Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SCNN1D	6339	broad.mit.edu	37	1	1226035	1226035	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1226035C>G	uc001adu.1	+	14	2010	c.1386C>G	c.(1384-1386)CTC>CTG	p.L462L	SCNN1D_uc001adt.1_Silent_p.L626L|SCNN1D_uc001adw.2_Silent_p.L528L|SCNN1D_uc001adx.2_Silent_p.L251L|SCNN1D_uc001adv.2_Silent_p.L462L	NM_002978	NP_002969			sodium channel, nonvoltage-gated 1, delta												0	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)		CATTCAAGCTCTCCACTGGGA	0.652													17	31	---	---	---	---	PASS
PRAMEF2	65122	broad.mit.edu	37	1	12921089	12921089	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12921089C>A	uc001aum.1	+	4	967	c.880C>A	c.(880-882)CCC>ACC	p.P294T		NM_023014	NP_075390	O60811	PRAM2_HUMAN	PRAME family member 2	294											0	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTCCAGAACCCCTTGGAGAA	0.458													4	62	---	---	---	---	PASS
SLC30A2	7780	broad.mit.edu	37	1	26371487	26371487	+	Splice_Site	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26371487C>G	uc001blh.1	-	2	488	c.271_splice	c.e2+1	p.E91_splice	SLC30A2_uc001blg.1_Splice_Site_p.G91_splice	NM_032513	NP_115902	Q9BRI3	ZNT2_HUMAN	solute carrier family 30, member 2 isoform 2						positive regulation of sequestering of zinc ion|zinc ion transport	integral to membrane|late endosome|lysosomal membrane	cation transmembrane transporter activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGTGCTTACCAACGACTTC	0.423													71	28	---	---	---	---	PASS
UBXN11	91544	broad.mit.edu	37	1	26611997	26611997	+	Silent	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26611997G>C	uc001blw.2	-	11	1083	c.810C>G	c.(808-810)CCC>CCG	p.P270P	UBXN11_uc001blz.1_Silent_p.P237P|UBXN11_uc001blv.2_Silent_p.P232P|UBXN11_uc001bly.2_Silent_p.P150P|UBXN11_uc001blx.2_Silent_p.P28P|UBXN11_uc001bma.2_Silent_p.P237P|UBXN11_uc001bmb.1_Silent_p.P270P|UBXN11_uc010ofb.1_Silent_p.P195P|UBXN11_uc010ofc.1_Silent_p.P112P	NM_183008	NP_892120	Q5T124	UBX11_HUMAN	socius isoform 2	270	SEP.					cytoplasm|cytoskeleton				ovary(1)	1						GGAGCTCTGAGGGAAAGAAGC	0.582											OREG0013265	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	6	---	---	---	---	PASS
EIF3I	8668	broad.mit.edu	37	1	32688037	32688037	+	5'UTR	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32688037G>A	uc001bur.3	+	2					C1orf91_uc001buo.3_5'Flank|C1orf91_uc001bup.3_5'Flank|C1orf91_uc009vub.1_5'Flank|C1orf91_uc010oha.1_5'Flank|C1orf91_uc001buq.3_5'Flank|EIF3I_uc009vuc.2_5'UTR|EIF3I_uc001bus.2_5'Flank	NM_003757	NP_003748	Q13347	EIF3I_HUMAN	eukaryotic translation initiation factor 3,							cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.212)				TCGCGTCACAGCCGGGATGGT	0.577													7	55	---	---	---	---	PASS
ZMPSTE24	10269	broad.mit.edu	37	1	40723960	40723960	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40723960C>T	uc001cfg.2	+	1	228	c.17C>T	c.(16-18)TCG>TTG	p.S6L	uc001cff.2_5'Flank	NM_005857	NP_005848	O75844	FACE1_HUMAN	zinc metallopeptidase STE24	6						endoplasmic reticulum membrane|Golgi membrane|integral to membrane	metal ion binding|metalloexopeptidase activity				0	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			ATGTGGGCATCGCTGGACGCT	0.632													28	89	---	---	---	---	PASS
PTPRF	5792	broad.mit.edu	37	1	44070639	44070639	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44070639C>G	uc001cjr.2	+	17	3443	c.3103C>G	c.(3103-3105)CCC>GCC	p.P1035A	PTPRF_uc001cjs.2_Missense_Mutation_p.P1026A|PTPRF_uc001cju.2_Missense_Mutation_p.P413A|PTPRF_uc009vwt.2_Missense_Mutation_p.P595A|PTPRF_uc001cjv.2_Missense_Mutation_p.P495A|PTPRF_uc001cjw.2_Missense_Mutation_p.P261A	NM_002840	NP_002831	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1035	Extracellular (Potential).|Fibronectin type-III 8.				transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|skin(3)|lung(1)|kidney(1)|central_nervous_system(1)	10	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTGGGAGGTTCCCGACTCCTA	0.577													19	116	---	---	---	---	PASS
ZSWIM5	57643	broad.mit.edu	37	1	45671861	45671861	+	Silent	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45671861G>T	uc001cnd.2	-	1	390	c.162C>A	c.(160-162)CTC>CTA	p.L54L		NM_020883	NP_065934	Q9P217	ZSWM5_HUMAN	zinc finger, SWIM domain containing 5	54							zinc ion binding				0	Acute lymphoblastic leukemia(166;0.155)					GGCGGGCCCCGAGGACCAGGC	0.716													5	12	---	---	---	---	PASS
NRD1	4898	broad.mit.edu	37	1	52266334	52266334	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52266334C>T	uc001ctc.3	-	23	2861	c.2539G>A	c.(2539-2541)GAC>AAC	p.D847N	NRD1_uc009vzb.2_Missense_Mutation_p.D542N|NRD1_uc001ctd.3_Missense_Mutation_p.D779N|NRD1_uc001cte.2_Missense_Mutation_p.D715N|NRD1_uc001ctf.2_Missense_Mutation_p.D779N|NRD1_uc010ong.1_RNA	NM_002525	NP_002516	O43847	NRDC_HUMAN	nardilysin isoform a	778					cell migration|cell proliferation|neuromuscular junction development|positive regulation of membrane protein ectodomain proteolysis|proteolysis|regulation of endopeptidase activity	cell surface|cytosol	epidermal growth factor binding|metalloendopeptidase activity|zinc ion binding				0						GCTAAGTAGTCAATAATGAGC	0.383													27	55	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65339169	65339169	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65339169C>A	uc001dbu.1	-	5	616	c.367G>T	c.(367-369)GAG>TAG	p.E123*	JAK1_uc009wam.1_Nonsense_Mutation_p.E111*|JAK1_uc001dbv.2_RNA	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1	123	FERM.				interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		ACTGACTGCTCATTGTCGTTG	0.493			Mis		ALL								19	43	---	---	---	---	PASS
GNG12	55970	broad.mit.edu	37	1	68171223	68171223	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68171223C>A	uc001dea.1	-	4	322	c.130G>T	c.(130-132)GAG>TAG	p.E44*		NM_018841	NP_061329	Q9UBI6	GBG12_HUMAN	G-protein gamma-12 subunit precursor	44					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0						GCATGTTCCTCACAGTAGGAC	0.398													21	40	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92163641	92163641	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92163641C>G	uc001doh.2	-						TGFBR3_uc009wde.2_Intron|TGFBR3_uc010osy.1_Intron|TGFBR3_uc001doi.2_Intron|TGFBR3_uc001doj.2_Intron	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III						BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		TGCATAAAGACTTACGTGGAG	0.353													20	99	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103364270	103364270	+	Silent	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103364270A>C	uc001dul.2	-	56	4518	c.4200T>G	c.(4198-4200)CCT>CCG	p.P1400P	COL11A1_uc001duk.2_Silent_p.P596P|COL11A1_uc001dum.2_Silent_p.P1412P|COL11A1_uc001dun.2_Silent_p.P1361P|COL11A1_uc009weh.2_Silent_p.P1284P	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1400	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GCTTTCCTGCAGGTCCCTGAG	0.468													17	44	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103379198	103379198	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103379198G>T	uc001dul.2	-	53	4345	c.4027C>A	c.(4027-4029)CAA>AAA	p.Q1343K	COL11A1_uc001duk.2_Missense_Mutation_p.Q539K|COL11A1_uc001dum.2_Missense_Mutation_p.Q1355K|COL11A1_uc001dun.2_Missense_Mutation_p.Q1304K|COL11A1_uc009weh.2_Missense_Mutation_p.Q1227K	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	1343	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTCACCGGTTGACCAGGATCT	0.343													52	75	---	---	---	---	PASS
KCND3	3752	broad.mit.edu	37	1	112524921	112524921	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112524921T>C	uc001ebu.1	-	2	908	c.428A>G	c.(427-429)AAC>AGC	p.N143S	KCND3_uc001ebv.1_Missense_Mutation_p.N143S	NM_004980	NP_004971	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related	143	Cytoplasmic (Potential).					sarcolemma|voltage-gated potassium channel complex	A-type (transient outward) potassium channel activity|metal ion binding			ovary(2)|large_intestine(1)	3		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)		CCGCTCGGCGTTCTCCCTCTT	0.622													28	37	---	---	---	---	PASS
HMGCS2	3158	broad.mit.edu	37	1	120296009	120296009	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120296009G>T	uc001eid.2	-	7	1239	c.1188C>A	c.(1186-1188)CAC>CAA	p.H396Q	HMGCS2_uc010oxj.1_Missense_Mutation_p.H354Q|HMGCS2_uc001eie.2_Missense_Mutation_p.H304Q	NM_005518	NP_005509	P54868	HMCS2_HUMAN	hydroxymethylglutaryl-CoA synthase 2 isoform 1	396					acetoacetic acid biosynthetic process|cholesterol biosynthetic process|isoprenoid biosynthetic process|ketone body biosynthetic process	mitochondrial matrix	hydroxymethylglutaryl-CoA synthase activity			ovary(2)	2	all_cancers(5;6.38e-10)|all_epithelial(5;1.1e-10)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;1.29e-06)|Lung NSC(69;9.35e-06)|all_epithelial(167;0.00124)		Lung(183;0.0112)|LUSC - Lung squamous cell carcinoma(189;0.0595)		GGGCAGAGTGGCTGTGGGGAA	0.328													8	12	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144886274	144886274	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144886274G>C	uc001elw.3	-	23	3251	c.2960C>G	c.(2959-2961)TCT>TGT	p.S987C	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.S1053C|PDE4DIP_uc001elv.3_Translation_Start_Site	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	987					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGGGGAAAAAGATGGGTTCTG	0.478			T	PDGFRB	MPD								27	284	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149904192	149904192	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149904192G>A	uc001etl.3	-	11	1267	c.1016C>T	c.(1015-1017)TCA>TTA	p.S339L	MTMR11_uc001etm.1_Missense_Mutation_p.S267L|MTMR11_uc010pbm.1_Missense_Mutation_p.S311L|MTMR11_uc010pbn.1_Missense_Mutation_p.S181L	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	339	Myotubularin phosphatase.						phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			TTCCAGGGCTGAAAGCCATTT	0.443													37	156	---	---	---	---	PASS
RORC	6097	broad.mit.edu	37	1	151787699	151787699	+	Silent	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151787699A>T	uc001ezh.2	-	5	609	c.501T>A	c.(499-501)CCT>CCA	p.P167P	RORC_uc001ezg.2_Silent_p.P146P|RORC_uc010pdo.1_Silent_p.P221P|RORC_uc010pdp.1_Silent_p.P167P	NM_005060	NP_005051	P51449	RORG_HUMAN	RAR-related orphan receptor C isoform a	167	Hinge (Potential).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			CAGAAGCCTCAGGCAGGTCAG	0.647													3	49	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285056	152285056	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285056C>T	uc001ezu.1	-	3	2342	c.2306G>A	c.(2305-2307)GGT>GAT	p.G769D	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	769	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGATGGTGACCAGCCTGTCC	0.567									Ichthyosis				207	277	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152323772	152323772	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152323772G>C	uc001ezw.3	-	3	6563	c.6490C>G	c.(6490-6492)CAG>GAG	p.Q2164E	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	2164	Filaggrin 10.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTGTGGACTGTCCATGACCA	0.502													171	255	---	---	---	---	PASS
SLC39A1	27173	broad.mit.edu	37	1	153935025	153935025	+	Missense_Mutation	SNP	C	T	T	rs141955044		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153935025C>T	uc001fdh.2	-	2	336	c.167G>A	c.(166-168)GGA>GAA	p.G56E	SLC39A1_uc001fdi.2_Missense_Mutation_p.G56E|SLC39A1_uc001fdj.2_Missense_Mutation_p.G56E|SLC39A1_uc001fdk.2_Missense_Mutation_p.G56E|SLC39A1_uc010pee.1_5'UTR|SLC39A1_uc001fdl.2_Missense_Mutation_p.G56E	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter),	56	Cytoplasmic (Potential).					endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		ATGGTTAGCTCCTGGCCGGCG	0.632													8	20	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155730294	155730294	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155730294G>A	uc001flz.2	-	24	5147	c.5050C>T	c.(5050-5052)CAG>TAG	p.Q1684*	GON4L_uc009wrg.1_RNA|GON4L_uc001fly.1_Nonsense_Mutation_p.Q1684*|GON4L_uc009wrh.1_Nonsense_Mutation_p.Q1684*|GON4L_uc001fma.1_Nonsense_Mutation_p.Q1684*|GON4L_uc001fmb.3_Nonsense_Mutation_p.Q880*	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	1684	PAH 1.				regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TTCAACAGCTGAGGCCAGTCT	0.468													22	95	---	---	---	---	PASS
CD1B	910	broad.mit.edu	37	1	158301220	158301220	+	5'UTR	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158301220G>T	uc001frx.2	-	1					CD1B_uc001frw.2_5'Flank|CD1B_uc010pic.1_5'UTR	NM_001764	NP_001755	P29016	CD1B_HUMAN	CD1B antigen precursor						antigen processing and presentation|immune response	endosome membrane|integral to membrane|lysosomal membrane|plasma membrane	protein binding			ovary(2)	2	all_hematologic(112;0.0378)					GCATTTCACTGGGAGATGCAA	0.473													11	17	---	---	---	---	PASS
DARC	2532	broad.mit.edu	37	1	159175317	159175317	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159175317T>C	uc001fto.2	+	2	328	c.88T>C	c.(88-90)TAT>CAT	p.Y30H	DARC_uc001ftp.3_Missense_Mutation_p.Y32H	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	30	Extracellular (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					GAATTCTTCCTATGGTGTGAA	0.542													22	62	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160109762	160109762	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160109762C>T	uc001fvc.2	+	22	3154	c.3022C>T	c.(3022-3024)CGG>TGG	p.R1008W	ATP1A2_uc001fvd.2_Missense_Mutation_p.R727W	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	1008	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CATCCTGCGGCGGTATCCTGG	0.582													57	85	---	---	---	---	PASS
TBX19	9095	broad.mit.edu	37	1	168260473	168260473	+	Silent	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168260473T>C	uc001gfl.2	+	2	330	c.279T>C	c.(277-279)TTT>TTC	p.F93F	TBX19_uc001gfj.3_Silent_p.F24F	NM_005149	NP_005140	O60806	TBX19_HUMAN	T-box 19	93	T-box.				anatomical structure morphogenesis	nucleus	DNA binding				0	all_hematologic(923;0.215)					TGCTGGACTTTGTCCCTACGG	0.552													87	125	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175097272	175097272	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175097272C>A	uc001gkl.1	+	14	3263	c.3150C>A	c.(3148-3150)AGC>AGA	p.S1050R		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	1050	Fibronectin type-III 9.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GTCGCCGGAGCAGAAATGTAT	0.557													20	42	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182812436	182812436	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182812436T>G	uc001gpr.2	+	3	282	c.119T>G	c.(118-120)GTG>GGG	p.V40G	DHX9_uc001gps.2_5'UTR	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	40	DRBM 1.|Interaction with CREBBP.				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						AAGGTTCAGGTGGAAGGTTAT	0.333													8	43	---	---	---	---	PASS
DHX9	1660	broad.mit.edu	37	1	182847165	182847165	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182847165G>A	uc001gpr.2	+	20	2371	c.2208G>A	c.(2206-2208)GTG>GTA	p.V736V	DHX9_uc001gps.2_Silent_p.V522V|DHX9_uc001gpt.2_Silent_p.V15V	NM_001357	NP_001348	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 9	736	Helicase C-terminal.				CRD-mediated mRNA stabilization|nuclear mRNA splicing, via spliceosome	centrosome|CRD-mediated mRNA stability complex|nucleolus|nucleoplasm|ribonucleoprotein complex	ATP binding|ATP-dependent DNA helicase activity|ATP-dependent RNA helicase activity|DNA binding|double-stranded RNA binding|protein binding			ovary(2)	2						GGCAGAAAGTGAAACTCTTCA	0.403													9	40	---	---	---	---	PASS
FAM58B	339521	broad.mit.edu	37	1	200183003	200183003	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200183003C>A	uc009wzi.1	+	1	348	c.312C>A	c.(310-312)TAC>TAA	p.Y104*		NM_001105517	NP_001098987	P0C7Q3	FA58B_HUMAN	family with sequence similarity 58 member B	104					regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent		protein kinase binding				0	Prostate(682;0.19)					CCAACAGGTACTTCAACCCAA	0.557													71	121	---	---	---	---	PASS
PPFIA4	8497	broad.mit.edu	37	1	203026006	203026006	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203026006A>G	uc001gyz.2	+	6	1410	c.817A>G	c.(817-819)ATT>GTT	p.I273V	PPFIA4_uc009xaj.2_Missense_Mutation_p.I904V|PPFIA4_uc010pqf.1_Missense_Mutation_p.I486V|PPFIA4_uc001gza.2_Missense_Mutation_p.I273V|PPFIA4_uc001gzb.1_5'UTR	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f	273					cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CAAGTCGTCCATTGGCCGCCT	0.612													22	50	---	---	---	---	PASS
PPP1R15B	84919	broad.mit.edu	37	1	204379802	204379802	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204379802C>A	uc001hav.3	-	1	1143	c.738G>T	c.(736-738)GAG>GAT	p.E246D		NM_032833	NP_116222	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	246					regulation of translation					ovary(1)|pancreas(1)	2	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			AGCCGACTACCTCGCTATTTC	0.522													22	147	---	---	---	---	PASS
TMEM206	55248	broad.mit.edu	37	1	212538573	212538573	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212538573G>A	uc001hjc.3	-	8	1205	c.1037C>T	c.(1036-1038)ACG>ATG	p.T346M	TMEM206_uc010pte.1_Missense_Mutation_p.T407M	NM_018252	NP_060722	Q9H813	TM206_HUMAN	transmembrane protein 206	346	Cytoplasmic (Potential).					integral to membrane				breast(1)	1				all cancers(67;0.012)|OV - Ovarian serous cystadenocarcinoma(81;0.0121)|GBM - Glioblastoma multiforme(131;0.0377)|Epithelial(68;0.148)		TATGTGGCTCGTTGCCTGACC	0.413													9	180	---	---	---	---	PASS
PTPN14	5784	broad.mit.edu	37	1	214567092	214567092	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214567092G>T	uc001hkk.1	-	10	1146	c.875C>A	c.(874-876)TCT>TAT	p.S292Y	PTPN14_uc010pty.1_Missense_Mutation_p.S193Y	NM_005401	NP_005392	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type	292	FERM.				lymphangiogenesis	cytoplasm|cytoskeleton	protein tyrosine phosphatase activity|receptor tyrosine kinase binding			breast(2)|ovary(1)|kidney(1)|skin(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		AAACAACCGAGAAATATACTT	0.333													24	79	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227239654	227239654	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227239654G>A	uc001hqr.2	-						CDC42BPA_uc001hqq.2_Silent_p.N243N|CDC42BPA_uc001hqs.2_Intron|CDC42BPA_uc009xes.2_Intron|CDC42BPA_uc010pvs.1_Intron|CDC42BPA_uc001hqp.2_Intron|CDC42BPA_uc001hqu.1_Silent_p.N151N	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B						actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TGACGCTCGGGTTCCATACAT	0.453													29	68	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228559483	228559483	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228559483C>T	uc009xez.1	+	94	21048	c.21004C>T	c.(21004-21006)CAG>TAG	p.Q7002*	OBSCN_uc001hsr.1_Nonsense_Mutation_p.Q1631*	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	7002	Pro-rich.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				GGGGCACCCTCAGGGCTCCAA	0.706													14	48	---	---	---	---	PASS
KIAA1383	54627	broad.mit.edu	37	1	232942054	232942054	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232942054G>C	uc001hvh.2	+	1	1417	c.1285G>C	c.(1285-1287)GAG>CAG	p.E429Q		NM_019090	NP_061963	Q9P2G4	K1383_HUMAN	hypothetical protein LOC54627	287										ovary(1)	1		all_cancers(173;0.00528)|Prostate(94;0.122)|all_epithelial(177;0.169)				CTCCCTAAATGAGGAAGTCAC	0.448													14	274	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237732556	237732556	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237732556G>T	uc001hyl.1	+	29	3655	c.3535G>T	c.(3535-3537)GGT>TGT	p.G1179C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1179	Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CACACTGAATGGTGAAATCCT	0.448													13	31	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237732557	237732557	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237732557G>T	uc001hyl.1	+	29	3656	c.3536G>T	c.(3535-3537)GGT>GTT	p.G1179V		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1179	Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACACTGAATGGTGAAATCCTT	0.443													13	31	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237935345	237935345	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237935345A>G	uc001hyl.1	+	86	11711	c.11591A>G	c.(11590-11592)AAT>AGT	p.N3864S	RYR2_uc010pya.1_Missense_Mutation_p.N279S	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3864					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CAGACTGGCAATAATACAACT	0.333													3	8	---	---	---	---	PASS
OPN3	23596	broad.mit.edu	37	1	241761284	241761284	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241761284C>G	uc001hza.2	-	3	854	c.709G>C	c.(709-711)GAT>CAT	p.D237H	OPN3_uc001hzb.2_RNA|OPN3_uc001hzc.2_RNA	NM_014322	NP_055137	Q9H1Y3	OPN3_HUMAN	opsin 3	237	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			GTCTGAAGATCTTCCACACAA	0.353													13	22	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242042219	242042219	+	Silent	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242042219T>C	uc001hzh.2	+	13	2223	c.1683T>C	c.(1681-1683)GAT>GAC	p.D561D	EXO1_uc001hzi.2_Silent_p.D561D|EXO1_uc001hzj.2_Silent_p.D561D|EXO1_uc009xgq.2_Silent_p.D560D	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	561					meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			ATTCAAGTGATGACATTCCGA	0.403								Direct_reversal_of_damage|Editing_and_processing_nucleases					37	47	---	---	---	---	PASS
AHCTF1	25909	broad.mit.edu	37	1	247006029	247006029	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247006029C>A	uc001ibu.1	-	34	6582	c.6575G>T	c.(6574-6576)CGA>CTA	p.R2192L	AHCTF1_uc001ibv.1_Missense_Mutation_p.R2201L|AHCTF1_uc009xgs.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS	2192	Necessary for nuclear localization (By similarity).				cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CGTCCTGATTCGTTTCGCTTT	0.348													8	240	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752529	247752529	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752529C>G	uc010pyy.1	+	1	868	c.868C>G	c.(868-870)CCT>GCT	p.P290A		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	290	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CATGCTTAACCCTCTTATTTA	0.348													56	141	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	248617078	248617078	+	IGR	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248617078G>T								OR2T2 (5 upstream) : OR2T3 (19574 downstream)																							GGCTAGCAGGGACTCCCACAG	0.552													40	75	---	---	---	---	PASS
RSAD2	91543	broad.mit.edu	37	2	7023640	7023640	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7023640G>A	uc002qyp.1	+	2	621	c.485G>A	c.(484-486)CGG>CAG	p.R162Q		NM_080657	NP_542388	Q8WXG1	RSAD2_HUMAN	radical S-adenosyl methionine domain containing	162					defense response to virus	endoplasmic reticulum membrane|Golgi apparatus	catalytic activity|iron-sulfur cluster binding|metal ion binding				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			OV - Ovarian serous cystadenocarcinoma(76;0.191)		AGCCTGATCCGGGAGAGGTGG	0.488													25	30	---	---	---	---	PASS
YWHAQ	10971	broad.mit.edu	37	2	9770387	9770387	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9770387G>C	uc002qzw.2	-	1	359	c.195C>G	c.(193-195)ATC>ATG	p.I65M	YWHAQ_uc002qzx.2_Missense_Mutation_p.I65M	NM_006826	NP_006817	P27348	1433T_HUMAN	tyrosine 3/tryptophan 5 -monooxygenase	65					negative regulation of transcription, DNA-dependent	centrosome|nucleus	protein N-terminus binding			breast(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.241)		TCTTCTGCTCGATGCTAGAGA	0.607													25	96	---	---	---	---	PASS
LPIN1	23175	broad.mit.edu	37	2	11922351	11922351	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11922351G>C	uc010yjn.1	+	8	1148	c.874G>C	c.(874-876)GAG>CAG	p.E292Q	LPIN1_uc010yjm.1_Missense_Mutation_p.E377Q|LPIN1_uc002rbt.2_Missense_Mutation_p.E292Q|LPIN1_uc002rbs.2_Missense_Mutation_p.E328Q	NM_145693	NP_663731	Q14693	LPIN1_HUMAN	lipin 1	292					fatty acid catabolic process|transcription, DNA-dependent|triglyceride biosynthetic process|triglyceride mobilization	cytosol|endoplasmic reticulum membrane	phosphatidate phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.173)		CAAGATGAAAGAGTCCAGCCC	0.448													10	57	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20137623	20137623	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20137623G>A	uc002rdi.2	-	20	2289	c.2181C>T	c.(2179-2181)GGC>GGT	p.G727G	WDR35_uc002rdj.2_Silent_p.G716G|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Silent_p.G292G|WDR35_uc002rdk.3_Silent_p.G292G	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	727										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAAACTTAATGCCTTGGTAAT	0.448													102	168	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21224842	21224842	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21224842C>T	uc002red.2	-	29	13580	c.13452G>A	c.(13450-13452)ACG>ACA	p.T4484T		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	4484					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	TTATTTTCTTCGTCGCAATGG	0.378													5	156	---	---	---	---	PASS
C2orf28	51374	broad.mit.edu	37	2	27439399	27439399	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27439399C>T	uc002rjf.2	+	6	834	c.661C>T	c.(661-663)CCT>TCT	p.P221S	C2orf28_uc002rjg.2_Missense_Mutation_p.P108S|C2orf28_uc002rjh.2_RNA|CAD_uc002rji.2_5'Flank|CAD_uc010eyw.2_5'Flank	NM_080592	NP_542159	Q6UW56	APR3_HUMAN	apoptosis related protein 3 isoform b	166	EGF-like.|Extracellular (Potential).					integral to membrane|plasma membrane				skin(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAAATGTGTCCTGAGAATGG	0.403													66	272	---	---	---	---	PASS
MRPL33	9553	broad.mit.edu	37	2	28002352	28002352	+	3'UTR	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28002352G>T	uc002rlm.1	+	4					MRPL33_uc002rln.1_Missense_Mutation_p.G32C	NM_004891	NP_004882	O75394	RM33_HUMAN	mitochondrial ribosomal protein L33 isoform a						translation	mitochondrion|ribosome	structural constituent of ribosome				0	Acute lymphoblastic leukemia(172;0.155)					CCCTTTAAACGGTGGATTGAA	0.363													14	168	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71708055	71708055	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71708055C>T	uc002sie.2	+	2	507	c.131C>T	c.(130-132)CCT>CTT	p.P44L	DYSF_uc010feg.2_Missense_Mutation_p.P44L|DYSF_uc010feh.2_Missense_Mutation_p.P44L|DYSF_uc002sig.3_Missense_Mutation_p.P44L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Missense_Mutation_p.P44L|DYSF_uc010fef.2_Missense_Mutation_p.P44L|DYSF_uc010fei.2_Missense_Mutation_p.P44L|DYSF_uc010fek.2_Missense_Mutation_p.P45L|DYSF_uc010fej.2_Missense_Mutation_p.P45L|DYSF_uc010fel.2_Missense_Mutation_p.P45L|DYSF_uc010feo.2_Missense_Mutation_p.P45L|DYSF_uc010fem.2_Missense_Mutation_p.P45L|DYSF_uc010fen.2_Missense_Mutation_p.P45L|DYSF_uc002sif.2_Missense_Mutation_p.P45L	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	44	Cytoplasmic (Potential).|C2 1.					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						AGCGTGAACCCTGTATGGAAT	0.502													26	47	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100628012	100628012	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100628012C>G	uc002tag.2	-						AFF3_uc002taf.2_Missense_Mutation_p.Q25H|AFF3_uc010fiq.1_Intron|AFF3_uc010yvr.1_Missense_Mutation_p.Q154H|AFF3_uc002tah.1_Missense_Mutation_p.Q25H|AFF3_uc010fir.1_Missense_Mutation_p.Q77H	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						AGTCATTCCTCTGGTTTAAGA	0.438													43	135	---	---	---	---	PASS
GCC2	9648	broad.mit.edu	37	2	109086545	109086545	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109086545G>A	uc002tec.2	+	6	914	c.760G>A	c.(760-762)GAG>AAG	p.E254K	GCC2_uc002ted.2_Missense_Mutation_p.E153K	NM_181453	NP_852118	Q8IWJ2	GCC2_HUMAN	GRIP and coiled-coil domain-containing 2	254	Potential.				Golgi ribbon formation|late endosome to Golgi transport|microtubule anchoring|microtubule organizing center organization|protein localization in Golgi apparatus|protein targeting to lysosome|recycling endosome to Golgi transport|regulation of protein exit from endoplasmic reticulum	membrane|trans-Golgi network	identical protein binding			ovary(1)	1						AGAGGTGAAAGAGTTGATGTG	0.353													10	202	---	---	---	---	PASS
GPR148	344561	broad.mit.edu	37	2	131487737	131487737	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131487737G>T	uc002trv.1	+	1	1015	c.1013G>T	c.(1012-1014)AGG>ATG	p.R338M		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	338	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity	p.R338R(1)		skin(1)	1	Colorectal(110;0.1)					CTCCCATCCAGGAGGCACCAG	0.532													13	18	---	---	---	---	PASS
POTEE	445582	broad.mit.edu	37	2	132021608	132021608	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132021608C>A	uc002tsn.2	+	15	2632	c.2580C>A	c.(2578-2580)ACC>ACA	p.T860T	PLEKHB2_uc002tsh.2_Intron|POTEE_uc002tsk.2_Silent_p.T460T|POTEE_uc002tsl.2_Silent_p.T442T|POTEE_uc010fmy.1_Silent_p.T324T	NM_001083538	NP_001077007	Q6S8J3	POTEE_HUMAN	protein expressed in prostate, ovary, testis,	860	Actin-like.						ATP binding				0						ACGGGGTCACCCACACTGTGC	0.617													6	119	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141232707	141232707	+	Missense_Mutation	SNP	C	A	A	rs77794732		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141232707C>A	uc002tvj.1	-	60	10597	c.9625G>T	c.(9625-9627)GTC>TTC	p.V3209F		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3209	Extracellular (Potential).|LDL-receptor class B 31.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTGGACCAACCTTTGTGTCTA	0.289										TSP Lung(27;0.18)			18	80	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152276711	152276711	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152276711G>C	uc002txm.2	+	7	641	c.511G>C	c.(511-513)GAA>CAA	p.E171Q	RIF1_uc002txl.2_Missense_Mutation_p.E171Q|RIF1_uc010fnv.1_Missense_Mutation_p.E135Q|RIF1_uc002txn.2_Missense_Mutation_p.E171Q|RIF1_uc002txo.2_Missense_Mutation_p.E171Q|RIF1_uc010zby.1_RNA	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	171					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		TAGGCTAATTGAACAAGCCCC	0.393													10	27	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152473910	152473910	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152473910A>C	uc010fnx.2	-	71	10611	c.10420T>G	c.(10420-10422)TTA>GTA	p.L3474V		NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	3474	Nebulin 95.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		AGTTTGGCTAACATGATTTCT	0.358													2	6	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160284489	160284489	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160284489C>G	uc002uao.2	-	13	2781	c.2429G>C	c.(2428-2430)AGA>ACA	p.R810T	BAZ2B_uc002uap.2_Intron|BAZ2B_uc002uaq.1_Missense_Mutation_p.R640T|BAZ2B_uc002uar.1_Missense_Mutation_p.R383T	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	810	MBD.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						GTCACCCACTCTTATTTTTGC	0.353													45	96	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168115271	168115271	+	3'UTR	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168115271G>A	uc002udx.2	+	10					XIRP2_uc010fpn.2_Missense_Mutation_p.E772K|XIRP2_uc010fpo.2_Missense_Mutation_p.E739K|XIRP2_uc010fpp.2_Missense_Mutation_p.E739K|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Missense_Mutation_p.E517K	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						CTTGTCGAGTGAAGCAAATGA	0.299													26	50	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170044630	170044630	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170044630C>T	uc002ues.2	-	49	9391	c.9178G>A	c.(9178-9180)GGA>AGA	p.G3060R		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3060	LDL-receptor class A 24.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCATCAGATCCGTCTCCACAG	0.502													48	100	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170090097	170090097	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170090097A>G	uc002ues.2	-	30	5135	c.4922T>C	c.(4921-4923)ATT>ACT	p.I1641T		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1641	LDL-receptor class B 13.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	GTGCCGTATAATCTGTGAGGC	0.488													31	36	---	---	---	---	PASS
C2orf77	129881	broad.mit.edu	37	2	170537574	170537574	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170537574C>G	uc002ufe.2	-	2	331	c.237G>C	c.(235-237)AAG>AAC	p.K79N		NM_001085447	NP_001078916	Q0VFZ6	CB077_HUMAN	hypothetical protein LOC129881	79	Potential.										0						GCATTTCTTTCTTTGCCTTTC	0.418													45	150	---	---	---	---	PASS
DCAF17	80067	broad.mit.edu	37	2	172309682	172309682	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:172309682C>G	uc002ugx.2	+	6	815	c.586C>G	c.(586-588)CTA>GTA	p.L196V	DCAF17_uc010zdq.1_RNA|DCAF17_uc010fqf.1_Missense_Mutation_p.L196V|DCAF17_uc010zdr.1_RNA|DCAF17_uc010fqg.2_5'UTR	NM_025000	NP_079276	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17 isoform 1	196	Helical; (Potential).					CUL4 RING ubiquitin ligase complex|integral to membrane|nucleolus					0						GTTCCGAGTTCTACCTTTTTC	0.348													22	82	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179468797	179468797	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179468797C>G	uc010zfg.1	-	231	47137	c.46913G>C	c.(46912-46914)AGA>ACA	p.R15638T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9333T|TTN_uc010zfi.1_Missense_Mutation_p.R9266T|TTN_uc010zfj.1_Missense_Mutation_p.R9141T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16565							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCCTCTTCTCTTTTCTCCAG	0.478													6	385	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179605892	179605892	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179605892G>A	uc010zfh.1	-	46	11779	c.11555C>T	c.(11554-11556)GCA>GTA	p.A3852V	TTN_uc010zfg.1_Intron|TTN_uc010zfi.1_Missense_Mutation_p.A3785V|TTN_uc010zfj.1_Missense_Mutation_p.A3660V|TTN_uc002umz.1_Intron	NM_133437	NP_597681	Q8WZ42	TITIN_HUMAN	titin isoform novex-2	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGCTCTGCTGCACAGGTGGA	0.502													10	162	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186671394	186671394	+	Intron	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186671394A>T	uc002upm.2	+						uc010zfu.1_Missense_Mutation_p.L285F					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		CTAAGTTTTTAGAAGATGTTA	0.294													4	80	---	---	---	---	PASS
