAA	p.E809K		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	809	Cytoplasmic (Potential).|Protein kinase.				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						CCAGAATCTTCAAATACTATT	0.413													49	269	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88890072	88890072	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88890072G>C	uc002stc.3	-	6	1256	c.1054C>G	c.(1054-1056)CCC>GCC	p.P352A		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	352	Lumenal (Potential).				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						AGACTGATGGGAATGACTTTC	0.348													25	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89345900	89345900	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89345900C>T	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TAGTGTTCTCCTTCCTTACCT	0.527													40	217	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90193250	90193250	+	RNA	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90193250G>T	uc010fhm.2	+	22		c.2840G>T								Parts of antibodies, mostly variable regions.																		CCTGGTATCAGCAGAAACCAG	0.532													49	215	---	---	---	---	PASS
NCAPH	23397	broad.mit.edu	37	2	97019078	97019078	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97019078C>G	uc002svz.1	+	8	1029	c.945C>G	c.(943-945)ATC>ATG	p.I315M	NCAPH_uc010fhu.1_Missense_Mutation_p.I291M|NCAPH_uc010fhv.1_Missense_Mutation_p.I304M|NCAPH_uc010yum.1_Missense_Mutation_p.I291M|NCAPH_uc010fhw.1_Missense_Mutation_p.I304M|NCAPH_uc010yun.1_Missense_Mutation_p.I179M|NCAPH_uc002swa.1_Translation_Start_Site	NM_015341	NP_056156	Q15003	CND2_HUMAN	non-SMC condensin I complex, subunit H	315					cell division|mitotic chromosome condensation	condensin complex|cytoplasm|microtubule cytoskeleton|nucleus				urinary_tract(1)|skin(1)	2		Ovarian(717;0.0221)				ATCGCCAGATCTGCCCTTCCC	0.502													17	79	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98744705	98744705	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98744705G>A	uc002syo.2	+	6	970	c.706G>A	c.(706-708)GAA>AAA	p.E236K	VWA3B_uc010yvh.1_Missense_Mutation_p.E86K|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Missense_Mutation_p.E236K|VWA3B_uc002syn.1_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	236										ovary(3)|large_intestine(2)|skin(1)	6						TTTGCAGATTGAATCCATTTA	0.473													90	171	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98744741	98744741	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98744741G>T	uc002syo.2	+	6	1006	c.742G>T	c.(742-744)GAA>TAA	p.E248*	VWA3B_uc010yvh.1_Nonsense_Mutation_p.E98*|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Intron|VWA3B_uc002sym.2_Nonsense_Mutation_p.E248*|VWA3B_uc002syn.1_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	248										ovary(3)|large_intestine(2)|skin(1)	6						GGATGTTCCTGAAGAATCCAA	0.498													39	181	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98797605	98797605	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98797605C>T	uc002syo.2	+	9	1505	c.1241C>T	c.(1240-1242)TCT>TTT	p.S414F	VWA3B_uc010yvh.1_Missense_Mutation_p.S264F|VWA3B_uc002syj.2_RNA|VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_5'UTR|VWA3B_uc002sym.2_Missense_Mutation_p.S414F|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.S71F	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	414										ovary(3)|large_intestine(2)|skin(1)	6						GCCGACTGCTCTTTCCGCCAC	0.537													29	118	---	---	---	---	PASS
C2orf55	343990	broad.mit.edu	37	2	99443447	99443447	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99443447C>T	uc002szf.1	-	6	1020	c.726G>A	c.(724-726)CGG>CGA	p.R242R		NM_207362	NP_997245	Q6NV74	CB055_HUMAN	hypothetical protein LOC343990	242											0						CCGATGAGAGCCGCCTCATCT	0.602													92	157	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102456381	102456381	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102456381C>T	uc002tbg.2	+	10	929	c.874C>T	c.(874-876)CAG>TAG	p.Q292*	MAP4K4_uc002tbc.2_Nonsense_Mutation_p.Q292*|MAP4K4_uc002tbd.2_Nonsense_Mutation_p.Q292*|MAP4K4_uc002tbe.2_Nonsense_Mutation_p.Q292*|MAP4K4_uc002tbf.2_Nonsense_Mutation_p.Q292*|MAP4K4_uc010yvy.1_Nonsense_Mutation_p.Q292*|MAP4K4_uc002tbh.2_Nonsense_Mutation_p.Q292*|MAP4K4_uc002tbi.2_Intron|MAP4K4_uc010yvz.1_Nonsense_Mutation_p.Q272*|MAP4K4_uc010fiw.1_Nonsense_Mutation_p.Q134*|MAP4K4_uc002tbj.1_Nonsense_Mutation_p.Q188*	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	292					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						TATAAGGGATCAGCCAAATGA	0.408													19	99	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109100635	109100635	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109100635G>T	uc002tec.2	+	13	3635	c.3481G>T	c.(3481-3483)GAA>TAA	p.E1161*	GCC2_uc002ted.2_Nonsense_Mutation_p.E1060*	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	1161	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						GATGAATATGGAAATAGCTGA	0.259													20	109	---	---	---	---	PASS
LIMS1	3987	broad.mit.edu	37	2	109276161	109276161	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109276161G>C	uc002teg.2	+	2	216	c.97G>C	c.(97-99)GAG>CAG	p.E33Q	LIMS1_uc002tef.2_Missense_Mutation_p.E45Q|LIMS1_uc002teh.2_Missense_Mutation_p.E33Q|LIMS1_uc002tei.2_Missense_Mutation_p.E33Q|LIMS1_uc002tej.2_Missense_Mutation_p.E70Q|LIMS1_uc002tek.3_Missense_Mutation_p.E95Q	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1	33	LIM zinc-binding 1.				cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						GCTGTACCATGAGCAGTGTTT	0.587													3	146	---	---	---	---	PASS
CNTNAP5	129684	broad.mit.edu	37	2	125530508	125530508	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:125530508T>A	uc002tno.2	+	17	3027	c.2663T>A	c.(2662-2664)CTG>CAG	p.L888Q	CNTNAP5_uc010flu.2_Missense_Mutation_p.L889Q	NM_130773	NP_570129	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5 precursor	888	Laminin G-like 3.|Extracellular (Potential).				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(10)	10				BRCA - Breast invasive adenocarcinoma(221;0.248)		GAGACCTCCCTGCAGGTGGAC	0.547													37	136	---	---	---	---	PASS
GPR148	344561	broad.mit.edu	37	2	131486964	131486964	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131486964G>A	uc002trv.1	+	1	242	c.240G>A	c.(238-240)CTG>CTA	p.L80L		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	80	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)					ACCAACGGCTGCGACAGGAGC	0.617													35	54	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131521481	131521481	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131521481G>T	uc002trw.2	+	2	2026	c.1836G>T	c.(1834-1836)TTG>TTT	p.L612F	FAM123C_uc010fmv.2_Missense_Mutation_p.L612F|FAM123C_uc010fms.1_Missense_Mutation_p.L612F|FAM123C_uc010fmt.1_Missense_Mutation_p.L612F|FAM123C_uc010fmu.1_Missense_Mutation_p.L612F	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	612										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		CTGAAGGCTTGTTCTCCTCTA	0.577													27	105	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021447	132021447	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021447G>T	uc002tsn.2	+	15	2471	c.2419G>T	c.(2419-2421)GAG>TAG	p.E807*	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Nonsense_Mutation_p.E407*|POTEE_uc002tsl.2_Nonsense_Mutation_p.E389*|POTEE_uc010fmy.1_Nonsense_Mutation_p.E271*	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	807	Actin-like.						ATP binding				0						CCTGCTGACCGAGGCCCCCCT	0.602													91	89	---	---	---	---	PASS
CCDC74A	90557	broad.mit.edu	37	2	132290239	132290239	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132290239C>T	uc002tta.2	+	5	813	c.761C>T	c.(760-762)GCG>GTG	p.A254V	CCDC74A_uc002ttb.2_Missense_Mutation_p.A188V	NM_138770	NP_620125	Q96AQ1	CC74A_HUMAN	coiled-coil domain containing 74A	254										skin(1)	1						CAGATGGGGGCGGGGGCACAC	0.602													39	152	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135744573	135744573	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135744573T>C	uc002tue.1	-	7	1900	c.1869A>G	c.(1867-1869)ACA>ACG	p.T623T	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Silent_p.T510T|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Silent_p.T351T|YSK4_uc002tui.3_Silent_p.T640T	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	623							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		ATGACTTCTGTGTTCCTGGAT	0.373													124	307	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135744883	135744883	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135744883A>G	uc002tue.1	-	7	1590	c.1559T>C	c.(1558-1560)ATA>ACA	p.I520T	YSK4_uc002tuf.1_Intron|YSK4_uc010fnc.1_Intron|YSK4_uc010fnd.1_Missense_Mutation_p.I407T|YSK4_uc010zbg.1_Intron|YSK4_uc002tuh.3_Missense_Mutation_p.I248T|YSK4_uc002tui.3_Missense_Mutation_p.I537T	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	520							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		GTGTACAGGTATGTTGACACT	0.423													41	124	---	---	---	---	PASS
ZRANB3	84083	broad.mit.edu	37	2	135965199	135965199	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135965199C>A	uc002tum.2	-	19	2931	c.2814G>T	c.(2812-2814)CTG>CTT	p.L938L	ZRANB3_uc002tuk.2_Silent_p.L481L|ZRANB3_uc002tul.2_Silent_p.L936L	NM_032143	NP_115519	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	938						intracellular	ATP binding|DNA binding|endonuclease activity|helicase activity|zinc ion binding			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.135)		CCTGACATTTCAGAGAGCAAA	0.428													72	246	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136566025	136566025	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136566025C>G	uc002tuu.1	-	8	3903	c.3892G>C	c.(3892-3894)GAG>CAG	p.E1298Q		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1298	3.|Extracellular (Potential).|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		TTCAAAGCCTCATTGATGTAG	0.443													80	305	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141130580	141130580	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141130580G>T	uc002tvj.1	-	69	11737	c.10765C>A	c.(10765-10767)CCA>ACA	p.P3589T		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3589	Extracellular (Potential).				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTTTTACCTGGCTCACAGCTT	0.363										TSP Lung(27;0.18)			81	151	---	---	---	---	PASS
ZEB2	9839	broad.mit.edu	37	2	145157151	145157151	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:145157151C>T	uc002tvu.2	-	8	2083	c.1603G>A	c.(1603-1605)GAA>AAA	p.E535K	ZEB2_uc002tvv.2_Missense_Mutation_p.E529K|ZEB2_uc010zbm.1_Missense_Mutation_p.E506K|ZEB2_uc010fnp.2_Intron|ZEB2_uc010fnq.1_Missense_Mutation_p.E564K	NM_014795	NP_055610	O60315	ZEB2_HUMAN	zinc finger homeobox 1b	535						cytoplasm|nucleolus	phosphatase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|SMAD binding|zinc ion binding			ovary(5)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)	9				BRCA - Breast invasive adenocarcinoma(221;0.112)		GCTTTGGCTTCATTGACTTTT	0.403													33	119	---	---	---	---	PASS
RND3	390	broad.mit.edu	37	2	151343232	151343232	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:151343232C>A	uc002txe.2	-	2	458	c.214G>T	c.(214-216)GAG>TAG	p.E72*	RND3_uc002txf.2_Nonsense_Mutation_p.E72*|RND3_uc002txg.2_Nonsense_Mutation_p.E72*|RND3_uc010zbv.1_Nonsense_Mutation_p.E72*|RND3_uc010zbw.1_5'UTR	NM_005168	NP_005159	P61587	RND3_HUMAN	ras homolog gene family, member E precursor	72					actin cytoskeleton organization|cell adhesion|small GTPase mediated signal transduction	Golgi membrane	GTP binding|GTPase activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.106)		AGGCTCAACTCTATTCTTTGT	0.532													48	253	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153528972	153528972	+	Splice_Site	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153528972C>G	uc002tyh.3	-	13	1392	c.1370_splice	c.e13+1	p.K457_splice	PRPF40A_uc002tyg.3_5'Flank|PRPF40A_uc010zcd.1_Splice_Site_p.K404_splice	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3						mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						AAACATCTTACTTGTATCTGG	0.348													34	80	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155265537	155265537	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155265537C>T	uc002tyr.3	+	11	1905	c.1338C>T	c.(1336-1338)GGC>GGT	p.G446G	GALNT13_uc002tyt.3_Silent_p.G446G|GALNT13_uc010foc.1_Silent_p.G265G|GALNT13_uc010fod.2_Silent_p.G199G	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	446	Ricin B-type lectin.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						ACAACATGGGCCGCAAGGAAA	0.368													22	84	---	---	---	---	PASS
GALNT5	11227	broad.mit.edu	37	2	158152278	158152278	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158152278A>G	uc002tzg.2	+	4	2100	c.1845A>G	c.(1843-1845)CCA>CCG	p.P615P	GALNT5_uc010zci.1_RNA	NM_014568	NP_055383	Q7Z7M9	GALT5_HUMAN	N-acetylgalactosaminyltransferase 5	615	Lumenal (Potential).				glycosaminoglycan biosynthetic process	Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(3)|skin(1)	4						TGGCCTGTCCAGTAATCGAAG	0.363													85	131	---	---	---	---	PASS
CCDC148	130940	broad.mit.edu	37	2	159201722	159201722	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159201722C>G	uc002tzq.2	-						CCDC148_uc002tzr.2_Intron|CCDC148_uc010foh.2_Intron|CCDC148_uc010foi.1_Intron|CCDC148_uc010foj.1_Intron|CCDC148_uc010fok.1_Intron|CCDC148_uc002tzs.1_Intron	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148											ovary(2)	2						TCCCCCAGTTCTTACCTGACT	0.358													55	211	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163076375	163076375	+	Silent	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163076375A>C	uc002ucd.2	-	7	682	c.474T>G	c.(472-474)GTT>GTG	p.V158V	FAP_uc010zct.1_Silent_p.V133V|FAP_uc010fpd.2_Intron|FAP_uc010fpe.1_Silent_p.V125V	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	158	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						ATTTACTCCCAACAGGCGACC	0.348													19	98	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163228560	163228560	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163228560C>T	uc002uch.1	-	16	3582	c.3370G>A	c.(3370-3372)GAA>AAA	p.E1124K		NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	1124	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	GAAAGGGATTCTTTGGATTTA	0.353													18	54	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467083	164467083	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467083C>A	uc002uck.1	-	3	1570	c.1259G>T	c.(1258-1260)GGG>GTG	p.G420V		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	420						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TGTGTACTTCCCAAAGGATTC	0.527													41	79	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467084	164467084	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467084C>A	uc002uck.1	-	3	1569	c.1258G>T	c.(1258-1260)GGG>TGG	p.G420W		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	420						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GTGTACTTCCCAAAGGATTCA	0.522													41	80	---	---	---	---	PASS
SCN1A	6323	broad.mit.edu	37	2	166900541	166900541	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:166900541C>A	uc010zcz.1	-	11	1699	c.1681G>T	c.(1681-1683)GGC>TGC	p.G561C	SCN1A_uc002udo.3_Missense_Mutation_p.G430C|SCN1A_uc010fpk.2_Missense_Mutation_p.G430C	NM_006920	NP_008851	P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha	561						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(6)|skin(6)|large_intestine(1)	13					Lamotrigine(DB00555)|Levetiracetam(DB01202)|Phenacemide(DB01121)|Phenytoin(DB00252)|Topiramate(DB00273)|Zonisamide(DB00909)	AATAGGGAGCCACGGATGCTC	0.393													18	65	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168103509	168103509	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168103509A>T	uc002udx.2	+	8	5625	c.5607A>T	c.(5605-5607)CTA>CTT	p.L1869L	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Silent_p.L1694L|XIRP2_uc010fpq.2_Silent_p.L1647L|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_5'Flank	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	1694					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GTAACATGCTAGCCACACTCA	0.383													17	92	---	---	---	---	PASS
STK39	27347	broad.mit.edu	37	2	168931607	168931607	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168931607G>A	uc002uea.2	-							NM_013233	NP_037365	Q9UEW8	STK39_HUMAN	serine threonine kinase 39 (STE20/SPS1 homolog,						response to stress	cytoplasm|nucleus	ATP binding|protein binding|receptor signaling protein serine/threonine kinase activity			central_nervous_system(1)|skin(1)	2						CATCGTCAACGATGTCATTTA	0.378													53	194	---	---	---	---	PASS
ABCB11	8647	broad.mit.edu	37	2	169836446	169836446	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169836446G>C	uc002ueo.1	-	11	1253	c.1127C>G	c.(1126-1128)GCC>GGC	p.A376G		NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	376	Cytoplasmic (Potential).|ABC transmembrane type-1 1.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	ACAAGGAGAGGCATTGCCAAG	0.378													9	49	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170062105	170062105	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170062105C>G	uc002ues.2	-	41	7812	c.7599G>C	c.(7597-7599)GAG>GAC	p.E2533D		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2533	LDL-receptor class B 27.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATGTGGCTCTCTCGATTTTGG	0.468													20	89	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170806565	170806565	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170806565A>G	uc010zdi.1	+	23	3535	c.3535A>G	c.(3535-3537)AAA>GAA	p.K1179E	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_5'UTR|UBR3_uc002uft.3_Missense_Mutation_p.K32E	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1179	Potential.				sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						AACATTGGACAAAGAAGAAAG	0.328													23	79	---	---	---	---	PASS
ITGA6	3655	broad.mit.edu	37	2	173349611	173349611	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173349611G>C	uc002uhp.1	+	12	1854	c.1651G>C	c.(1651-1653)GAA>CAA	p.E551Q	ITGA6_uc010zdy.1_Missense_Mutation_p.E432Q|ITGA6_uc002uho.1_Missense_Mutation_p.E551Q|ITGA6_uc010fqm.1_Missense_Mutation_p.E197Q	NM_001079818	NP_001073286	P23229	ITA6_HUMAN	integrin alpha chain, alpha 6 isoform a	590	Extracellular (Potential).				blood coagulation|cell adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|leukocyte migration|negative regulation of apoptosis|positive regulation of apoptosis|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter	integrin complex	protein binding|receptor activity			ovary(1)|lung(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			ATATACTCAAGAACTAACTCT	0.443													29	81	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098968	178098968	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098968T>G	uc002ulh.3	-	2	632	c.77A>C	c.(76-78)CAA>CCA	p.Q26P	NFE2L2_uc002ulg.3_Missense_Mutation_p.Q10P|NFE2L2_uc010zfa.1_Missense_Mutation_p.Q10P|NFE2L2_uc002uli.3_Missense_Mutation_p.Q10P|NFE2L2_uc010fra.2_Missense_Mutation_p.Q10P|NFE2L2_uc010frb.2_Missense_Mutation_p.Q10P	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	26					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ATCTATATCTTGCCTCCAAAG	0.348			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			16	73	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179238668	179238668	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179238668G>A	uc002ulx.2	+	15	1825	c.1447G>A	c.(1447-1449)GAG>AAG	p.E483K	OSBPL6_uc002ulw.2_Missense_Mutation_p.E416K|OSBPL6_uc002uly.2_Missense_Mutation_p.E508K|OSBPL6_uc010zfe.1_Missense_Mutation_p.E452K|OSBPL6_uc002ulz.2_Missense_Mutation_p.E447K|OSBPL6_uc002uma.2_Missense_Mutation_p.E487K	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	483					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AGTAGCCAATGAGAGCCGCCT	0.483													27	98	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179400936	179400936	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179400936G>A	uc010zfg.1	-	306	93058	c.92834C>T	c.(92833-92835)GCT>GTT	p.A30945V	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.A24640V|TTN_uc010zfi.1_Missense_Mutation_p.A24573V|TTN_uc010zfj.1_Missense_Mutation_p.A24448V	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31872							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACCAAGGTAGCATTGCTCTG	0.393													9	37	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179402377	179402377	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179402377C>T	uc010zfg.1	-	304	92077	c.91853G>A	c.(91852-91854)AGT>AAT	p.S30618N	uc002umo.2_RNA|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S24313N|TTN_uc010zfi.1_Missense_Mutation_p.S24246N|TTN_uc010zfj.1_Missense_Mutation_p.S24121N	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31545							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGAAGCTTACTACTGGTTTC	0.463													16	69	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179431323	179431323	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179431323G>A	uc010zfg.1	-	275	72056	c.71832C>T	c.(71830-71832)ATC>ATT	p.I23944I	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.I17639I|TTN_uc010zfi.1_Silent_p.I17572I|TTN_uc010zfj.1_Silent_p.I17447I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	24871							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CGCCATCATAGATGGGTTTAC	0.443													81	269	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179443940	179443940	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179443940G>T	uc010zfg.1	-	269	60337	c.60113C>A	c.(60112-60114)ACA>AAA	p.T20038K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T13733K|TTN_uc010zfi.1_Missense_Mutation_p.T13666K|TTN_uc010zfj.1_Missense_Mutation_p.T13541K|uc002umv.1_Missense_Mutation_p.V56L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20965							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATAAGAGTTGTGTTAACCGC	0.438													77	110	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179444806	179444806	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179444806G>T	uc010zfg.1	-	267	59728	c.59504C>A	c.(59503-59505)ACA>AAA	p.T19835K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T13530K|TTN_uc010zfi.1_Missense_Mutation_p.T13463K|TTN_uc010zfj.1_Missense_Mutation_p.T13338K|uc002umv.1_3'UTR	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	20762							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTGTCACTGTAGACCAGGA	0.443													60	169	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179473926	179473926	+	Intron	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179473926A>G	uc010zfg.1	-						uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTAGTTTTAATGACTCACCT	0.358													10	7	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179479049	179479049	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179479049C>G	uc010zfg.1	-	211	41595	c.41371G>C	c.(41371-41373)GAC>CAC	p.D13791H	uc002ump.1_RNA|TTN_uc010zfh.1_Missense_Mutation_p.D7486H|TTN_uc010zfi.1_Missense_Mutation_p.D7419H|TTN_uc010zfj.1_Missense_Mutation_p.D7294H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	14718							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGTGATGTCAAAGGCAGCT	0.393													20	72	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179532008	179532008	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179532008G>C	uc010zfk.1	-	8	822	c.274C>G	c.(274-276)CCA>GCA	p.P92A	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron|TTN_uc010fre.1_Intron			Q8WZ42	TITIN_HUMAN	SubName: Full=Titin; Flags: Fragment;	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GCCTCAGGTGGCTCCACCTCT	0.338													3	18	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179605624	179605624	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179605624C>T	uc010zfh.1	-	46	12047	c.11823G>A	c.(11821-11823)CAG>CAA	p.Q3941Q	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Silent_p.Q3874Q|TTN_uc010zfj.1_Silent_p.Q3749Q|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTGCAATTCCTGAGCTCCCA	0.413													40	136	---	---	---	---	PASS
ZNF385B	151126	broad.mit.edu	37	2	180310440	180310440	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180310440G>T	uc002unn.3	-	8	1536	c.932C>A	c.(931-933)ACC>AAC	p.T311N	ZNF385B_uc002unj.2_Missense_Mutation_p.T209N|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Missense_Mutation_p.T208N|ZNF385B_uc002unm.2_Missense_Mutation_p.T235N	NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	311	Matrin-type 3.					nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TTCAACCATGGTCTTGTGTTT	0.388													31	97	---	---	---	---	PASS
CWC22	57703	broad.mit.edu	37	2	180810308	180810308	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180810308C>T	uc010frh.1	-	20	2575	c.2275G>A	c.(2275-2277)GAG>AAG	p.E759K	CWC22_uc002uno.2_Missense_Mutation_p.E281K|CWC22_uc002unp.2_Missense_Mutation_p.E759K	NM_020943	NP_065994	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein homolog	759						catalytic step 2 spliceosome	protein binding|RNA binding				0						CTTTCTCTCTCAGTCCTTGTT	0.373													27	148	---	---	---	---	PASS
ITGA4	3676	broad.mit.edu	37	2	182363449	182363449	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182363449G>A	uc002unu.2	+	15	2403	c.1640G>A	c.(1639-1641)AGC>AAC	p.S547N	ITGA4_uc010frj.1_Missense_Mutation_p.S29N	NM_000885	NP_000876	P13612	ITA4_HUMAN	integrin alpha 4 precursor	547	Extracellular (Potential).				blood coagulation|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|leukocyte migration|regulation of immune response	integrin complex	identical protein binding|receptor activity			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)	ATTACAGGAAGCATACAGGTG	0.368													55	80	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182543437	182543437	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182543437C>A	uc002uof.2	-	2	387	c.151G>T	c.(151-153)GAC>TAC	p.D51Y	CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1	51					amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			CTCAGTGAGTCCTCCTCTGCG	0.408													6	20	---	---	---	---	PASS
NCKAP1	10787	broad.mit.edu	37	2	183902800	183902800	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183902800G>A	uc002upc.2	-	1	430	c.28C>T	c.(28-30)CAG>TAG	p.Q10*	NCKAP1_uc002upb.2_Nonsense_Mutation_p.Q10*	NM_013436	NP_038464	Q9Y2A7	NCKP1_HUMAN	NCK-associated protein 1 isoform 1	10					apoptosis|central nervous system development	integral to membrane|lamellipodium membrane	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0942)|Epithelial(96;0.209)			AGCTTCTGCTGACTGGGCTGC	0.507													5	23	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802654	185802654	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802654C>T	uc002uph.2	+	4	3125	c.2531C>T	c.(2530-2532)CCT>CTT	p.P844L		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	844						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TCCTTAAATCCTCTGGATAGG	0.358													31	46	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189899670	189899670	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189899670C>G	uc002uqk.2	-	53	4600	c.4325G>C	c.(4324-4326)CGG>CCG	p.R1442P	COL5A2_uc010frx.2_Missense_Mutation_p.R1018P	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	1442	Fibrillar collagen NC1.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			AACGATATACCGGAATCTAAT	0.348													20	123	---	---	---	---	PASS
ASNSD1	54529	broad.mit.edu	37	2	190532308	190532308	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190532308C>T	uc002uqt.2	+	4	1884	c.1450C>T	c.(1450-1452)CAG>TAG	p.Q484*		NM_019048	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	484	Asparagine synthetase.				asparagine biosynthetic process|glutamine metabolic process		asparagine synthase (glutamine-hydrolyzing) activity			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			GAAATCCTATCAGAGCAATGC	0.408													58	213	---	---	---	---	PASS
STAT1	6772	broad.mit.edu	37	2	191862686	191862686	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191862686G>T	uc002usj.2	-	9	1069	c.681C>A	c.(679-681)ACC>ACA	p.T227T	STAT1_uc010fse.1_Silent_p.T227T|STAT1_uc002usk.2_Silent_p.T227T|STAT1_uc002usl.2_Silent_p.T229T|STAT1_uc010fsf.1_Silent_p.T39T	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription	227					activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	GGGCATTCTGGGTAAGTTCAG	0.423													20	81	---	---	---	---	PASS
STAT4	6775	broad.mit.edu	37	2	191926554	191926554	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191926554G>T	uc002usm.1	-						STAT4_uc002usn.1_Intron|STAT4_uc010zgk.1_Intron|STAT4_uc002uso.2_Intron	NM_003151	NP_003142	Q14765	STAT4_HUMAN	signal transducer and activator of transcription						JAK-STAT cascade	cytoplasm|nucleus	calcium ion binding|protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			breast(3)|skin(2)|lung(1)|ovary(1)|prostate(1)|pancreas(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TGAGCTAGATGAAAAGGAAAT	0.408													49	230	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196664154	196664154	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196664154G>T	uc002utj.3	-	55	10320	c.10219C>A	c.(10219-10221)CGT>AGT	p.R3407S		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3407	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATGAATGCACGTCCCAATCTG	0.413													59	91	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197092865	197092865	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197092865A>G	uc002utm.1	-	22	4061	c.3878T>C	c.(3877-3879)ATA>ACA	p.I1293T	HECW2_uc002utl.1_Missense_Mutation_p.I937T	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	1293	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						CATAGGACTTATTTGTACTGT	0.353													69	79	---	---	---	---	PASS
ANKRD44	91526	broad.mit.edu	37	2	197964657	197964657	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197964657G>T	uc002uuc.2	-						ANKRD44_uc002utz.3_Intron|ANKRD44_uc002uua.1_Intron|ANKRD44_uc002uub.2_Intron|ANKRD44_uc010zgw.1_Intron	NM_153697	NP_710181	Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44								protein binding			ovary(4)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TTCACCTCCTGAAAGAGATAT	0.418													16	81	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198288681	198288681	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198288681G>A	uc002uue.2	-	2	94	c.46C>T	c.(46-48)CGA>TGA	p.R16*	SF3B1_uc010fsk.1_RNA|SF3B1_uc002uuf.2_Nonsense_Mutation_p.R16*|SF3B1_uc002uug.2_Nonsense_Mutation_p.R16*	NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1	16					nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGAATTTCTCGAATCTGTGCT	0.373													20	73	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201477417	201477417	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201477417G>A	uc002uvx.2	+	14	1450	c.1349G>A	c.(1348-1350)GGA>GAA	p.G450E	AOX1_uc010zhf.1_Missense_Mutation_p.G6E|AOX1_uc010fsu.2_5'UTR	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1	450					inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	GTCTTTTTTGGAGAAGGGGAT	0.473													51	70	---	---	---	---	PASS
ALS2	57679	broad.mit.edu	37	2	202569893	202569893	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202569893C>T	uc002uyo.2	-	31	5013	c.4657G>A	c.(4657-4659)GCC>ACC	p.A1553T	ALS2_uc010ftl.2_RNA	NM_020919	NP_065970	Q96Q42	ALS2_HUMAN	alsin isoform 1	1553	VPS9.				cell death|endosome organization|positive regulation of Rac GTPase activity|regulation of endosome size	centrosome|cytosol|early endosome|growth cone|lamellipodium|protein complex|ruffle	protein homodimerization activity|protein serine/threonine kinase activator activity|Rab GTPase binding|Rab guanyl-nucleotide exchange factor activity|Rac guanyl-nucleotide exchange factor activity|Ran guanyl-nucleotide exchange factor activity			skin(5)|lung(1)|breast(1)	7						ACTGCTGAGGCAAAACAAGCA	0.358													14	43	---	---	---	---	PASS
NDUFS1	4719	broad.mit.edu	37	2	207017163	207017163	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207017163G>C	uc002vbe.2	-	3	260	c.133C>G	c.(133-135)CCG>GCG	p.P45A	NDUFS1_uc010ziq.1_Missense_Mutation_p.P59A|NDUFS1_uc010zir.1_Missense_Mutation_p.P45A|NDUFS1_uc010zis.1_Intron|NDUFS1_uc010zit.1_Intron|NDUFS1_uc010ziu.1_Intron	NM_005006	NP_004997	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1,	45	2Fe-2S ferredoxin-type.				apoptosis|ATP metabolic process|mitochondrial electron transport, NADH to ubiquinone|reactive oxygen species metabolic process|regulation of mitochondrial membrane potential|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	2 iron, 2 sulfur cluster binding|4 iron, 4 sulfur cluster binding|electron carrier activity|metal ion binding|NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	GTCGTTCCCGGTTCCACCATG	0.368													27	116	---	---	---	---	PASS
PLEKHM3	389072	broad.mit.edu	37	2	208866341	208866341	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208866341T>A	uc002vcl.2	-	2	513	c.23A>T	c.(22-24)GAT>GTT	p.D8V	PLEKHM3_uc002vcm.2_Missense_Mutation_p.D8V	NM_001080475	NP_001073944	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M,	8					intracellular signal transduction		metal ion binding			ovary(1)	1						TGGGCTGATATCATCCACTTC	0.478													90	110	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210588313	210588313	+	Intron	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210588313T>G	uc002vde.1	+						MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Intron	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1						central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	CTCCAATTCCTTTTAGGTTAG	0.413													16	49	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	210888807	210888807	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210888807C>A	uc002vds.2	-	14	2891	c.2683G>T	c.(2683-2685)GAT>TAT	p.D895Y	C2orf67_uc002vdt.2_Missense_Mutation_p.D853Y	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050	895										ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		GCACACAGATCCTGGTTCTCT	0.403													28	90	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212566848	212566848	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212566848G>A	uc002veg.1	-	12	1431	c.1333C>T	c.(1333-1335)CTA>TTA	p.L445L	ERBB4_uc002veh.1_Silent_p.L445L|ERBB4_uc010zji.1_Silent_p.L445L|ERBB4_uc010zjj.1_Silent_p.L445L|ERBB4_uc010fut.1_Silent_p.L445L	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	445	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		TGGAACTGTAGAGAGGTGATG	0.448										TSP Lung(8;0.080)			39	120	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216247016	216247016	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216247016G>T	uc002vfa.2	-	32	5349	c.5083C>A	c.(5083-5085)CCC>ACC	p.P1695T	FN1_uc002vfb.2_Missense_Mutation_p.P1604T|FN1_uc002vfc.2_Missense_Mutation_p.P1604T|FN1_uc002vfd.2_Missense_Mutation_p.P1695T|FN1_uc002vfe.2_Missense_Mutation_p.P1604T|FN1_uc002vff.2_Missense_Mutation_p.P1604T|FN1_uc002vfg.2_Missense_Mutation_p.P1604T|FN1_uc002vfh.2_Missense_Mutation_p.P1604T|FN1_uc002vfi.2_Missense_Mutation_p.P1695T|FN1_uc002vfj.2_Missense_Mutation_p.P1695T|FN1_uc002vez.2_5'UTR|FN1_uc010zjp.1_Missense_Mutation_p.P322T|FN1_uc010fvc.1_Missense_Mutation_p.P57T|FN1_uc010fvd.1_Missense_Mutation_p.P57T	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	1694	Fibronectin type-III 12; extra domain.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TCCACTGTGGGCTGCAAGCCT	0.473													33	41	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216285475	216285475	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216285475G>C	uc002vfa.2	-	11	1862	c.1596C>G	c.(1594-1596)CAC>CAG	p.H532Q	FN1_uc002vfb.2_Missense_Mutation_p.H532Q|FN1_uc002vfc.2_Missense_Mutation_p.H532Q|FN1_uc002vfd.2_Missense_Mutation_p.H532Q|FN1_uc002vfe.2_Missense_Mutation_p.H532Q|FN1_uc002vff.2_Missense_Mutation_p.H532Q|FN1_uc002vfg.2_Missense_Mutation_p.H532Q|FN1_uc002vfh.2_Missense_Mutation_p.H532Q|FN1_uc002vfi.2_Missense_Mutation_p.H532Q|FN1_uc002vfj.2_Missense_Mutation_p.H532Q|FN1_uc002vfl.2_Missense_Mutation_p.H532Q	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	532	Collagen-binding.|Fibronectin type-I 8.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	CATGACGCTTGTGGAATGTGT	0.473													21	80	---	---	---	---	PASS
STK36	27148	broad.mit.edu	37	2	219544402	219544402	+	Missense_Mutation	SNP	C	T	T	rs138126812		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219544402C>T	uc002viu.2	+	8	1164	c.898C>T	c.(898-900)CGC>TGC	p.R300C	STK36_uc002viv.2_Missense_Mutation_p.R300C	NM_015690	NP_056505	Q9NRP7	STK36_HUMAN	serine/threonine kinase 36	300					cilium assembly|positive regulation of hh target transcription factor activity|positive regulation of smoothened signaling pathway|post-embryonic development	aggresome|cytoplasm|focal adhesion|intermediate filament cytoskeleton|nucleus	ATP binding|protein serine/threonine kinase activity|transcription factor binding			ovary(4)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)	11		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		TAATCAGTCTCGCATCTTGAC	0.562													14	45	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220162770	220162770	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220162770C>A	uc002vkz.2	-	13	1813	c.1724G>T	c.(1723-1725)CGC>CTC	p.R575L	PTPRN_uc010zlc.1_Missense_Mutation_p.R485L|PTPRN_uc002vla.2_Missense_Mutation_p.R546L	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N	575	Extracellular (Potential).				response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CAGCACTGAGCGCATGGGTGA	0.637													3	88	---	---	---	---	PASS
AP1S3	130340	broad.mit.edu	37	2	224642556	224642556	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224642556C>T	uc010fwx.1	-	2	186	c.34G>A	c.(34-36)GGG>AGG	p.G12R	AP1S3_uc002vnn.2_Missense_Mutation_p.G12R|AP1S3_uc010fww.2_RNA|AP1S3_uc002vno.2_RNA	NM_001039569	NP_001034658	Q96PC3	AP1S3_HUMAN	adaptor-related protein complex 1, sigma 3	12					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane coat	protein transporter activity				0		Renal(207;0.0112)|Lung NSC(271;0.0186)|all_lung(227;0.0272)		Epithelial(121;7.6e-10)|all cancers(144;3.62e-07)|Lung(261;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.00902)		CGTAATTTCCCTTGTCGACTG	0.428													22	90	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225710006	225710006	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225710006G>C	uc010fwz.1	-	21	2634	c.2395C>G	c.(2395-2397)CAG>GAG	p.Q799E	DOCK10_uc002vob.2_Missense_Mutation_p.Q793E	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	799	DHR-1.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		GAAGCTATCTGATCGTGTTTC	0.368													4	18	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226516161	226516161	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226516161C>A	uc002voe.2	+	6	2017	c.1842C>A	c.(1840-1842)AGC>AGA	p.S614R	KIAA1486_uc010fxa.1_3'UTR|KIAA1486_uc002vof.1_Missense_Mutation_p.S384R	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	614										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		CTAAAGTAAGCTGCAAATTAG	0.483													106	142	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228882159	228882159	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228882159C>T	uc002vpq.2	-	7	3458	c.3411G>A	c.(3409-3411)ATG>ATA	p.M1137I	SPHKAP_uc002vpp.2_Missense_Mutation_p.M1137I|SPHKAP_uc010zlx.1_Missense_Mutation_p.M1137I	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1137						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CTTCATTTTCCATCTGGTTCA	0.537													40	37	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228884681	228884681	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228884681G>T	uc002vpq.2	-	7	936	c.889C>A	c.(889-891)CAG>AAG	p.Q297K	SPHKAP_uc002vpp.2_Missense_Mutation_p.Q297K|SPHKAP_uc010zlx.1_Missense_Mutation_p.Q297K	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	297						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TCTAGACTCTGCAAGGCTGTG	0.418													87	348	---	---	---	---	PASS
DNER	92737	broad.mit.edu	37	2	230312225	230312225	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230312225C>A	uc002vpv.2	-	8	1440	c.1293G>T	c.(1291-1293)GTG>GTT	p.V431V	DNER_uc010zly.1_Silent_p.V159V	NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing	431	Extracellular (Potential).|EGF-like 6.				central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CGCAGGGGTCCACCTTTTCTT	0.488													19	43	---	---	---	---	PASS
COPS7B	64708	broad.mit.edu	37	2	232653351	232653351	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232653351G>C	uc002vsg.1	+	2	174	c.71G>C	c.(70-72)GGC>GCC	p.G24A	COPS7B_uc010fxy.1_Intron|COPS7B_uc002vsh.1_Missense_Mutation_p.G24A|COPS7B_uc002vsi.1_5'UTR|COPS7B_uc002vsj.1_5'Flank	NM_022730	NP_073567	Q9H9Q2	CSN7B_HUMAN	COP9 constitutive photomorphogenic homolog	24					cullin deneddylation	cytoplasm|signalosome				ovary(1)|liver(1)|skin(1)	3		all_hematologic(139;0.0123)|Acute lymphoblastic leukemia(138;0.0182)|Renal(207;0.025)		Epithelial(121;1.36e-12)|BRCA - Breast invasive adenocarcinoma(100;0.00136)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		GGTACCAGTGGCTCAGCCCTC	0.498													26	71	---	---	---	---	PASS
ECEL1	9427	broad.mit.edu	37	2	233349770	233349770	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233349770C>T	uc002vsv.2	-	4	1092	c.887G>A	c.(886-888)CGA>CAA	p.R296Q	ECEL1_uc010fya.1_Missense_Mutation_p.R296Q|ECEL1_uc010fyb.1_Missense_Mutation_p.R3Q	NM_004826	NP_004817	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	296	Lumenal (Potential).				neuropeptide signaling pathway|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity			central_nervous_system(2)	2		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GCTGAGCACTCGCTCCATGAA	0.642													16	64	---	---	---	---	PASS
UGT1A10	54575	broad.mit.edu	37	2	234545255	234545255	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234545255G>C	uc002vur.2	+	1	133	c.87G>C	c.(85-87)CTG>CTC	p.L29L	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Silent_p.L29L	NM_019075	NP_061948	Q9HAW8	UD110_HUMAN	UDP glycosyltransferase 1 family, polypeptide	29					flavone metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity|protein heterodimerization activity|protein homodimerization activity|protein kinase C binding			ovary(2)|skin(1)	3		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0334)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;1.96e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000468)|Lung(119;0.00381)|LUSC - Lung squamous cell carcinoma(224;0.008)		GGAAGCTGCTGGTAGTGCCCA	0.577													35	122	---	---	---	---	PASS
SH3BP4	23677	broad.mit.edu	37	2	235951264	235951264	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235951264C>G	uc002vvp.2	+	4	2244	c.1851C>G	c.(1849-1851)ATC>ATG	p.I617M	SH3BP4_uc010fym.2_Missense_Mutation_p.I617M|SH3BP4_uc002vvq.2_Missense_Mutation_p.I617M	NM_014521	NP_055336	Q9P0V3	SH3B4_HUMAN	SH3-domain binding protein 4	617					endocytosis	clathrin-coated vesicle|coated pit|nucleus	protein binding			skin(3)|ovary(1)	4		Breast(86;0.000332)|Renal(207;0.00339)|all_lung(227;0.00458)|all_hematologic(139;0.0296)|Lung NSC(271;0.0419)		Epithelial(121;7.66e-20)|BRCA - Breast invasive adenocarcinoma(100;0.000402)|Lung(119;0.00299)|LUSC - Lung squamous cell carcinoma(224;0.00645)|GBM - Glioblastoma multiforme(43;0.237)		AAAGTGCCATCAAGCCTTCCG	0.547													24	73	---	---	---	---	PASS
CXCR7	57007	broad.mit.edu	37	2	237489155	237489155	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:237489155A>T	uc010fyq.2	+	3	277	c.47A>T	c.(46-48)GAC>GTC	p.D16V	CXCR7_uc002vwd.2_Missense_Mutation_p.D16V	NM_020311	NP_064707	P25106	CXCR7_HUMAN	chemokine orphan receptor 1	16	Extracellular (Potential).				interspecies interaction between organisms	integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			large_intestine(1)|central_nervous_system(1)|skin(1)	3		Breast(86;0.000182)|Renal(207;0.00339)|all_hematologic(139;0.0048)|Acute lymphoblastic leukemia(138;0.0775)|Ovarian(221;0.089)|all_lung(227;0.147)|all_neural(83;0.223)		Epithelial(121;8.35e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.09e-11)|Kidney(56;1.11e-07)|KIRC - Kidney renal clear cell carcinoma(57;3.03e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000176)|Lung(119;0.00468)|LUSC - Lung squamous cell carcinoma(224;0.008)|COAD - Colon adenocarcinoma(134;0.118)		AACTTCTCGGACATCAGCTGG	0.517													8	67	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	239988490	239988490	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239988490G>A	uc002vyk.3	-	24	3708	c.2916C>T	c.(2914-2916)CTC>CTT	p.L972L	HDAC4_uc010fyy.2_Silent_p.L929L	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4	972	Histone deacetylase.				B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GGCCTCCCTCGAGGGCCAGGA	0.632													22	57	---	---	---	---	PASS
CAPN10	11132	broad.mit.edu	37	2	241531338	241531338	+	Intron	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241531338T>A	uc002vzk.1	+						CAPN10_uc010zoh.1_Intron|CAPN10_uc002vzl.1_Intron|CAPN10_uc002vzm.1_Intron|CAPN10_uc002vzn.1_Intron|CAPN10_uc002vzo.1_Intron|CAPN10_uc010fzg.1_Intron|CAPN10_uc002vzp.1_Intron|CAPN10_uc002vzq.1_Intron	NM_023083	NP_075571	Q9HC96	CAN10_HUMAN	calpain 10 isoform a						actin cytoskeleton reorganization|cellular response to insulin stimulus|positive regulation of apoptosis|positive regulation of glucose import|positive regulation of insulin secretion|positive regulation of intracellular transport|proteolysis	cytosol|plasma membrane	calcium-dependent cysteine-type endopeptidase activity|cytoskeletal protein binding|SNARE binding			ovary(3)|large_intestine(2)|lung(1)	6		all_epithelial(40;1.72e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|all_neural(83;0.0459)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.13e-31)|all cancers(36;3.24e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.82e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.1e-06)|Lung(119;0.00168)|Colorectal(34;0.00495)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.032)		CCATGGTGATTGTGTCCCCTA	0.627													8	21	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241685277	241685277	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241685277C>A	uc002vzy.2	-	29	3095	c.2949G>T	c.(2947-2949)CTG>CTT	p.L983L	KIF1A_uc010fzk.2_Silent_p.L1084L|KIF1A_uc002vzz.1_Silent_p.L1084L	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles	983					anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGGCCCATCCAGGGCGGCTT	0.612													7	19	---	---	---	---	PASS
PASK	23178	broad.mit.edu	37	2	242078087	242078087	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242078087C>A	uc002wao.1	-	5	815	c.723G>T	c.(721-723)TGG>TGT	p.W241C	PASK_uc010zol.1_Missense_Mutation_p.W55C|PASK_uc010zom.1_Missense_Mutation_p.W241C|PASK_uc010fzl.1_Missense_Mutation_p.W241C|PASK_uc010zon.1_Missense_Mutation_p.W22C|PASK_uc002waq.2_Missense_Mutation_p.W241C	NM_015148	NP_055963	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	241					regulation of transcription, DNA-dependent	Golgi apparatus	ATP binding|identical protein binding|protein serine/threonine kinase activity|signal transducer activity			ovary(4)|lung(1)|skin(1)	6		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		GGAAAGCGACCCAGGTCGAGA	0.602													19	85	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242402762	242402762	+	Missense_Mutation	SNP	G	T	T	rs139762137	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242402762G>T	uc002wbi.1	+	16	1807	c.1690G>T	c.(1690-1692)GCA>TCA	p.A564S	FARP2_uc010zoq.1_Missense_Mutation_p.A564S|FARP2_uc010zor.1_Missense_Mutation_p.A564S	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	564	DH.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		GTTCCGCAGCGCAGTGGTGAA	0.582													15	60	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242407695	242407695	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242407695G>T	uc002wbi.1	+	18	2151	c.2034G>T	c.(2032-2034)CTG>CTT	p.L678L		NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	678	DH.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		ACACGTTCCTGCTGAAGCCCA	0.572													47	46	---	---	---	---	PASS
NEU4	129807	broad.mit.edu	37	2	242758331	242758331	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242758331C>A	uc010fzr.2	+	4	1498	c.1412C>A	c.(1411-1413)CCC>CAC	p.P471H	NEU4_uc002wcl.2_RNA|NEU4_uc002wcm.2_Missense_Mutation_p.P471H|NEU4_uc002wcn.1_Missense_Mutation_p.P483H|NEU4_uc002wco.1_Missense_Mutation_p.P471H|NEU4_uc002wcp.1_Missense_Mutation_p.P483H	NM_080741	NP_542779	Q8WWR8	NEUR4_HUMAN	sialidase 4	471						lysosomal lumen|organelle inner membrane	exo-alpha-sialidase activity|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;3.84e-33)|all cancers(36;8.08e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.41e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0825)		CCCAAGCCGCCCAACCTTGGG	0.642													9	19	---	---	---	---	PASS
ITPR1	3708	broad.mit.edu	37	3	4808361	4808361	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:4808361G>C	uc003bqa.2	+	42	5896	c.5548G>C	c.(5548-5550)GAG>CAG	p.E1850Q	ITPR1_uc010hca.1_Missense_Mutation_p.E1835Q|ITPR1_uc011asu.1_Intron|ITPR1_uc003bqc.2_Missense_Mutation_p.E820Q	NM_001099952	NP_001093422	Q14643	ITPR1_HUMAN	inositol 1,4,5-triphosphate receptor, type 1	1898	Cytoplasmic (Potential).				activation of phospholipase C activity|cell death|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	endoplasmic reticulum membrane|integral to membrane|platelet dense granule membrane|platelet dense tubular network membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity|intracellular ligand-gated calcium channel activity|phosphatidylinositol binding|protein binding			lung(7)|breast(5)|ovary(4)|large_intestine(1)|liver(1)|skin(1)|kidney(1)|pancreas(1)	21				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)		GAAAGACGATGAGGTAGACAG	0.438													24	35	---	---	---	---	PASS
IRAK2	3656	broad.mit.edu	37	3	10283900	10283900	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10283900C>G	uc003bve.1	+	13	1942	c.1866C>G	c.(1864-1866)CTC>CTG	p.L622L		NM_001570	NP_001561	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	622					activation of MAPK activity|I-kappaB kinase/NF-kappaB cascade|inflammatory response|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cell surface|cytosol|endosome membrane|plasma membrane	ATP binding|NF-kappaB-inducing kinase activity|protein heterodimerization activity|protein homodimerization activity			lung(5)|breast(3)	8						GCATTGAGCTCTTTGGCCCCT	0.448													20	64	---	---	---	---	PASS
SLC6A1	6529	broad.mit.edu	37	3	11072947	11072947	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11072947T>A	uc010hdq.2	+	13	1819	c.1408T>A	c.(1408-1410)TCT>ACT	p.S470T		NM_003042	NP_003033	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter	470	Helical; Name=10; (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)|skin(1)	2		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Cocaine(DB00907)|Tiagabine(DB00906)	TGAATGTGTCTCTATTTCCTG	0.378													107	82	---	---	---	---	PASS
BTD	686	broad.mit.edu	37	3	15686066	15686066	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15686066C>T	uc003cah.2	+	4	806	c.703C>T	c.(703-705)CCC>TCC	p.P235S	BTD_uc011avv.1_Missense_Mutation_p.P237S|BTD_uc011avw.1_Missense_Mutation_p.P237S|BTD_uc011avx.1_Missense_Mutation_p.P215S	NM_000060	NP_000051	P43251	BTD_HUMAN	biotinidase precursor	235	CN hydrolase.				central nervous system development|epidermis development|nitrogen compound metabolic process	extracellular space	biotin carboxylase activity|biotinidase activity				0						CTTTGATACCCCCTTTGCTGG	0.448													39	61	---	---	---	---	PASS
THRB	7068	broad.mit.edu	37	3	24188169	24188169	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:24188169C>T	uc003ccx.3	-	7	878	c.529G>A	c.(529-531)GAT>AAT	p.D177N	THRB_uc010hfe.2_Missense_Mutation_p.D177N|THRB_uc003ccy.3_Missense_Mutation_p.D177N|THRB_uc003ccz.3_Missense_Mutation_p.D172N	NM_001128176	NP_001121648	P10828	THB_HUMAN	thyroid hormone receptor, beta	177	Nuclear receptor.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	enzyme binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription corepressor activity|zinc ion binding			skin(2)|pancreas(1)	3					Levothyroxine(DB00451)|Liothyronine(DB00279)	TACTTACAATCTGTTGCCATG	0.408													32	73	---	---	---	---	PASS
NEK10	152110	broad.mit.edu	37	3	27329226	27329226	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:27329226A>C	uc003cdt.1	-	21	2026	c.1752T>G	c.(1750-1752)CAT>CAG	p.H584Q	NEK10_uc003cds.1_5'UTR	NM_199347	NP_955379	Q6ZWH5	NEK10_HUMAN	NIMA-related kinase 10 isoform 3	584	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(5)|stomach(2)|central_nervous_system(2)|lung(2)|skin(1)|pancreas(1)	13						CAATGTTGGGATGATAAAGCT	0.264													9	33	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38770276	38770276	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38770276A>T	uc003ciq.2	-	15	2397	c.2397T>A	c.(2395-2397)TTT>TTA	p.F799L		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	799	Helical; Name=S5 of repeat II; (Potential).|II.				sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GAGCAAAGACAAAGACAATGA	0.532													54	28	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38802160	38802160	+	Intron	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38802160T>C	uc003ciq.2	-							NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	TTGTCATAAGTTGGGAACTCA	0.398													53	45	---	---	---	---	PASS
ZNF501	115560	broad.mit.edu	37	3	44776538	44776538	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44776538G>A	uc003cnu.1	+	3	1026	c.625G>A	c.(625-627)GAA>AAA	p.E209K	ZNF501_uc003cnv.1_Missense_Mutation_p.M152I	NM_145044	NP_659481	Q96CX3	ZN501_HUMAN	zinc finger protein 501	209	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00843)|KIRC - Kidney renal clear cell carcinoma(197;0.0463)|Kidney(197;0.0579)		TGTTGAACATGAAAGGACTCA	0.418													19	57	---	---	---	---	PASS
CCR1	1230	broad.mit.edu	37	3	46245770	46245770	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46245770G>T	uc003cph.1	-	2	106	c.35C>A	c.(34-36)ACG>AAG	p.T12K	CCR3_uc003cpg.1_Intron	NM_001295	NP_001286	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	12	Extracellular (Potential).				cell adhesion|cell-cell signaling|cytokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|G-protein signaling, coupled to cyclic nucleotide second messenger|immune response|inflammatory response	integral to plasma membrane	C-C chemokine receptor activity			skin(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		CTCTGTGGTCGTGTCATAGTC	0.483													25	11	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48607181	48607181	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48607181T>C	uc003ctz.2	-	100	7535	c.7534A>G	c.(7534-7536)AGT>GGT	p.S2512G		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	2512	Triple-helical region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGTCCTGCACTCCCAACATCA	0.602													16	51	---	---	---	---	PASS
DALRD3	55152	broad.mit.edu	37	3	49055175	49055175	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49055175C>G	uc003cvk.1	-	3	609	c.589G>C	c.(589-591)GAA>CAA	p.E197Q	DALRD3_uc003cvl.1_Missense_Mutation_p.E197Q|DALRD3_uc003cvm.1_Missense_Mutation_p.E30Q|DALRD3_uc010hko.1_Missense_Mutation_p.E30Q|DALRD3_uc011bca.1_Missense_Mutation_p.E197Q|NDUFAF3_uc003cvn.2_5'Flank	NM_001009996	NP_001009996	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	197					arginyl-tRNA aminoacylation	cytoplasm	arginine-tRNA ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GTAAGTTCTTCAAGGGCGTGG	0.622													22	38	---	---	---	---	PASS
MST1R	4486	broad.mit.edu	37	3	49928829	49928829	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49928829G>A	uc003cxy.3	-						MST1R_uc011bdc.1_Intron	NM_002447	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor precursor						cellular component movement|defense response|multicellular organismal development|positive regulation of cell proliferation|single fertilization|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|macrophage colony-stimulating factor receptor activity|protein binding			ovary(5)|lung(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		GATGAACACTGACCCGCTGAG	0.622													15	54	---	---	---	---	PASS
HYAL3	8372	broad.mit.edu	37	3	50330709	50330709	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50330709C>G	uc003czd.1	-	4	1495	c.1222G>C	c.(1222-1224)GAG>CAG	p.E408Q	HYAL3_uc003czc.1_Missense_Mutation_p.E378Q|HYAL3_uc003cze.1_Missense_Mutation_p.E159Q|HYAL3_uc003czf.1_Missense_Mutation_p.E129Q|HYAL3_uc003czg.1_Missense_Mutation_p.E378Q|IFRD2_uc011bdp.1_5'Flank|IFRD2_uc003czb.2_5'Flank	NM_003549	NP_003540	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3 precursor	408					carbohydrate metabolic process	extracellular region|lysosome	hyalurononglucosaminidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		GGCCTGGGCTCCTGGCAGGTG	0.587													25	78	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52356682	52356682	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52356682G>T	uc011bef.1	+	2	485	c.224G>T	c.(223-225)GGG>GTG	p.G75V	DNAH1_uc003ddt.1_Missense_Mutation_p.G75V	NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	75	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TCAGACTTGGGGCAGCCACGG	0.582													17	12	---	---	---	---	PASS
DNAH12	201625	broad.mit.edu	37	3	57488140	57488140	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57488140G>A	uc003dit.2	-	10	1334	c.1153C>T	c.(1153-1155)CCT>TCT	p.P385S	DNAH12_uc003diu.2_Missense_Mutation_p.P385S	NM_178504	NP_848599	Q6ZR08	DYH12_HUMAN	dynein heavy chain domain 2 isoform 1	385	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			pancreas(1)|skin(1)	2						ACGTGTTCAGGAAGTTCTGTG	0.388													72	50	---	---	---	---	PASS
PXK	54899	broad.mit.edu	37	3	58377548	58377548	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58377548C>G	uc003djz.1	+	7	688	c.589C>G	c.(589-591)CTA>GTA	p.L197V	PXK_uc003djx.1_Missense_Mutation_p.L197V|PXK_uc003djy.1_Missense_Mutation_p.L180V|PXK_uc003dka.1_Missense_Mutation_p.L197V|PXK_uc003dkb.1_Missense_Mutation_p.L114V|PXK_uc003dkc.1_Missense_Mutation_p.L180V|PXK_uc011bfe.1_Missense_Mutation_p.L164V|PXK_uc010hnj.1_Missense_Mutation_p.L164V|PXK_uc003dkd.1_Missense_Mutation_p.L60V|PXK_uc010hnk.1_Intron	NM_017771	NP_060241	Q7Z7A4	PXK_HUMAN	PX domain containing serine/threonine kinase	197	Protein kinase.				cell communication|inflammatory response|negative regulation of ATPase activity|negative regulation of ion transport|regulation of synaptic transmission	centrosome|cytoplasm|nucleus|plasma membrane	actin binding|ATP binding|phosphatidylinositol binding|phosphatidylinositol binding|protein C-terminus binding|protein kinase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(55;0.000249)|KIRC - Kidney renal clear cell carcinoma(10;0.00346)|Kidney(10;0.00368)|OV - Ovarian serous cystadenocarcinoma(275;0.22)		TTTTCAGTGTCTAATCAAACT	0.388													25	132	---	---	---	---	PASS
C3orf67	200844	broad.mit.edu	37	3	58849464	58849464	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58849464C>T	uc003dkt.1	-	12	1447	c.1038G>A	c.(1036-1038)CAG>CAA	p.Q346Q	C3orf67_uc003dks.1_Silent_p.Q161Q|uc003dku.1_Intron|C3orf67_uc003dkv.1_Silent_p.Q161Q|C3orf67_uc003dkw.2_Silent_p.Q241Q	NM_198463	NP_940865	Q6ZVT6	CC067_HUMAN	hypothetical protein LOC200844	346											0		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		TTGGAACACTCTGGGATTCCT	0.493													21	107	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73453457	73453457	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73453457C>G	uc003dpl.1	-	4	1104	c.1008G>C	c.(1006-1008)TTG>TTC	p.L336F	PDZRN3_uc011bgh.1_5'UTR|PDZRN3_uc010hoe.1_Missense_Mutation_p.L34F|PDZRN3_uc011bgf.1_Missense_Mutation_p.L53F|PDZRN3_uc011bgg.1_Missense_Mutation_p.L56F	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	336	PDZ 1.						ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		GTGTTCTTCTCAACACCTGCA	0.512													34	78	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89390085	89390085	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89390085C>T	uc003dqy.2	+	4	1059	c.834C>T	c.(832-834)TAC>TAT	p.Y278Y	EPHA3_uc003dqx.1_Silent_p.Y278Y|EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	278	Extracellular (Potential).|Cys-rich.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAGGTTTCTACAAGGCATTGG	0.363										TSP Lung(6;0.00050)			53	80	---	---	---	---	PASS
PROS1	5627	broad.mit.edu	37	3	93615477	93615477	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93615477G>A	uc003drb.3	-	9	1249	c.908C>T	c.(907-909)GCG>GTG	p.A303V	PROS1_uc010hoo.2_Missense_Mutation_p.A172V|PROS1_uc003dqz.3_Missense_Mutation_p.A172V	NM_000313	NP_000304	P07225	PROS_HUMAN	protein S, alpha preproprotein	303	Laminin G-like 1.				leukocyte migration|peptidyl-glutamic acid carboxylation|platelet activation|platelet degranulation|post-translational protein modification|proteolysis	endoplasmic reticulum membrane|extracellular region|Golgi lumen|Golgi membrane|platelet alpha granule lumen	calcium ion binding|endopeptidase inhibitor activity			large_intestine(1)	1					Antihemophilic Factor(DB00025)|Drotrecogin alfa(DB00055)|Menadione(DB00170)	AAACTGCTCCGCCAAGTAAAG	0.358													47	202	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	97194254	97194254	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97194254C>A	uc010how.1	+	8	1996	c.1953C>A	c.(1951-1953)GGC>GGA	p.G651G	EPHA6_uc011bgo.1_RNA|EPHA6_uc011bgp.1_Silent_p.G17G|EPHA6_uc003drs.3_Silent_p.G43G|EPHA6_uc003drr.3_Silent_p.G43G|EPHA6_uc003drt.2_Silent_p.G43G|EPHA6_uc010hox.1_RNA	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	556	Helical; (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						CCGCTGTTGGCGGATTCACTC	0.428													7	21	---	---	---	---	PASS
NIT2	56954	broad.mit.edu	37	3	100065092	100065092	+	Silent	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100065092A>C	uc003dtv.2	+	6	572	c.498A>C	c.(496-498)GCA>GCC	p.A166A	NIT2_uc011bha.1_Missense_Mutation_p.H135P	NM_020202	NP_064587	Q9NQR4	NIT2_HUMAN	nitrilase family, member 2	166	CN hydrolase.				nitrogen compound metabolic process		omega-amidase activity			ovary(1)	1						AAATCTACGCACAGAGAGGTG	0.483													19	26	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105264115	105264115	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105264115G>T	uc003dvx.2	+	9	1580	c.1040G>T	c.(1039-1041)GGT>GTT	p.G347V	ALCAM_uc003dvw.1_Missense_Mutation_p.G347V|ALCAM_uc003dvy.2_Missense_Mutation_p.G347V|ALCAM_uc011bhh.1_3'UTR|ALCAM_uc010hpp.2_Missense_Mutation_p.G69V|ALCAM_uc003dvz.2_5'UTR	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	347	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						AGACAGATTGGTGATGCCCTA	0.408													36	69	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108406926	108406926	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108406926G>A	uc003dxd.2	+	29	3675	c.3253G>A	c.(3253-3255)GAC>AAC	p.D1085N	DZIP3_uc003dxf.1_Missense_Mutation_p.D1085N|DZIP3_uc011bhm.1_Missense_Mutation_p.D536N	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	1085					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCAGTTTATTGACCCCAAAAA	0.348													20	81	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108725873	108725873	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108725873C>T	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						ATTAATTACTCACCTTATGTG	0.388													10	79	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108782086	108782086	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108782086G>C	uc003dxl.2	-						MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1						cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						TTTCTGGAAAGAAACAAAAAG	0.284													42	78	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108788596	108788596	+	Missense_Mutation	SNP	G	T	T	rs148630097	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108788596G>T	uc003dxl.2	-	9	785	c.698C>A	c.(697-699)GCG>GAG	p.A233E	MORC1_uc011bhn.1_Missense_Mutation_p.A233E	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	233					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding	p.A233V(2)		ovary(3)|skin(3)|breast(2)	8						TGACCACCTCGCTGGGAAACT	0.348													23	61	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109023453	109023453	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109023453C>A	uc003dxo.2	-	7	970	c.723G>T	c.(721-723)CTG>CTT	p.L241L		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	241						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						CATGAAACTGCAGGCGTACCC	0.507													33	58	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109052846	109052846	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109052846G>T	uc003dxq.3	-						DPPA4_uc011bho.1_Intron|DPPA4_uc011bhp.1_Intron	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4							nucleus	protein binding			upper_aerodigestive_tract(1)	1						GTCCACTGGGGAACAGAGGAG	0.483													9	62	---	---	---	---	PASS
