Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ESPN	83715	broad.mit.edu	37	1	6512048	6512048	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6512048C>T	uc001amy.2	+	10	2385	c.2217C>T	c.(2215-2217)CTC>CTT	p.L739L	ESPN_uc001amz.2_Silent_p.L173L	NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin	739					sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TGGAGGCTCTCATCCCCACGC	0.657													7	12	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9804684	9804684	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9804684C>T	uc001aqh.2	-	8	1762	c.1003G>A	c.(1003-1005)GCC>ACC	p.A335T	CLSTN1_uc001aqi.2_Missense_Mutation_p.A325T|CLSTN1_uc010oag.1_Missense_Mutation_p.A335T	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	335	Extracellular (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		AGCAGCTCGGCAGTGCCCGCG	0.637													6	7	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12520422	12520422	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12520422G>A	uc001atv.2	+	67	12774	c.12633G>A	c.(12631-12633)GTG>GTA	p.V4211V	VPS13D_uc001atw.2_Silent_p.V4186V|VPS13D_uc001atx.2_Silent_p.V3398V|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_Silent_p.V209V	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	4210					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CCCAGGCGGTGAGAGACACAG	0.547													22	40	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12520424	12520424	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12520424G>A	uc001atv.2	+	67	12776	c.12635G>A	c.(12634-12636)AGA>AAA	p.R4212K	VPS13D_uc001atw.2_Missense_Mutation_p.R4187K|VPS13D_uc001atx.2_Missense_Mutation_p.R3399K|VPS13D_uc009vnl.2_RNA|VPS13D_uc010obd.1_Missense_Mutation_p.R210K	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	4211					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CAGGCGGTGAGAGACACAGCC	0.547													25	40	---	---	---	---	PASS
TMEM82	388595	broad.mit.edu	37	1	16069503	16069503	+	Intron	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16069503C>G	uc001axc.2	+							NM_001013641	NP_001013663	A0PJX8	TMM82_HUMAN	transmembrane protein 82							integral to membrane				breast(1)|central_nervous_system(1)	2		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CACACCCATTCTGTCCCCAAA	0.682													41	47	---	---	---	---	PASS
FBXO42	54455	broad.mit.edu	37	1	16577801	16577801	+	Silent	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16577801C>G	uc001ayg.2	-	10	1734	c.1518G>C	c.(1516-1518)CTG>CTC	p.L506L	FBXO42_uc001aye.3_Silent_p.L224L|FBXO42_uc001ayf.2_Silent_p.L413L	NM_018994	NP_061867	Q6P3S6	FBX42_HUMAN	F-box protein 42	506										upper_aerodigestive_tract(1)|skin(1)	2		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0193)|Colorectal(212;3.16e-07)|COAD - Colon adenocarcinoma(227;1.46e-05)|BRCA - Breast invasive adenocarcinoma(304;4.37e-05)|Kidney(64;0.000246)|KIRC - Kidney renal clear cell carcinoma(64;0.00336)|STAD - Stomach adenocarcinoma(313;0.0139)|READ - Rectum adenocarcinoma(331;0.0693)		AAGCGGGTTTCAGATCCCAAT	0.478													82	97	---	---	---	---	PASS
LEPRE1	64175	broad.mit.edu	37	1	43213039	43213039	+	Silent	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43213039T>A	uc001chv.2	-	14	2072	c.1959A>T	c.(1957-1959)TCA>TCT	p.S653S	LEPRE1_uc001chw.2_Silent_p.S653S|LEPRE1_uc001chx.3_Silent_p.S653S	NM_022356	NP_071751	Q32P28	P3H1_HUMAN	leprecan 1 isoform 1	653	Fe2OG dioxygenase.				negative regulation of cell proliferation	endoplasmic reticulum|proteinaceous extracellular matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			ovary(3)|lung(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TTTCAGTGCCTGAAGAGAATC	0.597											OREG0013422	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	49	59	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52827173	52827173	+	Intron	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52827173T>A	uc001ctq.1	-						CC2D1B_uc001cts.2_5'Flank	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B											ovary(2)	2						GATACCAGCCTGGCAGACACA	0.502													17	48	---	---	---	---	PASS
KANK4	163782	broad.mit.edu	37	1	62739201	62739201	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62739201G>T	uc001dah.3	-	3	1952	c.1575C>A	c.(1573-1575)GGC>GGA	p.G525G	KANK4_uc001dai.3_Intron|KANK4_uc001dag.3_5'Flank	NM_181712	NP_859063	Q5T7N3	KANK4_HUMAN	ankyrin repeat domain 38	525										ovary(3)|skin(2)|lung(1)	6						TTCTGTCGCTGCCCCACAGAA	0.602													52	46	---	---	---	---	PASS
LRRC40	55631	broad.mit.edu	37	1	70639152	70639152	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70639152G>T	uc001der.1	-	9	1159	c.1107C>A	c.(1105-1107)ATC>ATA	p.I369I		NM_017768	NP_060238	Q9H9A6	LRC40_HUMAN	leucine rich repeat containing 40	369										ovary(1)	1						AAGTACCTTTGATCTTGCTTC	0.313													20	42	---	---	---	---	PASS
AMY2B	280	broad.mit.edu	37	1	104117979	104117979	+	Intron	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:104117979A>T	uc001duq.2	+						AMY2B_uc010ouo.1_Intron|LOC648740_uc001dur.2_Intron|AMY2B_uc001dus.1_5'Flank	NM_020978	NP_066188	P19961	AMY2B_HUMAN	amylase, pancreatic, alpha-2B precursor						carbohydrate metabolic process|digestion	extracellular region	alpha-amylase activity|metal ion binding				0		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TAGAAAACCAAGTTCTCTATT	0.368													186	325	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152284369	152284369	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152284369G>T	uc001ezu.1	-	3	3029	c.2993C>A	c.(2992-2994)TCT>TAT	p.S998Y	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	998	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCTGTCTGCAGAGTGCCCGTG	0.562									Ichthyosis				234	470	---	---	---	---	PASS