CALCRL	10203	broad.mit.edu	37	2	188223976	188223976	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188223976T>C	uc002upv.3	-	11	1353	c.805A>G	c.(805-807)ATA>GTA	p.I269V	CALCRL_uc010frt.2_Missense_Mutation_p.I269V	NM_005795	NP_005786	Q16602	CALRL_HUMAN	calcitonin receptor-like precursor	269	Helical; Name=4; (Potential).					integral to plasma membrane				lung(3)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.0554)|Epithelial(96;0.227)			ATGGCATGTATACAAGCAGGA	0.239													8	7	---	---	---	---	PASS
FAM126B	285172	broad.mit.edu	37	2	201853065	201853065	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201853065T>G	uc002uws.3	-	11	1099	c.911A>C	c.(910-912)GAA>GCA	p.E304A	FAM126B_uc002uwu.2_Missense_Mutation_p.E222A|FAM126B_uc002uwv.2_Missense_Mutation_p.E304A	NM_173822	NP_776183	Q8IXS8	F126B_HUMAN	hypothetical protein LOC285172	304						intracellular				ovary(1)	1						TGGAGTGACTTCAACTTTAAG	0.413													61	82	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207460864	207460864	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207460864C>A	uc002vbq.2	+	24	2560	c.2337C>A	c.(2335-2337)CCC>CCA	p.P779P	ADAM23_uc010ziv.1_Intron	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	779	Extracellular (Potential).				cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		ACCTTCACCCCCCCAAGGATG	0.448													10	19	---	---	---	---	PASS
TNS1	7145	broad.mit.edu	37	2	218713626	218713626	+	Silent	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218713626G>T	uc002vgt.2	-	17	1637	c.1239C>A	c.(1237-1239)ACC>ACA	p.T413T	TNS1_uc002vgr.2_Silent_p.T413T|TNS1_uc002vgs.2_Silent_p.T413T|TNS1_uc010zjv.1_Silent_p.T413T|TNS1_uc010fvj.1_Silent_p.T481T|TNS1_uc010fvk.1_Silent_p.T538T|TNS1_uc010fvi.1_Silent_p.T100T	NM_022648	NP_072174	Q9HBL0	TENS1_HUMAN	tensin	413						cytoplasm|cytoskeleton|focal adhesion	actin binding			ovary(3)|breast(1)	4		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		TGTCGGTCTTGGTGGAGGCTG	0.642													18	84	---	---	---	---	PASS
PTPRN	5798	broad.mit.edu	37	2	220156190	220156190	+	Splice_Site	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220156190A>T	uc002vkz.2	-	20	2818	c.2729_splice	c.e20+1	p.S910_splice	PTPRN_uc010zlc.1_Splice_Site_p.S820_splice|PTPRN_uc002vla.2_Splice_Site_p.S881_splice	NM_002846	NP_002837	Q16849	PTPRN_HUMAN	protein tyrosine phosphatase, receptor type, N						response to reactive oxygen species	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|lung(1)|skin(1)	4		Renal(207;0.0474)		Epithelial(149;4.22e-07)|all cancers(144;8.82e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)|STAD - Stomach adenocarcinoma(1183;0.0875)		CTCTCCACCCACCTGCAGTGC	0.547													19	24	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220357321	220357321	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220357321G>A	uc010fwg.2	+	41	9617	c.9617G>A	c.(9616-9618)CGG>CAG	p.R3206Q		NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	3206	Protein kinase 2.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		GGCAGGAGCCGGCCCTCCCTG	0.522													6	105	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230724207	230724207	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230724207C>T	uc002vpw.1	-	3	291	c.182G>A	c.(181-183)GGG>GAG	p.G61E	TRIP12_uc002vpx.1_Missense_Mutation_p.G103E|TRIP12_uc002vpy.1_Intron|TRIP12_uc010zlz.1_RNA|TRIP12_uc010fxh.1_Missense_Mutation_p.G61E	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	61					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGGCACCTGCCCCGTTTTTTG	0.453													7	178	---	---	---	---	PASS
CHRNG	1146	broad.mit.edu	37	2	233408046	233408046	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233408046C>A	uc002vsx.1	+	8	888	c.867C>A	c.(865-867)TTC>TTA	p.F289L	CHRNG_uc010fye.1_Missense_Mutation_p.F237L	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	289	Helical; (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		TCTTCCTCTTCCTTGTGGCCA	0.582													8	32	---	---	---	---	PASS
CHRNG	1146	broad.mit.edu	37	2	233409214	233409214	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233409214C>G	uc002vsx.1	+	10	1194	c.1173C>G	c.(1171-1173)CTC>CTG	p.L391L	CHRNG_uc010fye.1_Silent_p.L339L	NM_005199	NP_005190	P07510	ACHG_HUMAN	cholinergic receptor, nicotinic, gamma	391	Cytoplasmic (Potential).				muscle contraction	cell junction|postsynaptic membrane	acetylcholine receptor activity				0		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;6.39e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00079)|LUSC - Lung squamous cell carcinoma(224;0.00757)|Lung(119;0.0086)		AGGTGGCCCTCTGCCTGCCTC	0.662													22	84	---	---	---	---	PASS
NGEF	25791	broad.mit.edu	37	2	233785170	233785170	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233785170C>A	uc002vts.2	-	5	900	c.652G>T	c.(652-654)GAA>TAA	p.E218*	NGEF_uc010fyg.1_Nonsense_Mutation_p.E126*|NGEF_uc002vtt.2_Nonsense_Mutation_p.E126*	NM_019850	NP_062824	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	218	Poly-Glu.|Regulatory region; modulates activity toward RHOA, RAC1 and CDC42 (By similarity).				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|growth cone|plasma membrane	Rho guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)|skin(1)	7		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		tcttcttcttcctcctccGGG	0.458													19	48	---	---	---	---	PASS
UGT1A5	54579	broad.mit.edu	37	2	234622280	234622280	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234622280C>G	uc002vuw.2	+	1	643	c.643C>G	c.(643-645)CTC>GTC	p.L215V	UGT1A8_uc010zmv.1_Intron|UGT1A8_uc002vup.2_Intron|UGT1A10_uc002vuq.3_Intron|UGT1A10_uc002vur.2_Intron|UGT1A9_uc010zmw.1_Intron|UGT1A9_uc002vus.2_Intron|UGT1A7_uc010zmx.1_Intron|UGT1A7_uc002vut.2_Intron|UGT1A6_uc002vuu.2_Intron|UGT1A6_uc010zmy.1_Intron|UGT1A6_uc002vuv.3_Intron|UGT1A5_uc010zmz.1_Missense_Mutation_p.L215V	NM_019078	NP_061951	P35504	UD15_HUMAN	UDP glycosyltransferase 1 family, polypeptide A5	215					xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	glucuronosyltransferase activity			skin(1)	1		Breast(86;0.000765)|all_lung(227;0.00267)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0457)|Lung SC(224;0.128)		Epithelial(121;4.51e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000523)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.00645)		CAAGAACATGCTCTACCCTCT	0.483													4	220	---	---	---	---	PASS
SATB1	6304	broad.mit.edu	37	3	18436276	18436276	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:18436276G>A	uc003cbh.2	-	7	2619	c.884C>T	c.(883-885)TCT>TTT	p.S295F	SATB1_uc003cbi.2_Missense_Mutation_p.S295F|SATB1_uc003cbj.2_Missense_Mutation_p.S295F	NM_002971	NP_002962	Q01826	SATB1_HUMAN	special AT-rich sequence binding protein 1	295					cellular component disassembly involved in apoptosis|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter	nuclear matrix|PML body	double-stranded DNA binding|sequence-specific DNA binding			skin(2)|ovary(1)|lung(1)	4						TGTCCGGACAGAGGGCTGGCT	0.582													15	75	---	---	---	---	PASS
TLR9	54106	broad.mit.edu	37	3	52257047	52257047	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52257047C>T	uc003dda.1	-	2	1919	c.1285G>A	c.(1285-1287)GGA>AGA	p.G429R	TLR9_uc003ddb.2_Missense_Mutation_p.G526R	NM_017442	NP_059138	Q9NR96	TLR9_HUMAN	toll-like receptor 9 isoform A precursor	429	LRR 14.|Extracellular (Potential).				defense response to bacterium|fibroblast growth factor receptor signaling pathway|I-kappaB phosphorylation|inflammatory response|innate immune response|insulin receptor signaling pathway|maintenance of gastrointestinal epithelium|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-beta production|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-10 production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|response to molecule of bacterial origin	apical plasma membrane|basolateral plasma membrane|early phagosome|endoplasmic reticulum membrane|endosome membrane|extracellular region|integral to membrane|lysosome	interleukin-1 receptor binding|siRNA binding|transmembrane receptor activity			large_intestine(2)|skin(2)	4				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)	TCCGAAGCTCCGCTGATGCGG	0.642													7	122	---	---	---	---	PASS
CCDC66	285331	broad.mit.edu	37	3	56600985	56600985	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56600985G>C	uc003dhz.2	+	6	805	c.718G>C	c.(718-720)GAA>CAA	p.E240Q	CCDC66_uc003dhy.2_5'UTR|CCDC66_uc003dhu.2_Missense_Mutation_p.E206Q|CCDC66_uc003dhx.2_RNA|CCDC66_uc003dhv.2_RNA|CCDC66_uc003dhw.2_Missense_Mutation_p.E240Q	NM_001141947	NP_001135419	A2RUB6	CCD66_HUMAN	coiled-coil domain containing 66 isoform 1	240										breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0478)|Kidney(284;0.0597)|OV - Ovarian serous cystadenocarcinoma(275;0.233)		TAGAGAGAATGAATGGAAACC	0.363													26	41	---	---	---	---	PASS
ADAMTS9	56999	broad.mit.edu	37	3	64527226	64527226	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64527226C>T	uc003dmg.2	-	34	5300	c.5268G>A	c.(5266-5268)CTG>CTA	p.L1756L	ADAMTS9_uc011bfo.1_Silent_p.L1728L|ADAMTS9_uc011bfp.1_Silent_p.L667L	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1756	GON.				glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTCTAATCATCAGGAAATATT	0.388													35	86	---	---	---	---	PASS
PDZRN3	23024	broad.mit.edu	37	3	73433635	73433635	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:73433635G>A	uc003dpl.1	-	10	2178	c.2082C>T	c.(2080-2082)AGC>AGT	p.S694S	PDZRN3_uc011bgh.1_Silent_p.S351S|PDZRN3_uc010hoe.1_Silent_p.S392S|PDZRN3_uc011bgf.1_Silent_p.S411S|PDZRN3_uc011bgg.1_Silent_p.S414S	NM_015009	NP_055824	Q9UPQ7	PZRN3_HUMAN	PDZ domain containing ring finger 3	694	Potential.						ubiquitin-protein ligase activity|zinc ion binding			pancreas(2)|ovary(2)|skin(2)|large_intestine(1)	7		Prostate(10;0.114)|Lung NSC(201;0.187)|Lung SC(41;0.236)		BRCA - Breast invasive adenocarcinoma(55;0.00041)|Epithelial(33;0.0023)|LUSC - Lung squamous cell carcinoma(21;0.0048)|Lung(16;0.0105)|KIRC - Kidney renal clear cell carcinoma(39;0.111)|Kidney(39;0.134)		CCAGCTCGATGCTGCGCAGCT	0.632													23	11	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89480480	89480480	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89480480G>A	uc003dqy.2	+	13	2542	c.2317G>A	c.(2317-2319)GAT>AAT	p.D773N	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	773	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		TGTCCTGGAGGATGACCCAGA	0.408										TSP Lung(6;0.00050)			6	11	---	---	---	---	PASS
FAM55C	91775	broad.mit.edu	37	3	101540528	101540528	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101540528C>G	uc003dvn.2	+	8	2047	c.1410C>G	c.(1408-1410)CTC>CTG	p.L470L	FAM55C_uc010hpn.2_Silent_p.L470L	NM_145037	NP_659474	Q969Y0	FA55C_HUMAN	hypothetical protein LOC91775 precursor	470						extracellular region				ovary(1)|pancreas(1)|skin(1)	3						TGGTTCGGCTCCTCGATCGAA	0.567													19	175	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111603110	111603110	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111603110C>G	uc010hqa.2	+	2	597	c.186C>G	c.(184-186)CTC>CTG	p.L62L	PHLDB2_uc003dyc.2_Silent_p.L89L|PHLDB2_uc003dyd.2_Silent_p.L62L|PHLDB2_uc003dyg.2_Silent_p.L62L|PHLDB2_uc003dyh.2_Silent_p.L62L|PHLDB2_uc003dye.3_Silent_p.L62L|PHLDB2_uc003dyf.3_Silent_p.L62L	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	62						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						ATTTAACCCTCTCACAACCTG	0.478													11	447	---	---	---	---	PASS
GAP43	2596	broad.mit.edu	37	3	115395016	115395016	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:115395016G>A	uc003ebq.2	+	2	573	c.187G>A	c.(187-189)GAG>AAG	p.E63K	GAP43_uc003ebr.2_Missense_Mutation_p.E99K	NM_002045	NP_002036	P17677	NEUM_HUMAN	growth associated protein 43 isoform 2	63					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell differentiation|nervous system development|regulation of filopodium assembly|regulation of growth|response to wounding	cell junction|filopodium membrane|growth cone membrane|synapse	calmodulin binding			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.164)		CCAAGCTGCTGAGGCTGAAGC	0.517													9	130	---	---	---	---	PASS
SLC15A2	6565	broad.mit.edu	37	3	121649733	121649733	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121649733G>C	uc003eep.2	+	18	1753	c.1600G>C	c.(1600-1602)GAT>CAT	p.D534H	SLC15A2_uc011bjn.1_Missense_Mutation_p.D503H	NM_021082	NP_066568	Q16348	S15A2_HUMAN	peptide transporter 2 isoform a	534					protein transport	integral to plasma membrane	peptide:hydrogen symporter activity|protein binding			skin(1)	1				GBM - Glioblastoma multiforme(114;0.0967)	Cefadroxil(DB01140)	CCTGAGTACAGATACCTCTCT	0.383													12	121	---	---	---	---	PASS
PARP15	165631	broad.mit.edu	37	3	122354848	122354848	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122354848C>G	uc003efm.2	+	12	2004	c.1938C>G	c.(1936-1938)CTC>CTG	p.L646L	PARP15_uc003efn.2_Silent_p.L451L|PARP15_uc003efo.1_Silent_p.L393L|PARP15_uc003efp.1_Silent_p.L412L|PARP15_uc011bjt.1_Silent_p.L343L	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	624	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)		CCACAGATCTCTTTGACTCAG	0.433													5	165	---	---	---	---	PASS
ALDH1L1	10840	broad.mit.edu	37	3	125855651	125855651	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125855651C>G	uc003eim.1	-	11	1490	c.1300G>C	c.(1300-1302)GAG>CAG	p.E434Q	ALDH1L1_uc010hse.1_RNA|ALDH1L1_uc011bki.1_Missense_Mutation_p.E333Q|ALDH1L1_uc003eio.2_Missense_Mutation_p.E136Q|ALDH1L1_uc010hsf.1_Missense_Mutation_p.E460Q	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1	434	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	TTGGCGCCCTCGGCATCCACG	0.592													3	20	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126218239	126218239	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126218239C>T	uc003eiz.1	-	13	1289	c.1257G>A	c.(1255-1257)GAG>GAA	p.E419E	UROC1_uc010hsi.1_Silent_p.E479E	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	419					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		CACCTTTCTTCTCCACATCCG	0.602													6	49	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126218994	126218994	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126218994C>G	uc003eiz.1	-	12	1181	c.1149G>C	c.(1147-1149)CTG>CTC	p.L383L	UROC1_uc010hsi.1_Silent_p.L443L	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	383					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		CTTGCCTCCTCAGGCTGCAAC	0.602													8	79	---	---	---	---	PASS
ACAD9	28976	broad.mit.edu	37	3	128615308	128615308	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128615308G>A	uc003ela.3	+	5	685	c.483G>A	c.(481-483)CAG>CAA	p.Q161Q	ACAD9_uc010hsw.1_Silent_p.Q38Q|ACAD9_uc011bks.1_Silent_p.Q38Q|ACAD9_uc003elb.2_Silent_p.Q38Q|ACAD9_uc003elc.1_5'Flank|ACAD9_uc003eld.1_5'Flank	NM_014049	NP_054768	Q9H845	ACAD9_HUMAN	acyl-Coenzyme A dehydrogenase family, member 9	161						mitochondrion	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding			ovary(2)|central_nervous_system(1)	3						CTGAGGAGCAGAAAGCCAAAT	0.512													4	77	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129282078	129282078	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129282078C>T	uc003emx.2	-	26	4627	c.4527G>A	c.(4525-4527)ACG>ACA	p.T1509T	PLXND1_uc011blb.1_Silent_p.T177T	NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	1509	Cytoplasmic (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						GCTCCCCCACCGTCTCCTGAG	0.627													4	37	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130318603	130318603	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130318603C>A	uc010htl.2	+	19	4633	c.4602C>A	c.(4600-4602)GGC>GGA	p.G1534G	COL6A6_uc003eni.3_5'UTR	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	1534	Triple-helical region.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						TTTGACAGGGCAGAAGAGGCT	0.498													14	88	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130327739	130327739	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130327739G>A	uc010htl.2	+						COL6A6_uc003eni.3_Intron	NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor						axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						ATTCTTTCTCGCCACAGGGAA	0.453													12	77	---	---	---	---	PASS
ASTE1	28990	broad.mit.edu	37	3	130735094	130735094	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130735094C>T	uc003env.1	-	5	2045	c.1603G>A	c.(1603-1605)GAC>AAC	p.D535N	ATP2C1_uc011blh.1_3'UTR|ATP2C1_uc011bli.1_3'UTR|ATP2C1_uc003enm.2_3'UTR|ATP2C1_uc003enn.2_3'UTR|ATP2C1_uc003enp.2_3'UTR|ATP2C1_uc003enr.2_3'UTR|ATP2C1_uc003ens.2_3'UTR|ATP2C1_uc003ent.2_3'UTR|ASTE1_uc010htm.1_Missense_Mutation_p.D535N|ASTE1_uc011blj.1_RNA	NM_014065	NP_054784	Q2TB18	ASTE1_HUMAN	asteroid homolog 1	535					DNA repair		nuclease activity				0						GTGTCTAAGTCCAGTCTTGTG	0.512													6	250	---	---	---	---	PASS
PLS1	5357	broad.mit.edu	37	3	142389956	142389956	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142389956C>G	uc010huv.2	+	4	515	c.356C>G	c.(355-357)TCT>TGT	p.S119C	PLS1_uc003euz.2_Missense_Mutation_p.S119C|PLS1_uc003eva.2_Missense_Mutation_p.S119C	NM_001145319	NP_001138791	Q14651	PLSI_HUMAN	plastin 1	119	Actin-binding 1.					cytoplasm	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(1)	1						ACACAGCATTCTTATTCAGGT	0.289													5	452	---	---	---	---	PASS
DHX36	170506	broad.mit.edu	37	3	154001039	154001039	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154001039G>A	uc003ezy.3	-	20	2395	c.2314C>T	c.(2314-2316)CGT>TGT	p.R772C	DHX36_uc010hvq.2_Missense_Mutation_p.R758C|DHX36_uc003ezz.3_Missense_Mutation_p.R743C	NM_020865	NP_065916	Q9H2U1	DHX36_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 36	772						cytoplasm|nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CTGAAACCACGTCGCCTAGCC	0.393													118	71	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154055653	154055653	+	Silent	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154055653G>T	uc003faa.2	-	4	2131	c.2031C>A	c.(2029-2031)CCC>CCA	p.P677P		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	677	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GATTACTGGTGGGCAAAAAGA	0.458													86	419	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155232559	155232559	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155232559C>A	uc011bok.1	-	11	1826	c.1549G>T	c.(1549-1551)GCA>TCA	p.A517S	PLCH1_uc011boj.1_Missense_Mutation_p.A517S|PLCH1_uc011bol.1_Missense_Mutation_p.A499S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	517					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTCAGTAGTGCCCGCACTGTG	0.408													17	139	---	---	---	---	PASS
KCNAB1	7881	broad.mit.edu	37	3	155861003	155861003	+	Intron	SNP	G	A	A	rs149229225		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155861003G>A	uc003far.2	+						KCNAB1_uc011bon.1_Intron|KCNAB1_uc003fas.2_Silent_p.P12P	NM_172160	NP_751892	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related							cytoplasm|integral to membrane	oxidoreductase activity|potassium channel regulator activity|voltage-gated potassium channel activity			ovary(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			CAGACATCCCGAGCCCCAAGC	0.488													16	50	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165491294	165491294	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165491294C>T	uc003fem.3	-	4	1845	c.1685G>A	c.(1684-1686)GGA>GAA	p.G562E	BCHE_uc003fen.3_RNA	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	562					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	ATCAATATTTCCTGTAAAATA	0.313													5	100	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167507060	167507060	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167507060C>G	uc003ffa.3	+	2	342	c.144C>G	c.(142-144)TTC>TTG	p.F48L	SERPINI1_uc003ffb.3_Missense_Mutation_p.F48L	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	48					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						ATATTCTCTTCTCTCCATTGA	0.458													24	317	---	---	---	---	PASS
LRRIQ4	344657	broad.mit.edu	37	3	169540078	169540078	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169540078C>T	uc003fgb.2	+	1	369	c.369C>T	c.(367-369)CTC>CTT	p.L123L		NM_001080460	NP_001073929	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	123	LRR 5.										0						TGCGCGAGCTCCGGCTCTACC	0.582													35	261	---	---	---	---	PASS
PRKCI	5584	broad.mit.edu	37	3	170016837	170016837	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170016837G>T	uc003fgs.2	+	17	1880	c.1642G>T	c.(1642-1644)GGT>TGT	p.G548C	PRKCI_uc003fgt.2_Missense_Mutation_p.G103C	NM_002740	NP_002731	P41743	KPCI_HUMAN	protein kinase C, iota	548	AGC-kinase C-terminal.				anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			TGGGGAATTTGGTTTGGACAA	0.368													8	188	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171405270	171405270	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171405270C>T	uc003fhs.2	-	15	1760	c.1644G>A	c.(1642-1644)CTG>CTA	p.L548L	PLD1_uc003fht.2_Silent_p.L548L	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	548	Catalytic.				cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	CTATTCCTTTCAGTTTTGAAT	0.433													10	428	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			11	171	---	---	---	---	PASS
FAM131A	131408	broad.mit.edu	37	3	184062659	184062659	+	Silent	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184062659A>G	uc003fog.2	+	3	2273	c.909A>G	c.(907-909)CCA>CCG	p.P303P	FAM131A_uc003fob.1_Intron|FAM131A_uc003foc.2_Silent_p.P249P|FAM131A_uc003foe.2_Silent_p.P249P	NM_144635	NP_653236	Q6UXB0	F131A_HUMAN	hypothetical protein LOC131408 precursor	303						extracellular region				breast(1)	1	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGCCCACCACTAACGGGCA	0.637													11	124	---	---	---	---	PASS
FETUB	26998	broad.mit.edu	37	3	186362640	186362640	+	Silent	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186362640T>C	uc010hyq.2	+	5	786	c.525T>C	c.(523-525)CTT>CTC	p.L175L	FETUB_uc011brz.1_Silent_p.L27L|FETUB_uc003fqn.2_Silent_p.L175L|FETUB_uc003fqo.2_Silent_p.L70L|FETUB_uc010hyr.2_Silent_p.L138L|FETUB_uc010hys.2_Silent_p.L27L|FETUB_uc003fqp.3_Silent_p.L110L	NM_014375	NP_055190	Q9UGM5	FETUB_HUMAN	fetuin B precursor	175	Cystatin fetuin-B-type 2.					extracellular space	cysteine-type endopeptidase inhibitor activity			ovary(1)|lung(1)	2	all_cancers(143;6.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.73e-20)	GBM - Glioblastoma multiforme(93;0.0479)		CCGAGTCTCTTGCGAAATACA	0.473													29	377	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193028476	193028476	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193028476T>C	uc011bsq.1	-	21	2476	c.2476A>G	c.(2476-2478)ATG>GTG	p.M826V		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	826					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		CCAGGAGACATTCTTGCAAAA	0.348													23	196	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195487765	195487765	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195487765G>A	uc011bto.1	-	17	14914	c.14454C>T	c.(14452-14454)AAC>AAT	p.N4818N	MUC4_uc003fuz.2_Silent_p.N544N|MUC4_uc003fva.2_Silent_p.N426N|MUC4_uc003fvb.2_Silent_p.N462N|MUC4_uc003fvc.2_RNA|MUC4_uc003fvd.2_RNA|MUC4_uc003fve.2_Silent_p.N462N|MUC4_uc010hzr.2_RNA|MUC4_uc011btf.1_Silent_p.N426N|MUC4_uc011btg.1_RNA|MUC4_uc011bth.1_Silent_p.N510N|MUC4_uc011bti.1_Silent_p.N510N|MUC4_uc011btj.1_Silent_p.N687N|MUC4_uc011btk.1_Silent_p.N426N|MUC4_uc011btl.1_Silent_p.N455N|MUC4_uc011btm.1_Silent_p.N635N|MUC4_uc011btn.1_Silent_p.N426N|MUC4_uc003fvo.2_Silent_p.N710N|MUC4_uc003fvp.2_Silent_p.N659N	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	1703					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGAGGGTGGCGTTCGCCTGCT	0.582													14	202	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515857	195515857	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515857G>A	uc011bto.1	-	2	3054	c.2594C>T	c.(2593-2595)TCT>TTT	p.S865F	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.S747F	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	870	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACGATCGAAGACGCCATTCC	0.587													10	98	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195515959	195515959	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195515959G>A	uc011bto.1	-	2	2952	c.2492C>T	c.(2491-2493)TCA>TTA	p.S831L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.S713L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	836	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GGGGTTTGATGAAAACCTTGT	0.567													23	202	---	---	---	---	PASS
MUC4	4585	broad.mit.edu	37	3	195517057	195517057	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195517057G>A	uc011bto.1	-	2	1854	c.1394C>T	c.(1393-1395)CCT>CTT	p.P465L	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Missense_Mutation_p.P347L	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	470					cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CCTCTCATGAGGCCGTCCTGT	0.493													55	514	---	---	---	---	PASS
DLG1	1739	broad.mit.edu	37	3	196792249	196792249	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196792249C>T	uc003fxo.3	-	23	2494	c.2304G>A	c.(2302-2304)CAG>CAA	p.Q768Q	DLG1_uc011bub.1_Silent_p.Q664Q|DLG1_uc011buc.1_Silent_p.Q652Q|DLG1_uc011bud.1_Silent_p.Q451Q|DLG1_uc003fxn.3_Silent_p.Q790Q|DLG1_uc011bue.1_Silent_p.Q756Q|DLG1_uc010ial.2_Silent_p.Q768Q	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1	768	Guanylate kinase-like.				actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CTTTTTCCATCTGCTCTCTTG	0.353													48	448	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197665535	197665535	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197665535G>C	uc003fyo.2	-	4	545	c.399C>G	c.(397-399)ATC>ATG	p.I133M	IQCG_uc003fyn.2_Missense_Mutation_p.I35M|IQCG_uc003fyp.2_Missense_Mutation_p.I133M|IQCG_uc003fyq.3_Missense_Mutation_p.I133M	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	133											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		CTCTGTGTCTGATTTCTGGCA	0.438													686	232	---	---	---	---	PASS
ZNF595	152687	broad.mit.edu	37	4	53394	53394	+	Intron	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53394G>T	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		TGGTGAGTGTGCGGGGCAGGG	0.652													17	377	---	---	---	---	PASS
ADRA2C	152	broad.mit.edu	37	4	3768879	3768879	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3768879C>G	uc003ghm.2	+	1	584	c.546C>G	c.(544-546)ATC>ATG	p.I182M	ADRA2C_uc010icx.2_Missense_Mutation_p.I182M	NM_000683	NP_000674	P18825	ADA2C_HUMAN	alpha-2C-adrenergic receptor	182	Helical; Name=4; (By similarity).				activation of MAPK activity by adrenergic receptor signaling pathway|activation of protein kinase B activity|blood coagulation|cell-cell signaling|energy reserve metabolic process|epidermal growth factor receptor transactivation by G-protein coupled receptor signaling pathway|negative regulation of epinephrine secretion|negative regulation of norepinephrine secretion|positive regulation of neuron differentiation|regulation of insulin secretion	endosome|integral to plasma membrane	alpha-2A adrenergic receptor binding|alpha2-adrenergic receptor activity|epinephrine binding|protein heterodimerization activity|protein homodimerization activity				0				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)	Bethanidine(DB00217)|Brimonidine(DB00484)|Debrisoquin(DB04840)|Fenoldopam(DB00800)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Lofexidine(DB04948)|Norepinephrine(DB00368)|Yohimbine(DB01392)	CGGCCGTCATCTCCTTCCCGC	0.672													3	13	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6050631	6050631	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6050631G>C	uc010idb.1	-	16	2467	c.1981C>G	c.(1981-1983)CAG>GAG	p.Q661E	JAKMIP1_uc010idc.1_Missense_Mutation_p.Q476E|JAKMIP1_uc010idd.1_Intron	NM_001099433	NP_001092903	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						ATTGCAACCTGTTCTTCATTT	0.468													12	46	---	---	---	---	PASS
CPZ	8532	broad.mit.edu	37	4	8603071	8603071	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8603071C>T	uc003glm.2	+	3	469	c.343C>T	c.(343-345)CGC>TGC	p.R115C	CPZ_uc003gll.2_RNA|CPZ_uc003gln.2_5'UTR|CPZ_uc003glo.2_Missense_Mutation_p.R104C|CPZ_uc003glp.2_RNA	NM_001014447	NP_001014447	Q66K79	CBPZ_HUMAN	carboxypeptidase Z isoform 1	115	FZ.				proteolysis|Wnt receptor signaling pathway	proteinaceous extracellular matrix	metallocarboxypeptidase activity|zinc ion binding			ovary(2)|pancreas(1)	3						CGGCTGGGTGCGCAGACCCTG	0.692													15	14	---	---	---	---	PASS
KLB	152831	broad.mit.edu	37	4	39449075	39449075	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39449075A>T	uc003gua.2	+	4	2826	c.2729A>T	c.(2728-2730)TAC>TTC	p.Y910F	KLB_uc011byj.1_Missense_Mutation_p.Y901F	NM_175737	NP_783864	Q86Z14	KLOTB_HUMAN	klotho beta	910	Extracellular (Potential).|Glycosyl hydrolase-1 2.				carbohydrate metabolic process	integral to membrane|plasma membrane	cation binding|fibroblast growth factor binding|hydrolase activity, hydrolyzing O-glycosyl compounds			skin(1)	1						CTAGGGAAGTACCTTCAGGAG	0.572													23	64	---	---	---	---	PASS
GNPDA2	132789	broad.mit.edu	37	4	44709814	44709814	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:44709814C>G	uc003gwy.2	-	6	881	c.724G>C	c.(724-726)GAT>CAT	p.D242H	GNPDA2_uc010iga.2_Missense_Mutation_p.D208H|GNPDA2_uc011bzb.1_Missense_Mutation_p.D172H|GNPDA2_uc003gwz.1_Missense_Mutation_p.D242H	NM_138335	NP_612208	Q8TDQ7	GNPI2_HUMAN	glucosamine-6-phosphate deaminase 2	242					N-acetylglucosamine metabolic process	cytoplasm	glucosamine-6-phosphate deaminase activity|hydrolase activity			ovary(1)	1						AAAGTAGCATCTTCATCGCAT	0.393													29	16	---	---	---	---	PASS
GABRA4	2557	broad.mit.edu	37	4	46967219	46967219	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:46967219G>C	uc003gxg.2	-	8	1041	c.902C>G	c.(901-903)ACA>AGA	p.T301R		NM_000809	NP_000800	P48169	GBRA4_HUMAN	gamma-aminobutyric acid A receptor, alpha 4	301	Helical; (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)	4					Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	GATGCTTAGTGTGGTCATGGT	0.448													4	137	---	---	---	---	PASS
TXK	7294	broad.mit.edu	37	4	48114532	48114532	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48114532G>A	uc003gxx.3	-						TXK_uc003gxy.1_Intron	NM_003328	NP_003319	P42681	TXK_HUMAN	TXK tyrosine kinase							cytoplasm	ATP binding|non-membrane spanning protein tyrosine kinase activity				0						GTGTTGGACTGTGAAAACCAA	0.428													32	71	---	---	---	---	PASS
CXCL9	4283	broad.mit.edu	37	4	76927430	76927430	+	Intron	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76927430G>C	uc003hjh.1	-							NM_002416	NP_002407	Q07325	CXCL9_HUMAN	small inducible cytokine B9 precursor						cell-cell signaling|cellular defense response|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|inflammatory response	extracellular space	chemokine activity			ovary(1)	1			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGGGGTTCCTGAGGGAAAGAA	0.418													32	131	---	---	---	---	PASS
MEPE	56955	broad.mit.edu	37	4	88766127	88766127	+	Splice_Site	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88766127A>T	uc003hqy.2	+	4	148	c.109_splice	c.e4-2	p.Q37_splice	MEPE_uc010ikn.2_Splice_Site	NM_020203	NP_064588	Q9NQ76	MEPE_HUMAN	matrix, extracellular phosphoglycoprotein with						skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent|protein binding			ovary(1)|lung(1)|skin(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		ATTGTATTTTAGCAGGAAGAA	0.244													13	29	---	---	---	---	PASS
H2AFZ	3015	broad.mit.edu	37	4	100870459	100870459	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100870459C>G	uc003hvo.1	-	3	351	c.166G>C	c.(166-168)GCA>CCA	p.A56P	DNAJB14_uc003hvl.2_5'Flank|DNAJB14_uc010ili.2_5'Flank|DNAJB14_uc003hvm.2_5'Flank|H2AFZ_uc003hvn.1_3'UTR|LOC256880_uc003hvp.1_5'Flank	NM_002106	NP_002097	P0C0S5	H2AZ_HUMAN	H2A histone family, member Z	56					nucleosome assembly	nucleosome|nucleus	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(123;2.32e-08)		AGGATGGCTGCGCTGTACACA	0.552											OREG0016271	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	34	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125592435	125592435	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125592435T>C	uc003ifg.3	-	3	2263	c.1997A>G	c.(1996-1998)CAT>CGT	p.H666R	ANKRD50_uc011cgo.1_Missense_Mutation_p.H487R|ANKRD50_uc010inw.2_Missense_Mutation_p.H666R	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	666	ANK 6.									central_nervous_system(1)	1						TTCAGCGCCATGTTGTAGCAA	0.468													4	97	---	---	---	---	PASS
PCDH10	57575	broad.mit.edu	37	4	134084129	134084129	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:134084129C>G	uc003iha.2	+							NM_032961	NP_116586	Q9P2E7	PCD10_HUMAN	protocadherin 10 isoform 1 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2				LUSC - Lung squamous cell carcinoma(193;0.227)		TTTCTGCTTACAGGTATGGAT	0.458													17	31	---	---	---	---	PASS