ARHGAP31	57514	broad.mit.edu	37	3	119133799	119133799	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119133799G>C	uc003ecj.3	+	12	3555	c.3023G>C	c.(3022-3024)AGA>ACA	p.R1008T		NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein	1008					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						AGGTCCTTCAGAGAGTTCTCT	0.552													18	48	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119211167	119211167	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119211167A>T	uc003ecm.2	+	11	1145	c.1061A>T	c.(1060-1062)GAC>GTC	p.D354V	KTELC1_uc011bja.1_Missense_Mutation_p.D195V	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	354						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		CAGATGGATGACATCACCTGT	0.328													61	80	---	---	---	---	PASS
C3orf15	89876	broad.mit.edu	37	3	119466000	119466000	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119466000A>G	uc003ede.3	+	15	2018	c.1941A>G	c.(1939-1941)CTA>CTG	p.L647L	C3orf15_uc010hqz.2_Silent_p.L585L|C3orf15_uc011bjd.1_Silent_p.L521L|C3orf15_uc011bje.1_Silent_p.L627L|C3orf15_uc003edg.3_5'Flank	NM_033364	NP_203528	Q7Z4T9	AAT1_HUMAN	AAT1-alpha	483						mitochondrion	protein binding			ovary(2)|pancreas(1)	3				GBM - Glioblastoma multiforme(114;0.186)		GCTCCTACCTAGAAGACATAA	0.368													27	91	---	---	---	---	PASS
HCLS1	3059	broad.mit.edu	37	3	121351169	121351169	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121351169C>G	uc003eeh.3	-						HCLS1_uc011bjj.1_Intron	NM_005335	NP_005326	P14317	HCLS1_HUMAN	hematopoietic cell-specific Lyn substrate 1						erythrocyte differentiation|intracellular signal transduction|positive regulation of cell proliferation|positive regulation of tyrosine phosphorylation of STAT protein|response to hormone stimulus	mitochondrion|nucleus|plasma membrane	DNA binding|sequence-specific DNA binding transcription factor activity				0				GBM - Glioblastoma multiforme(114;0.0912)		CTTCTCCTCCCATCACTCACC	0.498													32	120	---	---	---	---	PASS
ADCY5	111	broad.mit.edu	37	3	123046520	123046520	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:123046520T>A	uc003egh.1	-	7	1892	c.1892A>T	c.(1891-1893)TAC>TTC	p.Y631F	ADCY5_uc003egg.1_Missense_Mutation_p.Y264F|ADCY5_uc003egi.1_Missense_Mutation_p.Y190F	NM_183357	NP_899200	O95622	ADCY5_HUMAN	adenylate cyclase 5	631	Cytoplasmic (Potential).				activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|plasma membrane	adenylate cyclase activity|ATP binding|metal ion binding			ovary(4)	4				GBM - Glioblastoma multiforme(114;0.0342)		CTCCTTGAGGTAGGCGTTGCG	0.642													12	50	---	---	---	---	PASS
PODXL2	50512	broad.mit.edu	37	3	127379811	127379811	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127379811G>T	uc003ejq.2	+	3	964	c.940G>T	c.(940-942)GCT>TCT	p.A314S		NM_015720	NP_056535	Q9NZ53	PDXL2_HUMAN	podocalyxin-like 2 precursor	314	Extracellular (Potential).				leukocyte tethering or rolling	integral to plasma membrane	glycosaminoglycan binding|protein binding			ovary(1)|central_nervous_system(1)	2						TCAAACCACAGCTCCCAGTGG	0.612													28	87	---	---	---	---	PASS
TF	7018	broad.mit.edu	37	3	133494302	133494302	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133494302G>A	uc003epu.1	+	20	3441	c.1713G>A	c.(1711-1713)AAG>AAA	p.K571K	TF_uc011blt.1_Silent_p.K444K|TF_uc003epw.1_Intron|TF_uc003epv.1_Silent_p.K571K	NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor	571	Transferrin-like 2.				cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	CATGGGCTAAGAATCTGAATG	0.527													35	115	---	---	---	---	PASS
ANAPC13	25847	broad.mit.edu	37	3	134197492	134197492	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134197492C>T	uc003eqi.2	-	3	262	c.165G>A	c.(163-165)ATG>ATA	p.M55I	ANAPC13_uc003eqj.2_RNA|ANAPC13_uc003eqk.3_RNA	NM_015391	NP_056206	Q9BS18	APC13_HUMAN	anaphase promoting complex subunit 13	55					cell division|mitosis|protein K11-linked ubiquitination	anaphase-promoting complex				skin(1)	1						CTGTCCACTTCATTTCTTGTT	0.418													31	105	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134873025	134873025	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134873025C>G	uc003eqt.2	+	6	1549	c.1329C>G	c.(1327-1329)GTC>GTG	p.V443V	EPHB1_uc003equ.2_Silent_p.V4V	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	443	Fibronectin type-III 2.|Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TGCACCAAGTCAGTGCCACTA	0.537													39	240	---	---	---	---	PASS
SOX14	8403	broad.mit.edu	37	3	137483679	137483679	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137483679G>T	uc003erm.1	+	1	101	c.53G>T	c.(52-54)TGG>TTG	p.W18L		NM_004189	NP_004180	O95416	SOX14_HUMAN	SRY-box 14	18	HMG box.				negative regulation of transcription from RNA polymerase II promoter|nervous system development|transcription, DNA-dependent	nucleus	sequence-specific DNA binding				0						TTCATGGTATGGTCCCGGGGC	0.602													19	45	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140277540	140277540	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140277540C>A	uc003etn.2	+	12	2072	c.1882C>A	c.(1882-1884)CTC>ATC	p.L628I		NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	628	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						TGTGATGGTCCTCCAGGCCAT	0.557										HNSCC(16;0.037)			26	86	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141164623	141164623	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141164623C>A	uc003etw.2	+	8	4375	c.3393C>A	c.(3391-3393)CCC>CCA	p.P1131P	ZBTB38_uc010hun.2_Silent_p.P1128P|ZBTB38_uc010huo.2_Silent_p.P1131P|ZBTB38_uc003ety.2_Silent_p.P1131P|ZBTB38_uc010hup.2_Silent_p.P1132P	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	1131	C2H2-type 10.				positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						TCCAGTGCCCCAAAATTTGCA	0.463													4	147	---	---	---	---	PASS
PAQR9	344838	broad.mit.edu	37	3	142681231	142681231	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142681231G>C	uc003evg.2	-	1	948	c.948C>G	c.(946-948)ATC>ATG	p.I316M	PAQR9_uc003evf.1_RNA	NM_198504	NP_940906	Q6ZVX9	PAQR9_HUMAN	progestin and adipoQ receptor family member IX	316	Helical; (Potential).					integral to membrane	receptor activity				0						GGAAGGTGAAGATGTGGAAGA	0.607													25	93	---	---	---	---	PASS
PLSCR2	57047	broad.mit.edu	37	3	146173175	146173175	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146173175C>A	uc003evv.1	-	5	505	c.172G>T	c.(172-174)GCA>TCA	p.A58S	PLSCR2_uc003evw.1_Missense_Mutation_p.A127S	NM_020359	NP_065092	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2	58	Cytoplasmic (By similarity).				phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0						GTATCTTCTGCTGCAAAATAA	0.363													41	143	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147127995	147127995	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147127995C>A	uc003ewe.2	+	1	815	c.96C>A	c.(94-96)GAC>GAA	p.D32E		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	32					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCGAACGAGACGTGGGCCTGG	0.701													17	51	---	---	---	---	PASS
CLRN1	7401	broad.mit.edu	37	3	150690483	150690483	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150690483G>C	uc003eyk.1	-	1	304	c.13C>G	c.(13-15)CAG>GAG	p.Q5E	CLRN1OS_uc011bny.1_Intron|CLRN1OS_uc003eyl.2_RNA	NM_174878	NP_777367	P58418	CLRN1_HUMAN	clarin 1 isoform a	5					equilibrioception|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATTTTCTTCTGTTGGCTTGGC	0.483													9	57	---	---	---	---	PASS
MBNL1	4154	broad.mit.edu	37	3	152132854	152132854	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152132854T>C	uc003ezm.2	+	2	1088	c.299T>C	c.(298-300)ATG>ACG	p.M100T	MBNL1_uc003ezh.2_Missense_Mutation_p.M100T|MBNL1_uc003ezi.2_Missense_Mutation_p.M100T|MBNL1_uc003ezj.2_Missense_Mutation_p.M43T|MBNL1_uc003ezl.2_Missense_Mutation_p.M100T|MBNL1_uc003ezp.2_Missense_Mutation_p.M100T|MBNL1_uc003ezn.2_Missense_Mutation_p.M100T|MBNL1_uc003ezo.2_Missense_Mutation_p.M100T|MBNL1_uc010hvp.2_Missense_Mutation_p.M8T	NM_207293	NP_997176	Q9NR56	MBNL1_HUMAN	muscleblind-like 1 isoform c	100					embryonic limb morphogenesis|in utero embryonic development|myoblast differentiation|nervous system development	nucleus|stress granule	double-stranded RNA binding|protein binding|zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			GCCCAGCAAATGCAACTAGCC	0.428													50	66	---	---	---	---	PASS
SHOX2	6474	broad.mit.edu	37	3	157820615	157820615	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157820615G>A	uc003fbr.2	-	2	546	c.407C>T	c.(406-408)ACC>ATC	p.T136I	SHOX2_uc003fbs.2_Missense_Mutation_p.T160I|SHOX2_uc010hvw.2_Missense_Mutation_p.T136I	NM_006884	NP_006875	O60902	SHOX2_HUMAN	short stature homeobox 2 isoform a	136					nervous system development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			CTTGATTTTGGTCTGGCCTTC	0.562													52	71	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164714433	164714433	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164714433C>A	uc003fei.2	-	40	4644	c.4582G>T	c.(4582-4584)GCA>TCA	p.A1528S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	1528	Sucrase.|Lumenal.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CAGATGTCTGCTCCAGTCTAA	0.303										HNSCC(35;0.089)			120	103	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164764675	164764675	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164764675C>G	uc003fei.2	-	16	1903	c.1841G>C	c.(1840-1842)TGG>TCG	p.W614S		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	614	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	AGTTATAGACCATTCCATTTG	0.383										HNSCC(35;0.089)			30	328	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164786965	164786965	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164786965C>A	uc003fei.2	-	4	336	c.274G>T	c.(274-276)GGC>TGC	p.G92C		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	92	Lumenal.|P-type 1.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	CAGCAGCAGCCTCTCTGTGCA	0.368										HNSCC(35;0.089)			12	142	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164905964	164905964	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164905964T>C	uc003fej.3	-	2	3099	c.2655A>G	c.(2653-2655)CTA>CTG	p.L885L	SLITRK3_uc003fek.2_Silent_p.L885L	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	885	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						TCTCTCGATCTAGTAGCATAC	0.567										HNSCC(40;0.11)			16	192	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164906343	164906343	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164906343C>A	uc003fej.3	-	2	2720	c.2276G>T	c.(2275-2277)CGT>CTT	p.R759L	SLITRK3_uc003fek.2_Missense_Mutation_p.R759L	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	759	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						CTCCTCCTCACGAGGCTTGTA	0.577										HNSCC(40;0.11)			32	266	---	---	---	---	PASS
ZBBX	79740	broad.mit.edu	37	3	167045853	167045853	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167045853G>C	uc003fep.2	-	11	1062	c.739C>G	c.(739-741)CTG>GTG	p.L247V	ZBBX_uc011bpc.1_Missense_Mutation_p.L247V|ZBBX_uc003feq.2_Missense_Mutation_p.L218V	NM_024687	NP_078963	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	247						intracellular	zinc ion binding			ovary(2)	2						TCACACAACAGACTCTTTCTT	0.363													53	449	---	---	---	---	PASS
SKIL	6498	broad.mit.edu	37	3	170079108	170079108	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170079108A>T	uc003fgu.2	+	2	1701	c.989A>T	c.(988-990)CAT>CTT	p.H330L	SKIL_uc011bps.1_Missense_Mutation_p.H310L|SKIL_uc003fgv.2_Missense_Mutation_p.H330L|SKIL_uc003fgw.2_Missense_Mutation_p.H330L	NM_005414	NP_005405	P12757	SKIL_HUMAN	SKI-like isoform 1	330					cell cycle arrest|negative regulation of cell differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of axonogenesis|protein heterotrimerization|protein homotrimerization|regulation of apoptosis|regulation of apoptosis|response to antibiotic|response to growth factor stimulus|skeletal muscle tissue development	cytoplasm|PML body	chromatin binding|nucleotide binding|protein complex binding|protein domain specific binding|SMAD binding|transcription corepressor activity|transcription repressor activity			ovary(2)|skin(1)	3	all_cancers(22;7.13e-23)|all_epithelial(15;9.95e-28)|all_lung(20;1.23e-16)|Lung NSC(18;5.15e-16)|Ovarian(172;0.000337)|Breast(254;0.137)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TGCTATCTTCATGTGAACCAA	0.383													50	306	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171362816	171362816	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171362816G>A	uc003fhs.2	-						PLD1_uc003fht.2_Intron|PLD1_uc003fhu.3_Intron	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	GGTTTTCCCTGCAAAGGTCAG	0.428													118	162	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	A	A	rs121913273		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936082G>A	uc003fjk.2	+	10	1781	c.1624G>A	c.(1624-1626)GAA>AAA	p.E542K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	542	PI3K helical.		E -> V (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation).|E -> Q (in cancer).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E542K(481)|p.E542V(8)|p.E542Q(6)|p.E542G(1)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TCCTCTCTCTGAAATCACTGA	0.333	E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(CAL51_BREAST)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(VMCUB1_URINARY_TRACT)|E542K(BT483_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			77	122	---	---	---	---	PASS
C3orf70	285382	broad.mit.edu	37	3	184870595	184870595	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184870595G>A	uc003fpd.2	-	1	208	c.17C>T	c.(16-18)TCG>TTG	p.S6L		NM_001025266	NP_001020437	A6NLC5	CC070_HUMAN	hypothetical protein LOC285382	6											0						CGACGCCGGCGAGGCCGCCGC	0.716													8	101	---	---	---	---	PASS
MAP3K13	9175	broad.mit.edu	37	3	185169181	185169181	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185169181C>G	uc010hyf.2	+	8	1542	c.1276C>G	c.(1276-1278)CAG>GAG	p.Q426E	MAP3K13_uc011brt.1_Missense_Mutation_p.Q219E|MAP3K13_uc003fph.3_Missense_Mutation_p.Q194E|MAP3K13_uc011bru.1_Missense_Mutation_p.Q282E|MAP3K13_uc003fpi.2_Missense_Mutation_p.Q426E|MAP3K13_uc010hyg.2_Missense_Mutation_p.Q116E	NM_004721	NP_004712	O43283	M3K13_HUMAN	mitogen-activated protein kinase kinase kinase	426					activation of MAPKK activity|JNK cascade|positive regulation of NF-kappaB transcription factor activity|protein autophosphorylation	cytoplasm|membrane|membrane fraction	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			ovary(2)|skin(1)	3	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CTTCAAGTCTCAGGTAAGTTG	0.423													84	112	---	---	---	---	PASS
SENP2	59343	broad.mit.edu	37	3	185347593	185347593	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185347593G>C	uc003fpn.2	+	17	1902	c.1731G>C	c.(1729-1731)AAG>AAC	p.K577N	SENP2_uc011brv.1_Missense_Mutation_p.K567N|SENP2_uc011brw.1_Missense_Mutation_p.K390N	NM_021627	NP_067640	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific protease 2	577					mRNA transport|protein desumoylation|protein transport|proteolysis|regulation of Wnt receptor signaling pathway|transmembrane transport|Wnt receptor signaling pathway	cytoplasm|nuclear membrane|nuclear pore	protein binding|SUMO-specific protease activity				0	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			TCTTCCGGAAGAAGATGGTGT	0.468													26	171	---	---	---	---	PASS
AHSG	197	broad.mit.edu	37	3	186333536	186333536	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186333536G>T	uc003fqk.3	+	2	357	c.276G>T	c.(274-276)CTG>CTT	p.L92L	AHSG_uc003fqj.2_Silent_p.L92L|AHSG_uc003fql.3_Silent_p.L92L|AHSG_uc003fqm.3_Silent_p.L91L|AHSG_uc010hyp.2_Intron	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	92	Cystatin fetuin-A-type 1.				acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		GCCATGTGCTGGACCCCACCC	0.567													113	49	---	---	---	---	PASS
CCDC50	152137	broad.mit.edu	37	3	191075833	191075833	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191075833G>A	uc003fsw.2	+	3	749	c.159G>A	c.(157-159)CAG>CAA	p.Q53Q	CCDC50_uc003fsv.2_Silent_p.Q53Q	NM_174908	NP_777568	Q8IVM0	CCD50_HUMAN	Ymer protein short isoform	53						cytoplasm	protein binding				0	all_cancers(143;8.88e-09)|Ovarian(172;0.103)|Breast(254;0.221)		LUSC - Lung squamous cell carcinoma(58;2.42e-06)|Lung(62;2.86e-06)	GBM - Glioblastoma multiforme(46;0.000136)		GTTTGGTCCAGCATGATCTCC	0.488													54	509	---	---	---	---	PASS
ATP13A3	79572	broad.mit.edu	37	3	194147892	194147892	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194147892G>C	uc003fty.3	-	28	3439	c.3037C>G	c.(3037-3039)CAG>GAG	p.Q1013E	ATP13A3_uc003ftx.3_5'Flank	NM_024524	NP_078800	Q9H7F0	AT133_HUMAN	ATPase type 13A3	1013	Helical; (Potential).				ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(1)	1	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		ATGATAATCTGAGACAAAACG	0.413													14	175	---	---	---	---	PASS
TNK2	10188	broad.mit.edu	37	3	195611843	195611843	+	Missense_Mutation	SNP	C	A	A	rs113498671		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195611843C>A	uc003fvu.1	-	4	839	c.296G>T	c.(295-297)CGG>CTG	p.R99L	TNK2_uc003fvs.1_Missense_Mutation_p.R131L|TNK2_uc003fvt.1_Missense_Mutation_p.R162L|TNK2_uc010hzw.1_RNA|TNK2_uc003fvv.1_5'UTR|TNK2_uc010hzx.1_Missense_Mutation_p.R113L	NM_005781	NP_005772	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2 isoform 1	99	SAM-like domain.		R -> Q (in an ovarian mucinous carcinoma sample; somatic mutation; undergoes autoactivation and causes phosphorylation on Tyr-284 leading to activation of AKT1).		positive regulation of peptidyl-tyrosine phosphorylation|protein ubiquitination|small GTPase mediated signal transduction	adherens junction|cytoplasmic vesicle membrane|endosome|nucleus	ATP binding|GTPase inhibitor activity|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding	p.R99Q(1)|p.R99R(1)		ovary(3)|central_nervous_system(3)|lung(2)|stomach(1)|skin(1)	10	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	CGAGGTCTTCCGGAAGGTGCT	0.642													21	164	---	---	---	---	PASS
LRCH3	84859	broad.mit.edu	37	3	197566206	197566206	+	Silent	SNP	G	A	A	rs149928703		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197566206G>A	uc011bul.1	+	10	1271	c.1266G>A	c.(1264-1266)AAG>AAA	p.K422K	LRCH3_uc003fyj.1_Silent_p.K422K|LRCH3_uc011bum.1_Silent_p.K394K|LRCH3_uc011bun.1_Silent_p.K268K|LRCH3_uc003fyk.2_Silent_p.K17K	NM_032773	NP_116162	Q96II8	LRCH3_HUMAN	leucine-rich repeats and calponin homology (CH)	422						extracellular region				ovary(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;4.82e-24)|all cancers(36;3.61e-22)|OV - Ovarian serous cystadenocarcinoma(49;7.08e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.119)		CACCAGTAAAGCCAGTAGCCA	0.328													99	89	---	---	---	---	PASS
ZNF141	7700	broad.mit.edu	37	4	366586	366586	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:366586G>A	uc003gaa.2	+	5	538	c.360G>A	c.(358-360)TTG>TTA	p.L120L	ZNF141_uc003gab.2_Silent_p.L120L	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141	120					anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						GTAAAAGTTTGAATGAGTGTA	0.343													29	66	---	---	---	---	PASS
SORCS2	57537	broad.mit.edu	37	4	7726979	7726979	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7726979A>G	uc003gkb.3	+	20	2710	c.2710A>G	c.(2710-2712)ACC>GCC	p.T904A	SORCS2_uc011bwi.1_Missense_Mutation_p.T732A	NM_020777	NP_065828	Q96PQ0	SORC2_HUMAN	VPS10 domain receptor protein SORCS 2 precursor	904	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(1)|central_nervous_system(1)	2						CCCTAACCTCACCGTCTTCTA	0.622													19	22	---	---	---	---	PASS
LAP3	51056	broad.mit.edu	37	4	17581491	17581491	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:17581491G>T	uc003gph.1	+	2	309	c.147G>T	c.(145-147)GTG>GTT	p.V49V	LAP3_uc010ieg.2_Silent_p.V49V	NM_015907	NP_056991	P28838	AMPL_HUMAN	leucine aminopeptidase 3	49					proteolysis	nucleus	aminopeptidase activity|magnesium ion binding|manganese ion binding|metalloexopeptidase activity|zinc ion binding				0						AAGATGATGTGCCACAGTTCA	0.373													39	34	---	---	---	---	PASS
TBC1D19	55296	broad.mit.edu	37	4	26641807	26641807	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26641807G>C	uc003gsf.3	+	7	748	c.478G>C	c.(478-480)GAG>CAG	p.E160Q	TBC1D19_uc010iew.2_Missense_Mutation_p.E160Q|TBC1D19_uc011bxu.1_Missense_Mutation_p.E95Q	NM_018317	NP_060787	Q8N5T2	TBC19_HUMAN	TBC1 domain family, member 19	160						intracellular	Rab GTPase activator activity			breast(1)	1		Breast(46;0.0503)				GGATTTTCTTGAGGTAGGTTC	0.204													26	69	---	---	---	---	PASS
GABRG1	2565	broad.mit.edu	37	4	46043100	46043100	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46043100G>A	uc003gxb.2	-	9	1455	c.1303C>T	c.(1303-1305)CGC>TGC	p.R435C		NM_173536	NP_775807	Q8N1C3	GBRG1_HUMAN	gamma-aminobutyric acid A receptor, gamma 1	435	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(2)	2				Lung(65;0.106)|LUSC - Lung squamous cell carcinoma(721;0.23)		TTGGCAATGCGTATGTGTATC	0.403													52	37	---	---	---	---	PASS
SGCB	6443	broad.mit.edu	37	4	52894207	52894207	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:52894207C>A	uc003gzj.2	-	5	740	c.680G>T	c.(679-681)CGT>CTT	p.R227L	SGCB_uc011bzp.1_Missense_Mutation_p.R157L	NM_000232	NP_000223	Q16585	SGCB_HUMAN	sarcoglycan, beta	227	Extracellular (Potential).|Cys-rich.				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to plasma membrane|sarcoglycan complex|sarcolemma					0			GBM - Glioblastoma multiforme(4;7.63e-12)|LUSC - Lung squamous cell carcinoma(32;0.00204)			TTCATTTCCACGCACAATAGC	0.338													77	51	---	---	---	---	PASS
KIT	3815	broad.mit.edu	37	4	55593588	55593588	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55593588A>T	uc010igr.2	+	11	1741	c.1654A>T	c.(1654-1656)ATG>TTG	p.M552L	KIT_uc010igs.2_Missense_Mutation_p.M548L|KIT_uc010igt.1_Missense_Mutation_p.M1L	NM_000222	NP_000213	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral	552	Cytoplasmic (Potential).		Missing (in GIST; somatic mutation).|Missing (in GIST; somatic mutation).		male gonad development|transmembrane receptor protein tyrosine kinase signaling pathway	extracellular space|integral to membrane	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity	p.K550_K558del(33)|p.M552_W557del(19)|p.M552_Y553del(15)|p.P551_E554del(14)|p.P551_V555del(12)|p.M552_V555del(11)|p.K550_E554del(10)|p.P551_M552>L(9)|p.P551_Q556del(9)|p.M552_E554>K(7)|p.K550_V555del(6)|p.K550_V555>I(6)|p.M552_V559>I(5)|p.K550_Q556del(5)|p.M552_E554del(4)|p.K550_W557del(4)|p.M552_K558del(4)|p.M552_Q556del(4)|p.M552_D572del(4)|p.M552_Q556>K(4)|p.P551_V559del(3)|p.K550_V559del(3)|p.P551_Y553del(3)|p.P551_E554>H(3)|p.M552_E561>K(2)|p.P551_K558del(2)|p.L548_K558>Q(2)|p.M552_E554>I(2)|p.M552_K558>T(2)|p.M552V(2)|p.K550_K558>Q(2)|p.K550_E554>I(2)|p.P551_V569del(2)|p.M552L(2)|p.P551_M552del(2)|p.K550fs*6(2)|p.K550_W557>IL(2)|p.M552T(2)|p.M552_Q556>T(2)|p.P551_Q556>T(2)|p.K550_W557>QR(2)|p.Y547_K558>Q(2)|p.M552_V559>IT(1)|p.Q549_V555>I(1)|p.K550_V555>KTL(1)|p.M552_W557>Z(1)|p.K550_W557>IR(1)|p.P551_V559>I(1)|p.P551_W557>R(1)|p.K550_V560>L(1)|p.P551_V555>L(1)|p.M552_Y553>T(1)|p.M552_T574>TESA(1)|p.M552_I563del(1)|p.K550_W557>HR(1)|p.M552_V555>I(1)|p.M552_Q556>(1)|p.K550_Q556>L(1)|p.P551_Q556>HV(1)|p.P551_Y553>Q(1)|p.M552I(1)|p.P551_E561>Q(1)|p.K550_V555>QRI(1)|p.L548_E554>QK(1)|p.M552_V560del(1)|p.?(1)|p.P551_W557del(1)|p.M552_Y553>N(1)|p.K550_Y553del(1)|p.M552_K558>NE(1)|p.K550_Y568del(1)|p.K550_K558>G(1)|p.K550_W557>FL(1)|p.Q549_E554del(1)|p.M552K(1)|p.K550_V555>F(1)|p.P551_V569>L(1)|p.P551_V559del>L(1)|p.K550_Q556>II(1)|p.P551_V555>?(1)|p.M552_Y570del(1)		soft_tissue(3273)|haematopoietic_and_lymphoid_tissue(1572)|skin(99)|testis(49)|bone(21)|genital_tract(18)|kidney(17)|ovary(16)|salivary_gland(15)|large_intestine(11)|thymus(6)|lung(6)|central_nervous_system(4)|NS(3)|eye(2)|endometrium(2)|breast(1)|stomach(1)|autonomic_ganglia(1)|pancreas(1)	5118	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Sorafenib(DB00398)|Sunitinib(DB01268)	ACAGAAACCCATGTATGAAGT	0.373		1	Mis|O		GIST|AML|TGCT|mastocytosis|mucosal melanoma	GIST|epithelioma	Piebald trait		Mast_Cell_disease_Familial_Clustering_of|Piebaldism|Gastrointestinal_Stromal_Tumors_Sporadic_Multiple_Primary|Familial_Gastrointestinal_Stromal_Tumors				50	45	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55961110	55961110	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55961110G>T	uc003has.2	-	21	3132	c.2830C>A	c.(2830-2832)CGA>AGA	p.R944R	KDR_uc003hat.1_Silent_p.R944R	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	944	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TGACGGAATCGTGCCCCTTTG	0.433			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			55	27	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62758438	62758438	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62758438A>G	uc010ihh.2	+	7	1514	c.1341A>G	c.(1339-1341)ACA>ACG	p.T447T	LPHN3_uc003hcq.3_Silent_p.T447T|LPHN3_uc003hcs.1_Silent_p.T276T	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	447	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						TTCGGACCACAACTTTGAGCC	0.483													59	47	---	---	---	---	PASS
UGT2B28	54490	broad.mit.edu	37	4	70160366	70160366	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70160366C>T	uc003hej.2	+	6	1431	c.1429C>T	c.(1429-1431)CGA>TGA	p.R477*	UGT2B28_uc010ihr.2_3'UTR	NM_053039	NP_444267	Q9BY64	UDB28_HUMAN	UDP glucuronosyltransferase 2 family,	477					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1					Flunitrazepam(DB01544)	CAAACACCTTCGAGTTGCAGC	0.463													65	50	---	---	---	---	PASS
NAP1L5	266812	broad.mit.edu	37	4	89618712	89618712	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89618712G>T	uc003hrx.2	-	1	312	c.194C>A	c.(193-195)CCG>CAG	p.P65Q	HERC3_uc003hrw.1_Intron|HERC3_uc011cdn.1_Intron|HERC3_uc011cdo.1_Intron	NM_153757	NP_715638	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	65					nucleosome assembly	nucleus	protein binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		GTCATTTTTCGGCTTTGGGGC	0.458													90	88	---	---	---	---	PASS
PPP3CA	5530	broad.mit.edu	37	4	101950344	101950344	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101950344C>G	uc011cen.1	-	13	2023	c.1348G>C	c.(1348-1350)GAG>CAG	p.E450Q	PPP3CA_uc003hvu.2_Intron|PPP3CA_uc010ilj.2_Intron|PPP3CA_uc003hvt.2_Intron|PPP3CA_uc003hvs.2_Missense_Mutation_p.E383Q|PPP3CA_uc010ilk.2_Missense_Mutation_p.E218Q	NM_000944	NP_000935	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha	450					protein dephosphorylation	calcineurin complex|cytosol|nucleus	calcium ion binding|calmodulin binding			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		TCAATAGCCTCAACAGTAGCT	0.423													23	108	---	---	---	---	PASS
TET2	54790	broad.mit.edu	37	4	106155127	106155127	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106155127G>C	uc003hxk.2	+	3	414	c.28G>C	c.(28-30)GAG>CAG	p.E10Q	TET2_uc011cez.1_Missense_Mutation_p.E31Q|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Missense_Mutation_p.E10Q|TET2_uc003hxi.1_Missense_Mutation_p.E10Q	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	10					cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen			haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CAACCATGTTGAGGGCAACAG	0.483			Mis N|F		MDS								29	28	---	---	---	---	PASS
NDST3	9348	broad.mit.edu	37	4	118975437	118975437	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:118975437G>A	uc003ibx.2	+	2	775	c.372G>A	c.(370-372)ATG>ATA	p.M124I	NDST3_uc011cgf.1_Missense_Mutation_p.M124I|NDST3_uc003ibw.2_Missense_Mutation_p.M124I	NM_004784	NP_004775	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan	124	Lumenal (Potential).|Heparan sulfate N-deacetylase 3.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			large_intestine(1)	1						TAGACAAAATGAAAGGCAAAT	0.328													4	49	---	---	---	---	PASS
PRSS12	8492	broad.mit.edu	37	4	119252905	119252905	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119252905C>G	uc003ica.1	-	4	984	c.937G>C	c.(937-939)GAT>CAT	p.D313H		NM_003619	NP_003610	P56730	NETR_HUMAN	neurotrypsin precursor	313	SRCR 2.					membrane	scavenger receptor activity			skin(1)	1						ACTTCTGCATCGGCATCATCC	0.498													4	63	---	---	---	---	PASS
SEC24D	9871	broad.mit.edu	37	4	119653922	119653922	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119653922G>C	uc003ici.3	-	20	2914	c.2642C>G	c.(2641-2643)TCT>TGT	p.S881C	SEC24D_uc003ich.3_RNA|SEC24D_uc003icj.3_Missense_Mutation_p.S882C|SEC24D_uc003ick.2_Missense_Mutation_p.S43C	NM_014822	NP_055637	O94855	SC24D_HUMAN	Sec24-related protein D	881					COPII vesicle coating|intracellular protein transport|post-translational protein modification|protein N-linked glycosylation via asparagine	COPII vesicle coat|cytosol|endoplasmic reticulum membrane|Golgi membrane|perinuclear region of cytoplasm	zinc ion binding				0						GAAAAGCTGAGAGTCAGCCAC	0.488													5	80	---	---	---	---	PASS
TRPC3	7222	broad.mit.edu	37	4	122846259	122846259	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:122846259G>C	uc003ieg.2	-	3	1164	c.1090C>G	c.(1090-1092)CTG>GTG	p.L364V	TRPC3_uc010inr.2_Missense_Mutation_p.L291V|TRPC3_uc003ief.2_Missense_Mutation_p.L291V|TRPC3_uc011cgl.1_Missense_Mutation_p.L28V	NM_001130698	NP_001124170	Q13507	TRPC3_HUMAN	transient receptor potential cation channel,	279	Cytoplasmic (Potential).				axon guidance|phototransduction|platelet activation	integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						GCTGATTCCAGATCTCCATTC	0.473													76	58	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126371354	126371354	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126371354A>G	uc003ifj.3	+	9	9183	c.9183A>G	c.(9181-9183)GCA>GCG	p.A3061A	FAT4_uc011cgp.1_Silent_p.A1359A|FAT4_uc003ifi.1_Silent_p.A539A	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3061	Extracellular (Potential).|Cadherin 29.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CAGTCACTGCAAAGGATAAGG	0.403													30	29	---	---	---	---	PASS
GYPA	2993	broad.mit.edu	37	4	145038082	145038082	+	Silent	SNP	G	C	C	rs140973108		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145038082G>C	uc003ijo.3	-	5	398	c.282C>G	c.(280-282)CTC>CTG	p.L94L	GYPA_uc003ijn.2_Intron|GYPA_uc011cia.1_RNA|GYPA_uc011cib.1_Silent_p.L61L|GYPA_uc003ijp.3_Silent_p.L62L|GYPA_uc010ioq.2_Silent_p.L81L|GYPA_uc010ior.2_Silent_p.L29L|GYPA_uc010ios.1_RNA	NM_002099	NP_002090	P02724	GLPA_HUMAN	glycophorin A precursor	94	Helical.			L->I: Diminishes dimerization.	interspecies interaction between organisms	membrane fraction	receptor activity			central_nervous_system(2)	2	all_hematologic(180;0.15)					CAAAAATAATGAGTGTTATCT	0.348													37	115	---	---	---	---	PASS
SLC10A7	84068	broad.mit.edu	37	4	147431098	147431098	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147431098G>A	uc010ioz.2	-	3	541	c.287C>T	c.(286-288)TCA>TTA	p.S96L	SLC10A7_uc003ikr.2_Missense_Mutation_p.S96L|SLC10A7_uc010ipa.2_Missense_Mutation_p.S96L|SLC10A7_uc003iks.2_RNA|SLC10A7_uc003ikt.2_Missense_Mutation_p.S96L	NM_001029998	NP_001025169	Q0GE19	NTCP7_HUMAN	solute carrier family 10 (sodium/bile acid	96						integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)					GGGTGTGATTGATAAAAGCTG	0.363													5	87	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158257696	158257696	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158257696G>A	uc003ipm.3	+	11	2100	c.1641G>A	c.(1639-1641)TGG>TGA	p.W547*	GRIA2_uc011cit.1_Nonsense_Mutation_p.W500*|GRIA2_uc003ipl.3_Nonsense_Mutation_p.W547*|GRIA2_uc003ipk.3_Nonsense_Mutation_p.W500*|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	547	Helical; (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	ATGAGATCTGGATGTGCATTG	0.453													128	111	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164450146	164450146	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164450146G>C	uc003iqs.1	-	8	1601	c.624C>G	c.(622-624)TTC>TTG	p.F208L	MARCH1_uc003iqr.1_Missense_Mutation_p.F191L	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I	208	Helical; (Potential).				antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				GACCTCCTGTGAAGCCAATGG	0.438													15	44	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169342981	169342981	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169342981G>T	uc003irq.3	-	17	2545	c.2324C>A	c.(2323-2325)TCC>TAC	p.S775Y	DDX60L_uc003irr.1_Missense_Mutation_p.S775Y|DDX60L_uc003irs.1_Missense_Mutation_p.S502Y	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	775	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GCAGTAGTAGGAAGCATAGGT	0.488													14	162	---	---	---	---	PASS
AADAT	51166	broad.mit.edu	37	4	170989782	170989782	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:170989782T>A	uc003isr.2	-	8	1202	c.860A>T	c.(859-861)CAC>CTC	p.H287L	AADAT_uc003iss.2_Missense_Mutation_p.H287L|AADAT_uc003ist.2_Missense_Mutation_p.H291L	NM_016228	NP_057312	Q8N5Z0	AADAT_HUMAN	kynurenine aminotransferase II	287					2-oxoglutarate metabolic process|biosynthetic process|glutamate metabolic process|lysine catabolic process	mitochondrial matrix	2-aminoadipate transaminase activity|kynurenine-oxoglutarate transaminase activity|protein homodimerization activity				0		Prostate(90;0.00601)|Renal(120;0.0183)|all_neural(102;0.122)|Melanoma(52;0.17)		GBM - Glioblastoma multiforme(119;0.0355)|LUSC - Lung squamous cell carcinoma(193;0.118)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	AACTTGTATGTGTAAAATAAC	0.318													66	70	---	---	---	---	PASS
NEIL3	55247	broad.mit.edu	37	4	178260984	178260984	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178260984A>T	uc003iut.2	+	5	792	c.675A>T	c.(673-675)ATA>ATT	p.I225I	NEIL3_uc010irs.2_Intron	NM_018248	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3	225					base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		TGAAAATGATACGTGATTTCA	0.358								BER_DNA_glycosylases					24	36	---	---	---	---	PASS
IRX2	153572	broad.mit.edu	37	5	2748758	2748758	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2748758G>A	uc003jda.2	-	3	1306	c.1064C>T	c.(1063-1065)CCC>CTC	p.P355L	IRX2_uc003jdb.2_Missense_Mutation_p.P355L	NM_001134222	NP_001127694	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	355						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1				GBM - Glioblastoma multiforme(108;0.204)		ggcggccgcgggcagccccgg	0.498													10	5	---	---	---	---	PASS
ADCY2	108	broad.mit.edu	37	5	7717318	7717318	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7717318G>C	uc003jdz.1	+	12	1738	c.1671G>C	c.(1669-1671)ATG>ATC	p.M557I	ADCY2_uc011cmo.1_Missense_Mutation_p.M377I	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2	557	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						ATGAAAGGATGATTCAAGCAA	0.284													19	234	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9227044	9227044	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9227044C>A	uc003jek.2	-	7	1081	c.369G>T	c.(367-369)GTG>GTT	p.V123V		NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor	123	Sema.|Extracellular (Potential).				cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						GGTCGCCACCCACCAGAAGCA	0.393													33	126	---	---	---	---	PASS
TAS2R1	50834	broad.mit.edu	37	5	9629785	9629785	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9629785C>A	uc003jem.1	-	1	679	c.360G>T	c.(358-360)ATG>ATT	p.M120I		NM_019599	NP_062545	Q9NYW7	TA2R1_HUMAN	taste receptor T2R1	120	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste	integral to membrane	taste receptor activity			ovary(3)	3						TGGATATCCTCATCTTCAACC	0.453													27	64	---	---	---	---	PASS
CTNND2	1501	broad.mit.edu	37	5	11384826	11384826	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11384826C>A	uc003jfa.1	-	7	1273	c.1128G>T	c.(1126-1128)TCG>TCT	p.S376S	CTNND2_uc010itt.2_Silent_p.S285S|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_5'UTR	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	376					multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ACAGCTCCTGCGAGTGCTTGC	0.697													14	42	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13735261	13735261	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13735261C>T	uc003jfd.2	-	68	11782	c.11740G>A	c.(11740-11742)GAG>AAG	p.E3914K	DNAH5_uc003jfc.2_Missense_Mutation_p.E82K	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3914					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GTGAGAAACTCTTCATGCTTG	0.428									Kartagener_syndrome				45	163	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19544068	19544068	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19544068C>T	uc003jgc.2	-	8	1677	c.1300G>A	c.(1300-1302)GAT>AAT	p.D434N	CDH18_uc003jgd.2_Missense_Mutation_p.D434N|CDH18_uc011cnm.1_Missense_Mutation_p.D434N	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	434	Extracellular (Potential).|Cadherin 4.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					GTATTGGCATCAATGTTGAAA	0.348													84	58	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21975440	21975440	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21975440C>G	uc010iuc.2	-	3	744	c.286G>C	c.(286-288)GAT>CAT	p.D96H	CDH12_uc011cno.1_Missense_Mutation_p.D96H|CDH12_uc003jgk.2_Missense_Mutation_p.D96H	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	96	Cadherin 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						CCAGCGCCATCTCCTGAGAGG	0.393										HNSCC(59;0.17)			6	326	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26915837	26915837	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26915837C>A	uc003jgs.1	-	3	593	c.424G>T	c.(424-426)GAA>TAA	p.E142*	CDH9_uc010iug.2_Nonsense_Mutation_p.E142*	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	142	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						AATTCCGATTCCGGTTCCACC	0.398													279	247	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33624408	33624408	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33624408A>T	uc003jia.1	-	14	2234	c.2071T>A	c.(2071-2073)TGC>AGC	p.C691S	ADAMTS12_uc010iuq.1_Intron	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	691	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						CACACACCGCAGCGATCCTCG	0.502										HNSCC(64;0.19)			61	58	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33938175	33938175	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33938175G>T	uc003jic.1	+	1	1687	c.1330G>T	c.(1330-1332)GAC>TAC	p.D444Y		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	444	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						cgcggAGCCGGACCTGCTCTA	0.572													34	37	---	---	---	---	PASS
UGT3A1	133688	broad.mit.edu	37	5	35966004	35966004	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35966004G>A	uc003jjv.1	-	4	484	c.327C>T	c.(325-327)GCC>GCT	p.A109A	UGT3A1_uc003jjw.1_RNA|UGT3A1_uc011coq.1_Silent_p.A109A|UGT3A1_uc011cor.1_Silent_p.A75A|UGT3A1_uc003jjy.1_Silent_p.A55A	NM_152404	NP_689617	Q6NUS8	UD3A1_HUMAN	UDP glycosyltransferase 3 family, polypeptide A1	109	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(2)|central_nervous_system(1)	3	all_lung(31;0.000197)		Epithelial(62;0.107)|Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCTTTACAAGGGCTTCAGATT	0.274													47	56	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38407204	38407204	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38407204G>A	uc003jlc.1	+	8	1427	c.1103G>A	c.(1102-1104)CGA>CAA	p.R368Q	EGFLAM_uc003jlb.1_Missense_Mutation_p.R368Q|EGFLAM_uc003jle.1_Missense_Mutation_p.R134Q|EGFLAM_uc003jlf.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	368	EGF-like 1.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					GGGGGCTCGCGATGCCAGTGC	0.552													15	104	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38458495	38458495	+	Silent	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38458495A>C	uc003jlc.1	+	21	3118	c.2794A>C	c.(2794-2796)AGG>CGG	p.R932R	EGFLAM_uc003jlb.1_Silent_p.R924R|EGFLAM_uc003jle.1_Silent_p.R690R|EGFLAM_uc003jlf.1_Silent_p.R290R|EGFLAM_uc003jlg.1_Silent_p.R67R	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	932	Laminin G-like 3.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					TAAGGCCGTTAGGTGAGTCCC	0.557													35	64	---	---	---	---	PASS
FYB	2533	broad.mit.edu	37	5	39110483	39110483	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39110483C>A	uc003jls.2	-	15	2339	c.2272G>T	c.(2272-2274)GTC>TTC	p.V758F	FYB_uc003jlt.2_Missense_Mutation_p.V804F|FYB_uc003jlu.2_Missense_Mutation_p.V758F|FYB_uc011cpl.1_Missense_Mutation_p.V814F	NM_199335	NP_955367	O15117	FYB_HUMAN	FYN binding protein (FYB-120/130) isoform 2	758					cell junction assembly|immune response|intracellular protein kinase cascade|NLS-bearing substrate import into nucleus|protein phosphorylation|T cell receptor signaling pathway	cytosol|nucleus	protein binding			ovary(2)	2	all_lung(31;0.000343)		Epithelial(62;0.235)			CTCCGAAGGACATAACCATCT	0.299													25	43	---	---	---	---	PASS
PTGER4	5734	broad.mit.edu	37	5	40681542	40681542	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40681542C>T	uc003jlz.2	+	2	1039	c.447C>T	c.(445-447)CTC>CTT	p.L149L		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	149	Helical; Name=4; (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						CCAACGTGCTCTTTTGCGCGC	0.602											OREG0016588	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	77	165	---	---	---	---	PASS
C7	730	broad.mit.edu	37	5	40947703	40947703	+	Splice_Site	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40947703G>T	uc003jmh.2	+	8	853	c.739_splice	c.e8-1	p.S247_splice	C7_uc011cpn.1_Intron	NM_000587	NP_000578	P10643	CO7_HUMAN	complement component 7 precursor						complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular region|membrane attack complex					0		Ovarian(839;0.0112)				TCTTTCCACAGAGTTACCAAC	0.398													23	35	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41181509	41181509	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41181509G>T	uc003jmk.2	-	7	1089	c.879C>A	c.(877-879)ATC>ATA	p.I293I	C6_uc003jml.1_Silent_p.I293I	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	293	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				AATTATGGTTGATATTTTCAC	0.358													59	130	---	---	---	---	PASS
FGF10	2255	broad.mit.edu	37	5	44388623	44388623	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44388623G>T	uc003jog.1	-	1	162	c.162C>A	c.(160-162)TCC>TCA	p.S54S		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	54	Poly-Ser.				actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)					AGAAGGAGGAGGAAGAAGAGT	0.542													43	45	---	---	---	---	PASS
CCNO	10309	broad.mit.edu	37	5	54528254	54528254	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54528254T>A	uc003jpw.2	-	2	659	c.502A>T	c.(502-504)ACG>TCG	p.T168S	CCNO_uc003jpv.2_RNA	NM_021147	NP_066970	P22674	CCNO_HUMAN	cyclin domain containing	168					cell cycle|cell division|depyrimidination|regulation of cyclin-dependent protein kinase activity	nucleoplasm	protein kinase binding|uracil DNA N-glycosylase activity				0		Lung NSC(810;4.08e-05)|Breast(144;0.0735)|Prostate(74;0.183)	LUSC - Lung squamous cell carcinoma(15;0.142)|Lung(15;0.161)			GCCACCGGCGTGGTGGTGAGG	0.602													37	29	---	---	---	---	PASS
ERCC8	1161	broad.mit.edu	37	5	60195503	60195503	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:60195503C>G	uc003jsm.3	-	8	739	c.669G>C	c.(667-669)TTG>TTC	p.L223F	ERCC8_uc003jsk.2_RNA|ERCC8_uc003jsl.3_Missense_Mutation_p.L165F|ERCC8_uc011cqp.1_Missense_Mutation_p.L70F	NM_000082	NP_000073	Q13216	ERCC8_HUMAN	excision repair cross-complementing rodent	223					positive regulation of DNA repair|proteasomal ubiquitin-dependent protein catabolic process|protein autoubiquitination|protein polyubiquitination|response to oxidative stress|response to UV|response to UV|transcription-coupled nucleotide-excision repair	Cul4A-RING ubiquitin ligase complex|nuclear matrix|nucleoplasm|nucleotide-excision repair complex|soluble fraction	protein binding|protein complex binding				0		Lung NSC(810;1.51e-06)|Prostate(74;0.0322)|Ovarian(174;0.0481)|Breast(144;0.077)				CAAGAGTAATCAAACATCCTG	0.328								Direct_reversal_of_damage|NER					29	126	---	---	---	---	PASS
HTR1A	3350	broad.mit.edu	37	5	63257310	63257310	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:63257310C>T	uc011cqt.1	-	1	237	c.237G>A	c.(235-237)GCG>GCA	p.A79A		NM_000524	NP_000515	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A	79	Helical; Name=2; (By similarity).				behavior|positive regulation of cell proliferation	integral to plasma membrane	serotonin receptor activity			ovary(2)|pancreas(2)	4		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Alprenolol(DB00866)|Aripiprazole(DB01238)|Buspirone(DB00490)|Clozapine(DB00363)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Fluvoxamine(DB00176)|Lisuride(DB00589)|Methysergide(DB00247)|Mirtazapine(DB00370)|Pindolol(DB00960)|Propranolol(DB00571)|Quetiapine(DB01224)|Sertraline(DB01104)|Tegaserod(DB01079)|Trazodone(DB00656)|Venlafaxine(DB00285)|Ziprasidone(DB00246)	GGTCGGTGACCGCCAAAGAGC	0.597													3	25	---	---	---	---	PASS
ANKRA2	57763	broad.mit.edu	37	5	72850214	72850214	+	Splice_Site	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:72850214C>T	uc003kcu.1	-	7	1385	c.739_splice	c.e7-1	p.N247_splice		NM_023039	NP_075526	Q9H9E1	ANRA2_HUMAN	ankyrin repeat, family A (RFXANK-like), 2							cytoskeleton|cytosol|membrane	low-density lipoprotein particle binding				0		Lung NSC(167;0.0378)|Ovarian(174;0.0908)		OV - Ovarian serous cystadenocarcinoma(47;3.71e-54)		TTCCTCCATTCTGCAAAATGA	0.343													6	60	---	---	---	---	PASS
AP3B1	8546	broad.mit.edu	37	5	77334916	77334916	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:77334916C>T	uc003kfj.2	-	23	2885	c.2760G>A	c.(2758-2760)GGG>GGA	p.G920G		NM_003664	NP_003655	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1	920					endocytosis|melanosome organization	clathrin coated vesicle membrane|Golgi apparatus|membrane coat	protein phosphatase binding|protein transporter activity			central_nervous_system(1)	1		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GTTTTTTTTCCCCTATGTGGA	0.294									Hermansky-Pudlak_syndrome				35	32	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90084131	90084131	+	Intron	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90084131T>C	uc003kju.2	+						GPR98_uc003kjt.2_Intron|GPR98_uc003kjw.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATTAACCGTATGTATGGCTTT	0.294													21	21	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	90459686	90459686	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90459686G>T	uc003kju.2	+	90	18986	c.18890G>T	c.(18889-18891)AGG>ATG	p.R6297M	GPR98_uc003kjt.2_Missense_Mutation_p.R4003M|GPR98_uc003kjw.2_Missense_Mutation_p.R1958M|GPR98_uc003kjx.2_Missense_Mutation_p.R325M	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	6297	Cytoplasmic (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		GTGGAGCTCAGGAGGATACCC	0.502													9	10	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101597671	101597671	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101597671C>G	uc003knm.2	-	5	1253	c.966G>C	c.(964-966)TGG>TGC	p.W322C		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	322	Helical; Name=6; (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		AAGCAAAGATCCATGATAGAA	0.363													15	53	---	---	---	---	PASS
PDLIM4	8572	broad.mit.edu	37	5	131607158	131607158	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131607158C>T	uc003kwn.2	+	5	746	c.669C>T	c.(667-669)GGC>GGT	p.G223G	uc003kwm.3_Intron|PDLIM4_uc003kwp.2_Silent_p.G223G|PDLIM4_uc003kwo.2_Silent_p.G223G	NM_003687	NP_003678	P50479	PDLI4_HUMAN	PDZ and LIM domain 4 isoform 1	223							protein binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCGGCGAGGGCGGTAAGACGC	0.692													24	18	---	---	---	---	PASS
FSTL4	23105	broad.mit.edu	37	5	132652353	132652353	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:132652353G>C	uc003kyn.1	-							NM_015082	NP_055897	Q6MZW2	FSTL4_HUMAN	follistatin-like 4 precursor							extracellular region	calcium ion binding			central_nervous_system(1)|skin(1)	2		all_cancers(142;0.244)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACCTGAAAGAGAAGGTGAGGT	0.527											OREG0016777	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	40	23	---	---	---	---	PASS
SLC23A1	9963	broad.mit.edu	37	5	138717664	138717664	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138717664G>T	uc003leh.2	-	3	322	c.225C>A	c.(223-225)GAC>GAA	p.D75E	SLC23A1_uc003leg.2_Missense_Mutation_p.D75E	NM_005847	NP_005838	Q9UHI7	S23A1_HUMAN	solute carrier family 23 (nucleobase	75				DQHMVS -> SQTLHC (in Ref. 1; AAC78804).	brain development|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|response to toxin|transepithelial L-ascorbic acid transport|water-soluble vitamin metabolic process	apical plasma membrane|cytoplasm|integral to plasma membrane|intracellular organelle|membrane fraction	dehydroascorbic acid transporter activity|L-ascorbate:sodium symporter activity|nucleobase transmembrane transporter activity|protein binding|sodium-dependent L-ascorbate transmembrane transporter activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)		Vitamin C(DB00126)	CCATGTGCTGGTCGTGGCCCA	0.632													8	4	---	---	---	---	PASS
HBEGF	1839	broad.mit.edu	37	5	139722236	139722236	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139722236G>A	uc003lfi.2	-	3	657	c.382C>T	c.(382-384)CGG>TGG	p.R128W	HBEGF_uc010jfj.2_RNA	NM_001945	NP_001936	Q99075	HBEGF_HUMAN	heparin-binding EGF-like growth factor	128	Extracellular (Potential).|EGF-like.				epidermal growth factor receptor signaling pathway|muscle organ development|positive regulation of protein kinase B signaling cascade|positive regulation of wound healing	cell surface|extracellular space|integral to plasma membrane	epidermal growth factor receptor binding|eukaryotic cell surface binding|growth factor activity|heparin binding|receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGGGAGCCCGGAGCTCCTTC	0.517													153	113	---	---	---	---	PASS
HARS	3035	broad.mit.edu	37	5	140056274	140056274	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140056274C>G	uc003lgv.2	-	10	1241	c.1159G>C	c.(1159-1161)GAG>CAG	p.E387Q	HARS_uc003lgu.2_Missense_Mutation_p.E318Q|HARS_uc011czm.1_Missense_Mutation_p.E347Q|HARS_uc003lgw.2_Missense_Mutation_p.E367Q|HARS_uc011czn.1_Missense_Mutation_p.E327Q|HARS_uc010jfu.2_Missense_Mutation_p.E387Q|HARS_uc011czo.1_Missense_Mutation_p.E313Q|HARS_uc011czp.1_Missense_Mutation_p.E273Q|HARS_uc011czq.1_Missense_Mutation_p.E277Q	NM_002109	NP_002100	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	387					histidyl-tRNA aminoacylation	cytosol	ATP binding|histidine-tRNA ligase activity			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	AAAATCCGCTCCACCCCAATG	0.562													11	221	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140516142	140516142	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140516142G>A	uc003liq.2	+	1	1343	c.1126G>A	c.(1126-1128)GAC>AAC	p.D376N		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	376	Cadherin 4.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGACTCCGGGGACAACGGTAG	0.493													57	36	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590553	140590553	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590553G>C	uc003liz.2	+	1	2263	c.2074G>C	c.(2074-2076)GTG>CTG	p.V692L	PCDHB12_uc011dak.1_Missense_Mutation_p.V355L|PCDHB13_uc003lja.1_5'Flank	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	692	Helical; (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTACCTGGTGGTGGCGTTGGC	0.706													135	103	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140720617	140720617	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140720617G>T	uc003ljk.1	+	1	2264	c.2079G>T	c.(2077-2079)CTG>CTT	p.L693L	PCDHGA1_uc003lji.1_Intron|PCDHGA3_uc003ljm.1_5'Flank|PCDHGA3_uc010jfx.1_5'Flank|PCDHGA2_uc011dao.1_Silent_p.L693L|PCDHGA3_uc011dap.1_5'Flank	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	693	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCTGTACCTGGTGGTGGCGG	0.677													83	85	---	---	---	---	PASS
PCDHGA3	56112	broad.mit.edu	37	5	140724255	140724255	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140724255G>C	uc003ljm.1	+	1	655	c.655G>C	c.(655-657)GAC>CAC	p.D219H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc010jfx.1_5'UTR|PCDHGA3_uc011dap.1_Missense_Mutation_p.D219H	NM_018916	NP_061739	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3 isoform 1	219	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATGGTGGCGACCCTGTCCA	0.537													41	26	---	---	---	---	PASS
PCDHGA4	56111	broad.mit.edu	37	5	140735547	140735547	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140735547G>T	uc003ljq.1	+	1	780	c.780G>T	c.(778-780)CGG>CGT	p.R260R	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljp.1_Silent_p.R260R	NM_018917	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4 isoform 1	260	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGGCACTCGGCTACTCACCG	0.463													19	14	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150928976	150928976	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150928976G>C	uc003lue.3	-	8	4682	c.4669C>G	c.(4669-4671)CAG>GAG	p.Q1557E	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1557	Extracellular (Potential).|Cadherin 14.				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TAATGGAGCTGAGTGAAGCGG	0.572													31	23	---	---	---	---	PASS
GEMIN5	25929	broad.mit.edu	37	5	154311721	154311721	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154311721G>C	uc003lvx.3	-	4	682	c.599C>G	c.(598-600)TCC>TGC	p.S200C	GEMIN5_uc011ddk.1_Missense_Mutation_p.S200C	NM_015465	NP_056280	Q8TEQ6	GEMI5_HUMAN	gemin 5	200	WD 4.				ncRNA metabolic process|protein complex assembly|spliceosomal snRNP assembly	Cajal body|cytosol|spliceosomal complex	protein binding|snRNA binding			skin(2)|ovary(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CCAGGCTATGGAGTGGATTTC	0.408													48	136	---	---	---	---	PASS
SGCD	6444	broad.mit.edu	37	5	156021941	156021941	+	Splice_Site	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156021941G>T	uc003lwd.3	+	5	856	c.380_splice	c.e5-1	p.G127_splice	SGCD_uc003lwa.1_Splice_Site_p.G128_splice|SGCD_uc003lwb.2_Splice_Site_p.G128_splice|SGCD_uc003lwc.3_Splice_Site_p.G128_splice	NM_001128209	NP_001121681	Q92629	SGCD_HUMAN	delta-sarcoglycan isoform 3						cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			atatctctcAGGTCCAAAAGC	0.269													14	6	---	---	---	---	PASS
PANK3	79646	broad.mit.edu	37	5	167991022	167991022	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167991022A>G	uc003lzz.1	-	4	984	c.684T>C	c.(682-684)TGT>TGC	p.C228C		NM_024594	NP_078870	Q9H999	PANK3_HUMAN	pantothenate kinase 3	228					coenzyme A biosynthetic process	cytoplasm|nucleus	ATP binding|pantothenate kinase activity			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		CAAAACTTTCACAGCCAGTCA	0.383													78	190	---	---	---	---	PASS
PDLIM7	9260	broad.mit.edu	37	5	176911113	176911113	+	Silent	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176911113T>G	uc003mhc.1	-	11	1214	c.1129A>C	c.(1129-1131)AGG>CGG	p.R377R	PDLIM7_uc003mha.1_Silent_p.R271R|PDLIM7_uc003mhb.1_Silent_p.R343R|PDLIM7_uc003mhd.1_Silent_p.R229R|PDLIM7_uc003mhe.1_RNA	NM_005451	NP_005442	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 isoform 1	377	LIM zinc-binding 2.				cell differentiation|multicellular organismal development|ossification|receptor-mediated endocytosis	cytoplasm|focal adhesion	protein binding|zinc ion binding			breast(1)	1	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TAGAAGGCCCTGTTCCGGATG	0.607													71	47	---	---	---	---	PASS
DOK3	79930	broad.mit.edu	37	5	176931332	176931332	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176931332G>A	uc003mhk.2	-	6	1148	c.1143C>T	c.(1141-1143)TAC>TAT	p.Y381Y	DOK3_uc003mhh.3_Intron|DOK3_uc003mhi.3_Intron|DOK3_uc003mhj.3_Intron|DOK3_uc003mhl.2_Silent_p.Y325Y	NM_024872	NP_079148	Q7L591	DOK3_HUMAN	docking protein 3 isoform 1	381						cytoplasm|plasma membrane	insulin receptor binding				0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			ACACTGAAGCGTAGAGCCCGG	0.662													12	8	---	---	---	---	PASS
DUSP22	56940	broad.mit.edu	37	6	348099	348099	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:348099G>T	uc003msx.2	+						DUSP22_uc011dhn.1_Intron|DUSP22_uc003msy.1_Intron	NM_020185	NP_064570	Q9NRW4	DUS22_HUMAN	dual specificity phosphatase 22						apoptosis|cell proliferation|inactivation of MAPK activity|multicellular organismal development|positive regulation of JNK cascade|regulation of cell proliferation|transforming growth factor beta receptor signaling pathway	cytoplasm|nucleus	protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	all_hematologic(77;0.228)	Breast(5;0.0249)|all_hematologic(90;0.0489)		OV - Ovarian serous cystadenocarcinoma(45;0.0277)|BRCA - Breast invasive adenocarcinoma(62;0.0669)		TCTTGGCCCCGCAGCCTGGCC	0.587													18	236	---	---	---	---	PASS
GCM2	9247	broad.mit.edu	37	6	10874708	10874708	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10874708G>A	uc003mzn.3	-	5	1113	c.1041C>T	c.(1039-1041)AAC>AAT	p.N347N	SYCP2L_uc011dim.1_Intron	NM_004752	NP_004743	O75603	GCM2_HUMAN	glial cells missing homolog 2	347					cellular calcium ion homeostasis|cellular phosphate ion homeostasis|parathyroid gland development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|sequence-specific DNA binding			ovary(2)|central_nervous_system(1)	3	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)				ACTGCCCATGGTTAGTCCTTT	0.512													111	59	---	---	---	---	PASS
SYCP2L	221711	broad.mit.edu	37	6	10924825	10924825	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10924825A>T	uc003mzo.2	+	15	1465	c.1169A>T	c.(1168-1170)CAG>CTG	p.Q390L	SYCP2L_uc011din.1_Missense_Mutation_p.Q231L|SYCP2L_uc010jow.2_Missense_Mutation_p.Q10L	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like	390						nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			TTTGATTTGCAGTTCAACATA	0.214													24	16	---	---	---	---	PASS
NRSN1	140767	broad.mit.edu	37	6	24145857	24145857	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24145857G>A	uc010jpq.1	+	4	508	c.271G>A	c.(271-273)GAA>AAA	p.E91K		NM_080723	NP_542454	Q8IZ57	NRSN1_HUMAN	neurensin 1	91					nervous system development	growth cone|integral to membrane|neuronal cell body|transport vesicle					0						CCCCAAAATCGAAGCATTTGG	0.488													25	92	---	---	---	---	PASS
HIST1H3D	8351	broad.mit.edu	37	6	26197488	26197488	+	5'UTR	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26197488C>T	uc003ngv.2	-	2					HIST1H2BF_uc003ngx.2_5'Flank	NM_003530	NP_003521	P68431	H31_HUMAN	histone cluster 1, H3d						blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0		all_hematologic(11;0.196)				TTGCGAACTTCTAAACCCTGC	0.532													51	42	---	---	---	---	PASS
ZNF391	346157	broad.mit.edu	37	6	27368701	27368701	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27368701G>C	uc003njf.1	+	3	1070	c.552G>C	c.(550-552)CAG>CAC	p.Q184H		NM_001076781	NP_001070249	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	184	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(2)|skin(1)	3						GTCTACATCAGAGAATCCATA	0.403													23	61	---	---	---	---	PASS
TRIM15	89870	broad.mit.edu	37	6	30131694	30131694	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30131694T>C	uc010jrx.2	+	1	712	c.233T>C	c.(232-234)CTG>CCG	p.L78P	TRIM10_uc003npn.2_5'Flank|TRIM10_uc003npo.3_5'Flank	NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15	78	B box-type.				mesodermal cell fate determination	intracellular	zinc ion binding				0						CTGGGCCCGCTGGGAGAAACT	0.627													26	26	---	---	---	---	PASS
TRIM15	89870	broad.mit.edu	37	6	30131695	30131695	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30131695G>T	uc010jrx.2	+	1	713	c.234G>T	c.(232-234)CTG>CTT	p.L78L	TRIM10_uc003npn.2_5'Flank|TRIM10_uc003npo.3_5'Flank	NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15	78	B box-type.				mesodermal cell fate determination	intracellular	zinc ion binding				0						TGGGCCCGCTGGGAGAAACTT	0.627													26	26	---	---	---	---	PASS
MDC1	9656	broad.mit.edu	37	6	30671759	30671759	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30671759G>A	uc003nrg.3	-	10	5641	c.5201C>T	c.(5200-5202)GCA>GTA	p.A1734V	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.A1341V	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1734	Required for nuclear localization (NLS2).			A -> T (in Ref. 4; BAE78617).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						AATGGGAGCTGCGAGGGAGCC	0.552								Other_conserved_DNA_damage_response_genes					18	73	---	---	---	---	PASS
LHFPL5	222662	broad.mit.edu	37	6	35782501	35782501	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35782501C>T	uc003olg.1	+	2	968	c.591C>T	c.(589-591)TTC>TTT	p.F197F		NM_182548	NP_872354	Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	197	Helical; (Potential).					integral to membrane				skin(1)	1						TCCTGGCCTTCGTGTTGGGCT	0.612													32	14	---	---	---	---	PASS
TBC1D22B	55633	broad.mit.edu	37	6	37259053	37259053	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37259053G>T	uc003onn.2	+	8	1048	c.902G>T	c.(901-903)CGC>CTC	p.R301L	TBC1D22B_uc010jwt.2_RNA	NM_017772	NP_060242	Q9NU19	TB22B_HUMAN	TBC1 domain family, member 22B	301	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0			OV - Ovarian serous cystadenocarcinoma(102;0.241)			TGGGCCATCCGCCACCCTGCC	0.443													48	31	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43155792	43155792	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43155792G>T	uc003ouk.2	+	7	1998	c.1923G>T	c.(1921-1923)CTG>CTT	p.L641L	CUL9_uc003ouj.1_Silent_p.L531L|CUL9_uc003oul.2_Silent_p.L641L|CUL9_uc010jyk.2_5'UTR|CUL9_uc003oum.1_Silent_p.L99L	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	641					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						ATTCTCAGCTGTTTAACCAGC	0.567													35	18	---	---	---	---	PASS