PCDH18	54510	broad.mit.edu	37	4	138452960	138452960	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:138452960C>G	uc003ihe.3	-	1	670	c.283G>C	c.(283-285)GAA>CAA	p.E95Q	PCDH18_uc003ihf.3_Missense_Mutation_p.E88Q|PCDH18_uc011cgz.1_Intron|PCDH18_uc003ihg.3_Intron|PCDH18_uc011cha.1_Intron	NM_019035	NP_061908	Q9HCL0	PCD18_HUMAN	protocadherin 18 precursor	95	Extracellular (Potential).|Cadherin 1.				brain development|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			pancreas(3)|skin(2)	5	all_hematologic(180;0.24)					CACAGTTGTTCACGGTCAATT	0.433													51	135	---	---	---	---	PASS
INPP4B	8821	broad.mit.edu	37	4	143114254	143114254	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:143114254T>G	uc003iix.3	-	16	1762	c.1167A>C	c.(1165-1167)GAA>GAC	p.E389D	INPP4B_uc003iiw.3_Missense_Mutation_p.E389D|INPP4B_uc011chm.1_RNA|INPP4B_uc011chn.1_Missense_Mutation_p.E204D|INPP4B_uc011cho.1_RNA|INPP4B_uc011chp.1_Missense_Mutation_p.E260D	NM_003866	NP_003857	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II,	389					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			ovary(1)|lung(1)	2	all_hematologic(180;0.158)					TTCTTTCTGTTTCAAATCTAT	0.438													4	90	---	---	---	---	PASS
LRAT	9227	broad.mit.edu	37	4	155670262	155670262	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155670262C>A	uc003iom.1	+	2	994	c.667C>A	c.(667-669)CCA>ACA	p.P223T	LRAT_uc003ion.1_Missense_Mutation_p.P223T	NM_004744	NP_004735	O95237	LRAT_HUMAN	lecithin retinol acyltransferase	223	Lumenal (By similarity).				response to stimulus|retinoid metabolic process|steroid metabolic process|visual perception	endoplasmic reticulum membrane|integral to membrane|multivesicular body|perinuclear region of cytoplasm|rough endoplasmic reticulum	phosphatidylcholine-retinol O-acyltransferase activity			central_nervous_system(1)	1	all_hematologic(180;0.215)	Renal(120;0.0458)			Vitamin A(DB00162)	AATTTTTATTCCATTCTTCCT	0.393													50	125	---	---	---	---	PASS
TKTL2	84076	broad.mit.edu	37	4	164394680	164394680	+	Missense_Mutation	SNP	G	T	T	rs114941835	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164394680G>T	uc003iqp.3	-	1	368	c.207C>A	c.(205-207)AAC>AAA	p.N69K		NM_032136	NP_115512	Q9H0I9	TKTL2_HUMAN	transketolase-like 2	69						cytoplasm	metal ion binding|transketolase activity			ovary(2)|skin(2)|pancreas(1)	5	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				TGAACCGGTCGTTGTCCGGGT	0.557													8	20	---	---	---	---	PASS
DDX60	55601	broad.mit.edu	37	4	169157421	169157421	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169157421G>A	uc003irp.2	-	33	4807	c.4515C>T	c.(4513-4515)TTC>TTT	p.F1505F		NM_017631	NP_060101	Q8IY21	DDX60_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60	1505							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0485)		GATAAAACTCGAAGTGTGCAT	0.323													3	36	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169362543	169362543	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169362543A>C	uc003irq.3	-	10	1460	c.1239T>G	c.(1237-1239)TTT>TTG	p.F413L	DDX60L_uc003irr.1_Missense_Mutation_p.F413L|DDX60L_uc003irs.1_Missense_Mutation_p.F140L	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	413							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTCTCAGAGGAAAAGACTTTC	0.368													19	59	---	---	---	---	PASS
ADAM29	11086	broad.mit.edu	37	4	175897229	175897229	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175897229C>G	uc003iuc.2	+	5	1223	c.553C>G	c.(553-555)CAG>GAG	p.Q185E	ADAM29_uc003iud.2_Missense_Mutation_p.Q185E|ADAM29_uc010irr.2_Missense_Mutation_p.Q185E|ADAM29_uc011cki.1_Missense_Mutation_p.Q185E	NM_014269	NP_055084	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29 preproprotein	185					proteolysis|spermatogenesis	integral to plasma membrane	metalloendopeptidase activity|zinc ion binding			skin(5)|central_nervous_system(3)|ovary(3)|large_intestine(2)|lung(2)|pancreas(1)	16		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TAATTCCACTCAGAAGCAAAG	0.358													20	39	---	---	---	---	PASS
VEGFC	7424	broad.mit.edu	37	4	177608578	177608578	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177608578C>A	uc003ius.1	-	6	1338	c.908G>T	c.(907-909)AGC>ATC	p.S303I		NM_005429	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	303	4 X 16 AA repeats of C-X(10)-C-X-C- X(1,3)-C.				angiogenesis|induction of positive chemotaxis|platelet activation|platelet degranulation|positive regulation of cell division|positive regulation of mast cell chemotaxis|substrate-dependent cell migration|vascular endothelial growth factor receptor signaling pathway	membrane|platelet alpha granule lumen	chemoattractant activity|growth factor activity			lung(5)	5		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		GGGTCCACAGCTGGCAGGCCG	0.507													27	72	---	---	---	---	PASS
CCDC110	256309	broad.mit.edu	37	4	186380457	186380457	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186380457A>C	uc003ixu.3	-	6	1360	c.1284T>G	c.(1282-1284)ATT>ATG	p.I428M	CCDC110_uc003ixv.3_Missense_Mutation_p.I391M|CCDC110_uc011ckt.1_Missense_Mutation_p.I428M	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a	428						nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GTAAGTACTGAATTTTTGCAA	0.323													45	84	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	161981	161981	+	Silent	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161981G>C	uc003jak.2	+	10	1553	c.1503G>C	c.(1501-1503)CTG>CTC	p.L501L		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	501					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		GAAGGGGCCTGAGCGCCGTGG	0.607													9	35	---	---	---	---	PASS
SLC6A19	340024	broad.mit.edu	37	5	1219621	1219621	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1219621C>T	uc003jbw.3	+	10	1436	c.1380C>T	c.(1378-1380)GGC>GGT	p.G460G		NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19	460	Helical; Name=9; (Potential).				cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GGCCTGCAGGCCTCATCTGCC	0.637													9	43	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1264568	1264568	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1264568C>T	uc003jcb.1	-	11	2852	c.2794G>A	c.(2794-2796)GGC>AGC	p.G932S	TERT_uc003jbz.1_Missense_Mutation_p.G128S|TERT_uc003jca.1_Missense_Mutation_p.G920S|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	932	Primer grip sequence.|Reverse transcriptase.			WCGLL->AAAAA: Completely abolishes telomerase-mediated primer extension and reduced binding to short telomeric primers. Complete loss of catalytic activity but no further loss of binding to telomeric primers; when associated with 137-A--A-141.	anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			AGCAGCAGGCCGCACCAGGGG	0.647									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				16	22	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13721263	13721263	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13721263C>G	uc003jfd.2	-	71	12167	c.12125G>C	c.(12124-12126)CGG>CCG	p.R4042P	DNAH5_uc003jfc.2_Missense_Mutation_p.R210P	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4042	AAA 6 (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAGTGGCGTCCGTGGATCAGA	0.483									Kartagener_syndrome				42	77	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13894861	13894861	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13894861G>A	uc003jfd.2	-	16	2371	c.2329C>T	c.(2329-2331)CAC>TAC	p.H777Y		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	777	Potential.|Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTGGCCAAGTGAGGGACAATC	0.413									Kartagener_syndrome				28	115	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13923469	13923469	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13923469C>T	uc003jfd.2	-	4	400	c.358G>A	c.(358-360)GAT>AAT	p.D120N	DNAH5_uc003jfe.1_RNA	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	120	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGAGCCACATCGTTTCCCTCG	0.458									Kartagener_syndrome				65	166	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752083	21752083	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752083G>A	uc010iuc.2	-	12	2606	c.2148C>T	c.(2146-2148)TTC>TTT	p.F716F	CDH12_uc011cno.1_Silent_p.F676F|CDH12_uc003jgk.2_Silent_p.F716F|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	716	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TTTGATGAATGAAATCCCTTA	0.468										HNSCC(59;0.17)			15	77	---	---	---	---	PASS
PDZD2	23037	broad.mit.edu	37	5	32048766	32048766	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32048766G>A	uc003jhl.2	+	8	2029	c.1641G>A	c.(1639-1641)CTG>CTA	p.L547L	PDZD2_uc003jhm.2_Silent_p.L547L|PDZD2_uc011cnx.1_Silent_p.L373L	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2	547					cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TCCCGCAGCTGCTGGACTCTT	0.552													7	63	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37305197	37305197	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37305197C>T	uc003jku.1	-	26	3137	c.3019G>A	c.(3019-3021)GAT>AAT	p.D1007N	NUP155_uc003jkt.1_Missense_Mutation_p.D948N|NUP155_uc010iuz.1_Missense_Mutation_p.D943N	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	1007					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATATTTGGATCAGATGACAAC	0.408													50	170	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38338836	38338836	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38338836C>T	uc003jlc.1	+	3	568	c.244C>T	c.(244-246)CAG>TAG	p.Q82*	EGFLAM_uc003jlb.1_Nonsense_Mutation_p.Q82*	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	82	Fibronectin type-III 1.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					TAAATCCCTGCAGGAGCAGTT	0.542													18	37	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41004926	41004926	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41004926G>T	uc003jmj.3	-	36	4451	c.3961C>A	c.(3961-3963)CAG>AAG	p.Q1321K	HEATR7B2_uc003jmi.3_Missense_Mutation_p.Q876K	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1321							binding			ovary(6)|central_nervous_system(2)	8						ATGGCCATCTGCCTCAGAGTG	0.493													27	27	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41069802	41069802	+	Silent	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41069802A>G	uc003jmj.3	-	2	571	c.81T>C	c.(79-81)ATT>ATC	p.I27I		NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	27							binding			ovary(6)|central_nervous_system(2)	8						CCTTGTTAACAATATCTTCCT	0.328													6	9	---	---	---	---	PASS
MCCC2	64087	broad.mit.edu	37	5	70900248	70900248	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:70900248C>A	uc003kbs.3	+	6	715	c.577C>A	c.(577-579)CGT>AGT	p.R193S	MCCC2_uc010iyv.1_Missense_Mutation_p.R193S|MCCC2_uc003kbt.3_RNA|MCCC2_uc003kbu.1_Missense_Mutation_p.R62S	NM_022132	NP_071415	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-Coenzyme A carboxylase 2 (beta)	193	Carboxyltransferase.		R -> C (in MCC2 deficiency; mild form).		leucine catabolic process	mitochondrial inner membrane|mitochondrial matrix	ATP binding|methylcrotonoyl-CoA carboxylase activity			ovary(1)	1		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	CCACTTTGGCCGTACATTCTA	0.368													3	80	---	---	---	---	PASS
BHMT	635	broad.mit.edu	37	5	78411716	78411716	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78411716G>A	uc003kfu.3	+	2	265	c.160G>A	c.(160-162)GAA>AAA	p.E54K	BHMT_uc011cti.1_Missense_Mutation_p.E54K	NM_001713	NP_001704	Q93088	BHMT1_HUMAN	betaine-homocysteine methyltransferase	54	Hcy-binding.				protein methylation|regulation of homocysteine metabolic process	cytoplasm	betaine-homocysteine S-methyltransferase activity|homocysteine S-methyltransferase activity|zinc ion binding			ovary(1)	1		all_lung(232;0.00051)|Lung NSC(167;0.00131)|Ovarian(174;0.0261)|Prostate(461;0.191)		OV - Ovarian serous cystadenocarcinoma(54;1.88e-45)|Epithelial(54;8.07e-41)|all cancers(79;3.51e-36)	L-Methionine(DB00134)	GGAGCACCCAGAAGCAGGTTG	0.363													12	24	---	---	---	---	PASS
FAM172A	83989	broad.mit.edu	37	5	93388891	93388891	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93388891C>T	uc010jbd.2	-	3	355	c.148G>A	c.(148-150)GAT>AAT	p.D50N	FAM172A_uc011cuf.1_Missense_Mutation_p.D4N|FAM172A_uc011cug.1_Missense_Mutation_p.D4N|FAM172A_uc011cuh.1_5'UTR|FAM172A_uc011cui.1_RNA|FAM172A_uc011cuj.1_5'UTR|FAM172A_uc003kkm.3_Missense_Mutation_p.D50N	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1	50						endoplasmic reticulum|extracellular region					0						GGCGGTTCATCTTTTTTCATT	0.244													31	22	---	---	---	---	PASS
FAM172A	83989	broad.mit.edu	37	5	93410402	93410402	+	Missense_Mutation	SNP	G	C	C	rs143516571		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:93410402G>C	uc010jbd.2	-	2	262	c.55C>G	c.(55-57)CAA>GAA	p.Q19E	FAM172A_uc011cuf.1_Intron|FAM172A_uc011cug.1_Intron|FAM172A_uc011cuh.1_5'UTR|FAM172A_uc011cui.1_RNA|FAM172A_uc011cuj.1_Intron|FAM172A_uc003kkm.3_Missense_Mutation_p.Q19E	NM_032042	NP_114431	Q8WUF8	F172A_HUMAN	hypothetical protein LOC83989 isoform 1	19						endoplasmic reticulum|extracellular region					0						TGCTGGATTTGTGCCATGTTT	0.338													13	63	---	---	---	---	PASS
CAMK4	814	broad.mit.edu	37	5	110820063	110820063	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:110820063C>A	uc011cvj.1	+	12	1420	c.1321C>A	c.(1321-1323)CTG>ATG	p.L441M	CAMK4_uc003kpf.2_Missense_Mutation_p.L441M|CAMK4_uc010jbv.2_Missense_Mutation_p.L244M|CAMK4_uc003kpg.2_Missense_Mutation_p.L132M	NM_001744	NP_001735	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	441					activation of phospholipase C activity|nerve growth factor receptor signaling pathway|synaptic transmission	cytosol|nucleoplasm	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(3)|lung(2)	5		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGAGGAGAAGCTGAAGACTGT	0.537													31	10	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127670448	127670448	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127670448C>G	uc003kuu.2	-	31	4501	c.4062G>C	c.(4060-4062)CTG>CTC	p.L1354L	FBN2_uc003kuv.2_Silent_p.L1321L	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	1354	EGF-like 21; calcium-binding.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTGAGTAACCCAGCTGACAGT	0.408													72	19	---	---	---	---	PASS
ADAMTS19	171019	broad.mit.edu	37	5	128957936	128957936	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128957936C>T	uc003kvb.1	+	10	1647	c.1647C>T	c.(1645-1647)GTC>GTT	p.V549V	ADAMTS19_uc010jdh.1_RNA	NM_133638	NP_598377	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1	549	Disintegrin.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(5)|breast(2)|lung(1)|skin(1)	9		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CGCAGAGTGTCAATTCTGTGA	0.433													18	39	---	---	---	---	PASS
SKP1	6500	broad.mit.edu	37	5	133496743	133496743	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133496743C>T	uc003kzc.3	-	4	429	c.250G>A	c.(250-252)GAT>AAT	p.D84N	SKP1_uc003kzd.3_Missense_Mutation_p.D84N|SKP1_uc010jdv.2_Missense_Mutation_p.D84N	NM_170679	NP_733779	P63208	SKP1_HUMAN	S-phase kinase-associated protein 1 isoform b	84					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|G1/S transition of mitotic cell cycle|histone H2A monoubiquitination|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|viral reproduction	cytosol|nucleoplasm|SCF ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			ACAGGGATATCATCTGTTCGC	0.413													17	30	---	---	---	---	PASS
CAMLG	819	broad.mit.edu	37	5	134086614	134086614	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134086614G>C	uc003kzt.2	+	4	970	c.865G>C	c.(865-867)GAT>CAT	p.D289H	CAMLG_uc003kzu.2_3'UTR	NM_001745	NP_001736	P49069	CAMLG_HUMAN	calcium modulating ligand	289	Cytoplasmic (Potential).				defense response	endoplasmic reticulum|integral to membrane					0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Cyclosporine(DB00091)	TGAACTGCTTGATTATTGGGG	0.368													36	14	---	---	---	---	PASS
CXXC5	51523	broad.mit.edu	37	5	139060756	139060756	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139060756C>T	uc010jfg.1	+	2	938	c.648C>T	c.(646-648)ATC>ATT	p.I216I	CXXC5_uc003let.2_Silent_p.I216I	NM_016463	NP_057547	Q7LFL8	CXXC5_HUMAN	CXXC finger 5	216					positive regulation of I-kappaB kinase/NF-kappaB cascade	cytoplasm|nucleus	DNA binding|signal transducer activity|zinc ion binding			central_nervous_system(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTCCCCATCAACCCAGGCC	0.657													10	31	---	---	---	---	PASS
ANKHD1-EIF4EBP3	404734	broad.mit.edu	37	5	139905841	139905841	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139905841G>T	uc003lfs.1	+	26	4877	c.4753G>T	c.(4753-4755)GGT>TGT	p.G1585C	ANKHD1_uc003lfr.2_Missense_Mutation_p.G1585C|ANKHD1_uc003lfu.1_Missense_Mutation_p.G1065C|ANKHD1-EIF4EBP3_uc011czh.1_Missense_Mutation_p.G324C|ANKHD1_uc003lfw.2_Missense_Mutation_p.G223C|ANKHD1_uc010jfl.2_Missense_Mutation_p.G20C|ANKHD1-EIF4EBP3_uc003lfx.1_5'Flank	NM_020690	NP_065741	Q8IWZ2	Q8IWZ2_HUMAN	ANKHD1-EIF4EBP3 protein	1585						cytoplasm|nucleus	RNA binding			ovary(6)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACCTAGAGGTGGTGGTGCAGG	0.398													40	103	---	---	---	---	PASS
PCDHGA2	56113	broad.mit.edu	37	5	140719400	140719400	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140719400A>T	uc003ljk.1	+	1	1047	c.862A>T	c.(862-864)ACC>TCC	p.T288S	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc011dao.1_Missense_Mutation_p.T288S	NM_018915	NP_061738	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2 isoform 1	288	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCTGGAGAAACCTCAGAGGT	0.448													11	149	---	---	---	---	PASS
PTTG1	9232	broad.mit.edu	37	5	159855639	159855639	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159855639C>T	uc003lyj.2	+	6	605	c.560C>T	c.(559-561)TCG>TTG	p.S187L	PTTG1_uc003lyk.2_Missense_Mutation_p.S187L	NM_004219	NP_004210	O95997	PTTG1_HUMAN	pituitary tumor-transforming protein 1	187					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|chromosome organization|chromosome segregation|DNA repair|mitosis|spermatogenesis|transcription from RNA polymerase II promoter	cytosol|nucleus	cysteine-type endopeptidase inhibitor activity|sequence-specific DNA binding transcription factor activity|SH3 domain binding				0	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.00219)|Epithelial(171;0.00348)|all cancers(165;0.0104)		AGCATTCTGTCGACCCTGGAT	0.348													112	58	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178634588	178634588	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178634588C>A	uc003mjw.2	-	4	817	c.817G>T	c.(817-819)GGC>TGC	p.G273C	ADAMTS2_uc011dgm.1_Missense_Mutation_p.G273C	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	273	Peptidase M12B.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TCATCCACGCCCAGCAGGACC	0.627													73	41	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178634589	178634589	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178634589C>A	uc003mjw.2	-	4	816	c.816G>T	c.(814-816)CTG>CTT	p.L272L	ADAMTS2_uc011dgm.1_Silent_p.L272L	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	272	Peptidase M12B.				collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CATCCACGCCCAGCAGGACCT	0.622													74	40	---	---	---	---	PASS
CNOT6	57472	broad.mit.edu	37	5	180001041	180001041	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180001041C>A	uc003mlx.2	+	12	1864	c.1515C>A	c.(1513-1515)ATC>ATA	p.I505I	CNOT6_uc010jld.2_Silent_p.I505I|CNOT6_uc010jle.2_Silent_p.I500I	NM_015455	NP_056270	Q9ULM6	CNOT6_HUMAN	CCR4-NOT transcription complex, subunit 6	505					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	exonuclease activity|metal ion binding|protein binding|RNA binding				0	all_cancers(89;3.3e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00543)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	OV - Ovarian serous cystadenocarcinoma(192;0.023)		CCTTAGGCATCCTGGGCCCTC	0.463													13	76	---	---	---	---	PASS
FOXF2	2295	broad.mit.edu	37	6	1390512	1390512	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:1390512C>T	uc003mtm.2	+	1	444	c.330C>T	c.(328-330)GTC>GTT	p.V110V	FOXF2_uc003mtn.2_Silent_p.V110V	NM_001452	NP_001443	Q12947	FOXF2_HUMAN	forkhead box F2	110	Fork-head.				epithelial to mesenchymal transition|genitalia development|palate development|pattern specification process|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding				0	Ovarian(93;0.0733)	all_lung(73;0.0713)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.095)		CGCTCATCGTCATGGCCATCC	0.552													8	15	---	---	---	---	PASS
JARID2	3720	broad.mit.edu	37	6	15501270	15501270	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15501270G>A	uc003nbj.2	+	8	2322	c.2078G>A	c.(2077-2079)CGG>CAG	p.R693Q	JARID2_uc011div.1_Missense_Mutation_p.R521Q|JARID2_uc011diw.1_Missense_Mutation_p.R655Q	NM_004973	NP_004964	Q92833	JARD2_HUMAN	jumonji, AT rich interactive domain 2 protein	693	ARID.				central nervous system development|chromatin modification|negative regulation of histone methylation|positive regulation of histone H3-K9 methylation|stem cell differentiation|transcription, DNA-dependent		chromatin binding			ovary(2)|lung(1)|pancreas(1)	4	Breast(50;0.0142)|Ovarian(93;0.103)	all_hematologic(90;0.00612)				GCCCAGGACCGGCTGGCCAAG	0.587													29	72	---	---	---	---	PASS
BTN2A2	10385	broad.mit.edu	37	6	26393175	26393175	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26393175G>T	uc003nhq.2	+	8	1638	c.1552G>T	c.(1552-1554)GGG>TGG	p.G518W	BTN2A2_uc011dkg.1_3'UTR|BTN2A2_uc003nhr.2_Missense_Mutation_p.G402W|BTN2A2_uc011dkh.1_Missense_Mutation_p.G308W|BTN2A2_uc003nhs.2_Intron|BTN2A2_uc003nht.2_Missense_Mutation_p.G518W|BTN2A2_uc011dki.1_3'UTR	NM_006995	NP_008926	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2 isoform a	518	Cytoplasmic (Potential).				negative regulation of activated T cell proliferation|negative regulation of cellular metabolic process|negative regulation of cytokine secretion	integral to membrane					0						TCACAGAGTGGGGACCCACCA	0.557													7	52	---	---	---	---	PASS
ZNF192	7745	broad.mit.edu	37	6	28121755	28121755	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28121755G>C	uc003nkn.1	+	6	1881	c.1697G>C	c.(1696-1698)AGA>ACA	p.R566T	ZNF192_uc010jqx.1_Missense_Mutation_p.R566T|ZNF192_uc010jqy.1_Missense_Mutation_p.R379T|ZNF192_uc011dkz.1_Missense_Mutation_p.R379T	NM_006298	NP_006289	Q15776	ZN192_HUMAN	zinc finger protein 192	566	C2H2-type 9.				viral reproduction	cytoplasm|nucleolus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CGACATCAGAGAATCCACAGT	0.428													4	92	---	---	---	---	PASS
ZKSCAN3	80317	broad.mit.edu	37	6	28333415	28333415	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28333415G>A	uc003nle.3	+	6	1186	c.970G>A	c.(970-972)GCT>ACT	p.A324T	ZKSCAN3_uc010jrc.2_Missense_Mutation_p.A324T|ZKSCAN3_uc003nlf.3_Missense_Mutation_p.A176T|uc010jrd.2_5'Flank	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3	324	C2H2-type 1.				positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AAAGAGTTTTGCTCAAAGCTC	0.507													28	21	---	---	---	---	PASS
MDC1	9656	broad.mit.edu	37	6	30672362	30672362	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30672362G>T	uc003nrg.3	-	10	5038	c.4598C>A	c.(4597-4599)GCA>GAA	p.A1533E	MDC1_uc003nrf.3_Intron|MDC1_uc011dmp.1_Missense_Mutation_p.A1140E	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1533	Interaction with the PRKDC complex.			A -> T (in Ref. 4; BAC54931/BAF31266).	cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						CTCAGGGGCTGCGGGCACAAC	0.592								Other_conserved_DNA_damage_response_genes					5	230	---	---	---	---	PASS
ZBTB12	221527	broad.mit.edu	37	6	31868521	31868521	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31868521C>T	uc003nyd.1	-	2	738	c.562G>A	c.(562-564)GAA>AAA	p.E188K	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_5'Flank	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	188					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCCAAGTCTTCATCCAGTGGG	0.622													12	40	---	---	---	---	PASS
ZBTB12	221527	broad.mit.edu	37	6	31868998	31868998	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31868998C>T	uc003nyd.1	-	2	261	c.85G>A	c.(85-87)GAG>AAG	p.E29K	C2_uc003nyc.2_Intron|C2_uc011doo.1_Intron|C2_uc011dop.1_Intron	NM_181842	NP_862825	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	29					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						AACCGCTCCTCTGCCCGGAGC	0.652													12	32	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33132203	33132203	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33132203G>A	uc003ocx.1	-	65	5139	c.4911C>T	c.(4909-4911)CTC>CTT	p.L1637L	COL11A2_uc010jul.1_Silent_p.L207L|COL11A2_uc003ocy.1_Silent_p.L1551L|COL11A2_uc003ocz.1_Silent_p.L1530L	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	1637	Fibrillar collagen NC1.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						GCAGGAAGGTGAGCTGGACCA	0.652													3	10	---	---	---	---	PASS
UHRF1BP1	54887	broad.mit.edu	37	6	34826439	34826439	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34826439C>T	uc003oju.3	+	14	2540	c.2306C>T	c.(2305-2307)TCT>TTT	p.S769F	UHRF1BP1_uc010jvm.1_RNA|UHRF1BP1_uc010jvn.2_RNA|UHRF1BP1_uc010jvo.2_RNA	NM_017754	NP_060224	Q6BDS2	URFB1_HUMAN	ICBP90 binding protein 1	769										ovary(3)	3						GCCCCTGACTCTATGTCCCAT	0.502													6	89	---	---	---	---	PASS
PI16	221476	broad.mit.edu	37	6	36929668	36929668	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36929668C>A	uc003ona.2	+	4	838	c.510C>A	c.(508-510)AAC>AAA	p.N170K	PI16_uc003omz.1_Missense_Mutation_p.N170K|PI16_uc003onb.2_Missense_Mutation_p.N170K|PI16_uc011dts.1_5'UTR	NM_153370	NP_699201	Q6UXB8	PI16_HUMAN	protease inhibitor 16 precursor	170	Extracellular (Potential).					extracellular region|integral to membrane	peptidase inhibitor activity				0						GTAGGGGGAACGTGAAGGGGA	0.612													36	43	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43163986	43163986	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43163986G>A	uc003ouk.2	+	10	2643	c.2568G>A	c.(2566-2568)CTG>CTA	p.L856L	CUL9_uc003oul.2_Silent_p.L856L|CUL9_uc010jyk.2_5'UTR	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	856					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						CCGTGATCCTGATGCTGAATA	0.577													6	63	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56438586	56438586	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56438586C>T	uc003pdf.2	-	45	6798	c.6770G>A	c.(6769-6771)GGC>GAC	p.G2257D	DST_uc003pcz.3_Missense_Mutation_p.G2079D|DST_uc011dxj.1_Missense_Mutation_p.G2108D|DST_uc011dxk.1_Missense_Mutation_p.G2119D|DST_uc003pcy.3_Missense_Mutation_p.G1753D|DST_uc010kaa.1_RNA	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	4165					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCATCCAAGCCATCCTGCAC	0.423													32	67	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69758235	69758235	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69758235C>G	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				AGGTAAATATCTGAAATAATA	0.328													10	43	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76580394	76580394	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76580394C>T	uc003pih.1	+	19	2254	c.1975C>T	c.(1975-1977)CGA>TGA	p.R659*	MYO6_uc003pig.1_Nonsense_Mutation_p.R659*|MYO6_uc003pii.1_Nonsense_Mutation_p.R659*	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	659	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		GGATAAACTTCGAAGTACTGT	0.308													10	33	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76782212	76782212	+	5'UTR	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76782212T>C	uc003pik.1	-	1						NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1						visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ACATTCTGGCTTTTGTGCATT	0.284													5	40	---	---	---	---	PASS
SNAP91	9892	broad.mit.edu	37	6	84371269	84371269	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84371269G>T	uc011dze.1	-	5	721	c.404C>A	c.(403-405)GCT>GAT	p.A135D	SNAP91_uc003pkb.2_Missense_Mutation_p.A100D|SNAP91_uc003pkc.2_Missense_Mutation_p.A135D|SNAP91_uc003pkd.2_Missense_Mutation_p.A135D|SNAP91_uc003pka.2_Missense_Mutation_p.A135D|SNAP91_uc011dzf.1_Missense_Mutation_p.A16D	NM_014841	NP_055656	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa homolog	135	ENTH.				clathrin coat assembly	clathrin coat|coated pit|plasma membrane	1-phosphatidylinositol binding|clathrin binding			ovary(1)	1		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GTAAGAAAAAGCCTTTTCATT	0.333													14	30	---	---	---	---	PASS
CASP8AP2	9994	broad.mit.edu	37	6	90581069	90581069	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90581069G>C	uc003pnr.2	+	9	6050	c.5854G>C	c.(5854-5856)GCA>CCA	p.A1952P	CASP8AP2_uc003pns.2_Missense_Mutation_p.A160P|CASP8AP2_uc003pnt.2_Missense_Mutation_p.A1952P|CASP8AP2_uc011dzz.1_Missense_Mutation_p.A1952P	NM_001137667	NP_001131139	Q9UKL3	C8AP2_HUMAN	caspase 8 associated protein 2	1952	NCOA2-binding.				cell cycle|cellular response to mechanical stimulus|induction of apoptosis via death domain receptors|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	cytoplasm|nucleus	caspase activator activity|death receptor binding|transcription corepressor activity			ovary(2)	2		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		TAAAACATTTGCATATTTAGC	0.338													37	40	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123319198	123319198	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123319198C>A	uc003pzi.1	+	2	1145	c.276C>A	c.(274-276)ACC>ACA	p.T92T		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	92					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						TTAAGGCCACCGACCCTGGCA	0.542													52	75	---	---	---	---	PASS
PTPRK	5796	broad.mit.edu	37	6	128411138	128411138	+	Splice_Site	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128411138C>T	uc003qbk.2	-	8	1530	c.1163_splice	c.e8-1	p.E388_splice	PTPRK_uc003qbj.2_Splice_Site_p.E388_splice|PTPRK_uc010kfc.2_Splice_Site_p.E388_splice|PTPRK_uc011ebu.1_Splice_Site_p.E388_splice|PTPRK_uc003qbl.1_Splice_Site_p.E258_splice|PTPRK_uc011ebv.1_Splice_Site_p.E388_splice	NM_002844	NP_002835	Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K						cell migration|cellular response to reactive oxygen species|cellular response to UV|focal adhesion assembly|negative regulation of cell cycle|negative regulation of cell migration|negative regulation of keratinocyte proliferation|negative regulation of transcription, DNA-dependent|protein localization at cell surface|transforming growth factor beta receptor signaling pathway	adherens junction|cell surface|cell-cell junction|integral to plasma membrane|leading edge membrane	beta-catenin binding|gamma-catenin binding|protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|skin(2)|pancreas(1)|kidney(1)|central_nervous_system(1)	8				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTCATAGGTTCTGAAAAATAA	0.363													12	65	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135516964	135516964	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135516964G>T	uc003qfc.2	+	9	1226	c.1027G>T	c.(1027-1029)GCA>TCA	p.A343S	MYB_uc003qfh.2_Missense_Mutation_p.A343S|MYB_uc003qfi.2_Missense_Mutation_p.A343S|MYB_uc010kgi.2_Missense_Mutation_p.A343S|MYB_uc003qfq.2_Missense_Mutation_p.A340S|MYB_uc010kgj.2_Missense_Mutation_p.A308S|MYB_uc003qfo.2_Intron|MYB_uc003qfu.2_Missense_Mutation_p.A340S|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_Intron|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_5'UTR|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Missense_Mutation_p.A155S|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.A343S|MYB_uc003qge.1_RNA	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	343	Negative regulatory domain (By similarity).				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		TGGAGACAGTGCACCTGTTTC	0.577			T	NFIB	adenoid cystic carcinoma								35	57	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146625764	146625764	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146625764G>A	uc010khw.1	+	4	1438	c.968G>A	c.(967-969)AGA>AAA	p.R323K	GRM1_uc010khv.1_Missense_Mutation_p.R323K|GRM1_uc003qll.2_Missense_Mutation_p.R323K|GRM1_uc011edz.1_Missense_Mutation_p.R323K|GRM1_uc011eea.1_Missense_Mutation_p.R323K	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	323	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	TGGGCAGACAGAGATGAAGTC	0.428													7	15	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146720267	146720267	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146720267C>A	uc010khw.1	+	8	2562	c.2092C>A	c.(2092-2094)CCC>ACC	p.P698T	GRM1_uc010khv.1_Missense_Mutation_p.P698T|GRM1_uc003qll.2_Missense_Mutation_p.P698T|GRM1_uc011edz.1_Missense_Mutation_p.P698T|GRM1_uc011eea.1_Missense_Mutation_p.P698T	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	698	Cytoplasmic (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CACCCGGAAGCCCAGGTTCAT	0.512													45	104	---	---	---	---	PASS
STXBP5	134957	broad.mit.edu	37	6	147680256	147680256	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147680256C>T	uc003qlz.2	+	23	2503	c.2342C>T	c.(2341-2343)TCA>TTA	p.S781L	STXBP5_uc010khz.1_Missense_Mutation_p.S745L|STXBP5_uc003qlx.2_RNA|STXBP5_uc003qly.2_Missense_Mutation_p.S436L	NM_001127715	NP_001121187	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn) isoform b	781					exocytosis|positive regulation of exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|nicotinic acetylcholine-gated receptor-channel complex|synaptic vesicle	syntaxin-1 binding				0		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		TCACGGAGTTCAAGTGTAACA	0.398													14	36	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152763307	152763307	+	Missense_Mutation	SNP	C	T	T	rs141164314		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152763307C>T	uc010kiw.2	-	31	4513	c.3911G>A	c.(3910-3912)GGG>GAG	p.G1304E	SYNE1_uc003qot.3_Missense_Mutation_p.G1311E|SYNE1_uc003qou.3_Missense_Mutation_p.G1304E|SYNE1_uc010kjb.1_Missense_Mutation_p.G1287E|SYNE1_uc003qow.2_Missense_Mutation_p.G599E|SYNE1_uc003qox.1_Missense_Mutation_p.G820E	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1304	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGCAGCCCCCCTTCTCCCTG	0.592										HNSCC(10;0.0054)			38	83	---	---	---	---	PASS
NOX3	50508	broad.mit.edu	37	6	155728279	155728279	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155728279G>T	uc003qqm.2	-	12	1668	c.1565C>A	c.(1564-1566)GCC>GAC	p.A522D		NM_015718	NP_056533	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	522	Cytoplasmic (Potential).						electron carrier activity|flavin adenine dinucleotide binding|iron ion binding			ovary(1)	1		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GTGATTGTAGGCAATCTGCTT	0.483													31	47	---	---	---	---	PASS
ZDHHC14	79683	broad.mit.edu	37	6	158014099	158014099	+	Silent	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158014099G>T	uc003qqt.2	+	3	983	c.486G>T	c.(484-486)GTG>GTT	p.V162V	ZDHHC14_uc003qqs.2_Silent_p.V162V|ZDHHC14_uc010kjm.1_Silent_p.V57V	NM_024630	NP_078906	Q8IZN3	ZDH14_HUMAN	zinc finger, DHHC-type containing 14 isoform 1	162						integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|skin(1)	2		Breast(66;0.00586)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;2.9e-17)|BRCA - Breast invasive adenocarcinoma(81;5.8e-05)		GCCAGACCGTGAAACTTAAAT	0.532													54	75	---	---	---	---	PASS
MAS1	4142	broad.mit.edu	37	6	160328118	160328118	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160328118C>A	uc003qsz.2	+	1	145	c.131C>A	c.(130-132)CCA>CAA	p.P44Q		NM_002377	NP_002368	P04201	MAS_HUMAN	MAS1 oncogene	44	Helical; Name=1; (Potential).				anatomical structure morphogenesis|cell proliferation|protein kinase C signaling cascade	integral to plasma membrane	angiotensin type II receptor activity			ovary(2)|lung(2)	4		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		AGCATCTCCCCAGTGGGGTTT	0.527													68	94	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2962953	2962953	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2962953G>A	uc003smv.2	-	16	2359	c.1955C>T	c.(1954-1956)TCG>TTG	p.S652L		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	652					positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		AGAGGTGACCGAAGGCCGGAA	0.652			Mis		DLBCL								16	102	---	---	---	---	PASS
PAPOLB	56903	broad.mit.edu	37	7	4900561	4900561	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4900561C>T	uc003snk.2	-	1	1065	c.881G>A	c.(880-882)CGG>CAG	p.R294Q	RADIL_uc003sng.1_Intron|RADIL_uc011jwd.1_Intron|RADIL_uc003snj.1_Intron	NM_020144	NP_064529	Q9NRJ5	PAPOB_HUMAN	poly(A) polymerase beta (testis specific)	293					mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)	1		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.089)|OV - Ovarian serous cystadenocarcinoma(56;2.06e-14)		ATTAAGATTCCGTTCTTCAGG	0.443													10	153	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11445965	11445965	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11445965T>C	uc003ssf.3	-	21	4451	c.4199A>G	c.(4198-4200)AAT>AGT	p.N1400S		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1400	TSP type-1 14.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CAGAACCATATTTTTATTACC	0.418										HNSCC(18;0.044)			29	129	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11501683	11501683	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11501683T>C	uc003ssf.3	-	10	2708	c.2456A>G	c.(2455-2457)TAT>TGT	p.Y819C		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	819	TSP type-1 8.|Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		CTTCTCTTCATAGAGGGGATC	0.542										HNSCC(18;0.044)			96	169	---	---	---	---	PASS
TMEM195	392636	broad.mit.edu	37	7	15240918	15240918	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15240918A>T	uc003stb.1	-	13	1500	c.1330T>A	c.(1330-1332)TGG>AGG	p.W444R		NM_001004320	NP_001004320	Q6ZNB7	ALKMO_HUMAN	transmembrane protein 195	444					ether lipid metabolic process|fatty acid biosynthetic process|membrane lipid metabolic process	endoplasmic reticulum membrane|integral to membrane	glyceryl-ether monooxygenase activity|iron ion binding				0						GGTTATTTCCAAGGGTGAGAG	0.303													23	50	---	---	---	---	PASS
NUPL2	11097	broad.mit.edu	37	7	23226676	23226676	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23226676G>A	uc003svu.2	+	3	615	c.356G>A	c.(355-357)GGA>GAA	p.G119E	NUPL2_uc003svv.2_RNA|NUPL2_uc003svw.2_5'UTR|NUPL2_uc011jyw.1_RNA|NUPL2_uc003svx.2_5'UTR	NM_007342	NP_031368	O15504	NUPL2_HUMAN	nucleoporin like 2	119	Interaction with HIV-1 Vpr.				carbohydrate metabolic process|glucose transport|mRNA transport|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear membrane|nuclear pore	nuclear export signal receptor activity|nucleic acid binding|zinc ion binding			skin(2)|ovary(1)	3						TGCAGGGAAGGAATTGTAAAA	0.308													40	54	---	---	---	---	PASS
HOXA7	3204	broad.mit.edu	37	7	27195942	27195942	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27195942C>T	uc003sys.2	-	1	355	c.223G>A	c.(223-225)GAC>AAC	p.D75N		NM_006896	NP_008827	P31268	HXA7_HUMAN	homeobox A7	75				DA -> RR (in Ref. 8; AAD00727).	angiogenesis|negative regulation of cell-matrix adhesion|negative regulation of keratinocyte differentiation|negative regulation of leukocyte migration|negative regulation of monocyte differentiation|negative regulation of transcription from RNA polymerase II promoter		sequence-specific DNA binding|transcription factor binding				0						CCGTAGGCGTCGGCGCCCAGG	0.677													36	45	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31793022	31793022	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31793022G>A	uc003tcm.1	-	18	2575	c.2106C>T	c.(2104-2106)ATC>ATT	p.I702I	PDE1C_uc003tcn.1_Silent_p.I702I|PDE1C_uc003tco.1_Silent_p.I762I	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C	702					activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			AGTTATGTGAGATGTTCTGAA	0.473													48	397	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33573664	33573664	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33573664G>A	uc003tdn.1	+	21	2910	c.2397G>A	c.(2395-2397)CTG>CTA	p.L799L	BBS9_uc003tdo.1_Silent_p.L764L|BBS9_uc003tdp.1_Silent_p.L794L|BBS9_uc003tdq.1_Silent_p.L759L|BBS9_uc010kwn.1_RNA|BBS9_uc003tdr.1_Silent_p.L323L|BBS9_uc003tds.1_Silent_p.L222L|BBS9_uc003tdt.2_RNA	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	799					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			ACAGCCAGCTGAACATACCCA	0.507									Bardet-Biedl_syndrome				36	129	---	---	---	---	PASS
GCK	2645	broad.mit.edu	37	7	44192988	44192988	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44192988C>T	uc003tkl.2	-	2	590	c.120G>A	c.(118-120)GAG>GAA	p.E40E	GCK_uc003tkj.1_Silent_p.E39E|GCK_uc003tkk.1_Silent_p.E41E	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	40					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						CGCGGTCCATCTCCTTCTGCA	0.607													13	306	---	---	---	---	PASS
GCK	2645	broad.mit.edu	37	7	44193044	44193044	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44193044C>G	uc003tkl.2	-	2	534	c.64G>C	c.(64-66)GAG>CAG	p.E22Q	GCK_uc003tkj.1_Missense_Mutation_p.E21Q|GCK_uc003tkk.1_Missense_Mutation_p.E23Q	NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	22					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						AGCTGGAACTCTGCCAGGATC	0.637													9	267	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57194296	57194296	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57194296C>T	uc010kzo.2	-							NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			AAGTTATCCTCACCCAGGGAG	0.368													5	154	---	---	---	---	PASS
CCDC146	57639	broad.mit.edu	37	7	76797022	76797022	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:76797022G>C	uc003uga.2	+	2	164	c.37G>C	c.(37-39)GAA>CAA	p.E13Q	CCDC146_uc003ufz.1_Missense_Mutation_p.E13Q	NM_020879	NP_065930	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	13	Poly-Glu.									ovary(1)|central_nervous_system(1)	2		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				AAAAGAAGAGGAAGAGGAGAA	0.358													11	44	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83032100	83032100	+	Intron	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83032100A>G	uc003uhy.1	-							NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor						axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				TTACTGAAAAATACAAAAAAG	0.398													13	25	---	---	---	---	PASS
ABCB4	5244	broad.mit.edu	37	7	87049377	87049377	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87049377C>T	uc003uiv.1	-	19	2407	c.2331G>A	c.(2329-2331)GGG>GGA	p.G777G	ABCB4_uc003uiw.1_Silent_p.G777G|ABCB4_uc003uix.1_Silent_p.G777G	NM_018849	NP_061337	P21439	MDR3_HUMAN	ATP-binding cassette, subfamily B, member 4	777	ABC transmembrane type-1 2.|Cytoplasmic (By similarity).				cellular lipid metabolic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|xenobiotic-transporting ATPase activity			ovary(4)|skin(1)|pancreas(1)	6	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)					CGCCAGCTTTCCCAAACGTGA	0.358													24	111	---	---	---	---	PASS
CLDN12	9069	broad.mit.edu	37	7	90042641	90042641	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90042641G>T	uc003ukp.2	+	5	1287	c.651G>T	c.(649-651)ATG>ATT	p.M217I	CLDN12_uc003ukq.2_Missense_Mutation_p.M217I|CLDN12_uc010leq.2_Missense_Mutation_p.M217I|CLDN12_uc003ukr.2_Missense_Mutation_p.M217I|CLDN12_uc003uks.2_Missense_Mutation_p.M217I	NM_012129	NP_036261	P56749	CLD12_HUMAN	claudin 12	217	Cytoplasmic (Potential).				calcium-independent cell-cell adhesion|tight junction assembly	integral to membrane|tight junction	identical protein binding|structural molecule activity				0						CACCCAGTATGCATACTTACT	0.418													16	291	---	---	---	---	PASS
CASD1	64921	broad.mit.edu	37	7	94174881	94174881	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94174881G>T	uc003uni.3	+	12	1728	c.1501G>T	c.(1501-1503)GTA>TTA	p.V501L	CASD1_uc003unj.3_Missense_Mutation_p.V501L	NM_022900	NP_075051	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1 precursor	501	Helical; (Potential).					integral to membrane				ovary(2)	2	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CAATTTCCTGGTAGTGGTGTT	0.353													41	78	---	---	---	---	PASS
GNB2	2783	broad.mit.edu	37	7	100275765	100275765	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100275765C>T	uc003uwb.2	+	8	815	c.542C>T	c.(541-543)GCT>GTT	p.A181V	GNB2_uc003uwc.2_Missense_Mutation_p.A137V|GNB2_uc010lhd.2_Missense_Mutation_p.A137V|GNB2_uc010lhe.2_Missense_Mutation_p.A137V|GNB2_uc003uwd.2_Missense_Mutation_p.A81V|GNB2_uc010lhf.2_Missense_Mutation_p.A81V|GNB2_uc003uwe.2_Missense_Mutation_p.A181V|GNB2_uc003uwf.2_Missense_Mutation_p.A81V	NM_005273	NP_005264	P62879	GBB2_HUMAN	guanine nucleotide-binding protein, beta-2	181					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	perinuclear region of cytoplasm|plasma membrane	GTPase activity|GTPase binding|signal transducer activity			ovary(2)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				GTGGGTTTTGCTGGACACAGT	0.577													57	78	---	---	---	---	PASS
CUX1	1523	broad.mit.edu	37	7	101840185	101840185	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101840185G>T	uc003uyx.3	+	15	1532	c.1494G>T	c.(1492-1494)CAG>CAT	p.Q498H	CUX1_uc003uys.3_Missense_Mutation_p.Q509H|CUX1_uc003uyt.2_Intron|CUX1_uc011kkn.1_Intron|CUX1_uc003uyw.2_Intron|CUX1_uc003uyv.2_Intron|CUX1_uc003uyu.2_Intron	NM_181552	NP_853530	P39880	CUX1_HUMAN	cut-like homeobox 1 isoform a	498					negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(5)|pancreas(1)|central_nervous_system(1)|skin(1)	8						AGGCTATGCAGGAAGCCGGAA	0.483													51	58	---	---	---	---	PASS
SLC26A5	375611	broad.mit.edu	37	7	103050851	103050851	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103050851C>A	uc003vbz.2	-	7	952	c.716G>T	c.(715-717)GGA>GTA	p.G239V	SLC26A5_uc003vbt.1_Missense_Mutation_p.G239V|SLC26A5_uc003vbu.1_Missense_Mutation_p.G239V|SLC26A5_uc003vbv.1_Missense_Mutation_p.G239V|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.G239V|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	239	Extracellular (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						GGAAAAGATTCCACTGTACCG	0.433													24	62	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107820820	107820820	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107820820C>T	uc003vfb.2	-	25	3169	c.2698G>A	c.(2698-2700)GAG>AAG	p.E900K	NRCAM_uc003vfc.2_Missense_Mutation_p.E884K|NRCAM_uc011kmk.1_Missense_Mutation_p.E895K|NRCAM_uc003vfd.2_Missense_Mutation_p.E876K|NRCAM_uc003vfe.2_Missense_Mutation_p.E876K	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A	900	Fibronectin type-III 3.|Extracellular (Potential).				angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						ATCTTTTTCTCAATGTGACGT	0.458													25	52	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107822254	107822254	+	Intron	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107822254C>A	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						CAAAAGGTCCCCTTTCACTTG	0.493													20	28	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119914873	119914873	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119914873C>A	uc003vjj.1	+	1	1152	c.187C>A	c.(187-189)CCA>ACA	p.P63T		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	63	Cytoplasmic (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GGAACGTTACCCAGACACTCT	0.542													103	163	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142008789	142008789	+	Intron	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142008789C>A	uc011kro.1	+						uc011krp.1_RNA|uc003vxf.3_Missense_Mutation_p.P88T					SubName: Full=V_segment translation product; Flags: Fragment;																		ACCTAAATCTCCAGACAAAGC	0.398													39	91	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149476004	149476004	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149476004G>T	uc010lpk.2	+	7	970	c.970G>T	c.(970-972)GGG>TGG	p.G324W	SSPO_uc010lpl.1_5'UTR	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	324	VWFD 1.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			AGGCCTCTGTGGGCTCTACAA	0.627													12	111	---	---	---	---	PASS
DLC1	10395	broad.mit.edu	37	8	13251104	13251104	+	Silent	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:13251104A>C	uc003wwm.2	-	4	1716	c.1272T>G	c.(1270-1272)TCT>TCG	p.S424S	DLC1_uc003wwn.2_Silent_p.S424S|DLC1_uc011kxy.1_Silent_p.S424S	NM_182643	NP_872584	Q96QB1	RHG07_HUMAN	deleted in liver cancer 1 isoform 1	424					actin cytoskeleton organization|activation of caspase activity|focal adhesion assembly|forebrain development|heart morphogenesis|hindbrain morphogenesis|induction of apoptosis|negative regulation of cell migration|negative regulation of cell proliferation|negative regulation of Rho protein signal transduction|negative regulation of stress fiber assembly|neural tube closure|positive regulation of protein dephosphorylation|regulation of cell shape|small GTPase mediated signal transduction	caveola|cytosol|focal adhesion|nucleus	Rho GTPase activator activity|SH2 domain binding			ovary(3)|pancreas(2)|lung(1)|kidney(1)	7						CTGGAGTGGAAGATGGGAGGT	0.428													55	28	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505506	32505506	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505506C>G	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Silent_p.L90L|NRG1_uc010lvt.2_Silent_p.L90L	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		GCCTCTGCCTCTGCATCGCCG	0.542													31	54	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41547872	41547872	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41547872C>G	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CACCTAAACTCAATCACACAA	0.557													19	223	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59720307	59720307	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59720307C>T	uc003xtw.1	-	9	1801	c.1580G>A	c.(1579-1581)TGA>TAA	p.*527*		NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX	527						nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TTCAGATTCTCAAGTAAGGTA	0.438											OREG0018787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	47	---	---	---	---	PASS
PREX2	80243	broad.mit.edu	37	8	69020434	69020434	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:69020434A>G	uc003xxv.1	+	24	2833	c.2806A>G	c.(2806-2808)ACC>GCC	p.T936A	PREX2_uc011lez.1_Missense_Mutation_p.T871A	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a	936					G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						TTTCTGCCCTACCAACTGCCA	0.428													31	43	---	---	---	---	PASS
TPD52	7163	broad.mit.edu	37	8	80992640	80992640	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:80992640C>T	uc003ybr.1	-	1	371	c.49G>A	c.(49-51)GAT>AAT	p.D17N	TPD52_uc010lzr.2_RNA|TPD52_uc010lzs.1_Intron|TPD52_uc003ybs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025252	NP_001020423	P55327	TPD52_HUMAN	tumor protein D52 isoform 1	17					anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			GCATCAAAATCAAACGGGGAC	0.433													27	48	---	---	---	---	PASS
RSPO2	340419	broad.mit.edu	37	8	108913390	108913390	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108913390C>G	uc003yms.2	-	6	1303	c.645G>C	c.(643-645)AAG>AAC	p.K215N	RSPO2_uc003ymq.2_Missense_Mutation_p.K148N|RSPO2_uc003ymr.2_Missense_Mutation_p.K151N	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor	215					Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			tcttgttcctcttctccttcg	0.338													16	47	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110100362	110100362	+	Silent	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110100362T>A	uc003ymz.3	+	1	637	c.621T>A	c.(619-621)GCT>GCA	p.A207A		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	207	Helical; Name=5; (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			TGATCCTGGCTACCGTCCTCT	0.388													37	62	---	---	---	---	PASS
PKHD1L1	93035	broad.mit.edu	37	8	110406702	110406702	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110406702C>T	uc003yne.2	+	10	903	c.799C>T	c.(799-801)CAA>TAA	p.Q267*		NM_177531	NP_803875	Q86WI1	PKHL1_HUMAN	fibrocystin L precursor	267	Extracellular (Potential).				immune response	cytosol|extracellular space|integral to membrane	receptor activity			ovary(9)|central_nervous_system(2)|large_intestine(1)|breast(1)|pancreas(1)	14			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGCAATGTTTCAAACATATGC	0.284										HNSCC(38;0.096)			3	6	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113694723	113694723	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113694723A>T	uc003ynu.2	-	16	2784	c.2625T>A	c.(2623-2625)TGT>TGA	p.C875*	CSMD3_uc003yns.2_Nonsense_Mutation_p.C147*|CSMD3_uc003ynt.2_Nonsense_Mutation_p.C835*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.C771*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	875	Sushi 4.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CCATAAGAATACATGTAATTG	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			56	91	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131795975	131795975	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131795975A>G	uc003ytd.3	-	17	3486	c.3230T>C	c.(3229-3231)ATC>ACC	p.I1077T	ADCY8_uc010mds.2_Missense_Mutation_p.I946T	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1077	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			ATGCTTGTTGATCTCCTGTAT	0.498										HNSCC(32;0.087)			24	38	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143955898	143955898	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143955898A>T	uc003yxi.2	-	9	1410	c.1403T>A	c.(1402-1404)CTG>CAG	p.L468Q	CYP11B1_uc010mex.2_Missense_Mutation_p.L167Q|CYP11B1_uc003yxh.2_Missense_Mutation_p.L118Q|CYP11B1_uc003yxj.2_Missense_Mutation_p.L402Q|CYP11B1_uc010mey.2_Missense_Mutation_p.L539Q	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	468					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GAGGTGTTTCAGCACCTAGGA	0.537									Familial_Hyperaldosteronism_type_I		OREG0005640	type=TRANSCRIPTION FACTOR BINDING SITE|Gene=CYP11B1|TFbs=REST|Dataset=NRSF/REST ChIPSeq sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)	23	57	---	---	---	---	PASS
DGAT1	8694	broad.mit.edu	37	8	145541059	145541059	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145541059G>T	uc003zbv.3	-	13	1299	c.1031C>A	c.(1030-1032)TCC>TAC	p.S344Y	DGAT1_uc010mfv.2_Intron	NM_012079	NP_036211	O75907	DGAT1_HUMAN	diacylglycerol O-acyltransferase 1	344	Lumenal (Potential).				triglyceride biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane	diacylglycerol O-acyltransferase activity				0	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.94e-40)|Epithelial(56;7.67e-40)|all cancers(56;7.88e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0441)|Colorectal(110;0.055)			ATTCAGGCAGGAGTGGAAGAG	0.607													17	84	---	---	---	---	PASS
KIAA1432	57589	broad.mit.edu	37	9	5765672	5765672	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5765672C>G	uc003zji.2	+	20	2867	c.2774C>G	c.(2773-2775)TCA>TGA	p.S925*	KIAA1432_uc003zjh.2_Nonsense_Mutation_p.S925*|KIAA1432_uc003zjl.3_Nonsense_Mutation_p.S888*|KIAA1432_uc003zjj.1_Nonsense_Mutation_p.S467*|ERMP1_uc011lme.1_RNA	NM_020829	NP_065880	Q4ADV7	RIC1_HUMAN	connexin 43-interacting protein 150 isoform a	1004						integral to membrane					0		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		GAACCCAGTTCAAGTGGTGGA	0.413													161	78	---	---	---	---	PASS
IFNA8	3445	broad.mit.edu	37	9	21409512	21409512	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21409512G>C	uc003zpc.1	+	1	367	c.337G>C	c.(337-339)GAC>CAC	p.D113H		NM_002170	NP_002161	P32881	IFNA8_HUMAN	interferon, alpha 8 precursor	113					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding				0				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0174)		CATCGAACTTGACCAGCAGCT	0.502													32	62	---	---	---	---	PASS
CBWD6	644019	broad.mit.edu	37	9	69238300	69238300	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69238300C>G	uc004afj.3	-	8	698	c.592G>C	c.(592-594)GAT>CAT	p.D198H	CBWD6_uc004afk.3_Intron|CBWD6_uc011lrf.1_Intron	NM_001085457	NP_001078926	Q4V339	CBWD6_HUMAN	COBW domain containing 6	198							ATP binding				0						AGAATGATATCTGCCAAAGCA	0.303													12	192	---	---	---	---	PASS
BICD2	23299	broad.mit.edu	37	9	95491487	95491487	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95491487T>A	uc004aso.1	-	2	329	c.272A>T	c.(271-273)AAG>ATG	p.K91M	BICD2_uc004asp.1_Missense_Mutation_p.K91M	NM_015250	NP_056065	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 isoform 2	91	Potential.				microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1						AGCAGCCACCTTCTTGTGGTT	0.602													14	57	---	---	---	---	PASS
CTSL2	1515	broad.mit.edu	37	9	99799688	99799688	+	Intron	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99799688G>C	uc004awt.2	-						CTSL2_uc010msi.2_Intron|CTSL2_uc004awu.2_Intron|CTSL2_uc010msj.1_Intron|CTSL2_uc010msk.2_Intron	NM_001333	NP_001324	O60911	CATL2_HUMAN	cathepsin L2 preproprotein							lysosome	cysteine-type endopeptidase activity				0		Acute lymphoblastic leukemia(62;0.0559)				GGTCTTCAAGGAGAAGTAAAT	0.418													33	95	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101748070	101748070	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101748070C>A	uc004azb.1	+	3	530	c.324C>A	c.(322-324)TTC>TTA	p.F108L	COL15A1_uc004aza.2_Missense_Mutation_p.F108L	NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	108	TSP N-terminal.				angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				GCGTGCTCTTCGCCATCACTG	0.627													4	80	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104309471	104309471	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104309471G>A	uc004bbn.2	+	8	1037	c.947G>A	c.(946-948)GGC>GAC	p.G316D		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	316	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		CTGTATGGCGGCACAATCACT	0.428													5	119	---	---	---	---	PASS
OR13C4	138804	broad.mit.edu	37	9	107289089	107289089	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107289089G>A	uc011lvn.1	-	1	402	c.402C>T	c.(400-402)ATC>ATT	p.I134I		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	134	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGTTCATGATGATGGGGTATC	0.453													27	128	---	---	---	---	PASS
SLC44A1	23446	broad.mit.edu	37	9	108145413	108145413	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108145413G>T	uc004bcn.2	+	14	1863	c.1642G>T	c.(1642-1644)GTC>TTC	p.V548F	SLC44A1_uc010mtk.1_Missense_Mutation_p.V548F|SLC44A1_uc004bco.1_Missense_Mutation_p.V340F	NM_080546	NP_536856	Q8WWI5	CTL1_HUMAN	CDW92 antigen	548	Helical; (Potential).					integral to membrane|mitochondrial outer membrane|plasma membrane	choline transmembrane transporter activity			breast(3)|ovary(1)	4					Choline(DB00122)	GGTGCTGATAGTCTGCAGCAC	0.423													44	154	---	---	---	---	PASS
RXRA	6256	broad.mit.edu	37	9	137300036	137300036	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137300036C>T	uc004cfb.2	+	3	483	c.321C>T	c.(319-321)ATC>ATT	p.I107I	RXRA_uc004cfc.1_Silent_p.I10I	NM_002957	NP_002948	P19793	RXRA_HUMAN	retinoid X receptor, alpha	107	Modulating (By similarity).				cellular lipid metabolic process|cholesterol metabolic process|interspecies interaction between organisms|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid|vitamin metabolic process	nuclear chromatin|nucleoplasm	enzyme binding|ligand-regulated transcription factor activity|protein heterodimerization activity|retinoic acid-responsive element binding|retinoid-X receptor activity|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|transcription coactivator activity|vitamin D receptor binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(145;4.66e-08)|Epithelial(140;6.72e-08)|all cancers(34;2.22e-07)	Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)	GCGAGGACATCAAGCCCCCCC	0.637													11	22	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139390779	139390779	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139390779G>T	uc004chz.2	-	34	7412	c.7412C>A	c.(7411-7413)TCG>TAG	p.S2471*		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	2471	Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.L2473fs*1(1)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		TGGGACCAGCGAGGATGGCAG	0.697			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			3	6	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139390786	139390786	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139390786G>A	uc004chz.2	-	34	7405	c.7405C>T	c.(7405-7407)CCA>TCA	p.P2469S		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	2469	Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity	p.L2469fs*10(2)|p.L2469fs*11(1)		haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		AGCGAGGATGGCAGCGACGTG	0.697			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			3	7	---	---	---	---	PASS
NRARP	441478	broad.mit.edu	37	9	140196134	140196134	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140196134C>T	uc004cmo.2	-	1	570	c.247G>A	c.(247-249)GAC>AAC	p.D83N	C9orf167_uc011mew.1_Intron	NM_001004354	NP_001004354	Q7Z6K4	NRARP_HUMAN	NOTCH-regulated ankyrin repeat protein	83	ANK 2.				negative regulation of Notch signaling pathway|positive regulation of canonical Wnt receptor signaling pathway						0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.185)	OV - Ovarian serous cystadenocarcinoma(145;9.07e-05)|Epithelial(140;0.000273)		CTCCAGCCGTCGCGGTTGGCC	0.672													11	16	---	---	---	---	PASS
NRARP	441478	broad.mit.edu	37	9	140196233	140196233	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140196233C>A	uc004cmo.2	-	1	471	c.148G>T	c.(148-150)GAG>TAG	p.E50*	C9orf167_uc011mew.1_Intron	NM_001004354	NP_001004354	Q7Z6K4	NRARP_HUMAN	NOTCH-regulated ankyrin repeat protein	50	ANK 1.				negative regulation of Notch signaling pathway|positive regulation of canonical Wnt receptor signaling pathway						0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.185)	OV - Ovarian serous cystadenocarcinoma(145;9.07e-05)|Epithelial(140;0.000273)		GTCTGGCCCTCGGGCCCGAAC	0.637													17	39	---	---	---	---	PASS
GAD2	2572	broad.mit.edu	37	10	26508134	26508134	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26508134C>A	uc001isp.2	+	4	952	c.449C>A	c.(448-450)GCA>GAA	p.A150E	GAD2_uc009xkr.2_Missense_Mutation_p.A150E|GAD2_uc001isq.2_Missense_Mutation_p.A150E	NM_001134366	NP_001127838	Q05329	DCE2_HUMAN	glutamate decarboxylase 2	150					glutamate decarboxylation to succinate|neurotransmitter biosynthetic process|neurotransmitter secretion	cell junction|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|cytosol|Golgi membrane|presynaptic membrane	glutamate decarboxylase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Glutamic Acid(DB00142)	TGGGAATTGGCAGACCAACCA	0.328													40	99	---	---	---	---	PASS
GPRIN2	9721	broad.mit.edu	37	10	46999535	46999535	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46999535G>A	uc001jec.2	+	3	790	c.655G>A	c.(655-657)GAA>AAA	p.E219K	GPRIN2_uc010qfq.1_5'Flank	NM_014696	NP_055511	O60269	GRIN2_HUMAN	G protein-regulated inducer of neurite outgrowth	219											0						CAAAGCTGCTGAACAGCTGGC	0.637													6	56	---	---	---	---	PASS
JMJD1C	221037	broad.mit.edu	37	10	64967446	64967446	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:64967446C>T	uc001jmn.2	-	10	4283	c.3983G>A	c.(3982-3984)CGA>CAA	p.R1328Q	JMJD1C_uc001jml.2_Missense_Mutation_p.R1109Q|JMJD1C_uc001jmm.2_Missense_Mutation_p.R1040H|JMJD1C_uc010qiq.1_Missense_Mutation_p.R1146H|JMJD1C_uc009xpi.2_Missense_Mutation_p.R1146H|JMJD1C_uc009xpj.1_RNA|JMJD1C_uc009xpk.1_Missense_Mutation_p.R365H	NM_032776	NP_116165	Q15652	JHD2C_HUMAN	jumonji domain containing 1C isoform a	1328					blood coagulation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleoplasm	histone demethylase activity (H3-K9 specific)|metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|thyroid hormone receptor binding			ovary(4)|breast(1)|central_nervous_system(1)	6	Prostate(12;0.0119)|all_hematologic(501;0.191)					TTCACTAACACGATCTTTAGA	0.423													45	128	---	---	---	---	PASS
TET1	80312	broad.mit.edu	37	10	70426800	70426800	+	Splice_Site	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70426800A>C	uc001jok.3	+	7	4967	c.4462_splice	c.e7-2	p.V1488_splice		NM_030625	NP_085128	Q8NFU7	TET1_HUMAN	CXXC finger 6						DNA demethylation|inner cell mass cell differentiation|negative regulation of methylation-dependent chromatin silencing|stem cell maintenance		iron ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|structure-specific DNA binding|zinc ion binding			ovary(5)|lung(2)|prostate(1)|breast(1)	9						CTGTTTTTTCAGGTTTTAAGA	0.373													11	17	---	---	---	---	PASS
TACR2	6865	broad.mit.edu	37	10	71168822	71168822	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71168822G>A	uc001jpn.2	-	3	1192	c.597C>T	c.(595-597)CTC>CTT	p.L199L	TACR2_uc001jpm.2_5'UTR	NM_001057	NP_001048	P21452	NK2R_HUMAN	tachykinin receptor 2	199	Helical; Name=5; (Potential).				excretion|muscle contraction	integral to plasma membrane	tachykinin receptor activity			prostate(1)	1					Clonidine(DB00575)|Octreotide(DB00104)	CGATCACCACGAGGTGGTACC	0.687													3	14	---	---	---	---	PASS
SGPL1	8879	broad.mit.edu	37	10	72628097	72628097	+	Intron	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72628097T>A	uc001jrm.2	+						SGPL1_uc009xqk.2_5'Flank	NM_003901	NP_003892	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1						apoptosis|carboxylic acid metabolic process|ceramide metabolic process|sphingolipid catabolic process	integral to endoplasmic reticulum membrane	carboxy-lyase activity|pyridoxal phosphate binding|sphinganine-1-phosphate aldolase activity				0					Pyridoxal Phosphate(DB00114)	TCTTCTTTATTATAGGTGACT	0.458													35	104	---	---	---	---	PASS
KCNMA1	3778	broad.mit.edu	37	10	78844400	78844400	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78844400G>C	uc001jxn.2	-	12	1695	c.1518C>G	c.(1516-1518)ATC>ATG	p.I506M	KCNMA1_uc001jxj.2_Missense_Mutation_p.I506M|KCNMA1_uc001jxk.1_Missense_Mutation_p.I121M|KCNMA1_uc009xrt.1_Missense_Mutation_p.I326M|KCNMA1_uc001jxl.1_Missense_Mutation_p.I160M|KCNMA1_uc001jxo.2_Missense_Mutation_p.I506M|KCNMA1_uc001jxm.2_Missense_Mutation_p.I506M|KCNMA1_uc001jxq.2_Missense_Mutation_p.I506M	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium	506	RCK N-terminal.|Cytoplasmic (Potential).				cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	GTTACCTCATGATATTCGAGG	0.537													7	50	---	---	---	---	PASS
PAX2	5076	broad.mit.edu	37	10	102506039	102506039	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102506039G>C	uc001krk.3	+	1	572	c.22G>C	c.(22-24)GAC>CAC	p.D8H	PAX2_uc001krl.3_Missense_Mutation_p.D8H|PAX2_uc001krm.3_Missense_Mutation_p.D8H|PAX2_uc001kro.3_Missense_Mutation_p.D8H|PAX2_uc001krn.3_Missense_Mutation_p.D8H|PAX2_uc010qps.1_Missense_Mutation_p.D8H|PAX2_uc001krp.1_5'Flank	NM_003990	NP_003981	Q02962	PAX2_HUMAN	paired box protein 2 isoform e	8					anti-apoptosis|axonogenesis|brain morphogenesis|branching involved in ureteric bud morphogenesis|cell fate determination|cellular response to glucose stimulus|cellular response to hydrogen peroxide|cellular response to retinoic acid|cochlea development|glial cell differentiation|inner ear morphogenesis|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesodermal cell fate specification|mesonephros development|metanephric collecting duct development|metanephric distal convoluted tubule development|metanephric mesenchymal cell differentiation|metanephric nephron tubule formation|negative regulation of caspase activity|negative regulation of cytolysis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|negative regulation of reactive oxygen species metabolic process|negative regulation of transcription, DNA-dependent|nephric duct formation|neural tube closure|optic chiasma development|optic cup morphogenesis involved in camera-type eye development|optic nerve structural organization|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of epithelial cell proliferation|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of metanephric glomerulus development|positive regulation of optic nerve formation|positive regulation of transcription from RNA polymerase II promoter|pronephric field specification|protein kinase B signaling cascade|reactive oxygen species metabolic process|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of metanephros size|retinal pigment epithelium development|stem cell differentiation|transcription from RNA polymerase II promoter|ureter maturation|vestibulocochlear nerve formation|visual perception	centriolar satellite|nucleus|protein complex|protein-DNA complex	core promoter proximal region sequence-specific DNA binding|superoxide-generating NADPH oxidase activity				0		Colorectal(252;0.234)		Epithelial(162;1.32e-08)|all cancers(201;7.32e-07)		CTGCAAAGCAGACCCCTTCTC	0.682													7	241	---	---	---	---	PASS