SPATS1	221409	broad.mit.edu	37	6	44337825	44337825	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44337825C>G	uc003oxk.2	+	6	1080	c.733C>G	c.(733-735)CTT>GTT	p.L245V	SPATS1_uc003oxg.2_RNA|SPATS1_uc010jzb.2_Missense_Mutation_p.L130V	NM_145026	NP_659463	Q496A3	SPAS1_HUMAN	spermatogenesis associated, serine-rich 1	245										skin(1)	1	all_lung(25;0.00469)|Ovarian(13;0.0273)|all_hematologic(164;0.208)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATTTATTCCACTTGAGCCTCT	0.328													79	56	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582403	49582403	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582403G>A	uc003ozk.3	-	5	866	c.804C>T	c.(802-804)AAC>AAT	p.N268N	RHAG_uc010jzl.2_Silent_p.N268N|RHAG_uc010jzm.2_Silent_p.N268N	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	268	Cytoplasmic (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					CACTTACCATGTTGAGCTTGC	0.498													61	57	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582408	49582408	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582408G>A	uc003ozk.3	-	5	861	c.799C>T	c.(799-801)CTC>TTC	p.L267F	RHAG_uc010jzl.2_Missense_Mutation_p.L267F|RHAG_uc010jzm.2_Missense_Mutation_p.L267F	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	267	Cytoplasmic (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					ACCATGTTGAGCTTGCCTCGG	0.493													62	57	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51484067	51484067	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51484067C>G	uc003pah.1	-	67	12313	c.12037G>C	c.(12037-12039)GGC>CGC	p.G4013R		NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	4013	Cytoplasmic (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TGATTTTGGCCTGCCAGCTGG	0.572													41	30	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57398140	57398140	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57398140C>A	uc003pdx.2	+	10	930	c.843C>A	c.(841-843)ACC>ACA	p.T281T		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	281					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGCTTTCTACCAAATCCTTCC	0.373													51	119	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66044902	66044902	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66044902A>T	uc011dxu.1	-	11	2275	c.1737T>A	c.(1735-1737)GCT>GCA	p.A579A	EYS_uc003peq.2_Silent_p.A579A|EYS_uc003per.1_Silent_p.A579A	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	579	EGF-like 6.				response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						CTTTACAAACAGCTTCATGTT	0.323													20	99	---	---	---	---	PASS
EYS	346007	broad.mit.edu	37	6	66204874	66204874	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:66204874C>A	uc011dxu.1	-	4	968	c.430G>T	c.(430-432)GGG>TGG	p.G144W	EYS_uc003peq.2_Missense_Mutation_p.G144W|EYS_uc003per.1_Missense_Mutation_p.G144W|EYS_uc010kaj.1_RNA	NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1	144					response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						TAATGTGTCCCAACACTCAGC	0.433													43	49	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70610181	70610181	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70610181G>A	uc003pfc.1	+	4	334	c.217G>A	c.(217-219)GAT>AAT	p.D73N		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	73	TSP N-terminal.				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						TTGTGAAAGTGATAAAACCTG	0.259													39	37	---	---	---	---	PASS
COL9A1	1297	broad.mit.edu	37	6	70983776	70983776	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70983776C>T	uc003pfg.3	-	12	1198	c.1039G>A	c.(1039-1041)GGT>AGT	p.G347S	COL9A1_uc003pfe.3_5'UTR|COL9A1_uc003pff.3_Missense_Mutation_p.G104S	NM_001851	NP_001842	P20849	CO9A1_HUMAN	alpha 1 type IX collagen isoform 1 precursor	347	Triple-helical region (COL3).				axon guidance|cell adhesion|organ morphogenesis	collagen type IX	metal ion binding			ovary(4)	4						CCAGGCACACCAGGTTCTCCC	0.313													22	35	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72806703	72806703	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72806703G>A	uc003pga.2	+	3	374	c.297G>A	c.(295-297)GGG>GGA	p.G99G		NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	99	RabBD.				calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GAAAAATAGGGGAAGAAGCGC	0.438													6	26	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	73102502	73102502	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73102502C>A	uc003pga.2	+	31	4685	c.4608C>A	c.(4606-4608)ACC>ACA	p.T1536T	RIMS1_uc011dyb.1_Silent_p.T933T|RIMS1_uc003pgc.2_Silent_p.T985T|RIMS1_uc010kaq.2_Silent_p.T856T|RIMS1_uc011dyc.1_Silent_p.T661T|RIMS1_uc010kar.2_Silent_p.T604T|RIMS1_uc011dyd.1_Silent_p.T670T|RIMS1_uc003pgf.2_Silent_p.T536T|RIMS1_uc003pgg.2_Silent_p.T432T|RIMS1_uc003pgi.2_Silent_p.T352T|RIMS1_uc003pgh.2_Silent_p.T403T|RIMS1_uc003pgd.2_Silent_p.T602T|RIMS1_uc003pge.2_Silent_p.T576T|RIMS1_uc011dye.1_Silent_p.T342T|RIMS1_uc011dyf.1_Silent_p.T160T|RIMS1_uc011dyg.1_Silent_p.T63T	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	1536					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CCCTTGCCACCCCTGCAATGG	0.383													47	67	---	---	---	---	PASS
OOEP	441161	broad.mit.edu	37	6	74079480	74079480	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74079480C>A	uc003pgu.3	-	1	36	c.36G>T	c.(34-36)CGG>CGT	p.R12R	OOEP_uc003pgv.3_Intron	NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog	12						cytoplasm					0						TCTGTTTGCCCCGCTGGGACT	0.657													24	118	---	---	---	---	PASS
FILIP1	27145	broad.mit.edu	37	6	76022205	76022205	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76022205G>A	uc003pia.2	-	5	3716	c.3343C>T	c.(3343-3345)CAC>TAC	p.H1115Y	FILIP1_uc003phy.1_Missense_Mutation_p.H1115Y|FILIP1_uc003phz.2_Missense_Mutation_p.H1016Y|FILIP1_uc010kbe.2_Missense_Mutation_p.H1118Y|FILIP1_uc003pib.1_Missense_Mutation_p.H867Y	NM_015687	NP_056502	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	1115										skin(3)|ovary(1)	4						GAGGAGAGGTGATTCCTGGGA	0.537													44	168	---	---	---	---	PASS
DOPEY1	23033	broad.mit.edu	37	6	83850127	83850127	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83850127G>C	uc003pjs.1	+						DOPEY1_uc011dyy.1_Intron|DOPEY1_uc010kbl.1_Intron|DOPEY1_uc003pjt.2_Intron	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1						protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		ACAAAGGTTAGACAATTCATA	0.378													35	117	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84366499	84366499	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84366499T>A	uc011dze.1	-	7	949	c.632A>T	c.(631-633)TAC>TTC	p.Y211F	SNAP91_uc003pkb.2_Missense_Mutation_p.Y176F|SNAP91_uc003pkc.2_Missense_Mutation_p.Y211F|SNAP91_uc003pkd.2_Missense_Mutation_p.Y211F|SNAP91_uc003pka.2_Missense_Mutation_p.Y211F|SNAP91_uc011dzf.1_Missense_Mutation_p.Y92F	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	211					clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		ACCATCATTGTAGCAAGCAAA	0.378													10	36	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90362722	90362722	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90362722T>C	uc003pnn.1	-	94	15930	c.15814A>G	c.(15814-15816)ACG>GCG	p.T5272A		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	5272					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TGGAAGATCGTGTCCATGAGG	0.338													50	241	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	96973248	96973248	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96973248G>A	uc003por.2	+	4	376	c.328G>A	c.(328-330)GTG>ATG	p.V110M	KIAA0776_uc010kck.2_RNA	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376	110	Required for E3 UFM1-protein ligase activity.				negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TGTTCAGTTAGTGTTGGGACA	0.274													87	120	---	---	---	---	PASS
PRDM1	639	broad.mit.edu	37	6	106536322	106536322	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106536322G>A	uc003prd.2	+	2	523	c.289G>A	c.(289-291)GAG>AAG	p.E97K		NM_001198	NP_001189	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain isoform	97	SET.				negative regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding	p.?(1)		haematopoietic_and_lymphoid_tissue(54)|ovary(1)|skin(1)	56	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		CAACAGTGAAGAGGTAAGCCT	0.502			D|N|Mis|F|S		DLBCL								25	101	---	---	---	---	PASS
ATG5	9474	broad.mit.edu	37	6	106756369	106756369	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106756369G>T	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		AAAAGCAACTGAAATGAAAAT	0.299													7	23	---	---	---	---	PASS
AKD1	221264	broad.mit.edu	37	6	109993230	109993230	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109993230C>T	uc003ptn.2	-						AKD1_uc003ptr.3_Intron|AKD1_uc003pts.1_Intron	NM_001145128	NP_001138600	Q5TCS8	AKD1_HUMAN	adenylate kinase domain containing 1 isoform 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		ATP binding|nucleobase, nucleoside, nucleotide kinase activity|nucleoside-triphosphatase activity			ovary(1)	1						TAAGGACAAGCATAGATATTG	0.343													38	47	---	---	---	---	PASS
WASF1	8936	broad.mit.edu	37	6	110423427	110423427	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110423427G>A	uc003ptv.1	-						WASF1_uc003ptw.1_Intron|WASF1_uc003ptx.1_Intron|WASF1_uc003pty.1_Intron	NM_003931	NP_003922	Q92558	WASF1_HUMAN	Wiskott-Aldrich syndrome protein family member						actin filament polymerization|cellular component movement	actin cytoskeleton	actin binding				0		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		GAACTGAAATGACAAAGAGAT	0.408													36	110	---	---	---	---	PASS
HS3ST5	222537	broad.mit.edu	37	6	114378987	114378987	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114378987A>G	uc003pwg.3	-	2	507	c.475T>C	c.(475-477)TAT>CAT	p.Y159H	uc003pwf.2_Intron|HS3ST5_uc003pwh.3_Missense_Mutation_p.Y159H	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)	159	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GTGATAAAATATGCTGGGCTC	0.383													160	193	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117700271	117700271	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117700271G>C	uc003pxp.1	-	17	2747	c.2548C>G	c.(2548-2550)CAA>GAA	p.Q850E	ROS1_uc011ebi.1_RNA|GOPC_uc003pxq.1_Intron	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	850	Extracellular (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		TGACTGTCTTGAACCAACCAA	0.398			T	GOPC|ROS1	glioblastoma|NSCLC								36	54	---	---	---	---	PASS
FAM184A	79632	broad.mit.edu	37	6	119281342	119281342	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:119281342G>C	uc003pyj.2	-	18	3697	c.3349C>G	c.(3349-3351)CAG>GAG	p.Q1117E	FAM184A_uc003pyk.3_Missense_Mutation_p.Q948E|FAM184A_uc003pyl.3_Missense_Mutation_p.Q913E|FAM184A_uc003pyi.2_RNA	NM_024581	NP_078857	Q8NB25	F184A_HUMAN	hypothetical protein LOC79632 isoform 1	1117										ovary(2)|central_nervous_system(2)|skin(2)|pancreas(1)	7						GCTTCACTCTGAGCAGGACTG	0.443													12	98	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123318974	123318974	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123318974C>A	uc003pzi.1	+	2	921	c.52C>A	c.(52-54)CTG>ATG	p.L18M		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	18					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						GAAAGCTCGCCTGGAGCTCAA	0.547													33	47	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123319225	123319225	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123319225G>T	uc003pzi.1	+	2	1172	c.303G>T	c.(301-303)AAG>AAT	p.K101N		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	101	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AGGCACTGAAGGATGGCTTCC	0.537													60	73	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123319300	123319300	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123319300G>T	uc003pzi.1	+	2	1247	c.378G>T	c.(376-378)TGG>TGT	p.W126C		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	126	CRAL-TRIO.				lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						CTGCCAATTGGGATCAGAGCA	0.468													52	55	---	---	---	---	PASS
TRDN	10345	broad.mit.edu	37	6	123600200	123600200	+	Splice_Site	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123600200C>G	uc003pzj.1	-	25	1559	c.1537_splice	c.e25+1	p.Q513_splice	TRDN_uc010kem.1_Splice_Site_p.Q14_splice	NM_006073	NP_006064	Q13061	TRDN_HUMAN	triadin						muscle contraction	integral to membrane|plasma membrane|sarcoplasmic reticulum membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(226;0.184)		ATATAACATACGTGGAGGTTT	0.259													22	43	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129588326	129588326	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129588326C>A	uc003qbn.2	+	16	2389	c.2284C>A	c.(2284-2286)CAT>AAT	p.H762N	LAMA2_uc003qbo.2_Missense_Mutation_p.H762N	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	762	Laminin EGF-like 6.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTGCTTTGGTCATGCGGAGTC	0.493													165	205	---	---	---	---	PASS
ENPP1	5167	broad.mit.edu	37	6	132171234	132171234	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132171234T>A	uc011ecf.1	+	3	438	c.418T>A	c.(418-420)TGC>AGC	p.C140S		NM_006208	NP_006199	P22413	ENPP1_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	140	SMB 1.|Extracellular (Potential).				3'-phosphoadenosine 5'-phosphosulfate metabolic process|biomineral tissue development|cellular phosphate ion homeostasis|cellular response to insulin stimulus|generation of precursor metabolites and energy|immune response|inorganic diphosphate transport|negative regulation of cell growth|negative regulation of fat cell differentiation|negative regulation of glucose import|negative regulation of glycogen biosynthetic process|negative regulation of insulin receptor signaling pathway|negative regulation of protein autophosphorylation|nucleoside triphosphate catabolic process|phosphate metabolic process|sequestering of triglyceride|water-soluble vitamin metabolic process	basolateral plasma membrane|cell surface|extracellular space|integral to membrane	ATP binding|insulin receptor binding|metal ion binding|nucleic acid binding|nucleoside-triphosphate diphosphatase activity|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|protein homodimerization activity|scavenger receptor activity			upper_aerodigestive_tract(2)|ovary(2)	4	Breast(56;0.0505)			GBM - Glioblastoma multiforme(226;0.0216)|OV - Ovarian serous cystadenocarcinoma(155;0.022)	Amifostine(DB01143)|Ribavirin(DB00811)	CCAGGAGACGTGCATAGAACC	0.438													30	99	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132966703	132966703	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132966703C>A	uc003qdm.1	-	1	440	c.440G>T	c.(439-441)AGT>ATT	p.S147I		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	147	Helical; Name=4; (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	GACACTCCAACTAATGAAGAT	0.393													36	58	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132966855	132966855	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132966855A>G	uc003qdm.1	-	1	288	c.288T>C	c.(286-288)TGT>TGC	p.C96C		NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1	96	Extracellular (Potential).					plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	TGTGAATTTTACAGAAGACTT	0.458													12	62	---	---	---	---	PASS
TAAR1	134864	broad.mit.edu	37	6	132967144	132967144	+	5'Flank	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132967144C>G	uc003qdm.1	-							NM_138327	NP_612200	Q96RJ0	TAAR1_HUMAN	trace amine associated receptor 1							plasma membrane					0	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00616)|GBM - Glioblastoma multiforme(226;0.0154)	Amphetamine(DB00182)	GGGCATCATTCCTGAGGGCTG	0.358													139	173	---	---	---	---	PASS
ALDH8A1	64577	broad.mit.edu	37	6	135239933	135239933	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135239933T>A	uc003qew.2	-	7	1137	c.1084A>T	c.(1084-1086)AGC>TGC	p.S362C	ALDH8A1_uc003qex.2_Missense_Mutation_p.S308C|ALDH8A1_uc010kgh.2_Missense_Mutation_p.S140C|ALDH8A1_uc011ecx.1_Missense_Mutation_p.S312C	NM_022568	NP_072090	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8A1 isoform 1	362					retinal metabolic process	cytoplasm	retinal dehydrogenase activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		GCAGGGAGGCTCAACTTATCC	0.483													34	112	---	---	---	---	PASS
IFNGR1	3459	broad.mit.edu	37	6	137525569	137525569	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137525569G>A	uc003qho.2	-	4	549	c.446C>T	c.(445-447)TCA>TTA	p.S149L	IFNGR1_uc011edm.1_Missense_Mutation_p.S121L|IFNGR1_uc011edn.1_Missense_Mutation_p.S139L	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	149	Extracellular (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TACAAAAACTGAAGGGTGAAA	0.413													11	137	---	---	---	---	PASS
ECT2L	345930	broad.mit.edu	37	6	139206647	139206647	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139206647G>C	uc003qif.1	+	15	2136	c.2033G>C	c.(2032-2034)AGA>ACA	p.R678T	ECT2L_uc011edq.1_Intron	NM_001077706	NP_001071174	Q008S8	ECT2L_HUMAN	epithelial cell transforming sequence 2	678	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity				0						TTTTAGTGCAGAGAAATGATA	0.428													3	99	---	---	---	---	PASS
HIVEP2	3097	broad.mit.edu	37	6	143091585	143091585	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143091585T>A	uc003qjd.2	-	5	5034	c.4291A>T	c.(4291-4293)AGC>TGC	p.S1431C		NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer	1431					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GTGGCCACGCTGTCAGAGGTG	0.527													25	71	---	---	---	---	PASS
SHPRH	257218	broad.mit.edu	37	6	146243814	146243814	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146243814C>T	uc003qlf.2	-	19	4103	c.3704G>A	c.(3703-3705)AGA>AAA	p.R1235K	SHPRH_uc003qld.2_Missense_Mutation_p.R1239K|SHPRH_uc003qle.2_Missense_Mutation_p.R1239K|SHPRH_uc003qlg.1_Missense_Mutation_p.R791K|SHPRH_uc003qlh.2_Missense_Mutation_p.R160K|SHPRH_uc003qli.1_Missense_Mutation_p.R160K	NM_001042683	NP_001036148	Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase isoform a	1235					DNA repair|nucleosome assembly	nucleosome|nucleus	ATP binding|DNA binding|helicase activity|ligase activity|zinc ion binding			ovary(1)|kidney(1)|central_nervous_system(1)	3		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GAGAGGAAGTCTGGCTGGTCG	0.403													43	58	---	---	---	---	PASS
RAET1G	353091	broad.mit.edu	37	6	150240831	150240831	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150240831C>G	uc010kii.1	-	2	275	c.207G>C	c.(205-207)AAG>AAC	p.K69N	RAET1G_uc003qnm.2_RNA	NM_001001788	NP_001001788	Q6H3X3	RET1G_HUMAN	retinoic acid early transcript 1G precursor	69	MHC class I alpha-1 like.|Extracellular (Potential).				antigen processing and presentation|immune response	integral to membrane|MHC class I protein complex	protein binding				0		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		GTGTGACTGTCTTGCTGCCAC	0.517													5	364	---	---	---	---	PASS
RAET1L	154064	broad.mit.edu	37	6	150343258	150343258	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150343258C>G	uc011eei.1	-	2	268	c.207G>C	c.(205-207)AAG>AAC	p.K69N		NM_130900	NP_570970	Q5VY80	RET1L_HUMAN	retinoic acid early transcript 1L precursor	69	MHC class I alpha-1 like (By similarity).				antigen processing and presentation|immune response	anchored to membrane|MHC class I protein complex					0		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.4e-12)		GTGTGACTGTCTTGTTGCCAC	0.507													45	145	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152466622	152466622	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152466622C>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Missense_Mutation_p.G8278W|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Missense_Mutation_p.G511W|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Missense_Mutation_p.G1249W	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTGTGCCTACCGGAGGTATTT	0.493										HNSCC(10;0.0054)			8	42	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152565699	152565699	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152565699C>A	uc010kiw.2	-	106	20267	c.19665G>T	c.(19663-19665)CCG>CCT	p.P6555P	SYNE1_uc010kiv.2_Silent_p.P1079P|SYNE1_uc003qos.3_Silent_p.P1079P|SYNE1_uc003qot.3_Silent_p.P6484P|SYNE1_uc003qou.3_Silent_p.P6555P	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6555	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTGCATGGACGGCTGCTCGA	0.443										HNSCC(10;0.0054)			31	126	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152615100	152615100	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152615100T>G	uc010kiw.2	-	94	18447	c.17845A>C	c.(17845-17847)AAT>CAT	p.N5949H	SYNE1_uc010kiv.2_Missense_Mutation_p.N473H|SYNE1_uc003qos.3_Missense_Mutation_p.N473H|SYNE1_uc003qot.3_Missense_Mutation_p.N5878H|SYNE1_uc003qou.3_Missense_Mutation_p.N5949H|SYNE1_uc010kiy.1_Missense_Mutation_p.N124H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	5949	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTACCACATTCTTTAAGGTT	0.473										HNSCC(10;0.0054)			28	112	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152779985	152779985	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152779985C>T	uc010kiw.2	-	22	3077	c.2475G>A	c.(2473-2475)ACG>ACA	p.T825T	SYNE1_uc003qot.3_Silent_p.T832T|SYNE1_uc003qou.3_Silent_p.T825T|SYNE1_uc010kjb.1_Silent_p.T808T|SYNE1_uc003qow.2_Silent_p.T120T|SYNE1_uc003qox.1_Silent_p.T341T|SYNE1_uc003qoz.2_Silent_p.T257T|SYNE1_uc003qoy.2_Silent_p.T392T	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	825	Cytoplasmic (Potential).|Potential.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CATAAAAGGACGTCATCTGCT	0.388										HNSCC(10;0.0054)			25	102	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	6	153603833	153603833	+	IGR	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153603833C>A								RGS17 (151444 upstream) : OPRM1 (727803 downstream)																							TCACGTGGCCCCTAAGTTTCC	0.547													37	66	---	---	---	---	PASS
SLC22A3	6581	broad.mit.edu	37	6	160829959	160829959	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160829959G>C	uc003qti.2	+						SLC22A3_uc011efx.1_Intron	NM_021977	NP_068812	O75751	S22A3_HUMAN	solute carrier family 22 member 3							integral to plasma membrane|membrane fraction	protein binding|quaternary ammonium group transmembrane transporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(66;0.00028)|Ovarian(120;0.0308)|Prostate(117;0.218)		OV - Ovarian serous cystadenocarcinoma(65;9.47e-17)|BRCA - Breast invasive adenocarcinoma(81;9.75e-06)		TACTGGTAATGTGGTTTTGGT	0.358													34	64	---	---	---	---	PASS
AGPAT4	56895	broad.mit.edu	37	6	161574442	161574442	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161574442G>C	uc003qtr.1	-	5	827	c.600C>G	c.(598-600)CTC>CTG	p.L200L	AGPAT4_uc003qts.1_Silent_p.L60L|AGPAT4_uc011egb.1_Intron|AGPAT4_uc003qtt.1_RNA|AGPAT4_uc011egc.1_3'UTR|AGPAT4_uc011egd.1_3'UTR|AGPAT4_uc011ege.1_3'UTR	NM_020133	NP_064518	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	200					phospholipid biosynthetic process	integral to membrane	1-acylglycerol-3-phosphate O-acyltransferase activity|protein binding				0		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		GGTGATGCTTGAGGCGAGGCA	0.597											OREG0017775	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	26	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166580870	166580870	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166580870C>G	uc003quu.1	-						T_uc003qut.1_Intron|T_uc003quv.1_Intron	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T						anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GGACGCGCACCCACCTGCCGT	0.672									Chordoma_Familial_Clustering_of				23	30	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169632819	169632819	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169632819G>T	uc003qwt.2	-	13	2120	c.1872C>A	c.(1870-1872)CCC>CCA	p.P624P		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	624	EGF-like 2; calcium-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		CTCTGTATCGGGGCGGGCAGG	0.647													56	44	---	---	---	---	PASS
FTSJ2	29960	broad.mit.edu	37	7	2281800	2281800	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2281800G>A	uc003slm.2	-	1	34	c.5C>T	c.(4-6)GCG>GTG	p.A2V	FTSJ2_uc003slk.2_5'UTR|FTSJ2_uc003sll.2_5'UTR|FTSJ2_uc003sln.2_RNA|FTSJ2_uc003slo.2_5'UTR|NUDT1_uc003slp.1_5'Flank|NUDT1_uc003slq.1_5'Flank|NUDT1_uc003slr.1_5'Flank|NUDT1_uc003sls.1_5'Flank|NUDT1_uc003slt.1_5'Flank|NUDT1_uc003slu.1_5'Flank|NUDT1_uc003slv.1_5'Flank	NM_013393	NP_037525	Q9UI43	RRMJ2_HUMAN	FtsJ homolog 2	2					cell proliferation	mitochondrion|nucleolus	nucleic acid binding|rRNA (uridine-2'-O-)-methyltransferase activity			ovary(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)		AGCTCACCCCGCCATTGGTGT	0.726													23	4	---	---	---	---	PASS
RBAK	57786	broad.mit.edu	37	7	5105001	5105001	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5105001C>T	uc010kss.1	+	6	2238	c.1914C>T	c.(1912-1914)CTC>CTT	p.L638L	LOC389458_uc003snr.2_Intron|RBAK_uc003sns.1_Silent_p.L638L	NM_021163	NP_066986	Q9NYW8	RBAK_HUMAN	RB-associated KRAB repressor	638	C2H2-type 14.|Interaction with AR.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(3)|kidney(1)|skin(1)	5		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0916)|OV - Ovarian serous cystadenocarcinoma(56;2.44e-14)		TGTCAAACCTCACTGTCCACT	0.388													31	197	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20698188	20698188	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20698188G>A	uc003suw.3	+	5	807	c.261G>A	c.(259-261)AGG>AGA	p.R87R	ABCB5_uc010kuh.2_Silent_p.R532R|ABCB5_uc003suv.3_Silent_p.R87R|ABCB5_uc011jyi.1_Silent_p.R87R	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	87	ABC transporter 1.|Extracellular (Potential).				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGAAACAGAGGATCGCAATTG	0.438													15	98	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21779186	21779186	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21779186C>T	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTCTGTCTTTCAGGTATGATA	0.338									Kartagener_syndrome				58	72	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21882171	21882171	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21882171G>C	uc003svc.2	+	67	10753	c.10722G>C	c.(10720-10722)AGG>AGC	p.R3574S		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3574	AAA 5 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						GGTATATCAGGATTGGAGATA	0.383									Kartagener_syndrome				6	90	---	---	---	---	PASS
HNRNPA2B1	3181	broad.mit.edu	37	7	26236961	26236961	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26236961C>G	uc003sxr.3	-	4	490	c.274G>C	c.(274-276)GAG>CAG	p.E92Q	HNRNPA2B1_uc003sxs.3_Missense_Mutation_p.E80Q	NM_031243	NP_112533	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	92	RRM 1.				RNA transport	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleolus|nucleoplasm	nucleotide binding|protein binding|protein binding|RNA binding|single-stranded telomeric DNA binding			ovary(1)|central_nervous_system(1)|skin(1)	3						CGTTTTGGCTCAACTACTCTC	0.423			T	ETV1	prostate								55	411	---	---	---	---	PASS
RP9	6100	broad.mit.edu	37	7	33135041	33135041	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33135041T>C	uc003tdm.2	-	6	489	c.471A>G	c.(469-471)ATA>ATG	p.I157M		NM_203288	NP_976033	Q8TA86	RP9_HUMAN	retinitis pigmentosa 9	157					RNA splicing	nucleus	nucleic acid binding|protein binding|zinc ion binding				0			GBM - Glioblastoma multiforme(11;0.0403)			TTAACTGCTGTATCCTAAACA	0.328													90	23	---	---	---	---	PASS
PKD1L1	168507	broad.mit.edu	37	7	47873943	47873943	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47873943T>C	uc003tny.1	-	40	6168	c.6168A>G	c.(6166-6168)CCA>CCG	p.P2056P		NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1	2056	Cytoplasmic (Potential).				cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						TTACCTTGCGTGGCTCCTGTG	0.433													39	34	---	---	---	---	PASS
ABCA13	154664	broad.mit.edu	37	7	48312039	48312039	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48312039G>A	uc003toq.2	+	17	2801	c.2776G>A	c.(2776-2778)GCA>ACA	p.A926T	ABCA13_uc010kyr.2_Missense_Mutation_p.A429T	NM_152701	NP_689914	Q86UQ4	ABCAD_HUMAN	ATP binding cassette, sub-family A (ABC1),	926					transport	integral to membrane	ATP binding|ATPase activity			ovary(5)|central_nervous_system(4)|skin(1)	10						TATCAGGAATGCATCTGATCT	0.393													88	28	---	---	---	---	PASS
VOPP1	81552	broad.mit.edu	37	7	55565340	55565340	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55565340G>A	uc003tqs.2	-	3	340	c.157C>T	c.(157-159)CGG>TGG	p.R53W	VOPP1_uc003tqq.2_Missense_Mutation_p.R44W|VOPP1_uc010kzh.2_Missense_Mutation_p.R50W|VOPP1_uc010kzi.2_Missense_Mutation_p.R36W|VOPP1_uc011kcr.1_5'UTR	NM_030796	NP_110423	Q96AW1	VOPP1_HUMAN	EGFR-coamplified and overexpressed protein	53	Extracellular (Potential).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic vesicle membrane|endosome|integral to organelle membrane	signal transducer activity				0						GAGAGGGCCCGCACACAGCAC	0.627													4	233	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55910746	55910746	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55910746G>T	uc003tqz.2	-	5	564	c.447C>A	c.(445-447)TCC>TCA	p.S149S		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	149					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ACTCAAACAAGGAACGTTTAA	0.373													24	36	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57193716	57193716	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57193716C>G	uc010kzo.2	-							NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			TTCATTCGCTCTCACCTACCT	0.453													101	221	---	---	---	---	PASS
ZNF107	51427	broad.mit.edu	37	7	64167545	64167545	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64167545A>T	uc003ttd.2	+	7	1649	c.863A>T	c.(862-864)AAT>ATT	p.N288I	ZNF107_uc003tte.2_Missense_Mutation_p.N288I	NM_016220	NP_057304	Q9UII5	ZN107_HUMAN	zinc finger protein 107	288	C2H2-type 8; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Lung NSC(55;0.00948)|all_lung(88;0.0249)				TCAAACCTTAATAAACAGGAG	0.343													17	89	---	---	---	---	PASS
TPST1	8460	broad.mit.edu	37	7	65751683	65751683	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65751683A>C	uc003tuw.2	+	3	1383	c.1031A>C	c.(1030-1032)GAA>GCA	p.E344A	TPST1_uc010kzy.2_RNA|TPST1_uc010kzz.2_Missense_Mutation_p.E344A|TPST1_uc010laa.2_Missense_Mutation_p.E344A	NM_003596	NP_003587	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	344	Lumenal (Potential).				inflammatory response|peptidyl-tyrosine sulfation	Golgi membrane|integral to membrane|membrane fraction	protein-tyrosine sulfotransferase activity				0						AAAATTATTGAAAACACTCGA	0.343													46	50	---	---	---	---	PASS
AUTS2	26053	broad.mit.edu	37	7	69364300	69364300	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:69364300G>T	uc003tvw.3	+	2	1081	c.338G>T	c.(337-339)CGT>CTT	p.R113L	AUTS2_uc003tvv.3_Missense_Mutation_p.R113L|AUTS2_uc003tvx.3_Missense_Mutation_p.R113L	NM_015570	NP_056385	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2 isoform 1	113										ovary(2)|central_nervous_system(1)	3		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCTCAGGAACGTGTGGAGAAA	0.473													21	95	---	---	---	---	PASS
TRIM50	135892	broad.mit.edu	37	7	72732870	72732870	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72732870T>A	uc010lbd.1	-	4	802	c.677A>T	c.(676-678)GAG>GTG	p.E226V	FKBP6_uc003twz.2_Intron|TRIM50_uc003txy.1_Missense_Mutation_p.E226V|TRIM50_uc003txz.1_Missense_Mutation_p.E226V	NM_178125	NP_835226	Q86XT4	TRI50_HUMAN	tripartite motif protein 50A	226	Potential.					cytoplasm|intracellular membrane-bounded organelle	ligase activity|zinc ion binding			skin(1)	1						CAGCACACACTCGGCTTGGGC	0.667													33	142	---	---	---	---	PASS
RFC2	5982	broad.mit.edu	37	7	73657584	73657584	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73657584G>T	uc003uaj.2	-						RFC2_uc011kfa.1_Intron|RFC2_uc003uak.2_Intron|RFC2_uc010lbp.2_Intron|RFC2_uc003ual.2_Intron	NM_181471	NP_852136	P35250	RFC2_HUMAN	replication factor C 2 isoform 1						cell cycle checkpoint|DNA strand elongation involved in DNA replication|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor C complex|nucleoplasm	ATP binding|DNA clamp loader activity|protein binding			liver(1)|central_nervous_system(1)	2						ATGCTGAGAAGAAAAACACAA	0.463													97	65	---	---	---	---	PASS
FGL2	10875	broad.mit.edu	37	7	76825589	76825589	+	3'UTR	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76825589G>A	uc003ugb.2	-	2					CCDC146_uc003ufz.1_Intron|CCDC146_uc003uga.2_Intron	NM_006682	NP_006673	Q14314	FGL2_HUMAN	fibrinogen-like 2 precursor						signal transduction	fibrinogen complex	receptor binding			skin(2)	2						GGAATGAACAGAGTGATTTAT	0.408													20	65	---	---	---	---	PASS
SEMA3C	10512	broad.mit.edu	37	7	80378352	80378352	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:80378352G>C	uc003uhj.2	-						SEMA3C_uc011kgw.1_Intron	NM_006379	NP_006370	Q99985	SEM3C_HUMAN	semaphorin 3C precursor						immune response|response to drug	membrane	receptor activity			ovary(1)	1						ATGCTAGCAGGCAAAAATAAA	0.373													37	69	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81594957	81594957	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81594957C>T	uc003uhr.1	-	32	2783	c.2527G>A	c.(2527-2529)GAT>AAT	p.D843N	CACNA2D1_uc011kgy.1_Missense_Mutation_p.D55N	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	855	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AACCCACCATCATCCAGAATC	0.368													35	304	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82430892	82430892	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82430892C>T	uc003uhx.2	-	22	15238	c.14949G>A	c.(14947-14949)CAG>CAA	p.Q4983Q		NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	4906					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						CTTGTCCATTCTGTCCCATCT	0.338													42	126	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82585951	82585951	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82585951C>T	uc003uhx.2	-	5	4607	c.4318G>A	c.(4318-4320)GAA>AAA	p.E1440K	PCLO_uc003uhv.2_Missense_Mutation_p.E1440K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1371					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GGAGAAACTTCATGGGGTTGT	0.378													53	150	---	---	---	---	PASS
CROT	54677	broad.mit.edu	37	7	87027960	87027960	+	Nonstop_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87027960G>C	uc003uit.2	+	18	2084	c.1839G>C	c.(1837-1839)TAG>TAC	p.*613Y	CROT_uc003uiu.2_Nonstop_Mutation_p.*641Y	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	613					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity	p.*613W(1)		ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	CTCATCTTTAGAGATGAATCA	0.398													18	98	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87196188	87196188	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87196188C>G	uc003uiz.1	-	7	861	c.443G>C	c.(442-444)AGA>ACA	p.R148T	ABCB1_uc011khc.1_Intron	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	148	ABC transmembrane type-1 1.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AAACTGTTTTCTAATTTTGTG	0.428													3	192	---	---	---	---	PASS
SLC25A40	55972	broad.mit.edu	37	7	87465676	87465676	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87465676C>G	uc003uje.2	-	12	1256	c.905G>C	c.(904-906)GGC>GCC	p.G302A		NM_018843	NP_061331	Q8TBP6	S2540_HUMAN	mitochondrial carrier family protein	302	Solcar 3.|Helical; Name=6; (Potential).				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding			haematopoietic_and_lymphoid_tissue(1)	1	Esophageal squamous(14;0.00202)					AGGAATTAGGCCTGAGAAAAG	0.269													17	94	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	92027143	92027143	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92027143C>T	uc003ulw.2	+	19	2878	c.2502C>T	c.(2500-2502)GCC>GCT	p.A834A	ANKIB1_uc010lew.1_Silent_p.A103A	NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	834							protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ACACCCCTGCCAGTCGCTCTG	0.542													147	248	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94038908	94038908	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94038908C>T	uc003ung.1	+	18	1395	c.924C>T	c.(922-924)GCC>GCT	p.A308A	COL1A2_uc011kib.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	308					axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TTACTGGTGCCAAGGGTGCTG	0.448										HNSCC(75;0.22)			19	164	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94047028	94047028	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94047028G>C	uc003ung.1	+						COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_5'Flank	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ACATGTGTTTGACTCAAGGGT	0.473										HNSCC(75;0.22)			4	18	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94053638	94053638	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94053638C>A	uc003ung.1	+						COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AGTATTTTTTCTCTATTTAGG	0.468										HNSCC(75;0.22)			75	103	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94173843	94173843	+	Splice_Site	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94173843G>T	uc003uni.3	+	11	1703	c.1476_splice	c.e11+1	p.Q492_splice	CASD1_uc003unj.3_Splice_Site_p.Q492_splice	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor							integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			AGTATGTCAGGTAGGAATGCA	0.328													96	147	---	---	---	---	PASS
BAIAP2L1	55971	broad.mit.edu	37	7	97991745	97991745	+	Splice_Site	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97991745C>G	uc003upj.2	-	2	315	c.52_splice	c.e2-1	p.N18_splice		NM_018842	NP_061330	Q9UHR4	BI2L1_HUMAN	BAI1-associated protein 2-like 1						filopodium assembly|positive regulation of actin cytoskeleton reorganization|positive regulation of actin filament polymerization|response to bacterium|signal transduction	cell junction|cytoskeleton|cytosol|nucleus	actin binding|cytoskeletal adaptor activity|proline-rich region binding|SH3 domain binding			ovary(1)	1	all_cancers(62;4.34e-10)|all_epithelial(64;5e-10)|Esophageal squamous(72;0.00918)|Lung NSC(181;0.0113)|all_lung(186;0.0126)		STAD - Stomach adenocarcinoma(171;0.215)			CCATAACATTCTGCCAAACAA	0.348													5	202	---	---	---	---	PASS
TRRAP	8295	broad.mit.edu	37	7	98519471	98519471	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98519471G>A	uc003upp.2	+	21	2927	c.2718G>A	c.(2716-2718)CTG>CTA	p.L906L	TRRAP_uc011kis.1_Silent_p.L906L|TRRAP_uc003upr.2_Silent_p.L598L	NM_003496	NP_003487	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated	906					histone deubiquitination|histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|PCAF complex|STAGA complex|transcription factor TFTC complex	phosphotransferase activity, alcohol group as acceptor|protein binding|transcription cofactor activity			ovary(9)|large_intestine(8)|central_nervous_system(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(1)|lung(1)|liver(1)	37	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGAAGATGCTGAAGGAGTCGC	0.577													73	199	---	---	---	---	PASS
ZNF498	221785	broad.mit.edu	37	7	99221705	99221705	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99221705C>A	uc003url.1	+	7	1034	c.707C>A	c.(706-708)GCC>GAC	p.A236D	ZNF498_uc003urm.1_Missense_Mutation_p.A72D|ZNF498_uc010lge.1_Missense_Mutation_p.A72D|ZNF498_uc003urn.2_RNA|ZNF498_uc010lgf.1_Intron|ZNF498_uc003uro.1_Missense_Mutation_p.A20D	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25	236					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					AAAGATATGGCCCTGGCCTTC	0.522													152	219	---	---	---	---	PASS
STAG3	10734	broad.mit.edu	37	7	99802726	99802726	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99802726C>A	uc003utx.1	+	28	3205	c.3050C>A	c.(3049-3051)CCC>CAC	p.P1017H	STAG3_uc011kjk.1_Missense_Mutation_p.P959H|GATS_uc003uty.3_Intron|GATS_uc003utz.3_Intron|GATS_uc003uua.3_Intron|GATS_uc010lgt.2_Intron|STAG3_uc003uub.1_Missense_Mutation_p.P241H	NM_012447	NP_036579	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1017					chromosome segregation|synaptonemal complex assembly	chromosome, centromeric region|meiotic cohesin complex|synaptonemal complex	binding			ovary(4)|skin(2)|lung(1)|kidney(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GAGTTTTCCCCCCGACTCTTC	0.552													181	399	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99914690	99914690	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99914690C>T	uc003uug.1	+							NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3												0						TTCTCTCCATCAGTATCTCCT	0.542													30	284	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99914722	99914722	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99914722C>T	uc003uug.1	+	3	399	c.159C>T	c.(157-159)TTC>TTT	p.F53F		NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3	430											0						TAGCGTATTTCAGCCGGGCCG	0.522													43	369	---	---	---	---	PASS
PILRB	29990	broad.mit.edu	37	7	99964979	99964979	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99964979G>T	uc003uuk.2	+	18	3159	c.663G>T	c.(661-663)AGG>AGT	p.R221S	PILRB_uc003uul.2_3'UTR|PILRB_uc003uun.2_Missense_Mutation_p.R221S	NM_013440	NP_038468	Q9UKJ0	PILRB_HUMAN	paired immunoglobulin-like type 2 receptor beta	221	Cytoplasmic (Potential).				activation of transmembrane receptor protein tyrosine kinase activity	integral to plasma membrane	protein binding|receptor activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					caggtagcagggcgccaagca	0.020													28	152	---	---	---	---	PASS
MEPCE	56257	broad.mit.edu	37	7	100029210	100029210	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100029210C>T	uc003uuw.2	+	1	1682	c.1569C>T	c.(1567-1569)TTC>TTT	p.F523F	ZCWPW1_uc003uut.2_5'Flank|ZCWPW1_uc011kjr.1_5'Flank|ZCWPW1_uc011kjt.1_5'Flank|ZCWPW1_uc011kju.1_5'Flank|MEPCE_uc003uuv.2_Silent_p.F54F	NM_019606	NP_062552	Q7L2J0	MEPCE_HUMAN	bin3, bicoid-interacting 3	523	Bin3-type SAM.						methyltransferase activity			upper_aerodigestive_tract(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGAGCTGCTTCCCAGCCTCGC	0.627													26	83	---	---	---	---	PASS
LRCH4	4034	broad.mit.edu	37	7	100173489	100173489	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100173489C>A	uc003uvj.2	-						uc003uvh.2_5'Flank|LRCH4_uc010lgz.2_Intron|LRCH4_uc003uvi.2_Intron|LRCH4_uc011kjw.1_Intron	NM_002319	NP_002310	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH)						nervous system development	PML body	protein binding			large_intestine(1)|ovary(1)	2	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCAGCCCCAACTGACCACAGC	0.652													9	72	---	---	---	---	PASS
FBXO24	26261	broad.mit.edu	37	7	100193186	100193186	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100193186C>G	uc003uvm.1	+						FBXO24_uc003uvl.1_Intron|FBXO24_uc003uvn.1_Intron|uc011kjy.1_Intron|FBXO24_uc011kjz.1_Intron|FBXO24_uc011kka.1_Intron	NM_033506	NP_277041	O75426	FBX24_HUMAN	F-box only protein 24 isoform 1							ubiquitin ligase complex	ubiquitin-protein ligase activity			ovary(3)|skin(1)	4	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CCCTTTCTATCTTGCACGCTA	0.468													40	116	---	---	---	---	PASS
SRRT	51593	broad.mit.edu	37	7	100473227	100473227	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100473227G>A	uc003uwy.2	+	3	284	c.16G>A	c.(16-18)GAC>AAC	p.D6N	SRRT_uc010lhl.1_Missense_Mutation_p.D6N|SRRT_uc003uxa.2_Missense_Mutation_p.D6N|SRRT_uc003uwz.2_Missense_Mutation_p.D6N	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a	6					cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						TGACAGTGATGACGAGTACGA	0.622													36	235	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100853379	100853379	+	Missense_Mutation	SNP	C	G	G	rs140879834	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100853379C>G	uc003uyd.2	-	15	2134	c.1678G>C	c.(1678-1680)GAG>CAG	p.E560Q	PLOD3_uc010lhs.2_Missense_Mutation_p.E125Q	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	560					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	CTCACCTGCTCCACGATTCCT	0.632													3	16	---	---	---	---	PASS
LRRC17	10234	broad.mit.edu	37	7	102584869	102584869	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102584869C>G	uc003vau.2	+	4	1530	c.1141C>G	c.(1141-1143)CCT>GCT	p.P381A	FBXL13_uc010liq.1_Intron|FBXL13_uc003vaq.2_Intron|FBXL13_uc010lir.1_Intron|FBXL13_uc003var.2_Intron|FBXL13_uc003vas.2_Intron|LRRC17_uc003vat.2_3'UTR	NM_001031692	NP_001026862	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17 isoform 1	381	LRRCT 2.				bone marrow development|negative regulation of osteoclast differentiation|ossification	extracellular space				ovary(1)	1						ATGCAAAACGCCTGAAGAATA	0.403													33	272	---	---	---	---	PASS
FBXL13	222235	broad.mit.edu	37	7	102665558	102665558	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102665558C>T	uc003vaq.2	-	6	874	c.447G>A	c.(445-447)GAG>GAA	p.E149E	FBXL13_uc010liq.1_5'UTR|FBXL13_uc010lir.1_Silent_p.E149E|FBXL13_uc003var.2_RNA|FBXL13_uc003vas.2_Silent_p.E149E|FBXL13_uc003vav.2_RNA	NM_145032	NP_659469	Q8NEE6	FXL13_HUMAN	F-box and leucine-rich repeat protein 13 isoform	149											0						ATTTTAGAGTCTCATCTACAA	0.289													39	34	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106513008	106513008	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106513008T>G	uc003vdv.3	+	3	2107	c.2022T>G	c.(2020-2022)GAT>GAG	p.D674E	PIK3CG_uc003vdu.2_Missense_Mutation_p.D674E|PIK3CG_uc003vdw.2_Missense_Mutation_p.D674E	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	674					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						CATACCATGATAGCGCCCTTG	0.393													31	237	---	---	---	---	PASS
C7orf66	154907	broad.mit.edu	37	7	108524212	108524212	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108524212G>T	uc003vfo.2	-	2	248	c.200C>A	c.(199-201)TCA>TAA	p.S67*		NM_001024607	NP_001019778	A4D0T2	CG066_HUMAN	hypothetical protein LOC154907	67						integral to membrane				ovary(2)	2						ATATTGAGCTGAGAATTCCTC	0.423													117	194	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117149087	117149087	+	Splice_Site	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117149087G>T	uc003vjd.2	+	3	297	c.165_splice	c.e3-1	p.R55_splice	CFTR_uc011knq.1_Splice_Site	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	TTCTTTTGCAGAGAATGGGAT	0.348									Cystic_Fibrosis				69	118	---	---	---	---	PASS
GCC1	79571	broad.mit.edu	37	7	127223192	127223192	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127223192C>T	uc003vma.2	-	2	1622	c.1204G>A	c.(1204-1206)GAC>AAC	p.D402N		NM_024523	NP_078799	Q96CN9	GCC1_HUMAN	Golgi coiled-coil protein 1	402	Potential.					Golgi membrane|plasma membrane	protein binding			ovary(2)	2						TTCTCCAGGTCCAGCTGCAGA	0.532													20	127	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129125498	129125498	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129125498G>A	uc011koy.1	+	21	2373	c.2333G>A	c.(2332-2334)CGC>CAC	p.R778H	FAM40B_uc011koz.1_Missense_Mutation_p.R270H	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	778											0						AACAGCCGTCGCTATGACAGA	0.498													39	72	---	---	---	---	PASS
EXOC4	60412	broad.mit.edu	37	7	133580390	133580390	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133580390G>A	uc003vrk.2	+	12	1808	c.1773G>A	c.(1771-1773)CTG>CTA	p.L591L	EXOC4_uc011kpo.1_Silent_p.L490L|EXOC4_uc003vrl.2_Silent_p.L201L|EXOC4_uc011kpp.1_Silent_p.L123L	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a	591					vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				AAGACCTCCTGAACCTGATGC	0.448													10	248	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134873261	134873261	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134873261G>C	uc003vsp.2	-	13	1867	c.1805C>G	c.(1804-1806)GCC>GGC	p.A602G	WDR91_uc010lmq.2_Missense_Mutation_p.A191G|WDR91_uc010lmr.2_Intron	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	602	WD 5.									breast(2)|ovary(1)|skin(1)	4						CCCGTAGTGGGCCCTCCAGCT	0.537													64	261	---	---	---	---	PASS
FAM180A	389558	broad.mit.edu	37	7	135418972	135418972	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135418972G>A	uc003vtd.2	-	3	539	c.273C>T	c.(271-273)ACC>ACT	p.T91T	FAM180A_uc010lmt.2_RNA|FAM180A_uc010lmu.2_Silent_p.T91T	NM_205855	NP_995327	Q6UWF9	F180A_HUMAN	hypothetical protein LOC389558 precursor	91						extracellular region				ovary(2)	2						TGTTGCAGACGGTGCGGAAGT	0.587													8	314	---	---	---	---	PASS
KIAA1549	57670	broad.mit.edu	37	7	138591781	138591781	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138591781G>A	uc011kql.1	-	6	3393	c.3344C>T	c.(3343-3345)GCG>GTG	p.A1115V	KIAA1549_uc003vuk.3_Missense_Mutation_p.A1065V|KIAA1549_uc011kqj.1_Missense_Mutation_p.A1115V	NM_020910	NP_065961	Q9HCM3	K1549_HUMAN	hypothetical protein LOC57670 isoform 1	1115						integral to membrane			KIAA1549/BRAF(229)	central_nervous_system(229)|pancreas(1)	230						GCTTTTAACCGCAAAGATGAT	0.458			O	BRAF	pilocytic astrocytoma								3	37	---	---	---	---	PASS
TRYX3	136541	broad.mit.edu	37	7	141952369	141952369	+	Missense_Mutation	SNP	C	G	G	rs149180097		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141952369C>G	uc003vxb.2	-	4	819	c.499G>C	c.(499-501)GAT>CAT	p.D167H	TRYX3_uc003vxc.3_Missense_Mutation_p.D167H	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	167	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					TTATAGGCATCGCGACACTGA	0.428													29	226	---	---	---	---	PASS
TRYX3	136541	broad.mit.edu	37	7	141955036	141955036	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141955036T>A	uc003vxb.2	-	3	595	c.275A>T	c.(274-276)CAC>CTC	p.H92L	TRYX3_uc003vxc.3_Missense_Mutation_p.H92L	NM_001001317	NP_001001317	Q8IYP2	PRS58_HUMAN	trypsin X3 precursor	92	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity				0	Melanoma(164;0.0272)					GACTGAGAAGTGTGGATGATG	0.423													45	162	---	---	---	---	PASS
PRSS1	5644	broad.mit.edu	37	7	142457345	142457345	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142457345C>T	uc003wak.2	+	1	27	c.10C>T	c.(10-12)CTC>TTC	p.L4F	uc011krr.1_Intron|uc003vzp.2_Intron|uc011ksh.1_Intron|uc011ksi.1_Intron|uc003vzw.1_Intron|uc010loj.1_Intron|uc003wad.2_Intron|uc003wag.1_Intron|TRY6_uc011ksn.1_RNA|PRSS1_uc011ksm.1_Missense_Mutation_p.L4F|PRSS1_uc003wam.2_5'Flank	NM_002769	NP_002760	P07477	TRY1_HUMAN	protease, serine, 1 preproprotein	4				L -> F (in Ref. 7; AAI28227).	digestion|proteolysis	extracellular space	metal ion binding|protein binding|serine-type endopeptidase activity			large_intestine(1)|central_nervous_system(1)	2	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)			CATGAATCCACTCCTGATCCT	0.572									Hereditary_Pancreatitis				24	129	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143096484	143096484	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143096484C>T	uc003wcz.2	-	5	945	c.858G>A	c.(856-858)CGG>CGA	p.R286R		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	286	Extracellular (Potential).|Cys-rich.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				CCATGTCCATCCGGTAGGAGC	0.587													19	56	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146829458	146829458	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146829458G>T	uc003weu.1	+	8	1721	c.1205G>T	c.(1204-1206)AGG>ATG	p.R402M		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	402	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TTCCAGTTTAGGACATGGAAC	0.498										HNSCC(39;0.1)			40	139	---	---	---	---	PASS
C7orf33	202865	broad.mit.edu	37	7	148312503	148312503	+	3'UTR	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148312503A>T	uc003wew.2	+	3						NM_145304	NP_660347	Q8WU49	CG033_HUMAN	hypothetical protein LOC202865											central_nervous_system(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			AGAATTTTGCAGAATCTAAGA	0.378													47	67	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149482321	149482321	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149482321C>T	uc010lpk.2	+						SSPO_uc010lpl.1_Intron	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TTGGTATGCCCAGCTGCCGTG	0.627													15	42	---	---	---	---	PASS
WDR86	349136	broad.mit.edu	37	7	151093209	151093209	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151093209C>A	uc003wkb.2	-	3	828	c.379G>T	c.(379-381)GGG>TGG	p.G127W	WDR86_uc003wka.2_Missense_Mutation_p.G85W|WDR86_uc011kvk.1_Missense_Mutation_p.G127W|WDR86_uc003wkc.2_5'UTR	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	127	WD 3.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GACATCTGCCCCTTGTCCACA	0.662													19	50	---	---	---	---	PASS
WDR86	349136	broad.mit.edu	37	7	151093210	151093210	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151093210C>A	uc003wkb.2	-	3	827	c.378G>T	c.(376-378)AAG>AAT	p.K126N	WDR86_uc003wka.2_Missense_Mutation_p.K84N|WDR86_uc011kvk.1_Missense_Mutation_p.K126N|WDR86_uc003wkc.2_Translation_Start_Site	NM_198285	NP_938026	Q86TI4	WDR86_HUMAN	WD repeat domain 86	126	WD 3.										0			OV - Ovarian serous cystadenocarcinoma(82;0.00419)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACATCTGCCCCTTGTCCACAC	0.657													19	50	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151880070	151880070	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151880070T>A	uc003wla.2	-	35	5473	c.5254A>T	c.(5254-5256)AAA>TAA	p.K1752*	MLL3_uc003wkz.2_Nonsense_Mutation_p.K813*	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1752	Gln-rich.				intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TGTCTAAATTTCCATTCCTGT	0.343			N		medulloblastoma								118	64	---	---	---	---	PASS
NCAPG2	54892	broad.mit.edu	37	7	158464254	158464254	+	Silent	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158464254T>G	uc003wnv.1	-	13	1576	c.1431A>C	c.(1429-1431)GTA>GTC	p.V477V	NCAPG2_uc010lqu.1_Silent_p.V269V|NCAPG2_uc003wnw.1_RNA|NCAPG2_uc003wnx.1_Silent_p.V477V|NCAPG2_uc011kwe.1_Silent_p.V477V	NM_017760	NP_060230	Q86XI2	CNDG2_HUMAN	leucine zipper protein 5	477	HEAT.				cell division|chromosome condensation|mitosis	nucleus	methylated histone residue binding			ovary(1)|breast(1)|kidney(1)	3	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		CCACAAAAGCTACCCTCACTT	0.448													48	163	---	---	---	---	PASS
WDR60	55112	broad.mit.edu	37	7	158672642	158672642	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158672642A>G	uc003woe.3	+	5	999	c.841A>G	c.(841-843)AAA>GAA	p.K281E	WDR60_uc010lqv.2_RNA	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	281										ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TAGAAAAGAGAAATCGGCAAA	0.488													29	57	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	3000184	3000184	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3000184T>A	uc011kwk.1	-	41	6437	c.6047A>T	c.(6046-6048)CAG>CTG	p.Q2016L	CSMD1_uc011kwj.1_Missense_Mutation_p.Q1408L|CSMD1_uc010lrg.2_Missense_Mutation_p.Q84L	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor	2016	Extracellular (Potential).|CUB 12.					integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		ATTCAGAAACTGAATATGTGC	0.368													66	55	---	---	---	---	PASS
SGK223	157285	broad.mit.edu	37	8	8239031	8239031	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8239031C>T	uc003wsh.3	-	1	227	c.227G>A	c.(226-228)AGC>AAC	p.S76N		NM_001080826	NP_001074295	Q86YV5	SG223_HUMAN	pragmin	76							ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GTAAGGTGAGCTGTTCACACC	0.647													26	45	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189354	11189354	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189354C>T	uc003wtp.1	+	1	860	c.739C>T	c.(739-741)CCC>TCC	p.P247S		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	247						integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		CCCCGTGTTGCCCAGTGACCT	0.627													60	62	---	---	---	---	PASS
TNFRSF10A	8797	broad.mit.edu	37	8	23049437	23049437	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23049437C>T	uc003xda.2	-	10	1242	c.1177G>A	c.(1177-1179)GAG>AAG	p.E393K		NM_003844	NP_003835	O00220	TR10A_HUMAN	tumor necrosis factor receptor superfamily,	393	Cytoplasmic (Potential).|Death.				activation of NF-kappaB-inducing kinase activity|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors		caspase activator activity|death receptor activity|TRAIL binding|transcription factor binding			central_nervous_system(3)|ovary(2)|skin(1)	6		Prostate(55;0.0421)|Breast(100;0.14)		Colorectal(74;0.016)|COAD - Colon adenocarcinoma(73;0.0646)		ACATCGATCTCATTTTTCGTG	0.522													51	25	---	---	---	---	PASS
KCNU1	157855	broad.mit.edu	37	8	36703341	36703341	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36703341C>T	uc010lvw.2	+	18	1902	c.1815C>T	c.(1813-1815)GTC>GTT	p.V605V	KCNU1_uc003xjw.2_RNA	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	605	Cytoplasmic (Potential).					voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ACTGTTCAGTCTGTCATGATG	0.438													7	16	---	---	---	---	PASS
BRF2	55290	broad.mit.edu	37	8	37702059	37702059	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37702059C>A	uc003xkk.2	-	4	1319	c.1209G>T	c.(1207-1209)CAG>CAT	p.Q403H		NM_018310	NP_060780	Q9HAW0	BRF2_HUMAN	RNA polymerase III transcription initiation	403					regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter|transcription initiation, DNA-dependent	nucleoplasm	protein binding|zinc ion binding				0		Lung NSC(58;0.118)|all_lung(54;0.195)	BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;1.81e-10)			CCTGGGCTCTCTGAAAGTCCC	0.507													4	157	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38173512	38173512	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38173512C>T	uc003xli.2	-	10	2422	c.1904G>A	c.(1903-1905)CGC>CAC	p.R635H	WHSC1L1_uc011lbm.1_Missense_Mutation_p.R635H|WHSC1L1_uc010lwe.2_Missense_Mutation_p.R635H	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	635					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			AGTTGAGGCGCGACTCCTTTT	0.403			T	NUP98	AML								61	162	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39646253	39646253	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39646253G>A	uc003xnj.2	-	8	652	c.577C>T	c.(577-579)CAT>TAT	p.H193Y	ADAM2_uc003xnk.2_Missense_Mutation_p.H174Y|ADAM2_uc011lck.1_Missense_Mutation_p.H193Y|ADAM2_uc003xnl.2_Intron	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	193	Extracellular (Potential).|Peptidase M12B.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		GACCCCATATGATTATACTGt	0.264													8	106	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48885504	48885504	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48885504G>C	uc003xqk.1	+	14	2111	c.2016G>C	c.(2014-2016)CAG>CAC	p.Q672H	MCM4_uc003xql.1_Missense_Mutation_p.Q672H|MCM4_uc011ldi.1_Missense_Mutation_p.Q659H	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	672					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TGTACTACCAGAGCGAGGAGC	0.552													13	80	---	---	---	---	PASS
SNTG1	54212	broad.mit.edu	37	8	51617317	51617317	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51617317G>A	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				ATACAGGTGAGAGTCTGTGGG	0.488													21	28	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53536426	53536426	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53536426G>A	uc003xre.3	-						RB1CC1_uc003xrf.3_Intron	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1						autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				GTGCCTAAGAGGGAAAGAAAA	0.333													42	82	---	---	---	---	PASS
ATP6V1H	51606	broad.mit.edu	37	8	54669176	54669176	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54669176C>G	uc003xrl.2	-	12	1368	c.1216G>C	c.(1216-1218)GTC>CTC	p.V406L	ATP6V1H_uc003xrk.2_Missense_Mutation_p.V366L|ATP6V1H_uc003xrm.2_Missense_Mutation_p.V406L|ATP6V1H_uc003xrn.2_Missense_Mutation_p.V388L|ATP6V1H_uc011ldv.1_Missense_Mutation_p.V326L|ATP6V1H_uc010lyd.2_Missense_Mutation_p.V342L	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1	406					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			ACAGCTAAGACTTGGGGATCA	0.373													46	55	---	---	---	---	PASS
NSMAF	8439	broad.mit.edu	37	8	59510037	59510037	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59510037T>C	uc003xtt.2	-	21	1915	c.1701A>G	c.(1699-1701)CTA>CTG	p.L567L	NSMAF_uc011lee.1_Silent_p.L598L	NM_003580	NP_003571	Q92636	FAN_HUMAN	neutral sphingomyelinase (N-SMase) activation	567	BEACH.				ceramide metabolic process	cytoplasm|soluble fraction	protein binding|receptor signaling protein activity			ovary(1)	1		all_lung(136;0.174)|Lung NSC(129;0.2)				GTGTCACAAATAGTTGTTTTG	0.428													173	158	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69030878	69030878	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69030878A>T	uc003xxv.1	+	27	3447	c.3420A>T	c.(3418-3420)TCA>TCT	p.S1140S		NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	1140					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						AAATGGACTCAGGTGTGTTCG	0.413													15	116	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71071771	71071771	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71071771G>A	uc003xyn.1	-	10	1255	c.1093C>T	c.(1093-1095)CAA>TAA	p.Q365*		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	365					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			ATTACAAGTTGAGGTTCATTA	0.373			T	RUNXBP2	AML								8	439	---	---	---	---	PASS
TRPA1	8989	broad.mit.edu	37	8	72970052	72970052	+	Splice_Site	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:72970052C>A	uc003xza.2	-	9	1169	c.994_splice	c.e9-1	p.G332_splice		NM_007332	NP_015628	O75762	TRPA1_HUMAN	ankyrin-like protein 1							integral to plasma membrane				ovary(4)|lung(1)|kidney(1)	6			Epithelial(68;0.223)		Menthol(DB00825)	TATCTGCTCCCTAAAAATCAA	0.318													42	85	---	---	---	---	PASS
C8orf84	157869	broad.mit.edu	37	8	73993433	73993433	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73993433A>T	uc003xzf.2	-	2	435	c.230T>A	c.(229-231)GTG>GAG	p.V77E		NM_153225	NP_694957	Q8IVN8	RPESP_HUMAN	RPE-spondin precursor	77	TSP type-1.				immune response	extracellular region	polysaccharide binding|scavenger receptor activity				0						CCATTCCCCCACGAAGCACGG	0.617													55	133	---	---	---	---	PASS
JPH1	56704	broad.mit.edu	37	8	75227697	75227697	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75227697C>A	uc003yae.2	-	2	578	c.538G>T	c.(538-540)GCA>TCA	p.A180S	JPH1_uc003yaf.2_Missense_Mutation_p.A180S|JPH1_uc003yag.1_Missense_Mutation_p.A44S	NM_020647	NP_065698	Q9HDC5	JPH1_HUMAN	junctophilin 1	180	Cytoplasmic (Potential).				calcium ion transport into cytosol|regulation of ryanodine-sensitive calcium-release channel activity	integral to membrane|junctional membrane complex|junctional sarcoplasmic reticulum membrane|plasma membrane				ovary(1)	1	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GCGGCGGCTGCGGCGTCGTGG	0.706													39	32	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77616803	77616803	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77616803C>A	uc003yav.2	+	2	867	c.480C>A	c.(478-480)CTC>CTA	p.L160L	ZFHX4_uc003yat.1_Silent_p.L160L|ZFHX4_uc003yau.1_Silent_p.L160L|ZFHX4_uc003yaw.1_Silent_p.L160L	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	160						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			ATAGCAAACTCTTTTCTACAG	0.478										HNSCC(33;0.089)			8	33	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768487	77768487	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768487C>A	uc003yav.2	+	10	9582	c.9195C>A	c.(9193-9195)CCC>CCA	p.P3065P	ZFHX4_uc003yau.1_Silent_p.P3110P|ZFHX4_uc003yaw.1_Silent_p.P3065P	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3065	Pro-rich.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			TCCTTCTCCCCGGAATGAACG	0.527										HNSCC(33;0.089)			12	56	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77775711	77775711	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77775711C>A	uc003yav.2	+	11	10013	c.9626C>A	c.(9625-9627)CCA>CAA	p.P3209Q		NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3205						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCTGGTGACCCAGCTTCCTTT	0.458										HNSCC(33;0.089)			103	103	---	---	---	---	PASS
CA3	761	broad.mit.edu	37	8	86354385	86354385	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86354385G>C	uc003ydj.2	+	3	399	c.316G>C	c.(316-318)GAG>CAG	p.E106Q	CA3_uc011lfv.1_Intron	NM_005181	NP_005172	P07451	CAH3_HUMAN	carbonic anhydrase III	106					one-carbon metabolic process	cytoplasm	carbonate dehydratase activity|zinc ion binding				0						TCATGGCTCTGAGCACACCGT	0.493													20	118	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89180131	89180131	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89180131C>G	uc003yeb.3	-	4	758	c.476G>C	c.(475-477)TGG>TCG	p.W159S	MMP16_uc003yec.2_Missense_Mutation_p.W159S	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	159	Extracellular (Potential).				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						TACATTCTGCCACACATCAAA	0.378													13	69	---	---	---	---	PASS