POLL	27343	broad.mit.edu	37	10	103344610	103344610	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103344610G>A	uc001ktg.1	-	4	1406	c.640C>T	c.(640-642)CTC>TTC	p.L214F	DPCD_uc010qpz.1_Intron|POLL_uc001ktd.1_5'Flank|POLL_uc001kte.1_5'Flank|POLL_uc001kth.1_Intron|POLL_uc001kti.1_Missense_Mutation_p.L214F|POLL_uc001ktj.1_Missense_Mutation_p.L214F|POLL_uc001ktf.2_Intron|POLL_uc001ktk.1_Intron|POLL_uc010qqa.1_Intron|POLL_uc010qqb.1_Intron|POLL_uc001ktm.2_Missense_Mutation_p.L214F|POLL_uc001ktl.2_Missense_Mutation_p.L126F|POLL_uc010qqc.1_Intron|POLL_uc010qqd.1_Silent_p.P71P	NM_013274	NP_037406	Q9UGP5	DPOLL_HUMAN	DNA-directed DNA polymerase lambda	214					DNA replication|nucleotide-excision repair|somatic hypermutation of immunoglobulin genes	nucleus	DNA binding|DNA-directed DNA polymerase activity|lyase activity|metal ion binding				0		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		CCACTGATGAGGGCTTCCAGA	0.527								DNA_polymerases_(catalytic_subunits)					20	19	---	---	---	---	PASS
NOLC1	9221	broad.mit.edu	37	10	103919289	103919289	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103919289G>C	uc001kuo.2	+	7	1058	c.823G>C	c.(823-825)GAA>CAA	p.E275Q	NOLC1_uc001kup.2_Missense_Mutation_p.E285Q|NOLC1_uc001kuq.2_Missense_Mutation_p.E276Q|NOLC1_uc009xxb.1_5'UTR|NOLC1_uc001kur.2_5'UTR	NM_004741	NP_004732	Q14978	NOLC1_HUMAN	nucleolar and coiled-body phosphoprotein 1	275	Acidic serine cluster 5.|11 X 12 AA approximate repeats of an acidic serine cluster.|Interacts with RPA194.				mitosis|rRNA processing	cytoplasm|nucleolus	ATP binding|GTP binding|protein binding			ovary(1)	1		Colorectal(252;0.122)		Epithelial(162;5.19e-08)|all cancers(201;9.43e-07)		CAGTGACGAGGAAGAGGAGCA	0.358													24	39	---	---	---	---	PASS
SORCS3	22986	broad.mit.edu	37	10	107022168	107022168	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107022168G>A	uc001kyi.1	+	26	3750	c.3523G>A	c.(3523-3525)GAA>AAA	p.E1175K		NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor	1175	Cytoplasmic (Potential).					integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GAGCCAAAGTGAAAACGCCCC	0.507													12	49	---	---	---	---	PASS
SMC3	9126	broad.mit.edu	37	10	112344088	112344088	+	Silent	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112344088T>C	uc001kze.2	+	13	1365	c.1239T>C	c.(1237-1239)ATT>ATC	p.I413I		NM_005445	NP_005436	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	413	Potential.				cell division|DNA mediated transformation|DNA repair|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|mitotic spindle organization|negative regulation of DNA endoreduplication|signal transduction|sister chromatid cohesion	basement membrane|chromatin|chromosome, centromeric region|cytoplasm|meiotic cohesin complex|nuclear matrix|nucleoplasm|spindle pole	ATP binding|dynein binding|microtubule motor activity|protein heterodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		AAAGACAGATTGCTGCTATAC	0.343													5	90	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135106044	135106044	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135106044C>G	uc001lmg.1	-	8	1530	c.1173G>C	c.(1171-1173)CTG>CTC	p.L391L	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Silent_p.L419L|TUBGCP2_uc009ybk.1_Silent_p.L391L|TUBGCP2_uc010qvd.1_Silent_p.L261L|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	391					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TCCACTTCTCCAGAACCTCGA	0.458													10	42	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1213233	1213233	+	Intron	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1213233A>G	uc009ycr.1	+						uc001lsz.2_RNA	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;						cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCACTCCCAACCAGTCACCA	0.572													50	121	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080688	5080688	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080688A>G	uc010qyw.1	-	1	170	c.170T>C	c.(169-171)CTA>CCA	p.L57P		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		GGGCTGGTGTAGGCTGCTGTC	0.488													18	38	---	---	---	---	PASS
CNGA4	1262	broad.mit.edu	37	11	6265537	6265537	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6265537C>T	uc001mco.2	+	6	1733	c.1626C>T	c.(1624-1626)CCC>CCT	p.P542P	CNGA4_uc010raa.1_3'UTR|CNGA4_uc001mcn.2_3'UTR	NM_001037329	NP_001032406	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	542	Cytoplasmic (Potential).				response to stimulus|sensory perception of smell		cAMP binding			skin(1)	1		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGCCAATGCCCGAGGACCTGG	0.607													14	36	---	---	---	---	PASS
TPP1	1200	broad.mit.edu	37	11	6640152	6640152	+	Intron	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6640152G>C	uc001mel.1	-						TPP1_uc001mek.1_Intron|TPP1_uc010rar.1_Intron	NM_000391	NP_000382	O14773	TPP1_HUMAN	tripeptidyl-peptidase I preproprotein						bone resorption|cell death|lipid metabolic process|lysosome organization|nervous system development|neuromuscular process controlling balance|peptide catabolic process|protein catabolic process|proteolysis	lysosome|melanosome|soluble fraction	metal ion binding|peptide binding|protein binding|serine-type endopeptidase activity|tripeptidyl-peptidase activity				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;3.45e-09)|BRCA - Breast invasive adenocarcinoma(625;0.131)		GCAGCCTGTAGGGTCAGGGGT	0.567													39	72	---	---	---	---	PASS
CYB5R2	51700	broad.mit.edu	37	11	7689735	7689735	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7689735T>A	uc001mfm.2	-	6	684	c.446A>T	c.(445-447)CAC>CTC	p.H149L	CYB5R2_uc001mfn.2_RNA|CYB5R2_uc009yfk.2_Missense_Mutation_p.H149L|CYB5R2_uc009yfl.1_3'UTR	NM_016229	NP_057313	Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase b5R.2	149	FAD (By similarity).				sterol biosynthetic process	membrane|soluble fraction	cytochrome-b5 reductase activity				0				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CATTCCCAGGTGATCGGCCAG	0.517													96	154	---	---	---	---	PASS
CYB5R2	51700	broad.mit.edu	37	11	7689738	7689738	+	Missense_Mutation	SNP	T	A	A	rs142026127	byFrequency	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7689738T>A	uc001mfm.2	-	6	681	c.443A>T	c.(442-444)GAT>GTT	p.D148V	CYB5R2_uc001mfn.2_RNA|CYB5R2_uc009yfk.2_Missense_Mutation_p.D148V|CYB5R2_uc009yfl.1_3'UTR	NM_016229	NP_057313	Q6BCY4	NB5R2_HUMAN	cytochrome b5 reductase b5R.2	148	FAD (By similarity).				sterol biosynthetic process	membrane|soluble fraction	cytochrome-b5 reductase activity				0				Epithelial(150;5.48e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCCCAGGTGATCGGCCAGTGT	0.507													93	158	---	---	---	---	PASS
ABTB2	25841	broad.mit.edu	37	11	34180853	34180853	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34180853T>C	uc001mvl.1	-	14	2359	c.2129A>G	c.(2128-2130)CAC>CGC	p.H710R		NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing	710							DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				CTGAAAAATGTGGTACTTCAT	0.522													8	39	---	---	---	---	PASS
ABTB2	25841	broad.mit.edu	37	11	34226167	34226167	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34226167A>C	uc001mvl.1	-	2	626	c.396T>G	c.(394-396)GAT>GAG	p.D132E		NM_145804	NP_665803	Q8N961	ABTB2_HUMAN	ankyrin repeat and BTB (POZ) domain containing	132							DNA binding			central_nervous_system(1)|skin(1)	2		Acute lymphoblastic leukemia(5;0.0508)|all_hematologic(20;0.0691)				GGGCATAGGCATCGGCTCGCT	0.632													16	17	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136744	40136744	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136744C>T	uc001mxa.1	-	2	3063	c.1099G>A	c.(1099-1101)GAA>AAA	p.E367K	LRRC4C_uc001mxc.1_Missense_Mutation_p.E363K|LRRC4C_uc001mxd.1_Missense_Mutation_p.E363K|LRRC4C_uc001mxb.1_Missense_Mutation_p.E363K	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	367	Ig-like C2-type.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GCCATGCCTTCAGTGACATTG	0.507													22	110	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904510	55904510	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904510G>T	uc010riz.1	-	1	685	c.685C>A	c.(685-687)CGT>AGT	p.R229S		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	229	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					TCTGGTGAACGTATCCTTAGA	0.363													5	98	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944867	55944867	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944867C>A	uc010rjb.1	+	1	774	c.774C>A	c.(772-774)AGC>AGA	p.S258R		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					TAATCTTTAGCTACATTCAGC	0.453													25	148	---	---	---	---	PASS
SLC43A1	8501	broad.mit.edu	37	11	57256868	57256868	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57256868G>A	uc001nkk.2	-						SLC43A1_uc001nkl.2_Intron	NM_003627	NP_003618	O75387	LAT3_HUMAN	solute carrier family 43, member 1						cellular nitrogen compound metabolic process|ion transport	integral to plasma membrane	neutral amino acid transmembrane transporter activity				0						CCCCGTCCCTGAGGAGTACGG	0.582													44	131	---	---	---	---	PASS
MS4A2	2206	broad.mit.edu	37	11	59857928	59857928	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59857928C>A	uc001nop.2	+	3	408	c.306C>A	c.(304-306)TTC>TTA	p.F102L	MS4A2_uc009ymu.2_Missense_Mutation_p.F102L	NM_000139	NP_000130	Q01362	FCERB_HUMAN	membrane-spanning 4-domains, subfamily A, member	102	Helical; (Potential).				cell proliferation|humoral immune response	integral to plasma membrane	calcium channel activity			ovary(1)	1		all_epithelial(135;0.245)			Omalizumab(DB00043)	GTTATCCATTCTGGGGAGCCA	0.343													5	213	---	---	---	---	PASS
CD6	923	broad.mit.edu	37	11	60785236	60785236	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60785236G>C	uc001nqq.2	+	11	1811	c.1588G>C	c.(1588-1590)GAA>CAA	p.E530Q	CD6_uc001nqp.2_Missense_Mutation_p.E530Q|CD6_uc001nqr.2_Missense_Mutation_p.E498Q|CD6_uc001nqs.2_RNA|CD6_uc001nqt.2_Missense_Mutation_p.E489Q	NM_006725	NP_006716	P30203	CD6_HUMAN	CD6 molecule precursor	530	Cytoplasmic (Potential).				cell adhesion	cell surface|integral to plasma membrane	scavenger receptor activity			pancreas(1)	1						CTTAGGACTTGAAGAGTTGCA	0.398													18	108	---	---	---	---	PASS
FERMT3	83706	broad.mit.edu	37	11	63978285	63978285	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63978285C>G	uc001nyl.2	+	3	512	c.363C>G	c.(361-363)TTC>TTG	p.F121L	FERMT3_uc001nym.2_Missense_Mutation_p.F121L	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	121					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						AGCCCCTCTTCCAGGCTGTGG	0.667													49	176	---	---	---	---	PASS
CDCA5	113130	broad.mit.edu	37	11	64851098	64851098	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64851098C>T	uc001ocp.2	-						ZFPL1_uc009yqa.2_5'Flank|ZFPL1_uc001ocq.1_5'Flank|ZFPL1_uc010rnx.1_5'Flank	NM_080668	NP_542399	Q96FF9	CDCA5_HUMAN	cell division cycle associated 5						cell division|double-strand break repair|G1/S transition of mitotic cell cycle|mitotic chromosome condensation|mitotic metaphase plate congression|mitotic sister chromatid cohesion|regulation of cohesin localization to chromatin	cytoplasm|nuclear chromatin|plasma membrane	chromatin binding|identical protein binding				0						ATCTGGGGCTCACCTTCGGCC	0.587													30	33	---	---	---	---	PASS
KCNK7	10089	broad.mit.edu	37	11	65360824	65360824	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65360824C>T	uc001oes.2	-						KCNK7_uc001oeq.2_Nonsense_Mutation_p.W250*|KCNK7_uc001oer.2_Nonsense_Mutation_p.W250*|KCNK7_uc001oeu.2_3'UTR	NM_033347	NP_203133	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7 isoform							integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						CTACCCCTCCCACGCCGTGCC	0.652													39	64	---	---	---	---	PASS
ARAP1	116985	broad.mit.edu	37	11	72470437	72470437	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72470437G>A	uc001osv.2	-						STARD10_uc001osy.2_Intron|STARD10_uc001osz.3_Intron|STARD10_uc001ota.2_Intron|STARD10_uc001otb.2_Intron	NM_001040118	NP_001035207	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						actin filament reorganization involved in cell cycle|negative regulation of stress fiber assembly|positive regulation of Cdc42 GTPase activity|positive regulation of filopodium assembly|regulation of ARF GTPase activity|regulation of cell shape|regulation of cellular component movement|small GTPase mediated signal transduction	cytosol|Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|protein binding|Rho GTPase activator activity|zinc ion binding			skin(1)	1						CTGCAGACAAGATATATGGGT	0.547													4	123	---	---	---	---	PASS
PGM2L1	283209	broad.mit.edu	37	11	74057825	74057825	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74057825G>A	uc001ovb.1	-	8	1285	c.989C>T	c.(988-990)GCC>GTC	p.A330V		NM_173582	NP_775853	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	330					glucose 1-phosphate metabolic process	cytosol	glucose-1,6-bisphosphate synthase activity|phosphoglucomutase activity			ovary(1)	1	Breast(11;3.32e-06)					AGGATCTGTGGCTAGCACTAC	0.418													7	343	---	---	---	---	PASS
DDI1	414301	broad.mit.edu	37	11	103908395	103908395	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:103908395T>G	uc001phr.2	+	1	1088	c.845T>G	c.(844-846)GTG>GGG	p.V282G	PDGFD_uc001php.2_Intron|PDGFD_uc001phq.2_Intron	NM_001001711	NP_001001711	Q8WTU0	DDI1_HUMAN	DDI1, DNA-damage inducible 1, homolog 1	282					proteolysis		aspartic-type endopeptidase activity			large_intestine(3)|upper_aerodigestive_tract(1)|pancreas(1)	5		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		ATGAGGCTGGTGGACCGACGG	0.502													61	74	---	---	---	---	PASS
MLL	4297	broad.mit.edu	37	11	118352801	118352801	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118352801G>T	uc001pta.2	+	7	4029	c.4006G>T	c.(4006-4008)GAA>TAA	p.E1336*	MLL_uc001ptb.2_Nonsense_Mutation_p.E1336*|MLL_uc001pte.1_RNA|MLL_uc009zab.1_Missense_Mutation_p.Q61H	NM_005933	NP_005924	Q03164	MLL1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	1336					apoptosis|embryonic hemopoiesis|histone H4-K16 acetylation|positive regulation of transcription, DNA-dependent|protein complex assembly|transcription from RNA polymerase II promoter	MLL1 complex	AT DNA binding|histone acetyl-lysine binding|histone methyltransferase activity (H3-K4 specific)|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|unmethylated CpG binding|zinc ion binding			lung(7)|ovary(5)|kidney(5)|central_nervous_system(3)|pancreas(2)|urinary_tract(1)|breast(1)|skin(1)	25	all_hematologic(175;0.046)	all_hematologic(192;1.13e-50)|all_neural(223;3.18e-06)|Breast(348;1.07e-05)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.244)		OV - Ovarian serous cystadenocarcinoma(223;2.77e-44)|BRCA - Breast invasive adenocarcinoma(274;1.2e-11)|Lung(307;3.48e-06)|LUSC - Lung squamous cell carcinoma(976;7.92e-05)|Colorectal(284;0.144)		TCCACCACCAGAATCAGGTGA	0.478			T|O	MLL|MLLT1|MLLT2|MLLT3|MLLT4|MLLT7|MLLT10|MLLT6|ELL|EPS15|AF1Q|CREBBP|SH3GL1|FNBP1|PNUTL1|MSF|GPHN|GMPS|SSH3BP1|ARHGEF12|GAS7|FOXO3A|LAF4|LCX|SEPT6|LPP|CBFA2T1|GRAF|EP300|PICALM|HEAB	AML|ALL								14	19	---	---	---	---	PASS
ARHGAP32	9743	broad.mit.edu	37	11	128840352	128840352	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128840352C>T	uc009zcp.2	-	22	4714	c.4714G>A	c.(4714-4716)GAA>AAA	p.E1572K	ARHGAP32_uc009zcq.1_3'UTR|ARHGAP32_uc009zco.2_Missense_Mutation_p.E531K|ARHGAP32_uc001qez.2_Missense_Mutation_p.E1223K	NM_001142685	NP_001136157	A7KAX9	RHG32_HUMAN	Rho GTPase-activating protein isoform 1	1572	Interaction with GAB2.				cell communication|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cell cortex|cell junction|cytosol|dendritic spine|endoplasmic reticulum membrane|endosome membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	GTPase activator activity|phosphatidylinositol binding			lung(3)|ovary(2)	5						GGAATGTCTTCGGGGTAACAG	0.552													15	65	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4920213	4920213	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920213A>C	uc001qng.2	+	1	1872	c.1006A>C	c.(1006-1008)ATG>CTG	p.M336L		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	336						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						GCAGCAGGCCATGTCCCTGGC	0.632										HNSCC(72;0.22)			19	51	---	---	---	---	PASS
GDF3	9573	broad.mit.edu	37	12	7842861	7842861	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7842861C>T	uc001qte.2	-	2	744	c.708G>A	c.(706-708)GTG>GTA	p.V236V		NM_020634	NP_065685	Q9NR23	GDF3_HUMAN	growth differentiation factor 3 precursor	236					eye development|growth|skeletal system development	extracellular space	cytokine activity|growth factor activity			skin(3)|ovary(1)|lung(1)|central_nervous_system(1)	6						GGTTGAGAGTCACCACCAGCA	0.517													4	97	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174550	11174550	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174550C>A	uc010shj.1	-	1	621	c.621G>T	c.(619-621)AAG>AAT	p.K207N	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	207	Cytoplasmic (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						GCCGCATCTTCTTGAGATGTT	0.403													10	219	---	---	---	---	PASS
TAS2R19	259294	broad.mit.edu	37	12	11174583	11174583	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11174583C>T	uc010shj.1	-	1	588	c.588G>A	c.(586-588)CTG>CTA	p.L196L	PRR4_uc009zhp.2_Intron|PRH1_uc001qzb.3_Intron|PRH1_uc001qzc.2_Intron|PRB4_uc001qzf.1_Intron|PRH1_uc001qzj.2_Intron	NM_176888	NP_795369	P59542	T2R19_HUMAN	taste receptor, type 2, member 19	196	Helical; Name=5; (Potential).				sensory perception of taste	integral to membrane	G-protein coupled receptor activity			skin(1)	1						AGATTAACAGCAGAAAACATA	0.398													7	211	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22061137	22061137	+	Missense_Mutation	SNP	C	A	A	rs151197166		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22061137C>A	uc001rfi.1	-	9	1349	c.1329G>T	c.(1327-1329)ATG>ATT	p.M443I	ABCC9_uc001rfh.2_Missense_Mutation_p.M443I|ABCC9_uc001rfj.1_Missense_Mutation_p.M443I	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	443	ABC transmembrane type-1 1.|Helical; Name=8; (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	GAATCACGCCCATTATGATCT	0.393													19	33	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23699316	23699316	+	Nonsense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23699316T>A	uc001rfw.2	-	12	1633	c.1531A>T	c.(1531-1533)AAA>TAA	p.K511*	SOX5_uc001rfx.2_Nonsense_Mutation_p.K498*|SOX5_uc001rfy.2_Nonsense_Mutation_p.K390*|SOX5_uc001rfv.2_Nonsense_Mutation_p.K125*|SOX5_uc010siv.1_Nonsense_Mutation_p.K498*|SOX5_uc010siw.1_Intron|SOX5_uc001rfz.1_Nonsense_Mutation_p.K463*	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	511	Potential.				transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						TCATTCTGTTTAACTGCCAGT	0.313													83	112	---	---	---	---	PASS
C12orf35	55196	broad.mit.edu	37	12	32135892	32135892	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32135892G>T	uc001rks.2	+	4	2417	c.2003G>T	c.(2002-2004)TGT>TTT	p.C668F		NM_018169	NP_060639	Q9HCM1	CL035_HUMAN	hypothetical protein LOC55196	668										ovary(1)|skin(1)	2	all_cancers(9;3.36e-11)|all_epithelial(9;2.56e-11)|all_lung(12;5.67e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0114)			GACAGTAGCTGTTCCATGGAA	0.423													23	28	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40657693	40657693	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40657693C>A	uc001rmg.3	+	14	1767	c.1646C>A	c.(1645-1647)GCT>GAT	p.A549D	LRRK2_uc001rmh.1_Missense_Mutation_p.A171D	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	549					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GTCCTAGCAGCTTTGAACAGG	0.323													23	48	---	---	---	---	PASS
H1FNT	341567	broad.mit.edu	37	12	48723172	48723172	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48723172G>A	uc001rrm.2	+	1	410	c.98G>A	c.(97-99)CGA>CAA	p.R33Q		NM_181788	NP_861453	Q75WM6	H1FNT_HUMAN	H1 histone family, member N, testis-specific	33					chromosome condensation|multicellular organismal development|sperm chromatin condensation|spermatid nucleus elongation	nuclear chromatin	ATP binding|DNA binding			pancreas(1)	1						GGCGAATCCCGAGGACACTCA	0.657													5	28	---	---	---	---	PASS
ZNF385A	25946	broad.mit.edu	37	12	54767862	54767862	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54767862C>G	uc001sfw.1	-	3	439	c.256G>C	c.(256-258)GAG>CAG	p.E86Q	ZNF385A_uc001sfv.1_Missense_Mutation_p.E67Q|ZNF385A_uc009zno.1_RNA|ZNF385A_uc010sov.1_Missense_Mutation_p.E86Q|ZNF385A_uc001sfx.1_Missense_Mutation_p.E86Q|ZNF385A_uc001sfy.3_Missense_Mutation_p.E106Q|ZNF385A_uc001sfz.3_Missense_Mutation_p.E106Q	NM_015481	NP_056296	Q96PM9	Z385A_HUMAN	zinc finger protein 385A isoform c	86					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding|zinc ion binding			ovary(1)	1						TTGGCAGCCTCAATGCCTTTG	0.587													10	53	---	---	---	---	PASS
OR6C1	390321	broad.mit.edu	37	12	55714515	55714515	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55714515C>A	uc010spi.1	+	1	132	c.132C>A	c.(130-132)ATC>ATA	p.I44I		NM_001005182	NP_001005182	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C,	44	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2						TGACCCTTATCACAATTACCC	0.433													50	73	---	---	---	---	PASS
NUP107	57122	broad.mit.edu	37	12	69085841	69085841	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69085841G>C	uc001suf.2	+	5	512	c.397G>C	c.(397-399)GAT>CAT	p.D133H	NUP107_uc001sug.2_Intron|NUP107_uc010stj.1_Missense_Mutation_p.D104H	NM_020401	NP_065134	P57740	NU107_HUMAN	nucleoporin 107kDa	133					carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			skin(1)	1	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TATAACAGAAGATGTAACTAT	0.428													18	85	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72036236	72036236	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72036236T>A	uc001swo.2	-	6	1966	c.1607A>T	c.(1606-1608)GAT>GTT	p.D536V		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	536					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GGTTTCACTATCTGTATCCAT	0.368													22	109	---	---	---	---	PASS
ZFC3H1	196441	broad.mit.edu	37	12	72036237	72036237	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72036237C>A	uc001swo.2	-	6	1965	c.1606G>T	c.(1606-1608)GAT>TAT	p.D536Y		NM_144982	NP_659419	O60293	ZC3H1_HUMAN	proline/serine-rich coiled-coil 2	536					RNA processing	intracellular	metal ion binding			ovary(2)|breast(1)|central_nervous_system(1)|skin(1)	5						GTTTCACTATCTGTATCCATA	0.368													22	109	---	---	---	---	PASS
RAB21	23011	broad.mit.edu	37	12	72149021	72149021	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72149021C>T	uc001swt.2	+	1	364	c.112C>T	c.(112-114)CGC>TGC	p.R38C		NM_014999	NP_055814	Q9UL25	RAB21_HUMAN	RAB21, member RAS oncogene family	38					protein transport|small GTPase mediated signal transduction	cleavage furrow|cytoplasmic vesicle membrane|early endosome membrane|endoplasmic reticulum membrane|Golgi membrane	GDP binding|GTP binding|GTPase activity|protein binding				0						GCTGGTGCTGCGCTACTGCGA	0.557													5	10	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72338186	72338186	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72338186T>C	uc009zrw.1	+	3	509	c.368T>C	c.(367-369)ATT>ACT	p.I123T	TPH2_uc001swy.2_Missense_Mutation_p.I33T	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	123	ACT.				aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	AATGAGCTCATTCAGTTGCTG	0.433													60	97	---	---	---	---	PASS
SYT1	6857	broad.mit.edu	37	12	79685839	79685839	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:79685839G>C	uc001sys.2	+	7	1074	c.403G>C	c.(403-405)GAA>CAA	p.E135Q	SYT1_uc001syt.2_Missense_Mutation_p.E135Q|SYT1_uc001syu.2_Missense_Mutation_p.E132Q|SYT1_uc001syv.2_Missense_Mutation_p.E135Q	NM_001135805	NP_001129277	P21579	SYT1_HUMAN	synaptotagmin I	135	Cytoplasmic (Potential).				detection of calcium ion|glutamate secretion|neurotransmitter secretion|protein homooligomerization	cell junction|chromaffin granule membrane|clathrin sculpted acetylcholine transport vesicle membrane|clathrin sculpted gamma-aminobutyric acid transport vesicle membrane|clathrin sculpted glutamate transport vesicle membrane|clathrin sculpted monoamine transport vesicle membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	1-phosphatidylinositol binding|low-density lipoprotein particle receptor binding|metal ion binding|syntaxin-1 binding|transporter activity			skin(3)|pancreas(2)|ovary(1)	6						AGAAGAAAAAGAAGAACCCAA	0.373													18	71	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85546834	85546834	+	Silent	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85546834A>T	uc001tac.2	+	21	4563	c.4452A>T	c.(4450-4452)TCA>TCT	p.S1484S		NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	1484										ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		ATGATACTTCATTTAATTTAC	0.284													51	89	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88588962	88588962	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88588962G>C	uc001tau.2	+	14	2501	c.2281G>C	c.(2281-2283)GAA>CAA	p.E761Q		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	762	TPR 9.					integral to membrane	binding			skin(1)	1						AAAATGTTTTGAAAGGATTTT	0.333													24	71	---	---	---	---	PASS
TMTC3	160418	broad.mit.edu	37	12	88589107	88589107	+	Missense_Mutation	SNP	G	A	A	rs111307435	byFrequency	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88589107G>A	uc001tau.2	+	14	2646	c.2426G>A	c.(2425-2427)CGC>CAC	p.R809H		NM_181783	NP_861448	Q6ZXV5	TMTC3_HUMAN	transmembrane and tetratricopeptide repeat	810						integral to membrane	binding			skin(1)	1						TATATTCAGCGCCATTTGAAT	0.338													51	82	---	---	---	---	PASS
SLC17A8	246213	broad.mit.edu	37	12	100813710	100813710	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100813710C>G	uc010svi.1	+	12	1856	c.1543C>G	c.(1543-1545)CTC>GTC	p.L515V	SLC17A8_uc009ztx.2_Missense_Mutation_p.L465V	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent	515	Cytoplasmic (Potential).				neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						CCCAGAGAATCTCTCTGAGGA	0.468													12	68	---	---	---	---	PASS
ATP2A2	488	broad.mit.edu	37	12	110783838	110783838	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110783838C>G	uc001tqk.3	+	19	3337	c.2774C>G	c.(2773-2775)CCC>CGC	p.P925R	ATP2A2_uc001tql.3_Missense_Mutation_p.P925R|ATP2A2_uc010sxy.1_Missense_Mutation_p.P898R|ATP2A2_uc001tqn.3_Missense_Mutation_p.P2R|ATP2A2_uc009zvn.2_5'Flank	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform	925	Cytoplasmic (By similarity).				ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						CTGAGGATGCCCCCCTGGGAG	0.577													65	107	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132537712	132537712	+	Silent	SNP	G	A	A	rs141540187	byFrequency	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132537712G>A	uc001ujn.2	+	41	7451	c.7416G>A	c.(7414-7416)CCG>CCA	p.P2472P	EP400_uc001ujl.2_Silent_p.P2471P|EP400_uc001ujm.2_Silent_p.P2391P	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2508					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		ATGACAAGCCGCTGCCTCCCA	0.493													11	122	---	---	---	---	PASS
POLE	5426	broad.mit.edu	37	12	133256810	133256810	+	Splice_Site	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133256810T>A	uc001uks.1	-	4	330	c.286_splice	c.e4-1	p.V96_splice	POLE_uc010tbq.1_Splice_Site|POLE_uc009zyu.1_Splice_Site_p.V69_splice	NM_006231	NP_006222	Q07864	DPOE1_HUMAN	DNA-directed DNA polymerase epsilon						base-excision repair, gap-filling|DNA synthesis involved in DNA repair|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	chromatin binding|DNA binding|DNA-directed DNA polymerase activity|nucleotide binding|protein binding|zinc ion binding			ovary(3)|skin(3)|lung(1)|central_nervous_system(1)	8	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)		CAAAGCCACCTGTTAAGAGTC	0.468								DNA_polymerases_(catalytic_subunits)|Direct_reversal_of_damage					41	64	---	---	---	---	PASS
NUPL1	9818	broad.mit.edu	37	13	25914196	25914196	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25914196C>G	uc001uqi.2	+	16	1970	c.1724C>G	c.(1723-1725)TCT>TGT	p.S575C	NUPL1_uc001uqj.2_Missense_Mutation_p.S563C	NM_014089	NP_054808	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1 isoform a	575	14 X 2 AA repeats of F-G.				carbohydrate metabolic process|glucose transport|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore					0		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		AATCCTGCCTCTGCAGGTTTT	0.458													4	129	---	---	---	---	PASS
GPR183	1880	broad.mit.edu	37	13	99948238	99948238	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99948238G>A	uc001vog.2	-	2	336	c.162C>T	c.(160-162)GTC>GTT	p.V54V	UBAC2_uc001voa.3_Intron|UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_004951	NP_004942	P32249	GP183_HUMAN	EBV-induced G protein-coupled receptor 2	54	Helical; Name=1; (Potential).				humoral immune response|mature B cell differentiation involved in immune response	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled				0						GAACAATGACGACCAAGGCTA	0.438													21	57	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109445971	109445971	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109445971G>A	uc001vqt.1	+	6	784	c.658G>A	c.(658-660)GAT>AAT	p.D220N	MYO16_uc010agk.1_Missense_Mutation_p.D242N|MYO16_uc001vqu.1_Missense_Mutation_p.D20N	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	220					cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGAGAAAAACGATGAAGGAGT	0.338													8	38	---	---	---	---	PASS
TOX4	9878	broad.mit.edu	37	14	21955802	21955802	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21955802C>T	uc001waz.2	+	3	371	c.268C>T	c.(268-270)CAT>TAT	p.H90Y	TOX4_uc001way.2_5'UTR|TOX4_uc001wba.2_RNA|TOX4_uc010tlu.1_Missense_Mutation_p.H67Y|TOX4_uc010tlv.1_Intron	NM_014828	NP_055643	O94842	TOX4_HUMAN	epidermal Langerhans cell protein LCP1	90						chromatin|nucleus|PTW/PP1 phosphatase complex	DNA binding|protein binding			ovary(1)	1	all_cancers(95;0.000465)		Epithelial(56;6.61e-06)|all cancers(55;5.15e-05)	GBM - Glioblastoma multiforme(265;0.0149)		GGGCATGACCCATGGCTTGAT	0.572													18	87	---	---	---	---	PASS
HOMEZ	57594	broad.mit.edu	37	14	23746292	23746292	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23746292C>T	uc001wja.2	-	2	293	c.145G>A	c.(145-147)GAG>AAG	p.E49K	HOMEZ_uc001wjb.2_Missense_Mutation_p.E51K	NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein	49						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TGTAGCTCCTCAGAGATTGGA	0.542													9	37	---	---	---	---	PASS
DHRS4L1	728635	broad.mit.edu	37	14	24507074	24507074	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24507074C>G	uc010alc.2	+	2	251	c.251C>G	c.(250-252)ACG>AGG	p.T84R	DHRS4L1_uc010tnu.1_Intron	NM_001082488	NP_001075957	P0CG22	DR4L1_HUMAN	dehydrogenase/reductase (SDR family) member 4	84							binding|oxidoreductase activity				0						CTGAGCATGACGGGCACTGTG	0.652													3	12	---	---	---	---	PASS
NYNRIN	57523	broad.mit.edu	37	14	24885022	24885022	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24885022C>A	uc001wpf.3	+	9	4385	c.4067C>A	c.(4066-4068)GCA>GAA	p.A1356E		NM_025081	NP_079357	Q9P2P1	NYNRI_HUMAN	hypothetical protein LOC57523	1356					DNA integration	integral to membrane	DNA binding			ovary(2)|central_nervous_system(1)	3						GCCCACCTGGCAGCCGTGGCC	0.612													9	88	---	---	---	---	PASS
PTGER2	5732	broad.mit.edu	37	14	52781483	52781483	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52781483G>A	uc001wzr.2	+	1	468	c.217G>A	c.(217-219)GAG>AAG	p.E73K		NM_000956	NP_000947	P43116	PE2R2_HUMAN	prostaglandin E receptor 2 (subtype EP2), 53kDa	73	Helical; Name=2; (Potential).					integral to plasma membrane	prostaglandin E receptor activity			lung(1)|breast(1)	2	Breast(41;0.0639)|all_epithelial(31;0.0729)				Alprostadil(DB00770)|Iloprost(DB01088)	GCTGGTGACCGAGCTGGTGTT	0.697													5	55	---	---	---	---	PASS
CGRRF1	10668	broad.mit.edu	37	14	54989297	54989297	+	Nonsense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:54989297C>G	uc001xay.2	+	2	321	c.230C>G	c.(229-231)TCA>TGA	p.S77*	CGRRF1_uc010tra.1_Nonsense_Mutation_p.S77*|CGRRF1_uc001xaz.2_RNA	NM_006568	NP_006559	Q99675	CGRF1_HUMAN	cell growth regulator with ring finger domain 1	77					cell cycle arrest|negative regulation of cell proliferation|response to stress		zinc ion binding			ovary(1)	1						AATCCATCTTCAGCTTCAATT	0.363													38	91	---	---	---	---	PASS