OTUD6B	51633	broad.mit.edu	37	8	92092907	92092907	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92092907G>T	uc003yeu.3	+	5	828	c.729G>T	c.(727-729)CAG>CAT	p.Q243H	OTUD6B_uc011lgh.1_Missense_Mutation_p.Q112H	NM_016023	NP_057107	Q8N6M0	OTU6B_HUMAN	OTU domain containing 6B	213	OTU.									ovary(2)|lung(1)	3			BRCA - Breast invasive adenocarcinoma(11;0.0187)			AAGAATTTCAGAAGTACTGTG	0.338													6	23	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105456623	105456623	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105456623C>A	uc003yly.3	-	4	775	c.646G>T	c.(646-648)GGC>TGC	p.G216C		NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	216					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			AGCTCGTGGCCCTCAGGGCCT	0.527													37	62	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106815657	106815657	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106815657C>A	uc003ymd.2	+	8	3370	c.3347C>A	c.(3346-3348)ACC>AAC	p.T1116N	ZFPM2_uc011lhs.1_Missense_Mutation_p.T847N	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	1116					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			CAGGCTCCAACCAGTGGGAAA	0.433													9	33	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110457611	110457611	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110457611C>A	uc003yne.2	+	38	5617	c.5513C>A	c.(5512-5514)CCA>CAA	p.P1838Q		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	1838	Extracellular (Potential).|IPT/TIG 11.				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCTCTATCACCAACTTCTGGA	0.493										HNSCC(38;0.096)			12	39	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113363403	113363403	+	Splice_Site	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113363403C>A	uc003ynu.2	-	40	6484	c.6325_splice	c.e40+1	p.A2109_splice	CSMD3_uc003yns.2_Splice_Site_p.A1311_splice|CSMD3_uc003ynt.2_Splice_Site_p.A2069_splice|CSMD3_uc011lhx.1_Splice_Site_p.A2005_splice	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1							integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTTTAACTTACCTAAACAAAT	0.308										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			21	102	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113519002	113519002	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113519002G>C	uc003ynu.2	-	29	4972	c.4813C>G	c.(4813-4815)CCT>GCT	p.P1605A	CSMD3_uc003yns.2_Missense_Mutation_p.P877A|CSMD3_uc003ynt.2_Missense_Mutation_p.P1565A|CSMD3_uc011lhx.1_Missense_Mutation_p.P1501A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1605	Extracellular (Potential).|CUB 9.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TATGGATGAGGGAAGTTTGGT	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	82	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113519003	113519003	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113519003G>T	uc003ynu.2	-	29	4971	c.4812C>A	c.(4810-4812)TTC>TTA	p.F1604L	CSMD3_uc003yns.2_Missense_Mutation_p.F876L|CSMD3_uc003ynt.2_Missense_Mutation_p.F1564L|CSMD3_uc011lhx.1_Missense_Mutation_p.F1500L	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1604	Extracellular (Potential).|CUB 9.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATGGATGAGGGAAGTTTGGTG	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			18	83	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113564938	113564938	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113564938C>A	uc003ynu.2	-	26	4405	c.4246G>T	c.(4246-4248)GGT>TGT	p.G1416C	CSMD3_uc003yns.2_Missense_Mutation_p.G688C|CSMD3_uc003ynt.2_Missense_Mutation_p.G1376C|CSMD3_uc011lhx.1_Missense_Mutation_p.G1312C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1416	Extracellular (Potential).|CUB 8.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TTAAAACGACCTCCACATTCA	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			33	49	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113871398	113871398	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113871398G>A	uc003ynu.2	-	11	1890	c.1731C>T	c.(1729-1731)GTC>GTT	p.V577V	CSMD3_uc003ynt.2_Silent_p.V537V|CSMD3_uc011lhx.1_Silent_p.V473V	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	577	Extracellular (Potential).|CUB 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTGCTGTGATGACCCAGACAC	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			36	142	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118159212	118159212	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118159212C>A	uc003yoh.2	+	2	321	c.91C>A	c.(91-93)CCG>ACG	p.P31T	SLC30A8_uc010mcz.2_5'UTR|SLC30A8_uc011lia.1_5'UTR|SLC30A8_uc003yog.2_5'UTR	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	31	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CCAACAGAAACCGGTGAATAA	0.517													33	55	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118159213	118159213	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118159213C>A	uc003yoh.2	+	2	322	c.92C>A	c.(91-93)CCG>CAG	p.P31Q	SLC30A8_uc010mcz.2_5'UTR|SLC30A8_uc011lia.1_5'UTR|SLC30A8_uc003yog.2_5'UTR	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	31	Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			CAACAGAAACCGGTGAATAAA	0.522													35	55	---	---	---	---	PASS
C8orf76	84933	broad.mit.edu	37	8	124232363	124232363	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124232363C>A	uc003yqc.1	-	6	1154	c.1123G>T	c.(1123-1125)GAG>TAG	p.E375*		NM_032847	NP_116236	Q96K31	CH076_HUMAN	hypothetical protein LOC84933	375							binding			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			ATTTGTATCTCTGTATGGAAC	0.363													31	116	---	---	---	---	PASS
FBXO32	114907	broad.mit.edu	37	8	124547001	124547001	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124547001T>C	uc003yqr.2	-	2	362	c.170A>G	c.(169-171)TAT>TGT	p.Y57C	FBXO32_uc003yqq.2_5'Flank|FBXO32_uc010mdk.2_Missense_Mutation_p.Y57C	NM_058229	NP_478136	Q969P5	FBX32_HUMAN	F-box only protein 32 isoform 1	57										skin(3)|breast(2)|lung(1)	6	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TGCAACATCATAGTTCAGGCT	0.368													108	97	---	---	---	---	PASS
ANXA13	312	broad.mit.edu	37	8	124748114	124748114	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124748114G>A	uc003yqu.2	-						ANXA13_uc003yqt.2_Nonsense_Mutation_p.Q7*	NM_004306	NP_004297	P27216	ANX13_HUMAN	annexin A13 isoform a						cell differentiation	plasma membrane	calcium ion binding|calcium-dependent phospholipid binding			ovary(1)|pancreas(1)|skin(1)	3	Lung NSC(37;2.06e-11)|Ovarian(258;0.00579)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00288)			GTGTACGACTGGCTCTGAGGA	0.483													19	111	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139190802	139190802	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139190802G>A	uc003yuy.2	-	10	1176	c.1005C>T	c.(1003-1005)CTC>CTT	p.L335L	FAM135B_uc003yux.2_Silent_p.L236L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	335										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTTCCTGGGTGAGATAAGTGG	0.498										HNSCC(54;0.14)			11	61	---	---	---	---	PASS
KCNK9	51305	broad.mit.edu	37	8	140630639	140630639	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140630639G>T	uc003yvf.1	-	2	1051	c.987C>A	c.(985-987)TCC>TCA	p.S329S	KCNK9_uc003yvg.1_Silent_p.S329S|KCNK9_uc003yve.1_RNA	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9	329	Cytoplasmic (Potential).					integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			TGTAAGAGATGGAGTGGAAGT	0.557													37	108	---	---	---	---	PASS
TRAPPC9	83696	broad.mit.edu	37	8	141415750	141415750	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141415750C>T	uc003yvj.2	-	6	1068	c.934G>A	c.(934-936)GGA>AGA	p.G312R	TRAPPC9_uc003yvh.2_Missense_Mutation_p.G410R|TRAPPC9_uc003yvi.1_Missense_Mutation_p.G303R	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform	312					cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						TTAGCACGTCCGATCTCAGTA	0.398													20	79	---	---	---	---	PASS
EIF2C2	27161	broad.mit.edu	37	8	141559241	141559241	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141559241G>C	uc003yvn.2	-	12	1600	c.1560C>G	c.(1558-1560)GTC>GTG	p.V520V	EIF2C2_uc010men.2_Silent_p.V443V|EIF2C2_uc010meo.2_Silent_p.V520V	NM_012154	NP_036286	Q9UKV8	AGO2_HUMAN	argonaute 2 isoform 1	520	Piwi.				mRNA cleavage involved in gene silencing by miRNA|negative regulation of translation involved in gene silencing by miRNA|negative regulation of translational initiation|pre-miRNA processing|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|micro-ribonucleoprotein complex|mRNA cap binding complex|nucleus|polysome|RNA-induced silencing complex	endoribonuclease activity, cleaving siRNA-paired mRNA|metal ion binding|protein binding|RNA 7-methylguanosine cap binding|siRNA binding|translation initiation factor activity				0	all_cancers(97;2.54e-14)|all_epithelial(106;5.99e-13)|Lung NSC(106;1.45e-05)|all_lung(105;2.07e-05)|Ovarian(258;0.0154)|Acute lymphoblastic leukemia(118;0.155)	Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.158)			CGGGCAGGATGACCACCACCA	0.662													9	43	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143559588	143559588	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143559588G>T	uc003ywm.2	+	6	1611	c.1428G>T	c.(1426-1428)TGG>TGT	p.W476C		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	476	Extracellular (Potential).|TSP type-1 4.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GGTCGAGCTGGAGCGCCTGCT	0.677													4	11	---	---	---	---	PASS
ZFP41	286128	broad.mit.edu	37	8	144332175	144332175	+	Silent	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144332175T>G	uc003yxw.2	+	2	520	c.162T>G	c.(160-162)CCT>CCG	p.P54P	ZFP41_uc003yxv.2_RNA	NM_173832	NP_776193	Q8N8Y5	ZFP41_HUMAN	zinc finger protein 41 homolog	54					cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GCCTGAGTCCTGAAGACGAAG	0.547													18	73	---	---	---	---	PASS
TOP1MT	116447	broad.mit.edu	37	8	144413411	144413411	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144413411A>G	uc003yxz.2	-	2	240	c.221T>C	c.(220-222)GTG>GCG	p.V74A	TOP1MT_uc011lkd.1_5'UTR|TOP1MT_uc011lke.1_5'UTR|TOP1MT_uc010mfb.2_5'UTR|TOP1MT_uc010mfd.1_5'UTR	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor	74					DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	GAAGAAACGCACTCCGTCGGG	0.637													23	110	---	---	---	---	PASS
GSDMD	79792	broad.mit.edu	37	8	144641548	144641548	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144641548G>A	uc010mfe.2	+	5	746	c.43G>A	c.(43-45)GAG>AAG	p.E15K	uc003yye.2_5'Flank|GSDMD_uc003yyf.2_Missense_Mutation_p.E63K|GSDMD_uc003yyi.2_Missense_Mutation_p.E15K|GSDMD_uc003yyg.2_Missense_Mutation_p.E15K|GSDMD_uc003yyh.2_Missense_Mutation_p.E15K	NM_024736	NP_079012	P57764	GSDMD_HUMAN	gasdermin D	15											0						AGTGGTCCAGGAGCTGGACCA	0.632													36	51	---	---	---	---	PASS
ZNF250	58500	broad.mit.edu	37	8	146106968	146106968	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146106968C>A	uc003zeq.3	-	6	1732	c.1615G>T	c.(1615-1617)GAG>TAG	p.E539*	COMMD5_uc010mgf.2_Intron|ZNF250_uc003zer.3_Nonsense_Mutation_p.E534*|ZNF250_uc010mgg.2_Nonsense_Mutation_p.E534*	NM_021061	NP_066405	P15622	ZN250_HUMAN	zinc finger protein 250 isoform a	539	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;2.53e-38)|OV - Ovarian serous cystadenocarcinoma(54;4.07e-38)|all cancers(56;2.27e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.0654)		CGCCCACACTCCCCGCACTCA	0.557													5	28	---	---	---	---	PASS
KIAA1432	57589	broad.mit.edu	37	9	5720617	5720617	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5720617G>A	uc003zji.2	+	5	443	c.350G>A	c.(349-351)GGT>GAT	p.G117D	KIAA1432_uc003zjh.2_Missense_Mutation_p.G117D|KIAA1432_uc003zjl.3_Missense_Mutation_p.G117D|KIAA1432_uc003zjj.1_5'UTR	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	196						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCATCAGTAGGTTCATTCCTG	0.343													335	65	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14801851	14801851	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14801851C>G	uc003zlm.2	-	20	4083	c.3493G>C	c.(3493-3495)GAG>CAG	p.E1165Q	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	1165	CSPG 8.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		GAGTCCAGCTCTTTCATCTGA	0.473													27	188	---	---	---	---	PASS
TTC39B	158219	broad.mit.edu	37	9	15177792	15177792	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15177792C>A	uc003zlr.1	-	18	1667	c.1546G>T	c.(1546-1548)GAT>TAT	p.D516Y	TTC39B_uc003zlq.1_Missense_Mutation_p.D485Y|TTC39B_uc011lmp.1_Missense_Mutation_p.D417Y|TTC39B_uc010mie.1_Missense_Mutation_p.D514Y|TTC39B_uc011lmq.1_Missense_Mutation_p.D503Y|TTC39B_uc011lmr.1_Missense_Mutation_p.D447Y|TTC39B_uc003zlp.1_Missense_Mutation_p.D99Y	NM_152574	NP_689787	Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	516							binding			ovary(1)	1						CACTCATCATCCACAGAGAAG	0.303													86	14	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32632175	32632175	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32632175G>C	uc003zrg.1	-	1	3493	c.3403C>G	c.(3403-3405)CAG>GAG	p.Q1135E	uc003zrh.1_5'Flank	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	1135					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding	p.Q1135*(1)		lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		CGTGACAGCTGAGAGCTGGTT	0.468													25	99	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73478022	73478022	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73478022G>A	uc004aid.2	-	3	508	c.264C>T	c.(262-264)TGC>TGT	p.C88C	TRPM3_uc004ahw.2_5'UTR|TRPM3_uc004ahx.2_5'UTR|TRPM3_uc004ahy.2_5'UTR|TRPM3_uc004ahz.2_5'UTR|TRPM3_uc004aia.2_5'UTR|TRPM3_uc004aib.2_5'UTR|TRPM3_uc004aic.2_Silent_p.C88C|TRPM3_uc010mor.2_Silent_p.C88C|TRPM3_uc004aie.2_5'UTR|TRPM3_uc004aif.2_5'UTR|TRPM3_uc004aig.2_5'UTR|TRPM3_uc004aii.2_Silent_p.C90C	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	88	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GACGCCCACAGCAACACCTAT	0.478													21	63	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74810478	74810478	+	Silent	SNP	G	C	C	rs146363148	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74810478G>C	uc004aiq.2	+	2	369	c.186G>C	c.(184-186)CCG>CCC	p.P62P	GDA_uc011lse.1_5'UTR|GDA_uc011lsf.1_5'UTR|GDA_uc004air.2_Silent_p.P62P|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Silent_p.P20P|GDA_uc004ait.1_5'UTR	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	62					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GCTTCAAGCCGTGTGAAATAA	0.363													14	43	---	---	---	---	PASS
C9orf40	55071	broad.mit.edu	37	9	77567353	77567353	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77567353C>T	uc004ajo.3	-	1	450	c.175G>A	c.(175-177)GAC>AAC	p.D59N	uc004ajp.2_5'Flank	NM_017998	NP_060468	Q8IXQ3	CI040_HUMAN	hypothetical protein LOC55071	59											0						GTCCCTGCGTCGATTTTGCGC	0.711													6	26	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79319808	79319808	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79319808C>G	uc010mpk.2	-	8	7506	c.7382G>C	c.(7381-7383)CGT>CCT	p.R2461P	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2461					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						AGGGTCTTCACGAATATGCAG	0.473											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	15	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79465456	79465456	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79465456C>A	uc010mpk.2	-	3	391	c.267G>T	c.(265-267)CGG>CGT	p.R89R	PRUNE2_uc004akn.2_Silent_p.R89R	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	89					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TAATTTCATCCCGGAATATGT	0.418													44	169	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84606478	84606478	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84606478G>T	uc004amn.2	+	4	1140	c.1093G>T	c.(1093-1095)GAC>TAC	p.D365Y		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	365						integral to membrane					0						TCATGCCAAGGACTCTTTTTC	0.498													28	82	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84607348	84607348	+	Missense_Mutation	SNP	C	T	T	rs142037367		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84607348C>T	uc004amn.2	+	4	2010	c.1963C>T	c.(1963-1965)CCC>TCC	p.P655S		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	655						integral to membrane					0						TCCTCCAGCTCCCAATCCTGA	0.468													61	66	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84607883	84607883	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84607883G>C	uc004amn.2	+	4	2545	c.2498G>C	c.(2497-2499)CGT>CCT	p.R833P		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	833						integral to membrane					0						CTGACAGTACGTTTGAGCAAG	0.448													16	77	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90499964	90499964	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90499964A>T	uc004app.3	+	4	597	c.562A>T	c.(562-564)AGC>TGC	p.S188C	C9orf79_uc004apo.1_Intron	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	188	Pro-rich.					integral to membrane				ovary(3)	3						GTCTCCTGCCAGCTTGTCCCC	0.622													29	122	---	---	---	---	PASS
LOC286238	286238	broad.mit.edu	37	9	91262462	91262462	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91262462C>G	uc010mql.1	-	2	314	c.181G>C	c.(181-183)GAG>CAG	p.E61Q		NM_001100111	NP_001093581			hypothetical protein LOC286238												0						GTTATCATCTCTCCTGTTTTG	0.433													27	135	---	---	---	---	PASS
TDRD7	23424	broad.mit.edu	37	9	100232920	100232920	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100232920C>G	uc004axj.2	+	9	1935	c.1710C>G	c.(1708-1710)CTC>CTG	p.L570L	TDRD7_uc011lux.1_Silent_p.L496L|TDRD7_uc010msp.1_Intron|TDRD7_uc011luy.1_5'UTR	NM_014290	NP_055105	Q8NHU6	TDRD7_HUMAN	tudor domain containing 7	570	Tudor 1.				lens fiber cell differentiation|lens morphogenesis in camera-type eye|posttranscriptional regulation of gene expression|spermatogenesis	chromatoid body	mRNA binding			ovary(2)|pancreas(1)	3		Acute lymphoblastic leukemia(62;0.158)				TTTGTTCACTCTCATTTCAAG	0.323													3	91	---	---	---	---	PASS
OR13D1	286365	broad.mit.edu	37	9	107457019	107457019	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107457019C>G	uc011lvs.1	+	1	317	c.317C>G	c.(316-318)ACA>AGA	p.T106R		NM_001004484	NP_001004484	Q8NGV5	O13D1_HUMAN	olfactory receptor, family 13, subfamily D,	106	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						ATCTGTTACACATCCTCATCC	0.428													205	279	---	---	---	---	PASS
ZNF462	58499	broad.mit.edu	37	9	109689124	109689124	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:109689124G>T	uc004bcz.2	+	3	3220	c.2931G>T	c.(2929-2931)CTG>CTT	p.L977L	ZNF462_uc010mto.2_Silent_p.L825L|ZNF462_uc004bda.2_Silent_p.L825L	NM_021224	NP_067047	Q96JM2	ZN462_HUMAN	zinc finger protein 462	977					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5						CCCAGACCCTGAGGGAGATTC	0.498													9	103	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114182345	114182345	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114182345G>C	uc004bfe.1	-	17	2045	c.2045C>G	c.(2044-2046)TCA>TGA	p.S682*	KIAA0368_uc010muc.1_Nonsense_Mutation_p.S504*	NM_001080398	NP_001073867			KIAA0368 protein												0						GATATGATCTGAGGGAAACAC	0.398													25	93	---	---	---	---	PASS
RGS3	5998	broad.mit.edu	37	9	116345834	116345834	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116345834G>C	uc004bhq.2	+	21	2351	c.2142G>C	c.(2140-2142)CAG>CAC	p.Q714H	RGS3_uc004bhs.2_Missense_Mutation_p.Q604H|RGS3_uc004bht.2_Missense_Mutation_p.Q433H|RGS3_uc010muy.2_Intron|RGS3_uc004bhv.2_Missense_Mutation_p.Q35H|RGS3_uc010muz.1_Missense_Mutation_p.Q53H|RGS3_uc004bhw.2_Intron|RGS3_uc011lxh.1_Missense_Mutation_p.Q24H|RGS3_uc004bhx.2_Missense_Mutation_p.Q35H|RGS3_uc004bhy.1_Missense_Mutation_p.Q24H|RGS3_uc004bhz.2_Missense_Mutation_p.Q56H	NM_144488	NP_652759	P49796	RGS3_HUMAN	regulator of G-protein signalling 3 isoform 6	714	Pro-rich.				inactivation of MAPK activity|regulation of G-protein coupled receptor protein signaling pathway	cytosol|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			ovary(1)|lung(1)|skin(1)	3						CTCCTGGCCAGGAGCTTCCTC	0.607													46	66	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119028236	119028236	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119028236G>T	uc004bjn.2	+	8	3214	c.2833G>T	c.(2833-2835)GGG>TGG	p.G945W	PAPPA_uc011lxp.1_Missense_Mutation_p.G640W|PAPPA_uc011lxq.1_Missense_Mutation_p.G320W	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	945					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						CCATGGAAGTGGGTACTGTGG	0.433													21	52	---	---	---	---	PASS
DBC1	1620	broad.mit.edu	37	9	122075479	122075479	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122075479C>A	uc004bkc.2	-	2	611	c.155G>T	c.(154-156)AGG>ATG	p.R52M	DBC1_uc004bkd.2_Missense_Mutation_p.R52M	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor	52					cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						TAGGTAGCTCCTGGAGTGGTG	0.483													21	121	---	---	---	---	PASS
OR1L3	26735	broad.mit.edu	37	9	125437982	125437982	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125437982A>T	uc011lzb.1	+	1	574	c.574A>T	c.(574-576)ACC>TCC	p.T192S		NM_001005234	NP_001005234	Q8NH93	OR1L3_HUMAN	olfactory receptor, family 1, subfamily L,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTGCTCCTCCACCTTTGTCAA	0.438													156	168	---	---	---	---	PASS
PDCL	5082	broad.mit.edu	37	9	125589053	125589053	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125589053T>C	uc004bmz.1	-	2	110	c.14A>G	c.(13-15)GAT>GGT	p.D5G	PDCL_uc004bna.2_Missense_Mutation_p.D5G	NM_005388	NP_005379	Q13371	PHLP_HUMAN	phosducin-like	5					signal transduction|visual perception						0						CAACTTATCATCAAGGGTGGT	0.517													41	149	---	---	---	---	PASS
RC3H2	54542	broad.mit.edu	37	9	125655289	125655289	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125655289G>A	uc010mwc.1	-	3	489	c.248C>T	c.(247-249)TCA>TTA	p.S83L	RC3H2_uc004bnc.2_RNA|RC3H2_uc004bnd.1_Missense_Mutation_p.S83L|RC3H2_uc004bne.3_Missense_Mutation_p.S83L|RC3H2_uc011lzg.1_Missense_Mutation_p.S83L|RC3H2_uc004bng.1_Missense_Mutation_p.S83L	NM_001100588	NP_001094058	Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type zinc finger domains 2	83						cell surface|endomembrane system|membrane|membrane fraction|perinuclear region of cytoplasm	DNA binding|zinc ion binding			ovary(2)|lung(2)	4						TAACTTAATTGACTGATGATC	0.313													16	54	---	---	---	---	PASS
LHX2	9355	broad.mit.edu	37	9	126794808	126794808	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:126794808G>T	uc004boe.1	+	5	1782	c.1043G>T	c.(1042-1044)GGC>GTC	p.G348V	LHX2_uc010mwi.1_Missense_Mutation_p.G356V	NM_004789	NP_004780	P50458	LHX2_HUMAN	LIM homeobox protein 2	348						nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACGCCATCGGGCCCGGCCTCG	0.662													19	74	---	---	---	---	PASS
PPP6C	5537	broad.mit.edu	37	9	127912174	127912174	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:127912174G>A	uc004bpg.3	-	7	917	c.696C>T	c.(694-696)CTC>CTT	p.L232L	PPP6C_uc010mwv.2_Silent_p.L269L|PPP6C_uc010mww.2_Silent_p.L210L|PPP6C_uc011lzr.1_Silent_p.L85L	NM_002721	NP_002712	O00743	PPP6_HUMAN	protein phosphatase 6, catalytic subunit isoform	232					G1/S transition of mitotic cell cycle|protein dephosphorylation	cytosol	metal ion binding|protein binding|protein serine/threonine phosphatase activity			ovary(1)|skin(1)	2						CTCTGCAGATGAGTTTTAAGT	0.353													17	46	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128117939	128117939	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128117939C>T	uc010mwx.2	+	25	4154	c.3828C>T	c.(3826-3828)ACC>ACT	p.T1276T	GAPVD1_uc004bpp.2_Silent_p.T1285T|GAPVD1_uc004bpq.2_Silent_p.T1258T|GAPVD1_uc004bpr.2_Silent_p.T1237T|GAPVD1_uc004bps.2_Silent_p.T1231T|GAPVD1_uc004bpt.2_Silent_p.T291T	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1276					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AGAAACTCACCGCAGCTGACG	0.308													12	49	---	---	---	---	PASS
CCBL1	883	broad.mit.edu	37	9	131597858	131597858	+	Missense_Mutation	SNP	C	T	T	rs139758426	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131597858C>T	uc004bwh.2	-	10	1129	c.944G>A	c.(943-945)CGC>CAC	p.R315H	CCBL1_uc004bwf.2_Missense_Mutation_p.R349H|CCBL1_uc004bwg.2_RNA|CCBL1_uc010myn.2_Missense_Mutation_p.R315H|CCBL1_uc004bwj.2_Missense_Mutation_p.R265H|CCBL1_uc011mbl.1_Missense_Mutation_p.R409H|CCBL1_uc004bwi.2_RNA|CCBL1_uc010myo.2_Missense_Mutation_p.R272H	NM_004059	NP_004050	Q16773	KAT1_HUMAN	kynurenine aminotransferase I isoform a	315					kynurenine metabolic process|L-phenylalanine catabolic process|tryptophan catabolic process	cytosol|nucleus	1-aminocyclopropane-1-carboxylate synthase activity|cysteine-S-conjugate beta-lyase activity|glutamine-phenylpyruvate transaminase activity|kynurenine-oxoglutarate transaminase activity|L-glutamine:pyruvate aminotransferase activity|L-phenylalanine:pyruvate aminotransferase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)	1					L-Glutamine(DB00130)|Pyridoxal Phosphate(DB00114)	GTCACGGCAGCGCTGCATGGC	0.587													31	89	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135161823	135161823	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135161823G>C	uc004cbk.2	-	18	6566	c.6383C>G	c.(6382-6384)TCT>TGT	p.S2128C	SETX_uc004cbj.2_Missense_Mutation_p.S1747C|SETX_uc010mzt.2_Missense_Mutation_p.S1747C	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	2128	Potential.				cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TTTAATTTTAGAAGCAAGTTC	0.294													13	112	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202559	135202559	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202559C>T	uc004cbk.2	-	10	4609	c.4426G>A	c.(4426-4428)GAG>AAG	p.E1476K	SETX_uc004cbj.2_Missense_Mutation_p.E1095K|SETX_uc010mzt.2_Missense_Mutation_p.E1095K	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1476					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GCTGCCATCTCTATATGACGT	0.413													43	151	---	---	---	---	PASS
GTF3C4	9329	broad.mit.edu	37	9	135554533	135554533	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135554533G>C	uc010mzv.2	+	2	1785	c.1527G>C	c.(1525-1527)CAG>CAC	p.Q509H	GTF3C4_uc010mzw.2_RNA	NM_012204	NP_036336	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC 4	509					transcription initiation from RNA polymerase III promoter	transcription factor TFIIIC complex	DNA binding|enzyme activator activity|histone acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		AAAACTACCAGGTCCAATTTG	0.483													36	160	---	---	---	---	PASS
SARDH	1757	broad.mit.edu	37	9	136577802	136577802	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136577802C>G	uc004cep.3	-	10	1401	c.1267G>C	c.(1267-1269)GAG>CAG	p.E423Q	SARDH_uc004ceo.2_Missense_Mutation_p.E423Q|SARDH_uc011mdn.1_Missense_Mutation_p.E423Q|SARDH_uc011mdo.1_Missense_Mutation_p.E255Q	NM_001134707	NP_001128179	Q9UL12	SARDH_HUMAN	sarcosine dehydrogenase precursor	423					glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|sarcosine dehydrogenase activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.21e-07)|Epithelial(140;2.37e-06)|all cancers(34;2.75e-05)		TGGGCCAGCTCCTGCCCACAG	0.637													15	71	---	---	---	---	PASS
QSOX2	169714	broad.mit.edu	37	9	139100962	139100962	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139100962G>A	uc010nbi.2	-	12	1747	c.1709C>T	c.(1708-1710)ACG>ATG	p.T570M		NM_181701	NP_859052	Q6ZRP7	QSOX2_HUMAN	quiescin Q6 sulfhydryl oxidase 2 precursor	570					cell redox homeostasis	extracellular region|integral to membrane|nuclear membrane|plasma membrane	thiol oxidase activity			ovary(1)	1		Myeloproliferative disorder(178;0.0511)		Epithelial(140;7.78e-08)|OV - Ovarian serous cystadenocarcinoma(145;1.55e-07)		TGCGGAATACGTGTCTAAGAG	0.577													25	141	---	---	---	---	PASS
FAM69B	138311	broad.mit.edu	37	9	139616741	139616741	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139616741C>T	uc004cik.2	+	4	565	c.471C>T	c.(469-471)CTC>CTT	p.L157L	FAM69B_uc004cil.2_Silent_p.L70L|SNHG7_uc004cim.2_RNA	NM_152421	NP_689634	Q5VUD6	FA69B_HUMAN	hypothetical protein LOC138311	157	Lumenal (Potential).					endoplasmic reticulum membrane|integral to membrane					0	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		AGATGACCCTCAGCTTCCTCA	0.662													3	31	---	---	---	---	PASS
C9orf86	55684	broad.mit.edu	37	9	139717980	139717980	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139717980A>T	uc004cji.1	+	2	402	c.134A>T	c.(133-135)AAG>ATG	p.K45M	C9orf86_uc004cjm.2_Missense_Mutation_p.K45M|C9orf86_uc004cjh.2_Missense_Mutation_p.K45M|C9orf86_uc004cjj.1_Missense_Mutation_p.K45M|C9orf86_uc004cjk.1_RNA|C9orf86_uc010nbr.1_Missense_Mutation_p.K45M|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_5'Flank	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	45	Small GTPase-like.				small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)		TCCCCAGTGAAGATAGTGATC	0.562													8	44	---	---	---	---	PASS
C9orf86	55684	broad.mit.edu	37	9	139733427	139733427	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139733427C>T	uc004cji.1	+	11	1615	c.1347C>T	c.(1345-1347)GAC>GAT	p.D449D	C9orf86_uc004cjj.1_Silent_p.D450D|C9orf86_uc004cjk.1_Intron|C9orf86_uc010nbr.1_Intron|C9orf86_uc004cjl.1_RNA|C9orf86_uc010nbs.1_Silent_p.D334D|C9orf86_uc004cjn.1_Silent_p.D243D	NM_024718	NP_078994	Q3YEC7	PARF_HUMAN	Rab-like GTP-binding protein 1 isoform 1	449					small GTPase mediated signal transduction	cytoplasm|nucleus	GTP binding|protein binding				0	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.61e-05)|Epithelial(140;0.000183)		ACCTCGAAGACCAGCCACGTG	0.637													4	18	---	---	---	---	PASS
MAMDC4	158056	broad.mit.edu	37	9	139748318	139748318	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139748318G>C	uc004cjs.2	+	5	594	c.544G>C	c.(544-546)GAG>CAG	p.E182Q	MAMDC4_uc011mej.1_5'UTR	NM_206920	NP_996803	Q6UXC1	AEGP_HUMAN	apical early endosomal glycoprotein precursor	182	Extracellular (Potential).|MAM 1.				protein transport	integral to membrane				breast(4)|upper_aerodigestive_tract(2)|central_nervous_system(1)	7	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		TGGCTGGCAGGAGTTGGCAGT	0.657													3	58	---	---	---	---	PASS
PNPLA7	375775	broad.mit.edu	37	9	140361888	140361888	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140361888C>T	uc004cnf.2	-	25	3182	c.2845G>A	c.(2845-2847)GAG>AAG	p.E949K	C9orf167_uc011mew.1_Intron|PNPLA7_uc004cnd.1_Missense_Mutation_p.E215K|PNPLA7_uc004cne.1_Missense_Mutation_p.E215K|PNPLA7_uc011mfa.1_Missense_Mutation_p.E357K|PNPLA7_uc010ncj.1_Missense_Mutation_p.E974K	NM_152286	NP_689499	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	949	Patatin.				lipid metabolic process	endoplasmic reticulum|integral to membrane|lysosomal membrane|microsome|mitochondrial membrane|nuclear membrane	hydrolase activity			skin(1)	1	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		ATGCCGCACTCCGCCAAGGCC	0.652													15	66	---	---	---	---	PASS
LARP4B	23185	broad.mit.edu	37	10	930416	930416	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:930416G>A	uc001ifs.1	-	2	153	c.112C>T	c.(112-114)CAG>TAG	p.Q38*		NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	38							nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						GAACTTGTCTGAGAAGTGGTT	0.328													14	102	---	---	---	---	PASS
GATA3	2625	broad.mit.edu	37	10	8100519	8100519	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:8100519C>A	uc001ika.2	+	3	1050	c.493C>A	c.(493-495)CCA>ACA	p.P165T	GATA3_uc001ijz.2_Missense_Mutation_p.P165T	NM_002051	NP_002042	P23771	GATA3_HUMAN	GATA binding protein 3 isoform 2	165					aortic valve morphogenesis|blood coagulation|canonical Wnt receptor signaling pathway involved in metanephric kidney development|cardiac right ventricle morphogenesis|cell fate determination|cellular response to interferon-alpha|cellular response to interleukin-4|cellular response to tumor necrosis factor|defense response|ear development|lymphocyte migration|male gonad development|mesenchymal to epithelial transition|mesonephros development|negative regulation of cell cycle|negative regulation of cell motility|negative regulation of cell proliferation involved in mesonephros development|negative regulation of endothelial cell apoptosis|negative regulation of fat cell differentiation|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation|negative regulation of inflammatory response|negative regulation of mammary gland epithelial cell proliferation|nephric duct formation|norepinephrine biosynthetic process|pharyngeal system development|phosphatidylinositol 3-kinase cascade|positive regulation of endothelial cell migration|positive regulation of interleukin-13 secretion|positive regulation of interleukin-4 production|positive regulation of interleukin-5 secretion|positive regulation of protein kinase B signaling cascade|positive regulation of T cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription regulatory region DNA binding|positive regulation of ureteric bud formation|regulation of cellular response to X-ray|regulation of cytokine biosynthetic process|regulation of nephron tubule epithelial cell differentiation|response to estrogen stimulus|response to virus|sympathetic nervous system development|T cell receptor signaling pathway|TOR signaling cascade|ureteric bud formation|uterus development|ventricular septum development	nuclear chromatin|nucleolus|nucleoplasm	core promoter proximal region sequence-specific DNA binding|core promoter sequence-specific DNA binding|E-box binding|HMG box domain binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription|transcription coactivator activity|transcription factor binding|zinc ion binding			breast(17)|ovary(3)|central_nervous_system(2)	22						CTCCCCGGACCCATCGCTGTC	0.706			F|N|S		breast		HDR syndrome (HYPOPARATHYROIDISM|SENSORINEURAL DEAFNESS|AND RENAL DISEASE)						83	27	---	---	---	---	PASS
DHTKD1	55526	broad.mit.edu	37	10	12148367	12148367	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12148367G>T	uc001ild.3	+	11	2118	c.2019G>T	c.(2017-2019)CAG>CAT	p.Q673H		NM_018706	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain	673					glycolysis	mitochondrion	oxoglutarate dehydrogenase (succinyl-transferring) activity|thiamine pyrophosphate binding			ovary(1)|central_nervous_system(1)	2		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			ATGGTGCCCAGATCATCTTTG	0.542													8	325	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18816510	18816510	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18816510C>G	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qco.1_Intron|CACNB2_uc001iqa.2_Intron|NSUN6_uc001iqb.2_Intron	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	ACTTTTTCCTCCAACAGGATA	0.408													19	112	---	---	---	---	PASS
KIAA1217	56243	broad.mit.edu	37	10	24813693	24813693	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24813693G>A	uc001iru.3	+	13	3301	c.2898G>A	c.(2896-2898)GAG>GAA	p.E966E	KIAA1217_uc001irs.2_Silent_p.E886E|KIAA1217_uc001irt.3_Silent_p.E931E|KIAA1217_uc010qcy.1_Silent_p.E931E|KIAA1217_uc010qcz.1_Silent_p.E931E|KIAA1217_uc001irv.1_Silent_p.E781E|KIAA1217_uc010qda.1_Intron|KIAA1217_uc001irw.2_Silent_p.E649E|KIAA1217_uc001irz.2_Silent_p.E649E|KIAA1217_uc001irx.2_Silent_p.E649E|KIAA1217_uc001iry.2_Silent_p.E649E	NM_019590	NP_062536	Q5T5P2	SKT_HUMAN	sickle tail isoform 1	966	Potential.				embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						TGTCTATCGAGGTAGAGTCCT	0.448													40	18	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30602839	30602839	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30602839G>A	uc001iva.3	-	9	1511	c.1448C>T	c.(1447-1449)TCT>TTT	p.S483F	MTPAP_uc001ivb.3_Missense_Mutation_p.S613F	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	483	PAP-associated.				cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						TATGTTGAGAGAAGTTTCAAA	0.368													5	239	---	---	---	---	PASS
MTPAP	55149	broad.mit.edu	37	10	30615386	30615386	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30615386G>A	uc001iva.3	-	5	1022	c.959C>T	c.(958-960)TCC>TTC	p.S320F	MTPAP_uc001ivb.3_Missense_Mutation_p.S450F	NM_018109	NP_060579	Q9NVV4	PAPD1_HUMAN	PAP associated domain containing 1 precursor	320					cell death|histone mRNA catabolic process|mRNA polyadenylation|transcription, DNA-dependent	mitochondrion	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|protein homodimerization activity|RNA binding|UTP binding			ovary(1)	1						CTGAAATCCGGAGGCCTGGTG	0.423													37	225	---	---	---	---	PASS
LYZL2	119180	broad.mit.edu	37	10	30918578	30918578	+	Silent	SNP	G	A	A	rs140215273	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30918578G>A	uc001ivk.2	-	1	70	c.57C>T	c.(55-57)TCC>TCT	p.S19S		NM_183058	NP_898881	Q7Z4W2	LYZL2_HUMAN	lysozyme-like 2	Error:Variant_position_missing_in_Q7Z4W2_after_alignment					cell wall macromolecule catabolic process	extracellular region	lysozyme activity				0		Prostate(175;0.151)				TTGAGTCTGCGGAAGAAACAC	0.517													70	30	---	---	---	---	PASS
C10orf68	79741	broad.mit.edu	37	10	33103371	33103371	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:33103371G>C	uc001iwn.3	+	12	1457	c.984G>C	c.(982-984)AAG>AAC	p.K328N	C10orf68_uc001iwl.1_Intron|C10orf68_uc001iwm.1_Missense_Mutation_p.K304N|C10orf68_uc010qei.1_Missense_Mutation_p.K276N|C10orf68_uc001iwo.3_RNA	NM_024688	NP_078964	Q9H943	CJ068_HUMAN	chromosome 10 open reading frame 68	328										skin(2)|ovary(1)	3						CACGATCAAAGAGTCTCCCTG	0.343													33	233	---	---	---	---	PASS
CSGALNACT2	55454	broad.mit.edu	37	10	43650712	43650712	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43650712G>C	uc001jan.2	+	2	450	c.115G>C	c.(115-117)GAT>CAT	p.D39H	CSGALNACT2_uc001jam.1_Missense_Mutation_p.D39H	NM_018590	NP_061060	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate	39	Lumenal (Potential).				chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Golgi cisterna membrane|integral to Golgi membrane	glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding			ovary(1)	1						CCCCCAGACTGATGGAAATGC	0.468													21	160	---	---	---	---	PASS
RASGEF1A	221002	broad.mit.edu	37	10	43694588	43694588	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43694588G>A	uc001jap.1	-	8	985	c.904C>T	c.(904-906)CGG>TGG	p.R302W	RASGEF1A_uc001jao.1_Missense_Mutation_p.R310W	NM_145313	NP_660356	Q8N9B8	RGF1A_HUMAN	RasGEF domain family, member 1A	302	Ras-GEF.				cell migration|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	Ras guanyl-nucleotide exchange factor activity				0						AAGCACTCCCGGGCCACATCA	0.617													42	10	---	---	---	---	PASS
BICC1	80114	broad.mit.edu	37	10	60566341	60566341	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:60566341C>T	uc001jki.1	+						BICC1_uc001jkj.1_Intron	NM_001080512	NP_001073981	Q9H694	BICC1_HUMAN	bicaudal C homolog 1						multicellular organismal development		RNA binding			ovary(2)|lung(1)|skin(1)	4						GTTTCATTTTCAGGCATTTGA	0.343													55	146	---	---	---	---	PASS
FAM13C	220965	broad.mit.edu	37	10	61112201	61112201	+	Silent	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:61112201T>A	uc001jkn.2	-	4	287	c.153A>T	c.(151-153)GCA>GCT	p.A51A	FAM13C_uc001jko.2_Silent_p.A51A|FAM13C_uc010qid.1_5'UTR|FAM13C_uc010qie.1_5'UTR|FAM13C_uc010qif.1_Silent_p.A73A|FAM13C_uc001jkp.2_5'UTR	NM_198215	NP_937858	Q8NE31	FA13C_HUMAN	hypothetical protein LOC220965 isoform 1	51										ovary(2)	2						CCAGAGCCCCTGCGTCGGGGT	0.502													4	26	---	---	---	---	PASS
ANK3	288	broad.mit.edu	37	10	62023652	62023652	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62023652C>T	uc001jky.2	-	6	832	c.640G>A	c.(640-642)GAC>AAC	p.D214N	ANK3_uc010qih.1_Missense_Mutation_p.D197N|ANK3_uc001jkz.3_Missense_Mutation_p.D208N|ANK3_uc001jlb.1_5'UTR	NM_020987	NP_066267	Q12955	ANK3_HUMAN	ankyrin 3 isoform 1	214	ANK 5.				establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						GCTTTCGTGTCGTCTTTTCGG	0.547													17	47	---	---	---	---	PASS
ARID5B	84159	broad.mit.edu	37	10	63759929	63759929	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63759929C>G	uc001jlt.1	+	4	608	c.582C>G	c.(580-582)ATC>ATG	p.I194M	ARID5B_uc010qil.1_Missense_Mutation_p.I194M	NM_032199	NP_115575	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	194					liver development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|transcription, DNA-dependent		protein binding|transcription regulatory region DNA binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4	Prostate(12;0.016)|all_hematologic(501;0.215)					TGAAACGCATCCAGGATAAGC	0.537													21	50	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68040264	68040264	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68040264T>C	uc009xpn.1	-	13	1971	c.1848A>G	c.(1846-1848)ACA>ACG	p.T616T	CTNNA3_uc001jmw.2_Silent_p.T616T	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	616					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity	p.T616P(1)		skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						TATCATGAATTGTATCATAGA	0.368													30	76	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68686899	68686899	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68686899A>C	uc001jmz.1	+	2	775	c.225A>C	c.(223-225)AAA>AAC	p.K75N	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Missense_Mutation_p.K75N	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	75	Extracellular (Potential).|LRR 1.					integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GCCTTCAAAAACTTAAGTATA	0.373													38	110	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72614558	72614558	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72614558C>T	uc001jrm.2	+	5	577	c.355C>T	c.(355-357)CAG>TAG	p.Q119*		NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	119	Cytoplasmic (Potential).				apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	TTTACCCTCCCAGGGTCTGAG	0.413													70	172	---	---	---	---	PASS
UNC5B	219699	broad.mit.edu	37	10	73053268	73053268	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73053268G>A	uc001jro.2	+	12	2324	c.1879G>A	c.(1879-1881)GAA>AAA	p.E627K	UNC5B_uc001jrp.2_Missense_Mutation_p.E616K	NM_170744	NP_734465	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B precursor	627	Cytoplasmic (Potential).|ZU5.				apoptosis|axon guidance|regulation of apoptosis	integral to membrane				ovary(2)|lung(1)	3						CCACTGTGCCGAAGTCAGTGC	0.637													41	98	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73544071	73544071	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73544071G>A	uc001jrx.3	+	40	5773	c.5396G>A	c.(5395-5397)GGG>GAG	p.G1799E		NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1799	Cadherin 17.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CCTGTGGAGGGGGTGCTAAGG	0.622													22	43	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78880778	78880778	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78880778C>T	uc001jxn.2	-	6	1014	c.837G>A	c.(835-837)CTG>CTA	p.L279L	KCNMA1_uc001jxj.2_Silent_p.L279L|KCNMA1_uc001jxk.1_5'UTR|KCNMA1_uc009xrt.1_Silent_p.L99L|KCNMA1_uc001jxo.2_Silent_p.L279L|KCNMA1_uc001jxm.2_Silent_p.L279L|KCNMA1_uc001jxq.2_Silent_p.L279L	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	279	Helical; Name=Segment S4; (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	AAAACTGTATCAGTCTCAGAG	0.328													11	46	---	---	---	---	PASS
HECTD2	143279	broad.mit.edu	37	10	93252127	93252127	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93252127G>T	uc001khl.2	+	13	1418	c.1318G>T	c.(1318-1320)GAT>TAT	p.D440Y	LOC100188947_uc010qnl.1_Intron|HECTD2_uc010qnm.1_Missense_Mutation_p.D444Y|HECTD2_uc001khm.2_RNA|HECTD2_uc009xty.1_Missense_Mutation_p.D29Y|HECTD2_uc001khn.1_Missense_Mutation_p.D90Y	NM_182765	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing 2 isoform a	440	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	intracellular	ubiquitin-protein ligase activity			skin(1)	1						GAAAAGAGCCGATTTGAAAAA	0.343													41	78	---	---	---	---	PASS
C10orf12	26148	broad.mit.edu	37	10	98744488	98744488	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98744488A>T	uc001kmv.2	+	1	3448	c.3341A>T	c.(3340-3342)CAT>CTT	p.H1114L		NM_015652	NP_056467	Q8N655	CJ012_HUMAN	hypothetical protein LOC26148	1114										skin(2)	2		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		AAAGAAAAGCATGCTGATGGA	0.507													16	44	---	---	---	---	PASS
SLIT1	6585	broad.mit.edu	37	10	98778804	98778804	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98778804T>C	uc001kmw.2	-	27	3059	c.2807A>G	c.(2806-2808)AAC>AGC	p.N936S		NM_003061	NP_003052	O75093	SLIT1_HUMAN	slit homolog 1 precursor	936	EGF-like 1.				axon extension involved in axon guidance|forebrain morphogenesis|motor axon guidance|negative chemotaxis|negative regulation of synaptogenesis	cytoplasm|extracellular space	calcium ion binding|Roundabout binding			ovary(4)	4		Colorectal(252;0.162)		Epithelial(162;2.02e-08)|all cancers(201;1.5e-06)		GGTGCCCTGGTTCTGGCACGG	0.433													5	18	---	---	---	---	PASS
HPSE2	60495	broad.mit.edu	37	10	100503730	100503730	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100503730G>A	uc001kpn.1	-	4	754	c.694C>T	c.(694-696)CCC>TCC	p.P232S	HPSE2_uc009xwc.1_Missense_Mutation_p.P222S|HPSE2_uc001kpo.1_Intron|HPSE2_uc009xwd.1_Intron	NM_021828	NP_068600	Q8WWQ2	HPSE2_HUMAN	heparanase 2	232					carbohydrate metabolic process	intracellular|membrane	cation binding|heparanase activity			ovary(1)	1				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		GAGTTATTGGGATTACGACGC	0.448													29	98	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101578643	101578643	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101578643G>T	uc001kqf.2	+	18	2507	c.2368G>T	c.(2368-2370)GCA>TCA	p.A790S		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	790	Cytoplasmic (By similarity).|ABC transporter 1.					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CCCCCTGTCTGCAGTGGATGC	0.443													25	41	---	---	---	---	PASS
CPN1	1369	broad.mit.edu	37	10	101835789	101835789	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101835789G>A	uc001kql.2	-	2	559	c.299C>T	c.(298-300)TCG>TTG	p.S100L		NM_001308	NP_001299	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1 precursor	100	Catalytic.				proteolysis	extracellular space	metallocarboxypeptidase activity|zinc ion binding			central_nervous_system(3)|pancreas(1)	4		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CAGAAACTCCGACAGCTGCAG	0.587													24	68	---	---	---	---	PASS
CHUK	1147	broad.mit.edu	37	10	101964284	101964284	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101964284C>A	uc001kqp.2	-	13	1541	c.1486G>T	c.(1486-1488)GAG>TAG	p.E496*		NM_001278	NP_001269	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	496					I-kappaB phosphorylation|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|nucleus	ATP binding|identical protein binding|IkappaB kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|breast(1)	7		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)		GTCATCTGCTCGCTGTATCTC	0.383													39	101	---	---	---	---	PASS
FGF8	2253	broad.mit.edu	37	10	103531278	103531278	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103531278C>T	uc001ktp.1	-	5	523	c.353G>A	c.(352-354)CGA>CAA	p.R118Q	FGF8_uc001ktq.1_Missense_Mutation_p.R129Q|FGF8_uc001ktr.1_Missense_Mutation_p.R100Q|FGF8_uc001kts.1_Missense_Mutation_p.R89Q|FGF8_uc009xwr.1_Missense_Mutation_p.R25Q	NM_033164	NP_149354	P55075	FGF8_HUMAN	fibroblast growth factor 8 isoform E precursor	118					bone development|dopaminergic neuron differentiation|fibroblast growth factor receptor signaling pathway|gastrulation|gonad development|insulin receptor signaling pathway|mesonephros development|metanephros development|negative regulation of cardiac muscle tissue development|neuroepithelial cell differentiation|odontogenesis|positive regulation of cell division|positive regulation of cell proliferation	extracellular region|extracellular space	growth factor activity|growth factor activity|type 1 fibroblast growth factor receptor binding|type 2 fibroblast growth factor receptor binding				0		Colorectal(252;0.122)		Epithelial(162;3.94e-09)|all cancers(201;2.13e-07)		CTCGGCTCCTCGGACTCGAAC	0.602													20	48	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103550821	103550821	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103550821G>A	uc001ktv.2	-	14	2729	c.2286C>T	c.(2284-2286)CTC>CTT	p.L762L	MGEA5_uc001ktu.2_RNA|MGEA5_uc010qqe.1_Silent_p.L709L|MGEA5_uc009xws.2_Silent_p.L695L	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	762	Histone acetyltransferase activity (By similarity).|Required for histone H4 binding (By similarity).				glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		AATCCAGGCTGAGGGAAAGCA	0.418													27	61	---	---	---	---	PASS
GBF1	8729	broad.mit.edu	37	10	104140380	104140380	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104140380G>A	uc001kux.1	+	38	5347	c.5107G>A	c.(5107-5109)GAA>AAA	p.E1703K	GBF1_uc001kuy.1_Missense_Mutation_p.E1699K|GBF1_uc001kuz.1_Missense_Mutation_p.E1700K	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine	1703					COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GATCACCTGGGAACGCATTGA	0.552													11	542	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107005329	107005329	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107005329C>A	uc001kyi.1	+	21	3125	c.2898C>A	c.(2896-2898)TCC>TCA	p.S966S	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	966	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GCAGCATTTCCTTCACATTCC	0.453													44	117	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107006977	107006977	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107006977A>G	uc001kyi.1	+	22	3220	c.2993A>G	c.(2992-2994)GAA>GGA	p.E998G	SORCS3_uc010qqz.1_RNA	NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	998	Lumenal (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		CTCCCTGCAGAATATTTCCAG	0.453													10	36	---	---	---	---	PASS
NRAP	4892	broad.mit.edu	37	10	115374675	115374675	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115374675G>A	uc001laj.2	-	28	3273	c.3109C>T	c.(3109-3111)CGA>TGA	p.R1037*	NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Nonsense_Mutation_p.R1002*|NRAP_uc001lal.3_Nonsense_Mutation_p.R1037*	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S	1037	Nebulin 26.					fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		CCACCATCTCGAAGTTTGCTC	0.468													24	72	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117075194	117075194	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117075194C>A	uc001lcg.2	+	18	3371	c.2985C>A	c.(2983-2985)ACC>ACA	p.T995T	ATRNL1_uc010qsm.1_Silent_p.T170T|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	995	PSI 5.|Extracellular (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TTCTTGACACCAATCTTTGCC	0.408													31	83	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118318783	118318783	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118318783A>T	uc001lcm.2	+	10	1091	c.1048A>T	c.(1048-1050)AGT>TGT	p.S350C		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	350					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	TGGTGATGCCAGTAATTTTGC	0.363													22	55	---	---	---	---	PASS
PRLHR	2834	broad.mit.edu	37	10	120353838	120353838	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120353838C>G	uc001ldp.1	-	2	1058	c.919G>C	c.(919-921)GCC>CCC	p.A307P		NM_004248	NP_004239	P49683	PRLHR_HUMAN	G protein-coupled receptor 10	307	Extracellular (Potential).				female pregnancy	integral to plasma membrane	neuropeptide Y receptor activity				0		Colorectal(252;0.0429)|Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0166)		GGGTCGATGGCGTGGGGGTCG	0.647													16	46	---	---	---	---	PASS
WDR11	55717	broad.mit.edu	37	10	122618251	122618251	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122618251G>C	uc010qtf.1	+	3	533	c.295G>C	c.(295-297)GAT>CAT	p.D99H	WDR11_uc010qte.1_Intron|WDR11_uc001lfd.1_5'UTR	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	99	WD 1.					integral to membrane					0						CATCGTCTGGGATGTAGCAGC	0.463													11	42	---	---	---	---	PASS
WDR11	55717	broad.mit.edu	37	10	122664830	122664830	+	Splice_Site	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122664830G>A	uc010qtf.1	+	26	3432	c.3194_splice	c.e26-1	p.E1065_splice	WDR11_uc010qte.1_Splice_Site_p.E667_splice|WDR11_uc001lfd.1_Splice_Site_p.E583_splice|WDR11_uc009xzn.2_Splice_Site_p.E356_splice|uc001lfe.1_5'Flank	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2							integral to membrane					0						TTGTCTTTCAGAGGGCGTTCA	0.502													36	75	---	---	---	---	PASS
ZRANB1	54764	broad.mit.edu	37	10	126660603	126660603	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:126660603G>A	uc001lic.2	+	3	1443	c.1072G>A	c.(1072-1074)GAG>AAG	p.E358K	ZRANB1_uc010qug.1_Missense_Mutation_p.E384K	NM_017580	NP_060050	Q9UGI0	ZRAN1_HUMAN	zinc finger, RAN-binding domain containing 1	358					positive regulation of Wnt receptor signaling pathway|protein K63-linked deubiquitination|Wnt receptor signaling pathway	aggresome|centrosome|intermediate filament cytoskeleton|nucleolus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity|zinc ion binding			ovary(1)|kidney(1)	2		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.113)|COAD - Colon adenocarcinoma(40;0.119)		AATCCGGAGAGAGATAGCTGC	0.418													44	109	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129911827	129911827	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129911827G>A	uc001lke.2	-	8	1715	c.1520C>T	c.(1519-1521)TCC>TTC	p.S507F	MKI67_uc001lkf.2_Missense_Mutation_p.S147F|MKI67_uc009yav.1_Missense_Mutation_p.S82F|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	507					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				CCCACCAAAGGACACACGCCT	0.418													37	91	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134006222	134006222	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134006222G>T	uc009ybb.2	+	3	343	c.189G>T	c.(187-189)CTG>CTT	p.L63L		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	63					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		CCCACGGCCTGATGGTCCTTC	0.587													37	49	---	---	---	---	PASS
KNDC1	85442	broad.mit.edu	37	10	134996995	134996995	+	Splice_Site	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134996995G>A	uc001llz.1	+	4	508	c.507_splice	c.e4+1	p.E169_splice	KNDC1_uc001lma.1_Splice_Site_p.E104_splice	NM_152643	NP_689856	Q76NI1	VKIND_HUMAN	kinase non-catalytic C-lobe domain (KIND)						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction					upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(35;4.16e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00145)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.173)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.77e-06)|Epithelial(32;1.13e-05)|all cancers(32;1.51e-05)		GGACCTTGAGGTAAGCGAGGC	0.701													8	10	---	---	---	---	PASS
ANO9	338440	broad.mit.edu	37	11	428392	428392	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:428392G>A	uc001lpi.2	-	14	1273	c.1188C>T	c.(1186-1188)ATC>ATT	p.I396I	ANO9_uc001lph.2_Silent_p.I89I|ANO9_uc010qvv.1_Silent_p.I252I	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5	396	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						CGCACCTGTTGATCTGCGGAG	0.672													15	37	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1214005	1214005	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1214005C>A	uc009ycr.1	+						uc001lsz.2_Intron	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTTCCTCTTACAGGATCCACC	0.532													3	58	---	---	---	---	PASS
OR52N2	390077	broad.mit.edu	37	11	5842405	5842405	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5842405C>A	uc010qzp.1	+	1	840	c.840C>A	c.(838-840)GCC>GCA	p.A280A	TRIM5_uc001mbq.1_Intron	NM_001005174	NP_001005174	Q8NGI0	O52N2_HUMAN	olfactory receptor, family 52, subfamily N,	280	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.49e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCATCGTGGCCAACCTTTATC	0.398													82	42	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862858	5862858	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862858A>G	uc010qzq.1	-	1	270	c.270T>C	c.(268-270)AAT>AAC	p.N90N	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTTCCTTGATATTGAACCAGA	0.473													81	74	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7067933	7067933	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7067933C>A	uc001mfb.1	+	5	2316	c.1993C>A	c.(1993-1995)CTC>ATC	p.L665I		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	665					cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		TTGGCAAGATCTCTGTTCTGT	0.378													55	153	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7081298	7081298	+	Intron	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7081298A>T	uc001mfb.1	+							NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14						cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		GACTTGGAGTAGGTTTTCTGT	0.428													52	164	---	---	---	---	PASS
RBMXL2	27288	broad.mit.edu	37	11	7111393	7111393	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7111393C>A	uc001mfc.2	+	1	1229	c.1042C>A	c.(1042-1044)CGT>AGT	p.R348S		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	348	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CAGACCAGATCGTGGGCTCTC	0.672													12	20	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9167307	9167307	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9167307G>A	uc001mhl.2	-	17	3168	c.2913C>T	c.(2911-2913)TTC>TTT	p.F971F	DENND5A_uc001mhk.2_Silent_p.F314F|DENND5A_uc010rbw.1_Silent_p.F971F|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	971	PLAT.									liver(1)	1						GGTTGGCAGTGAACATGGAGC	0.468													38	370	---	---	---	---	PASS
SBF2	81846	broad.mit.edu	37	11	10052684	10052684	+	Missense_Mutation	SNP	T	C	C	rs139730490		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10052684T>C	uc001mib.2	-	4	451	c.313A>G	c.(313-315)AAA>GAA	p.K105E	SBF2_uc001mif.3_5'UTR|SBF2_uc001mij.2_RNA	NM_030962	NP_112224	Q86WG5	MTMRD_HUMAN	SET binding factor 2	105					myelination	cytoplasm|membrane	phosphatase activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		CCAGACACTTTTGCTTCACCT	0.378													126	74	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17482030	17482030	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17482030C>A	uc001mnc.2	-						ABCC8_uc010rcy.1_Intron	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8						carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CCTGGGGCTGCCTACCTTGGG	0.592													54	80	---	---	---	---	PASS
SLC6A5	9152	broad.mit.edu	37	11	20676280	20676280	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20676280C>T	uc001mqd.2	+	16	2533	c.2260C>T	c.(2260-2262)CCA>TCA	p.P754S	SLC6A5_uc009yic.2_Missense_Mutation_p.P519S	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter	754	Cytoplasmic (Potential).				synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	GGTGTGCTCGCCACAGCCGGA	0.562													67	57	---	---	---	---	PASS
NELL1	4745	broad.mit.edu	37	11	21556041	21556041	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21556041G>C	uc001mqe.2	+	16	1920	c.1767G>C	c.(1765-1767)CTG>CTC	p.L589L	NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Silent_p.L617L|NELL1_uc010rdo.1_Silent_p.L532L|NELL1_uc010rdp.1_Intron|NELL1_uc001mqh.2_Missense_Mutation_p.C199S	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor	589	EGF-like 5; calcium-binding (Potential).				cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						CCTATTCACTGTCCGGGGAGT	0.542													35	37	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26663549	26663549	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26663549G>T	uc001mqt.3	+	22	2393	c.2248G>T	c.(2248-2250)GGA>TGA	p.G750*	ANO3_uc010rdr.1_Nonsense_Mutation_p.G734*|ANO3_uc010rds.1_Nonsense_Mutation_p.G589*|ANO3_uc010rdt.1_Nonsense_Mutation_p.G604*	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	750	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAACCTTCATGGACTGATGGA	0.418													71	32	---	---	---	---	PASS
SLC5A12	159963	broad.mit.edu	37	11	26743234	26743234	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26743234C>T	uc001mra.2	-	1	341	c.28G>A	c.(28-30)GAT>AAT	p.D10N	SLC5A12_uc001mrb.2_Intron|SLC5A12_uc001mrc.3_Missense_Mutation_p.D10N	NM_178498	NP_848593	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/glucose	10	Helical; (Potential).				sodium ion transport	apical plasma membrane|integral to membrane	symporter activity			ovary(1)|skin(1)	2						ACAACATAATCCCAAACTGCA	0.418													27	104	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32674691	32674691	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32674691T>A	uc001mtv.2	-	12	961	c.917A>T	c.(916-918)AAG>ATG	p.K306M	CCDC73_uc001mtw.1_Missense_Mutation_p.K296M	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	306	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTTTAGCACCTTCAATTCTGC	0.264													50	39	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33566887	33566887	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33566887G>T	uc001mup.3	+	2	2599	c.2475G>T	c.(2473-2475)CTG>CTT	p.L825L	C11orf41_uc001mun.1_Silent_p.L825L	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	819						integral to membrane				ovary(2)	2						CATCCAACCTGGAGTGTCAGA	0.527													12	9	---	---	---	---	PASS
TRIM44	54765	broad.mit.edu	37	11	35747495	35747495	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:35747495G>A	uc001mwi.2	+	3	1078	c.771G>A	c.(769-771)ATG>ATA	p.M257I		NM_017583	NP_060053	Q96DX7	TRI44_HUMAN	DIPB protein	257						intracellular	protein binding|zinc ion binding			skin(1)	1	all_lung(20;0.0317)|Lung NSC(22;0.0661)|all_epithelial(35;0.115)	all_hematologic(20;0.107)				AAATGAAGATGTTTATACAGC	0.403													37	31	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136617	40136617	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136617C>T	uc001mxa.1	-	2	3190	c.1226G>A	c.(1225-1227)GGT>GAT	p.G409D	LRRC4C_uc001mxc.1_Missense_Mutation_p.G405D|LRRC4C_uc001mxd.1_Missense_Mutation_p.G405D|LRRC4C_uc001mxb.1_Missense_Mutation_p.G405D	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	409	Ig-like C2-type.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				ATTTAACGTACCATCACTGAG	0.458													53	157	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136954	40136954	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136954G>T	uc001mxa.1	-	2	2853	c.889C>A	c.(889-891)CAT>AAT	p.H297N	LRRC4C_uc001mxc.1_Missense_Mutation_p.H293N|LRRC4C_uc001mxd.1_Missense_Mutation_p.H293N|LRRC4C_uc001mxb.1_Missense_Mutation_p.H293N	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	297					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TGATGTAAATGTATCCGCTCT	0.478													70	70	---	---	---	---	PASS
RAPSN	5913	broad.mit.edu	37	11	47463291	47463291	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47463291G>C	uc001nfi.1	-						RAPSN_uc001nfj.1_Intron|RAPSN_uc009yls.1_Intron	NM_005055	NP_005046	Q13702	RAPSN_HUMAN	43 kD receptor-associated protein of the synapse						synaptic transmission, cholinergic	cell junction|cytoskeleton|postsynaptic membrane	acetylcholine receptor binding|zinc ion binding			ovary(1)	1						GCTGTCTGCAGAGCCAGGTGG	0.672													4	31	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55432923	55432923	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55432923G>T	uc001nht.3	+	3	546	c.281G>T	c.(280-282)GGC>GTC	p.G94V	OR4C6_uc010rik.1_Missense_Mutation_p.G94V	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						TCTCTCAAAGGCTGCCTCACC	0.522													60	53	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433293	55433293	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433293G>T	uc001nht.3	+	3	916	c.651G>T	c.(649-651)ACG>ACT	p.T217T	OR4C6_uc010rik.1_Silent_p.T217T	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	217	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						CGTCCTACACGGTCATCCTAT	0.522													34	88	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55606570	55606570	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55606570A>T	uc010rio.1	+	1	343	c.343A>T	c.(343-345)ATT>TTT	p.I115F		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	115	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				GACTGAATTAATTCTATTTGC	0.438													62	144	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735665	55735665	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735665A>G	uc010rit.1	-	1	275	c.275T>C	c.(274-276)ATG>ACG	p.M92T		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	92	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					AAAAAAACACATTTGTGTAGC	0.403													85	71	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	55999618	55999618	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55999618C>A	uc010rjc.1	-	1	1044	c.1044G>T	c.(1042-1044)CAG>CAT	p.Q348H		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	348	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					TATTGATAACCTGATTTTTCC	0.299													48	27	---	---	---	---	PASS