ESR2	2100	broad.mit.edu	37	14	64727439	64727439	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64727439C>A	uc001xha.1	-	5	1148	c.680G>T	c.(679-681)CGC>CTC	p.R227L	ESR2_uc001xgu.2_Missense_Mutation_p.R227L|ESR2_uc001xgv.2_Missense_Mutation_p.R227L|ESR2_uc001xgw.2_RNA|ESR2_uc001xgx.2_Missense_Mutation_p.R227L|ESR2_uc001xgy.1_Missense_Mutation_p.R227L|ESR2_uc001xgz.1_Missense_Mutation_p.R227L|ESR2_uc010aqb.1_RNA|ESR2_uc010aqc.1_Missense_Mutation_p.R227L|ESR2_uc010aqd.1_RNA	NM_001437	NP_001428	Q92731	ESR2_HUMAN	estrogen receptor beta isoform 1	227	Steroid-binding.				cell-cell signaling|negative regulation of cell growth|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	mitochondrion|nucleoplasm	enzyme binding|estrogen receptor activity|receptor antagonist activity|sequence-specific DNA binding transcription factor activity|steroid binding|transcription coactivator activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3				all cancers(60;0.00916)|OV - Ovarian serous cystadenocarcinoma(108;0.0111)|BRCA - Breast invasive adenocarcinoma(234;0.0437)	Bicalutamide(DB01128)|Estradiol(DB00783)|Estramustine(DB01196)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Trilostane(DB01108)	CCGCACAAGGCGGTACCCACA	0.587													13	41	---	---	---	---	PASS
KCNK13	56659	broad.mit.edu	37	14	90650863	90650863	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90650863A>G	uc001xye.1	+	2	1185	c.743A>G	c.(742-744)AAC>AGC	p.N248S		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	248						integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				AGCAGCCAGAACGCCCACTAT	0.502													10	56	---	---	---	---	PASS
KCNK13	56659	broad.mit.edu	37	14	90650864	90650864	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:90650864C>T	uc001xye.1	+	2	1186	c.744C>T	c.(742-744)AAC>AAT	p.N248N		NM_022054	NP_071337	Q9HB14	KCNKD_HUMAN	potassium channel, subfamily K, member 13	248						integral to membrane	potassium channel activity|voltage-gated ion channel activity			skin(1)	1		all_cancers(154;0.186)				GCAGCCAGAACGCCCACTATG	0.507													10	57	---	---	---	---	PASS
FBLN5	10516	broad.mit.edu	37	14	92413584	92413584	+	5'UTR	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92413584C>G	uc001xzx.3	-	1					FBLN5_uc010aud.2_5'Flank|FBLN5_uc010aue.2_5'UTR	NM_006329	NP_006320	Q9UBX5	FBLN5_HUMAN	fibulin 5 precursor						cell-matrix adhesion|elastic fiber assembly|protein localization at cell surface|regulation of removal of superoxide radicals	extracellular space|proteinaceous extracellular matrix|soluble fraction	calcium ion binding|integrin binding|protein C-terminus binding			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		all_cancers(154;0.0722)				GTCCAAGACGCGCGAGGAGGA	0.617													4	29	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102483504	102483504	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102483504G>T	uc001yks.2	+	39	8092	c.7928G>T	c.(7927-7929)CGC>CTC	p.R2643L	DYNC1H1_uc001ykt.1_Missense_Mutation_p.R134L	NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	2643	AAA 3 (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						GAGTACAGGCGCACACCTAAT	0.473													28	154	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405346	105405346	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405346C>T	uc010axc.1	-	7	16562	c.16442G>A	c.(16441-16443)AGC>AAC	p.S5481N	AHNAK2_uc001ypx.2_Missense_Mutation_p.S5381N	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5481						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGTCACTATGCTGTGTATAGT	0.478													3	27	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	107283028	107283028	+	RNA	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:107283028C>A	uc010tyt.1	-	1		c.60G>T			uc001ytb.1_Missense_Mutation_p.V39F					Parts of antibodies, mostly variable regions.												0						TTGCAGGAGACCTTCACTGAG	0.572													59	113	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24921369	24921369	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24921369C>A	uc001ywo.2	+	1	829	c.355C>A	c.(355-357)CCC>ACC	p.P119T		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	119					cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		GATCCCTCCTCCCAGCCGCAT	0.652													38	54	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25321171	25321171	+	Intron	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25321171A>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-12_uc001yxv.1_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GAGGTCCAGCACACTGCTTCA	0.468													8	49	---	---	---	---	PASS
SNORD115-26	100033802	broad.mit.edu	37	15	25479407	25479407	+	Intron	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25479407G>C	uc001yzw.1	+						uc001zae.2_5'Flank|SNORD115-35_uc001zac.1_RNA|SNORD115-11_uc001zad.1_5'Flank					Homo sapiens clone Rt-15 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCAATGATGAGAACCTTGTAT	0.493													10	300	---	---	---	---	PASS
GABRB3	2562	broad.mit.edu	37	15	26806098	26806098	+	Nonsense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26806098G>C	uc001zaz.2	-	8	1203	c.1061C>G	c.(1060-1062)TCA>TGA	p.S354*	GABRB3_uc010uae.1_Nonsense_Mutation_p.S269*|GABRB3_uc001zba.2_Nonsense_Mutation_p.S354*|GABRB3_uc001zbb.2_Nonsense_Mutation_p.S410*	NM_000814	NP_000805	P28472	GBRB3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta	354	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)|liver(1)|central_nervous_system(1)	5		all_cancers(20;1.89e-22)|all_lung(180;6.35e-15)|Breast(32;0.000279)|Colorectal(260;0.232)		all cancers(64;1.46e-07)|Epithelial(43;2.89e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0251)|COAD - Colon adenocarcinoma(236;0.235)|Lung(196;0.243)	Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	TTCGCTCTTTGAACGGTCATT	0.483													17	274	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27185157	27185157	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27185157G>A	uc001zbd.1	+	10	1149	c.810G>A	c.(808-810)ATG>ATA	p.M270I	GABRB3_uc001zbb.2_5'Flank	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	270	Helical; (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CCTGCATAATGACCGTGATCT	0.493													21	39	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33922206	33922206	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33922206G>C	uc001zhi.2	+	22	2815	c.2745G>C	c.(2743-2745)GAG>GAC	p.E915D	RYR3_uc010bar.2_Missense_Mutation_p.E915D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	915	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CAGAAACTGAGAAGAACTATA	0.338													3	14	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43822282	43822282	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43822282A>T	uc001zrt.2	+	6	8739	c.8272A>T	c.(8272-8274)ACT>TCT	p.T2758S		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2758						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCTGATCCCTACTCATGACAC	0.517													32	57	---	---	---	---	PASS
CATSPER2	117155	broad.mit.edu	37	15	43940214	43940214	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43940214C>T	uc001zsh.2	-	2	261	c.46G>A	c.(46-48)GAT>AAT	p.D16N	CATSPER2_uc010bdm.2_RNA|CATSPER2_uc001zsi.2_Missense_Mutation_p.D16N|CATSPER2_uc001zsj.2_Missense_Mutation_p.D16N|CATSPER2_uc001zsk.2_Missense_Mutation_p.D16N|CATSPER2_uc001zsl.1_Intron	NM_172095	NP_742093	Q96P56	CTSR2_HUMAN	sperm-associated cation channel 2 isoform 2	16	Cytoplasmic (Potential).				cell differentiation|multicellular organismal development|spermatogenesis	cilium|flagellar membrane|integral to membrane	calcium channel activity|protein binding|voltage-gated ion channel activity			ovary(1)	1		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CGAATGGCATCAGCTCGGGGA	0.488													64	286	---	---	---	---	PASS
MYO5A	4644	broad.mit.edu	37	15	52615590	52615590	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52615590G>C	uc002aby.2	-	36	4931	c.4687C>G	c.(4687-4689)CGA>GGA	p.R1563G	MYO5A_uc002abx.3_Missense_Mutation_p.R1536G|MYO5A_uc010ugd.1_Missense_Mutation_p.R285G	NM_000259	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA isoform 1	1563	Dilute.				actin filament-based movement|transport	cytoplasm|growth cone|myosin complex|ruffle	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|central_nervous_system(1)	4				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		TGCAAAAATCGGCATGTGTTA	0.383													4	97	---	---	---	---	PASS
MYO1E	4643	broad.mit.edu	37	15	59506474	59506474	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59506474C>T	uc002aga.2	-	12	1600	c.1228G>A	c.(1228-1230)GAA>AAA	p.E410K		NM_004998	NP_004989	Q12965	MYO1E_HUMAN	myosin IE	410	Myosin head-like.				actin filament-based movement	myosin complex	actin binding|ATP binding|ATPase activity, coupled|calmodulin binding|microfilament motor activity			central_nervous_system(3)	3				all cancers(107;0.207)		TGCAGTTTTTCATTAACAAAA	0.279													15	55	---	---	---	---	PASS
TRIP4	9325	broad.mit.edu	37	15	64701915	64701915	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64701915G>A	uc002anm.2	+	7	974	c.931G>A	c.(931-933)GAG>AAG	p.E311K		NM_016213	NP_057297	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	311					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	ligand-dependent nuclear receptor binding|transcription coactivator activity|zinc ion binding			ovary(1)|kidney(1)|skin(1)	3						GAAGCGAGAGGAGGAGCTGAG	0.463													21	96	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80884053	80884053	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80884053G>A	uc002bfr.2	+						ARNT2_uc010unm.1_Intron|ARNT2_uc002bfs.2_Intron	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator						central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			CAGGTAAATCGAGCGAGCACC	0.627													20	89	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85643423	85643423	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85643423C>A	uc002blh.2	+	11	1219	c.1030C>A	c.(1030-1032)CAT>AAT	p.H344N	PDE8A_uc002bli.2_Missense_Mutation_p.H298N|PDE8A_uc010bnc.2_Missense_Mutation_p.H97N|PDE8A_uc010bnd.2_Missense_Mutation_p.H97N|PDE8A_uc002blj.2_5'UTR|PDE8A_uc002blk.2_5'UTR	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	344				H -> R (in Ref. 2; AAK57641 and 6; AAC39763).	cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			GTCTGACACTCATACAGGTAC	0.383													32	50	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1509096	1509096	+	Intron	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1509096C>A	uc002clv.2	-						CLCN7_uc002clw.2_Intron	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a							integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				GCCAGGGCCACCGCACCCTCA	0.647													18	19	---	---	---	---	PASS
CLCN7	1186	broad.mit.edu	37	16	1509097	1509097	+	Intron	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1509097C>A	uc002clv.2	-						CLCN7_uc002clw.2_Intron	NM_001287	NP_001278	P51798	CLCN7_HUMAN	chloride channel 7 isoform a							integral to membrane|lysosomal membrane	antiporter activity|ATP binding|voltage-gated chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4		Hepatocellular(780;0.0893)				CCAGGGCCACCGCACCCTCAC	0.647													17	18	---	---	---	---	PASS
TBC1D24	57465	broad.mit.edu	37	16	2546958	2546958	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2546958G>T	uc002cql.2	+	2	949	c.809G>T	c.(808-810)CGC>CTC	p.R270L	TBC1D24_uc002cqk.2_Missense_Mutation_p.R270L|TBC1D24_uc002cqm.2_Missense_Mutation_p.R270L|TBC1D24_uc010bsm.2_5'Flank	NM_020705	NP_065756	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	270					neuron projection development	cytoplasm	protein binding|Rab GTPase activator activity				0						CAGGACATCCGCACGTTCGTC	0.617													4	147	---	---	---	---	PASS
OR1F1	4992	broad.mit.edu	37	16	3254528	3254528	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3254528C>T	uc010uwu.1	+	1	282	c.282C>T	c.(280-282)TTC>TTT	p.F94F		NM_012360	NP_036492	O43749	OR1F1_HUMAN	olfactory receptor, family 1, subfamily F,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCATCTCCTTCTGTGGCTGTC	0.502													7	300	---	---	---	---	PASS
ZNF174	7727	broad.mit.edu	37	16	3458795	3458795	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3458795C>T	uc002cvc.2	+	3	1915	c.1100C>T	c.(1099-1101)TCA>TTA	p.S367L		NM_003450	NP_003441	Q15697	ZN174_HUMAN	zinc finger protein 174 isoform a	367	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter|viral reproduction	actin cytoskeleton|cytoplasm|nucleus	protein homodimerization activity|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding				0						GGGCGGCAGTCAACCCTGAAG	0.542													6	43	---	---	---	---	PASS
UBN1	29855	broad.mit.edu	37	16	4924782	4924782	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4924782C>T	uc002cyb.2	+	15	2710	c.2371C>T	c.(2371-2373)CAC>TAC	p.H791Y	UBN1_uc010uxw.1_Missense_Mutation_p.H791Y|UBN1_uc002cyc.2_Missense_Mutation_p.H791Y	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	791					chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						ACGGACGTCTCACGGGCCCCA	0.572													24	200	---	---	---	---	PASS
CIITA	4261	broad.mit.edu	37	16	11004059	11004059	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11004059C>G	uc002dai.3	+	13	2964	c.2831C>G	c.(2830-2832)TCG>TGG	p.S944W	CIITA_uc002daj.3_Missense_Mutation_p.S945W|CIITA_uc002dak.3_Missense_Mutation_p.S360W|CIITA_uc010bup.1_Missense_Mutation_p.R341G	NM_000246	NP_000237	P33076	C2TA_HUMAN	class II transactivator	944			Missing (in BLS2).		interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|response to antibiotic|transcription, DNA-dependent	nucleus	activating transcription factor binding|ATP binding|protein C-terminus binding|protein complex binding|transcription coactivator activity|transcription regulatory region DNA binding			central_nervous_system(1)	1						AGAAGTTCCTCGGAAGACACA	0.567			T	FLJ27352|CD274|CD273|RALGDS|RUNDC2A|C16orf75	PMBL|Hodgkin Lymphona|								8	24	---	---	---	---	PASS
DNAH3	55567	broad.mit.edu	37	16	21082026	21082026	+	Intron	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21082026C>G	uc010vbe.1	-							NM_017539	NP_060009	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(10)|skin(3)|large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	18				GBM - Glioblastoma multiforme(48;0.207)		TTCATTTCCTCTTACCCGGCA	0.423													36	138	---	---	---	---	PASS
SLC5A2	6524	broad.mit.edu	37	16	31494562	31494562	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31494562G>A	uc002ecf.3	+	1	124	c.105G>A	c.(103-105)CTG>CTA	p.L35L	SLC5A2_uc010car.2_RNA	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose	35	Helical; (Potential).				carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						ATTTCCTGCTGGTCATTGGCG	0.597													56	97	---	---	---	---	PASS
DNAJA2	10294	broad.mit.edu	37	16	46998598	46998598	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46998598G>A	uc002eeo.2	-	6	841	c.699C>T	c.(697-699)TTC>TTT	p.F233F	DNAJA2_uc002eep.2_Silent_p.F150F	NM_005880	NP_005871	O60884	DNJA2_HUMAN	DnaJ subfamily A member 2	233					positive regulation of cell proliferation|protein folding|response to heat	membrane	ATP binding|heat shock protein binding|metal ion binding|unfolded protein binding			lung(1)	1		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				CTTCCCCAGTGAATGTAATTC	0.418													52	196	---	---	---	---	PASS
HSF4	3299	broad.mit.edu	37	16	67199689	67199689	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67199689G>A	uc002erl.1	+	5	1265	c.300G>A	c.(298-300)GAG>GAA	p.E100E	HSF4_uc002erm.1_Silent_p.E100E|HSF4_uc002ern.1_RNA|HSF4_uc010cec.1_RNA	NM_001040667	NP_001035757	Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4 isoform b	100	By similarity.				response to stress	nucleus	sequence-specific DNA binding transcription factor activity|transcription corepressor activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		ACCACGTCGAGTTCCAGCACC	0.711													20	6	---	---	---	---	PASS
CENPT	80152	broad.mit.edu	37	16	67862302	67862302	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67862302G>A	uc002eun.3	-						CENPT_uc002eum.3_Intron|CENPT_uc010vkc.1_Intron	NM_025082	NP_079358	Q96BT3	CENPT_HUMAN	centromere protein T						mitotic prometaphase	condensed chromosome kinetochore|cytosol|nucleus	DNA binding				0		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		GCCTGCAGTGGAGGAAGAGAA	0.632													37	74	---	---	---	---	PASS
PSMB10	5699	broad.mit.edu	37	16	67968568	67968568	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67968568G>A	uc002eux.1	-	8	818	c.717C>T	c.(715-717)GGC>GGT	p.G239G	CTRL_uc002euw.2_5'Flank	NM_002801	NP_002792	P40306	PSB10_HUMAN	proteasome beta 10 subunit proprotein	239					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|humoral immune response|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)		AGTGGTAGCGGCCAGACCTGG	0.597													4	174	---	---	---	---	PASS
ZFHX3	463	broad.mit.edu	37	16	72821373	72821373	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72821373G>C	uc002fck.2	-	10	11475	c.10802C>G	c.(10801-10803)TCG>TGG	p.S3601W	uc002fcj.1_Intron|ZFHX3_uc002fcl.2_Missense_Mutation_p.S2687W	NM_006885	NP_008816	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3 isoform A	3601					muscle organ development|negative regulation of myoblast differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|positive regulation of myoblast differentiation	transcription factor complex	enzyme binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|skin(2)	4		Ovarian(137;0.13)				GGCGGCGGCCGACGGGGGAGG	0.652													12	50	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1543260	1543260	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1543260G>A	uc002fsz.1	-	6	1135	c.1085C>T	c.(1084-1086)TCC>TTC	p.S362F	SCARF1_uc002fsy.1_Missense_Mutation_p.S362F|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Intron	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	362	Extracellular (Potential).|EGF-like 6.				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGTATCACAGGACCCCTGAAC	0.642													16	50	---	---	---	---	PASS
ANKFY1	51479	broad.mit.edu	37	17	4084552	4084552	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4084552C>A	uc002fxq.1	-	16	2275	c.2237G>T	c.(2236-2238)CGC>CTC	p.R746L	ANKFY1_uc002fxn.2_Missense_Mutation_p.R788L|ANKFY1_uc002fxo.2_Missense_Mutation_p.R747L|ANKFY1_uc002fxp.2_Missense_Mutation_p.R745L|ANKFY1_uc010ckp.2_Missense_Mutation_p.R688L	NM_016376	NP_057460	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	746	ANK 12.					endosome membrane	metal ion binding|protein binding			ovary(2)|skin(1)	3						CTCAGACCTGCGAATAAGAAA	0.522													25	11	---	---	---	---	PASS
ZNF232	7775	broad.mit.edu	37	17	5009402	5009402	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5009402C>G	uc002gas.2	-	5	1725	c.971G>C	c.(970-972)AGA>ACA	p.R324T	ZNF232_uc002gar.1_Missense_Mutation_p.R342T|ZNF232_uc002gat.2_Missense_Mutation_p.R351T	NM_014519	NP_055334	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	324	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2						TGTATGAATTCTCTGATGCTG	0.458													53	77	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7232368	7232368	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7232368G>A	uc002gga.1	-	1	271	c.264C>T	c.(262-264)ACC>ACT	p.T88T	NEURL4_uc002ggb.1_Silent_p.T88T|NEURL4_uc002ggc.1_5'Flank	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	88	NHR 1.						protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						CGATGCGGACGGTGAAGACGC	0.672													23	10	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578478	7578478	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578478G>C	uc002gim.2	-	5	646	c.452C>G	c.(451-453)CCC>CGC	p.P151R	TP53_uc002gig.1_Missense_Mutation_p.P151R|TP53_uc002gih.2_Missense_Mutation_p.P151R|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P19R|TP53_uc010cng.1_Missense_Mutation_p.P19R|TP53_uc002gii.1_Missense_Mutation_p.P19R|TP53_uc010cnh.1_Missense_Mutation_p.P151R|TP53_uc010cni.1_Missense_Mutation_p.P151R|TP53_uc002gij.2_Missense_Mutation_p.P151R|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.P58R|TP53_uc002gio.2_Missense_Mutation_p.P19R|TP53_uc010vug.1_Missense_Mutation_p.P112R	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	151	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> R (in sporadic cancers; somatic mutation).|P -> A (in sporadic cancers; somatic mutation).|P -> L (in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P151S(61)|p.P151H(25)|p.P151T(13)|p.P151P(12)|p.P151A(8)|p.0?(7)|p.P151fs*30(7)|p.P151L(6)|p.P151R(6)|p.T150fs*16(3)|p.P151_V173del23(1)|p.P152_P153del(1)|p.P152fs*28(1)|p.P151del(1)|p.D148_T155delDSTPPPGT(1)|p.T150_P153delTPPP(1)|p.P153fs*28(1)|p.D148fs*23(1)|p.P152del(1)|p.S149fs*72(1)|p.S149fs*17(1)|p.Q144_G154del11(1)|p.P152fs*14(1)|p.T150_P151delTP(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCCGGGCGGGGGTGTGGAATC	0.607		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			32	16	---	---	---	---	PASS
MYOCD	93649	broad.mit.edu	37	17	12666802	12666802	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12666802C>A	uc002gnn.2	+	13	2957	c.2658C>A	c.(2656-2658)CCC>CCA	p.P886P	MYOCD_uc002gno.2_Silent_p.P934P|MYOCD_uc002gnq.2_Silent_p.P610P	NM_153604	NP_705832	Q8IZQ8	MYCD_HUMAN	myocardin isoform 2	886					cardiac muscle cell differentiation|negative regulation of cell proliferation|negative regulation of cyclin-dependent protein kinase activity|positive regulation of smooth muscle cell differentiation|positive regulation of smooth muscle contraction|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation|regulation of histone acetylation|smooth muscle cell differentiation	nucleus	nucleic acid binding|RNA polymerase II transcription factor binding transcription factor activity|transcription factor binding			central_nervous_system(2)|skin(2)|ovary(1)	5				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CTGAATCTCCCTGGGAAACCA	0.547													11	20	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18647967	18647967	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18647967C>T	uc002guk.2	+	1	642	c.410C>T	c.(409-411)ACT>ATT	p.T137I	FBXW10_uc002guj.2_Missense_Mutation_p.T137I|FBXW10_uc002gul.2_Missense_Mutation_p.T137I|FBXW10_uc010cqh.1_Missense_Mutation_p.T137I	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	137										ovary(1)	1						GCGAATTATACTCTCTTACTG	0.438													71	36	---	---	---	---	PASS
RAB34	83871	broad.mit.edu	37	17	27041699	27041699	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27041699G>C	uc002hce.2	-	10	1366	c.742C>G	c.(742-744)CTA>GTA	p.L248V	PROCA1_uc002hca.1_5'Flank|RAB34_uc002hcg.2_Missense_Mutation_p.L240V|RAB34_uc002hcf.2_Missense_Mutation_p.L249V|RAB34_uc010was.1_Missense_Mutation_p.L305V|RAB34_uc010wat.1_Missense_Mutation_p.L297V|RAB34_uc002hch.2_Missense_Mutation_p.L248V|RAB34_uc010wau.1_Missense_Mutation_p.L226V|RAB34_uc010wav.1_Intron	NM_031934	NP_114140	Q9BZG1	RAB34_HUMAN	Ras-related protein RAB34 isoform 1	248					protein transport|small GTPase mediated signal transduction	Golgi apparatus	GTP binding				0	Lung NSC(42;0.00431)					CTGGCAGTTAGGTAGAGGTTG	0.552													44	64	---	---	---	---	PASS
SSH2	85464	broad.mit.edu	37	17	27963527	27963527	+	Missense_Mutation	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27963527T>C	uc002heo.1	-	14	1640	c.1640A>G	c.(1639-1641)AAC>AGC	p.N547S	SSH2_uc010wbh.1_Missense_Mutation_p.N574S	NM_033389	NP_203747	Q76I76	SSH2_HUMAN	slingshot 2	547					actin cytoskeleton organization|regulation of actin polymerization or depolymerization|regulation of axonogenesis|regulation of lamellipodium assembly	cytoplasm|cytoskeleton	actin binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			skin(2)	2						GTCATTTAAGTTTAATTCATC	0.393													62	100	---	---	---	---	PASS
CRLF3	51379	broad.mit.edu	37	17	29119460	29119460	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29119460G>C	uc002hfr.3	-	6	1066	c.957C>G	c.(955-957)TTC>TTG	p.F319L	CRLF3_uc010wbr.1_Missense_Mutation_p.F203L	NM_015986	NP_057070	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	319					negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|positive regulation of cell cycle arrest|positive regulation of JAK-STAT cascade|positive regulation of transcription from RNA polymerase II promoter	cytoplasm					0		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				CTACTTGCCTGAATGTTAATG	0.294													25	115	---	---	---	---	PASS
C17orf102	400591	broad.mit.edu	37	17	32906212	32906212	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32906212G>A	uc002hie.1	-	1	177	c.88C>T	c.(88-90)CAG>TAG	p.Q30*	TMEM132E_uc002hif.2_5'Flank	NM_207454	NP_997337	A2RUQ5	CQ102_HUMAN	hypothetical protein LOC400591	30										ovary(1)	1						AAACGCAGCTGAGGGAGGTGG	0.627													11	31	---	---	---	---	PASS
PIP4K2B	8396	broad.mit.edu	37	17	36940500	36940500	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36940500T>A	uc002hqs.2	-	3	831	c.350A>T	c.(349-351)TAC>TTC	p.Y117F	PIP4K2B_uc010wdt.1_Missense_Mutation_p.Y117F|PIP4K2B_uc010wdu.1_Missense_Mutation_p.Y53F	NM_003559	NP_003550	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type	117	PIPK.				cell surface receptor linked signaling pathway	endoplasmic reticulum membrane|plasma membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|1-phosphatidylinositol-5-phosphate 4-kinase activity|ATP binding|receptor signaling protein activity			ovary(1)	1						CCATACCTGGTAATCCTGATC	0.493													15	41	---	---	---	---	PASS
KCNH4	23415	broad.mit.edu	37	17	40317507	40317507	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40317507C>T	uc002hzb.2	-	11	2378	c.2045G>A	c.(2044-2046)CGG>CAG	p.R682Q		NM_012285	NP_036417	Q9UQ05	KCNH4_HUMAN	potassium voltage-gated channel, subfamily H,	682	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	two-component sensor activity|voltage-gated potassium channel activity			large_intestine(1)	1		all_cancers(22;1.24e-06)|all_epithelial(22;4.33e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGTGAGGTCCCGGGGCAGGCC	0.632													5	140	---	---	---	---	PASS
C1QL1	10882	broad.mit.edu	37	17	43045094	43045094	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43045094G>T	uc002ihv.2	-	1	551	c.323C>A	c.(322-324)CCG>CAG	p.P108Q		NM_006688	NP_006679	O75973	C1QRF_HUMAN	complement component 1, q subcomponent-like 1	108	Collagen-like.				locomotory behavior	collagen					0		Prostate(33;0.155)				cggcagccccggagggcccgg	0.577													16	38	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45473328	45473328	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45473328C>A	uc002iln.2	+	17	2341	c.1930C>A	c.(1930-1932)CTA>ATA	p.L644I	C17orf57_uc002ilm.2_Missense_Mutation_p.L548I	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	644	EF-hand 3.						calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						TGCATTGGAACTAGTGACAGT	0.328													50	87	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48266307	48266307	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48266307C>T	uc002iqm.2	-	41	3128	c.3002G>A	c.(3001-3003)GGC>GAC	p.G1001D		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	1001	Triple-helical region.		G -> C (in OI2A).		axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	TCCAGGGGGGCCCATGGGACC	0.612			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta						30	116	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54428207	54428207	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428207C>A	uc002iun.1	+	4	313	c.278C>A	c.(277-279)CCC>CAC	p.P93H		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	93										large_intestine(1)|ovary(1)	2						CCCTCATCTCCCAACGCAGCC	0.453													51	74	---	---	---	---	PASS
DCAF7	10238	broad.mit.edu	37	17	61661022	61661022	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61661022G>C	uc002jbc.2	+	6	904	c.687G>C	c.(685-687)TGG>TGC	p.W229C	DCAF7_uc002jbb.2_RNA|DCAF7_uc010wpn.1_Intron	NM_005828	NP_005819	P61962	DCAF7_HUMAN	WD-repeat protein	229					multicellular organismal development	CUL4 RING ubiquitin ligase complex|cytoplasm|nucleus	protein binding			ovary(1)	1						GCCTCTGCTGGAACAAGCAGG	0.572													13	39	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62018997	62018997	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62018997C>T	uc002jds.1	-	24	4722	c.4645G>A	c.(4645-4647)GGG>AGG	p.G1549R		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	1549	IV.				muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	TCTGGGGGCCCGCTGTTGAGG	0.597													4	38	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66040122	66040122	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66040122C>T	uc002jgk.2	+	8	1231	c.1099C>T	c.(1099-1101)CAG>TAG	p.Q367*	KPNA2_uc002jgl.2_Nonsense_Mutation_p.Q367*	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	367	NLS binding site (minor) (By similarity).|ARM 8.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGCCGGCCGCCAGGACCAGAT	0.468													63	215	---	---	---	---	PASS
KIAA0195	9772	broad.mit.edu	37	17	73486809	73486809	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73486809C>T	uc002jnz.3	+	11	1373	c.1098C>T	c.(1096-1098)CTC>CTT	p.L366L	KIAA0195_uc010wsa.1_Silent_p.L376L|KIAA0195_uc010wsb.1_Silent_p.L18L	NM_014738	NP_055553	Q12767	K0195_HUMAN	hypothetical protein LOC9772	366					ATP biosynthetic process|cation transport	integral to membrane	ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism			ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGATACTCTCAGCAGCTATA	0.572													12	88	---	---	---	---	PASS
SAP30BP	29115	broad.mit.edu	37	17	73702548	73702548	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73702548A>G	uc002jpe.2	+	11	928	c.874A>G	c.(874-876)AAG>GAG	p.K292E	SAP30BP_uc002jpc.1_RNA|SAP30BP_uc010wsf.1_RNA|SAP30BP_uc010wsg.1_RNA|SAP30BP_uc002jpf.2_Missense_Mutation_p.K276E	NM_013260	NP_037392	Q9UHR5	S30BP_HUMAN	transcriptional regulator protein	292	Thr-rich.				apoptosis|induction of apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1	all_cancers(13;6.42e-08)		all cancers(21;4.25e-07)|Epithelial(20;9.57e-07)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGCGGCTCCAAGACCACCGT	0.612													61	150	---	---	---	---	PASS
RHBDF2	79651	broad.mit.edu	37	17	74476009	74476009	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74476009C>T	uc002jrq.1	-	4	458	c.165G>A	c.(163-165)AGG>AGA	p.R55R	RHBDF2_uc002jrp.1_Intron|RHBDF2_uc002jrr.1_Intron|RHBDF2_uc010wtf.1_Intron|RHBDF2_uc002jrs.1_Intron	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1	55	Cytoplasmic (Potential).				negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						TCTTTAGCCTCCTATTCTGAA	0.433													5	11	---	---	---	---	PASS
GPS1	2873	broad.mit.edu	37	17	80012801	80012801	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80012801C>A	uc002kdl.1	+	5	694	c.649C>A	c.(649-651)CAT>AAT	p.H217N	GPS1_uc002kdk.1_Missense_Mutation_p.H253N|GPS1_uc010dij.1_Missense_Mutation_p.H253N|GPS1_uc002kdm.1_Missense_Mutation_p.H197N|GPS1_uc002kdn.1_Missense_Mutation_p.H213N|GPS1_uc002kdo.1_Missense_Mutation_p.H217N|GPS1_uc010wvh.1_Missense_Mutation_p.H209N	NM_004127	NP_004118	Q13098	CSN1_HUMAN	G protein pathway suppressor 1 isoform 2	217					cell cycle|cullin deneddylation|inactivation of MAPK activity|JNK cascade	cytoplasm|signalosome	GTPase inhibitor activity|protein binding			central_nervous_system(1)	1	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			GAATTGGTCTCATGTGCTCAG	0.662													6	87	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80724167	80724167	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80724167C>A	uc002kfz.2	+	4	488	c.358C>A	c.(358-360)CGT>AGT	p.R120S	TBCD_uc002kfx.1_Missense_Mutation_p.R103S|TBCD_uc002kfy.1_Missense_Mutation_p.R120S	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	120					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AACATTTCTTCGTTTATTTCC	0.388													7	23	---	---	---	---	PASS
C18orf34	374864	broad.mit.edu	37	18	30518063	30518063	+	Intron	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30518063G>T	uc002kxn.2	-						C18orf34_uc010xbq.1_Intron|C18orf34_uc010dme.1_Intron|C18orf34_uc010xbr.1_Intron|C18orf34_uc010dmf.1_Intron|C18orf34_uc002kxo.2_Intron	NM_001105528	NP_001098998	Q5BJE1	CR034_HUMAN	hypothetical protein LOC374864 isoform 1											ovary(1)	1						CTCCTGTTCAGAAGCAAGAAA	0.313													23	55	---	---	---	---	PASS
KIAA1632	57724	broad.mit.edu	37	18	43456279	43456279	+	Nonsense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43456279C>A	uc002lbm.2	-	35	6071	c.5971G>T	c.(5971-5973)GAG>TAG	p.E1991*	KIAA1632_uc010xcq.1_Nonsense_Mutation_p.E545*|KIAA1632_uc010xcr.1_Intron|KIAA1632_uc010xcs.1_Intron|KIAA1632_uc002lbn.2_Nonsense_Mutation_p.E866*	NM_020964	NP_066015	Q9HCE0	EPG5_HUMAN	hypothetical protein LOC57724	1991					autophagy						0						GTATCACTCTCTAGCCAGGGG	0.458													48	60	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46284376	46284376	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46284376A>G	uc002ldc.2	+	8	956	c.671A>G	c.(670-672)CAG>CGG	p.Q224R	KIAA0427_uc002ldd.2_Missense_Mutation_p.Q224R|KIAA0427_uc002lde.3_5'Flank	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	224	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						AGGGACCACCAGAAATCCTAC	0.632													102	110	---	---	---	---	PASS
KIAA1468	57614	broad.mit.edu	37	18	59899640	59899640	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59899640G>C	uc002lil.2	+	10	1815	c.1600G>C	c.(1600-1602)GTG>CTG	p.V534L	KIAA1468_uc002lik.1_Missense_Mutation_p.V534L|KIAA1468_uc010xel.1_Missense_Mutation_p.V534L|KIAA1468_uc002lim.2_Missense_Mutation_p.V178L	NM_020854	NP_065905	Q9P260	K1468_HUMAN	hypothetical protein LOC57614	534							binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)	6		Colorectal(73;0.186)				TGTTCCCAATGTGCTATTGGC	0.388													42	113	---	---	---	---	PASS
KCNG2	26251	broad.mit.edu	37	18	77659303	77659303	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77659303C>G	uc010xfl.1	+	2	888	c.888C>G	c.(886-888)CTC>CTG	p.L296L		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	296	Helical; Voltage-sensor; Name=Segment S4; (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		TGCGCGTGCTCTACGTGATGC	0.741													5	12	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2114168	2114168	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2114168C>G	uc002luz.2	-	22	2780	c.2557G>C	c.(2557-2559)GAG>CAG	p.E853Q	AP3D1_uc010dsv.2_5'Flank|AP3D1_uc002luy.2_Missense_Mutation_p.E762Q|AP3D1_uc002lva.2_Missense_Mutation_p.E853Q	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	853	Lys-rich.|Potential.				eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ctctctttctctttGTGTTTT	0.388													6	15	---	---	---	---	PASS
ZFR2	23217	broad.mit.edu	37	19	3831804	3831804	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3831804G>T	uc002lyw.2	-	4	464	c.452C>A	c.(451-453)CCC>CAC	p.P151H	ZFR2_uc010xhx.1_RNA	NM_015174	NP_055989	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2 isoform 1	151						intracellular	nucleic acid binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		CTCCACTATGGGCGCCTGCTG	0.677													5	24	---	---	---	---	PASS
SAFB	6294	broad.mit.edu	37	19	5664121	5664121	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5664121G>A	uc002mcf.2	+	16	2295	c.2242G>A	c.(2242-2244)GAC>AAC	p.D748N	SAFB_uc002mcg.2_Missense_Mutation_p.D748N|SAFB_uc002mce.3_Missense_Mutation_p.D747N|SAFB_uc010xir.1_Missense_Mutation_p.D747N|SAFB_uc010xis.1_Missense_Mutation_p.D679N|SAFB_uc010xit.1_Missense_Mutation_p.D590N|SAFB_uc010xiu.1_Missense_Mutation_p.D547N	NM_002967	NP_002958	Q15424	SAFB1_HUMAN	scaffold attachment factor B	748	Interaction with SAFB2.|Interaction with POLR2A.|Arg-rich.				chromatin organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	double-stranded DNA binding|nucleotide binding|protein binding|RNA binding			ovary(1)|liver(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;0.000222)		CCGCTTCCACGACTTTGACCA	0.627													5	80	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6904052	6904052	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6904052G>C	uc002mfw.2	+	8	846	c.808G>C	c.(808-810)GAT>CAT	p.D270H	EMR1_uc010dvc.2_Missense_Mutation_p.D270H|EMR1_uc010dvb.2_Missense_Mutation_p.D218H|EMR1_uc010xji.1_Missense_Mutation_p.D129H|EMR1_uc010xjj.1_Intron	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	270	Extracellular (Potential).|EGF-like 6; calcium-binding (Potential).				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					TGCAGATATTGATGAGTGCCG	0.463													43	74	---	---	---	---	PASS
PNPLA6	10908	broad.mit.edu	37	19	7620527	7620527	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7620527G>C	uc010xjq.1	+	26	3196	c.3001G>C	c.(3001-3003)GAG>CAG	p.E1001Q	PNPLA6_uc002mgq.1_Missense_Mutation_p.E953Q|PNPLA6_uc010xjp.1_Missense_Mutation_p.E926Q|PNPLA6_uc002mgr.1_Missense_Mutation_p.E953Q|PNPLA6_uc002mgs.2_Missense_Mutation_p.E991Q|PNPLA6_uc002mgt.1_RNA	NM_006702	NP_006693	Q8IY17	PLPL6_HUMAN	neuropathy target esterase isoform b	992	Patatin.|Cytoplasmic (Potential).				cell death|lipid catabolic process|phosphatidylcholine metabolic process	endoplasmic reticulum membrane|integral to membrane	lysophospholipase activity			ovary(3)	3						AAAGGCATTAGAGGAGGCGGG	0.662													7	48	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9003290	9003290	+	Intron	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9003290C>A	uc002mkp.2	-						MUC16_uc010dwi.2_Intron|MUC16_uc010dwj.2_Intron|MUC16_uc010xki.1_Intron	NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16						cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TCTAAAGTCTCACCTGAGCAA	0.483													5	39	---	---	---	---	PASS
ZNF560	147741	broad.mit.edu	37	19	9583891	9583891	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9583891C>G	uc002mlp.1	-	5	412	c.202G>C	c.(202-204)GAA>CAA	p.E68Q	ZNF560_uc010dwr.1_5'UTR	NM_152476	NP_689689	Q96MR9	ZN560_HUMAN	zinc finger protein 560	68	KRAB 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|large_intestine(1)|pancreas(1)|liver(1)	6						CTCAACTCTTCTTCTTCCAAC	0.353													104	200	---	---	---	---	PASS
UBL5	59286	broad.mit.edu	37	19	9939262	9939262	+	Intron	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9939262G>T	uc002mmi.1	+						FBXL12_uc002mmh.2_5'Flank|UBL5_uc002mmj.1_Intron	NM_001048241	NP_001041706	Q9BZL1	UBL5_HUMAN	ubiquitin-like 5							cytoplasm					0						ACTGCTCTGCGCCCAGCACGG	0.552													53	99	---	---	---	---	PASS
LPPR2	64748	broad.mit.edu	37	19	11474413	11474413	+	Nonsense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11474413C>T	uc002mre.1	+	8	1202	c.865C>T	c.(865-867)CAG>TAG	p.Q289*	LPPR2_uc002mrf.1_Nonsense_Mutation_p.Q264*|LPPR2_uc010dxy.1_Nonsense_Mutation_p.Q96*	NM_022737	NP_073574	Q96GM1	LPPR2_HUMAN	lipid phosphate phosphatase-related protein type	289						integral to membrane	phosphatidate phosphatase activity			large_intestine(1)	1						GCATAACTTTCAGAGCCGGCC	0.512													19	65	---	---	---	---	PASS
ZNF709	163051	broad.mit.edu	37	19	12575430	12575430	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12575430G>C	uc002mtv.3	-	4	1467	c.1306C>G	c.(1306-1308)CGA>GGA	p.R436G	ZNF709_uc002mtw.3_Missense_Mutation_p.R404G|ZNF709_uc002mtx.3_Missense_Mutation_p.R436G	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	436	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCATGTATTCGAACAGAACTG	0.408													15	209	---	---	---	---	PASS
ZNF709	163051	broad.mit.edu	37	19	12577613	12577613	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12577613C>T	uc002mtv.3	-	2	216	c.55G>A	c.(55-57)GCT>ACT	p.A19T	ZNF709_uc002mtw.3_5'UTR|ZNF709_uc002mtx.3_Missense_Mutation_p.A19T	NM_152601	NP_689814	Q8N972	ZN709_HUMAN	zinc finger protein 709 isoform a	19	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CCCAGCAAAGCCCACTCCTCC	0.473													7	103	---	---	---	---	PASS
MRI1	84245	broad.mit.edu	37	19	13875456	13875456	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13875456G>T	uc002mxe.2	+	1	120	c.54G>T	c.(52-54)CAG>CAT	p.Q18H	MRI1_uc002mxf.2_Missense_Mutation_p.Q18H	NM_001031727	NP_001026897	Q9BV20	MTNA_HUMAN	translation initiation factor eIF-2B subunit	18					L-methionine salvage from methylthioadenosine	cell projection|cytoplasm|nucleus	identical protein binding|S-methyl-5-thioribose-1-phosphate isomerase activity			ovary(1)	1						TCCTAGACCAGCTGCTGCTGC	0.612													5	41	---	---	---	---	PASS
BRD4	23476	broad.mit.edu	37	19	15349587	15349587	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15349587C>A	uc002nar.2	-	19	4209	c.3987G>T	c.(3985-3987)CGG>CGT	p.R1329R		NM_058243	NP_490597	O60885	BRD4_HUMAN	bromodomain-containing protein 4 isoform long	1329					interspecies interaction between organisms|positive regulation of G2/M transition of mitotic cell cycle|positive regulation of transcription elongation from RNA polymerase II promoter|regulation of transcription involved in G1 phase of mitotic cell cycle	condensed nuclear chromosome|cytoplasm	protein binding			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GCTCCCGCTTCCGGGCCAACT	0.622			T	NUT|C15orf55	lethal midline carcinoma of young people								5	31	---	---	---	---	PASS
SFRS14	10147	broad.mit.edu	37	19	19120951	19120951	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19120951C>G	uc002nkx.2	-	5	2197	c.2051G>C	c.(2050-2052)CGT>CCT	p.R684P	SFRS14_uc002nkz.1_Missense_Mutation_p.R698P|SFRS14_uc002nla.1_Missense_Mutation_p.R684P|SFRS14_uc002nlb.2_Missense_Mutation_p.R684P|SFRS14_uc010xqk.1_Missense_Mutation_p.R453P	NM_014884	NP_055699	Q8IX01	SUGP2_HUMAN	splicing factor, arginine/serine-rich 14	684					mRNA processing|RNA splicing	nucleus	RNA binding				0			OV - Ovarian serous cystadenocarcinoma(5;3.05e-05)|Epithelial(12;0.00161)			CCCTTGAGCACGGAGGAGCCC	0.667													49	90	---	---	---	---	PASS
ZNF100	163227	broad.mit.edu	37	19	21910548	21910548	+	Missense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21910548A>T	uc002nqi.2	-	5	765	c.566T>A	c.(565-567)TTT>TAT	p.F189Y	ZNF100_uc002nqh.2_Missense_Mutation_p.F125Y	NM_173531	NP_775802	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	189	C2H2-type 1; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TGAATTTGAAAATGTATGAAA	0.299													23	168	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22156018	22156018	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156018C>T	uc002nqp.2	-	5	1667	c.1518G>A	c.(1516-1518)GAG>GAA	p.E506E	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TGTAGGGTTTCTCACCAGTAT	0.363													21	79	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22157258	22157258	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157258C>G	uc002nqp.2	-	4	727	c.578G>C	c.(577-579)AGA>ACA	p.R193T	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGTATAAATTCTTTTATGTTG	0.353													39	61	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22375890	22375890	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22375890G>T	uc002nqs.1	-	2	376	c.58C>A	c.(58-60)CTG>ATG	p.L20M		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	20	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAAATGATCAGGTCTGGCTTA	0.403													31	58	---	---	---	---	PASS
KIAA0355	9710	broad.mit.edu	37	19	34833290	34833290	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34833290C>A	uc002nvd.3	+	10	3310	c.2451C>A	c.(2449-2451)ACC>ACA	p.T817T		NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710	817										ovary(1)	1	Esophageal squamous(110;0.162)					GAAATAACACCTGGCCCAACC	0.517													62	122	---	---	---	---	PASS
ZNF585B	92285	broad.mit.edu	37	19	37677991	37677991	+	Missense_Mutation	SNP	T	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37677991T>G	uc002ofq.2	-	5	702	c.448A>C	c.(448-450)AAA>CAA	p.K150Q	ZNF585B_uc002ofr.1_Intron	NM_152279	NP_689492	Q52M93	Z585B_HUMAN	zinc finger protein 585B	150					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTAGGAACTTTCAGATGTACC	0.388													61	89	---	---	---	---	PASS
ZNF571	51276	broad.mit.edu	37	19	38055520	38055520	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38055520G>A	uc002ogt.2	-	4	1911	c.1810C>T	c.(1810-1812)CAT>TAT	p.H604Y	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Missense_Mutation_p.H604Y	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	604	C2H2-type 17.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGCCTTGTATGTTGAGTAAGT	0.348													24	33	---	---	---	---	PASS
ZNF571	51276	broad.mit.edu	37	19	38056780	38056780	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38056780G>A	uc002ogt.2	-	4	651	c.550C>T	c.(550-552)CAA>TAA	p.Q184*	uc002ogm.2_Intron|uc002ogn.2_Intron|ZNF540_uc002ogo.2_Intron|ZNF540_uc002ogp.2_Intron|ZNF540_uc002ogq.2_Intron|ZNF571_uc002ogr.1_Intron|uc002ogs.1_5'Flank|ZNF571_uc010efp.2_Nonsense_Mutation_p.Q184*	NM_016536	NP_057620	Q7Z3V5	ZN571_HUMAN	zinc finger protein 571	184	C2H2-type 2; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTCTGATGTTGAATATAGCTT	0.363													18	70	---	---	---	---	PASS
SIPA1L3	23094	broad.mit.edu	37	19	38573263	38573263	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38573263A>G	uc002ohk.2	+	3	1567	c.1058A>G	c.(1057-1059)AAC>AGC	p.N353S		NM_015073	NP_055888	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like	353					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(1)|central_nervous_system(1)	2			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TTCGACCTCAACGAGGCGGCC	0.706													26	34	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38956903	38956903	+	Missense_Mutation	SNP	C	A	A	rs139006437		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38956903C>A	uc002oit.2	+	24	3173	c.3043C>A	c.(3043-3045)CGC>AGC	p.R1015S	RYR1_uc002oiu.2_Missense_Mutation_p.R1015S	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	1015	6 X approximate repeats.|2.|Cytoplasmic.|B30.2/SPRY 2.				muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CATCCCAGCGCGCCGAAACCC	0.677													11	31	---	---	---	---	PASS
PVRL2	5819	broad.mit.edu	37	19	45375120	45375120	+	Silent	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45375120G>A	uc002ozw.1	+	3	879	c.489G>A	c.(487-489)AAG>AAA	p.K163K	PVRL2_uc002ozv.2_Silent_p.K163K	NM_001042724	NP_001036189	Q92692	PVRL2_HUMAN	poliovirus receptor related 2 isoform delta	163	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|adhesion to symbiont|cell junction assembly|homophilic cell adhesion|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target|susceptibility to natural killer cell mediated cytotoxicity|susceptibility to T cell mediated cytotoxicity|viral envelope fusion with host membrane|virion attachment, binding of host cell surface coreceptor	cell surface|integral to membrane|zonula adherens	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0	Lung NSC(12;0.00195)|all_lung(12;0.00522)	Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0143)		CCAAGCCCAAGAACCAAGCTG	0.547													10	25	---	---	---	---	PASS
ERCC2	2068	broad.mit.edu	37	19	45868093	45868093	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45868093C>T	uc002pbj.2	-						ERCC2_uc002pbi.2_5'Flank|ERCC2_uc010ejz.2_Intron|ERCC2_uc002pbk.2_Intron|ERCC2_uc002pbl.3_Intron|ERCC2_uc010xxj.1_Intron	NM_000400	NP_000391	P18074	ERCC2_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|chromosome segregation|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|UV protection|viral reproduction	cytoplasm|holo TFIIH complex|MMXD complex	5'-3' DNA helicase activity|ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding|protein C-terminus binding|protein N-terminus binding			lung(2)|pancreas(1)	3		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		CCAGCCTCCTCACTGAGTATC	0.478			Mis|N|F|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				14	53	---	---	---	---	PASS
CCDC8	83987	broad.mit.edu	37	19	46915713	46915713	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46915713G>A	uc002pep.2	-	1	1207	c.355C>T	c.(355-357)CAG>TAG	p.Q119*		NM_032040	NP_114429	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	119						plasma membrane				ovary(3)	3				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		CGCGGGCCCTGGCGGCTCTTG	0.642													48	74	---	---	---	---	PASS
GRIN2D	2906	broad.mit.edu	37	19	48945182	48945182	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48945182C>T	uc002pjc.3	+	11	2497	c.2409C>T	c.(2407-2409)ATC>ATT	p.I803I	GRIN2D_uc010elx.2_Silent_p.I38I	NM_000836	NP_000827	O15399	NMDE4_HUMAN	N-methyl-D-aspartate receptor subunit 2D	803	Extracellular (Potential).					cell junction|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|protein binding			ovary(3)|breast(3)	6		all_epithelial(76;1.11e-06)|all_lung(116;5.79e-06)|Lung NSC(112;1.18e-05)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		all cancers(93;0.00014)|OV - Ovarian serous cystadenocarcinoma(262;0.000233)|Epithelial(262;0.0112)|GBM - Glioblastoma multiforme(486;0.0161)	L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Orphenadrine(DB01173)	AGCGGCCCATCGACCTGGCGT	0.602													4	66	---	---	---	---	PASS
HAS1	3036	broad.mit.edu	37	19	52220298	52220298	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52220298C>G	uc002pxo.1	-	3	886	c.851G>C	c.(850-852)CGA>CCA	p.R284P	HAS1_uc010epc.1_5'UTR|HAS1_uc010epd.1_Missense_Mutation_p.R249P|HAS1_uc002pxn.1_Missense_Mutation_p.R291P|HAS1_uc002pxp.1_Missense_Mutation_p.R283P	NM_001523	NP_001514	Q92839	HAS1_HUMAN	hyaluronan synthase 1	284	Cytoplasmic (Potential).				cell adhesion	integral to plasma membrane	hyaluronan synthase activity|protein binding			ovary(1)|pancreas(1)	2		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		TACCCAGTATCGCAGGCTGCT	0.597													33	101	---	---	---	---	PASS
ZNF600	162966	broad.mit.edu	37	19	53270592	53270592	+	Nonsense_Mutation	SNP	A	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53270592A>T	uc002qab.3	-	3	703	c.417T>A	c.(415-417)TAT>TAA	p.Y139*		NM_198457	NP_940859	Q6ZNG1	ZN600_HUMAN	zinc finger protein 600	139					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				OV - Ovarian serous cystadenocarcinoma(262;0.0241)|GBM - Glioblastoma multiforme(134;0.0404)		AATTATTCCCATAGTTATTAG	0.373													80	133	---	---	---	---	PASS
MIR518E	574487	broad.mit.edu	37	19	54233171	54233171	+	RNA	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54233171G>A	hsa-mir-518e|MI0003169	+			c.80G>A			MIR518A1_hsa-mir-518a-1|MI0003170_5'Flank																	0						GAGTGTTAACGCTTTGAGAAA	0.403													5	63	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54310894	54310894	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54310894C>T	uc002qch.3	-	4	2318	c.2098G>A	c.(2098-2100)GCC>ACC	p.A700T	NLRP12_uc010eqw.2_5'UTR|NLRP12_uc002qci.3_Missense_Mutation_p.A700T|NLRP12_uc002qcj.3_Missense_Mutation_p.A701T|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.A701T	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	700					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TCACTGTAGGCGTCCAGCAGA	0.552													13	70	---	---	---	---	PASS
LILRB2	10288	broad.mit.edu	37	19	54783643	54783643	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54783643C>T	uc002qfb.2	-						LILRA6_uc002qew.1_Intron|LILRB2_uc010eri.2_Intron|LILRB2_uc010erj.2_Intron|LILRB2_uc002qfc.2_Intron|LILRB2_uc010yet.1_Intron|LILRB2_uc010yeu.1_Intron	NM_005874	NP_005865	Q8N423	LIRB2_HUMAN	leukocyte immunoglobulin-like receptor,						cell surface receptor linked signaling pathway|cell-cell signaling|cellular defense response|immune response|regulation of immune response	integral to plasma membrane|membrane fraction	receptor activity			skin(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		AGTGTCCTCTCACCTGTCATC	0.617													23	111	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55607623	55607623	+	Intron	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55607623C>T	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		CTCCTCCCTCCCTATACCTTC	0.642													77	170	---	---	---	---	PASS
PPP1R12C	54776	broad.mit.edu	37	19	55607648	55607648	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55607648G>T	uc002qix.2	-	7	1023	c.1007C>A	c.(1006-1008)TCT>TAT	p.S336Y	PPP1R12C_uc010yfs.1_Missense_Mutation_p.S262Y|PPP1R12C_uc002qiy.2_Missense_Mutation_p.S336Y	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C	336						cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		TTTGCTGCTAGAGGGCGCTTG	0.652													82	202	---	---	---	---	PASS
ZNF776	284309	broad.mit.edu	37	19	58265931	58265931	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58265931A>C	uc002qpx.2	+	3	1656	c.1433A>C	c.(1432-1434)CAT>CCT	p.H478P	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.H478P	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	478	C2H2-type 10; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		CTCATTCGACATCAGCAGATT	0.453													39	44	---	---	---	---	PASS
ZNF418	147686	broad.mit.edu	37	19	58438048	58438048	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58438048G>C	uc002qqs.1	-	4	1793	c.1501C>G	c.(1501-1503)CAG>GAG	p.Q501E	ZNF418_uc010yhn.1_RNA|ZNF418_uc010yho.1_Missense_Mutation_p.Q416E	NM_133460	NP_597717	Q8TF45	ZN418_HUMAN	zinc finger protein 418	501	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		TGAACTCTCTGATGAACACGA	0.448													36	158	---	---	---	---	PASS
ZNF606	80095	broad.mit.edu	37	19	58490952	58490952	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58490952C>A	uc002qqw.2	-	7	1714	c.1096G>T	c.(1096-1098)GGT>TGT	p.G366C	ZNF606_uc010yhp.1_Missense_Mutation_p.G276C	NM_025027	NP_079303	Q8WXB4	ZN606_HUMAN	zinc finger protein 606	366					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		TCTACAGTACCAATTTTTTGA	0.343													54	100	---	---	---	---	PASS
ZNF544	27300	broad.mit.edu	37	19	58773197	58773197	+	Nonsense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58773197G>T	uc010euo.2	+	7	1699	c.1225G>T	c.(1225-1227)GAG>TAG	p.E409*	ZNF544_uc010yhw.1_RNA|ZNF544_uc010yhx.1_Nonsense_Mutation_p.E381*|ZNF544_uc010yhy.1_Nonsense_Mutation_p.E381*|ZNF544_uc002qrt.3_Nonsense_Mutation_p.E267*|ZNF544_uc002qru.3_Nonsense_Mutation_p.E267*|uc002qrx.1_Intron	NM_014480	NP_055295	Q6NX49	ZN544_HUMAN	zinc finger protein 544	409	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		GAAGCCCTATGAGTGTGACCT	0.448													15	98	---	---	---	---	PASS
SIRPB2	284759	broad.mit.edu	37	20	1456912	1456912	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1456912G>A	uc002wfg.2	-	5	1157	c.929C>T	c.(928-930)GCC>GTC	p.A310V	SIRPB2_uc002wfh.3_Missense_Mutation_p.A212V	NM_001122962	NP_001116434	Q5JXA9	SIRB2_HUMAN	signal-regulatory protein beta 2 isoform 1	310	Cytoplasmic (Potential).					integral to membrane					0						GGTAGCCAGGGCCAGTAGGAG	0.602													5	144	---	---	---	---	PASS
SMOX	54498	broad.mit.edu	37	20	4163303	4163303	+	Missense_Mutation	SNP	G	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4163303G>C	uc002wkm.1	+	5	1378	c.1177G>C	c.(1177-1179)GAG>CAG	p.E393Q	SMOX_uc002wkk.1_Missense_Mutation_p.E340Q|SMOX_uc002wkl.1_Missense_Mutation_p.E340Q|SMOX_uc002wkn.1_Intron|SMOX_uc002wkp.2_Missense_Mutation_p.E393Q|SMOX_uc010zqo.1_Missense_Mutation_p.E317Q|SMOX_uc002wko.1_Missense_Mutation_p.E393Q	NM_175839	NP_787033	Q9NWM0	SMOX_HUMAN	spermine oxidase isoform 1	393					polyamine biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	polyamine oxidase activity			breast(1)	1					Spermine(DB00127)	GGACGAAGCAGAGAGCCACAC	0.597													15	82	---	---	---	---	PASS
BTBD3	22903	broad.mit.edu	37	20	11903866	11903866	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11903866G>A	uc002wnz.2	+	4	1480	c.1121G>A	c.(1120-1122)CGC>CAC	p.R374H	BTBD3_uc002wny.2_Missense_Mutation_p.R313H|BTBD3_uc002woa.2_Missense_Mutation_p.R313H|BTBD3_uc010zrf.1_Missense_Mutation_p.R223H|BTBD3_uc010zrg.1_Missense_Mutation_p.R223H|BTBD3_uc010zrh.1_Missense_Mutation_p.R223H	NM_014962	NP_055777	Q9Y2F9	BTBD3_HUMAN	BTB/POZ domain containing protein 3 isoform a	374										ovary(2)|central_nervous_system(1)	3						GTCCCCCAGCGCTGTCACCGT	0.502													9	82	---	---	---	---	PASS
NAPB	63908	broad.mit.edu	37	20	23401981	23401981	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23401981C>G	uc002wta.2	-	1	176	c.59G>C	c.(58-60)CGA>CCA	p.R20P	NAPB_uc002wtc.2_5'UTR|NAPB_uc002wtb.2_Missense_Mutation_p.R20P|NAPB_uc002wtd.3_RNA|NAPB_uc010zst.1_Missense_Mutation_p.R20P	NM_022080	NP_071363	Q9H115	SNAB_HUMAN	N-ethylmaleimide-sensitive factor attachment	20					intracellular protein transport|vesicle-mediated transport	membrane				ovary(1)	1	Lung NSC(19;0.0646)|Colorectal(13;0.0993)|all_lung(19;0.143)					GGCCTTGACTCGCTTCTCGGC	0.701													3	4	---	---	---	---	PASS
DUSP15	128853	broad.mit.edu	37	20	30436696	30436696	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30436696C>T	uc002wwu.1	-	9	716	c.639G>A	c.(637-639)CCG>CCA	p.P213P				Q9H1R2	DUS15_HUMAN	RecName: Full=Dual specificity protein phosphatase 15;          EC=3.1.3.48;          EC=3.1.3.16; AltName: Full=Vaccinia virus VH1-related dual-specific protein phosphatase Y; AltName: Full=VH1-related member Y;	213						cytoplasm|plasma membrane	protein binding|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			pancreas(1)	1			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ACTTTGGGTCCGGTGACCATC	0.567													14	26	---	---	---	---	PASS
EPB41L1	2036	broad.mit.edu	37	20	34761748	34761748	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34761748G>A	uc002xfb.2	+	2	220	c.49G>A	c.(49-51)GAG>AAG	p.E17K	EPB41L1_uc002xeu.2_Intron|EPB41L1_uc010zvo.1_Missense_Mutation_p.E17K|EPB41L1_uc002xev.2_Missense_Mutation_p.E17K|EPB41L1_uc002xew.2_Intron|EPB41L1_uc002xex.2_Intron|EPB41L1_uc002xey.2_Missense_Mutation_p.E17K|EPB41L1_uc002xez.2_Intron	NM_012156	NP_036288	Q9H4G0	E41L1_HUMAN	erythrocyte membrane protein band 4.1-like 1	17					cortical actin cytoskeleton organization|synaptic transmission	cytoskeleton|cytosol|extrinsic to membrane|plasma membrane	actin binding|structural molecule activity			ovary(2)|pancreas(1)	3	Breast(12;0.0239)					AGCTCAGGAGGAGGCCCCGCA	0.622													8	65	---	---	---	---	PASS
DOK5	55816	broad.mit.edu	37	20	53205259	53205259	+	Missense_Mutation	SNP	A	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:53205259A>C	uc002xwy.2	+	4	543	c.323A>C	c.(322-324)CAG>CCG	p.Q108P	DOK5_uc010gin.2_5'UTR|DOK5_uc002xwz.2_5'UTR	NM_018431	NP_060901	Q9P104	DOK5_HUMAN	docking protein 5	108	PH.						insulin receptor binding			ovary(1)	1			Colorectal(105;0.202)			AAAGTACTCCAGATGGAGTGT	0.453													36	55	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19713822	19713822	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19713822G>A	uc002ykw.2	-	13	1503	c.1472C>T	c.(1471-1473)GCG>GTG	p.A491V		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	491	Extracellular (Potential).|MAM.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						GTCATCCAACGCAATATCACT	0.388													4	99	---	---	---	---	PASS
SLC7A4	6545	broad.mit.edu	37	22	21384233	21384233	+	Missense_Mutation	SNP	G	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21384233G>T	uc002zud.2	-	3	1458	c.1390C>A	c.(1390-1392)CCC>ACC	p.P464T	SLC7A4_uc002zue.2_Missense_Mutation_p.P464T	NM_004173	NP_004164	O43246	CTR4_HUMAN	solute carrier family 7 (cationic amino acid	464					cellular amino acid metabolic process	integral to membrane	basic amino acid transmembrane transporter activity			ovary(1)|lung(1)	2	all_cancers(11;2.85e-22)|Lung NSC(8;4.21e-14)|all_lung(8;6.08e-13)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0968)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)		L-Arginine(DB00125)|L-Lysine(DB00123)|L-Ornithine(DB00129)	CCCAGGTAGGGCCTCAGGGCT	0.617													5	75	---	---	---	---	PASS
TOP3B	8940	broad.mit.edu	37	22	22324733	22324733	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22324733C>T	uc002zvs.2	-	6	865	c.430G>A	c.(430-432)GAG>AAG	p.E144K	TOP3B_uc010gtm.1_5'Flank|TOP3B_uc002zvr.2_5'Flank|TOP3B_uc010gtl.2_Missense_Mutation_p.E144K|TOP3B_uc002zvt.3_Missense_Mutation_p.E144K	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	144	Toprim.				DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		ACGGTCTTCTCGCCACCATGG	0.612													10	41	---	---	---	---	PASS
PIWIL3	440822	broad.mit.edu	37	22	25145673	25145673	+	Silent	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25145673C>G	uc003abd.1	-	10	1620	c.1203G>C	c.(1201-1203)CTG>CTC	p.L401L	PIWIL3_uc011ajx.1_Silent_p.L292L|PIWIL3_uc011ajy.1_Silent_p.L292L|PIWIL3_uc010gut.1_Silent_p.L401L	NM_001008496	NP_001008496	Q7Z3Z3	PIWL3_HUMAN	piwi-like 3	401	PAZ.				cell differentiation|gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatogenesis	cytoplasm	RNA binding			ovary(3)|central_nervous_system(1)	4						TCATGTGGCACAGCTGAGGAA	0.478													22	40	---	---	---	---	PASS
ZNRF3	84133	broad.mit.edu	37	22	29445639	29445639	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29445639C>T	uc003aeg.2	+	8	1335	c.1170C>T	c.(1168-1170)CTC>CTT	p.L390L	ZNRF3_uc003aeh.1_Silent_p.L390L	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	490	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1						CACCTAGCCTCGCACCCCGGG	0.682													7	25	---	---	---	---	PASS
ZNRF3	84133	broad.mit.edu	37	22	29446217	29446217	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29446217C>T	uc003aeg.2	+	8	1913	c.1748C>T	c.(1747-1749)TCA>TTA	p.S583L	ZNRF3_uc003aeh.1_Missense_Mutation_p.S583L	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	683	Cytoplasmic (Potential).					integral to membrane	zinc ion binding			ovary(1)	1						AGCTCTACCTCAGAAGTGGGG	0.662													21	116	---	---	---	---	PASS
KREMEN1	83999	broad.mit.edu	37	22	29490392	29490392	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29490392G>A	uc011akm.1	+	2	257	c.244G>A	c.(244-246)GAG>AAG	p.E82K	KREMEN1_uc003ael.2_Missense_Mutation_p.E82K|KREMEN1_uc011akn.1_5'UTR	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1	80	Extracellular (Potential).|Kringle.				cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						GGGCCTGGGTGAGCACAACTA	0.483													35	53	---	---	---	---	PASS
MORC2	22880	broad.mit.edu	37	22	31345808	31345808	+	Nonsense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31345808G>A	uc003aje.1	-	6	1425	c.61C>T	c.(61-63)CAG>TAG	p.Q21*		NM_014941	NP_055756	Q9Y6X9	MORC2_HUMAN	MORC family CW-type zinc finger 2	83							ATP binding|zinc ion binding			ovary(1)|pancreas(1)	2						TTCCCAAACTGGATCACACTG	0.478													30	82	---	---	---	---	PASS
C1QTNF6	114904	broad.mit.edu	37	22	37578732	37578732	+	Missense_Mutation	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37578732C>A	uc003aqw.1	-	2	781	c.276G>T	c.(274-276)ATG>ATT	p.M92I	C1QTNF6_uc003aqx.1_Missense_Mutation_p.M111I|C1QTNF6_uc003aqy.1_Missense_Mutation_p.M111I|C1QTNF6_uc003aqz.1_Intron	NM_182486	NP_872292	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	92	Collagen-like.					collagen					0						CCTCCCTGCCCATGTACCCTG	0.657													8	42	---	---	---	---	PASS
MICALL1	85377	broad.mit.edu	37	22	38323472	38323472	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38323472C>T	uc003aui.2	+	9	1604	c.1520C>T	c.(1519-1521)CCA>CTA	p.P507L		NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13	507	Pro-rich.					cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					ACACCATCGCCAGCGCTCAGC	0.672													14	48	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42189826	42189826	+	Intron	SNP	T	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42189826T>C	uc003baz.1	+						WBP2NL_uc011ape.1_Intron|LOC339674_uc003bba.1_Intron|MEI1_uc011apd.1_Intron|MEI1_uc003bbb.1_Intron|MEI1_uc003bbc.1_Intron|MEI1_uc010gym.1_Intron|MEI1_uc003bbd.1_Intron|MEI1_uc010gyn.1_Intron|MEI1_uc003bbe.1_Intron|MEI1_uc011apf.1_Intron|MEI1_uc010gyo.1_Intron|MEI1_uc003bbf.2_Intron|MEI1_uc003bbg.2_Intron	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1								binding			central_nervous_system(1)|skin(1)	2						TTTTTTTTTTTCTGCAGAAGG	0.289													4	17	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46792655	46792655	+	Intron	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46792655G>A	uc003bhw.1	-						CELSR1_uc011arc.1_Intron	NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1						central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGCAAGGACAGAGCCAGCATT	0.572													3	14	---	---	---	---	PASS
BRD1	23774	broad.mit.edu	37	22	50170800	50170800	+	Silent	SNP	C	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50170800C>A	uc003biv.2	-	9	3097	c.2610G>T	c.(2608-2610)GCG>GCT	p.A870A	BRD1_uc011arf.1_Silent_p.A596A|BRD1_uc011arg.1_Silent_p.A919A|BRD1_uc011arh.1_Silent_p.A870A|BRD1_uc003biu.3_Silent_p.A1001A	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1	870					histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		CACATTTGGGCGCATTAAAGC	0.637													48	105	---	---	---	---	PASS
CRLF2	64109	broad.mit.edu	37	X	1325354	1325354	+	RNA	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1325354G>A	uc004cpm.1	-	3		c.321C>T						Q9HC73	CRLF2_HUMAN	Homo sapiens mRNA for IL-XR, complete cds.							extracellular region|integral to membrane|plasma membrane	receptor activity			haematopoietic_and_lymphoid_tissue(7)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				GACTTGCGGTGAAAACGGGGT	0.493			Mis|T	P2RY8|IGH@	B-ALL|Downs associated ALL								17	181	---	---	---	---	PASS
OFD1	8481	broad.mit.edu	37	X	13771542	13771542	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13771542G>A	uc004cvp.3	+	11	1470	c.1111G>A	c.(1111-1113)GAT>AAT	p.D371N	OFD1_uc004cvr.3_5'UTR|OFD1_uc011mil.1_5'UTR|OFD1_uc004cvq.3_Missense_Mutation_p.D231N|OFD1_uc010nen.2_Missense_Mutation_p.D370N|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.D330N|OFD1_uc004cvv.3_Missense_Mutation_p.D330N|OFD1_uc010neo.1_Missense_Mutation_p.D117N	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	371	Potential.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						ACTGATTGAAGATGAAAGGAA	0.363													131	16	---	---	---	---	PASS
BMX	660	broad.mit.edu	37	X	15540664	15540664	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15540664C>G	uc004cww.2	+	7	894	c.706C>G	c.(706-708)CCA>GCA	p.P236A	BMX_uc004cwx.3_Missense_Mutation_p.P236A|BMX_uc004cwy.3_Missense_Mutation_p.P236A	NM_203281	NP_975010	P51813	BMX_HUMAN	BMX non-receptor tyrosine kinase	236					cellular component disassembly involved in apoptosis|intracellular signal transduction|mesoderm development	cytosol	ATP binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|signal transducer activity			lung(3)|ovary(2)	5	Hepatocellular(33;0.183)					GCAGTATATTCCAAGGGAAGA	0.483													25	120	---	---	---	---	PASS
TMEM27	57393	broad.mit.edu	37	X	15646095	15646095	+	Silent	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15646095C>T	uc004cxc.1	-	6	924	c.668G>A	c.(667-669)TGA>TAA	p.*223*		NM_020665	NP_065716	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27 precursor	223					proteolysis	integral to membrane	metallopeptidase activity|peptidyl-dipeptidase activity			ovary(1)	1	Hepatocellular(33;0.183)					AACAGCCCTTCAGAGAGGGGT	0.438													11	53	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64753613	64753613	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64753613G>A	uc004dwa.1	-	2	311	c.239C>T	c.(238-240)TCA>TTA	p.S80L	LAS1L_uc004dwc.1_Missense_Mutation_p.S80L|LAS1L_uc004dwd.1_Intron	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like	80						MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						TTCGTTGCCTGACCTAAAGGG	0.517													14	18	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72433467	72433467	+	Missense_Mutation	SNP	C	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72433467C>G	uc004ebi.2	-	1	1218	c.862G>C	c.(862-864)GAA>CAA	p.E288Q	NAP1L2_uc011mqj.1_Missense_Mutation_p.E146Q	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	288					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					AAGTGAAATTCTAGTGTGAAA	0.383													4	72	---	---	---	---	PASS