P2RX3	5024	broad.mit.edu	37	11	57117248	57117248	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57117248A>T	uc001nju.2	+	7	657	c.581A>T	c.(580-582)AAC>ATC	p.N194I		NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3	194	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						CTCCTTCCCAACCTGACAGCC	0.617											OREG0020966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	20	18	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58979633	58979633	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58979633C>T	uc001nnu.3	-	1	862	c.706G>A	c.(706-708)GTG>ATG	p.V236M		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	236	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				GAGGCGGTCACGGCACTACGA	0.542													13	55	---	---	---	---	PASS
MPEG1	219972	broad.mit.edu	37	11	58980144	58980144	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58980144C>G	uc001nnu.3	-	1	351	c.195G>C	c.(193-195)TTG>TTC	p.L65F		NM_001039396	NP_001034485	Q2M385	MPEG1_HUMAN	macrophage expressed gene 1 precursor	65	MACPF.|Extracellular (Potential).					integral to membrane				ovary(1)|skin(1)	2		all_epithelial(135;0.125)				TGGAGTAAGTCAATTCCATAA	0.478													125	76	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62286541	62286541	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62286541T>C	uc001ntl.2	-	5	15648	c.15348A>G	c.(15346-15348)GAA>GAG	p.E5116E	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	5116					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				GTGCCTGGAGTTCACCCTCCA	0.483													3	85	---	---	---	---	PASS
NRXN2	9379	broad.mit.edu	37	11	64434752	64434752	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64434752G>A	uc001oar.2	-	10	2207	c.1768C>T	c.(1768-1770)CAC>TAC	p.H590Y	NRXN2_uc001oas.2_Missense_Mutation_p.H559Y|NRXN2_uc001oaq.2_Missense_Mutation_p.H257Y	NM_015080	NP_055895	P58401	NRX2B_HUMAN	neurexin 2 isoform alpha-1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell adhesion	integral to membrane				upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)|ovary(2)|kidney(1)|pancreas(1)	10						AAGTCCACGTGACACCACTCG	0.602													26	71	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64677516	64677516	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64677516A>C	uc001obx.2	-	13	1974	c.1859T>G	c.(1858-1860)CTG>CGG	p.L620R		NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	620							protein binding			ovary(1)|central_nervous_system(1)	2						TCTCACCAGCAGGCCGGCTGG	0.731													23	15	---	---	---	---	PASS
DPF2	5977	broad.mit.edu	37	11	65107889	65107889	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65107889G>A	uc001odm.2	+	2	78	c.66G>A	c.(64-66)GAG>GAA	p.E22E	DPF2_uc001odn.2_Silent_p.E22E|DPF2_uc010roe.1_Silent_p.E22E	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	22					apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						ATGCCATGGAGCAGTGCCACA	0.547													65	167	---	---	---	---	PASS
SLC25A45	283130	broad.mit.edu	37	11	65147353	65147353	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65147353A>G	uc001odp.1	-	3	560	c.138T>C	c.(136-138)ATT>ATC	p.I46I	SLC25A45_uc009yqi.1_Silent_p.I46I|SLC25A45_uc001odq.1_Intron|SLC25A45_uc001odr.1_Silent_p.I46I|SLC25A45_uc001ods.1_Silent_p.I4I|SLC25A45_uc001odt.1_Silent_p.I4I	NM_001077241	NP_001070709	Q8N413	S2545_HUMAN	solute carrier family 25, member 45 isoform b	46	Solcar 1.				transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CATGGCGGTAAATCTTGACCA	0.617													15	46	---	---	---	---	PASS
SPTBN2	6712	broad.mit.edu	37	11	66457282	66457282	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66457282G>A	uc001ojd.2	-	28	6015	c.5943C>T	c.(5941-5943)GCC>GCT	p.A1981A	SPTBN2_uc001ojc.1_5'Flank	NM_006946	NP_008877	O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	1981	Spectrin 16.				actin filament capping|axon guidance|cell death|vesicle-mediated transport	cytosol|spectrin	actin binding|structural constituent of cytoskeleton			large_intestine(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						CCACCTCCTCGGCCGCATAGT	0.607													36	145	---	---	---	---	PASS
TBC1D10C	374403	broad.mit.edu	37	11	67177104	67177104	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67177104G>A	uc001ola.2	+	10	1249	c.1220G>A	c.(1219-1221)CGG>CAG	p.R407Q	PPP1CA_uc001okx.1_Intron|TBC1D10C_uc001okz.2_3'UTR|TBC1D10C_uc001olb.2_RNA	NM_198517	NP_940919	Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	407	Interaction with calcineurin.					intracellular	Rab GTPase activator activity				0			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CCACCGCGGCGGAAACCCCAG	0.711													3	7	---	---	---	---	PASS
RPS6KB2	6199	broad.mit.edu	37	11	67202553	67202553	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67202553G>T	uc001old.2	+	15	1444	c.1362G>T	c.(1360-1362)CCG>CCT	p.P454P	RPS6KB2_uc001olf.2_Silent_p.P254P|RPS6KB2_uc001olg.2_3'UTR|RPS6KB2_uc009yrq.2_3'UTR|RPS6KB2_uc001ole.2_RNA|RPS6KB2_uc001olh.2_RNA|RPS6KB2_uc009yrr.2_Silent_p.P285P	NM_003952	NP_003943	Q9UBS0	KS6B2_HUMAN	ribosomal protein S6 kinase, 70kDa, polypeptide	454	Pro-rich.				nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of translational initiation|translation	nucleoplasm	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|stomach(1)|lung(1)|salivary_gland(1)	7			BRCA - Breast invasive adenocarcinoma(15;3.26e-06)			tgccaccgccgccgccctcga	0.458													22	25	---	---	---	---	PASS
MRGPRD	116512	broad.mit.edu	37	11	68747787	68747787	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68747787G>A	uc010rqf.1	-	1	669	c.669C>T	c.(667-669)GTC>GTT	p.V223V		NM_198923	NP_944605	Q8TDS7	MRGRD_HUMAN	MAS-related GPR, member D	223	Helical; Name=6; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(1)	1			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CAGAGGCCAGGACCACCACGA	0.612													9	46	---	---	---	---	PASS
FAM181B	220382	broad.mit.edu	37	11	82443575	82443575	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:82443575G>T	uc001ozp.2	-	1	1332	c.1197C>A	c.(1195-1197)TAC>TAA	p.Y399*		NM_175885	NP_787081	A6NEQ2	F181B_HUMAN	hypothetical protein LOC220382	399										large_intestine(1)	1						CGGTGCGGCTGTAGCCCGCGC	0.692													12	4	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89424640	89424640	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89424640T>A	uc001pda.2	+	12	1516	c.990T>A	c.(988-990)AAT>AAA	p.N330K		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	330					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						CAGTAAAAAATTTTACAGAAA	0.269													27	33	---	---	---	---	PASS
MRE11A	4361	broad.mit.edu	37	11	94180480	94180480	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94180480G>A	uc001peu.2	-	15	1877	c.1688C>T	c.(1687-1689)TCA>TTA	p.S563L	MRE11A_uc001pev.2_Missense_Mutation_p.S563L|MRE11A_uc009ywj.2_Missense_Mutation_p.S566L	NM_005591	NP_005582	P49959	MRE11_HUMAN	meiotic recombination 11 homolog A isoform 1	563					DNA duplex unwinding|double-strand break repair via homologous recombination|double-strand break repair via nonhomologous end joining|negative regulation of DNA endoreduplication|positive regulation of kinase activity|positive regulation of protein autophosphorylation|reciprocal meiotic recombination|regulation of mitotic recombination|sister chromatid cohesion|telomere maintenance via telomerase	Mre11 complex|nucleoplasm	3'-5' exonuclease activity|double-stranded DNA binding|manganese ion binding|protein C-terminus binding|single-stranded DNA specific endodeoxyribonuclease activity			breast(4)|lung(1)	5		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				GGTTGCTGCTGAGATGCTATC	0.483								Homologous_recombination	Ataxia-Telangiectasia-Like_Disorder				15	201	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95826149	95826149	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95826149T>G	uc001pfw.1	-	2	2331	c.1046A>C	c.(1045-1047)CAG>CCG	p.Q349P		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	349					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				TGTGCTCCTCTGGCTTTGCTG	0.502			T	MECT1|CRTC3	salivary gland mucoepidermoid								40	34	---	---	---	---	PASS
KIAA1377	57562	broad.mit.edu	37	11	101833366	101833366	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:101833366A>G	uc001pgm.2	+	6	1870	c.1600A>G	c.(1600-1602)AAA>GAA	p.K534E	KIAA1377_uc001pgn.2_Missense_Mutation_p.K490E|KIAA1377_uc010run.1_Missense_Mutation_p.K335E|KIAA1377_uc009yxa.1_Missense_Mutation_p.K335E	NM_020802	NP_065853	Q9P2H0	K1377_HUMAN	hypothetical protein LOC57562	534							protein binding			breast(2)|ovary(1)|central_nervous_system(1)	4	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		TCCTGATTCAAAAGATGAAAA	0.299													37	23	---	---	---	---	PASS
MMP20	9313	broad.mit.edu	37	11	102464193	102464193	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102464193G>C	uc001phc.2	-	8	1237	c.1224C>G	c.(1222-1224)TTC>TTG	p.F408L		NM_004771	NP_004762	O60882	MMP20_HUMAN	matrix metalloproteinase 20 preproprotein	408	Hemopexin-like 3.				proteolysis|regulation of enamel mineralization	extracellular space|proteinaceous extracellular matrix	calcium ion binding|metalloendopeptidase activity|protein binding|zinc ion binding			urinary_tract(1)|skin(1)	2	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)		CTCCCACAAAGAAAAGGGTCT	0.393													25	67	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	102991224	102991224	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102991224G>T	uc001pho.2	+	7	1192	c.1048G>T	c.(1048-1050)GCC>TCC	p.A350S	DYNC2H1_uc001phn.1_Missense_Mutation_p.A350S|DYNC2H1_uc009yxe.1_Missense_Mutation_p.A350S	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	350	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		TTTTCTACCTGCCAGTGAAGA	0.323													151	97	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	103025457	103025457	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103025457G>A	uc001pho.2	+	24	3636	c.3492G>A	c.(3490-3492)ATG>ATA	p.M1164I	DYNC2H1_uc001phn.1_Missense_Mutation_p.M1164I|DYNC2H1_uc009yxe.1_Intron	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1164	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AATTTTTGATGAACTGGCATG	0.294													3	5	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104874003	104874003	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104874003C>T	uc010rva.1	-	4	573	c.541G>A	c.(541-543)GAG>AAG	p.E181K	CASP5_uc010ruz.1_Missense_Mutation_p.E194K|CASP5_uc010rvb.1_Missense_Mutation_p.E123K|CASP5_uc010rvc.1_Missense_Mutation_p.E39K|CASP5_uc009yxh.2_Intron|CASP5_uc010rvd.1_Intron	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	181					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CACAGCACCTCATCATGATTT	0.343													39	102	---	---	---	---	PASS
CARD16	114769	broad.mit.edu	37	11	104912298	104912298	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104912298A>G	uc001pip.1	-	3	450	c.423T>C	c.(421-423)AGT>AGC	p.S141S	CASP1_uc010rve.1_Intron|CASP1_uc010rvf.1_Intron|CASP1_uc010rvg.1_Intron|CASP1_uc010rvh.1_Intron|CASP1_uc010rvi.1_Intron|CARD16_uc001pio.1_3'UTR	NM_001017534	NP_001017534	Q5EG05	CAR16_HUMAN	caspase-1 dominant-negative inhibitor pseudo-ICE	141					regulation of apoptosis	intracellular	cysteine-type endopeptidase inhibitor activity			skin(1)	1						TATATCTTTCACTCCACTTTA	0.398													38	94	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108098502	108098502	+	Splice_Site	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108098502G>A	uc001pkb.1	+	3	458	c.73_splice	c.e3-1	p.K25_splice	ATM_uc009yxr.1_Splice_Site_p.K25_splice|ATM_uc001pkc.1_Splice_Site_p.K25_splice	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TTTATTTTCAGAAAGAAGTTG	0.308			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			26	122	---	---	---	---	PASS
DDX10	1662	broad.mit.edu	37	11	108549060	108549060	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108549060G>C	uc001pkm.2	+	5	621	c.556G>C	c.(556-558)GAG>CAG	p.E186Q	DDX10_uc001pkl.1_Missense_Mutation_p.E186Q	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	186	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		ACACGAAGCTGAGAGGATCAA	0.403			T	NUP98	AML*								4	104	---	---	---	---	PASS
ZW10	9183	broad.mit.edu	37	11	113608312	113608312	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113608312G>C	uc001poe.2	-	14	2035	c.1998C>G	c.(1996-1998)GGC>GGG	p.G666G	ZW10_uc009yyv.2_RNA	NM_004724	NP_004715	O43264	ZW10_HUMAN	centromere/kinetochore protein zw10	666					cell division|ER to Golgi vesicle-mediated transport|establishment of mitotic spindle orientation|meiosis|mitotic cell cycle checkpoint|mitotic metaphase plate congression|mitotic prometaphase|protein complex assembly|protein localization to kinetochore|protein transport|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|endoplasmic reticulum membrane|kinetochore microtubule|nucleus|spindle pole	centromeric DNA binding|protein binding			central_nervous_system(1)|skin(1)	2		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		CAGTAATTTTGCCAATGACCT	0.418													51	141	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113857404	113857404	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113857404C>T	uc010rxb.1	+	7	1121	c.888C>T	c.(886-888)ATC>ATT	p.I296I	HTR3A_uc010rxa.1_Silent_p.I296I|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.I275I	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	290	Helical; Name=2; (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	TCCTGATCATCGTTTCTGACA	0.597													32	71	---	---	---	---	PASS
FAM55D	54827	broad.mit.edu	37	11	114453663	114453663	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114453663C>G	uc001ppc.2	-	3	358	c.177G>C	c.(175-177)CTG>CTC	p.L59L	FAM55D_uc001ppd.2_5'UTR	NM_001077639	NP_001071107	Q6UWF7	FA55D_HUMAN	hypothetical protein LOC54827 isoform 1	59						extracellular region				ovary(2)|skin(2)	4		all_cancers(61;8.53e-16)|all_epithelial(67;1.71e-08)|all_hematologic(158;3.05e-05)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0194)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.82e-06)|Epithelial(105;0.000129)|all cancers(92;0.000938)		TTAATGATATCAGTGGTGTTT	0.418													8	264	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116729308	116729308	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116729308G>A	uc001ppy.2	-	20	2591	c.2555C>T	c.(2554-2556)ACA>ATA	p.T852I	SIK3_uc001ppz.2_Intron|SIK3_uc001pqa.2_Intron|SIK3_uc001ppw.2_Intron|SIK3_uc001ppx.2_Intron|SIK3_uc001pqb.2_Missense_Mutation_p.T155I	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	852	Gln-rich.					cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CCCCACTCCTGTTGAAGGGCT	0.582													53	102	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118376003	118376003	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118376003C>G	uc001pta.2	+	27	9410	c.9387C>G	c.(9385-9387)CTC>CTG	p.L3129L	MLL_uc001ptb.2_Silent_p.L3132L	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	3129					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		GAGGTGGTCTCACCCTTACCA	0.458			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								7	225	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119045386	119045386	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045386G>T	uc001pvu.2	+	6	1289	c.1074G>T	c.(1072-1074)CTG>CTT	p.L358L	NLRX1_uc010rzc.1_Silent_p.L180L|NLRX1_uc001pvv.2_Silent_p.L358L|NLRX1_uc001pvw.2_Silent_p.L358L|NLRX1_uc001pvx.2_Silent_p.L358L	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	358	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCCGGAACCTGGAGGGGCACC	0.642													78	56	---	---	---	---	PASS
NLRX1	79671	broad.mit.edu	37	11	119045387	119045387	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119045387G>T	uc001pvu.2	+	6	1290	c.1075G>T	c.(1075-1077)GAG>TAG	p.E359*	NLRX1_uc010rzc.1_Nonsense_Mutation_p.E181*|NLRX1_uc001pvv.2_Nonsense_Mutation_p.E359*|NLRX1_uc001pvw.2_Nonsense_Mutation_p.E359*|NLRX1_uc001pvx.2_Nonsense_Mutation_p.E359*	NM_024618	NP_078894	Q86UT6	NLRX1_HUMAN	NLR family member X1 isoform 1	359	Required for interaction with MAVS.|NACHT.				innate immune response|interspecies interaction between organisms|negative regulation of type I interferon production	mitochondrial outer membrane	ATP binding			ovary(1)|skin(1)	2	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		CCGGAACCTGGAGGGGCACCA	0.637													75	56	---	---	---	---	PASS
OAF	220323	broad.mit.edu	37	11	120096498	120096498	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120096498C>T	uc001pxb.2	+	2	601	c.360C>T	c.(358-360)CTC>CTT	p.L120L		NM_178507	NP_848602	Q86UD1	OAF_HUMAN	OAF homolog precursor	120											0		Breast(109;0.00663)|Medulloblastoma(222;0.0523)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)		TGGCCAAGCTCCGGCAGGTAA	0.657													42	107	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121028649	121028649	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121028649G>C	uc010rzo.1	+	13	4405	c.4405G>C	c.(4405-4407)GAG>CAG	p.E1469Q		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	1469					cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GTCAGACGAGGAGTGTGCGCT	0.662													4	80	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123900989	123900989	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123900989C>G	uc001pzp.1	+	1	660	c.660C>G	c.(658-660)ATC>ATG	p.I220M		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		ATGTGTCCATCGTCTGTTCCA	0.542													33	91	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294594	124294594	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294594G>T	uc010sak.1	-	1	174	c.174C>A	c.(172-174)CCC>CCA	p.P58P		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAAAGTACATGGGGGTGTGAA	0.408													20	45	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294596	124294596	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294596G>C	uc010sak.1	-	1	172	c.172C>G	c.(172-174)CCC>GCC	p.P58A		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	58	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		AAGTACATGGGGGTGTGAAGG	0.413													20	45	---	---	---	---	PASS
BARX2	8538	broad.mit.edu	37	11	129321282	129321282	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129321282C>A	uc001qfc.3	+	4	875	c.825C>A	c.(823-825)CCC>CCA	p.P275P		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	275											0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CTTCGGAACCCCCACCATTAA	0.537													34	23	---	---	---	---	PASS
ST14	6768	broad.mit.edu	37	11	130064581	130064581	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130064581C>T	uc001qfw.2	+	9	1255	c.1062C>T	c.(1060-1062)CCC>CCT	p.P354P	ST14_uc010sca.1_Silent_p.P164P	NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase	354	CUB 2.|Extracellular (Potential).				proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	TCAACAGCCCCTACTACCCAG	0.507													40	28	---	---	---	---	PASS
SLC6A13	6540	broad.mit.edu	37	12	332341	332341	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:332341C>A	uc001qic.1	-	12	1424	c.1371G>T	c.(1369-1371)CTG>CTT	p.L457L	SLC6A13_uc009zdj.1_Silent_p.L447L|SLC6A13_uc010sdl.1_Silent_p.L365L	NM_016615	NP_057699	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter	457	Helical; Name=10; (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			TGGCCACGAACAGGAGGCACA	0.522													27	25	---	---	---	---	PASS
CACNA2D4	93589	broad.mit.edu	37	12	1949924	1949924	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1949924C>G	uc001qjp.2	-	26	2763	c.2532G>C	c.(2530-2532)AAG>AAC	p.K844N	CACNA2D4_uc009zds.1_RNA|CACNA2D4_uc009zdt.1_Missense_Mutation_p.K708N|CACNA2D4_uc009zdr.1_RNA	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4	844	Extracellular (Potential).					integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TGGCTGTCCTCTTGTCCACGG	0.582													18	150	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2706461	2706461	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2706461G>A	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	TGAAGGTAAAGCCCCCATCCC	0.488													41	360	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7640016	7640016	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7640016A>G	uc001qsz.3	-	8	2117	c.1989T>C	c.(1987-1989)CCT>CCC	p.P663P	CD163_uc001qta.3_Silent_p.P663P|CD163_uc009zfw.2_Silent_p.P696P	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	663	SRCR 6.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						GAGCAGTTACAGGACAATCTC	0.498													62	48	---	---	---	---	PASS
CLEC4C	170482	broad.mit.edu	37	12	7882195	7882195	+	Missense_Mutation	SNP	T	C	C	rs147980423		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7882195T>C	uc001qtg.1	-	6	813	c.639A>G	c.(637-639)ATA>ATG	p.I213M	CLEC4C_uc001qth.1_Missense_Mutation_p.I213M|CLEC4C_uc001qti.1_Missense_Mutation_p.I182M	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform	213	Extracellular (Potential).				innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		ATTTCATTTATATGTAGATCT	0.353													127	64	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14650888	14650888	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14650888C>G	uc001rbw.2	+	15	3852	c.3694C>G	c.(3694-3696)CAG>GAG	p.Q1232E	ATF7IP_uc001rbx.2_Missense_Mutation_p.Q1231E|ATF7IP_uc001rby.3_Missense_Mutation_p.Q1232E|ATF7IP_uc001rca.2_Missense_Mutation_p.Q1232E	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	1232	Interaction with MBD1.|Fibronectin type-III.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						TACTCTCACCCAGTTTGTATC	0.473													6	293	---	---	---	---	PASS
ATF7IP	55729	broad.mit.edu	37	12	14650988	14650988	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14650988C>G	uc001rbw.2	+	15	3952	c.3794C>G	c.(3793-3795)TCT>TGT	p.S1265C	ATF7IP_uc001rbx.2_Missense_Mutation_p.S1264C|ATF7IP_uc001rby.3_Missense_Mutation_p.S1265C|ATF7IP_uc001rca.2_Missense_Mutation_p.S1265C	NM_018179	NP_060649	Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting	1265	Interaction with MBD1.				DNA methylation|interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|regulation of RNA polymerase II transcriptional preinitiation complex assembly|transcription, DNA-dependent		protein binding			lung(3)|ovary(1)|skin(1)	5						GATGTGATCTCTTCTACCCAG	0.393													11	671	---	---	---	---	PASS
ARHGDIB	397	broad.mit.edu	37	12	15103648	15103648	+	5'UTR	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15103648C>G	uc001rcq.1	-	2					ARHGDIB_uc001rcp.1_5'Flank	NM_001175	NP_001166	P52566	GDIR2_HUMAN	Rho GDP dissociation inhibitor (GDI) beta						actin cytoskeleton organization|cellular component movement|immune response|multicellular organismal development|negative regulation of cell adhesion|regulation of small GTPase mediated signal transduction|Rho protein signal transduction	cytoplasmic membrane-bounded vesicle|cytoskeleton|cytosol	GTPase activator activity|Rho GDP-dissociation inhibitor activity				0						TTCAGTCATTCTGATCTATTT	0.463													21	127	---	---	---	---	PASS
PTPRO	5800	broad.mit.edu	37	12	15654883	15654883	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15654883G>C	uc001rcv.1	+	5	1165	c.991G>C	c.(991-993)GAG>CAG	p.E331Q	PTPRO_uc001rcw.1_Missense_Mutation_p.E331Q|PTPRO_uc001rcu.1_Missense_Mutation_p.E331Q	NM_030667	NP_109592	Q16827	PTPRO_HUMAN	receptor-type protein tyrosine phosphatase O	331	Fibronectin type-III 4.|Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			skin(5)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	9		Hepatocellular(102;0.244)				CAGTGAGACAGAGAAGTCAAC	0.443													14	161	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20801636	20801636	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20801636C>T	uc001reh.1	+	13	2602	c.2580C>T	c.(2578-2580)AAC>AAT	p.N860N		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A	860	Catalytic (By similarity).				lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TGCTATATAACGATCGTTCAG	0.368													121	146	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20854340	20854340	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20854340G>T	uc001rej.3	+	4	573	c.218G>T	c.(217-219)AGG>ATG	p.R73M	SLCO1C1_uc010sii.1_Missense_Mutation_p.R73M|SLCO1C1_uc010sij.1_Missense_Mutation_p.R73M|SLCO1C1_uc009zip.2_Intron|SLCO1C1_uc001rei.2_Missense_Mutation_p.R73M|SLCO1C1_uc010sik.1_Intron	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	73	Extracellular (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					ATAGAGAGAAGGTTTGATATC	0.398													136	150	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20890111	20890111	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20890111A>C	uc001rej.3	+	12	1808	c.1453A>C	c.(1453-1455)ACA>CCA	p.T485P	SLCO1C1_uc010sii.1_Missense_Mutation_p.T485P|SLCO1C1_uc010sij.1_Missense_Mutation_p.T436P|SLCO1C1_uc009zip.2_Missense_Mutation_p.T319P|SLCO1C1_uc001rei.2_Missense_Mutation_p.T485P|SLCO1C1_uc010sik.1_Missense_Mutation_p.T367P	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	485	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					ATGTTCAGAGACAAAATGGGA	0.363													115	54	---	---	---	---	PASS
ETNK1	55500	broad.mit.edu	37	12	22826547	22826547	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22826547G>A	uc001rft.2	+	6	1187	c.1165G>A	c.(1165-1167)GAA>AAA	p.E389K	ETNK1_uc009ziz.2_Missense_Mutation_p.E389K	NM_018638	NP_061108	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1 isoform A	389					phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|ethanolamine kinase activity				0						TGAAGTTACTGAAAAGGAGGT	0.368													32	220	---	---	---	---	PASS
CAPRIN2	65981	broad.mit.edu	37	12	30884403	30884403	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30884403C>A	uc001rji.1	-	6	1685	c.934G>T	c.(934-936)GGC>TGC	p.G312C	CAPRIN2_uc001rjf.1_Missense_Mutation_p.G109C|CAPRIN2_uc001rjg.1_Translation_Start_Site|CAPRIN2_uc001rjh.1_Missense_Mutation_p.G312C|CAPRIN2_uc001rjj.1_Translation_Start_Site|CAPRIN2_uc001rjk.3_Missense_Mutation_p.G312C|CAPRIN2_uc001rjl.3_Missense_Mutation_p.G312C|CAPRIN2_uc001rjm.1_Translation_Start_Site|CAPRIN2_uc001rjn.1_Translation_Start_Site	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	312					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TCAAAATAGCCTGAGTTCAGC	0.348													46	162	---	---	---	---	PASS
NELL2	4753	broad.mit.edu	37	12	45173518	45173518	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45173518C>A	uc001rog.2	-	5	1129	c.534G>T	c.(532-534)AAG>AAT	p.K178N	NELL2_uc001rof.3_Missense_Mutation_p.K177N|NELL2_uc001roh.2_Missense_Mutation_p.K178N|NELL2_uc009zkd.2_Missense_Mutation_p.K177N|NELL2_uc010skz.1_Missense_Mutation_p.K228N|NELL2_uc010sla.1_Missense_Mutation_p.K201N|NELL2_uc001roi.1_Missense_Mutation_p.K178N|NELL2_uc010slb.1_Missense_Mutation_p.K177N|NELL2_uc001roj.2_Missense_Mutation_p.K178N	NM_001145108	NP_001138580	Q99435	NELL2_HUMAN	NEL-like protein 2 isoform b precursor	178	TSP N-terminal.				cell adhesion	extracellular region	calcium ion binding|protein binding|structural molecule activity			skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	4	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		CTGTGGAGGGCTTTTCTACTA	0.378													53	104	---	---	---	---	PASS
PLEKHA9	51054	broad.mit.edu	37	12	45567332	45567332	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45567332C>T	uc001rom.1	-	3	1354	c.817G>A	c.(817-819)GAA>AAA	p.E273K	PLEKHA9_uc009zke.2_Missense_Mutation_p.E273K	NM_015899	NP_056983			pleckstrin homology domain containing, family A												0	Lung SC(27;0.192)|Renal(347;0.236)			GBM - Glioblastoma multiforme(48;0.173)		GCCTCCACTTCGTGCAGCACT	0.413													31	145	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46123697	46123697	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46123697C>G	uc001ros.1	+	1	78	c.78C>G	c.(76-78)TTC>TTG	p.F26L	ARID2_uc001ror.2_Missense_Mutation_p.F26L|LOC400027_uc001roq.2_5'Flank	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	26	ARID.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TGCGGCAGTTCCACCACAGCA	0.672													7	34	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46244950	46244950	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46244950A>C	uc001ros.1	+	15	3044	c.3044A>C	c.(3043-3045)CAG>CCG	p.Q1015P	ARID2_uc001ror.2_Missense_Mutation_p.Q1015P|ARID2_uc009zkg.1_Missense_Mutation_p.Q471P|ARID2_uc009zkh.1_Missense_Mutation_p.Q642P|ARID2_uc001rou.1_Missense_Mutation_p.Q349P	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1015	Gln-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CAGCAACAGCAGCAACATTCA	0.507													22	93	---	---	---	---	PASS
VDR	7421	broad.mit.edu	37	12	48251014	48251014	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48251014C>T	uc001rqm.2	-	7	763	c.481G>A	c.(481-483)GAT>AAT	p.D161N	VDR_uc001rql.2_Missense_Mutation_p.D211N|VDR_uc001rqn.2_Missense_Mutation_p.D161N|VDR_uc010slq.1_Missense_Mutation_p.D129N	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor	161	Hinge.				decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CCTCCACCATCATTCACACGA	0.552													8	56	---	---	---	---	PASS
VDR	7421	broad.mit.edu	37	12	48251018	48251018	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48251018C>G	uc001rqm.2	-	7	759	c.477G>C	c.(475-477)GTG>GTC	p.V159V	VDR_uc001rql.2_Silent_p.V209V|VDR_uc001rqn.2_Silent_p.V159V|VDR_uc010slq.1_Silent_p.V127V	NM_001017535	NP_001017535	P11473	VDR_HUMAN	vitamin D (1,25-dihydroxyvitamin D3) receptor	159	Hinge.				decidualization|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of vitamin D 24-hydroxylase activity|regulation of calcidiol 1-monooxygenase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	retinoid X receptor binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|vitamin D3 receptor activity|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3		Acute lymphoblastic leukemia(13;0.109)|all_hematologic(14;0.214)		GBM - Glioblastoma multiforme(48;0.17)	Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Dihydrotachysterol(DB01070)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	CACCATCATTCACACGAACTG	0.552													8	53	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49439860	49439860	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49439860C>G	uc001rta.3	-	17	4681	c.4681G>C	c.(4681-4683)GTA>CTA	p.V1561L		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1561					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ACAGGCTTTACCACGTAGGGC	0.592			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			3	16	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49441824	49441824	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49441824C>A	uc001rta.3	-	14	4160	c.4160G>T	c.(4159-4161)GGC>GTC	p.G1387V		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	1387	PHD-type 3.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TGCCCCCCGGCCAAAGCTGCC	0.547			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			18	71	---	---	---	---	PASS
SCN8A	6334	broad.mit.edu	37	12	52115631	52115631	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52115631A>C	uc001ryw.2	+	12	2115	c.1937A>C	c.(1936-1938)AAC>ACC	p.N646T	SCN8A_uc010snl.1_Missense_Mutation_p.N511T|SCN8A_uc001ryx.1_Missense_Mutation_p.N511T|SCN8A_uc001ryz.1_Missense_Mutation_p.N511T|SCN8A_uc001ryy.2_Missense_Mutation_p.N511T	NM_014191	NP_055006	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha	646					axon guidance|myelination|peripheral nervous system development	cytoplasmic membrane-bounded vesicle|node of Ranvier	ATP binding|voltage-gated sodium channel activity			ovary(7)	7				BRCA - Breast invasive adenocarcinoma(357;0.181)	Lamotrigine(DB00555)	GTGGACTGCAACGGCGTGGTG	0.567													4	93	---	---	---	---	PASS
ACVRL1	94	broad.mit.edu	37	12	52306283	52306283	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52306283G>C	uc001rzj.2	+	2	308	c.25G>C	c.(25-27)GGC>CGC	p.G9R	ACVRL1_uc001rzk.2_Missense_Mutation_p.G9R|ACVRL1_uc010snm.1_Missense_Mutation_p.G23R	NM_000020	NP_000011	P37023	ACVL1_HUMAN	activin A receptor type II-like 1 precursor	9					blood vessel endothelial cell proliferation involved in sprouting angiogenesis|blood vessel maturation|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of endothelial cell migration|negative regulation of focal adhesion assembly|positive regulation of BMP signaling pathway|positive regulation of transcription, DNA-dependent|regulation of blood pressure|regulation of blood vessel endothelial cell migration|regulation of DNA replication|regulation of endothelial cell proliferation|transforming growth factor beta receptor signaling pathway|wound healing, spreading of epidermal cells	cell surface|integral to plasma membrane	activin binding|activin receptor activity, type I|ATP binding|metal ion binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			lung(2)	2				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CCCCAGGAAAGGCCTTCTGAT	0.592									Hereditary_Hemorrhagic_Telangiectasia				9	69	---	---	---	---	PASS
AMHR2	269	broad.mit.edu	37	12	53823264	53823264	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53823264G>A	uc001scx.1	+	8	1073	c.995G>A	c.(994-996)CGA>CAA	p.R332Q	AMHR2_uc009zmy.1_Missense_Mutation_p.R332Q	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	332	Cytoplasmic (Potential).|Protein kinase.				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	ATTGCCCACCGAGATCTGAGC	0.448									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				4	117	---	---	---	---	PASS
NCKAP1L	3071	broad.mit.edu	37	12	54905629	54905629	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54905629A>G	uc001sgc.3	+	8	857	c.778A>G	c.(778-780)ATT>GTT	p.I260V	NCKAP1L_uc010sox.1_5'UTR|NCKAP1L_uc010soy.1_Missense_Mutation_p.I210V	NM_005337	NP_005328	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	260					actin polymerization-dependent cell motility|B cell homeostasis|B cell receptor signaling pathway|cortical actin cytoskeleton organization|erythrocyte development|maintenance of cell polarity|myeloid cell homeostasis|negative regulation of apoptosis|negative regulation of interleukin-17 production|negative regulation of interleukin-6 production|negative regulation of myosin-light-chain-phosphatase activity|neutrophil chemotaxis|positive regulation of actin filament polymerization|positive regulation of B cell differentiation|positive regulation of B cell proliferation|positive regulation of CD4-positive, alpha-beta T cell differentiation|positive regulation of CD8-positive, alpha-beta T cell differentiation|positive regulation of cell adhesion mediated by integrin|positive regulation of erythrocyte differentiation|positive regulation of gamma-delta T cell differentiation|positive regulation of neutrophil chemotaxis|positive regulation of phagocytosis, engulfment|positive regulation of T cell proliferation|protein complex assembly|response to drug|T cell homeostasis	cytosol|integral to plasma membrane|membrane fraction|SCAR complex	protein complex binding|protein kinase activator activity|Rac GTPase activator activity			ovary(3)|central_nervous_system(1)	4						GGAGCGCTGGATTATCAGTAA	0.413													42	157	---	---	---	---	PASS
OR6C4	341418	broad.mit.edu	37	12	55945428	55945428	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55945428A>T	uc010spp.1	+	1	418	c.418A>T	c.(418-420)ATA>TTA	p.I140L		NM_001005494	NP_001005494	Q8NGE1	OR6C4_HUMAN	olfactory receptor, family 6, subfamily C,	140	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CAGAGTCTGCATACAACTAGT	0.468													38	174	---	---	---	---	PASS
GLI1	2735	broad.mit.edu	37	12	57863408	57863408	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57863408C>T	uc001snx.2	+	11	1581	c.1503C>T	c.(1501-1503)CTC>CTT	p.L501L	GLI1_uc009zpq.2_Silent_p.L373L	NM_005269	NP_005260	P08151	GLI1_HUMAN	GLI family zinc finger 1 isoform 1	501					epidermal cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|osteoblast differentiation|positive regulation of DNA replication|positive regulation of smoothened signaling pathway|positive regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	transcription regulatory region DNA binding|zinc ion binding			skin(4)|ovary(4)|breast(3)|central_nervous_system(1)|urinary_tract(1)|kidney(1)|pancreas(1)	15			GBM - Glioblastoma multiforme(3;3.99e-32)			TTGAGAACCTCAGGCTGGACC	0.617													31	118	---	---	---	---	PASS
CAND1	55832	broad.mit.edu	37	12	67675838	67675838	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:67675838G>C	uc001stn.2	+							NM_018448	NP_060918	Q86VP6	CAND1_HUMAN	TIP120 protein						cell differentiation|negative regulation of catalytic activity|protein ubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|ubiquitin ligase complex	protein binding			central_nervous_system(1)|skin(1)	2			GBM - Glioblastoma multiforme(1;1.13e-10)|Lung(24;0.000342)|LUSC - Lung squamous cell carcinoma(43;0.196)	GBM - Glioblastoma multiforme(28;0.0279)		CAAATGGTAAGTTGTTTTTTA	0.333													23	148	---	---	---	---	PASS
CPSF6	11052	broad.mit.edu	37	12	69652507	69652507	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69652507C>T	uc001sut.3	+	6	942	c.832C>T	c.(832-834)CTT>TTT	p.L278F	CPSF6_uc001suu.3_Missense_Mutation_p.L315F|CPSF6_uc010stk.1_5'UTR	NM_007007	NP_008938	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6,	278	Pro-rich.				mRNA polyadenylation|protein tetramerization	mRNA cleavage factor complex|paraspeckles|ribonucleoprotein complex	mRNA binding|nucleotide binding|protein binding				0	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			ACCACCAGTTCTTTTTCCTGG	0.632													5	249	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70918263	70918263	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70918263C>G	uc001swb.3	-	31	5989	c.5959G>C	c.(5959-5961)GAG>CAG	p.E1987Q	uc001svz.2_Intron|PTPRB_uc010sto.1_Missense_Mutation_p.E1897Q|PTPRB_uc010stp.1_Missense_Mutation_p.E1897Q|PTPRB_uc001swc.3_Missense_Mutation_p.E2205Q|PTPRB_uc001swa.3_Missense_Mutation_p.E2117Q	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1987	Cytoplasmic (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CTGTGATACTCTGGATTCACA	0.348													8	32	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70931979	70931979	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70931979C>A	uc001swb.3	-	26	5278	c.5248G>T	c.(5248-5250)GAT>TAT	p.D1750Y	uc001svz.2_RNA|PTPRB_uc010sto.1_Missense_Mutation_p.D1660Y|PTPRB_uc010stp.1_Missense_Mutation_p.D1660Y|PTPRB_uc001swc.3_Missense_Mutation_p.D1968Y|PTPRB_uc001swa.3_Missense_Mutation_p.D1880Y	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1750	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGATCATCATCTACATTGGAG	0.428													24	127	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70953211	70953211	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70953211T>C	uc001swb.3	-	16	4002	c.3972A>G	c.(3970-3972)CCA>CCG	p.P1324P	PTPRB_uc010sto.1_Silent_p.P1234P|PTPRB_uc010stp.1_Silent_p.P1234P|PTPRB_uc001swc.3_Silent_p.P1542P|PTPRB_uc001swa.3_Silent_p.P1454P|PTPRB_uc001swd.3_Silent_p.P1541P|PTPRB_uc009zrr.1_Silent_p.P1421P	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1324	Fibronectin type-III 15.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGGATCTCCCTGGACGAAGAC	0.443													72	416	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70956660	70956660	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70956660C>G	uc001swb.3	-	14	3508	c.3478G>C	c.(3478-3480)GAG>CAG	p.E1160Q	PTPRB_uc010sto.1_Missense_Mutation_p.E1070Q|PTPRB_uc010stp.1_Missense_Mutation_p.E1070Q|PTPRB_uc001swc.3_Missense_Mutation_p.E1378Q|PTPRB_uc001swa.3_Missense_Mutation_p.E1290Q|PTPRB_uc001swd.3_Missense_Mutation_p.E1377Q|PTPRB_uc009zrr.1_Missense_Mutation_p.E1257Q	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1160	Fibronectin type-III 13.|Extracellular (Potential).				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TTAGACAGCTCCCCACTGTGA	0.463													5	180	---	---	---	---	PASS
TRHDE	29953	broad.mit.edu	37	12	72680712	72680712	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72680712C>A	uc001sxa.2	+	2	1061	c.1031C>A	c.(1030-1032)ACT>AAT	p.T344N		NM_013381	NP_037513	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	344	Extracellular (Potential).				cell-cell signaling|proteolysis|signal transduction	integral to plasma membrane	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(2)|skin(1)	3						TACAGAGAAACTACCACCAAG	0.393													26	61	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78388627	78388627	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78388627C>A	uc001syp.2	+	6	889	c.716C>A	c.(715-717)GCA>GAA	p.A239E	NAV3_uc001syo.2_Missense_Mutation_p.A239E	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	239						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AGTGGAATTGCAACCAGTCAA	0.343										HNSCC(70;0.22)			25	63	---	---	---	---	PASS
NUDT4	11163	broad.mit.edu	37	12	93793026	93793026	+	Missense_Mutation	SNP	G	C	C	rs77656411		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93793026G>C	uc001tcm.2	+	5	812	c.414G>C	c.(412-414)GAG>GAC	p.E138D	NUDT4_uc010sup.1_Missense_Mutation_p.E138D|NUDT4_uc001tcn.2_Missense_Mutation_p.E86D|NUDT4_uc010suq.1_Missense_Mutation_p.E87D|NUDT4_uc001tco.2_Missense_Mutation_p.E86D	NM_019094	NP_061967	Q9NZJ9	NUDT4_HUMAN	nudix-type motif 4 isoform alpha	138	Nudix hydrolase.				calcium-mediated signaling|cyclic nucleotide metabolic process|cyclic-nucleotide-mediated signaling|intracellular transport|regulation of RNA export from nucleus	cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0						TACATGCAGAGTATCTGGAAA	0.428													6	119	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100796216	100796216	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100796216G>T	uc010svi.1	+	7	1175	c.862G>T	c.(862-864)GAG>TAG	p.E288*	SLC17A8_uc009ztx.2_Nonsense_Mutation_p.E288*	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	288	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						GACCTATATAGAGACAAGCAT	0.423													19	37	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101493391	101493391	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101493391G>A	uc010svm.1	+	22	2614	c.2042G>A	c.(2041-2043)CGA>CAA	p.R681Q	ANO4_uc001thw.2_Missense_Mutation_p.R646Q|ANO4_uc001thx.2_Missense_Mutation_p.R681Q|ANO4_uc001thy.2_Missense_Mutation_p.R201Q	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	681	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						AGAAAAGTACGACAAGAACAT	0.353										HNSCC(74;0.22)			28	81	---	---	---	---	PASS
TMEM116	89894	broad.mit.edu	37	12	112374620	112374620	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112374620T>G	uc001ttc.1	-	10	844	c.188A>C	c.(187-189)CAC>CCC	p.H63P	TMEM116_uc001ttd.1_Missense_Mutation_p.H155P|TMEM116_uc001tte.1_Missense_Mutation_p.H120P|TMEM116_uc001ttf.1_Missense_Mutation_p.H63P|TMEM116_uc001ttg.1_RNA|TMEM116_uc001tth.1_Intron|TMEM116_uc001tti.1_Missense_Mutation_p.H155P	NM_138341	NP_612350	Q8NCL8	TM116_HUMAN	transmembrane protein 116	63						integral to membrane				ovary(1)	1						TGGTGGTGAGTGCATCAAGAT	0.403													23	59	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112666057	112666057	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112666057C>T	uc009zwc.2	-	36	5442	c.5424G>A	c.(5422-5424)TTG>TTA	p.L1808L	C12orf51_uc001ttr.1_5'UTR	NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						TATGAAGAGGCAATGCCTGAT	0.423													8	23	---	---	---	---	PASS
C12orf51	283450	broad.mit.edu	37	12	112670832	112670832	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112670832C>T	uc009zwc.2	-	31	4725	c.4707G>A	c.(4705-4707)GTG>GTA	p.V1569V		NM_001109662	NP_001103132			chromosome 12 open reading frame 51											ovary(1)|lung(1)	2						GATCCATCTTCACAACTTTCT	0.443													13	11	---	---	---	---	PASS
TBX3	6926	broad.mit.edu	37	12	115117424	115117424	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:115117424G>C	uc001tvt.1	-	4	1714	c.750C>G	c.(748-750)CCC>CCG	p.P250P	TBX3_uc001tvu.1_Silent_p.P230P	NM_016569	NP_057653	O15119	TBX3_HUMAN	T-box 3 protein isoform 2	250	T-box; second part.				anterior/posterior axis specification, embryo|anti-apoptosis|cell aging|embryonic arm morphogenesis|embryonic digit morphogenesis|female genitalia development|follicle-stimulating hormone secretion|luteinizing hormone secretion|male genitalia development|mesoderm morphogenesis|negative regulation of myoblast differentiation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle|positive regulation of cell proliferation|regulation of transcription from RNA polymerase II promoter|skeletal system development	nucleus	sequence-specific DNA binding			ovary(2)|skin(1)	3	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		TGTGGAACCGGGGCTGGTATT	0.443													38	137	---	---	---	---	PASS
NOS1	4842	broad.mit.edu	37	12	117724063	117724063	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117724063G>C	uc001twm.1	-	6	1822	c.1136C>G	c.(1135-1137)TCC>TGC	p.S379C		NM_000620	NP_000611	P29475	NOS1_HUMAN	nitric oxide synthase 1, neuronal	379					multicellular organismal response to stress|myoblast fusion|negative regulation of calcium ion transport into cytosol|neurotransmitter biosynthetic process|nitric oxide biosynthetic process|platelet activation|positive regulation of vasodilation|regulation of cardiac muscle contraction|response to heat|response to hypoxia	cytoskeleton|cytosol|dendritic spine|perinuclear region of cytoplasm|photoreceptor inner segment|sarcolemma|sarcoplasmic reticulum	arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			ovary(3)|skin(3)|pancreas(1)	7	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)	L-Citrulline(DB00155)	GTGGGCTTTGGAGCCAAATCT	0.507													4	54	---	---	---	---	PASS
KSR2	283455	broad.mit.edu	37	12	118298109	118298109	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118298109T>C	uc001two.2	-	2	276	c.221A>G	c.(220-222)AAG>AGG	p.K74R		NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	103					intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CAGGACCTCCTTGCGCACATC	0.622													13	30	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124156113	124156113	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124156113G>C	uc001ufp.2	+	2	270	c.142G>C	c.(142-144)GAC>CAC	p.D48H	TCTN2_uc009zya.2_Missense_Mutation_p.D48H	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	48	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CCTGGTCGGAGACACCGAGGG	0.632													22	56	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124303765	124303765	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124303765G>T	uc001uft.3	+	22	3639	c.3614G>T	c.(3613-3615)GGC>GTC	p.G1205V		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1205	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TACAGTGAAGGCCCTGGTTCT	0.393													3	27	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124846713	124846713	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124846713C>T	uc010tba.1	-	22	3176	c.3059G>A	c.(3058-3060)CGG>CAG	p.R1020Q	NCOR2_uc010tay.1_Missense_Mutation_p.R1019Q|NCOR2_uc010taz.1_Missense_Mutation_p.R1003Q|NCOR2_uc010tbb.1_Missense_Mutation_p.R1020Q|NCOR2_uc010tbc.1_Missense_Mutation_p.R1002Q|NCOR2_uc001ugj.1_Missense_Mutation_p.R1020Q	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2	1020					cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		GCTCTTGCCCCGGGGGCTGCT	0.721													14	9	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129442087	129442087	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129442087C>A	uc010tbh.1	+						GLT1D1_uc001uhx.1_Intron|GLT1D1_uc001uhy.1_Intron	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1						biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		CTGTCTCCTCCAGGCAATGGA	0.527													13	23	---	---	---	---	PASS
XPO4	64328	broad.mit.edu	37	13	21396422	21396422	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21396422G>A	uc001unq.3	-	8	883	c.847C>T	c.(847-849)CGA>TGA	p.R283*		NM_022459	NP_071904	Q9C0E2	XPO4_HUMAN	exportin 4	283					protein transport	cytoplasm|nucleus	protein binding			large_intestine(1)|ovary(1)|kidney(1)	3		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		CTGATTTTTCGATGTACCTGT	0.398													24	50	---	---	---	---	PASS
RNF17	56163	broad.mit.edu	37	13	25367445	25367445	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25367445G>A	uc001upr.2	+	10	1242	c.1201G>A	c.(1201-1203)GAT>AAT	p.D401N	RNF17_uc010tdd.1_Missense_Mutation_p.D260N|RNF17_uc010aab.2_RNA|RNF17_uc010tde.1_Missense_Mutation_p.D401N|RNF17_uc001ups.2_Missense_Mutation_p.D340N|RNF17_uc001upq.1_Missense_Mutation_p.D401N	NM_031277	NP_112567	Q9BXT8	RNF17_HUMAN	ring finger protein 17	401					multicellular organismal development	cytoplasm|nucleus	hydrolase activity, acting on ester bonds|nucleic acid binding|zinc ion binding			ovary(1)|skin(1)	2		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATCTAGCCCTGATGTGATAAT	0.383													6	170	---	---	---	---	PASS
ATP8A2	51761	broad.mit.edu	37	13	26145831	26145831	+	Splice_Site	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26145831G>A	uc001uqk.2	+	18	1804	c.1662_splice	c.e18+1	p.A554_splice	ATP8A2_uc010tdi.1_Splice_Site_p.A514_splice|ATP8A2_uc010tdj.1_Splice_Site|ATP8A2_uc010aaj.1_Splice_Site_p.A64_splice|ATP8A2_uc001uql.1_Missense_Mutation_p.V515M	NM_016529	NP_057613	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter-like,						ATP biosynthetic process|negative regulation of cell proliferation	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|large_intestine(1)|skin(1)	4		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		CATAGAAGCGGTGAGTAACAT	0.418													49	75	---	---	---	---	PASS
CDK8	1024	broad.mit.edu	37	13	26974588	26974588	+	Splice_Site	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26974588A>C	uc001uqr.1	+	10	960	c.934_splice	c.e10-2	p.L312_splice	CDK8_uc001uqs.1_Splice_Site_p.L312_splice|CDK8_uc001uqt.1_Splice_Site_p.L139_splice	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TTGTGATTTCAGCTTCAGAAG	0.393													44	114	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39591689	39591689	+	Intron	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39591689A>G	uc001uwy.2	-						C13orf23_uc001uwz.2_Intron	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1											ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		TCTCTATATAAAAATAAATAA	0.274													20	12	---	---	---	---	PASS
KIAA0564	23078	broad.mit.edu	37	13	42179419	42179419	+	Intron	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42179419T>C	uc001uyj.2	-							NM_015058	NP_055873	A3KMH1	K0564_HUMAN	hypothetical protein LOC23078 isoform a							extracellular region	ATP binding|ATPase activity			ovary(3)|upper_aerodigestive_tract(1)|kidney(1)|skin(1)	6		Lung NSC(96;4.61e-06)|Prostate(109;0.0167)|Lung SC(185;0.0262)|Breast(139;0.0854)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000368)|GBM - Glioblastoma multiforme(144;0.0033)|BRCA - Breast invasive adenocarcinoma(63;0.0969)		TAGCCTGAAATCAGAAGAGTA	0.433													71	46	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52951735	52951735	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52951735C>G	uc001vgo.2	-	5	2915	c.2370G>C	c.(2368-2370)CTG>CTC	p.L790L	THSD1_uc001vgp.2_Silent_p.L737L|THSD1_uc010tgz.1_Silent_p.L411L|THSD1_uc010aea.2_Silent_p.L251L	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	790	Cytoplasmic (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		GAGAAGGGCTCAGAGAACTGA	0.522													7	125	---	---	---	---	PASS
SUGT1	10910	broad.mit.edu	37	13	53254242	53254242	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53254242C>G	uc001vhc.2	+	13	1173	c.948C>G	c.(946-948)ATC>ATG	p.I316M	SUGT1_uc001vha.2_RNA|SUGT1_uc001vhb.2_Missense_Mutation_p.I284M|SUGT1_uc010thb.1_Missense_Mutation_p.I228M|SUGT1_uc001vhd.2_Missense_Mutation_p.I173M	NM_001130912	NP_001124384	Q9Y2Z0	SUGT1_HUMAN	suppressor of G2 allele of SKP1 isoform a	316	SGS.				mitosis	kinetochore|ubiquitin ligase complex	binding				0		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		TTCAGCAGATCTATTCAGATG	0.313													33	105	---	---	---	---	PASS
PCDH17	27253	broad.mit.edu	37	13	58207128	58207128	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:58207128C>T	uc001vhq.1	+	1	1340	c.448C>T	c.(448-450)CGC>TGC	p.R150C	PCDH17_uc010aec.1_Missense_Mutation_p.R150C	NM_001040429	NP_001035519	O14917	PCD17_HUMAN	protocadherin 17 precursor	150	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	7		Lung NSC(96;0.027)|Prostate(109;0.0453)|Breast(118;0.128)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;1.06e-05)		TCCGGGCACCCGCTTCCCCCT	0.622													10	20	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67799867	67799867	+	Silent	SNP	C	T	T	rs144564425		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67799867C>T	uc001vik.2	-	2	3398	c.2706G>A	c.(2704-2706)GGG>GGA	p.G902G	PCDH9_uc001vil.2_Silent_p.G902G|PCDH9_uc010thl.1_Silent_p.G902G|PCDH9_uc001vin.3_Silent_p.G902G	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	902	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GGCTTATTGTCCCATTGATAG	0.463													50	138	---	---	---	---	PASS
PIBF1	10464	broad.mit.edu	37	13	73428246	73428246	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73428246G>C	uc001vjc.2	+	10	1580	c.1275G>C	c.(1273-1275)GTG>GTC	p.V425V	PIBF1_uc001vja.1_Silent_p.V425V|PIBF1_uc010aeo.1_RNA|PIBF1_uc001vjb.2_Silent_p.V425V|PIBF1_uc010aep.2_Intron	NM_006346	NP_006337	Q8WXW3	PIBF1_HUMAN	progesterone-induced blocking factor 1	425						centrosome				ovary(1)|breast(1)	2		Prostate(6;0.00191)|Breast(118;0.0736)|Acute lymphoblastic leukemia(28;0.0865)		GBM - Glioblastoma multiforme(99;0.000664)		AACGAGCAGTGATGGCTGAAA	0.343													16	63	---	---	---	---	PASS
KLF12	11278	broad.mit.edu	37	13	74289590	74289590	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:74289590C>G	uc001vjf.2	-	7	1164	c.942G>C	c.(940-942)CGG>CGC	p.R314R	KLF12_uc010aeq.2_Silent_p.R314R	NM_007249	NP_009180	Q9Y4X4	KLF12_HUMAN	Kruppel-like factor 12	314					negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1		Prostate(6;0.00217)|Breast(118;0.0838)		GBM - Glioblastoma multiforme(99;0.00677)		TGTGGATACGCCGTTTTCTGG	0.468													61	36	---	---	---	---	PASS
LMO7	4008	broad.mit.edu	37	13	76415914	76415914	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:76415914G>T	uc001vjv.2	+	21	3887	c.3127G>T	c.(3127-3129)GAA>TAA	p.E1043*	LMO7_uc010thv.1_Nonsense_Mutation_p.E994*|LMO7_uc001vjt.1_Nonsense_Mutation_p.E942*|LMO7_uc010thw.1_Nonsense_Mutation_p.E920*|LMO7_uc001vjw.1_Nonsense_Mutation_p.E949*	NM_015842	NP_056667	Q8WWI1	LMO7_HUMAN	LIM domain only 7 isoform 2	1328						cytoplasm|nucleus|ubiquitin ligase complex	ubiquitin-protein ligase activity|zinc ion binding			large_intestine(2)|ovary(1)|prostate(1)|skin(1)	5		Breast(118;0.0992)		GBM - Glioblastoma multiforme(99;0.0109)		GCCACAAGAGGAAGTTGTTCA	0.512													30	60	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77641898	77641898	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77641898G>A	uc001vkf.2	-	72	12250	c.12159C>T	c.(12157-12159)ATC>ATT	p.I4053I	MYCBP2_uc010aev.2_Silent_p.I3457I|MYCBP2_uc001vke.2_Silent_p.I670I	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	4053					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TTGAGTGAATGATATCACTGA	0.448													7	224	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78137971	78137971	+	Missense_Mutation	SNP	T	C	C	rs78419173		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78137971T>C	uc001vki.2	+	5	397	c.227T>C	c.(226-228)GTA>GCA	p.V76A	SCEL_uc001vkj.2_Missense_Mutation_p.V76A|SCEL_uc010thx.1_Missense_Mutation_p.V76A	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1	76					embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TACAGGAAAGTAAATGAGAGA	0.308													68	40	---	---	---	---	PASS
SLITRK1	114798	broad.mit.edu	37	13	84454902	84454902	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:84454902C>A	uc001vlk.2	-	1	1627	c.741G>T	c.(739-741)CTG>CTT	p.L247L		NM_052910	NP_443142	Q96PX8	SLIK1_HUMAN	slit and trk like 1 protein precursor	247	Extracellular (Potential).|LRRCT 1.					integral to membrane				ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		CTTTACCCTGCAGTCTGGTGG	0.552													15	69	---	---	---	---	PASS
SLITRK5	26050	broad.mit.edu	37	13	88330197	88330197	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:88330197G>T	uc001vln.2	+	2	2773	c.2554G>T	c.(2554-2556)GAC>TAC	p.D852Y	SLITRK5_uc010tic.1_Missense_Mutation_p.D611Y	NM_015567	NP_056382	O94991	SLIK5_HUMAN	SLIT and NTRK-like family, member 5 precursor	852	Cytoplasmic (Potential).					integral to membrane				ovary(2)|pancreas(2)|central_nervous_system(1)	5	all_neural(89;0.101)|Medulloblastoma(90;0.163)					GCAGGACGCCGACCGCTTTTA	0.647													10	9	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101833626	101833626	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101833626G>C	uc001vox.1	-						NALCN_uc001voy.2_Intron|NALCN_uc001voz.2_Silent_p.L609L|NALCN_uc001vpa.2_Silent_p.L609L	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTGGAGGCTGGAGAGGAAGGC	0.537													44	42	---	---	---	---	PASS
ITGBL1	9358	broad.mit.edu	37	13	102231757	102231757	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102231757G>T	uc001vpb.2	+	5	925	c.706G>T	c.(706-708)GGC>TGC	p.G236C	ITGBL1_uc010agb.2_Missense_Mutation_p.G187C|ITGBL1_uc001vpc.3_Missense_Mutation_p.G95C	NM_004791	NP_004782	O95965	ITGBL_HUMAN	integrin, beta-like 1 (with EGF-like repeat	236	V.|Cysteine-rich tandem repeats.				cell-matrix adhesion|integrin-mediated signaling pathway	extracellular region|integrin complex	binding|receptor activity			ovary(1)|skin(1)	2	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTCTCCAGATGGCAAAATCTG	0.423													27	33	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389723	20389723	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389723A>T	uc010tkw.1	+	1	958	c.958A>T	c.(958-960)ACT>TCT	p.T320S		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	320	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AGTAGTGAGAACTTCCTTTCA	0.358													22	126	---	---	---	---	PASS
RNASE13	440163	broad.mit.edu	37	14	21502089	21502089	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21502089G>C	uc001vzj.2	-	2	497	c.359C>G	c.(358-360)CCC>CGC	p.P120R	NDRG2_uc010tll.1_Intron	NM_001012264	NP_001012264	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 precursor	120						extracellular region	nucleic acid binding|pancreatic ribonuclease activity			upper_aerodigestive_tract(1)	1	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		GCAGCTAGTGGGTGGCTGTTG	0.498													56	137	---	---	---	---	PASS
SUPT16H	11198	broad.mit.edu	37	14	21831420	21831420	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21831420C>A	uc001wao.2	-	12	1706	c.1367G>T	c.(1366-1368)CGG>CTG	p.R456L		NM_007192	NP_009123	Q9Y5B9	SP16H_HUMAN	chromatin-specific transcription elongation	456	Potential.				DNA repair|DNA replication|nucleosome disassembly|positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	chromosome|nucleoplasm	GTP binding				0	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TAATGCTGCCCGAGAACCTCT	0.254													8	21	---	---	---	---	PASS
NFATC4	4776	broad.mit.edu	37	14	24838738	24838738	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24838738G>A	uc001wpc.2	+	2	455	c.134G>A	c.(133-135)CGT>CAT	p.R45H	NFATC4_uc010tok.1_Missense_Mutation_p.R108H|NFATC4_uc010tol.1_Missense_Mutation_p.R108H|NFATC4_uc010alr.2_Missense_Mutation_p.R108H|NFATC4_uc010als.2_Missense_Mutation_p.R58H|NFATC4_uc010tom.1_Missense_Mutation_p.R58H|NFATC4_uc010ton.1_Missense_Mutation_p.R58H|NFATC4_uc010too.1_Missense_Mutation_p.R58H|NFATC4_uc010alt.2_Missense_Mutation_p.R77H|NFATC4_uc010top.1_Missense_Mutation_p.R77H|NFATC4_uc010toq.1_Missense_Mutation_p.R77H|NFATC4_uc010alu.2_Missense_Mutation_p.R45H|NFATC4_uc010tor.1_Missense_Mutation_p.R45H|NFATC4_uc010tos.1_5'UTR|NFATC4_uc010tot.1_Missense_Mutation_p.R33H|NFATC4_uc010tou.1_5'UTR|NFATC4_uc010tov.1_Missense_Mutation_p.R33H|NFATC4_uc010tow.1_5'UTR|NFATC4_uc010alv.2_Missense_Mutation_p.R33H|NFATC4_uc010tox.1_5'UTR	NM_004554	NP_004545	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells,	45	Pro-rich.				cell differentiation|inflammatory response|transcription from RNA polymerase II promoter	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(265;0.018)		CCATGCTGCCGTCTGGCCTTG	0.622													88	242	---	---	---	---	PASS
AKAP6	9472	broad.mit.edu	37	14	33292897	33292897	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33292897C>T	uc001wrq.2	+	13	6048	c.5878C>T	c.(5878-5880)CTT>TTT	p.L1960F		NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6	1960					protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TGTTAGACATCTTCCAAAGAA	0.388													8	117	---	---	---	---	PASS
NPAS3	64067	broad.mit.edu	37	14	33684378	33684378	+	Intron	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:33684378T>C	uc001wru.2	+						NPAS3_uc001wrs.2_Intron|NPAS3_uc001wrt.2_Intron|NPAS3_uc001wrv.2_Intron|NPAS3_uc001wrw.2_5'Flank	NM_173159	NP_071406	Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3 isoform 3						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			ovary(1)|skin(1)	2	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		TCTCACTCCTTTGATTTCAGT	0.393													19	67	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42360792	42360792	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42360792G>T	uc001wvm.2	+	4	2923	c.1725G>T	c.(1723-1725)GGG>GGT	p.G575G	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	575	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		AAACTAACGGGGCTCAAATAC	0.453										HNSCC(30;0.082)			21	46	---	---	---	---	PASS
SAMD4A	23034	broad.mit.edu	37	14	55168860	55168860	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55168860G>A	uc001xbb.2	+	2	275	c.274G>A	c.(274-276)GGA>AGA	p.G92R	SAMD4A_uc001xba.2_Missense_Mutation_p.G92R|SAMD4A_uc001xbc.2_Missense_Mutation_p.G92R|SAMD4A_uc001xbf.1_RNA|SAMD4A_uc001xbe.2_5'UTR	NM_015589	NP_056404	Q9UPU9	SMAG1_HUMAN	sterile alpha motif domain containing 4 isoform	93					positive regulation of translation	cell junction|cytoplasm|dendrite|synapse|synaptosome	translation repressor activity				0						GCTGAAGCCAGGAAACCTCGA	0.448													25	50	---	---	---	---	PASS
SLC35F4	341880	broad.mit.edu	37	14	58056099	58056099	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58056099G>A	uc001xdb.1	-	3	530	c.530C>T	c.(529-531)TCT>TTT	p.S177F	SLC35F4_uc010aoz.1_RNA|SLC35F4_uc010apa.1_Missense_Mutation_p.S18F	NM_001080455	NP_001073924			solute carrier family 35, member F4											ovary(2)	2						TCCAACCCAAGATGATGATAC	0.408													5	35	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64467388	64467388	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64467388G>T	uc001xgm.2	+	28	3819	c.3589G>T	c.(3589-3591)GAC>TAC	p.D1197Y	SYNE2_uc001xgl.2_Missense_Mutation_p.D1197Y	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1197	Cytoplasmic (Potential).|Potential.				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TAAGGAAAGAGACACACTAAA	0.308													41	96	---	---	---	---	PASS
SYNE2	23224	broad.mit.edu	37	14	64519522	64519522	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64519522G>A	uc001xgm.2	+	48	9121	c.8891G>A	c.(8890-8892)CGC>CAC	p.R2964H	SYNE2_uc001xgl.2_Missense_Mutation_p.R2964H	NM_015180	NP_055995	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2964	Potential.|Cytoplasmic (Potential).				centrosome localization|cytoskeletal anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	cytoskeleton|filopodium membrane|focal adhesion|integral to membrane|lamellipodium membrane|mitochondrial part|nuclear outer membrane|nucleoplasm|sarcoplasmic reticulum membrane|SUN-KASH complex|Z disc	actin binding|protein binding			ovary(8)|breast(4)|central_nervous_system(1)|pancreas(1)	14				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGTATACAGCGCAATGAACTA	0.358													16	44	---	---	---	---	PASS
HEATR4	399671	broad.mit.edu	37	14	73987628	73987628	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73987628G>T	uc010tub.1	-	4	1319	c.997C>A	c.(997-999)CGC>AGC	p.R333S	HEATR4_uc010tua.1_Missense_Mutation_p.R286S	NM_203309	NP_976054			HEAT repeat containing 4											ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		GTCACCTGGCGAAAGTAGCTC	0.522													46	81	---	---	---	---	PASS
SPATA7	55812	broad.mit.edu	37	14	88895791	88895791	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88895791C>T	uc001xwq.2	+	8	1163	c.1012C>T	c.(1012-1014)CAG>TAG	p.Q338*	SPATA7_uc001xwr.2_Nonsense_Mutation_p.Q306*|SPATA7_uc001xws.2_Nonsense_Mutation_p.Q274*|SPATA7_uc001xwt.2_Nonsense_Mutation_p.Q232*|SPATA7_uc001xwu.2_5'UTR	NM_018418	NP_060888	Q9P0W8	SPAT7_HUMAN	spermatogenesis-associated protein 7 isoform a	338					response to stimulus|visual perception					ovary(1)	1						TGATGCTCTTCAGCATTCCTC	0.373													4	82	---	---	---	---	PASS
ZC3H14	79882	broad.mit.edu	37	14	89039028	89039028	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:89039028G>A	uc001xww.2	+	6	763	c.538G>A	c.(538-540)GAT>AAT	p.D180N	ZC3H14_uc010twd.1_Missense_Mutation_p.D180N|ZC3H14_uc010twe.1_Missense_Mutation_p.D180N|ZC3H14_uc001xwx.2_Missense_Mutation_p.D180N|ZC3H14_uc010twf.1_Missense_Mutation_p.D25N|ZC3H14_uc001xwy.2_Missense_Mutation_p.D146N|ZC3H14_uc010twg.1_Missense_Mutation_p.D25N	NM_024824	NP_079100	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14 isoform 1	180						cytoplasm|cytoplasm|nuclear speck	protein binding|RNA binding|zinc ion binding			ovary(2)|skin(1)	3						AGAACCAGATGATCTCATTGA	0.438													63	118	---	---	---	---	PASS
RPS6KA5	9252	broad.mit.edu	37	14	91372653	91372653	+	Intron	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91372653G>C	uc001xys.2	-						RPS6KA5_uc010twi.1_Intron|RPS6KA5_uc001xyt.2_Intron|RPS6KA5_uc010att.1_Intron	NM_004755	NP_004746	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, polypeptide 5						axon guidance|epidermal growth factor receptor signaling pathway|histone phosphorylation|innate immune response|interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of histone acetylation|positive regulation of histone phosphorylation|positive regulation of transcription from RNA polymerase II promoter|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		CCTGTAGGCAGACAAAACTTG	0.353													15	53	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93118174	93118174	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93118174C>T	uc001yap.2	+	6	932	c.780C>T	c.(778-780)CGC>CGT	p.R260R	RIN3_uc010auk.2_5'UTR|RIN3_uc001yaq.2_Silent_p.R185R|RIN3_uc001yar.1_5'UTR|RIN3_uc001yas.1_5'UTR	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	260	Pro-rich.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GCCCTGCACGCCCTTTGCCGC	0.468													13	131	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93142918	93142918	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93142918G>A	uc001yap.2	+	8	2586	c.2434G>A	c.(2434-2436)GAG>AAG	p.E812K	RIN3_uc010auk.2_Missense_Mutation_p.E474K|RIN3_uc001yaq.2_Missense_Mutation_p.E737K|RIN3_uc001yas.1_Missense_Mutation_p.E474K	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	812	VPS9.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GTACATGATGGAGCTCATGGA	0.622													14	62	---	---	---	---	PASS
PRIMA1	145270	broad.mit.edu	37	14	94245620	94245620	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94245620A>G	uc001ybw.1	-	3	173	c.131T>C	c.(130-132)GTG>GCG	p.V44A	PRIMA1_uc001ybx.1_RNA	NM_178013	NP_821092	Q86XR5	PRIMA_HUMAN	proline rich membrane anchor 1 precursor	44	Extracellular (Potential).				neurotransmitter catabolic process	cell junction|integral to membrane|synapse				large_intestine(1)|skin(1)	2		all_cancers(154;0.127)		Epithelial(152;0.138)|COAD - Colon adenocarcinoma(157;0.229)		GCTGTCAGTCACTTTGGAGCA	0.363													12	28	---	---	---	---	PASS
TCL1A	8115	broad.mit.edu	37	14	96178694	96178694	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96178694C>G	uc001yfc.3	-	2	290	c.160G>C	c.(160-162)GAA>CAA	p.E54Q	TCL1A_uc001yfb.3_Missense_Mutation_p.E54Q	NM_001098725	NP_001092195	P56279	TCL1A_HUMAN	T-cell leukemia/lymphoma 1A	54					multicellular organismal development	endoplasmic reticulum|microsome				lung(1)	1		all_cancers(154;0.103)		COAD - Colon adenocarcinoma(157;0.205)|Epithelial(152;0.248)		ACGACGTCTTCCCGACGCAAG	0.567			T	TRA@	T-CLL								37	105	---	---	---	---	PASS
DEGS2	123099	broad.mit.edu	37	14	100615443	100615443	+	Silent	SNP	G	A	A	rs145891510		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100615443G>A	uc001ygx.2	-	2	775	c.687C>T	c.(685-687)TTC>TTT	p.F229F		NM_206918	NP_996801	Q6QHC5	DEGS2_HUMAN	degenerative spermatocyte homolog 2, lipid	229	Helical; (Potential).				fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	sphingosine hydroxylase activity				0		Melanoma(154;0.212)				GCTCGGCCACGAAGTGGCCCG	0.622													37	135	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106091400	106091400	+	RNA	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106091400T>C	uc010tyt.1	-	3647		c.62108A>G			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron					Parts of antibodies, mostly variable regions.												0						CTTGGCATTATGCACCTCCAC	0.612													83	253	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106235584	106235584	+	RNA	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106235584G>A	uc010tyt.1	-	3617		c.58263C>T			uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Intron|uc001yrx.1_Intron|uc001yrz.1_Intron|uc001yse.2_Intron|uc001ysf.2_Intron|uc001ysh.1_RNA|uc001ysi.1_RNA					Parts of antibodies, mostly variable regions.												0						TCATTTACCCGGAGACAGGGA	0.637													14	171	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106622046	106622046	+	RNA	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106622046C>G	uc010tyt.1	-	1113		c.25600G>C								Parts of antibodies, mostly variable regions.												0						ACACCCGATACCCACTCCAGC	0.552													169	278	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106962949	106962949	+	RNA	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106962949G>A	uc010tyt.1	-	207		c.9735C>T								Parts of antibodies, mostly variable regions.												0						AGTAATACATGGCTGTGTCCT	0.512													97	240	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106963124	106963124	+	RNA	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106963124A>G	uc010tyt.1	-	207		c.9560T>C								Parts of antibodies, mostly variable regions.												0						CACCCAGTGCAGGTAGCGGTA	0.557													27	145	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106967343	106967343	+	RNA	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106967343G>C	uc010tyt.1	-	201		c.9098C>G								Parts of antibodies, mostly variable regions.												0						GCTGCACCTGGGAGTGAGCAC	0.542													30	125	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	20170107	20170107	+	IGR	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20170107C>A								None (None upstream) : GOLGA6L6 (566987 downstream)																							CCTGGCACACCCAGTGCATAC	0.567													30	107	---	---	---	---	PASS
MKRN3	7681	broad.mit.edu	37	15	23811259	23811259	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23811259G>A	uc001ywh.3	+	1	806	c.330G>A	c.(328-330)AAG>AAA	p.K110K	MKRN3_uc001ywi.2_Intron|MKRN3_uc010ayi.1_Silent_p.K110K	NM_005664	NP_005655	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	110	C3H1-type 1.					ribonucleoprotein complex	ligase activity|nucleic acid binding|zinc ion binding			lung(6)|large_intestine(2)|ovary(2)	10		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		GGCAGTGCAAGGAGGGGGAGA	0.597													30	100	---	---	---	---	PASS
MAGEL2	54551	broad.mit.edu	37	15	23890784	23890784	+	Silent	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23890784T>A	uc001ywj.3	-	1	392	c.297A>T	c.(295-297)GCA>GCT	p.A99A		NM_019066	NP_061939			MAGE-like protein 2												0		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		AATTTGCCGCTGCTACCGGGG	0.627													8	15	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25326534	25326534	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25326534G>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|SNORD116-16_uc001yya.2_5'Flank|IPW_uc001yyb.3_5'Flank|SNORD116-19_uc001yyc.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCAGCACACTGCTCCATCAGG	0.483													38	148	---	---	---	---	PASS
IPW	3653	broad.mit.edu	37	15	25417840	25417840	+	Intron	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25417840C>A	uc001yyp.1	+						IPW_uc010aym.1_Intron|SNORD115-2_uc001yyr.1_RNA|uc001yys.1_5'Flank|SNORD115-3_uc001yyt.1_5'Flank					Homo sapiens clone kid12 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AAAAATCATGCTCAATAGGAT	0.527													69	195	---	---	---	---	PASS
PAR4	347745	broad.mit.edu	37	15	25446530	25446530	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25446530C>G	uc001yzk.1	+						PAR4_uc010ayo.1_Intron|SNORD115-17_uc001yzn.1_RNA|SNORD115-17_uc001yzo.1_5'Flank|SNORD115-17_uc001yzp.1_5'Flank					Homo sapiens clone Rt-13I SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						AAATCATTCTCAAAAGGATTA	0.493													85	186	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25932875	25932875	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25932875A>G	uc010ayu.2	-	16	3372	c.3266T>C	c.(3265-3267)GTG>GCG	p.V1089A		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	1089	Helical; (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GAAGTACAGCACCATGTTGGC	0.498													47	136	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25958918	25958918	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25958918C>T	uc010ayu.2	-	10	2353	c.2247G>A	c.(2245-2247)ATG>ATA	p.M749I		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	749	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		TCACCACTGACATCCTCTTGC	0.602													26	81	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28235790	28235790	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28235790C>A	uc001zbh.3	-	10	1158	c.1048G>T	c.(1048-1050)GTG>TTG	p.V350L	OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II	350	Cytoplasmic (Potential).		V -> M (in unclassified OCA).		eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		GTTCTGTGCACGATCTGGAAA	0.547									Oculocutaneous_Albinism				59	85	---	---	---	---	PASS
APBA2	321	broad.mit.edu	37	15	29393881	29393881	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:29393881G>C	uc001zck.2	+	9	1625	c.1418G>C	c.(1417-1419)CGC>CCC	p.R473P	APBA2_uc010azj.2_Missense_Mutation_p.R461P|APBA2_uc010uat.1_Missense_Mutation_p.R461P|APBA2_uc001zcl.2_Missense_Mutation_p.R461P|APBA2_uc001zcm.1_Missense_Mutation_p.R165P	NM_005503	NP_005494	Q99767	APBA2_HUMAN	amyloid beta A4 precursor protein-binding,	473	PID.				nervous system development|protein transport		protein binding				0		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		ATGGCCAGACGCCGCATGCCC	0.587													8	24	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31352744	31352744	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31352744C>T	uc001zfm.2	-						TRPM1_uc010azy.2_Intron|TRPM1_uc001zfl.2_Intron	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,						cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AAAACAGTTTCACCGGCCAGT	0.458													12	20	---	---	---	---	PASS
ARHGAP11A	9824	broad.mit.edu	37	15	32926224	32926224	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32926224G>T	uc001zgy.1	+	10	2048	c.1326G>T	c.(1324-1326)GGG>GGT	p.G442G	ARHGAP11A_uc010ubw.1_Silent_p.G253G|ARHGAP11A_uc001zgw.2_Silent_p.G442G|ARHGAP11A_uc001zgx.2_Silent_p.G414G|ARHGAP11A_uc010ubx.1_Silent_p.G253G	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1	442					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		TCAATCTAGGGAAAAATGGCA	0.353													9	23	---	---	---	---	PASS
ATPBD4	89978	broad.mit.edu	37	15	35834710	35834710	+	Splice_Site	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35834710T>A	uc001zja.2	-	2	86	c.24_splice	c.e2-1	p.S8_splice	ATPBD4_uc001ziz.2_5'UTR|ATPBD4_uc001zjb.2_Splice_Site_p.S8_splice	NM_080650	NP_542381	Q7L8W6	ATBD4_HUMAN	ATP binding domain 4 isoform 1												0		all_epithelial(112;2.11e-09)|Lung NSC(122;2.38e-08)|all_lung(180;3.65e-07)		all cancers(64;9.9e-19)|GBM - Glioblastoma multiforme(113;2.01e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)		TTCCCACCACTAAACAATAAA	0.373													56	176	---	---	---	---	PASS
C15orf52	388115	broad.mit.edu	37	15	40628788	40628788	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40628788C>A	uc001zlh.3	-	9	1022	c.1006G>T	c.(1006-1008)GGC>TGC	p.G336C	C15orf52_uc001zli.1_3'UTR|C15orf52_uc010ucn.1_Missense_Mutation_p.G126C	NM_207380	NP_997263	Q6ZUT6	CO052_HUMAN	hypothetical protein LOC388115	336										large_intestine(1)	1		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		CGGGCCCTGCCAGTCAGCCTC	0.642													49	143	---	---	---	---	PASS
DISP2	85455	broad.mit.edu	37	15	40660227	40660227	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40660227C>A	uc001zlk.1	+	8	2003	c.1914C>A	c.(1912-1914)CCC>CCA	p.P638P		NM_033510	NP_277045	A7MBM2	DISP2_HUMAN	dispatched B	638	SSD.				smoothened signaling pathway	integral to membrane				ovary(2)	2		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		TCTGGCTGCCCGCCTCCGCCG	0.552													3	4	---	---	---	---	PASS
RTF1	23168	broad.mit.edu	37	15	41770814	41770814	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41770814C>A	uc001zny.2	+	15	1821	c.1809C>A	c.(1807-1809)ATC>ATA	p.I603I		NM_015138	NP_055953	Q92541	RTF1_HUMAN	Paf1/RNA polymerase II complex component	603					histone modification|regulation of transcription, DNA-dependent|transcription initiation, DNA-dependent	nucleoplasm	protein binding|single-stranded DNA binding			ovary(2)	2		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		AGCCTACCATCGTTTCTAATG	0.398													5	208	---	---	---	---	PASS
CAPN3	825	broad.mit.edu	37	15	42695083	42695083	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42695083T>G	uc001zpn.1	+	13	1934	c.1628T>G	c.(1627-1629)GTG>GGG	p.V543G	CAPN3_uc001zpk.1_Missense_Mutation_p.V316G|CAPN3_uc001zpl.1_Missense_Mutation_p.V456G|CAPN3_uc010udf.1_Missense_Mutation_p.V456G|CAPN3_uc010udg.1_Missense_Mutation_p.V408G|CAPN3_uc001zpo.1_Missense_Mutation_p.V543G|CAPN3_uc001zpp.1_Missense_Mutation_p.V495G|CAPN3_uc001zpq.1_Missense_Mutation_p.V31G|CAPN3_uc010bcv.1_5'Flank|CAPN3_uc001zpr.1_5'Flank|CAPN3_uc001zps.1_5'Flank|CAPN3_uc001zpt.1_5'Flank	NM_000070	NP_000061	P20807	CAN3_HUMAN	calpain 3 isoform a	543	Domain III.				muscle organ development|proteolysis	cytoplasm	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity|signal transducer activity			central_nervous_system(1)	1		all_cancers(109;1.65e-16)|all_epithelial(112;8.34e-15)|Lung NSC(122;3.56e-09)|all_lung(180;1.68e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;7.36e-07)		ATGCGGGAGGTGTCCCAGCGC	0.587													49	109	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43819299	43819299	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43819299C>G	uc001zrt.2	+	4	6095	c.5628C>G	c.(5626-5628)TTC>TTG	p.F1876L		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1876						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CTGCACCCTTCTCTTGGGGCA	0.662													20	32	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48719794	48719794	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48719794G>A	uc001zwx.1	-	58	7502	c.7174C>T	c.(7174-7176)CAT>TAT	p.H2392Y	FBN1_uc010beo.1_RNA	NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	2392					heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CCTCGGCCATGGGGACAGAGT	0.478													47	89	---	---	---	---	PASS
FBN1	2200	broad.mit.edu	37	15	48788313	48788313	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48788313A>G	uc001zwx.1	-	20	2731	c.2403T>C	c.(2401-2403)GAT>GAC	p.D801D		NM_000138	NP_000129	P35555	FBN1_HUMAN	fibrillin 1 precursor	801	EGF-like 12; calcium-binding.				heart development|negative regulation of BMP signaling pathway by extracellular sequestering of BMP|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|skeletal system development	basement membrane|extracellular space|microfibril	calcium ion binding|extracellular matrix structural constituent|protein binding			ovary(2)|large_intestine(1)	3		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		ATGTTTTTAGATCAGGTTTGT	0.358													27	84	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49048734	49048734	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49048734G>A	uc001zwy.2	-	20	2745	c.2711C>T	c.(2710-2712)TCT>TTT	p.S904F	CEP152_uc001zwz.2_Missense_Mutation_p.S904F|CEP152_uc001zxa.1_Missense_Mutation_p.S811F	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	904	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTTAGCTTCAGAAACAGCAAA	0.323													24	39	---	---	---	---	PASS
GLDN	342035	broad.mit.edu	37	15	51696579	51696579	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51696579T>C	uc002aba.2	+	10	1453	c.1284T>C	c.(1282-1284)GCT>GCC	p.A428A	GLDN_uc002abb.2_Silent_p.A304A	NM_181789	NP_861454	Q6ZMI3	GLDN_HUMAN	gliomedin	428	Extracellular (Potential).|Olfactomedin-like.				cell differentiation|nervous system development	collagen|integral to membrane|plasma membrane				ovary(2)	2				all cancers(107;0.00194)|GBM - Glioblastoma multiforme(94;0.00942)		TCAATCTAGCTGTAGATGAAA	0.413													100	161	---	---	---	---	PASS
DMXL2	23312	broad.mit.edu	37	15	51792045	51792045	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:51792045C>T	uc002abf.2	-	18	3601	c.3376G>A	c.(3376-3378)GAT>AAT	p.D1126N	DMXL2_uc010ufy.1_Missense_Mutation_p.D1126N|DMXL2_uc010bfa.2_Intron	NM_015263	NP_056078	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1126						cell junction|synaptic vesicle membrane	Rab GTPase binding			ovary(6)|skin(3)	9				all cancers(107;0.00494)		ACCAAATCATCAAGATGAATT	0.373													27	50	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	53908224	53908224	+	Missense_Mutation	SNP	G	T	T	rs28470860		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53908224G>T	uc002acj.2	-	15	2221	c.2179C>A	c.(2179-2181)CTG>ATG	p.L727M	WDR72_uc010bfi.1_Missense_Mutation_p.L727M	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	727										lung(1)|skin(1)	2				all cancers(107;0.0511)		CTTTTTCTCAGTGTCAGTGTC	0.473													26	71	---	---	---	---	PASS
PYGO1	26108	broad.mit.edu	37	15	55881056	55881056	+	5'Flank	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55881056G>A	uc010bfl.1	-						PYGO1_uc002adf.1_5'Flank	NM_015617	NP_056432	Q9Y3Y4	PYGO1_HUMAN	pygopus homolog 1						Wnt receptor signaling pathway	nucleus	zinc ion binding			ovary(1)|skin(1)	2				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GGCATGTGGGGATCCAGATTC	0.562													23	59	---	---	---	---	PASS
TEX9	374618	broad.mit.edu	37	15	56665712	56665712	+	Intron	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56665712T>A	uc002adp.2	+						TEX9_uc002ado.1_Intron|TEX9_uc010ugl.1_Intron|TEX9_uc002adq.1_Intron	NM_198524	NP_940926	Q8N6V9	TEX9_HUMAN	testis expressed 9												0				all cancers(107;0.0394)|GBM - Glioblastoma multiforme(80;0.056)		AGTAAGTATATGTACAATTAT	0.199													5	28	---	---	---	---	PASS
RNF111	54778	broad.mit.edu	37	15	59323142	59323142	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59323142G>C	uc002afv.2	+	2	400	c.121G>C	c.(121-123)GAG>CAG	p.E41Q	RNF111_uc002afs.2_Missense_Mutation_p.E41Q|RNF111_uc002aft.2_Missense_Mutation_p.E41Q|RNF111_uc002afu.2_Missense_Mutation_p.E41Q|RNF111_uc002afw.2_Missense_Mutation_p.E41Q	NM_017610	NP_060080	Q6ZNA4	RN111_HUMAN	ring finger protein 111	41					multicellular organismal development|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2				all cancers(107;0.194)		TTTGCATCCAGAGCCCATTGG	0.428													17	41	---	---	---	---	PASS
PLEKHO2	80301	broad.mit.edu	37	15	65153733	65153733	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65153733G>A	uc002anv.2	+	5	576	c.442G>A	c.(442-444)GGC>AGC	p.G148S	PLEKHO2_uc010bgz.2_Intron|PLEKHO2_uc002anw.2_Missense_Mutation_p.G98S	NM_025201	NP_079477	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O	148										ovary(1)|lung(1)	2						GGTGCGAGGGGGCCAGCGACG	0.637													8	18	---	---	---	---	PASS
DENND4A	10260	broad.mit.edu	37	15	66044854	66044854	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66044854T>G	uc002aph.2	-	4	802	c.424A>C	c.(424-426)ATC>CTC	p.I142L	DENND4A_uc002api.2_Missense_Mutation_p.I142L|DENND4A_uc002apj.3_Missense_Mutation_p.I142L|DENND4A_uc010ujj.1_Missense_Mutation_p.I142L	NM_005848	NP_005839	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A isoform 2	142	MABP.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	4						CGGTAAGTGATATAAATTCTT	0.418													15	47	---	---	---	---	PASS
LBXCOR1	390598	broad.mit.edu	37	15	68119422	68119422	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68119422C>T	uc002aqy.1	+	3	1124	c.1124C>T	c.(1123-1125)CCA>CTA	p.P375L		NM_001031807	NP_001026977	P84550	SKOR1_HUMAN	transcriptional corepressor Corl1	419					negative regulation of BMP signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|dendrite|neuronal cell body|nucleus	nucleotide binding|SMAD binding|transcription repressor activity				0						GCGGGCGAGCCAAAGGGCGGT	0.388													8	40	---	---	---	---	PASS
FEM1B	10116	broad.mit.edu	37	15	68582929	68582929	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68582929G>C	uc002arg.2	+	2	1848	c.1233G>C	c.(1231-1233)TTG>TTC	p.L411F	FEM1B_uc002arh.2_Missense_Mutation_p.L331F	NM_015322	NP_056137	Q9UK73	FEM1B_HUMAN	fem-1 homolog b	411					apoptosis|induction of apoptosis|regulation of DNA damage checkpoint|regulation of ubiquitin-protein ligase activity	cytoplasm|nucleus	death receptor binding|ubiquitin-protein ligase activity				0						AATGTGTTTTGAGATGCAGTG	0.363													4	162	---	---	---	---	PASS
UBL7	84993	broad.mit.edu	37	15	74738472	74738472	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74738472G>A	uc002axw.1	-	11	1264	c.1102C>T	c.(1102-1104)CAA>TAA	p.Q368*	UBL7_uc002axx.1_Nonsense_Mutation_p.Q408*|UBL7_uc010bjr.1_Nonsense_Mutation_p.Q259*|UBL7_uc002axy.1_Nonsense_Mutation_p.Q368*|UBL7_uc002axz.1_Nonsense_Mutation_p.Q368*	NM_032907	NP_116296	Q96S82	UBL7_HUMAN	ubiquitin-like 7	368	UBA.						protein binding			ovary(1)	1						AGGGCTGCTTGGATGTCCCCA	0.642													53	89	---	---	---	---	PASS
MAN2C1	4123	broad.mit.edu	37	15	75650580	75650580	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75650580T>A	uc002baf.2	-	21	2526	c.2509A>T	c.(2509-2511)ACC>TCC	p.T837S	MAN2C1_uc002bag.2_Missense_Mutation_p.T837S|MAN2C1_uc002bah.2_Missense_Mutation_p.T854S|MAN2C1_uc010bkk.2_Missense_Mutation_p.T738S	NM_006715	NP_006706	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	837					mannose metabolic process		alpha-mannosidase activity|carbohydrate binding|protein binding|zinc ion binding				0						TTGTAGTGGGTAGGTCGCTGC	0.597													17	77	---	---	---	---	PASS
SH2D7	646892	broad.mit.edu	37	15	78393758	78393758	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78393758C>T	uc010blb.1	+	5	1163	c.1163C>T	c.(1162-1164)CCA>CTA	p.P388L		NM_001101404	NP_001094874	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7	388											0						GCCAGGGCCCCACATCCTGGG	0.612													11	28	---	---	---	---	PASS
IREB2	3658	broad.mit.edu	37	15	78757687	78757687	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78757687G>C	uc002bdr.2	+	4	529	c.367G>C	c.(367-369)GAT>CAT	p.D123H	IREB2_uc010unb.1_5'UTR|IREB2_uc002bdq.2_Missense_Mutation_p.D123H	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	123							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		TTGTCCGACAGATCTTACAGT	0.408													16	82	---	---	---	---	PASS
CHRNA3	1136	broad.mit.edu	37	15	78911109	78911109	+	Intron	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78911109A>T	uc002bec.2	-						CHRNA3_uc002bea.2_Intron|CHRNA3_uc002beb.2_Intron	NM_000743	NP_000734	P32297	ACHA3_HUMAN	cholinergic receptor, nicotinic, alpha 3						activation of transmembrane receptor protein tyrosine kinase activity|behavioral response to nicotine|locomotory behavior|regulation of acetylcholine secretion|regulation of dendrite morphogenesis|regulation of excitatory postsynaptic membrane potential|regulation of smooth muscle contraction|synaptic transmission involved in micturition|synaptic transmission, cholinergic	cell junction|dendrite|neuronal cell body|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic density|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity			central_nervous_system(3)|ovary(1)	4						CGTGGCTTCCAGCACTCACCA	0.507											OREG0023334	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	41	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79341890	79341890	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79341890G>A	uc002beq.2	-	4	947	c.572C>T	c.(571-573)ACC>ATC	p.T191I	RASGRF1_uc002bep.2_Missense_Mutation_p.T191I|RASGRF1_uc010blm.1_Missense_Mutation_p.T113I|RASGRF1_uc002ber.3_Missense_Mutation_p.T191I	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	191					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GACAGTCTGGGTGGACTGGAT	0.547													23	45	---	---	---	---	PASS
BCL2A1	597	broad.mit.edu	37	15	80260024	80260024	+	Intron	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80260024T>A	uc002bfc.3	-						BCL2A1_uc002bfd.3_Missense_Mutation_p.H144L	NM_004049	NP_004040	Q16548	B2LA1_HUMAN	BCL2-related protein A1 isoform 1						anti-apoptosis|apoptosis	cytoplasm	protein binding			pancreas(1)	1						TGTGTGATTGTGCCATTTCCC	0.388													21	33	---	---	---	---	PASS
RLBP1	6017	broad.mit.edu	37	15	89753509	89753509	+	3'UTR	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89753509G>C	uc002bnl.2	-	9						NM_000326	NP_000317	P12271	RLBP1_HUMAN	retinaldehyde binding protein 1						response to stimulus|visual perception|vitamin A metabolic process	cytoplasm|soluble fraction	retinol binding|transporter activity			central_nervous_system(1)	1	Lung NSC(78;0.0472)|all_lung(78;0.089)				Vitamin A(DB00162)	GCTGGCAGGAGATGTTTTCAG	0.572													53	96	---	---	---	---	PASS
IQGAP1	8826	broad.mit.edu	37	15	91037999	91037999	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91037999G>T	uc002bpl.1	+	36	4784	c.4683G>T	c.(4681-4683)CTG>CTT	p.L1561L	IQGAP1_uc010uqg.1_Silent_p.L182L	NM_003870	NP_003861	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1561	C2.				energy reserve metabolic process|regulation of insulin secretion|small GTPase mediated signal transduction	actin filament|cytoplasm|midbody|nucleus|plasma membrane	calmodulin binding|GTPase inhibitor activity|protein phosphatase binding|Ras GTPase activator activity			ovary(2)|lung(2)|central_nervous_system(2)|pancreas(1)|skin(1)	8	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			AGATTTCTCTGAAATATACAG	0.333													60	111	---	---	---	---	PASS
NTHL1	4913	broad.mit.edu	37	16	2090045	2090045	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2090045C>G	uc002col.1	-	6	838	c.819G>C	c.(817-819)GAG>GAC	p.E273D	NTHL1_uc002com.1_Missense_Mutation_p.E274D	NM_002528	NP_002519	P78549	NTHL1_HUMAN	nth endonuclease III-like 1	273					depyrimidination|nucleotide-excision repair, DNA incision, 5'-to lesion	nucleoplasm	4 iron, 4 sulfur cluster binding|double-stranded DNA binding|endonuclease activity|metal ion binding|oxidized pyrimidine base lesion DNA N-glycosylase activity|protein binding			lung(1)	1						CGTGCCACAGCTCCCTGTGGG	0.652								BER_DNA_glycosylases					4	136	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2326794	2326794	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2326794G>A	uc002cpy.1	-	33	5708	c.4996C>T	c.(4996-4998)CTG>TTG	p.L1666L	ABCA3_uc010bsk.1_Silent_p.L1608L	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	1666					response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				GCTTTCTCCAGAATACCGAAA	0.587													12	65	---	---	---	---	PASS
ABCA3	21	broad.mit.edu	37	16	2349432	2349432	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2349432C>T	uc002cpy.1	-	14	2425	c.1713G>A	c.(1711-1713)GGG>GGA	p.G571G	ABCA3_uc010bsk.1_Silent_p.G513G|ABCA3_uc010bsl.1_Silent_p.G571G	NM_001089	NP_001080	Q99758	ABCA3_HUMAN	ATP-binding cassette, sub-family A member 3	571	ABC transporter 1.|ATP 1 (Potential).				response to drug	integral to membrane|lamellar body|membrane fraction|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			breast(5)|ovary(5)|central_nervous_system(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	16		Ovarian(90;0.17)				TGGTGGTCTTCCCGGCACCGT	0.647													29	139	---	---	---	---	PASS
SRRM2	23524	broad.mit.edu	37	16	2815055	2815055	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2815055G>A	uc002crk.2	+	11	5075	c.4526G>A	c.(4525-4527)TGT>TAT	p.C1509Y	SRRM2_uc002crj.1_Missense_Mutation_p.C1413Y|SRRM2_uc002crl.1_Missense_Mutation_p.C1509Y|SRRM2_uc010bsu.1_Missense_Mutation_p.C1413Y	NM_016333	NP_057417	Q9UQ35	SRRM2_HUMAN	splicing coactivator subunit SRm300	1509	Ser-rich.					Cajal body|catalytic step 2 spliceosome|nuclear speck	C2H2 zinc finger domain binding|protein N-terminus binding|RNA binding			ovary(1)|pancreas(1)|central_nervous_system(1)|skin(1)	4						AACAACAAGTGTCTTACCCCC	0.537													51	196	---	---	---	---	PASS
ZSCAN10	84891	broad.mit.edu	37	16	3140292	3140292	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3140292G>A	uc002ctv.1	-	5	1066	c.978C>T	c.(976-978)TGC>TGT	p.C326C	ZSCAN10_uc002cty.1_5'UTR|ZSCAN10_uc002ctw.1_Silent_p.C244C|ZSCAN10_uc002ctx.1_Silent_p.C254C	NM_032805	NP_116194	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	326	C2H2-type 2.				negative regulation of transcription, DNA-dependent|viral reproduction	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1						AGCTCTTCCCGCAGCAAAGGC	0.697													19	70	---	---	---	---	PASS
BTBD12	84464	broad.mit.edu	37	16	3641118	3641118	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3641118C>G	uc002cvp.2	-	12	3148	c.2521G>C	c.(2521-2523)GAA>CAA	p.E841Q		NM_032444	NP_115820	Q8IY92	SLX4_HUMAN	BTB (POZ) domain containing 12	841	Potential.|Interaction with PLK1 and TERF2-TERF2IP.|Glu-rich.				DNA double-strand break processing involved in repair via single-strand annealing|double-strand break repair via homologous recombination|nucleotide-excision repair	Slx1-Slx4 complex	enzyme activator activity|protein binding				0						TCTTGATCTTCTTCGTGGTCC	0.478								Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia				9	179	---	---	---	---	PASS
ZNF500	26048	broad.mit.edu	37	16	4810574	4810574	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4810574C>A	uc002cxp.1	-	5	926	c.679G>T	c.(679-681)GAG>TAG	p.E227*	ZNF500_uc002cxo.1_Nonsense_Mutation_p.E19*|ZNF500_uc010uxt.1_Nonsense_Mutation_p.E227*	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	227	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						GCCACGTCCTCCAAGTTCACG	0.612													21	99	---	---	---	---	PASS
ZNF500	26048	broad.mit.edu	37	16	4810575	4810575	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4810575C>A	uc002cxp.1	-	5	925	c.678G>T	c.(676-678)TTG>TTT	p.L226F	ZNF500_uc002cxo.1_Missense_Mutation_p.L18F|ZNF500_uc010uxt.1_Missense_Mutation_p.L226F	NM_021646	NP_067678	O60304	ZN500_HUMAN	zinc finger protein 500	226	KRAB.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(1)	3						CCACGTCCTCCAAGTTCACGG	0.617													20	98	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9934639	9934639	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9934639C>A	uc002czo.3	-	7	2064	c.1516G>T	c.(1516-1518)GTC>TTC	p.V506F	GRIN2A_uc010uym.1_Missense_Mutation_p.V506F|GRIN2A_uc010uyn.1_Missense_Mutation_p.V349F|GRIN2A_uc002czr.3_Missense_Mutation_p.V506F	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	506	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ACTGCCATGACTGCCCGTTGA	0.443													42	33	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	10032171	10032171	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10032171G>T	uc002czo.3	-	3	1200	c.652C>A	c.(652-654)CAG>AAG	p.Q218K	GRIN2A_uc010uym.1_Missense_Mutation_p.Q218K|GRIN2A_uc010uyn.1_Missense_Mutation_p.Q61K|GRIN2A_uc002czr.3_Missense_Mutation_p.Q218K	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	218	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TTCTTCAGCTGGACTTGTGTC	0.517													20	103	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17211612	17211612	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17211612C>G	uc002dfa.2	-	11	2533	c.2448G>C	c.(2446-2448)CTG>CTC	p.L816L		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	816	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CCCCAGGCCTCAGGGGCAAGT	0.552													15	50	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19033093	19033093	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19033093C>T	uc002dfq.2	+	4	733	c.603C>T	c.(601-603)TTC>TTT	p.F201F	TMC7_uc010vao.1_Silent_p.F201F|TMC7_uc002dfp.2_Silent_p.F201F|TMC7_uc010vap.1_Silent_p.F91F	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	201	Cytoplasmic (Potential).					integral to membrane				skin(2)|ovary(1)	3						ACAGCAGCTTCGTGCTCATTC	0.423													4	108	---	---	---	---	PASS
ACSM2A	123876	broad.mit.edu	37	16	20482472	20482472	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20482472G>T	uc010bwe.2	+	6	913	c.674G>T	c.(673-675)AGT>ATT	p.S225I	ACSM2A_uc010bwd.1_Intron|ACSM2A_uc010vax.1_Missense_Mutation_p.S146I|ACSM2A_uc002dhf.3_Missense_Mutation_p.S225I|ACSM2A_uc002dhg.3_Missense_Mutation_p.S225I|ACSM2A_uc010vay.1_Missense_Mutation_p.S146I	NM_001010845	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member	225	ATP.				fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|metal ion binding			skin(2)|breast(1)	3						AGTGGGACCAGTGGTCTTCCC	0.512													45	72	---	---	---	---	PASS
THUMPD1	55623	broad.mit.edu	37	16	20749105	20749105	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20749105C>T	uc002dho.2	-	3	718	c.580G>A	c.(580-582)GGG>AGG	p.G194R	THUMPD1_uc010vaz.1_Missense_Mutation_p.G47R|THUMPD1_uc002dhp.2_Missense_Mutation_p.G194R	NM_017736	NP_060206	Q9NXG2	THUM1_HUMAN	THUMP domain containing 1	194	THUMP.										0						TGAAATGTCCCTTTGTTTGGA	0.363													27	97	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	20976398	20976398	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20976398G>C	uc010vbe.1	-	53	8808	c.8808C>G	c.(8806-8808)CTC>CTG	p.L2936L	DNAH3_uc010vbd.1_Silent_p.L371L	NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	2936	Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TCAGGGCCTGGAGCCGATCTA	0.522													100	312	---	---	---	---	PASS
EEF2K	29904	broad.mit.edu	37	16	22269837	22269837	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22269837G>A	uc002dki.2	+	10	1537	c.1052G>A	c.(1051-1053)AGA>AAA	p.R351K	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	351					insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		ACCATCTTGAGAGGAACAGAG	0.532													40	65	---	---	---	---	PASS
LCMT1	51451	broad.mit.edu	37	16	25123230	25123230	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25123230C>G	uc002dnx.1	+	1	184	c.26C>G	c.(25-27)TCT>TGT	p.S9C	LCMT1_uc002dny.1_Missense_Mutation_p.S9C|LCMT1_uc002dnz.1_5'UTR|LCMT1_uc002doa.1_5'UTR|LCMT1_uc002dnw.1_RNA	NM_016309	NP_057393	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1 isoform a	9							protein binding|protein C-terminal carboxyl O-methyltransferase activity|S-adenosylmethionine-dependent methyltransferase activity				0				GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	AGGGAATCCTCTATCACCTCC	0.682													6	36	---	---	---	---	PASS
KIAA0556	23247	broad.mit.edu	37	16	27786317	27786317	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27786317A>C	uc002dow.2	+	24	4385	c.4361A>C	c.(4360-4362)GAC>GCC	p.D1454A		NM_015202	NP_056017	O60303	K0556_HUMAN	hypothetical protein LOC23247	1454										ovary(4)|large_intestine(2)|upper_aerodigestive_tract(1)|skin(1)	8						GTGGGCGGGGACGTCCGCACC	0.627													28	95	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28913589	28913589	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28913589C>G	uc002dro.1	+	17	2590	c.2406C>G	c.(2404-2406)CTC>CTG	p.L802L	uc010vct.1_Intron|ATP2A1_uc002drn.1_Silent_p.L802L|ATP2A1_uc002drp.1_Silent_p.L677L	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	802	Interacts with phospholamban 2 (By similarity).|Helical; Name=6; (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						CCGACGGGCTCCCAGCCACAG	0.657													49	141	---	---	---	---	PASS
ATP2A1	487	broad.mit.edu	37	16	28914425	28914425	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28914425C>T	uc002dro.1	+	20	3003	c.2819C>T	c.(2818-2820)TCC>TTC	p.S940F	uc010vct.1_Intron|ATP2A1_uc002drn.1_Missense_Mutation_p.S940F|ATP2A1_uc002drp.1_Missense_Mutation_p.S815F	NM_173201	NP_775293	O14983	AT2A1_HUMAN	ATPase, Ca++ transporting, fast twitch 1 isoform	940	Helical; Name=9; (By similarity).				apoptosis in response to endoplasmic reticulum stress|apoptotic mitochondrial changes|ATP biosynthetic process|calcium ion import|elevation of endoplasmic reticulum calcium ion concentration|elevation of mitochondrial calcium ion concentration|maintenance of mitochondrion location|negative regulation of striated muscle contraction|platelet activation|positive regulation of fast-twitch skeletal muscle fiber contraction|reduction of endoplasmic reticulum calcium ion concentration|relaxation of skeletal muscle|response to endoplasmic reticulum stress	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|H zone|I band|microsome|perinuclear region of cytoplasm|platelet dense tubular network membrane|sarcoplasmic reticulum|sarcoplasmic reticulum membrane	ATP binding|ATP binding|calcium ion binding|calcium ion binding|calcium-transporting ATPase activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ATCTGCCTCTCCATGTCCCTG	0.662													44	122	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31500570	31500570	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31500570T>G	uc002ecf.3	+	12	1595	c.1576T>G	c.(1576-1578)TAC>GAC	p.Y526D	SLC5A2_uc010car.2_RNA|C16orf58_uc002ecg.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	526	Extracellular (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						CGGCGTGCACTACCTCTACTT	0.642													4	77	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47675523	47675523	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47675523C>G	uc002eev.3	+	16	1580	c.1528C>G	c.(1528-1530)CTG>GTG	p.L510V	PHKB_uc002eeu.3_Missense_Mutation_p.L503V	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	510					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				TCAAGTTTTTCTGAACACATA	0.378													22	41	---	---	---	---	PASS
CYLD	1540	broad.mit.edu	37	16	50783821	50783821	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50783821G>T	uc002egp.1	+	4	627	c.212G>T	c.(211-213)GGA>GTA	p.G71V	CYLD_uc002egn.1_Missense_Mutation_p.G71V|CYLD_uc002ego.2_Missense_Mutation_p.G71V|CYLD_uc010cbs.1_Missense_Mutation_p.G71V|CYLD_uc002egq.1_Missense_Mutation_p.G71V|CYLD_uc002egr.1_Missense_Mutation_p.G71V|CYLD_uc002egs.1_Missense_Mutation_p.G71V	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	71					cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				AATCAGATTGGATTAAAAATT	0.373			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				81	58	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53358337	53358337	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53358337A>T	uc002ehb.2	+	38	8388	c.8224A>T	c.(8224-8226)AAA>TAA	p.K2742*	CHD9_uc002egy.2_Nonsense_Mutation_p.K2726*|CHD9_uc002ehc.2_Nonsense_Mutation_p.K2727*|CHD9_uc002ehf.2_Nonsense_Mutation_p.K1840*|CHD9_uc010cbw.2_Nonsense_Mutation_p.K808*	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	2742					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				GACAGAAGACAAAAAGGGAAG	0.473													24	38	---	---	---	---	PASS
ELMO3	79767	broad.mit.edu	37	16	67233628	67233628	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67233628C>A	uc002esa.2	+	3	363	c.320C>A	c.(319-321)GCG>GAG	p.A107E	ELMO3_uc002esb.2_Missense_Mutation_p.A107E|ELMO3_uc002esc.2_5'UTR	NM_024712	NP_078988	Q96BJ8	ELMO3_HUMAN	engulfment and cell motility 3	54					apoptosis|phagocytosis	cytoplasm|cytoskeleton	SH3 domain binding				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00067)|Epithelial(162;0.00442)|all cancers(182;0.0417)		CTGCAGTTTGCGGATGGGCAC	0.682													16	10	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67316211	67316211	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67316211G>A	uc002eso.3	+	8	3747	c.1212G>A	c.(1210-1212)CTG>CTA	p.L404L	PLEKHG4_uc002esp.3_Silent_p.L211L|PLEKHG4_uc002esq.3_Silent_p.L404L|PLEKHG4_uc010cef.2_Silent_p.L404L|PLEKHG4_uc002ess.3_Silent_p.L404L|PLEKHG4_uc010ceg.2_Silent_p.L323L	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	404					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		TGACATGGCTGAAGCAAGAGG	0.612													13	23	---	---	---	---	PASS
CHTF8	54921	broad.mit.edu	37	16	69154502	69154502	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69154502G>A	uc002ewn.1	-	4	293	c.192C>T	c.(190-192)ATC>ATT	p.I64I	CHTF8_uc002ewm.1_5'UTR|CHTF8_uc002ewo.1_Silent_p.I45I|CHTF8_uc002ewp.1_Silent_p.I64I	NM_001040146	NP_001035236	P0CG13	CTF8_HUMAN	chromosome transmission fidelity factor 8	64					cell cycle|DNA replication	nucleus	DNA binding				0						TCTCCAGGTGGATGATTTTCC	0.537													18	62	---	---	---	---	PASS
PDPR	55066	broad.mit.edu	37	16	70177543	70177543	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70177543C>G	uc002eyf.1	+	14	2693	c.1736C>G	c.(1735-1737)GCA>GGA	p.A579G	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.A479G|PDPR_uc002eyg.1_Missense_Mutation_p.A307G|PDPR_uc002eyh.2_5'Flank|PDPR_uc010vls.1_5'Flank	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	579					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		TGCAGCATAGCACGACTGAAC	0.552													3	37	---	---	---	---	PASS
PHLPP2	23035	broad.mit.edu	37	16	71682897	71682897	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71682897C>G	uc002fax.2	-	18	3874	c.3868G>C	c.(3868-3870)GAA>CAA	p.E1290Q	PHLPP2_uc002fav.2_Intron|PHLPP2_uc010cgf.2_Missense_Mutation_p.E1223Q	NM_015020	NP_055835	Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein	1290						cytoplasm|membrane|nucleus	metal ion binding|phosphoprotein phosphatase activity			ovary(1)|central_nervous_system(1)	2						TCCTTCACTTCTTCTTCCAGG	0.557													3	100	---	---	---	---	PASS
PSMD7	5713	broad.mit.edu	37	16	74339345	74339345	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74339345T>A	uc002fcq.2	+	7	821	c.689T>A	c.(688-690)CTG>CAG	p.L230Q	PSMD7_uc010vmr.1_Missense_Mutation_p.L153Q	NM_002811	NP_002802	P51665	PSD7_HUMAN	proteasome 26S non-ATPase subunit 7	230					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0						ATCTACCAGCTGCAGGACGTC	0.527													27	12	---	---	---	---	PASS
WDR59	79726	broad.mit.edu	37	16	74949878	74949878	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74949878G>A	uc002fdh.1	-	13	1216	c.1114C>T	c.(1114-1116)CCC>TCC	p.P372S	WDR59_uc002fdi.2_Missense_Mutation_p.P372S|WDR59_uc002fdj.2_Missense_Mutation_p.P372S|WDR59_uc002fdg.1_5'UTR	NM_030581	NP_085058	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	372										ovary(1)|breast(1)	2						TTTCTAGGGGGATCTTCTTTT	0.463													24	84	---	---	---	---	PASS
MAF	4094	broad.mit.edu	37	16	79632723	79632723	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79632723G>C	uc002ffn.2	-	1	1900	c.1077C>G	c.(1075-1077)AAC>AAG	p.N359K	MAF_uc002ffm.2_Missense_Mutation_p.N359K	NM_001031804	NP_001026974	O75444	MAF_HUMAN	v-maf musculoaponeurotic fibrosarcoma oncogene	359	Represses ARE-mediated transcription.				transcription from RNA polymerase II promoter	chromatin|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1		all_epithelial(2;0.139)|Lung NSC(2;0.186)|Melanoma(2;0.211)		UCEC - Uterine corpus endometrioid carcinoma (2;0.0178)		TGCTCGAGCCGTTTTCTCGGA	0.592			T	IGH@	MM								15	21	---	---	---	---	PASS
TAF1C	9013	broad.mit.edu	37	16	84212912	84212912	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84212912G>A	uc002fhn.2	-	14	2473	c.2245C>T	c.(2245-2247)CGG>TGG	p.R749W	TAF1C_uc002fhm.2_Missense_Mutation_p.R655W|TAF1C_uc010vnx.1_Missense_Mutation_p.R723W|TAF1C_uc010vny.1_Missense_Mutation_p.R340W|TAF1C_uc010vnz.1_Missense_Mutation_p.R417W|TAF1C_uc002fho.2_Missense_Mutation_p.R272W|TAF1C_uc010voa.1_Missense_Mutation_p.R417W|TAF1C_uc002fhp.1_Intron	NM_005679	NP_005670	Q15572	TAF1C_HUMAN	TBP-associated factor 1C isoform 1	749					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	nucleoplasm	DNA binding			ovary(1)	1						CGCTTGGGCCGCCTGGTCTGT	0.687													11	11	---	---	---	---	PASS
NXN	64359	broad.mit.edu	37	17	729316	729316	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:729316G>C	uc002fsa.2	-	2	455	c.363C>G	c.(361-363)CTC>CTG	p.L121L	NXN_uc002fsb.1_Silent_p.L8L|NXN_uc002frz.2_5'UTR|NXN_uc010vqe.1_Silent_p.L13L	NM_022463	NP_071908	Q6DKJ4	NXN_HUMAN	nucleoredoxin	121					cell differentiation|cell redox homeostasis|multicellular organismal development|Wnt receptor signaling pathway	cytosol|nucleus	protein-disulfide reductase activity			ovary(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (25;0.0237)		TCCAAAGTTTGAGCTGTATGA	0.468													13	39	---	---	---	---	PASS
SGSM2	9905	broad.mit.edu	37	17	2279103	2279103	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2279103G>A	uc002fun.3	+	17	2458	c.2283G>A	c.(2281-2283)GAG>GAA	p.E761E	SGSM2_uc002fum.3_Silent_p.E806E|SGSM2_uc010vqw.1_Silent_p.E761E|SGSM2_uc002fup.1_5'UTR|SGSM2_uc002fuq.2_5'Flank	NM_001098509	NP_001091979	O43147	SGSM2_HUMAN	RUN and TBC1 domain containing 1 isoform 2	761	Rab-GAP TBC.					intracellular	Rab GTPase activator activity				0				Colorectal(2;5.15e-05)|READ - Rectum adenocarcinoma(2;0.000115)		CCAGCCAGGAGAAGCCTCAGG	0.677													66	37	---	---	---	---	PASS
NLRP1	22861	broad.mit.edu	37	17	5418228	5418228	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5418228G>T	uc002gci.2	-	17	4823	c.4268C>A	c.(4267-4269)CCC>CAC	p.P1423H	NLRP1_uc002gcg.1_Intron|NLRP1_uc002gck.2_Missense_Mutation_p.P1379H|NLRP1_uc002gcj.2_Missense_Mutation_p.P1393H|NLRP1_uc002gcl.2_Missense_Mutation_p.P1349H|NLRP1_uc002gch.3_Missense_Mutation_p.P1379H	NM_033004	NP_127497	Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1 isoform 1	1423	CARD.				defense response to bacterium|induction of apoptosis|neuron apoptosis|positive regulation of interleukin-1 beta secretion|response to muramyl dipeptide	cytoplasm|NALP1 inflammasome complex|nucleus	ATP binding|caspase activator activity|enzyme binding|protein domain specific binding			lung(4)|breast(2)|ovary(1)|central_nervous_system(1)|skin(1)	9		Colorectal(1115;3.48e-05)				CATCTGGCTGGGCCTCGTGTT	0.572													32	24	---	---	---	---	PASS
ACADVL	37	broad.mit.edu	37	17	7124370	7124370	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7124370A>T	uc002gev.2	+	6	621	c.470A>T	c.(469-471)AAC>ATC	p.N157I	DLG4_uc002get.3_5'Flank|DLG4_uc010vto.1_5'Flank|ACADVL_uc010vtp.1_Missense_Mutation_p.N167I|ACADVL_uc010vtq.1_Missense_Mutation_p.N203I|ACADVL_uc002gew.2_Missense_Mutation_p.N135I|ACADVL_uc002gex.2_Missense_Mutation_p.N81I	NM_000018	NP_000009	P49748	ACADV_HUMAN	acyl-Coenzyme A dehydrogenase, very long chain	157	Catalytic.				energy derivation by oxidation of organic compounds|fatty acid beta-oxidation using acyl-CoA dehydrogenase|negative regulation of fatty acid biosynthetic process|negative regulation of fatty acid oxidation|regulation of cholesterol metabolic process|temperature homeostasis	mitochondrial inner membrane|mitochondrial nucleoid	long-chain-acyl-CoA dehydrogenase activity			ovary(3)	3						GGCCTTTGCAACACCCAGGTG	0.597													44	31	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577046	7577046	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577046C>A	uc002gim.2	-	8	1086	c.892G>T	c.(892-894)GAG>TAG	p.E298*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E298*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E166*|TP53_uc010cng.1_Nonsense_Mutation_p.E166*|TP53_uc002gii.1_Nonsense_Mutation_p.E166*|TP53_uc010cnh.1_Nonsense_Mutation_p.E298*|TP53_uc010cni.1_Nonsense_Mutation_p.E298*|TP53_uc002gij.2_Nonsense_Mutation_p.E298*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	298	Interaction with HIPK1 (By similarity).		E -> V (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> A (in a sporadic cancer; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E298*(35)|p.0?(7)|p.E298K(2)|p.?(2)|p.E298V(2)|p.L299fs*2(1)|p.L265_K305del41(1)|p.E298A(1)|p.E298fs*53(1)|p.G293fs*1(1)|p.E298fs*47(1)|p.E298E(1)|p.E298Q(1)|p.E298_P301delELPP(1)|p.H296_S303delHHELPPGS(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGGGGCAGCTCGTGGTGAGGC	0.567		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			47	45	---	---	---	---	PASS
PFAS	5198	broad.mit.edu	37	17	8166571	8166571	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8166571G>C	uc002gkr.2	+	13	1696	c.1555G>C	c.(1555-1557)GCT>CCT	p.A519P	PFAS_uc010vuv.1_Missense_Mutation_p.A95P|PFAS_uc010cnw.1_Missense_Mutation_p.A73P|PFAS_uc002gks.2_5'Flank	NM_012393	NP_036525	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	519					'de novo' IMP biosynthetic process|glutamine metabolic process|purine base metabolic process	cytosol	ATP binding|phosphoribosylformylglycinamidine synthase activity|protein binding			ovary(2)|central_nervous_system(2)|pancreas(1)	5					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TGATCAGGGCGCTGGTGGCAA	0.562													56	58	---	---	---	---	PASS
PIK3R6	146850	broad.mit.edu	37	17	8753098	8753098	+	Splice_Site	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8753098C>T	uc002glq.1	-	2	253	c.13_splice	c.e2+1	p.D5_splice	PIK3R6_uc002glr.1_Splice_Site|PIK3R6_uc002gls.1_Splice_Site	NM_001010855	NP_001010855	Q5UE93	PI3R6_HUMAN	phosphoinositide-3-kinase, regulatory subunit 6						platelet activation	cytosol					0						ACCACACTGACCTGAGCTCTC	0.597													12	7	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10351127	10351127	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10351127C>G	uc002gmn.2	-						uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle						muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						GTATTTACCCCAGCATACCTT	0.408													91	95	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10355635	10355635	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10355635C>A	uc002gmn.2	-	27	3472	c.3361G>T	c.(3361-3363)GAG>TAG	p.E1121*	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1121	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TCCTCCAGCTCCTCAATGCGG	0.522													62	35	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10411242	10411242	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10411242C>A	uc002gmo.2	-	17	2023	c.1929G>T	c.(1927-1929)AAG>AAT	p.K643N	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	643	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						AAGAACCCTTCTTCTTACCAC	0.378													50	35	---	---	---	---	PASS
MPRIP	23164	broad.mit.edu	37	17	17046940	17046940	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17046940G>C	uc002gqu.1	+	9	1162	c.1106G>C	c.(1105-1107)AGA>ACA	p.R369T	MPRIP_uc002gqv.1_Missense_Mutation_p.R369T|MPRIP_uc002gqw.1_Intron	NM_201274	NP_958431	Q6WCQ1	MPRIP_HUMAN	myosin phosphatase-Rho interacting protein	369	Interaction with F-actin (By similarity).					cytoplasm|cytoskeleton	actin binding				0						CCACACCGAAGAGCCAAGTCA	0.667													10	45	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18647983	18647983	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18647983G>C	uc002guk.2	+	1	658	c.426G>C	c.(424-426)CAG>CAC	p.Q142H	FBXW10_uc002guj.2_Missense_Mutation_p.Q142H|FBXW10_uc002gul.2_Missense_Mutation_p.Q142H|FBXW10_uc010cqh.1_Missense_Mutation_p.Q142H	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	142										ovary(1)	1						TACTGCTGCAGATGTGCAACC	0.453													57	87	---	---	---	---	PASS
SARM1	23098	broad.mit.edu	37	17	26708607	26708607	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26708607G>A	uc010crl.1	+	5	923	c.856G>A	c.(856-858)GAG>AAG	p.E286K	SARM1_uc010wah.1_3'UTR|SARM1_uc010waj.1_RNA	NM_015077	NP_055892	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	286					innate immune response	cytoplasm|intrinsic to membrane	binding|transmembrane receptor activity				0	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GGTGGAGCGCGAGGTGGAGCG	0.682													4	4	---	---	---	---	PASS
TAOK1	57551	broad.mit.edu	37	17	27778620	27778620	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27778620C>G	uc002hdz.1	+	2	248	c.54C>G	c.(52-54)CTC>CTG	p.L18L	TAOK1_uc010wbe.1_Silent_p.L18L|TAOK1_uc010wbf.1_Silent_p.L18L	NM_020791	NP_065842	Q7L7X3	TAOK1_HUMAN	TAO kinase 1	18					mitotic prometaphase	cytosol|intracellular membrane-bounded organelle	ATP binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)|skin(1)	4			Colorectal(6;0.198)			TTGCAGAGCTCTTCTTCAAAG	0.443													36	90	---	---	---	---	PASS
EVI2A	2123	broad.mit.edu	37	17	29645355	29645355	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29645355C>T	uc002hgm.2	-	2	892	c.677G>A	c.(676-678)GGA>GAA	p.G226E	NF1_uc002hgg.2_Intron|NF1_uc002hgh.2_Intron|NF1_uc002hgi.1_Intron|NF1_uc010cso.2_Intron|EVI2A_uc002hgl.2_Missense_Mutation_p.G249E	NM_014210	NP_055025	P22794	EVI2A_HUMAN	ecotropic viral integration site 2A isoform 2	226	Cytoplasmic (Potential).					integral to membrane	transmembrane receptor activity			ovary(1)|breast(1)	2		all_cancers(10;6.97e-11)|all_epithelial(10;0.0051)|all_hematologic(16;0.0149)|Breast(31;0.0155)|Myeloproliferative disorder(56;0.0255)|Acute lymphoblastic leukemia(14;0.0257)|all_lung(9;0.0468)|Lung NSC(157;0.094)		UCEC - Uterine corpus endometrioid carcinoma (4;6.64e-05)|all cancers(4;5.94e-13)|Epithelial(4;7.98e-12)|OV - Ovarian serous cystadenocarcinoma(4;9.4e-12)|GBM - Glioblastoma multiforme(4;0.18)		TTTTTCAGTTCCTTCTTCATC	0.378													18	155	---	---	---	---	PASS
TMEM132E	124842	broad.mit.edu	37	17	32956200	32956200	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32956200C>T	uc002hif.2	+	5	1373	c.1045C>T	c.(1045-1047)CAA>TAA	p.Q349*		NM_207313	NP_997196	Q6IEE7	T132E_HUMAN	transmembrane protein 132E precursor	349	Extracellular (Potential).					integral to membrane				central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(366;0.231)		GCGGGATGTGCAAGCCATCCT	0.592													12	67	---	---	---	---	PASS
PSMB3	5691	broad.mit.edu	37	17	36918668	36918668	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36918668C>T	uc002hqr.2	+	5	557	c.479C>T	c.(478-480)CCG>CTG	p.P160L		NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit	160					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						TGGCAGGATCCGGATCACCTG	0.512													58	119	---	---	---	---	PASS
KRT10	3858	broad.mit.edu	37	17	38974732	38974732	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38974732T>C	uc002hvi.2	-	8	1777	c.1751A>G	c.(1750-1752)TAC>TGC	p.Y584C	KRT10_uc010cxd.2_RNA|TMEM99_uc002hvj.1_5'Flank	NM_000421	NP_000412	P13645	K1C10_HUMAN	keratin 10	584	Tail.				epidermis development		protein binding|structural constituent of epidermis				0		Breast(137;0.000301)				GTTTTGTTAGTATCTGTGTGA	0.333													38	30	---	---	---	---	PASS
KRT12	3859	broad.mit.edu	37	17	39020084	39020084	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39020084G>C	uc002hvk.2	-	4	864	c.840C>G	c.(838-840)GGC>GGG	p.G280G		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	280	Rod.|Linker 12.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				CGCTGACCTCGCCTGGGCCGC	0.498													45	30	---	---	---	---	PASS
KRTAP9-4	85280	broad.mit.edu	37	17	39406130	39406130	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39406130G>A	uc002hwi.2	+	1	192	c.158G>A	c.(157-159)CGC>CAC	p.R53H	KRTAP9-9_uc010wfq.1_Intron	NM_033191	NP_149461	Q9BYQ2	KRA94_HUMAN	keratin associated protein 9-4	53	6.|15 X 5 AA repeats of C-C-[RQVGE]-[SPTN]- [TASPF].					keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CCTTGCTGCCGCCCAACTTGC	0.642													6	132	---	---	---	---	PASS
KRT13	3860	broad.mit.edu	37	17	39661684	39661684	+	Missense_Mutation	SNP	C	A	A	rs144144601		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39661684C>A	uc002hwu.1	-	1	182	c.119G>T	c.(118-120)GGA>GTA	p.G40V	KRT13_uc002hwv.1_Missense_Mutation_p.G40V|KRT13_uc002hww.2_Intron|KRT13_uc010wfr.1_Intron|KRT13_uc010cxo.2_Missense_Mutation_p.G40V|KRT13_uc002hwx.1_Missense_Mutation_p.G40V	NM_153490	NP_705694	P13646	K1C13_HUMAN	keratin 13 isoform a	40	Gly-rich.|Head.				epidermis development	intermediate filament	structural molecule activity			ovary(2)|skin(2)|pancreas(1)	5		Breast(137;0.000286)				CCCAGCTGATCCCCCGGACAC	0.418													43	53	---	---	---	---	PASS
MPP3	4356	broad.mit.edu	37	17	41895442	41895442	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41895442C>T	uc002iei.3	-	12	1084	c.918G>A	c.(916-918)CCG>CCA	p.P306P	MPP3_uc002ieh.2_Silent_p.P331P|MPP3_uc002iej.2_RNA|MPP3_uc010czi.1_Silent_p.P306P|MPP3_uc010wik.1_Silent_p.P331P	NM_001932	NP_001923	Q13368	MPP3_HUMAN	palmitoylated membrane protein 3	306					signal transduction	cell surface|integral to plasma membrane	guanylate kinase activity			large_intestine(1)|skin(1)	2		Breast(137;0.00394)		BRCA - Breast invasive adenocarcinoma(366;0.119)		TCTGGGGGCTCGGCAGGGTGC	0.652													5	17	---	---	---	---	PASS
KPNB1	3837	broad.mit.edu	37	17	45730120	45730120	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45730120A>G	uc002ilt.1	+	3	496	c.160A>G	c.(160-162)AGA>GGA	p.R54G	KPNB1_uc010wkw.1_5'UTR	NM_002265	NP_002256	Q14974	IMB1_HUMAN	karyopherin beta 1	54	Importin N-terminal.				DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TCAGGTTGCCAGAGTTGCAGC	0.413													23	87	---	---	---	---	PASS
HOXB8	3218	broad.mit.edu	37	17	46691796	46691796	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46691796G>T	uc002inw.2	-	1	506	c.271C>A	c.(271-273)CTG>ATG	p.L91M		NM_024016	NP_076921	P17481	HXB8_HUMAN	homeobox B8	91						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						TGGCGTTGCAGCGGGTCGTAG	0.692													39	61	---	---	---	---	PASS
ZNF652	22834	broad.mit.edu	37	17	47394301	47394301	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47394301G>T	uc002iov.3	-	2	1251	c.787C>A	c.(787-789)CAC>AAC	p.H263N	ZNF652_uc002iow.2_Missense_Mutation_p.H263N|ZNF652_uc002iou.3_Intron	NM_001145365	NP_001138837	Q9Y2D9	ZN652_HUMAN	zinc finger protein 652	263	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1	all_cancers(4;6.81e-14)|Breast(4;4.97e-29)|all_epithelial(4;1.53e-17)		BRCA - Breast invasive adenocarcinoma(1;3.1e-14)|Epithelial(5;2.92e-06)|all cancers(6;3.15e-05)			ACGTTCATGTGCTTCTCCAGG	0.483													4	130	---	---	---	---	PASS
PDK2	5164	broad.mit.edu	37	17	48172882	48172882	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48172882C>A	uc002iqc.2	+	1	187	c.83C>A	c.(82-84)CCG>CAG	p.P28Q	PDK2_uc002iqb.2_Intron	NM_002611	NP_002602	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase 2 precursor	28					glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|nucleus	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity			central_nervous_system(3)	3						AAGTTCTCCCCGTCCCCGCTG	0.701									Autosomal_Dominant_Polycystic_Kidney_Disease				8	16	---	---	---	---	PASS
MYCBPAP	84073	broad.mit.edu	37	17	48594754	48594754	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48594754G>T	uc010wmr.1	+	3	596	c.434G>T	c.(433-435)TGC>TTC	p.C145F	MYCBPAP_uc002iqx.2_Missense_Mutation_p.C145F|MYCBPAP_uc002iqz.2_RNA	NM_032133	NP_115509	Q8TBZ2	MYBPP_HUMAN	Myc-binding protein-associated protein	108					cell differentiation|multicellular organismal development|spermatogenesis|synaptic transmission	cytoplasm|membrane	protein binding			urinary_tract(2)|skin(2)|ovary(1)|pancreas(1)	6	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			AGGAAGGTCTGCCACCTTGTA	0.493													39	125	---	---	---	---	PASS
HLF	3131	broad.mit.edu	37	17	53345449	53345449	+	Splice_Site	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53345449T>A	uc002iug.1	+	2	976	c.451_splice	c.e2+2	p.G151_splice	HLF_uc010dce.1_Splice_Site_p.G66_splice|HLF_uc002iuh.2_Splice_Site_p.G66_splice|HLF_uc010wni.1_Splice_Site_p.Q99_splice	NM_002126	NP_002117	Q16534	HLF_HUMAN	hepatic leukemia factor						multicellular organismal development|rhythmic process|transcription from RNA polymerase II promoter	nucleus	double-stranded DNA binding|protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						TCAGACCAGGTAAGTGCCCTG	0.557			T	TCF3	ALL								19	86	---	---	---	---	PASS
HSF5	124535	broad.mit.edu	37	17	56565108	56565108	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56565108C>G	uc002iwi.1	-	1	652	c.528G>C	c.(526-528)GCG>GCC	p.A176A		NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	176	By similarity.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					gccggggccccgcgggcggcg	0.632													4	9	---	---	---	---	PASS
MTMR4	9110	broad.mit.edu	37	17	56581118	56581118	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56581118G>T	uc002iwj.2	-	15	1908	c.1798C>A	c.(1798-1800)CGC>AGC	p.R600S		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	600						cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCCAGAGAGCGGCCAGAGAAC	0.463													40	143	---	---	---	---	PASS
TUBD1	51174	broad.mit.edu	37	17	57937725	57937725	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57937725G>A	uc002ixw.1	-	9	1598	c.1320C>T	c.(1318-1320)TTC>TTT	p.F440F	TUBD1_uc010ddf.1_Silent_p.F338F|TUBD1_uc010ddg.1_Silent_p.F405F|TUBD1_uc010ddh.1_Silent_p.F266F|TUBD1_uc010wok.1_Silent_p.F383F|TUBD1_uc002ixx.1_Silent_p.F385F|TUBD1_uc010wol.1_Silent_p.F224F|TUBD1_uc010ddi.1_Silent_p.F186F	NM_016261	NP_057345	Q9UJT1	TBD_HUMAN	delta-tubulin	440					cell differentiation|microtubule-based movement|multicellular organismal development|protein polymerization|spermatogenesis	centriole|microtubule|nucleus	GTP binding|GTPase activity|structural molecule activity			ovary(1)	1	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)			CTAATGACGTGAAACTGTCTA	0.318													11	87	---	---	---	---	PASS
C17orf64	124773	broad.mit.edu	37	17	58506928	58506928	+	Intron	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58506928A>G	uc002iyq.2	+							NM_181707	NP_859058	Q86WR6	CQ064_HUMAN	hypothetical protein LOC124773											breast(1)	1	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;5.81e-13)|all cancers(12;2.17e-11)|Colorectal(3;0.01)			GGTAATGACCATTTGGTGTTG	0.592													15	70	---	---	---	---	PASS
EFCAB3	146779	broad.mit.edu	37	17	60464772	60464772	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60464772T>A	uc002izu.1	+	3	224	c.146T>A	c.(145-147)ATG>AAG	p.M49K	EFCAB3_uc010wpc.1_Missense_Mutation_p.M101K	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b	49	EF-hand 1.						calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			GCTTCACAAATGGCAGGTAAT	0.363													51	77	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60813357	60813357	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60813357G>A	uc010ddr.2	-	6	2110	c.1872C>T	c.(1870-1872)TTC>TTT	p.F624F	MARCH10_uc002jag.3_Silent_p.F624F|MARCH10_uc010dds.2_Silent_p.F662F|MARCH10_uc002jah.2_Silent_p.F623F|uc002jaj.1_RNA|uc002jak.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	624							ligase activity|zinc ion binding				0						TTTCATCTGTGAAACCAGAGG	0.383													48	202	---	---	---	---	PASS