NAP1L2	4674	broad.mit.edu	37	X	72434097	72434097	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:72434097C>T	uc004ebi.2	-	1	588	c.232G>A	c.(232-234)GAT>AAT	p.D78N	NAP1L2_uc011mqj.1_Intron	NM_021963	NP_068798	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	78					nucleosome assembly	chromatin assembly complex				lung(1)	1	Renal(35;0.156)					TCATCAGTATCGCCACCTTTT	0.498													5	72	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694327	109694327	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694327C>T	uc004eor.1	+	3	728	c.482C>T	c.(481-483)TCT>TTT	p.S161F	RGAG1_uc011msr.1_Missense_Mutation_p.S161F	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	161										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCACCAGATTCTGCAGAGATA	0.483													30	71	---	---	---	---	PASS
PGRMC1	10857	broad.mit.edu	37	X	118370591	118370591	+	Missense_Mutation	SNP	A	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118370591A>G	uc004erb.2	+	1	381	c.265A>G	c.(265-267)ATA>GTA	p.I89V	PGRMC1_uc011mts.1_Missense_Mutation_p.I89V	NM_006667	NP_006658	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	89	Cytochrome b5 heme-binding.|Cytoplasmic (Potential).					cell surface|endoplasmic reticulum membrane|integral to membrane|microsome|nucleolus	heme binding|protein binding|receptor activity|steroid binding				0						GGACCCGCGCATACTCATGGC	0.677													11	5	---	---	---	---	PASS
CT47A6	728062	broad.mit.edu	37	X	120094533	120094533	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:120094533C>T	uc004eth.2	-	1	805	c.550G>A	c.(550-552)GAG>AAG	p.E184K	CT47A1_uc004eti.2_Intron	NM_001080141	NP_001073610	Q5JQC4	CT47A_HUMAN	cancer/testis antigen family 47, member A6	184											0						CCCAGGCCCTCGCCCGCCCGG	0.746													23	97	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130215674	130215674	+	Missense_Mutation	SNP	G	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130215674G>A	uc004evz.2	+	2	380	c.35G>A	c.(34-36)AGG>AAG	p.R12K	ARHGAP36_uc004ewa.2_Intron|ARHGAP36_uc004ewb.2_Intron|ARHGAP36_uc004ewc.2_5'Flank	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	12					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						AAGGCAGCAAGGGCACTGTGC	0.522													66	16	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144906425	144906425	+	Missense_Mutation	SNP	T	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144906425T>A	uc004fcd.2	+	5	3472	c.2482T>A	c.(2482-2484)TCA>ACA	p.S828T	SLITRK2_uc010nsp.2_Missense_Mutation_p.S828T|SLITRK2_uc010nso.2_Missense_Mutation_p.S828T|SLITRK2_uc011mwq.1_Missense_Mutation_p.S828T|SLITRK2_uc011mwr.1_Missense_Mutation_p.S828T|SLITRK2_uc011mws.1_Missense_Mutation_p.S828T|SLITRK2_uc004fcg.2_Missense_Mutation_p.S828T|SLITRK2_uc011mwt.1_Missense_Mutation_p.S828T|CXorf1_uc004fch.2_5'Flank	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	828	Cytoplasmic (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					TAAGCCGCAATCAGAACCGGA	0.458													16	70	---	---	---	---	PASS
SLITRK2	84631	broad.mit.edu	37	X	144906426	144906426	+	Missense_Mutation	SNP	C	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:144906426C>T	uc004fcd.2	+	5	3473	c.2483C>T	c.(2482-2484)TCA>TTA	p.S828L	SLITRK2_uc010nsp.2_Missense_Mutation_p.S828L|SLITRK2_uc010nso.2_Missense_Mutation_p.S828L|SLITRK2_uc011mwq.1_Missense_Mutation_p.S828L|SLITRK2_uc011mwr.1_Missense_Mutation_p.S828L|SLITRK2_uc011mws.1_Missense_Mutation_p.S828L|SLITRK2_uc004fcg.2_Missense_Mutation_p.S828L|SLITRK2_uc011mwt.1_Missense_Mutation_p.S828L|CXorf1_uc004fch.2_5'Flank	NM_032539	NP_115928	Q9H156	SLIK2_HUMAN	SLIT and NTRK-like family, member 2 precursor	828	Cytoplasmic (Potential).					integral to membrane				ovary(5)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCCGCAATCAGAACCGGAC	0.458													16	70	---	---	---	---	PASS
DNAJC11	55735	broad.mit.edu	37	1	6700131	6700132	+	Intron	INS	-	A	A	rs71568659		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6700131_6700132insA	uc001aof.2	-						DNAJC11_uc010nzt.1_Intron|DNAJC11_uc001aog.2_Intron|DNAJC11_uc010nzu.1_Intron	NM_018198	NP_060668	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11						protein folding		heat shock protein binding|unfolded protein binding			ovary(1)|skin(1)	2	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		GGGAAAAATACAAAAAAAAAAA	0.500													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116891725	116891725	+	IGR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116891725delA								C1orf161 (213864 upstream) : ATP1A1 (23279 downstream)																							taaggagcttaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142538007	142538021	+	IGR	DEL	TGGAGTGGAGCTGAG	-	-	rs67314244		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142538007_142538021delTGGAGTGGAGCTGAG								None (None upstream) : None (None downstream)																							tggaatgaattggagtggagctgagtggagtggag	0.153													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143274068	143274068	+	IGR	DEL	C	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143274068delC								None (None upstream) : LOC100286793 (373571 downstream)																							ctgaccctgacccctgaccct	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	204363980	204363980	+	IGR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204363980delA								LOC127841 (25133 upstream) : PPP1R15B (8514 downstream)																							tttgtttttcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
C1orf55	163859	broad.mit.edu	37	1	226180814	226180816	+	Intron	DEL	TTC	-	-	rs66975923		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226180814_226180816delTTC	uc001hpu.3	-						C1orf55_uc001hpv.2_Intron	NM_152608	NP_689821	Q6IQ49	CA055_HUMAN	hypothetical protein LOC163859											lung(1)	1	Breast(184;0.197)					TCTACTTTCTTTCTTTTTTTTTT	0.305													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	16134251	16134266	+	IGR	DEL	CTTCCTTCCTTCCTTC	-	-	rs71938919		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:16134251_16134266delCTTCCTTCCTTCCTTC								MYCN (47123 upstream) : FAM49A (599635 downstream)																							ttctttctttcttccttccttccttccttccttcct	0.028													6	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29129301	29129301	+	Intron	DEL	T	-	-	rs113220687		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29129301delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					cagccttaaattttttttttt	0.194													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91801506	91801507	+	IGR	INS	-	A	A	rs141536533		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91801506_91801507insA								None (None upstream) : LOC654342 (3685 downstream)																							attttctatttttttttttttt	0.000													6	3	---	---	---	---	
TBR1	10716	broad.mit.edu	37	2	162276925	162276927	+	Intron	DEL	TCT	-	-	rs145401096		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162276925_162276927delTCT	uc002ubw.1	+						TBR1_uc010foy.2_Intron	NM_006593	NP_006584	Q16650	TBR1_HUMAN	T-box, brain, 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						ttcttcttcctcttctttttttt	0.315													4	5	---	---	---	---	
ABCB11	8647	broad.mit.edu	37	2	169801324	169801324	+	Intron	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169801324delG	uc002ueo.1	-						ABCB11_uc010zda.1_Intron|ABCB11_uc010zdb.1_Intron	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),						bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	TGAGAAAAAAGGAAAAATAAC	0.343													21	12	---	---	---	---	
KIAA1715	80856	broad.mit.edu	37	2	176794784	176794784	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176794784delC	uc002ukc.1	-	13	1391	c.1198delG	c.(1198-1200)GCCfs	p.A400fs	KIAA1715_uc010zer.1_Frame_Shift_Del_p.A431fs|KIAA1715_uc010fqw.1_Frame_Shift_Del_p.A466fs|KIAA1715_uc010zes.1_Frame_Shift_Del_p.A402fs|KIAA1715_uc002ukd.1_Frame_Shift_Del_p.A277fs|KIAA1715_uc010zet.1_RNA	NM_030650	NP_085153	Q9C0E8	LNP_HUMAN	Lunapark	400	Cytoplasmic (Potential).					integral to membrane	protein binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			ATCACTGAGGCTTCCTCATTC	0.433													116	68	---	---	---	---	
TRAK2	66008	broad.mit.edu	37	2	202272482	202272483	+	Intron	INS	-	T	T	rs149839068	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202272482_202272483insT	uc002uyb.3	-						TRAK2_uc002uyc.2_Intron	NM_015049	NP_055864	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2							early endosome|plasma membrane	GABA receptor binding				0						TAGTAGTATAGTTTTTTTTTCT	0.238													5	3	---	---	---	---	
NBEAL1	65065	broad.mit.edu	37	2	204002728	204002729	+	Intron	INS	-	G	G	rs10180704	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204002728_204002729insG	uc002uzt.3	+						NBEAL1_uc002uzs.3_Intron	NM_001114132	NP_001107604	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1 isoform 3								binding			ovary(1)|skin(1)	2						aaaaaaaaaaaTTCAATTTCCA	0.163													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228614557	228614558	+	IGR	INS	-	TCCTTCCTTCCTTCCT	TCCTTCCTTCCTTCCT	rs141805638	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228614557_228614558insTCCTTCCTTCCTTCCT								SLC19A3 (31812 upstream) : CCL20 (64000 downstream)																							ACTTAAATGAAtccttccttcc	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232509791	232509791	+	IGR	DEL	T	-	-	rs34336942		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232509791delT								C2orf57 (50799 upstream) : PTMA (63444 downstream)																							cctttctttcttttttttttt	0.124													4	2	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241724244	241724244	+	Intron	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241724244delA	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGGGGGGGGGACGTCCACACC	0.657													4	2	---	---	---	---	
SCN10A	6336	broad.mit.edu	37	3	38755241	38755241	+	Intron	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38755241delG	uc003ciq.2	-							NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha						sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	ggagtataatggcacaatctc	0.109													4	2	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53898562	53898563	+	Intron	INS	-	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53898562_53898563insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		actatgtctccaaaaaaaaaaa	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	105797748	105797751	+	IGR	DEL	CCTT	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105797748_105797751delCCTT								CBLB (209482 upstream) : LOC100302640 (757909 downstream)																							tccttcctccccttccttccttcc	0.000													3	4	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173262049	173262050	+	Intron	INS	-	GT	GT	rs138469634	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173262049_173262050insGT	uc003fio.1	+							NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			gattatattacgtgtgtgtgtg	0.054													5	3	---	---	---	---	
IGF2BP2	10644	broad.mit.edu	37	3	185540779	185540779	+	Intron	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185540779delA	uc003fpo.2	-						IGF2BP2_uc010hyi.2_5'Flank|IGF2BP2_uc010hyj.2_5'Flank|IGF2BP2_uc010hyk.2_5'Flank|IGF2BP2_uc010hyl.2_5'Flank|IGF2BP2_uc003fpp.2_Intron|IGF2BP2_uc003fpq.2_Intron	NM_006548	NP_006539	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding						anatomical structure morphogenesis|negative regulation of translation	cytoskeletal part|cytosol|nucleus	mRNA 3'-UTR binding|mRNA 5'-UTR binding|nucleotide binding|protein binding|translation regulator activity				0	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TAATGAAAGTAAAAAAAAAAA	0.388													4	2	---	---	---	---	
ST6GAL1	6480	broad.mit.edu	37	3	186704984	186704985	+	Intron	INS	-	A	A	rs59834484		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186704984_186704985insA	uc003frb.2	+						ST6GAL1_uc003frc.2_Intron	NM_173216	NP_775323	P15907	SIAT1_HUMAN	ST6 beta-galactosamide						humoral immune response|post-translational protein modification|protein N-linked glycosylation via asparagine	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			central_nervous_system(1)	1	all_cancers(143;2.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;8.53e-19)	GBM - Glioblastoma multiforme(93;0.0939)		gggagggagggagggaaggaaa	0.099													9	5	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	65736	65736	+	Intron	DEL	A	-	-	rs113723441		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:65736delA	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ggcctcccctaaagcagaagc	0.000													4	2	---	---	---	---	
FAM114A1	92689	broad.mit.edu	37	4	38879585	38879586	+	Intron	INS	-	A	A	rs34317975		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38879585_38879586insA	uc003gtn.2	+						FAM114A1_uc011byh.1_Intron|FAM114A1_uc011byg.1_Intron	NM_138389	NP_612398	Q8IWE2	NXP20_HUMAN	hypothetical protein LOC92689							cytoplasm				ovary(1)	1						aactccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
SLAIN2	57606	broad.mit.edu	37	4	48344500	48344501	+	Intron	INS	-	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48344500_48344501insT	uc003gya.3	+							NM_020846	NP_065897	Q9P270	SLAI2_HUMAN	SLAIN motif family, member 2							centrosome					0						AAGATACTGGCTTTCGGATGGT	0.579													4	4	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13839438	13839438	+	Intron	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13839438delG	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TAAAAATGGTGGGGGTTGGGG	0.393									Kartagener_syndrome				63	28	---	---	---	---	
SYCP2L	221711	broad.mit.edu	37	6	10964195	10964195	+	Intron	DEL	T	-	-	rs149829365		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:10964195delT	uc003mzo.2	+						SYCP2L_uc010jow.2_Intron	NM_001040274	NP_001035364	Q5T4T6	SYC2L_HUMAN	synaptonemal complex protein 2-like							nucleus				ovary(1)|skin(1)	2	Breast(50;0.0838)|Ovarian(93;0.107)	all_hematologic(90;0.135)	Epithelial(50;0.239)			AACTTCTCCAttttttttttt	0.224													3	3	---	---	---	---	
DNAH8	1769	broad.mit.edu	37	6	38759300	38759300	+	Intron	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38759300delT	uc003ooe.1	+							NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GAAAGAAGAGTTTTTTTTTCT	0.343													20	20	---	---	---	---	
KLHL31	401265	broad.mit.edu	37	6	53517289	53517290	+	Intron	INS	-	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53517289_53517290insA	uc003pcb.3	-						uc003pcc.1_3'UTR	NM_001003760	NP_001003760	Q9H511	KLH31_HUMAN	kelch repeat and BTB (POZ) domain containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent					ovary(1)	1	Lung NSC(77;0.0158)					TCTCAGCCAGTAAAAATGTGTG	0.540													6	3	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53784268	53784269	+	Intron	INS	-	T	T	rs142498215		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53784268_53784269insT	uc003pcd.1	+							NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		TGTGATGTCTCtttttttaaaa	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	12717227	12717228	+	IGR	DEL	CA	-	-	rs60233257		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:12717227_12717228delCA								SCIN (24002 upstream) : ARL4A (9253 downstream)																							TACAAACGATcacacacacaca	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57929339	57929342	+	IGR	DEL	TTTG	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57929339_57929342delTTTG								ZNF716 (396074 upstream) : None (None downstream)																							CACATTCTGATTTGTTTTTTGTAT	0.363													5	4	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157941666	157941666	+	Intron	DEL	C	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157941666delC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		TTCAATGACACCCCATCTCAC	0.552													4	2	---	---	---	---	
KIAA0146	23514	broad.mit.edu	37	8	48614647	48614660	+	Intron	DEL	TCTCTCTCTCTCTT	-	-	rs35588989	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48614647_48614660delTCTCTCTCTCTCTT	uc003xqd.2	+						KIAA0146_uc011ldb.1_Intron|KIAA0146_uc010lxs.2_Intron|KIAA0146_uc011ldc.1_Intron|KIAA0146_uc011ldd.1_Intron|KIAA0146_uc003xqe.2_Intron|KIAA0146_uc003xqf.2_Intron|KIAA0146_uc011lde.1_Intron|KIAA0146_uc010lxt.2_Intron|KIAA0146_uc011ldf.1_Intron|KIAA0146_uc011ldg.1_Intron	NM_001080394	NP_001073863	Q14159	K0146_HUMAN	hypothetical protein LOC23514												0		Lung NSC(58;0.175)				tctctctctctctctctctctctTacacacacac	0.173													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	127921652	127921662	+	IGR	DEL	TCCTTCCTTCC	-	-	rs58044433		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:127921652_127921662delTCCTTCCTTCC								FAM84B (351186 upstream) : LOC727677 (380400 downstream)																							cttccttccttccttccttccttttttttct	0.104													6	5	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	129015195	129015196	+	Intron	INS	-	CCTC	CCTC	rs138039280	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:129015195_129015196insCCTC	uc010mdq.2	+						PVT1_uc003ysl.2_Intron	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						ctccctctctgcctccctccct	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68429938	68429938	+	IGR	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68429938delT								FAM27B (635749 upstream) : MIR1299 (572301 downstream)																							TCAGttttcattttttcagac	0.199													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132202148	132202151	+	IGR	DEL	TTCC	-	-	rs71964978		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132202148_132202151delTTCC								C9orf106 (117266 upstream) : C9orf50 (172355 downstream)																							TCCTTCTTGAttccttccttcctt	0.294													5	3	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93695680	93695681	+	Intron	INS	-	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93695680_93695681insT	uc001khr.2	+						BTAF1_uc009xua.1_Intron	NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				AAGACTTAAACTTTTTTTTTTT	0.282													6	3	---	---	---	---	
SEC31B	25956	broad.mit.edu	37	10	102275671	102275672	+	Intron	INS	-	G	G	rs143845466	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102275671_102275672insG	uc001krc.1	-						SEC31B_uc010qpo.1_Intron|SEC31B_uc001krd.1_Intron|SEC31B_uc001krf.1_Intron|SEC31B_uc001kre.1_Intron|SEC31B_uc010qpp.1_Intron|SEC31B_uc009xwn.1_Intron|SEC31B_uc009xwo.1_Intron|SEC31B_uc010qpq.1_Intron|SEC31B_uc010qpr.1_Intron	NM_015490	NP_056305	Q9NQW1	SC31B_HUMAN	SEC31 homolog B						protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle membrane				ovary(1)	1		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		CTGACTGGAAAGGGGGGGGGTG	0.480													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	132588812	132588813	+	IGR	INS	-	C	C			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:132588812_132588813insC								GLRX3 (606028 upstream) : TCERG1L (301843 downstream)																							caccacactcacccccacacac	0.000													4	3	---	---	---	---	
IGF2	3481	broad.mit.edu	37	11	2153023	2153026	+	3'UTR	DEL	GTGT	-	-	rs141005898		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2153023_2153026delGTGT	uc009yde.2	-	4					IGF2_uc001lvf.2_RNA|IGF2_uc001lvg.2_3'UTR|IGF2_uc009ydf.2_3'UTR|IGF2_uc001lvh.2_3'UTR|INS-IGF2_uc001lvi.2_RNA	NM_001007139	NP_001007140	P01344	IGF2_HUMAN	insulin-like growth factor 2 isoform 1						glucose metabolic process|ossification|phosphatidylinositol 3-kinase cascade involved in insulin receptor signaling|positive regulation of activated T cell proliferation|positive regulation of cell division|positive regulation of glycogen (starch) synthase activity|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|regulation of gene expression by genetic imprinting|regulation of transcription, DNA-dependent|skeletal system development	extracellular space	growth factor activity|hormone activity|insulin receptor binding|insulin-like growth factor receptor binding|protein serine/threonine kinase activator activity|receptor activator activity			central_nervous_system(1)	1		all_epithelial(84;5.04e-06)|Breast(177;0.000777)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)|all_lung(207;0.24)	Colorectal(5;0.0179)|COAD - Colon adenocarcinoma(6;0.029)	BRCA - Breast invasive adenocarcinoma(625;1.09e-05)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.153)		ctgtgtgctagtgtgtgtgctgtg	0.000											OREG0003766|OREG0003765	type=REGULATORY REGION|Gene=AK074614|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=C11orf43|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	4	4	---	---	---	---	
PDHX	8050	broad.mit.edu	37	11	34938098	34938098	+	5'UTR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34938098delA	uc001mvt.2	+	1					PDHX_uc010rep.1_Intron|PDHX_uc010req.1_5'UTR|APIP_uc010reo.1_5'Flank|APIP_uc001mvs.2_5'Flank	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X						pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			TGAGAGACCTAAAGGCACCGC	0.667													8	5	---	---	---	---	
FAM180B	399888	broad.mit.edu	37	11	47606232	47606232	+	5'Flank	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47606232delT	uc001ngb.1	+									Q6P0A1	F180B_HUMAN	RecName: Full=Protein FAM180B;							integral to membrane					0						CTTTGATGGGttttttttttt	0.269													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	64211760	64211763	+	IGR	DEL	TTCC	-	-	rs7943485	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64211760_64211763delTTCC								RPS6KA4 (72074 upstream) : SLC22A11 (111335 downstream)																							ctttctttctttccttccttcctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	90017337	90017337	+	IGR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:90017337delA								CHORDC1 (60805 upstream) : MIR1261 (584952 downstream)																							TCATTAACATAAAAAAAAaag	0.164													2	4	---	---	---	---	
NPAT	4863	broad.mit.edu	37	11	108043724	108043724	+	Frame_Shift_Del	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108043724delA	uc001pjz.3	-	13	2089	c.1987delT	c.(1987-1989)TCAfs	p.S663fs	NPAT_uc010rvv.1_5'Flank|NPAT_uc001pka.2_Frame_Shift_Del_p.S458fs	NM_002519	NP_002510	Q14207	NPAT_HUMAN	nuclear protein,  ataxia-telangiectasia locus	663					positive regulation of transcription, DNA-dependent|regulation of transcription involved in G1/S phase of mitotic cell cycle	Cajal body	protein C-terminus binding|protein N-terminus binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity			ovary(2)	2		all_cancers(61;2.31e-10)|all_epithelial(67;1.11e-06)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;1.05e-05)|Epithelial(105;3.01e-05)|all cancers(92;0.000816)|Colorectal(284;0.116)		ACAGAAGATGAAGGCTCCTGT	0.398													68	44	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38423009	38423009	+	IGR	DEL	C	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38423009delC								None (None upstream) : ALG10B (287548 downstream)																							gtaacccattccatgtcacca	0.000													48	24	---	---	---	---	
ATF1	466	broad.mit.edu	37	12	51208437	51208437	+	Intron	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51208437delG	uc001rww.3	+						ATF1_uc010smu.1_Intron	NM_005171	NP_005162	P18846	ATF1_HUMAN	activating transcription factor 1						innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway				EWSR1/ATF1(323)|FUS/ATF1(4)	soft_tissue(321)|ovary(2)|NS(2)|bone(2)|skin(2)	329						actcacgtttgtggcaatgct	0.000			T	EWSR1|FUS	malignant melanoma of soft parts |angiomatoid fibrous histiocytoma 								4	3	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133764701	133764702	+	Intron	INS	-	T	T	rs112587939		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133764701_133764702insT	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		TCTTTATTACCTTTTTTTTTTT	0.262													4	2	---	---	---	---	
GRK1	6011	broad.mit.edu	37	13	114321992	114321992	+	Frame_Shift_Del	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114321992delG	uc010tkf.1	+	1	399	c.291delG	c.(289-291)ACGfs	p.T97fs		NM_002929	NP_002920	Q15835	RK_HUMAN	rhodopsin kinase precursor	97	RGS.|N-terminal.				regulation of G-protein coupled receptor protein signaling pathway|rhodopsin mediated phototransduction|rhodopsin mediated signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|rhodopsin kinase activity|signal transducer activity			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			ACTATGACACGGCAGACAATG	0.582													7	23	---	---	---	---	
ELL3	80237	broad.mit.edu	37	15	44066423	44066427	+	Frame_Shift_Del	DEL	CCCAG	-	-	rs139597518		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44066423_44066427delCCCAG	uc001zsw.1	-	9	1394_1398	c.991_995delCTGGG	c.(991-996)CTGGGAfs	p.L331fs	ELL3_uc001zsv.1_Frame_Shift_Del_p.L285fs|ELL3_uc001zsx.1_Frame_Shift_Del_p.L216fs|uc001zsy.2_5'Flank	NM_025165	NP_079441	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	331_332					positive regulation of transcription elongation, DNA-dependent|positive regulation of transcription from RNA polymerase II promoter|spermatogenesis|transcription elongation from RNA polymerase II promoter	transcription elongation factor complex				ovary(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		AATCTCTGCTCCCAGCTCTATGAAC	0.507													89	45	---	---	---	---	
CEP152	22995	broad.mit.edu	37	15	49097636	49097636	+	Intron	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49097636delT	uc001zwy.2	-						CEP152_uc001zwz.2_Intron|CEP152_uc001zxa.1_Intron	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa						centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTTAGGGTTGTTTTTTTTTTA	0.299													4	2	---	---	---	---	
KIAA0430	9665	broad.mit.edu	37	16	15693011	15693012	+	Intron	INS	-	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15693011_15693012insA	uc002ddr.2	-						KIAA0430_uc002ddq.2_Intron|KIAA0430_uc010uzv.1_Intron|KIAA0430_uc010uzw.1_Intron	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1							peroxisome	nucleotide binding|RNA binding				0						TTTAAGGTATTaaaaaaaaaaa	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32095553	32095553	+	IGR	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32095553delG								ZNF267 (166927 upstream) : HERC2P4 (67057 downstream)																							CTGGGGCCCCGAGGGAGATGT	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33365420	33365420	+	IGR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33365420delA								SLC6A10P (468957 upstream) : MIR1826 (600088 downstream)																							TACAAACTATAAAAAAACAGA	0.358													5	5	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													5	4	---	---	---	---	
MYH2	4620	broad.mit.edu	37	17	10432354	10432354	+	Frame_Shift_Del	DEL	C	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10432354delC	uc010coi.2	-	27	3525	c.3397delG	c.(3397-3399)GCCfs	p.A1133fs	uc002gml.1_Intron|MYH2_uc002gmp.3_Frame_Shift_Del_p.A1133fs|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1133	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						GCCCGGGAGGCCCGCTCTGCC	0.602													29	41	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21408420	21408420	+	IGR	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21408420delA								KCNJ12 (85241 upstream) : C17orf51 (23152 downstream)																							TCTGGGCTGTAAAAAAAAAAG	0.353													4	2	---	---	---	---	
KIAA1267	284058	broad.mit.edu	37	17	44145075	44145076	+	Intron	DEL	GC	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44145075_44145076delGC	uc002ikb.2	-						KIAA1267_uc002ikc.2_Intron|KIAA1267_uc002ikd.2_Intron|KIAA1267_uc010dav.2_Intron	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058							MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				ATGTACCCAAGCGCACCCCTGC	0.381													26	14	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79399366	79399366	+	Intron	DEL	G	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79399366delG	uc002kaf.2	+							NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			tgtggttggtggtgatgtggt	0.000													4	2	---	---	---	---	
C19orf42	79086	broad.mit.edu	37	19	16770094	16770095	+	Intron	DEL	AA	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16770094_16770095delAA	uc002ner.2	-						TMEM38A_uc002nes.2_5'Flank|C19orf42_uc002neo.1_Intron|C19orf42_uc002nep.1_Intron	NM_024104	NP_077009	Q9BQ49	CS042_HUMAN	hypothetical protein LOC79086 precursor							integral to membrane					0						accttgtgtcaaaaaaaaaaaa	0.168													4	2	---	---	---	---	
FAM187B	148109	broad.mit.edu	37	19	35719750	35719750	+	5'Flank	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719750delT	uc002nyk.1	-							NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B							integral to membrane				ovary(2)	2						ACTGtttttcttttttttttt	0.249													4	3	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40715309	40715309	+	Intron	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40715309delT	uc002ona.2	+						MAP3K10_uc002onb.2_Intron	NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						ggataatttcttttttttttt	0.000													4	2	---	---	---	---	
MYH14	79784	broad.mit.edu	37	19	50764079	50764080	+	Intron	INS	-	GT	GT	rs140241247	by1000genomes	TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50764079_50764080insGT	uc002prr.1	+						MYH14_uc010enu.1_Intron|MYH14_uc002prq.1_Intron	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2						axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		tgtgtgtgcaagtgtgtgtgca	0.094													5	3	---	---	---	---	
KIR2DL3	3804	broad.mit.edu	37	19	55271765	55271766	+	Intron	DEL	GA	-	-	rs112795662		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55271765_55271766delGA	uc010erw.1	+						KIR2DS4_uc010yfj.1_Intron|KIR2DL1_uc002qgz.1_Intron|KIR2DL3_uc002qha.1_Intron|KIR3DP1_uc010yfi.1_Intron	NM_015868	NP_056952	P43628	KI2L3_HUMAN	killer cell immunoglobulin-like receptor, two						immune response|regulation of immune response	integral to plasma membrane	antigen binding|protein binding|receptor activity			ovary(2)	2				GBM - Glioblastoma multiforme(193;0.0192)		GGTGGAGGGTgagagagagaga	0.446													4	2	---	---	---	---	
RNF24	11237	broad.mit.edu	37	20	3972588	3972589	+	Intron	DEL	CA	-	-	rs35136119		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3972588_3972589delCA	uc002wkh.2	-						RNF24_uc002wki.2_Intron|RNF24_uc002wkj.2_Intron	NM_007219	NP_009150	Q9Y225	RNF24_HUMAN	ring finger protein 24 isoform 1							Golgi membrane|integral to membrane	zinc ion binding				0						cacacacacgcacacacacaca	0.262													4	2	---	---	---	---	
SLC24A3	57419	broad.mit.edu	37	20	19679414	19679414	+	Intron	DEL	A	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19679414delA	uc002wrl.2	+							NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						TGTCTCGGGGAAAAAGGGGTG	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48234052	48234053	+	IGR	INS	-	A	A			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48234052_48234053insA								PTGIS (49345 upstream) : B4GALT5 (15432 downstream)																							ctctccacaccccaccctctcc	0.015													6	3	---	---	---	---	
TCFL5	10732	broad.mit.edu	37	20	61473633	61473633	+	Intron	DEL	T	-	-	rs11475897		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61473633delT	uc002ydp.2	-						TCFL5_uc002ydo.2_Intron|DPH3B_uc011aan.1_5'Flank	NM_006602	NP_006593	Q9UL49	TCFL5_HUMAN	transcription factor-like 5 protein						cell differentiation|multicellular organismal development|regulation of cell differentiation|regulation of cell proliferation|spermatogenesis|transcription from RNA polymerase II promoter		DNA binding|sequence-specific DNA binding transcription factor activity			large_intestine(1)	1	Breast(26;5.68e-08)					AGATTTTAACTTTTTTTTTTT	0.303													4	4	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11079770	11079771	+	Intron	DEL	TG	-	-	rs148543332		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11079770_11079771delTG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TCCAAAACACTGTGCAGATGTA	0.168													4	2	---	---	---	---	
RIBC2	26150	broad.mit.edu	37	22	45813915	45813916	+	Intron	INS	-	T	T			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45813915_45813916insT	uc011aqs.1	+							NM_015653	NP_056468	Q9H4K1	RIBC2_HUMAN	RIB43A domain with coiled-coils 2												0		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)		CAACCCTACAGTTTTTTTTTTT	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	930724	930725	+	IGR	INS	-	GGAA	GGAA			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:930724_930725insGGAA								SHOX (310579 upstream) : CRLF2 (384162 downstream)																							aaaaaaGTGGGggaaggaagga	0.129													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1680330	1680333	+	IGR	DEL	CTTC	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1680330_1680333delCTTC								P2RY8 (24293 upstream) : SFRS17A (30153 downstream)																							ttctttctttcttccttccttcct	0.000													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	8434581	8434584	+	IGR	DEL	GGGA	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8434581_8434584delGGGA								VCX3B (31 upstream) : KAL1 (62332 downstream)																							TCTGATGGTGgggagggagggagg	0.216													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	75990880	75990881	+	Intron	INS	-	G	G			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:75990880_75990881insG	uc010nlv.1	-											Homo sapiens cDNA FLJ25017 fis, clone CBL01605.																		gaaagaaggaaggaaggagaaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13601466	13601467	+	IGR	INS	-	T	T	rs112972965		TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13601466_13601467insT								None (None upstream) : None (None downstream)																							AGAGCAGGCTCTTGCCCACATC	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	9478	9478	+	RNA	DEL	T	-	-			TCGA-22-5491-01	TCGA-22-5491-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:9478delT	uc011mfi.1	+	1		c.816delT			uc004cov.3_5'Flank|uc004cow.1_5'Flank|uc004cox.3_5'Flank					Homo sapiens mRNA for OK/SW-CL.16, complete cds.																		TACCTCAGAAGTTTTTTTCTT	0.522													34	75	---	---	---	---	