RGS9	8787	broad.mit.edu	37	17	63193283	63193283	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63193283C>A	uc002jfe.2	+	13	1010	c.900C>A	c.(898-900)GCC>GCA	p.A300A	RGS9_uc010dem.2_Silent_p.A297A|RGS9_uc002jfd.2_Silent_p.A297A|RGS9_uc002jff.2_RNA|RGS9_uc002jfg.2_Silent_p.A71A	NM_003835	NP_003826	O75916	RGS9_HUMAN	regulator of G-protein signaling 9 isoform 1	300	RGS.				intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway|visual perception	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			ovary(2)|skin(2)	4						AACGATGGGCCTTCAACTTCA	0.488													14	28	---	---	---	---	PASS
PRKCA	5578	broad.mit.edu	37	17	64299066	64299066	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64299066G>A	uc002jfp.1	+	1	141	c.97G>A	c.(97-99)GAG>AAG	p.E33K	PRKCA_uc002jfo.1_5'UTR	NM_002737	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	33					activation of phospholipase C activity|energy reserve metabolic process|induction of apoptosis by extracellular signals|intracellular signal transduction|mRNA metabolic process|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of blood vessel endothelial cell migration|regulation of insulin secretion|response to interleukin-1|synaptic transmission	cytosol|endoplasmic reticulum|membrane fraction|nucleoplasm|plasma membrane	ATP binding|enzyme binding|histone kinase activity (H3-T6 specific)|protein kinase C activity|zinc ion binding			central_nervous_system(4)|large_intestine(1)|stomach(1)|lung(1)|breast(1)|ovary(1)	9			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Phosphatidylserine(DB00144)|Vitamin E(DB00163)	GAACGTGCACGAGGTGAAGGA	0.627													5	137	---	---	---	---	PASS
BPTF	2186	broad.mit.edu	37	17	65918992	65918992	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65918992G>T	uc002jgf.2	+	14	5655	c.5594G>T	c.(5593-5595)AGT>ATT	p.S1865I	BPTF_uc002jge.2_Missense_Mutation_p.S1991I	NM_182641	NP_872579	Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1991					brain development|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|NURF complex	sequence-specific DNA binding|transcription factor binding|zinc ion binding			ovary(2)|skin(2)	4	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CTTCGATCAAGTGCACTGCGG	0.433													41	69	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67181617	67181617	+	Splice_Site	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67181617C>T	uc010dfa.1	-	21	3376	c.2497_splice	c.e21+1	p.G833_splice	ABCA10_uc010wqt.1_Splice_Site|ABCA10_uc010dfb.1_Splice_Site_p.G434_splice	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10						transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					CCATTTCTCACCTGTATTATT	0.373													30	57	---	---	---	---	PASS
ABCA5	23461	broad.mit.edu	37	17	67300870	67300870	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67300870T>A	uc002jif.2	-	6	2088	c.870A>T	c.(868-870)TTA>TTT	p.L290F	ABCA5_uc002jie.2_5'Flank|ABCA5_uc002jig.2_Missense_Mutation_p.L290F|ABCA5_uc002jih.2_Missense_Mutation_p.L290F|ABCA5_uc010dfe.2_Missense_Mutation_p.L290F	NM_018672	NP_061142	Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A , member 5	290					cholesterol efflux|high-density lipoprotein particle remodeling|negative regulation of macrophage derived foam cell differentiation	Golgi membrane|integral to membrane|late endosome membrane|lysosomal membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;3.72e-11)					TTTGAGGAAATAACAAAGAAG	0.323													41	60	---	---	---	---	PASS
KIAA0195	9772	broad.mit.edu	37	17	73492462	73492462	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73492462C>T	uc002jnz.3	+	24	3428	c.3153C>T	c.(3151-3153)CCC>CCT	p.P1051P	KIAA0195_uc010wsa.1_Silent_p.P1061P|KIAA0195_uc010wsb.1_Silent_p.P691P|KIAA0195_uc002job.3_Silent_p.P59P	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772	1051					ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			GCCTTTCTCCCCTGCAGCTGT	0.612													41	59	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78268622	78268622	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78268622G>A	uc002jyf.2	+	9	1718	c.1575G>A	c.(1573-1575)GGG>GGA	p.G525G	uc002jyg.1_Silent_p.G256G	NM_020954	NP_066005			hypothetical protein LOC57714																		TGGTGAAGGGGAAGCAGATTG	0.532													18	64	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78269537	78269537	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78269537C>T	uc002jyf.2	+	10	2079	c.1936C>T	c.(1936-1938)CAC>TAC	p.H646Y	uc002jyg.1_Missense_Mutation_p.H377Y	NM_020954	NP_066005			hypothetical protein LOC57714																		CTGGTTGTGTCACCTCCTAAC	0.443													27	91	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78272202	78272202	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78272202G>T	uc002jyf.2	+	11	2237	c.2094G>T	c.(2092-2094)CTG>CTT	p.L698L	uc002jyg.1_Silent_p.L429L	NM_020954	NP_066005			hypothetical protein LOC57714																		TGCCTGTCCTGCACTGCTGTA	0.622													21	55	---	---	---	---	PASS
FSCN2	25794	broad.mit.edu	37	17	79503906	79503906	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79503906G>T	uc010wup.1	+	5	1420	c.1279G>T	c.(1279-1281)GAC>TAC	p.D427Y	FSCN2_uc010wuo.1_Missense_Mutation_p.D451Y	NM_012418	NP_036550	O14926	FSCN2_HUMAN	fascin 2 isoform 1	427					actin filament bundle assembly|anatomical structure morphogenesis|visual perception	actin cytoskeleton|cytoplasm|stereocilium	actin filament binding|protein binding, bridging				0	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			CCCAGGCCGCGACGGAGGGTT	0.766													12	14	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5438111	5438111	+	Splice_Site	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5438111T>A	uc002kmt.1	-	6	616	c.530_splice	c.e6-1	p.S177_splice	EPB41L3_uc010wzh.1_Splice_Site_p.S177_splice|EPB41L3_uc002kmu.1_Splice_Site_p.S177_splice|EPB41L3_uc010dkq.1_Splice_Site_p.S68_splice|EPB41L3_uc010dks.1_Splice_Site_p.S199_splice|EPB41L3_uc002kmv.1_Splice_Site_p.S68_splice	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3						cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						AAGCACCACCTGCAAGGATGG	0.403													28	28	---	---	---	---	PASS
LRRC30	339291	broad.mit.edu	37	18	7231415	7231415	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231415G>C	uc010wzk.1	+	1	279	c.279G>C	c.(277-279)CTG>CTC	p.L93L		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	93	LRR 1.									ovary(1)|liver(1)	2						TGGGGAAACTGACCCGGATCG	0.572													11	74	---	---	---	---	PASS
RAB12	201475	broad.mit.edu	37	18	8609899	8609899	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8609899G>C	uc002knp.2	+	1	457	c.174G>C	c.(172-174)CTG>CTC	p.L58L	RAB12_uc002kno.1_Silent_p.L154L	NM_001025300	NP_001020471	Q6IQ22	RAB12_HUMAN	RAB12, member RAS oncogene family	58					protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0						AGACCAGCCTGATGGAGCGCT	0.716													11	31	---	---	---	---	PASS
ANKRD12	23253	broad.mit.edu	37	18	9255357	9255357	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9255357G>C	uc002knv.2	+	9	2349	c.2092G>C	c.(2092-2094)GAG>CAG	p.E698Q	ANKRD12_uc002knw.2_Missense_Mutation_p.E675Q|ANKRD12_uc002knx.2_Missense_Mutation_p.E675Q|ANKRD12_uc010dkx.1_Missense_Mutation_p.E405Q	NM_015208	NP_056023	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12 isoform 1	698						nucleus				ovary(2)|central_nervous_system(1)	3						attttggaaagagaatttttt	0.090													19	52	---	---	---	---	PASS
TUBB6	84617	broad.mit.edu	37	18	12325637	12325637	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12325637C>A	uc002kqw.2	+	4	894	c.849C>A	c.(847-849)GCC>GCA	p.A283A	TUBB6_uc002kqv.2_Silent_p.A211A|TUBB6_uc010dld.2_RNA|TUBB6_uc002kqx.2_Silent_p.A246A|TUBB6_uc002kqy.2_Intron	NM_032525	NP_115914	Q9BUF5	TBB6_HUMAN	tubulin, beta 6	283					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity				0				READ - Rectum adenocarcinoma(1;0.0649)		AGTACCGGGCCCTGACCGTGC	0.682													23	76	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	18	14183765	14183765	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:14183765G>T	uc010xag.1	+	2	616	c.318G>T	c.(316-318)CAG>CAT	p.Q106H	uc002ksv.1_5'Flank					RecName: Full=Putative ankyrin repeat domain-containing protein 20A5;																		CTTTGATACAGGTATATTAGA	0.353													4	166	---	---	---	---	PASS
RBBP8	5932	broad.mit.edu	37	18	20564878	20564878	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20564878C>T	uc002ktw.2	+	8	965	c.634C>T	c.(634-636)CAT>TAT	p.H212Y	RBBP8_uc002kty.2_Missense_Mutation_p.H212Y|RBBP8_uc002ktz.2_Missense_Mutation_p.H212Y|RBBP8_uc002kua.2_Missense_Mutation_p.H212Y|RBBP8_uc002ktx.1_Missense_Mutation_p.H212Y	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a	212					cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			GTCTTCAACTCATCCACAACA	0.308								Direct_reversal_of_damage|Homologous_recombination					16	85	---	---	---	---	PASS
ZNF271	10778	broad.mit.edu	37	18	32886644	32886644	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32886644C>G	uc002kyq.3	+	3	1048	c.56C>G	c.(55-57)TCC>TGC	p.S19C	ZNF271_uc002kyp.3_Missense_Mutation_p.S19C|ZNF271_uc002kyr.3_Missense_Mutation_p.S19C	NR_024565				SubName: Full=cDNA FLJ13394 fis, clone PLACE1001304, highly similar to Homo sapiens zinc finger protein 271 (ZNF271), mRNA;												0						ATCAGAGAATCCATACTGGGG	0.403													3	69	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	34854387	34854387	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34854387C>G	uc002lae.2	-	6	1084	c.688G>C	c.(688-690)GCC>CCC	p.A230P	CELF4_uc010dnd.1_Missense_Mutation_p.A229P|CELF4_uc002lag.2_Missense_Mutation_p.A220P|CELF4_uc002laf.2_Missense_Mutation_p.A225P|CELF4_uc002lai.2_Missense_Mutation_p.A215P|CELF4_uc002lah.1_5'Flank|CELF4_uc002laj.1_Missense_Mutation_p.R65P	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	230	Sufficient for RNA-binding and MSE- dependent splicing activity.|RRM 2.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						TCGGTGTCGGCGAACTTGACC	0.687													39	96	---	---	---	---	PASS
SYT4	6860	broad.mit.edu	37	18	40853715	40853715	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40853715C>A	uc002law.2	-	2	1048	c.679G>T	c.(679-681)GGG>TGG	p.G227W	SYT4_uc010dng.2_Intron|SYT4_uc010xcm.1_Missense_Mutation_p.G209W|SYT4_uc010dnh.2_Intron	NM_020783	NP_065834	Q9H2B2	SYT4_HUMAN	synaptotagmin IV	227	Phospholipid binding (Probable).|C2 1.|Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	transporter activity			skin(5)	5						TAGGGTATCCCATAGAATGTA	0.393													37	74	---	---	---	---	PASS
SEC11C	90701	broad.mit.edu	37	18	56819760	56819760	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56819760C>G	uc002lht.2	+						SEC11C_uc010dpo.1_Intron|SEC11C_uc010xej.1_Intron	NM_033280	NP_150596	Q9BY50	SC11C_HUMAN	SEC11-like 3						energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	endoplasmic reticulum membrane|integral to membrane|microsome	serine-type peptidase activity				0		Colorectal(73;0.175)				CTTTGTGCTTCTTTCCAGTGG	0.463													114	280	---	---	---	---	PASS
SERPINB12	89777	broad.mit.edu	37	18	61228335	61228335	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61228335G>C	uc010xen.1	+	4	402	c.402G>C	c.(400-402)GTG>GTC	p.V134V	SERPINB12_uc010xeo.1_Silent_p.V154V	NM_080474	NP_536722	Q96P63	SPB12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	134					negative regulation of protein catabolic process|regulation of proteolysis	cytoplasm	enzyme binding|serine-type endopeptidase inhibitor activity				0						TAGATGGTGTGATTCAATTTT	0.388													3	179	---	---	---	---	PASS
TSHZ1	10194	broad.mit.edu	37	18	72999460	72999460	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72999460G>T	uc002lly.2	+	2	2526	c.1963G>T	c.(1963-1965)GGG>TGG	p.G655W		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	700				GK -> WE (in Ref. 4; AAC18047).		nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GGCCGAGACTGGGAAGGCCAA	0.552													15	35	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76756976	76756976	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76756976G>T	uc002lmt.2	+	3	3557	c.3557G>T	c.(3556-3558)GGG>GTG	p.G1186V	SALL3_uc010dra.2_Missense_Mutation_p.G721V	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1186					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		GCTCTCCTAGGGGGTGATGCC	0.602													44	31	---	---	---	---	PASS
APC2	10297	broad.mit.edu	37	19	1468499	1468499	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1468499C>G	uc002lsr.1	+	15	5407	c.5199C>G	c.(5197-5199)CCC>CCG	p.P1733P	APC2_uc002lss.1_Silent_p.P1315P|APC2_uc002lst.1_Silent_p.P1733P|APC2_uc002lsu.1_Silent_p.P1732P|C19orf25_uc010xgn.1_Intron	NM_005883	NP_005874	O95996	APC2_HUMAN	adenomatosis polyposis coli 2	1733					negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|Wnt receptor signaling pathway	actin filament|catenin complex|cytoplasmic microtubule|Golgi membrane|lamellipodium membrane|perinuclear region of cytoplasm	beta-catenin binding|microtubule binding			breast(3)|pancreas(1)	4		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TACAGCCCCCCAAGCACAGGA	0.667													8	25	---	---	---	---	PASS
NFIC	4782	broad.mit.edu	37	19	3462740	3462740	+	Intron	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3462740G>T	uc010xhi.1	+						NFIC_uc002lxo.2_Intron|NFIC_uc010xhh.1_Intron|NFIC_uc002lxp.2_Intron|NFIC_uc010xhj.1_Intron	NM_205843	NP_995315	P08651	NFIC_HUMAN	nuclear factor I/C isoform 2						DNA replication|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;7.8e-05)|Epithelial(107;2.94e-108)|BRCA - Breast invasive adenocarcinoma(158;0.00154)|STAD - Stomach adenocarcinoma(1328;0.191)		GTCGCCACTGGGCCACTCAGT	0.612													285	398	---	---	---	---	PASS
EMR4P	326342	broad.mit.edu	37	19	6984771	6984771	+	5'UTR	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6984771C>G	uc010xjk.1	-	4					EMR4P_uc010dve.1_RNA	NR_024075				RecName: Full=Putative EGF-like module-containing mucin-like hormone receptor-like 4; AltName: Full=G-protein coupled receptor 127; AltName: Full=G-protein coupled receptor PGR16; Flags: Precursor;												0						TATATTTTACCAAACAGCTAC	0.348													9	39	---	---	---	---	PASS
XAB2	56949	broad.mit.edu	37	19	7684966	7684966	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7684966G>A	uc002mgx.2	-							NM_020196	NP_064581	Q9HCS7	SYF1_HUMAN	XPA binding protein 2						transcription, DNA-dependent|transcription-coupled nucleotide-excision repair	catalytic step 2 spliceosome|nucleoplasm	protein binding			central_nervous_system(2)|breast(1)|skin(1)	4						CAGACACTAGGGGGTGGGAGC	0.672								Direct_reversal_of_damage|NER					4	41	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9056897	9056897	+	Silent	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9056897T>A	uc002mkp.2	-	3	30753	c.30549A>T	c.(30547-30549)CCA>CCT	p.P10183P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10185	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTGTATTTGTTGGTGTGACTG	0.458													35	38	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9088876	9088876	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9088876G>A	uc002mkp.2	-	1	3143	c.2939C>T	c.(2938-2940)TCA>TTA	p.S980L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	980	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GGTTGTTGCTGAAGGTAACCC	0.458													8	328	---	---	---	---	PASS
PDE4A	5141	broad.mit.edu	37	19	10578192	10578192	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10578192C>T	uc002moj.2	+	15	2664	c.2556C>T	c.(2554-2556)CAC>CAT	p.H852H	PDE4A_uc002mok.2_Silent_p.H826H|PDE4A_uc002mol.2_Silent_p.H791H|PDE4A_uc002mom.2_Silent_p.H613H|PDE4A_uc002mon.2_Silent_p.H307H|PDE4A_uc002moo.2_3'UTR	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1	852					signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding	p.H613H(1)		ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	AACGAGAGCACCAGGCTGCCA	0.682													48	145	---	---	---	---	PASS
DNM2	1785	broad.mit.edu	37	19	10908188	10908188	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10908188C>T	uc002mps.1	+	10	1493	c.1329C>T	c.(1327-1329)GCC>GCT	p.A443A	DNM2_uc010dxk.2_RNA|DNM2_uc002mpt.1_Intron|DNM2_uc002mpv.1_Silent_p.A443A|DNM2_uc002mpu.1_Intron|DNM2_uc010dxl.1_Intron|DNM2_uc002mpw.2_Silent_p.A176A	NM_001005361	NP_001005361	P50570	DYN2_HUMAN	dynamin 2 isoform 2	443					G2/M transition of mitotic cell cycle|positive regulation of apoptosis|positive regulation of transcription, DNA-dependent|post-Golgi vesicle-mediated transport|receptor internalization|signal transduction|synaptic vesicle transport|transferrin transport	cell junction|cytosol|Golgi membrane|microtubule|postsynaptic density|postsynaptic membrane	GTP binding|GTPase activity|microtubule binding			central_nervous_system(2)|skin(2)|ovary(1)|breast(1)	6			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			AAAAGTGTGCCGAGAAGGTAA	0.478													25	126	---	---	---	---	PASS
RAB3D	9545	broad.mit.edu	37	19	11447869	11447869	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11447869C>T	uc002mqy.2	-	2	445	c.207G>A	c.(205-207)AAG>AAA	p.K69K		NM_004283	NP_004274	O95716	RAB3D_HUMAN	RAB3D, member RAS oncogene family	69					exocytosis|protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(2)	2						GCTTGATCCTCTTGTCATGGC	0.532													15	329	---	---	---	---	PASS
ZNF823	55552	broad.mit.edu	37	19	11833647	11833647	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11833647G>C	uc002msm.2	-	4	828	c.702C>G	c.(700-702)TCC>TCG	p.S234S	ZNF823_uc010xmd.1_Silent_p.S52S|ZNF823_uc010dyi.1_Silent_p.S190S	NM_001080493	NP_001073962	P16415	ZN823_HUMAN	ZFP-36 for a zinc finger protein	234	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						GTCTTAGATAGGAACTGTAAA	0.398										HNSCC(68;0.2)			43	175	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11943034	11943034	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11943034A>G	uc002msp.1	+	4	1199	c.1043A>G	c.(1042-1044)GAC>GGC	p.D348G		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	348	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGTGGAAAAGACTTTTGTTCT	0.373													21	58	---	---	---	---	PASS
ZNF136	7695	broad.mit.edu	37	19	12298172	12298172	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12298172G>A	uc002mti.2	+	4	1079	c.979G>A	c.(979-981)GAA>AAA	p.E327K	ZNF136_uc010xmh.1_Missense_Mutation_p.E261K	NM_003437	NP_003428	P52737	ZN136_HUMAN	zinc finger protein 136	327	C2H2-type 7.				negative regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|transcription corepressor activity|zinc ion binding			ovary(1)|pancreas(1)	2						TCGACTACATGAAAGAATTCA	0.428													4	138	---	---	---	---	PASS
DNASE2	1777	broad.mit.edu	37	19	12989655	12989655	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12989655C>G	uc002mvn.1	-						DNASE2_uc010xmr.1_Intron	NM_001375	NP_001366	O00115	DNS2A_HUMAN	deoxyribonuclease II, lysosomal precursor						apoptosis	lysosome	deoxyribonuclease II activity|DNA binding|protein binding				0						ACACCTGGACCAAAAGAAGGC	0.353								Direct_reversal_of_damage					6	19	---	---	---	---	PASS
RAD23A	5886	broad.mit.edu	37	19	13060094	13060094	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13060094G>A	uc002mvw.1	+	7	794	c.685G>A	c.(685-687)GAG>AAG	p.E229K	RAD23A_uc002mvx.1_Missense_Mutation_p.E228K|RAD23A_uc002mvz.1_Missense_Mutation_p.E228K|RAD23A_uc002mwa.1_Missense_Mutation_p.E229K|RAD23A_uc002mvy.1_Missense_Mutation_p.E63K|RAD23A_uc010xmw.1_Missense_Mutation_p.E64K	NM_005053	NP_005044	P54725	RD23A_HUMAN	UV excision repair protein RAD23 homolog A	229					interspecies interaction between organisms|nucleotide-excision repair|positive regulation of viral genome replication|proteasomal ubiquitin-dependent protein catabolic process|regulation of proteasomal ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	damaged DNA binding|polyubiquitin binding|single-stranded DNA binding			central_nervous_system(1)	1						ACCAGCAGGAGAGAACCCCCT	0.632								NER					9	92	---	---	---	---	PASS
TRMT1	55621	broad.mit.edu	37	19	13215822	13215822	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13215822G>A	uc002mwj.2	-	16	2157	c.1907C>T	c.(1906-1908)GCC>GTC	p.A636V	LYL1_uc002mwi.2_5'Flank|TRMT1_uc010xmy.1_Missense_Mutation_p.A240V|TRMT1_uc002mwk.2_Missense_Mutation_p.A607V|TRMT1_uc002mwl.3_Missense_Mutation_p.A636V	NM_017722	NP_060192	Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 isoform 1	636							RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		ACAGTCAGGGGCAGCATCAGC	0.622											OREG0025289	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	280	---	---	---	---	PASS
CC2D1A	54862	broad.mit.edu	37	19	14029608	14029608	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14029608C>A	uc002mxo.2	+	9	1295	c.996C>A	c.(994-996)CCC>CCA	p.P332P	CC2D1A_uc002mxn.2_Silent_p.P231P|CC2D1A_uc002mxp.2_Silent_p.P332P|CC2D1A_uc010dzh.2_5'UTR|CC2D1A_uc002mxq.1_5'UTR	NM_017721	NP_060191	Q6P1N0	C2D1A_HUMAN	coiled-coil and C2 domain containing 1A	332	Pro-rich.				positive regulation of I-kappaB kinase/NF-kappaB cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus|plasma membrane	DNA binding|signal transducer activity				0			OV - Ovarian serous cystadenocarcinoma(19;3.49e-23)			CTCCGACCCCCGCTACGGCGC	0.652													33	91	---	---	---	---	PASS
WIZ	58525	broad.mit.edu	37	19	15535160	15535160	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15535160C>A	uc002nbc.2	-	7	2604	c.2581G>T	c.(2581-2583)GAT>TAT	p.D861Y	WIZ_uc002nba.3_Missense_Mutation_p.D728Y|WIZ_uc002nbb.3_Missense_Mutation_p.D687Y	NM_021241	NP_067064	O95785	WIZ_HUMAN	widely-interspaced zinc finger motifs	1544						nucleus	zinc ion binding				0						GCGGAGGCATCTGGAGGGCGG	0.637													37	88	---	---	---	---	PASS
F2RL3	9002	broad.mit.edu	37	19	17001363	17001363	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17001363C>G	uc002nfa.2	+	2	1264	c.1089C>G	c.(1087-1089)ACC>ACG	p.T363T		NM_003950	NP_003941	Q96RI0	PAR4_HUMAN	coagulation factor II (thrombin) receptor-like 3	363	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation|positive regulation of release of sequestered calcium ion into cytosol	extracellular region|integral to plasma membrane	thrombin receptor activity				0						CGGGGGACACCGTGGCCTCCA	0.612													4	15	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17012067	17012067	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17012067C>A	uc002nfb.2	-	36	4899	c.4867G>T	c.(4867-4869)GTG>TTG	p.V1623L	CPAMD8_uc002nfd.1_Missense_Mutation_p.V88L	NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	1576						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						AGCAGGGGCACCTCCAGGACA	0.602													4	21	---	---	---	---	PASS
GLT25D1	79709	broad.mit.edu	37	19	17678315	17678315	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17678315C>T	uc002nhc.1	+	4	602	c.590C>T	c.(589-591)GCG>GTG	p.A197V	GLT25D1_uc010eax.1_5'Flank	NM_024656	NP_078932	Q8NBJ5	GT251_HUMAN	glycosyltransferase 25 domain containing 1	197					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity				0						TCCCGGGCTGCGTACTCCAAC	0.592													8	28	---	---	---	---	PASS
COMP	1311	broad.mit.edu	37	19	18897348	18897348	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18897348C>T	uc002nke.2	-	11	1284	c.1248G>A	c.(1246-1248)CCG>CCA	p.P416P	COMP_uc002nkd.2_Silent_p.P383P|COMP_uc010xqj.1_Silent_p.P363P	NM_000095	NP_000086	P49747	COMP_HUMAN	cartilage oligomeric matrix protein precursor	416	TSP type-3 5.				anti-apoptosis|apoptosis|cell adhesion|limb development	extracellular space|proteinaceous extracellular matrix	calcium ion binding|collagen binding|extracellular matrix structural constituent|heparan sulfate proteoglycan binding|heparin binding				0						TCACCTGATCCGGGTTGCTCT	0.567													8	55	---	---	---	---	PASS
ZNF93	81931	broad.mit.edu	37	19	20044144	20044144	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20044144C>A	uc002non.2	+	4	491	c.380C>A	c.(379-381)ACA>AAA	p.T127K		NM_031218	NP_112495	P35789	ZNF93_HUMAN	zinc finger protein 93	127						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1						AAGGTGCACACAGGAGGTTAT	0.333													26	67	---	---	---	---	PASS
ZNF431	170959	broad.mit.edu	37	19	21365741	21365741	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21365741C>T	uc002npp.2	+	5	782	c.635C>T	c.(634-636)TCA>TTA	p.S212L	ZNF431_uc010ecq.2_Missense_Mutation_p.S121L|ZNF431_uc010ecr.2_Missense_Mutation_p.S213L	NM_133473	NP_597730	Q8TF32	ZN431_HUMAN	zinc finger protein 431	212	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(2)	2						TGTGGCAAATCATTTTGCATG	0.289													17	76	---	---	---	---	PASS
ZNF429	353088	broad.mit.edu	37	19	21720081	21720081	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21720081C>T	uc002nqd.1	+	4	1363	c.1226C>T	c.(1225-1227)TCC>TTC	p.S409F	ZNF429_uc010ecu.1_Intron	NM_001001415	NP_001001415	Q86V71	ZN429_HUMAN	zinc finger protein 429	409	C2H2-type 10; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						TTTACCTGTTCCTCAACACTT	0.353													15	45	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22255656	22255656	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22255656G>T	uc010ecx.2	+	2	218	c.49G>T	c.(49-51)GAG>TAG	p.E17*	ZNF257_uc010ecy.2_5'UTR	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	17	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CTCTCTGGAGGAGTGGCATTG	0.443													62	97	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271355	22271355	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271355G>T	uc010ecx.2	+	4	972	c.803G>T	c.(802-804)CGG>CTG	p.R268L	ZNF257_uc010ecy.2_Missense_Mutation_p.R236L	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	268	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				GCCTTTAACCGGTCTTCACAC	0.388													7	45	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22271356	22271356	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22271356G>T	uc010ecx.2	+	4	973	c.804G>T	c.(802-804)CGG>CGT	p.R268R	ZNF257_uc010ecy.2_Silent_p.R236R	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	268	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCTTTAACCGGTCTTCACACA	0.383													8	43	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22272245	22272245	+	3'UTR	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22272245T>A	uc010ecx.2	+	4					ZNF257_uc010ecy.2_3'UTR	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				TAATTCATAATGGAGAAAAAC	0.348													5	26	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22272246	22272246	+	3'UTR	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22272246G>C	uc010ecx.2	+	4					ZNF257_uc010ecy.2_3'UTR	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				AATTCATAATGGAGAAAAACC	0.343													5	26	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22363597	22363597	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22363597G>T	uc002nqs.1	-	3	1240	c.922C>A	c.(922-924)CCC>ACC	p.P308T		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	308					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CACTTGTAGGGTTTCTCTCCA	0.438													32	138	---	---	---	---	PASS
UQCRFS1	7386	broad.mit.edu	37	19	29698958	29698958	+	Missense_Mutation	SNP	C	T	T	rs141991079	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:29698958C>T	uc002nsd.2	-	2	433	c.322G>A	c.(322-324)GAG>AAG	p.E108K		NM_006003	NP_005994	P47985	UCRI_HUMAN	ubiquinol-cytochrome c reductase, Rieske	108					respiratory electron transport chain	integral to membrane|mitochondrial respiratory chain complex III	2 iron, 2 sulfur cluster binding|metal ion binding|ubiquinol-cytochrome-c reductase activity				0	Breast(6;0.0545)|Esophageal squamous(110;0.239)		Lung(7;0.092)			TTCCTAGCCTCGCTGCTTTCT	0.468													17	229	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039710	31039710	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039710G>T	uc002nsu.1	+	4	3322	c.3184G>T	c.(3184-3186)GAC>TAC	p.D1062Y	ZNF536_uc010edd.1_Missense_Mutation_p.D1062Y	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1062					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					ATCAAACAAAGACCTGGGCCT	0.537													7	104	---	---	---	---	PASS
DPY19L3	147991	broad.mit.edu	37	19	32968458	32968458	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32968458G>C	uc002ntg.2	+	17	1904	c.1728G>C	c.(1726-1728)GCG>GCC	p.A576A	DPY19L3_uc002nth.1_Silent_p.A576A|DPY19L3_uc002nti.1_RNA|DPY19L3_uc002ntj.1_5'UTR	NM_207325	NP_997208	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3	576						integral to membrane				ovary(4)	4	Esophageal squamous(110;0.162)					CTGTGTTTGCGGGAAGCATGC	0.488													83	29	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33119701	33119701	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33119701G>A	uc002ntn.1	-	14	1420	c.1264C>T	c.(1264-1266)CAT>TAT	p.H422Y		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	422	ANK 1.				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity	p.H422H(1)		ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					TCTTTATCATGGTCCTCTTGG	0.453													28	161	---	---	---	---	PASS
NUDT19	390916	broad.mit.edu	37	19	33183180	33183180	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33183180C>A	uc010edf.2	+	1	314	c.314C>A	c.(313-315)CCC>CAC	p.P105H		NM_001105570	NP_001099040	A8MXV4	NUD19_HUMAN	nudix (nucleoside diphosphate linked moiety	105	Nudix hydrolase.					mitochondrion|peroxisome	hydrolase activity|metal ion binding				0	Esophageal squamous(110;0.137)					CCGTCGCTGCCCGACACCGAT	0.721													50	20	---	---	---	---	PASS
ZNF599	148103	broad.mit.edu	37	19	35250052	35250052	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35250052G>A	uc010edn.1	-	4	2042	c.1654C>T	c.(1654-1656)CAG>TAG	p.Q552*	ZNF599_uc010edm.1_Nonsense_Mutation_p.Q515*	NM_001007248	NP_001007249	Q96NL3	ZN599_HUMAN	zinc finger protein 599	552	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	all_lung(56;1.13e-07)|Lung NSC(56;1.81e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.138)			CTCATGTGCTGAGTTAAAGCA	0.413													99	179	---	---	---	---	PASS
LSR	51599	broad.mit.edu	37	19	35758764	35758764	+	3'UTR	SNP	C	A	A	rs138382483		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35758764C>A	uc002nyl.2	+	10					LSR_uc002nym.2_3'UTR|LSR_uc002nyn.2_3'UTR|LSR_uc002nyo.2_3'UTR|LSR_uc010xsr.1_3'UTR|LSR_uc002nyp.2_3'UTR|USF2_uc010xss.1_5'Flank|USF2_uc002nyq.1_5'Flank|USF2_uc002nyr.1_5'Flank|USF2_uc002nys.1_5'Flank|USF2_uc002nyt.1_5'Flank|USF2_uc002nyu.1_5'Flank|USF2_uc002nyv.1_5'Flank	NM_205834	NP_991403	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor						embryo development|liver development	chylomicron|integral to membrane|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle	receptor activity				0	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GTCGTCTGATCTGACGTTTTC	0.483													65	303	---	---	---	---	PASS
FFAR3	2865	broad.mit.edu	37	19	35849879	35849879	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35849879C>A	uc002nzd.2	+	2	162	c.87C>A	c.(85-87)CTC>CTA	p.L29L	FFAR3_uc010xsu.1_RNA	NM_005304	NP_005295	O14843	FFAR3_HUMAN	free fatty acid receptor 3	29	Helical; Name=1; (Potential).					integral to plasma membrane	G-protein coupled receptor activity|lipid binding				0	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;1.29e-19)|OV - Ovarian serous cystadenocarcinoma(14;4.63e-18)|all cancers(14;5.19e-17)|LUSC - Lung squamous cell carcinoma(66;0.0221)			TGGTGGGGCTCCCCCTCAACC	0.647													27	122	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36273344	36273344	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36273344G>T	uc002obr.1	+	13	1240	c.1155G>T	c.(1153-1155)GTG>GTT	p.V385V	ARHGAP33_uc002obs.1_Silent_p.V385V|ARHGAP33_uc002obt.1_Silent_p.V249V|ARHGAP33_uc010eel.2_5'UTR|ARHGAP33_uc002obv.1_5'Flank	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	385	Rho-GAP.				cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						TCCACAGCGTGTCCTCCCTCT	0.582													85	26	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36279116	36279116	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36279116C>T	uc002obs.1	+	21	3251	c.3166C>T	c.(3166-3168)CGT>TGT	p.R1056C	ARHGAP33_uc002obt.1_Missense_Mutation_p.R1053C|ARHGAP33_uc010eel.2_Intron|ARHGAP33_uc002obv.1_Missense_Mutation_p.R805C	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	1217					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						CTGGGGACCCCGTACCCCTCA	0.706													14	64	---	---	---	---	PASS
ZNF345	25850	broad.mit.edu	37	19	37368786	37368786	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37368786A>C	uc002oex.2	+	3	1432	c.1054A>C	c.(1054-1056)AGT>CGT	p.S352R	ZNF345_uc002oey.3_Missense_Mutation_p.S352R|ZNF345_uc002oez.2_Intron	NM_003419	NP_003410	Q14585	ZN345_HUMAN	zinc finger protein 345	352	C2H2-type 11.				negative regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase III promoter|transcription from RNA polymerase II promoter|transcription from RNA polymerase III promoter	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGACCTTTAGTAGTGGTTC	0.403													22	103	---	---	---	---	PASS
ZNF585A	199704	broad.mit.edu	37	19	37643697	37643697	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37643697C>A	uc002ofo.1	-	5	1335	c.1104G>T	c.(1102-1104)GAG>GAT	p.E368D	ZNF585A_uc002ofm.1_Missense_Mutation_p.E313D|ZNF585A_uc002ofn.1_Missense_Mutation_p.E313D	NM_199126	NP_954577	Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	368	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAATAATCAACTCTGACCTGT	0.418													7	204	---	---	---	---	PASS
RASGRP4	115727	broad.mit.edu	37	19	38912755	38912755	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38912755C>T	uc002oir.2	-	2	276	c.62G>A	c.(61-63)CGA>CAA	p.R21Q	RASGRP4_uc010efz.1_5'Flank|RASGRP4_uc010ega.1_5'Flank|RASGRP4_uc010xua.1_Missense_Mutation_p.R21Q|RASGRP4_uc010xub.1_Missense_Mutation_p.R21Q|RASGRP4_uc010xuc.1_Missense_Mutation_p.R21Q|RASGRP4_uc010xud.1_Missense_Mutation_p.R21Q|RASGRP4_uc010xue.1_Missense_Mutation_p.R21Q|RASGRP4_uc010egb.2_Missense_Mutation_p.R21Q	NM_170604	NP_733749	Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4 isoform a	21					activation of phospholipase C activity|cell growth|cell proliferation|myeloid cell differentiation|positive regulation of Ras protein signal transduction|regulation of G-protein coupled receptor protein signaling pathway|response to extracellular stimulus|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|membrane fraction|plasma membrane|soluble fraction	diacylglycerol binding|GTP-dependent protein binding|metal ion binding|Ras guanyl-nucleotide exchange factor activity			pancreas(1)|lung(1)|skin(1)	3	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GGGCCGGCCTCGCCCTCCTAT	0.617													31	32	---	---	---	---	PASS
SARS2	54938	broad.mit.edu	37	19	39412889	39412889	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39412889C>A	uc002oka.2	-	3	542	c.382G>T	c.(382-384)GAA>TAA	p.E128*	SARS2_uc002ojz.2_5'UTR|SARS2_uc010xup.1_Nonsense_Mutation_p.E128*|SARS2_uc002okb.2_Nonsense_Mutation_p.E128*|SARS2_uc010xuq.1_Nonsense_Mutation_p.E128*|SARS2_uc010xur.1_RNA|SARS2_uc010xus.1_Nonsense_Mutation_p.E128*	NM_017827	NP_060297	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2 isoform b precursor	128					seryl-tRNA aminoacylation	mitochondrial matrix	ATP binding|protein binding|serine-tRNA ligase activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGCTGCACTTCACCACTGTCC	0.473													32	144	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40395822	40395822	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40395822C>G	uc002omp.3	-	15	7583	c.7575G>C	c.(7573-7575)CAG>CAC	p.Q2525H		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	2525	VWFD 6.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TCCACTGTCTCTGCTCCAGCC	0.652													20	282	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41626291	41626291	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41626291G>C	uc002opu.1	+	4	430	c.374G>C	c.(373-375)AGA>ACA	p.R125T	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Missense_Mutation_p.R125T|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	125					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						AAGGTCCTGAGACAGTTCTCT	0.582													45	129	---	---	---	---	PASS
ZNF223	7766	broad.mit.edu	37	19	44571244	44571244	+	Silent	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44571244C>G	uc002oyf.1	+	5	1516	c.1263C>G	c.(1261-1263)CTC>CTG	p.L421L	ZNF284_uc010ejd.2_RNA	NM_013361	NP_037493	Q9UK11	ZN223_HUMAN	zinc finger protein 223	421	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(69;0.0352)				ATAAGAGACTCCATTGCCGAA	0.418													32	141	---	---	---	---	PASS
GRLF1	2909	broad.mit.edu	37	19	47492887	47492887	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47492887C>T	uc010ekv.2	+	4	3991	c.3991C>T	c.(3991-3993)CCC>TCC	p.P1331S		NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1	1331	Rho-GAP.				axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		ACTGCCTGACCCCCTGGTCCC	0.542													35	170	---	---	---	---	PASS
DHX34	9704	broad.mit.edu	37	19	47879256	47879256	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47879256G>A	uc010xyn.1	+	11	2724	c.2383G>A	c.(2383-2385)GAG>AAG	p.E795K	DHX34_uc010xyo.1_5'Flank	NM_014681	NP_055496	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	795						intracellular	ATP binding|ATP-dependent helicase activity|RNA binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)	5		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCTGAGCCGCGAGCAGCTGGC	0.672													52	80	---	---	---	---	PASS
SULT2A1	6822	broad.mit.edu	37	19	48387013	48387013	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48387013G>A	uc002phr.2	-	2	306	c.166C>T	c.(166-168)CTG>TTG	p.L56L		NM_003167	NP_003158	Q06520	ST2A1_HUMAN	bile-salt sulfotransferase 2A1	56					3'-phosphoadenosine 5'-phosphosulfate metabolic process|bile acid catabolic process|cellular lipid metabolic process|digestion|sulfation|xenobiotic metabolic process	cytosol	bile-salt sulfotransferase activity			ovary(1)|pancreas(1)	2		all_cancers(25;3.02e-09)|all_lung(116;6.48e-07)|all_epithelial(76;7.35e-07)|Lung NSC(112;1.56e-06)|all_neural(266;0.0146)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;0.000254)|all cancers(93;0.000545)|Epithelial(262;0.0217)|GBM - Glioblastoma multiforme(486;0.0552)		GAGTGCATCAGGCAGAGAATC	0.398													23	23	---	---	---	---	PASS
RASIP1	54922	broad.mit.edu	37	19	49242460	49242460	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49242460C>A	uc002pki.2	-	3	777	c.580G>T	c.(580-582)GGC>TGC	p.G194C		NM_017805	NP_060275	Q5U651	RAIN_HUMAN	Ras-interacting protein 1	194	Ras-associating.				signal transduction	Golgi stack|perinuclear region of cytoplasm				pancreas(1)	1		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		CTGCTCTCGCCGGGGCCACCG	0.652													4	0	---	---	---	---	PASS
SLC17A7	57030	broad.mit.edu	37	19	49939884	49939884	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49939884G>C	uc002pnp.2	-	2	409	c.237C>G	c.(235-237)ATC>ATG	p.I79M	SLC17A7_uc002pnq.1_Missense_Mutation_p.I12M	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	79	Helical; (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GGTTGCAGCGGATGCCAAAGC	0.642													3	142	---	---	---	---	PASS
AP2A1	160	broad.mit.edu	37	19	50306643	50306643	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50306643C>G	uc002ppn.2	+						AP2A1_uc002ppo.2_Intron|AP2A1_uc002ppp.1_3'UTR|AP2A1_uc010enk.2_5'Flank	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CATATCCTCTCAGGCCCGGCC	0.572													11	34	---	---	---	---	PASS
NR1H2	7376	broad.mit.edu	37	19	50885782	50885782	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50885782G>T	uc010enw.2	+	11	1585	c.1309G>T	c.(1309-1311)GAG>TAG	p.E437*	NR1H2_uc002prv.3_RNA|NR1H2_uc002prz.3_Nonsense_Mutation_p.E392*|NR1H2_uc002psa.3_Nonsense_Mutation_p.E339*|POLD1_uc002psb.3_5'Flank|POLD1_uc002psc.3_5'Flank|POLD1_uc010enx.2_5'Flank	NM_007121	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	436	Ligand-binding (Potential).				negative regulation of cholesterol storage|negative regulation of interferon-gamma-mediated signaling pathway|negative regulation of lipid transport|negative regulation of pinocytosis|negative regulation of transcription, DNA-dependent|positive regulation of cellular protein metabolic process|positive regulation of cholesterol efflux|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of transcription from RNA polymerase II promoter|positive regulation of triglyceride biosynthetic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	sequence-specific DNA binding|steroid hormone receptor activity|zinc ion binding				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TGTGCACTCGGAGCAGGTCTT	0.667													39	8	---	---	---	---	PASS
ASPDH	554235	broad.mit.edu	37	19	51015807	51015807	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51015807C>T	uc010enz.2	-	5	525	c.463G>A	c.(463-465)GAT>AAT	p.D155N	JOSD2_uc002psn.1_5'Flank|JOSD2_uc002pso.1_5'Flank|JOSD2_uc002psp.1_5'Flank|JOSD2_uc002psq.1_5'Flank|ASPDH_uc002psr.3_Missense_Mutation_p.D50N	NM_001114598	NP_001108070	A6ND91	ASPD_HUMAN	aspartate dehydrogenase isoform 1	155					NAD biosynthetic process|NADP catabolic process		aspartate dehydrogenase activity|NADP binding				0						CGGAAGCCATCGGGGTGTGTG	0.672													4	12	---	---	---	---	PASS
ZNF415	55786	broad.mit.edu	37	19	53611991	53611991	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53611991C>A	uc002qax.2	-	7	1800	c.1451G>T	c.(1450-1452)GGA>GTA	p.G484V	ZNF415_uc002qat.2_Missense_Mutation_p.G448V|ZNF415_uc002qaw.2_Missense_Mutation_p.G436V|ZNF415_uc010yds.1_Missense_Mutation_p.G436V|ZNF415_uc010ydt.1_Missense_Mutation_p.G436V|ZNF415_uc002qau.2_Missense_Mutation_p.G423V|ZNF415_uc002qav.2_Missense_Mutation_p.G448V|ZNF415_uc002qba.2_Missense_Mutation_p.G206V|ZNF415_uc002qay.2_Missense_Mutation_p.G423V|ZNF415_uc002qaz.2_Missense_Mutation_p.G484V	NR_028343		Q09FC8	ZN415_HUMAN	RecName: Full=Zinc finger protein 415;	484					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleolus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.0191)		AGGTTTCTCTCCAGTATGAAC	0.413													50	171	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54314548	54314548	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54314548G>A	uc002qch.3	-						NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Intron|NLRP12_uc002qcj.3_Intron|NLRP12_uc002qck.3_Intron|NLRP12_uc010eqx.2_Intron	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform						negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		GGGATCTAGGGGAGAGGAATG	0.488													55	78	---	---	---	---	PASS
SAPS1	22870	broad.mit.edu	37	19	55752352	55752352	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55752352G>A	uc002qjw.3	-	10	1499	c.1257C>T	c.(1255-1257)AGC>AGT	p.S419S	SAPS1_uc002qjv.2_Silent_p.S481S	NM_014931	NP_055746	Q9UPN7	PP6R1_HUMAN	SAPS domain family, member 1	419					regulation of phosphoprotein phosphatase activity	cytoplasm	protein phosphatase binding				0		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TCTCAGGGCTGCTGTCAGGAG	0.577													4	8	---	---	---	---	PASS
U2AF2	11338	broad.mit.edu	37	19	56180439	56180439	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56180439C>G	uc002qlu.2	+						U2AF2_uc002qlt.2_Intron	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		CCCTCATCCTCCAAACACAGG	0.662													5	41	---	---	---	---	PASS
NLRP9	338321	broad.mit.edu	37	19	56243511	56243511	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56243511C>T	uc002qly.2	-	2	1714	c.1686G>A	c.(1684-1686)ATG>ATA	p.M562I		NM_176820	NP_789790	Q7RTR0	NALP9_HUMAN	NLR family, pyrin domain containing 9	562						cytoplasm	ATP binding			skin(4)|ovary(2)|breast(1)	7		Colorectal(82;0.000133)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.123)		CAAAGAAATTCATCACTTTGG	0.343													24	70	---	---	---	---	PASS
ZFP28	140612	broad.mit.edu	37	19	57059206	57059206	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57059206C>T	uc002qnj.2	+	4	529	c.458C>T	c.(457-459)TCC>TTC	p.S153F	ZFP28_uc002qni.2_Missense_Mutation_p.S153F|uc002qnk.1_Intron	NM_020828	NP_065879	Q8NHY6	ZFP28_HUMAN	zinc finger protein 28	153	KRAB 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		GATGTGATCTCCTCGTTGGAA	0.512													61	90	---	---	---	---	PASS
ZNF417	147687	broad.mit.edu	37	19	58420562	58420562	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58420562G>A	uc002qqq.2	-	3	1283	c.1084C>T	c.(1084-1086)CGT>TGT	p.R362C	ZNF417_uc010yhm.1_Missense_Mutation_p.R319C|ZNF417_uc002qqr.2_Missense_Mutation_p.R361C	NM_152475	NP_689688	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	362	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		AACTTCTGACGAAAAGATTTC	0.428													36	175	---	---	---	---	PASS
DEFB128	245939	broad.mit.edu	37	20	168638	168638	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:168638T>C	uc002wcz.1	-	2	171	c.171A>G	c.(169-171)GAA>GAG	p.E57E		NM_001037732	NP_001032821	Q7Z7B8	DB128_HUMAN	beta-defensin 128 precursor	57					defense response to bacterium	extracellular region				breast(1)	1		all_cancers(10;0.00499)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			TTTTCTCTTCTTCATCATTAG	0.383													73	288	---	---	---	---	PASS
SIRPA	140885	broad.mit.edu	37	20	1918206	1918206	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1918206A>T	uc002wfq.2	+	9	1867	c.1507A>T	c.(1507-1509)AGG>TGG	p.R503W	SIRPA_uc010zps.1_Missense_Mutation_p.R483W|SIRPA_uc002wfr.2_Missense_Mutation_p.R503W|SIRPA_uc002wfs.2_Missense_Mutation_p.R503W|SIRPA_uc002wft.2_Missense_Mutation_p.R507W	NM_001040022	NP_001035111	P78324	SHPS1_HUMAN	signal-regulatory protein alpha precursor	503	Cytoplasmic (Potential).			R -> K (in Ref. 7; CAA71944).	blood coagulation|cell adhesion|cell junction assembly|leukocyte migration	integral to membrane|plasma membrane	SH3 domain binding			ovary(1)	1				Colorectal(46;0.018)|READ - Rectum adenocarcinoma(1;0.0556)		CCAGGTCCCGAGGAAGTGAAT	0.627													92	53	---	---	---	---	PASS
LRRN4	164312	broad.mit.edu	37	20	6031567	6031567	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6031567G>A	uc002wmo.2	-	3	942	c.718C>T	c.(718-720)CGG>TGG	p.R240W	LRRN4_uc002wmp.2_Missense_Mutation_p.R240W	NM_152611	NP_689824	Q8WUT4	LRRN4_HUMAN	leucine rich repeat neuronal 4 precursor	240	Extracellular (Potential).|LRR 8.					integral to membrane				skin(3)	3						GTCGTCAGCCGAGGCATCTTC	0.557													19	77	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13839949	13839949	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13839949T>A	uc010gcf.2	-	18	1859	c.1777A>T	c.(1777-1779)AAT>TAT	p.N593Y	SEL1L2_uc002woq.3_Missense_Mutation_p.N454Y|SEL1L2_uc010zrl.1_Intron|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	593	Extracellular (Potential).|Sel1-like 11.					integral to membrane	binding			ovary(2)	2						TAAGCCAGATTGAACATGGCT	0.413													44	49	---	---	---	---	PASS
FLRT3	23767	broad.mit.edu	37	20	14307545	14307545	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:14307545C>T	uc002wov.1	-	3	1075	c.608G>A	c.(607-609)CGC>CAC	p.R203H	MACROD2_uc002wot.2_Intron|MACROD2_uc002wou.2_Intron|FLRT3_uc002wow.1_Missense_Mutation_p.R203H	NM_198391	NP_938205	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	203	Extracellular (Potential).|LRR 7.				cell adhesion	integral to plasma membrane|proteinaceous extracellular matrix	protein binding, bridging|receptor signaling protein activity			kidney(1)	1		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		TAGAACCAGGCGTTTTAGACT	0.438													22	128	---	---	---	---	PASS
DSTN	11034	broad.mit.edu	37	20	17581499	17581499	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17581499C>T	uc002wpr.2	+	2	375	c.120C>T	c.(118-120)CTC>CTT	p.L40L	DSTN_uc002wpq.2_Silent_p.L23L|DSTN_uc010gck.2_Silent_p.L23L	NM_006870	NP_006861	P60981	DEST_HUMAN	destrin isoform a	40	ADF-H.				actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2						TTTTTTGTCTCAGTGCAGACA	0.378													25	120	---	---	---	---	PASS
GZF1	64412	broad.mit.edu	37	20	23345385	23345385	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23345385C>G	uc010gdb.2	+	3	539	c.365C>G	c.(364-366)TCA>TGA	p.S122*	GZF1_uc002wsy.2_Nonsense_Mutation_p.S122*|GZF1_uc010zsq.1_Intron|GZF1_uc010zsr.1_Intron|GZF1_uc002wsz.2_Nonsense_Mutation_p.S122*	NM_022482	NP_071927	Q9H116	GZF1_HUMAN	GDNF-inducible zinc finger protein 1	122					transcription, DNA-dependent	nucleolus|nucleoplasm	sequence-specific DNA binding|zinc ion binding			kidney(1)	1	Lung NSC(19;0.0605)|Colorectal(13;0.0993)|all_lung(19;0.135)					TTGGATTTATCAGAAACTTGT	0.423													16	92	---	---	---	---	PASS
BPIL1	80341	broad.mit.edu	37	20	31606524	31606524	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31606524G>A	uc002wyj.2	+	9	945	c.751G>A	c.(751-753)GAG>AAG	p.E251K		NM_025227	NP_079503	Q8N4F0	BPIL1_HUMAN	bactericidal/permeability-increasing	251						extracellular region	lipid binding			skin(2)|large_intestine(1)|ovary(1)	4						TGTGGGTACCGAGGGCTCCAT	0.637													9	182	---	---	---	---	PASS
C20orf144	128864	broad.mit.edu	37	20	32251450	32251450	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32251450T>G	uc002wzs.1	+	2	271	c.239T>G	c.(238-240)TTG>TGG	p.L80W	NECAB3_uc002wzl.2_5'Flank|NECAB3_uc002wzm.3_Intron|NECAB3_uc002wzn.3_Intron|NECAB3_uc002wzo.3_Intron|NECAB3_uc002wzp.3_Intron|NECAB3_uc002wzq.3_Intron|NECAB3_uc002wzr.3_Intron|NECAB3_uc010geo.2_Intron|C20orf134_uc002wzt.2_5'Flank	NM_080825	NP_543015	Q9BQM9	CT144_HUMAN	hypothetical protein LOC128864	80											0						GCACCCAGATTGCGCGGAGCG	0.731													3	29	---	---	---	---	PASS
E2F1	1869	broad.mit.edu	37	20	32267691	32267691	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32267691C>T	uc002wzu.3	-	3	582	c.442G>A	c.(442-444)GAC>AAC	p.D148N		NM_005225	NP_005216	Q01094	E2F1_HUMAN	E2F transcription factor 1	148	Potential.				apoptosis|cell proliferation|G1 phase of mitotic cell cycle|G2 phase of mitotic cell cycle|mRNA stabilization|negative regulation of transcription involved in G1/S phase of mitotic cell cycle|positive regulation of fibroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle	mitochondrion|Rb-E2F complex	sequence-specific DNA binding transcription factor activity|transcription corepressor activity|transcription factor binding				0						ACGACACCGTCAGCCGAGTGG	0.597													15	74	---	---	---	---	PASS
KIAA1755	85449	broad.mit.edu	37	20	36869797	36869797	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36869797G>C	uc002xhy.1	-	3	1008	c.736C>G	c.(736-738)CCA>GCA	p.P246A	KIAA1755_uc002xhz.1_Missense_Mutation_p.P246A	NM_001029864	NP_001025035	Q5JYT7	K1755_HUMAN	hypothetical protein LOC85449	246										ovary(4)|pancreas(1)	5		Myeloproliferative disorder(115;0.00874)				ATGAGTCCTGGATACTTGCTC	0.592													8	112	---	---	---	---	PASS
PPP1R16B	26051	broad.mit.edu	37	20	37536802	37536802	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37536802G>T	uc002xje.2	+	10	1349	c.1160G>T	c.(1159-1161)AGG>ATG	p.R387M	PPP1R16B_uc010ggc.2_Missense_Mutation_p.R345M	NM_015568	NP_056383	Q96T49	PP16B_HUMAN	protein phosphatase 1 regulatory inhibitor	387					regulation of filopodium assembly|signal transduction	nucleus|plasma membrane	protein phosphatase binding			upper_aerodigestive_tract(1)|kidney(1)|skin(1)	3		Myeloproliferative disorder(115;0.00878)				GGGGACATCAGGGAGACCAGG	0.597													3	66	---	---	---	---	PASS
FAM83D	81610	broad.mit.edu	37	20	37555035	37555035	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37555035C>A	uc002xjg.2	+	1	81	c.40C>A	c.(40-42)CGG>AGG	p.R14R	FAM83D_uc002xjf.2_Silent_p.R14R	NM_030919	NP_112181	Q9H4H8	FA83D_HUMAN	hypothetical protein LOC81610	Error:Variant_position_missing_in_Q9H4H8_after_alignment					cell division|mitosis	cytoplasm|spindle pole				ovary(3)	3		Myeloproliferative disorder(115;0.00878)				GCCTATAAAGCGGGACTGCAC	0.652													41	26	---	---	---	---	PASS
TOX2	84969	broad.mit.edu	37	20	42694504	42694504	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42694504C>T	uc002xlf.3	+	6	1076	c.1059C>T	c.(1057-1059)GCC>GCT	p.A353A	TOX2_uc010ggo.2_Silent_p.A371A|TOX2_uc002xle.3_Silent_p.A329A|TOX2_uc010ggp.2_Silent_p.A329A|TOX2_uc002xlg.2_Intron|TOX2_uc010zwk.1_Silent_p.A249A	NM_001098798	NP_001092268	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	353					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			CCTCCCCTGCCAGCCTCGCCC	0.701													82	47	---	---	---	---	PASS
PI3	5266	broad.mit.edu	37	20	43804653	43804653	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43804653C>T	uc002xng.2	+	2	255	c.231C>T	c.(229-231)CCC>CCT	p.P77P		NM_002638	NP_002629	P19957	ELAF_HUMAN	elafin preproprotein	77	WAP.				copulation	proteinaceous extracellular matrix	serine-type endopeptidase inhibitor activity				0		Myeloproliferative disorder(115;0.0122)				GCTCCTGCCCCATTATCTTGA	0.498													66	39	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44664529	44664529	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44664529G>A	uc010zxl.1	+	4	538	c.462G>A	c.(460-462)GAG>GAA	p.E154E	SLC12A5_uc002xra.2_Silent_p.E131E|SLC12A5_uc010zxm.1_RNA|SLC12A5_uc002xrb.2_Silent_p.E131E	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	154	Helical; (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	GCATCATGGAGTCCTTCTGCA	0.622													16	73	---	---	---	---	PASS
ZBTB46	140685	broad.mit.edu	37	20	62421182	62421182	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62421182C>T	uc002ygv.1	-	2	1130	c.929G>A	c.(928-930)CGA>CAA	p.R310Q	ZBTB46_uc002ygu.2_RNA	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	310					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					ACTTGAGTCTCGGCTGCTGAA	0.662													5	224	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10934063	10934063	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10934063T>A	uc002yip.1	-	16	1282	c.914A>T	c.(913-915)GAT>GTT	p.D305V	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D287V|TPTE_uc002yir.1_Missense_Mutation_p.D267V|TPTE_uc010gkv.1_Missense_Mutation_p.D167V	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	305	Phosphatase tensin-type.				signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATTATGATCATCAATCATGAT	0.313													29	229	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10970025	10970025	+	Missense_Mutation	SNP	C	G	G	rs143765390		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10970025C>G	uc002yip.1	-	6	471	c.103G>C	c.(103-105)GCA>CCA	p.A35P	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.A35P|TPTE_uc002yir.1_Missense_Mutation_p.A35P|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	35					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCGCAGGTGCCTCCTCGGTT	0.398													9	119	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19725358	19725358	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19725358T>C	uc002ykw.2	-	10	1064	c.1033A>G	c.(1033-1035)ATT>GTT	p.I345V		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	345	Extracellular (Potential).|MAM.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTACAATTAATTTTCTCATAA	0.299													37	87	---	---	---	---	PASS
TIAM1	7074	broad.mit.edu	37	21	32582453	32582453	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:32582453G>C	uc002yow.1	-	12	2768	c.2296C>G	c.(2296-2298)CCA>GCA	p.P766A	TIAM1_uc011adk.1_Missense_Mutation_p.P766A|TIAM1_uc011adl.1_Missense_Mutation_p.P741A	NM_003253	NP_003244	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	766	RBD.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cell-cell junction|cytosol	receptor signaling protein activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|breast(3)|ovary(2)|large_intestine(2)	10						AACCAGGATGGAGTGAAATAC	0.517													16	50	---	---	---	---	PASS
SIK1	150094	broad.mit.edu	37	21	44845334	44845334	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44845334G>C	uc002zdf.2	-	3	353	c.226C>G	c.(226-228)CAG>GAG	p.Q76E		NM_173354	NP_775490	P57059	SIK1_HUMAN	salt-inducible kinase 1	76	Protein kinase.				anoikis|cell cycle|cell differentiation|intracellular protein kinase cascade|multicellular organismal development|regulation of cell differentiation|regulation of mitotic cell cycle	nucleus	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			lung(2)|testis(2)|ovary(1)|central_nervous_system(1)|skin(1)	7						TTCATCAGCTGAACCTCACGA	0.348													15	30	---	---	---	---	PASS
KRTAP10-5	386680	broad.mit.edu	37	21	45999774	45999774	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45999774T>C	uc002zfl.1	-	1	708	c.682A>G	c.(682-684)ATA>GTA	p.I228V	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	228	22 X 5 AA repeats of C-C-X(3).					keratin filament					0						GGCCTGCATATGGGGCGGCAG	0.682													4	125	---	---	---	---	PASS
KRTAP10-5	386680	broad.mit.edu	37	21	45999841	45999841	+	Silent	SNP	A	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45999841A>G	uc002zfl.1	-	1	641	c.615T>C	c.(613-615)TGT>TGC	p.C205C	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	205	22 X 5 AA repeats of C-C-X(3).					keratin filament					0						AAGCCGGCTGACAGCTAGACT	0.632													4	274	---	---	---	---	PASS
ITGB2	3689	broad.mit.edu	37	21	46326964	46326964	+	Missense_Mutation	SNP	C	T	T	rs144806686		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46326964C>T	uc002zgd.2	-	3	238	c.194G>A	c.(193-195)CGG>CAG	p.R65Q	ITGB2_uc002zge.2_Missense_Mutation_p.R65Q|ITGB2_uc002zgf.3_Missense_Mutation_p.R65Q|ITGB2_uc011afl.1_5'UTR|ITGB2_uc010gpw.2_Missense_Mutation_p.R65Q|ITGB2_uc002zgg.2_Missense_Mutation_p.R65Q	NM_001127491	NP_001120963	P05107	ITB2_HUMAN	integrin, beta 2 precursor	65	Extracellular (Potential).				apoptosis|blood coagulation|cell-cell signaling|cell-matrix adhesion|inflammatory response|integrin-mediated signaling pathway|leukocyte cell-cell adhesion|multicellular organismal development|neutrophil chemotaxis|regulation of cell shape|regulation of immune response|regulation of peptidyl-tyrosine phosphorylation	integrin complex	glycoprotein binding|protein kinase binding|receptor activity			ovary(4)|central_nervous_system(3)|breast(2)	9				Colorectal(79;0.0669)	Simvastatin(DB00641)	CAGCTGTGGCCGGGTGTCGCA	0.652													25	58	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47532249	47532249	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47532249G>C	uc002zia.1	+	3	554	c.472G>C	c.(472-474)GTG>CTG	p.V158L	COL6A2_uc002zhy.1_Missense_Mutation_p.V158L|COL6A2_uc002zhz.1_Missense_Mutation_p.V158L|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	158	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CCACTTCGCCGTGGTCATCAC	0.711													6	26	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47832813	47832813	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47832813G>A	uc002zji.3	+	29	6164	c.6057G>A	c.(6055-6057)GTG>GTA	p.V2019V	PCNT_uc002zjj.2_Silent_p.V1901V	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	2019					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					AAGAAGGCGTGATGTCAGTGC	0.572													4	120	---	---	---	---	PASS
VPREB3	29802	broad.mit.edu	37	22	24095215	24095215	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24095215C>T	uc002zxt.2	-	2	300	c.220G>A	c.(220-222)GAG>AAG	p.E74K	ZNF70_uc002zxs.2_5'Flank	NM_013378	NP_037510	Q9UKI3	VPRE3_HUMAN	pre-B lymphocyte 3 precursor	74	Ig-like.					endoplasmic reticulum					0		Medulloblastoma(6;7.87e-06)|all_neural(6;0.00334)				TGATCCTCCTCCGAGCGGTAG	0.627													14	42	---	---	---	---	PASS
GAS2L1	10634	broad.mit.edu	37	22	29706515	29706515	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29706515G>C	uc003afa.1	+	3	919	c.720G>C	c.(718-720)TCG>TCC	p.S240S	GAS2L1_uc010gvm.1_Silent_p.S240S|GAS2L1_uc003afb.1_Silent_p.S240S|GAS2L1_uc003afc.1_Silent_p.S240S|GAS2L1_uc003afd.1_Silent_p.S240S|GAS2L1_uc003afe.1_Silent_p.S240S	NM_152236	NP_689422	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1 isoform a	240	GAR.				cell cycle arrest	cytoplasm|cytoskeleton					0						TGGGGGACTCGAGCCTGCTCA	0.677													14	77	---	---	---	---	PASS
AP1B1	162	broad.mit.edu	37	22	29745309	29745309	+	Silent	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29745309C>A	uc003afj.2	-	11	1519	c.1335G>T	c.(1333-1335)CGG>CGT	p.R445R	AP1B1_uc003afi.2_Silent_p.R445R|AP1B1_uc003afk.2_Silent_p.R445R|AP1B1_uc003afl.2_Silent_p.R445R|AP1B1_uc011ako.1_5'UTR	NM_001127	NP_001118	Q10567	AP1B1_HUMAN	adaptor-related protein complex 1 beta 1 subunit	445					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	clathrin adaptor complex|clathrin coated vesicle membrane|cytosol|Golgi membrane|lysosomal membrane	protein binding|protein transporter activity			ovary(1)|skin(1)	2						TCATGGCAGCCCGGGCCTCAG	0.587													32	121	---	---	---	---	PASS
ASCC2	84164	broad.mit.edu	37	22	30189459	30189459	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30189459C>G	uc003agr.2	-	17	1914	c.1809G>C	c.(1807-1809)GAG>GAC	p.E603D	ASCC2_uc003ags.2_RNA|ASCC2_uc003agt.2_Missense_Mutation_p.E603D|ASCC2_uc011akr.1_Missense_Mutation_p.E527D	NM_032204	NP_115580	Q9H1I8	ASCC2_HUMAN	activating signal cointegrator 1 complex subunit	603					regulation of transcription, DNA-dependent|transcription, DNA-dependent						0			OV - Ovarian serous cystadenocarcinoma(5;0.000103)|Epithelial(10;0.0169)|all cancers(5;0.0259)			AGGGCAGGCTCTCGCCTGGCT	0.602													24	77	---	---	---	---	PASS
RFPL3	10738	broad.mit.edu	37	22	32756259	32756259	+	Missense_Mutation	SNP	G	T	T	rs146565766	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32756259G>T	uc003amj.2	+	2	599	c.394G>T	c.(394-396)GAC>TAC	p.D132Y	RFPL3_uc010gwn.2_Missense_Mutation_p.D103Y|RFPL3S_uc003amk.2_RNA|RFPL3S_uc003aml.2_RNA	NM_001098535	NP_001092005	O75679	RFPL3_HUMAN	ret finger protein-like 3 isoform 1	132	B30.2/SPRY.						zinc ion binding			ovary(1)	1						CTTGGATGCCGACACAGCCAA	0.502													24	118	---	---	---	---	PASS
TOM1	10043	broad.mit.edu	37	22	35719913	35719913	+	Intron	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35719913C>T	uc003ann.2	+						TOM1_uc011ami.1_Intron|TOM1_uc011amj.1_Intron|TOM1_uc003ans.2_Intron|TOM1_uc011amk.1_Intron|TOM1_uc003anp.2_Intron|TOM1_uc011aml.1_Intron|TOM1_uc003ano.2_Intron|TOM1_uc003anq.2_Intron|TOM1_uc003anr.2_Intron	NM_005488	NP_005479	O60784	TOM1_HUMAN	target of myb1 isoform 1						endocytosis|endosome transport|intracellular protein transport	cytosol|early endosome|membrane	protein binding			ovary(1)	1						AACAGGTAAACGAGCCTGGGG	0.617													14	60	---	---	---	---	PASS
CYTH4	27128	broad.mit.edu	37	22	37696994	37696994	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37696994G>C	uc003arf.2	+	7	597	c.481G>C	c.(481-483)GAC>CAC	p.D161H	CYTH4_uc003are.2_Missense_Mutation_p.D161H|CYTH4_uc011amw.1_Missense_Mutation_p.D104H|CYTH4_uc010gxe.2_Intron	NM_013385	NP_037517	Q9UIA0	CYH4_HUMAN	cytohesin 4	161	SEC7.				regulation of ARF protein signal transduction|regulation of cell adhesion	cytoplasm|plasma membrane	ARF guanyl-nucleotide exchange factor activity			ovary(2)	2						CCAGAAGATAGACCGGATGAT	0.687													9	30	---	---	---	---	PASS
DDX17	10521	broad.mit.edu	37	22	38894559	38894559	+	Silent	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38894559C>T	uc003avy.3	-	4	661	c.558G>A	c.(556-558)TTG>TTA	p.L186L	DDX17_uc003avx.3_Silent_p.L186L|DDX17_uc011anu.1_Silent_p.L99L	NM_001098504	NP_001091974	Q92841	DDX17_HUMAN	DEAD box polypeptide 17 isoform 3	107	Q motif.				RNA processing	nucleus	ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity|RNA-dependent ATPase activity			skin(3)|upper_aerodigestive_tract(1)	4	Melanoma(58;0.0286)					GCTGATCCATCAACACATCCA	0.393													18	164	---	---	---	---	PASS
PRR5-ARHGAP8	553158	broad.mit.edu	37	22	45127638	45127638	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45127638G>T	uc003bfd.2	+	5	623	c.351G>T	c.(349-351)GAG>GAT	p.E117D	PRR5_uc003bew.1_Missense_Mutation_p.E108D|PRR5_uc003bex.1_Missense_Mutation_p.E22D|PRR5_uc010gzt.1_Missense_Mutation_p.E140D|PRR5_uc010gzu.1_Missense_Mutation_p.E81D|PRR5_uc003bey.1_Missense_Mutation_p.E108D|PRR5_uc003bez.1_Missense_Mutation_p.E22D|PRR5-ARHGAP8_uc003bfc.2_Intron|PRR5-ARHGAP8_uc011aqi.1_Intron|PRR5-ARHGAP8_uc011aqj.1_Intron|PRR5_uc003bfa.1_Missense_Mutation_p.E10D|PRR5_uc003bfb.1_Missense_Mutation_p.E117D|PRR5_uc003bfe.1_RNA|PRR5-ARHGAP8_uc003bfg.1_Intron|PRR5_uc003bfh.1_Missense_Mutation_p.E16D	NM_181335	NP_851852			Rho GTPase activating protein 8 isoform 2											skin(2)	2						CACTGGCAGAGACCTGGGACT	0.652													42	24	---	---	---	---	PASS
SMC1B	27127	broad.mit.edu	37	22	45779481	45779481	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45779481C>T	uc003bgc.2	-	12	1976	c.1924G>A	c.(1924-1926)GAT>AAT	p.D642N	SMC1B_uc003bgd.2_Missense_Mutation_p.D642N|SMC1B_uc003bge.1_Missense_Mutation_p.D425N	NM_148674	NP_683515	Q8NDV3	SMC1B_HUMAN	SMC1 structural maintenance of chromosomes	642	Flexible hinge.				chromosome organization|meiosis	chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nucleus	ATP binding			ovary(2)	2		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		AATGTTCCATCAAGAGCTACT	0.323													49	78	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46653841	46653841	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46653841C>G	uc003bhh.2	-	1	5379	c.5379G>C	c.(5377-5379)TTG>TTC	p.L1793F		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1793	Extracellular (Potential).				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		CTTGCCTCATCAATGGAAGGC	0.408													6	398	---	---	---	---	PASS
SBF1	6305	broad.mit.edu	37	22	50900000	50900000	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50900000G>A	uc003blh.2	-	22	2986	c.2791C>T	c.(2791-2793)CTC>TTC	p.L931F	SBF1_uc011arx.1_Missense_Mutation_p.L595F|SBF1_uc003bli.2_Missense_Mutation_p.L932F	NM_002972	NP_002963	O95248	MTMR5_HUMAN	SET binding factor 1	931	GRAM.				protein dephosphorylation	integral to membrane|nucleus	protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		TACGTGGTGAGGAAGACGGCG	0.701													10	27	---	---	---	---	PASS
WWC3	55841	broad.mit.edu	37	X	10047794	10047794	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10047794G>T	uc004csx.3	+	5	525	c.327G>T	c.(325-327)CAG>CAT	p.Q109H	WWC3_uc010nds.2_5'UTR|WWC3_uc010ndt.2_RNA	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3	109	Potential.									ovary(4)	4						AGCTGACCCAGATGAAGCAGG	0.433													13	13	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18213564	18213564	+	Splice_Site	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18213564T>A	uc004cyj.3	-	7	1188	c.1034_splice	c.e7-1	p.A345_splice	BEND2_uc010nfb.2_Intron	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2											ovary(3)|kidney(1)|central_nervous_system(1)	5						TTTTCTCAGCTATTGGGAaaa	0.209													19	19	---	---	---	---	PASS
BEND2	139105	broad.mit.edu	37	X	18230740	18230740	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18230740C>G	uc004cyj.3	-	4	591	c.437G>C	c.(436-438)AGT>ACT	p.S146T	BEND2_uc010nfb.2_Missense_Mutation_p.S146T	NM_153346	NP_699177	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	146										ovary(3)|kidney(1)|central_nervous_system(1)	5						TGAGTTGTAACTGTATCTTCT	0.338													35	46	---	---	---	---	PASS
PHEX	5251	broad.mit.edu	37	X	22186486	22186486	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22186486G>A	uc004dah.2	+	13	1665	c.1462G>A	c.(1462-1464)GTT>ATT	p.V488I	PHEX_uc011mjr.1_Missense_Mutation_p.V488I|PHEX_uc011mjs.1_Missense_Mutation_p.V391I	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase	488	Extracellular (Potential).				biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						TGATACTCATGTTAATGAAGA	0.363													27	35	---	---	---	---	PASS
ACOT9	23597	broad.mit.edu	37	X	23723173	23723173	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23723173T>C	uc004dap.2	-	13	1163	c.1017A>G	c.(1015-1017)GCA>GCG	p.A339A	ACOT9_uc004dan.2_Silent_p.A89A|ACOT9_uc004dao.2_Silent_p.A348A|ACOT9_uc004daq.2_Silent_p.A297A|ACOT9_uc004dar.2_Silent_p.A279A|ACOT9_uc011mjt.1_RNA|ACOT9_uc004das.2_Silent_p.A279A	NM_001033583	NP_001028755	Q9Y305	ACOT9_HUMAN	acyl-Coenzyme A thioesterase 2, mitochondrial	339					acyl-CoA metabolic process	mitochondrion	acetyl-CoA hydrolase activity|carboxylesterase activity			ovary(2)|pancreas(1)	3						TGTCATCTACTGCTACCACAA	0.408													44	31	---	---	---	---	PASS
POLA1	5422	broad.mit.edu	37	X	24721417	24721417	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24721417C>T	uc004dbl.2	+	3	223	c.200C>T	c.(199-201)TCG>TTG	p.S67L	POLA1_uc004dbm.2_Missense_Mutation_p.S73L|POLA1_uc004dbn.2_5'UTR	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1	67					cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	GAACAGTATTCGAAGCTGGTT	0.478													6	6	---	---	---	---	PASS
MAGEB18	286514	broad.mit.edu	37	X	26157751	26157751	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26157751G>T	uc004dbq.1	+	2	836	c.649G>T	c.(649-651)GAG>TAG	p.E217*		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	217	MAGE.						protein binding			central_nervous_system(1)	1						TGCCCCAGAAGAGGCAGTCTG	0.463													5	3	---	---	---	---	PASS
NR0B1	190	broad.mit.edu	37	X	30326502	30326502	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30326502C>A	uc004dcf.3	-	1	994	c.979G>T	c.(979-981)GAG>TAG	p.E327*		NM_000475	NP_000466	P51843	NR0B1_HUMAN	nuclear receptor subfamily 0, group B, member 1	327	Ligand-binding (By similarity).				adrenal gland development|hypothalamus development|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of steroid hormone receptor signaling pathway|pituitary gland development|protein localization|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid biosynthetic process	cytoplasm|membrane fraction|nucleoplasm|nucleus|polysomal ribosome	AF-2 domain binding|DNA hairpin binding|ligand-regulated transcription factor activity|protein domain specific binding|protein homodimerization activity|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|steroid hormone receptor binding|transcription corepressor activity|transcription factor binding			ovary(1)|lung(1)	2					Dexamethasone(DB01234)|Tretinoin(DB00755)	CCCCCGGTCTCCCGCCGCCTG	0.677											OREG0019719	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	11	---	---	---	---	PASS
FTHL17	53940	broad.mit.edu	37	X	31089771	31089771	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31089771G>T	uc004dcl.1	-	1	403	c.300C>A	c.(298-300)GCC>GCA	p.A100A		NM_031894	NP_114100	Q9BXU8	FHL17_HUMAN	ferritin, heavy polypeptide-like 17	100	Ferritin-like diiron.				cellular iron ion homeostasis|iron ion transport		ferric iron binding|oxidoreductase activity				0						CGGACTCCATGGCCACGAGCC	0.627													23	37	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148342	34148342	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148342G>C	uc004ddg.2	-	1	2087	c.2054C>G	c.(2053-2055)TCT>TGT	p.S685C		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	685										ovary(4)|central_nervous_system(1)	5						TGCGGTATAAGAATTCGATGG	0.443													38	50	---	---	---	---	PASS
CYBB	1536	broad.mit.edu	37	X	37655397	37655397	+	Intron	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37655397G>A	uc004ddr.2	+						CYBB_uc011mke.1_Intron|CYBB_uc011mkf.1_Intron|CYBB_uc011mkg.1_Intron	NM_000397	NP_000388	P04839	CY24B_HUMAN	cytochrome b-245 beta polypeptide						electron transport chain|inflammatory response|innate immune response|respiratory burst|superoxide anion generation	NADPH oxidase complex	electron carrier activity|flavin adenine dinucleotide binding|heme binding|protein heterodimerization activity|superoxide-generating NADPH oxidase activity|voltage-gated ion channel activity			central_nervous_system(1)|skin(1)	2						GGAGCTGAGTGAGTGTTTAAA	0.458													4	71	---	---	---	---	PASS
TSPYL2	64061	broad.mit.edu	37	X	53117071	53117071	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53117071C>T	uc004drw.2	+	7	2164	c.2032C>T	c.(2032-2034)CAG>TAG	p.Q678*	TSPYL2_uc004drv.2_3'UTR	NM_022117	NP_071400	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	678					cell cycle|chromatin modification|negative regulation of cell cycle|negative regulation of cell growth|negative regulation of DNA replication|nucleosome assembly|regulation of protein kinase activity|regulation of signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	protein binding|rDNA binding				0						GGATGTGCTTCAGGTCCCAAA	0.527											OREG0019795	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	19	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67940891	67940891	+	Silent	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67940891G>A	uc004dxa.2	+	8	2307	c.1935G>A	c.(1933-1935)AAG>AAA	p.K645K	STARD8_uc004dxb.2_Silent_p.K725K|STARD8_uc004dxc.3_Silent_p.K645K	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	645	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						ACCTGCTAAAGCAGTATTTCC	0.557													30	17	---	---	---	---	PASS
ARR3	407	broad.mit.edu	37	X	69495998	69495998	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69495998T>A	uc004dyb.2	+	6	280	c.212T>A	c.(211-213)TTC>TAC	p.F71Y	ARR3_uc004dya.2_Missense_Mutation_p.F71Y	NM_004312	NP_004303	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	71					signal transduction|visual perception	cytoplasm|soluble fraction				large_intestine(2)|ovary(2)	4						GGTCTGACGTTCCGAAAAGAT	0.537													11	10	---	---	---	---	PASS
MAGEE2	139599	broad.mit.edu	37	X	75004088	75004088	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75004088G>C	uc004ecj.1	-	1	984	c.799C>G	c.(799-801)CTG>GTG	p.L267V		NM_138703	NP_619648	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	267	MAGE 1.									ovary(1)|skin(1)	2						ACAAACTTCAGGGCTTCCATC	0.493													32	25	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79945455	79945455	+	Intron	SNP	C	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79945455C>G	uc004edt.2	-						BRWD3_uc010nmi.1_Intron|BRWD3_uc004edo.2_Intron|BRWD3_uc004edp.2_Intron|BRWD3_uc004edq.2_Intron|BRWD3_uc010nmj.1_Intron|BRWD3_uc004edr.2_Intron|BRWD3_uc004eds.2_Intron|BRWD3_uc004edu.2_Intron|BRWD3_uc004edv.2_Intron|BRWD3_uc004edw.2_Intron|BRWD3_uc004edx.2_Intron|BRWD3_uc004edy.2_Intron|BRWD3_uc004edz.2_Intron|BRWD3_uc004eea.2_Intron|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3											ovary(4)	4						GAAGCTAAAACTGCTTCTTAC	0.279													14	13	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79975093	79975093	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79975093G>C	uc004edt.2	-	18	2202	c.1939C>G	c.(1939-1941)CTT>GTT	p.L647V	BRWD3_uc010nmi.1_RNA|BRWD3_uc004edo.2_Missense_Mutation_p.L243V|BRWD3_uc004edp.2_Missense_Mutation_p.L476V|BRWD3_uc004edq.2_Missense_Mutation_p.L243V|BRWD3_uc010nmj.1_Missense_Mutation_p.L243V|BRWD3_uc004edr.2_Missense_Mutation_p.L317V|BRWD3_uc004eds.2_Missense_Mutation_p.L243V|BRWD3_uc004edu.2_Missense_Mutation_p.L317V|BRWD3_uc004edv.2_Missense_Mutation_p.L243V|BRWD3_uc004edw.2_Missense_Mutation_p.L243V|BRWD3_uc004edx.2_Missense_Mutation_p.L243V|BRWD3_uc004edy.2_Missense_Mutation_p.L243V|BRWD3_uc004edz.2_Missense_Mutation_p.L317V|BRWD3_uc004eea.2_Missense_Mutation_p.L317V|BRWD3_uc004eeb.2_Missense_Mutation_p.L243V	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	647										ovary(4)	4						ATTCCATCAAGAATGCTCTCA	0.393													9	64	---	---	---	---	PASS
MIR361	494323	broad.mit.edu	37	X	85158697	85158697	+	RNA	SNP	G	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85158697G>A	hsa-mir-361|MI0000760	-			c.16G>A			CHM_uc004eet.2_Intron|CHM_uc011mqz.1_Intron																	0						tacccctggagattctgatAA	0.313													3	32	---	---	---	---	PASS
BEX4	56271	broad.mit.edu	37	X	102471255	102471255	+	Silent	SNP	T	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102471255T>C	uc004ejv.3	+	3	409	c.174T>C	c.(172-174)CTT>CTC	p.L58L	BEX4_uc004ejw.3_Silent_p.L58L	NM_001080425	NP_001073894	Q9NWD9	BEX4_HUMAN	BEX family member 4	58						cytoplasm|nucleus				skin(1)	1						TTAGGCGACTTGTCCCTAATT	0.507													24	12	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105189947	105189947	+	Silent	SNP	A	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105189947A>T	uc004emd.2	+	25	4446	c.4143A>T	c.(4141-4143)GCA>GCT	p.A1381A	NRK_uc011msi.1_5'Flank	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1381	CNH.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						AAATACAGGCAGCTGATCCAG	0.433										HNSCC(51;0.14)			9	10	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110490677	110490677	+	Silent	SNP	G	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110490677G>T	uc004epc.1	-	12	1830	c.1662C>A	c.(1660-1662)GTC>GTA	p.V554V	CAPN6_uc011msu.1_Silent_p.V299V	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6	554	C2.				microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						TATTCTTCTGGACAGGAGAAC	0.413													54	45	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117731471	117731471	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117731471C>A	uc004eqp.2	+	21	2404	c.2341C>A	c.(2341-2343)CTT>ATT	p.L781I	DOCK11_uc004eqq.2_Missense_Mutation_p.L547I	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	781	DHR-1.				blood coagulation	cytosol	GTP binding			ovary(3)	3						TTCCGCCAATCTTCCCCCAGG	0.403													4	143	---	---	---	---	PASS
UPF3B	65109	broad.mit.edu	37	X	118986805	118986805	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118986805G>C	uc004erz.1	-	1	164	c.87C>G	c.(85-87)ACC>ACG	p.T29T	UPF3B_uc004esa.1_Silent_p.T29T	NM_080632	NP_542199	Q9BZI7	REN3B_HUMAN	UPF3 regulator of nonsense transcripts homolog B	29					mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|positive regulation of translation|termination of RNA polymerase II transcription	cytosol|exon-exon junction complex|nucleoplasm	mRNA binding|nucleocytoplasmic transporter activity|nucleotide binding|protein binding			ovary(2)|kidney(1)	3						TGTCCCCCGAGGTCCCACCAC	0.642													67	139	---	---	---	---	PASS
FAM70A	55026	broad.mit.edu	37	X	119394785	119394785	+	Silent	SNP	C	A	A	rs138279635		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119394785C>A	uc004eso.3	-	10	1217	c.990G>T	c.(988-990)CCG>CCT	p.P330P	FAM70A_uc004esp.3_Silent_p.P306P|FAM70A_uc010nqo.2_Silent_p.P222P	NM_017938	NP_060408	Q5JRV8	FA70A_HUMAN	hypothetical protein LOC55026 isoform 1	330	Pro-rich.					integral to membrane				lung(1)|breast(1)	2						AGTAACGGGGCGGTGCACTTG	0.527													24	42	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123196827	123196827	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123196827C>T	uc004etz.3	+	17	2053	c.1714C>T	c.(1714-1716)CCT>TCT	p.P572S	STAG2_uc004eua.2_Missense_Mutation_p.P572S|STAG2_uc004eub.2_Missense_Mutation_p.P572S|STAG2_uc004euc.2_Missense_Mutation_p.P572S|STAG2_uc004eud.2_Missense_Mutation_p.P572S|STAG2_uc004eue.2_Missense_Mutation_p.P572S	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	572					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CGTGGCCCTTCCTCAGTTATT	0.363													59	18	---	---	---	---	PASS
SMARCA1	6594	broad.mit.edu	37	X	128657245	128657245	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128657245G>C	uc004eun.3	-	1	216	c.103C>G	c.(103-105)CAG>GAG	p.Q35E	SMARCA1_uc004eup.3_Missense_Mutation_p.Q35E|SMARCA1_uc011muk.1_Missense_Mutation_p.Q35E|SMARCA1_uc011mul.1_Missense_Mutation_p.Q35E	NM_003069	NP_003060	P28370	SMCA1_HUMAN	SWI/SNF-related matrix-associated	35					ATP-dependent chromatin remodeling|brain development|neuron differentiation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	NURF complex	ATP binding|DNA binding|helicase activity|nucleosome binding|protein binding			ovary(3)|skin(1)	4						CCCTCCTCCTGAGAGGTGGAC	0.677													53	108	---	---	---	---	PASS
PNMA5	114824	broad.mit.edu	37	X	152159171	152159171	+	Silent	SNP	G	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152159171G>C	uc010ntw.2	-	3	1311	c.972C>G	c.(970-972)CTC>CTG	p.L324L	PNMA5_uc004fha.3_Silent_p.L324L|PNMA5_uc010ntx.2_Silent_p.L324L|PNMA5_uc004fgy.3_Silent_p.L324L	NM_001103151	NP_001096621	Q96PV4	PNMA5_HUMAN	paraneoplastic antigen like 5	324					apoptosis					ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CATCTCGAATGAGCTTCATTA	0.562													53	19	---	---	---	---	PASS
PDZD4	57595	broad.mit.edu	37	X	153072813	153072813	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153072813C>A	uc004fiz.1	-	3	558	c.308G>T	c.(307-309)AGC>ATC	p.S103I	PDZD4_uc004fiy.1_Missense_Mutation_p.S28I|PDZD4_uc004fix.2_Missense_Mutation_p.S7I|PDZD4_uc004fja.1_Missense_Mutation_p.S109I|PDZD4_uc011mze.1_Intron	NM_032512	NP_115901	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	103						cell cortex				breast(1)	1	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATACTCATGGCTGATTGGGGG	0.657													6	2	---	---	---	---	PASS
MECP2	4204	broad.mit.edu	37	X	153295970	153295970	+	Missense_Mutation	SNP	G	C	C	rs61753972		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153295970G>C	uc004fjv.2	-	4	1535	c.1309C>G	c.(1309-1311)CAG>GAG	p.Q437E	MECP2_uc004fjw.2_Missense_Mutation_p.Q449E	NM_004992	NP_004983	P51608	MECP2_HUMAN	methyl CpG binding protein 2 isoform 1	437					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCGCGGGCTGAGTCTTAGCT	0.607													6	375	---	---	---	---	PASS
ZFY	7544	broad.mit.edu	37	Y	2843674	2843674	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:2843674C>T	uc004fqj.2	+	5	1228	c.907C>T	c.(907-909)CAA>TAA	p.Q303*	ZFY_uc010nwd.1_Nonsense_Mutation_p.Q303*|ZFY_uc011nan.1_Nonsense_Mutation_p.Q112*|ZFY_uc010nwe.2_Nonsense_Mutation_p.Q277*	NM_003411	NP_003402	P08048	ZFY_HUMAN	zinc finger protein, Y-linked isoform 1	303					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAATGACTCTCAACAAGAAGA	0.254													28	57	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4967431	4967431	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4967431C>A	uc004fqo.2	+	2	2546	c.1812C>A	c.(1810-1812)CAC>CAA	p.H604Q	PCDH11Y_uc010nwg.1_Missense_Mutation_p.H593Q|PCDH11Y_uc004fql.1_Missense_Mutation_p.H593Q|PCDH11Y_uc004fqm.1_Missense_Mutation_p.H593Q|PCDH11Y_uc004fqn.1_Missense_Mutation_p.H604Q|PCDH11Y_uc004fqp.1_Missense_Mutation_p.H375Q	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	604	Extracellular (Potential).|Cadherin 6.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						TTTTCACTCACAATGAATACA	0.393													79	26	---	---	---	---	PASS
CAMK2N1	55450	broad.mit.edu	37	1	20809957	20809959	+	3'UTR	DEL	CTC	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20809957_20809959delCTC	uc001bdh.2	-	2					CAMK2N1_uc001bdg.2_RNA	NM_018584	NP_061054	Q7Z7J9	CK2N1_HUMAN	calcium/calmodulin-dependent protein kinase II							cell junction|postsynaptic density|postsynaptic membrane|synaptosome					0		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.0013)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000132)|Kidney(64;0.00016)|GBM - Glioblastoma multiforme(114;0.00116)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.195)		CCAGAGccttctcctcctcctcc	0.261													4	2	---	---	---	---	
CCDC18	343099	broad.mit.edu	37	1	93692082	93692083	+	Intron	DEL	AT	-	-	rs71875718		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93692082_93692083delAT	uc001dpq.2	+						CCDC18_uc009wdl.1_Intron	NM_206886	NP_996769	Q5T9S5	CCD18_HUMAN	sarcoma antigen NY-SAR-41											ovary(2)|breast(2)|pancreas(1)	5		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		GTAGGACAAAatatatatatat	0.124													4	2	---	---	---	---	
DAP3	7818	broad.mit.edu	37	1	155697260	155697260	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155697260delA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					accctgtctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
RNASEH1	246243	broad.mit.edu	37	2	3608128	3608131	+	5'Flank	DEL	TTCT	-	-	rs4849995		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3608128_3608131delTTCT	uc002qxs.2	-						RNASEH1_uc002qxt.2_5'Flank|uc002qxu.2_Intron|uc002qxv.2_Intron			O60930	RNH1_HUMAN	SubName: Full=cDNA FLJ39594 fis, clone SKNSH2001875, highly similar to Ribonuclease H1 (EC 3.1.26.4);						RNA catabolic process	cytoplasm	magnesium ion binding|ribonuclease H activity|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		ccttccttccttcttctttccttc	0.118													5	4	---	---	---	---	
C2orf48	348738	broad.mit.edu	37	2	10282327	10282328	+	Intron	DEL	GT	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10282327_10282328delGT	uc002rai.1	+							NM_182626	NP_872432	Q96LS8	CB048_HUMAN	hypothetical protein LOC348738												0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.188)		agtggagtgggtgtgtacatgc	0.000													178	86	---	---	---	---	
LAPTM4A	9741	broad.mit.edu	37	2	20237513	20237513	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20237513delA	uc002rdm.2	-						LAPTM4A_uc002rdn.2_Intron|LAPTM4A_uc010yjx.1_Intron	NM_014713	NP_055528	Q15012	LAP4A_HUMAN	lysosomal protein transmembrane 4 alpha						transport	endomembrane system|Golgi apparatus|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAAGAGGGTAAAAAAAAAAA	0.299													4	3	---	---	---	---	
NLRC4	58484	broad.mit.edu	37	2	32460779	32460780	+	Intron	INS	-	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32460779_32460780insT	uc002roi.2	-						NLRC4_uc002roj.1_Intron|NLRC4_uc010ezt.1_Intron	NM_021209	NP_067032	Q9NPP4	NLRC4_HUMAN	caspase recruitment domain protein 12						activation of caspase activity|defense response to bacterium|detection of bacterium|interleukin-1 beta secretion|positive regulation of apoptosis	cytoplasm	ATP binding|magnesium ion binding|protein homodimerization activity			ovary(3)|large_intestine(1)|lung(1)|skin(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTAATTTttggtttttttttgg	0.193													4	2	---	---	---	---	
ANKRD53	79998	broad.mit.edu	37	2	71209832	71209833	+	Intron	INS	-	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71209832_71209833insC	uc002shl.3	+						ANKRD53_uc002shk.3_Intron|ANKRD53_uc002shm.3_Intron	NM_001115116	NP_001108588	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53 isoform a												0						TATCAAGTAAGGGGGACAGCAG	0.545													88	39	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764886	91764893	+	IGR	DEL	TATGTGTG	-	-	rs4005074		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764886_91764893delTATGTGTG								None (None upstream) : LOC654342 (40299 downstream)																							gatgtacgtatatgtgtgtgtgtgtgtg	0.000													3	3	---	---	---	---	
CYP27C1	339761	broad.mit.edu	37	2	127960745	127960746	+	Intron	INS	-	A	A	rs71394673		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127960745_127960746insA	uc002tod.2	-							NM_001001665	NP_001001665	Q4G0S4	C27C1_HUMAN	cytochrome P450, family 27, subfamily C,							membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.071)		cttcatctcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	127992953	127992956	+	IGR	DEL	AAGA	-	-	rs62157501		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:127992953_127992956delAAGA								CYP27C1 (29610 upstream) : ERCC3 (21910 downstream)																							aaggaaggagaagaaagaaagaaa	0.015													3	3	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198338420	198338420	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198338420delA	uc002uuh.1	+						COQ10B_uc010fsl.1_Intron	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			caggaaaaccaaaaaaaaaaa	0.100													5	3	---	---	---	---	
KLF7	8609	broad.mit.edu	37	2	208030439	208030440	+	5'UTR	INS	-	A	A	rs71412410		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:208030439_208030440insA	uc002vbz.1	-	1					KLF7_uc002vca.1_Intron	NM_003709	NP_003700	O75840	KLF7_HUMAN	Kruppel-like factor 7 (ubiquitous)						regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|zinc ion binding			central_nervous_system(1)|skin(1)	2				LUSC - Lung squamous cell carcinoma(261;0.0856)|Lung(261;0.166)|Epithelial(149;0.173)		AACTAAAAAGGAAAAAAAAAAA	0.500													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	234699315	234699315	+	IGR	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234699315delT								UGT1A10 (17366 upstream) : HJURP (46172 downstream)																							cctccctccctccctcccttc	0.000													3	4	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1424694	1424694	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1424694delG	uc003boz.2	+	18	2502	c.2235delG	c.(2233-2235)TCGfs	p.S745fs	CNTN6_uc011asj.1_Frame_Shift_Del_p.S673fs|CNTN6_uc003bpa.2_Frame_Shift_Del_p.S745fs	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	745	Fibronectin type-III 2.				axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAGTGGGCTCGACAACCTGGT	0.453													43	49	---	---	---	---	
GRM7	2917	broad.mit.edu	37	3	7621110	7621111	+	Intron	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7621110_7621111insA	uc003bqm.2	+						GRM7_uc011ata.1_Intron|GRM7_uc011atb.1_Intron|GRM7_uc010hcf.2_Intron|GRM7_uc011atc.1_Intron|GRM7_uc010hcg.2_Intron|GRM7_uc003bql.2_Intron|GRM7_uc003bqn.1_Intron|GRM7_uc010hch.1_Intron	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a						negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	GTACTGAAACCAAATTGATTGT	0.327													6	8	---	---	---	---	
PDZRN3	23024	broad.mit.edu	37	3	73674019	73674019	+	5'UTR	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73674019delC	uc003dpl.1	-	1						NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3								ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		cggccgggcgcccccTCCCTC	0.547													3	5	---	---	---	---	
ABI3BP	25890	broad.mit.edu	37	3	100570788	100570788	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100570788delA	uc003dun.2	-						ABI3BP_uc003duo.2_Intron	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein							extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						TAAGTTGCTTAAAAAAAAAAA	0.338													9	4	---	---	---	---	
CPNE4	131034	broad.mit.edu	37	3	131894161	131894161	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:131894161delA	uc003eom.2	-							NM_130808	NP_570720	Q96A23	CPNE4_HUMAN	copine IV											upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						aataatttttaaaaaagaaca	0.189													6	3	---	---	---	---	
SCHIP1	29970	broad.mit.edu	37	3	158982846	158982847	+	Intron	INS	-	A	A	rs139557578	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158982846_158982847insA	uc003fcq.1	+						SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Intron|IQCJ_uc003fcp.1_Intron	NM_014575	NP_055390	Q9P0W5	SCHI1_HUMAN	schwannomin interacting protein 1							cytoplasm	identical protein binding|protein binding			ovary(1)|central_nervous_system(1)	2			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			ACATTAAATGTAAAAAATAAAA	0.307													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	35449718	35449720	+	IGR	DEL	AGG	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35449718_35449720delAGG								None (None upstream) : ARAP2 (500124 downstream)																							gaaagaagaaaggaagtcaactg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	70267902	70267902	+	IGR	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70267902delA								UGT2B28 (107135 upstream) : UGT2B4 (77982 downstream)																							TTCCTATGACAAAAAAAAAAA	0.323													4	3	---	---	---	---	
RASSF6	166824	broad.mit.edu	37	4	74441923	74441924	+	3'UTR	DEL	AA	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74441923_74441924delAA	uc003hhd.1	-	11					RASSF6_uc003hhc.1_3'UTR|RASSF6_uc010iik.1_3'UTR|RASSF6_uc010iil.1_3'UTR	NM_201431	NP_958834	Q6ZTQ3	RASF6_HUMAN	Ras association (RalGDS/AF-6) domain family 6						apoptosis|signal transduction		protein binding			pancreas(2)	2	Breast(15;0.00102)		all cancers(17;0.00104)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			GAGTTTTTTGAAATGTTTTAGC	0.292													18	27	---	---	---	---	
UNC5C	8633	broad.mit.edu	37	4	96140340	96140340	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96140340delG	uc003htp.1	-	9	1579	c.1425delC	c.(1423-1425)CCCfs	p.P475fs	UNC5C_uc010ilc.1_Frame_Shift_Del_p.P494fs|UNC5C_uc003htq.2_Frame_Shift_Del_p.P494fs	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	475	Cytoplasmic (Potential).				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TTTTCAGGTTGGGCAGTGGAT	0.517													179	196	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	110475293	110475294	+	IGR	INS	-	CTTCAGGAAG	CTTCAGGAAG	rs148787567	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110475293_110475294insCTTCAGGAAG								SEC24B (13679 upstream) : CCDC109B (6061 downstream)																							GTCTCCTTGCTCAGGCAGAAAA	0.460													4	4	---	---	---	---	
TLL1	7092	broad.mit.edu	37	4	167021723	167021723	+	Intron	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167021723delC	uc003irh.1	+						TLL1_uc011cjn.1_Intron|TLL1_uc011cjo.1_Intron	NM_012464	NP_036596	O43897	TLL1_HUMAN	tolloid-like 1 precursor						cell differentiation|proteolysis|skeletal system development	extracellular region	calcium ion binding|metalloendopeptidase activity|zinc ion binding			skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		ttctccgaatcccattttctc	0.050													8	13	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	89910905	89910905	+	Intron	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89910905delT	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATGGCAAGGATTTTTTTTTTC	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	138873637	138873637	+	IGR	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138873637delC								TMEM173 (11345 upstream) : UBE2D2 (67114 downstream)																							gtgggcggatcacgaggtcag	0.095													5	8	---	---	---	---	
SFXN1	94081	broad.mit.edu	37	5	174919392	174919393	+	Intron	DEL	AA	-	-	rs35883400		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174919392_174919393delAA	uc003mda.2	+						SFXN1_uc003mdb.1_Intron	NM_022754	NP_073591	Q9H9B4	SFXN1_HUMAN	sideroflexin 1						iron ion homeostasis	integral to membrane	cation transmembrane transporter activity|protein binding			ovary(1)	1	all_cancers(89;0.00922)|Renal(175;0.000269)|Lung NSC(126;0.00515)|all_lung(126;0.00873)	Medulloblastoma(196;0.0399)|all_neural(177;0.0663)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TCTTTTGACCAAAAAAAAAAAA	0.153													3	3	---	---	---	---	
HCG4	54435	broad.mit.edu	37	6	29760353	29760373	+	RNA	DEL	GCGGGCGCCGTGGATGGAGCA	-	-	rs146714150		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29760353_29760373delGCGGGCGCCGTGGATGGAGCA	uc003nns.2	-	1		c.478_498delTGCTCCATCCACGGCGCCCGC			uc010jrm.1_In_Frame_Del_p.AGAVDGA111del|uc003nnt.2_In_Frame_Del_p.RAPWMEQ147del|uc011dma.1_5'Flank	NR_002139				Homo sapiens clone HCG IV.9 unknown mRNA.												0						GGATGGAGCCGCGGGCGCCGTGGATGGAGCAGGAGGGGCCG	0.674													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73308509	73308510	+	IGR	INS	-	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73308509_73308510insG								RIMS1 (196002 upstream) : KCNQ5 (23061 downstream)																							CAGAAAATCGAGGGTTTTTTTT	0.366													6	4	---	---	---	---	
ESR1	2099	broad.mit.edu	37	6	152265522	152265522	+	Frame_Shift_Del	DEL	G	-	-	rs1801132	byFrequency	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152265522delG	uc003qom.3	+	6	1345	c.975delG	c.(973-975)CCCfs	p.P325fs	ESR1_uc010kin.2_Frame_Shift_Del_p.P325fs|ESR1_uc010kio.2_Frame_Shift_Del_p.P327fs|ESR1_uc010kip.2_Frame_Shift_Del_p.P324fs|ESR1_uc003qon.3_Frame_Shift_Del_p.P325fs|ESR1_uc003qoo.3_Frame_Shift_Del_p.P325fs|ESR1_uc010kiq.2_Intron|ESR1_uc010kir.2_Intron|ESR1_uc011eet.1_Intron|ESR1_uc011eeu.1_Intron|ESR1_uc011eev.1_Intron|ESR1_uc011eew.1_Intron|ESR1_uc010kis.2_Intron|ESR1_uc011eex.1_Frame_Shift_Del_p.P106fs|ESR1_uc010kit.1_Frame_Shift_Del_p.P62fs|ESR1_uc011eey.1_Frame_Shift_Del_p.P62fs	NM_001122742	NP_001116214	P03372	ESR1_HUMAN	estrogen receptor alpha isoform 4	325	Steroid-binding.|Interaction with AKAP13.				positive regulation of retinoic acid receptor signaling pathway|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	chromatin remodeling complex|cytoplasm|nucleoplasm	beta-catenin binding|enzyme binding|estrogen receptor activity|estrogen response element binding|nitric-oxide synthase regulator activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			central_nervous_system(2)|ovary(1)|lung(1)|breast(1)	5		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Chlorotrianisene(DB00269)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Dromostanolone(DB00858)|Drospirenone(DB01395)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Ethynodiol Diacetate(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Letrozole(DB01006)|Levonorgestrel(DB00367)|Medroxyprogesterone(DB00603)|Megestrol(DB00351)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Norgestrel(DB00506)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)	CTGAGCCCCCGATACTCTATT	0.547													87	72	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	6976149	6976150	+	IGR	INS	-	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6976149_6976150insG								C7orf28B (110288 upstream) : C1GALT1 (246096 downstream)																							AGAAGGCTGCCGGGTTCTCAAT	0.609													54	27	---	---	---	---	
DPY19L2P1	554236	broad.mit.edu	37	7	35180611	35180612	+	Intron	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35180611_35180612insA	uc003teq.1	-						DPY19L2P1_uc003tep.1_Intron|DPY19L2P1_uc010kwz.1_Intron					RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						TTTGGCAGGTTAAAAAAACCCA	0.327													16	27	---	---	---	---	
AOAH	313	broad.mit.edu	37	7	36580015	36580015	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:36580015delG	uc003tfh.3	-	16	1617	c.1216delC	c.(1216-1218)CACfs	p.H406fs	AOAH_uc010kxf.2_Frame_Shift_Del_p.H406fs|AOAH_uc011kba.1_Frame_Shift_Del_p.H374fs	NM_001637	NP_001628	P28039	AOAH_HUMAN	acyloxyacyl hydrolase precursor	406					inflammatory response|lipid metabolic process	extracellular region	acyloxyacyl hydrolase activity|lipoprotein lipase activity			skin(1)	1						TTGGGCAGGTGGGAATTTAGA	0.458													34	62	---	---	---	---	
AMPH	273	broad.mit.edu	37	7	38514893	38514893	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38514893delA	uc003tgu.2	-						AMPH_uc003tgv.2_Intron	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1						endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						TTGAATTTCTAAAAGGAACAT	0.289													10	26	---	---	---	---	
UPK3B	80761	broad.mit.edu	37	7	76139950	76139950	+	5'UTR	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76139950delC	uc003ufq.2	+	1					UPK3B_uc003ufo.2_5'UTR|UPK3B_uc010ldk.1_5'UTR	NM_030570	NP_085047	Q9BT76	UPK3B_HUMAN	uroplakin 3B isoform a						negative regulation of gene expression	integral to membrane|plasma membrane				central_nervous_system(1)	1		Myeloproliferative disorder(862;0.204)				CCCTGAGCCTCCCGGGTGCTG	0.662													32	24	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100345611	100345611	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100345611delA	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			caagactctgaaaaaaaaaaa	0.209													10	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	100985246	100985247	+	IGR	INS	-	TTCC	TTCC			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100985246_100985247insTTCC								RABL5 (20153 upstream) : EMID2 (20875 downstream)																							acttactttcgttccttccttc	0.015													2	5	---	---	---	---	
FOXP2	93986	broad.mit.edu	37	7	114059769	114059770	+	Intron	DEL	AC	-	-	rs66529869		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:114059769_114059770delAC	uc003vhb.2	+						FOXP2_uc003vgu.2_Intron|FOXP2_uc003vgz.2_Intron|FOXP2_uc003vha.2_Intron|FOXP2_uc011kmu.1_Intron|FOXP2_uc011kmv.1_Intron|FOXP2_uc003vgt.1_Intron|FOXP2_uc003vgv.1_Intron|FOXP2_uc003vgw.2_Intron|FOXP2_uc003vgx.2_Intron	NM_014491	NP_055306	O15409	FOXP2_HUMAN	forkhead box P2 isoform I						camera-type eye development|caudate nucleus development|cerebellum development|cerebral cortex development|embryo development|growth|lung alveolus development|negative regulation of transcription, DNA-dependent|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of mesenchymal cell proliferation|post-embryonic development|putamen development|regulation of sequence-specific DNA binding transcription factor activity|righting reflex|skeletal muscle tissue development|smooth muscle tissue development|vocal learning	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|lung(1)|breast(1)|skin(1)	8						atacacatagacacacacacac	0.282													4	2	---	---	---	---	
WEE2	494551	broad.mit.edu	37	7	141416182	141416182	+	Intron	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141416182delC	uc003vwn.2	+						FLJ40852_uc011krh.1_Intron|FLJ40852_uc010lnm.2_Intron|FLJ40852_uc010lnn.2_Intron|FLJ40852_uc003vwm.3_Intron|FLJ40852_uc010lno.2_Intron	NM_001105558	NP_001099028	P0C1S8	WEE2_HUMAN	WEE1 homolog 2						egg activation|female meiosis|female pronucleus assembly|meiotic metaphase II|meiotic prophase I|mitosis|negative regulation of oocyte development|regulation of meiosis I	centrosome|nucleus	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein serine/threonine kinase activity			ovary(1)|stomach(1)	2	Melanoma(164;0.0171)					tccctaccctcccttttctcc	0.075													40	26	---	---	---	---	
TNKS	8658	broad.mit.edu	37	8	9610302	9610303	+	Intron	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9610302_9610303insA	uc003wss.2	+						TNKS_uc011kww.1_Intron	NM_003747	NP_003738	O95271	TNKS1_HUMAN	tankyrase, TRF1-interacting ankyrin-related						mitotic spindle organization|mRNA transport|negative regulation of DNA binding|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of telomere maintenance via telomerase|protein auto-ADP-ribosylation|protein localization to chromosome, telomeric region|protein poly-ADP-ribosylation|protein polyubiquitination|protein transport|spindle assembly|transmembrane transport|Wnt receptor signaling pathway	chromosome, centromeric region|Golgi membrane|microsome|nuclear chromosome, telomeric region|nuclear membrane|nuclear pore|pericentriolar material	NAD+ ADP-ribosyltransferase activity|protein binding|zinc ion binding			lung(4)|ovary(2)|kidney(1)	7				COAD - Colon adenocarcinoma(149;0.0467)		cccatctctacaaaaaaaaaag	0.000													4	3	---	---	---	---	
CSGALNACT1	55790	broad.mit.edu	37	8	19297469	19297469	+	Intron	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19297469delG	uc011kyn.1	-						CSGALNACT1_uc011kyo.1_Intron|CSGALNACT1_uc003wzg.2_Intron|CSGALNACT1_uc011kyp.1_Intron|CSGALNACT1_uc003wzh.2_Intron	NM_001130518	NP_001123990	Q8TDX6	CGAT1_HUMAN	chondroitin sulfate						anatomical structure morphogenesis|cell proliferation|cell recognition|chondroitin sulfate biosynthetic process|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process|extracellular matrix organization|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|heparin biosynthetic process|nervous system development|UDP-glucuronate metabolic process|UDP-N-acetylgalactosamine metabolic process	Golgi cisterna membrane|integral to Golgi membrane|soluble fraction	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|glucuronosyltransferase activity|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|peptidoglycan glycosyltransferase activity			central_nervous_system(2)|ovary(1)	3				Colorectal(111;0.182)		ATGCATGTCTGGCACCTGTTT	0.433													24	44	---	---	---	---	
LETM2	137994	broad.mit.edu	37	8	38265165	38265166	+	Intron	INS	-	A	A	rs3215418		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38265165_38265166insA	uc003xlm.1	+						LETM2_uc003xll.1_Intron|LETM2_uc003xln.1_Intron|LETM2_uc003xlo.1_Intron	NM_144652	NP_653253	Q2VYF4	LETM2_HUMAN	leucine zipper-EF-hand containing transmembrane							integral to membrane|mitochondrial inner membrane					0	all_cancers(2;6.77e-47)|all_epithelial(2;1.01e-50)|all_lung(3;1.25e-23)|Lung NSC(2;2.76e-23)|Colorectal(12;0.000442)|Esophageal squamous(3;0.00202)	all_lung(54;0.0657)|Hepatocellular(245;0.152)|Lung NSC(58;0.175)	Epithelial(3;1.17e-42)|all cancers(3;5.44e-38)|BRCA - Breast invasive adenocarcinoma(5;5.44e-27)|LUSC - Lung squamous cell carcinoma(2;7.12e-25)|Lung(2;4.49e-22)|COAD - Colon adenocarcinoma(9;0.114)			TTCAACTATCCAAAAAAAAAAA	0.361													4	2	---	---	---	---	
ANK1	286	broad.mit.edu	37	8	41542170	41542171	+	Frame_Shift_Ins	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41542170_41542171insA	uc003xok.2	-	37	4512_4513	c.4428_4429insT	c.(4426-4431)CGTGGCfs	p.R1476fs	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Frame_Shift_Ins_p.R792fs|ANK1_uc003xoi.2_Frame_Shift_Ins_p.R1476fs|ANK1_uc003xoj.2_Frame_Shift_Ins_p.R1476fs|ANK1_uc003xol.2_Frame_Shift_Ins_p.R1476fs|ANK1_uc003xom.2_Frame_Shift_Ins_p.R1517fs	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	1476_1477	55 kDa regulatory domain.|Death.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			ACGATCTCGCCACGGTCAATGC	0.609													143	103	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	75830117	75830120	+	IGR	DEL	AAAG	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:75830117_75830120delAAAG								PI15 (62855 upstream) : CRISPLD1 (66723 downstream)																							gaaagaaagaaaagaaagaaagaa	0.074													4	4	---	---	---	---	
LRRCC1	85444	broad.mit.edu	37	8	86035599	86035599	+	Intron	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86035599delT	uc003ycw.2	+						LRRCC1_uc010lzz.1_Intron|LRRCC1_uc010maa.1_Intron|LRRCC1_uc003ycx.2_Intron|LRRCC1_uc003ycy.2_Intron	NM_033402	NP_208325	Q9C099	LRCC1_HUMAN	sodium channel associated protein 2 isoform a						cell division|mitosis	centriole|nucleus					0						AATTTCAATCTTTTTTATACT	0.239													32	16	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	96977958	96977958	+	IGR	DEL	G	-	-	rs35277274		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:96977958delG								C8orf37 (696521 upstream) : GDF6 (176602 downstream)																							aaggaaggaagggaaggaagg	0.119													4	2	---	---	---	---	
PKHD1L1	93035	broad.mit.edu	37	8	110451449	110451449	+	Intron	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110451449delG	uc003yne.2	+							NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor						immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TATCTTCTTTGGCAAAAGATG	0.383										HNSCC(38;0.096)			15	7	---	---	---	---	
SCRIB	23513	broad.mit.edu	37	8	144873992	144873993	+	Intron	INS	-	C	C	rs143315468	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144873992_144873993insC	uc003yzp.1	-						SCRIB_uc003yzn.1_Intron|SCRIB_uc003yzo.1_Intron	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b						activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GGCAGGCCAGACCCCACCCCCA	0.678													5	3	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14803313	14803314	+	Intron	INS	-	TCCCCTCCCC	TCCCCTCCCC	rs141611687	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14803313_14803314insTCCCCTCCCC	uc003zlm.2	-						FREM1_uc010mic.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		tctttttcttttcccctcccct	0.020													9	4	---	---	---	---	
CNTNAP3	79937	broad.mit.edu	37	9	39107309	39107310	+	Intron	INS	-	GGAA	GGAA			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39107309_39107310insGGAA	uc004abi.2	-						CNTNAP3_uc004abj.2_Intron|CNTNAP3_uc011lqr.1_Intron|CNTNAP3_uc004abk.1_Intron	NM_033655	NP_387504	Q9BZ76	CNTP3_HUMAN	cell recognition molecule CASPR3 precursor						cell adhesion|cell recognition|signal transduction	extracellular region|integral to membrane|plasma membrane	receptor binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ggagggagtggggaaggaagga	0.035													5	3	---	---	---	---	
SEC61B	10952	broad.mit.edu	37	9	101990074	101990075	+	Intron	INS	-	T	T	rs111986989		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101990074_101990075insT	uc004azh.2	+							NM_006808	NP_006799	P60468	SC61B_HUMAN	Sec61 beta subunit						ER-associated protein catabolic process|protein import into nucleus, translocation|retrograde protein transport, ER to cytosol|transmembrane transport	endoplasmic reticulum Sec complex|integral to membrane	epidermal growth factor binding				0		Acute lymphoblastic leukemia(62;0.0559)				AGCAAAGAAAGTTTTTTTTTTT	0.302													4	2	---	---	---	---	
PHYHD1	254295	broad.mit.edu	37	9	131689649	131689650	+	Intron	INS	-	T	T	rs113428118		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131689649_131689650insT	uc004bwo.2	+						PHYHD1_uc004bwn.2_Intron|PHYHD1_uc004bwm.2_Intron|PHYHD1_uc004bwp.2_Intron	NM_001100876	NP_001094346	Q5SRE7	PHYD1_HUMAN	phytanoyl-CoA dioxygenase domain containing 1								metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						ctttattgtccttttttttttt	0.114											OREG0019526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
GPSM1	26086	broad.mit.edu	37	9	139235823	139235824	+	Intron	INS	-	GGGCT	GGGCT	rs150586482	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139235823_139235824insGGGCT	uc004chd.2	+						GPSM1_uc004chc.2_3'UTR	NM_001145638	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1 (AGS3-like, C.						cell differentiation|nervous system development|signal transduction	cytosol|endoplasmic reticulum membrane|Golgi membrane|plasma membrane	binding|GTPase activator activity				0		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CATCAGCCAGAgggctgggctg	0.569													5	3	---	---	---	---	
CAMK1D	57118	broad.mit.edu	37	10	12547859	12547861	+	Intron	DEL	TCC	-	-	rs140049789		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:12547859_12547861delTCC	uc001ilo.2	+						CAMK1D_uc001iln.2_Intron	NM_153498	NP_705718	Q8IU85	KCC1D_HUMAN	calcium/calmodulin-dependent protein kinase ID							calcium- and calmodulin-dependent protein kinase complex|cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)|stomach(1)	2				GBM - Glioblastoma multiforme(1;3.16e-05)		GCTGTCAtcttcctcctcctcct	0.355													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69553862	69553863	+	IGR	INS	-	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69553862_69553863insC								CTNNA3 (97913 upstream) : DNAJC12 (2565 downstream)																							GAAGGAAAATGATCAGAAAAAG	0.446													9	4	---	---	---	---	
MARCH5	54708	broad.mit.edu	37	10	94066970	94066971	+	Intron	DEL	GC	-	-	rs61157486		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94066970_94066971delGC	uc001khx.1	+						MARCH5_uc010qno.1_Intron	NM_017824	NP_060294	Q9NX47	MARH5_HUMAN	membrane-associated ring finger (C3HC4) 5						cell aging|protein autoubiquitination|protein localization in mitochondrion|protein polyubiquitination|regulation of mitochondrial fission	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	GTPase binding|ubiquitin-protein ligase activity|zinc ion binding			skin(1)	1						gtgtgtgtgtgcgcgtgCATGC	0.228													3	3	---	---	---	---	
CEP55	55165	broad.mit.edu	37	10	95259630	95259630	+	Intron	DEL	A	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95259630delA	uc009xug.2	+						CEP55_uc001kiq.3_Intron	NM_001127182	NP_001120654	Q53EZ4	CEP55_HUMAN	centrosomal protein 55kDa						cell division|mitosis	centriole|cleavage furrow|midbody					0		Colorectal(252;0.207)				cactgagattaaaaaaaaaag	0.075													4	2	---	---	---	---	
PNLIPRP3	119548	broad.mit.edu	37	10	118202596	118202596	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118202596delC	uc001lcl.3	+	3	335	c.234delC	c.(232-234)ATCfs	p.I78fs		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	78					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		CTTCAACTATCCAAGCCTCAT	0.353													28	17	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122114156	122114156	+	IGR	DEL	T	-	-	rs146890294		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122114156delT								SEC23IP (412911 upstream) : PPAPDC1A (102310 downstream)																							AAGTTCATTCTTTTTTTTTTT	0.303													4	2	---	---	---	---	
OR2D3	120775	broad.mit.edu	37	11	6942481	6942482	+	Frame_Shift_Ins	INS	-	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6942481_6942482insT	uc010rav.1	+	1	249_250	c.249_250insT	c.(247-252)TCCTTTfs	p.S83fs		NM_001004684	NP_001004684	Q8NGH3	OR2D3_HUMAN	olfactory receptor, family 2, subfamily D,	83_84	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.78e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		GAAATCTCTCCTTTGCAGATCT	0.406													129	59	---	---	---	---	
SLCO1C1	53919	broad.mit.edu	37	12	20890118	20890118	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20890118delG	uc001rej.3	+	12	1815	c.1460delG	c.(1459-1461)TGGfs	p.W487fs	SLCO1C1_uc010sii.1_Frame_Shift_Del_p.W487fs|SLCO1C1_uc010sij.1_Frame_Shift_Del_p.W438fs|SLCO1C1_uc009zip.2_Frame_Shift_Del_p.W321fs|SLCO1C1_uc001rei.2_Frame_Shift_Del_p.W487fs|SLCO1C1_uc010sik.1_Frame_Shift_Del_p.W369fs	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	487	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					GAGACAAAATGGGAACCCATG	0.373													73	134	---	---	---	---	
DDX11	1663	broad.mit.edu	37	12	31250614	31250614	+	Intron	DEL	A	-	-	rs35761927		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31250614delA	uc001rjt.1	+						DDX11_uc001rjr.1_Intron|DDX11_uc001rjs.1_Intron|DDX11_uc001rju.1_Intron|DDX11_uc001rjv.1_Intron|DDX11_uc001rjw.1_Intron|DDX11_uc009zjn.1_Intron	NM_152438	NP_689651	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11						G2/M transition of mitotic cell cycle|interspecies interaction between organisms|mitotic sister chromatid segregation|positive regulation of cell proliferation|S phase of mitotic cell cycle|sister chromatid cohesion	midbody|nuclear chromatin|nucleolus|spindle pole	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding|RNA binding			breast(3)	3	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					actccatctcaaaaaaaaaaa	0.184										Multiple Myeloma(12;0.14)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	33452396	33452397	+	IGR	INS	-	AAGG	AAGG	rs143444187	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:33452396_33452397insAAGG								PKP2 (402616 upstream) : SYT10 (75951 downstream)																							gaaagaaaggaaaggaaggaag	0.000													9	4	---	---	---	---	
PDZRN4	29951	broad.mit.edu	37	12	41967593	41967593	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:41967593delG	uc010skn.1	+	10	2483	c.2415delG	c.(2413-2415)TTGfs	p.L805fs	PDZRN4_uc001rmq.3_Frame_Shift_Del_p.L746fs|PDZRN4_uc009zjz.2_Frame_Shift_Del_p.L744fs|PDZRN4_uc001rmr.2_Frame_Shift_Del_p.L631fs	NM_013377	NP_037509	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing RING finger 4 isoform 2	1004							ubiquitin-protein ligase activity|zinc ion binding			lung(3)|skin(3)|ovary(2)|large_intestine(1)|kidney(1)|pancreas(1)	11	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AGAAAATTTTGGACAACTGGA	0.458													46	30	---	---	---	---	
KRT85	3891	broad.mit.edu	37	12	52761001	52761001	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52761001delC	uc001sag.2	-	1	309	c.189delG	c.(187-189)GGGfs	p.G63fs		NM_002283	NP_002274	P78386	KRT85_HUMAN	keratin 85	63	Head.				epidermis development	keratin filament	protein binding|structural molecule activity			ovary(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		CTATCCGGGGCCCGCAGGAGC	0.711													54	30	---	---	---	---	
CENPJ	55835	broad.mit.edu	37	13	25473732	25473732	+	Intron	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25473732delC	uc001upt.3	-						CENPJ_uc010tdf.1_Intron|CENPJ_uc010aae.2_Intron|CENPJ_uc010aaf.2_Intron|CENPJ_uc001upu.2_Intron	NM_018451	NP_060921	Q9HC77	CENPJ_HUMAN	centromere protein J						cell division|centriole replication|G2/M transition of mitotic cell cycle|microtubule nucleation|microtubule polymerization	centriole|cytosol|gamma-tubulin small complex|microtubule	protein domain specific binding|tubulin binding			ovary(2)	2		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CCTAAAATGACCAAACTATGT	0.398													12	12	---	---	---	---	
KCNK10	54207	broad.mit.edu	37	14	88652582	88652582	+	Intron	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88652582delC	uc001xwo.2	-						KCNK10_uc001xwm.2_Intron|KCNK10_uc001xwn.2_Intron	NM_021161	NP_066984	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10						signal transduction	integral to membrane	potassium channel activity|voltage-gated ion channel activity			ovary(2)|skin(2)|pancreas(1)	5						CCTCGGGTGTCCCCACGGGGA	0.602													4	2	---	---	---	---	
AK7	122481	broad.mit.edu	37	14	96937692	96937693	+	Intron	DEL	GC	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96937692_96937693delGC	uc001yfn.2	+							NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		aaaaaaaaaagcaaaaTAGGGA	0.124													4	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	107190991	107191002	+	Intron	DEL	TCCTTCCATCCT	-	-	rs75354394		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107190991_107191002delTCCTTCCATCCT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						cctccttctgtccttccatccttccttccttt	0.014													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20263577	20263578	+	IGR	INS	-	A	A	rs58110116		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20263577_20263578insA								None (None upstream) : GOLGA6L6 (473516 downstream)																							aggaaggaaggaggaaggaagg	0.000													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31128275	31128275	+	IGR	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31128275delT								ARHGAP11B (150466 upstream) : MTMR15 (67780 downstream)																							TTTGATAAGCTTTTTTTTTTT	0.313													6	3	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41672442	41672442	+	3'UTR	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41672442delT	uc001zns.3	+	11					NUSAP1_uc001znq.3_3'UTR|NUSAP1_uc001znr.3_3'UTR|NUSAP1_uc010bce.2_3'UTR|NUSAP1_uc001znt.3_3'UTR|NUSAP1_uc001znv.3_3'UTR|NUSAP1_uc001znu.3_3'UTR|NUSAP1_uc010ucw.1_3'UTR|NUSAP1_uc001znw.3_3'UTR	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CTTTTGTAAATTTTTTTTTTT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	83395495	83395502	+	Frame_Shift_Del	DEL	ACGGCAGT	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83395495_83395502delACGGCAGT	uc002bjb.2	-	3	800_807	c.331_338delACTGCCGT	c.(331-339)ACTGCCGTGfs	p.T111fs						Homo sapiens actin, gamma pseudogene, mRNA (cDNA clone IMAGE:4866674), with apparent retained intron.																		GGAAGAGGACACGGCAGTGGCCATCTCC	0.577													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21689776	21689777	+	Intron	DEL	TA	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21689776_21689777delTA	uc002diq.3	+						OTOA_uc002djh.2_5'Flank					Homo sapiens cDNA FLJ59829 complete cds.																		tgtgtgtgtgtatatatatata	0.233													7	4	---	---	---	---	
FAM18B2	201158	broad.mit.edu	37	17	15406045	15406046	+	3'UTR	DEL	TT	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15406045_15406046delTT	uc002goq.2	-	6					CDRT4_uc010vvw.1_Intron|FAM18B2_uc010vvx.1_Intron	NM_145301	NP_660344	Q96ET8	F18B2_HUMAN	hypothetical protein LOC201158 isoform 1							integral to membrane					0				UCEC - Uterine corpus endometrioid carcinoma (92;0.0872)|BRCA - Breast invasive adenocarcinoma(8;0.0581)|READ - Rectum adenocarcinoma(1115;0.0967)		tctctctctctttctctctcct	0.198													3	3	---	---	---	---	
RARA	5914	broad.mit.edu	37	17	38499115	38499116	+	Intron	INS	-	CA	CA			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38499115_38499116insCA	uc002huk.1	+						RARA_uc002hul.3_Intron|RARA_uc010wfe.1_Intron|RARA_uc002hun.1_Frame_Shift_Ins_p.N53fs	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1						apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	ATGGCTCAAACCACTGTACGTA	0.624			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								448	200	---	---	---	---	
MAPT	4137	broad.mit.edu	37	17	44060961	44060961	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44060961delC	uc002ijr.3	+	6	1111	c.791delC	c.(790-792)GCCfs	p.A264fs	MAPT_uc010dau.2_Frame_Shift_Del_p.A264fs|MAPT_uc002ijs.3_Intron|MAPT_uc002ijx.3_Intron|MAPT_uc002ijt.3_Intron|MAPT_uc002iju.3_Intron|MAPT_uc002ijv.3_Intron	NM_016835	NP_058519	P10636	TAU_HUMAN	microtubule-associated protein tau isoform 1	264					cellular component disassembly involved in apoptosis|microtubule cytoskeleton organization|negative regulation of microtubule depolymerization|positive regulation of axon extension|positive regulation of microtubule polymerization|regulation of autophagy	axon|cytosol|growth cone|microtubule|microtubule associated complex|nuclear periphery|plasma membrane|tubulin complex	apolipoprotein E binding|enzyme binding|identical protein binding|lipoprotein particle binding|microtubule binding|protein binding|SH3 domain binding|structural constituent of cytoskeleton			pancreas(1)	1		Melanoma(429;0.216)				GCGGAGGGTGCCATCCCCCTC	0.667													45	39	---	---	---	---	
TBKBP1	9755	broad.mit.edu	37	17	45788180	45788180	+	3'UTR	DEL	G	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45788180delG	uc002ilu.2	+	9						NM_014726	NP_055541	A7MCY6	TBKB1_HUMAN	TBK1 binding protein 1						innate immune response						0						GGCTCTTCCTGGGAGGTCAGC	0.642													9	4	---	---	---	---	
SLC38A10	124565	broad.mit.edu	37	17	79220444	79220444	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79220444delC	uc002jzz.1	-	16	2647	c.2272delG	c.(2272-2274)GTGfs	p.V758fs	SLC38A10_uc002jzy.1_Frame_Shift_Del_p.V676fs	NM_001037984	NP_001033073	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10 isoform a	758					amino acid transport|sodium ion transport	integral to membrane				pancreas(1)|skin(1)	2	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			CCTCTGGGCACCGCTGCCCCG	0.627													163	100	---	---	---	---	
KIAA0802	23255	broad.mit.edu	37	18	8783440	8783441	+	Intron	INS	-	G	G			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8783440_8783441insG	uc002knr.2	+						KIAA0802_uc002knq.2_Intron|KIAA0802_uc010dkw.1_5'Flank	NM_015210	NP_056025	Q9Y4B5	CC165_HUMAN	hypothetical protein LOC23255												0						TTGTGTGCATTGGGGGCGAGGT	0.515													3	4	---	---	---	---	
GALR1	2587	broad.mit.edu	37	18	74964848	74964849	+	Intron	INS	-	C	C			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74964848_74964849insC	uc002lms.3	+							NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1						digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		caccaccaccaccatcaccacc	0.000													4	2	---	---	---	---	
CCDC151	115948	broad.mit.edu	37	19	11545356	11545357	+	Intron	INS	-	A	A	rs144480066		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11545356_11545357insA	uc002mrs.2	-						CCDC151_uc010dxz.2_Intron|PRKCSH_uc002mrt.2_5'Flank|PRKCSH_uc002mru.2_5'Flank|PRKCSH_uc010xlz.1_5'Flank|PRKCSH_uc010dya.2_5'Flank|PRKCSH_uc002mrv.1_5'Flank|PRKCSH_uc010dyb.2_5'Flank	NM_145045	NP_659482	A5D8V7	CC151_HUMAN	coiled-coil domain containing 151											ovary(1)	1						gagattctgccaaaaaaaaaaa	0.134													6	3	---	---	---	---	
HAPLN4	404037	broad.mit.edu	37	19	19379018	19379018	+	Intron	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19379018delT	uc002nmc.2	-						TM6SF2_uc002nmd.1_Intron	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			ttcttttttcttttttttttt	0.159													4	2	---	---	---	---	
ZNF766	90321	broad.mit.edu	37	19	52789441	52789442	+	Intron	INS	-	C	C	rs149933354	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52789441_52789442insC	uc002pyr.1	+						ZNF766_uc002pys.1_Intron|ZNF766_uc002pyt.1_Intron	NM_001010851	NP_001010851	Q5HY98	ZN766_HUMAN	zinc finger protein 766						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGTGGGCTTTTCCCCcctaatt	0.168													3	5	---	---	---	---	
PTPRH	5794	broad.mit.edu	37	19	55714694	55714695	+	Intron	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55714694_55714695insA	uc002qjq.2	-						PTPRH_uc010esv.2_Intron|PTPRH_uc002qjs.2_Intron	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H						apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		gactctgtctcaaaaaaaaaaa	0.069													4	2	---	---	---	---	
OVOL2	58495	broad.mit.edu	37	20	18022309	18022309	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18022309delC	uc002wqi.1	-	3	623	c.380delG	c.(379-381)GGCfs	p.G127fs		NM_021220	NP_067043	Q9BRP0	OVOL2_HUMAN	zinc finger protein 339	127	C2H2-type 1.				negative regulation of keratinocyte differentiation|negative regulation of Notch signaling pathway|negative regulation of transcription by competitive promoter binding|regulation of cell cycle|regulation of keratinocyte proliferation|transcription, DNA-dependent	nucleus	DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)	1						CAGACGGAAGCCCTTGCCACA	0.617													30	34	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37154320	37154320	+	Intron	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37154320delT	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron|RALGAPB_uc002xja.1_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TGACTTGTGATTTTTTTTTTT	0.294													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44624529	44624532	+	IGR	DEL	CTTT	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44624529_44624532delCTTT								ZNF335 (23696 upstream) : MMP9 (13015 downstream)																							CATCTGTAAACTttctttctttct	0.225													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57159887	57159888	+	Intron	INS	-	CTTC	CTTC	rs142796198	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57159887_57159888insCTTC	uc002xzg.1	+											Homo sapiens cDNA FLJ30075 fis, clone BGGI11000285.																		ctcccttctttcttccttcctt	0.000													5	5	---	---	---	---	
PTK6	5753	broad.mit.edu	37	20	62163700	62163701	+	Intron	INS	-	TGTGTGTC	TGTGTGTC	rs144559581	by1000genomes	TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62163700_62163701insTGTGTGTC	uc002yfg.2	-						PTK6_uc011aay.1_Intron|PTK6_uc011aaz.1_Intron	NM_005975	NP_005966	Q13882	PTK6_HUMAN	PTK6 protein tyrosine kinase 6							cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(1)|kidney(1)	2	all_cancers(38;2.51e-11)		Epithelial(9;1.5e-08)|all cancers(9;8.67e-08)|BRCA - Breast invasive adenocarcinoma(10;6.43e-06)			gtgtgtgtgcatgtgtgtctgt	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	34213737	34213737	+	IGR	DEL	T	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34213737delT								C21orf62 (27684 upstream) : OLIG2 (184502 downstream)																							tttcttCCTCTTTTTTTTTTG	0.259													4	2	---	---	---	---	
POTEH	23784	broad.mit.edu	37	22	16278069	16278069	+	Intron	DEL	C	-	-	rs143284967		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16278069delC	uc010gqp.2	-						POTEH_uc002zlg.1_Intron|POTEH_uc002zlh.1_Intron|POTEH_uc002zlj.1_Intron|uc002zlk.2_RNA	NM_001136213	NP_001129685	Q6S545	POTEH_HUMAN	ANKRD26-like family C, member 3											skin(1)	1						AAGGAAGGGACAAAAAAAAAA	0.368													5	3	---	---	---	---	
PDHA1	5160	broad.mit.edu	37	X	19363864	19363864	+	Intron	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19363864delC	uc004czg.3	+						PDHA1_uc004czh.3_Intron|PDHA1_uc011mjc.1_Intron|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Intron	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor						glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	TTTGCAGGGTCCCCCCCCCCC	0.468													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	48186144	48186145	+	IGR	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48186144_48186145insA								SSX1 (59265 upstream) : SSX3 (19718 downstream)																							GCTCATCCCCCACATCCCTGCA	0.475													57	55	---	---	---	---	
FAM120C	54954	broad.mit.edu	37	X	54117672	54117673	+	Intron	INS	-	A	A			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54117672_54117673insA	uc004dsz.3	-						FAM120C_uc011moh.1_Intron	NM_017848	NP_060318	Q9NX05	F120C_HUMAN	hypothetical protein LOC54954											ovary(1)|central_nervous_system(1)	2						TCAGCTTCAGGAAAAAAAAAAG	0.366													6	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093049	101093049	+	Intron	DEL	A	-	-	rs66689050		TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093049delA	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ACCTGTGGGGAAAGCAGTGAG	0.577													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9387191	9387191	+	IGR	DEL	C	-	-			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9387191delC								TSPY1 (39802 upstream) : RBMY3AP (61139 downstream)																							CAATCCCCTTCCCGCAAAAAT	0.498													23	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	28494702	28494703	+	IGR	INS	-	T	T			TCGA-22-5473-01	TCGA-22-5473-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:28494702_28494703insT								None (None upstream) : None (None downstream)																							AATACCTCCACTGGCTCCGTGA	0.411													21	22	---	---	---	---	