PBXIP1	57326	broad.mit.edu	37	1	154919185	154919185	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154919185G>A	uc001ffr.2	-	10	1024	c.965C>T	c.(964-966)GCC>GTC	p.A322V	PBXIP1_uc001ffs.2_Missense_Mutation_p.A293V|PBXIP1_uc010pep.1_Missense_Mutation_p.A167V	NM_020524	NP_065385	Q96AQ6	PBIP1_HUMAN	pre-B-cell leukemia homeobox interacting protein	322	Potential.				cell differentiation|multicellular organismal development|negative regulation of transcription, DNA-dependent	cytosol|microtubule|nucleus	protein binding|transcription corepressor activity			large_intestine(1)	1	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCGCTGGAAGGCTTCGCCCTG	0.662													20	77	---	---	---	---	PASS
RXFP4	339403	broad.mit.edu	37	1	155911970	155911970	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155911970G>C	uc010pgs.1	+	1	491	c.470G>C	c.(469-471)TGG>TCG	p.W157S		NM_181885	NP_871001	Q8TDU9	RL3R2_HUMAN	relaxin 3 receptor 2	157	Helical; Name=4; (Potential).					integral to membrane|plasma membrane	angiotensin type II receptor activity				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCACTCTTCTGGGCCCGAATA	0.652													17	51	---	---	---	---	PASS
NES	10763	broad.mit.edu	37	1	156646867	156646867	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156646867G>C	uc001fpq.2	-	1	323	c.190C>G	c.(190-192)CGG>GGG	p.R64G		NM_006617	NP_006608	P48681	NEST_HUMAN	nestin	64	Coil 1B.|Rod.				brain development|embryonic camera-type eye development|G2/M transition of mitotic cell cycle|negative regulation of apoptosis|positive regulation of intermediate filament depolymerization|positive regulation of neural precursor cell proliferation|stem cell proliferation	cytoplasm|intermediate filament	intermediate filament binding|structural molecule activity			ovary(6)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					ACGAGGGCCCGCAGGGCCGCC	0.721													6	10	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158152847	158152847	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158152847C>T	uc001frr.2	+	5	1286	c.787C>T	c.(787-789)CTC>TTC	p.L263F	CD1D_uc009wss.2_Intron	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	263	Ig-like.|Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					GACATGGTATCTCCGAGCAAC	0.617													47	114	---	---	---	---	PASS
IGSF9	57549	broad.mit.edu	37	1	159898366	159898366	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159898366C>G	uc001fur.2	-	19	3010	c.2812G>C	c.(2812-2814)GAT>CAT	p.D938H	IGSF9_uc001fuq.2_Missense_Mutation_p.D922H|IGSF9_uc001fup.2_Missense_Mutation_p.D84H	NM_001135050	NP_001128522	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9 isoform a	938	Pro-rich.|Cytoplasmic (Potential).					cell junction|integral to membrane|synapse				ovary(2)|central_nervous_system(2)|large_intestine(1)	5	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			CAGTCCCCATCCACATTCATC	0.637													3	7	---	---	---	---	PASS
ATP1A4	480	broad.mit.edu	37	1	160147298	160147298	+	Intron	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160147298G>A	uc001fve.3	+						ATP1A4_uc001fvf.3_Intron|ATP1A4_uc001fvg.2_Intron|ATP1A4_uc001fvh.2_5'UTR	NM_144699	NP_653300	Q13733	AT1A4_HUMAN	Na+/K+ -ATPase alpha 4 subunit isoform 1						ATP biosynthetic process|ATP hydrolysis coupled proton transport|regulation of cellular pH|sperm motility	sodium:potassium-exchanging ATPase complex	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(2)|skin(2)	4	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTGCAACTCTGTCATTCACAG	0.572													5	151	---	---	---	---	PASS
LRRC52	440699	broad.mit.edu	37	1	165533067	165533067	+	3'UTR	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165533067A>G	uc001gde.2	+	2					LOC400794_uc001gdc.2_Intron|LOC400794_uc001gdd.2_Intron|LOC400794_uc009wvd.2_Intron	NM_001005214	NP_001005214	Q8N7C0	LRC52_HUMAN	leucine rich repeat containing 52 precursor							integral to membrane				ovary(1)	1	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)					TTTAGTTGCCAGAGACCACTA	0.547													35	77	---	---	---	---	PASS
POU2F1	5451	broad.mit.edu	37	1	167382320	167382320	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167382320A>G	uc001gec.2	+	16	2052	c.1890A>G	c.(1888-1890)CTA>CTG	p.L630L	POU2F1_uc001ged.2_Silent_p.L628L|POU2F1_uc001gee.2_Silent_p.L630L|POU2F1_uc010plh.1_Silent_p.L567L|POU2F1_uc001gef.2_Silent_p.L642L|POU2F1_uc001geg.2_Silent_p.L528L	NM_002697	NP_002688	P14859	PO2F1_HUMAN	POU class 2 homeobox 1	630					negative regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(2)|skin(2)|breast(1)	5						GCCCAGCTCTAATGAGCAACA	0.413													73	157	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169993564	169993564	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169993564C>T	uc001ggv.2	-	9	1286	c.1015G>A	c.(1015-1017)GAT>AAT	p.D339N	KIFAP3_uc010plx.1_Missense_Mutation_p.D41N	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	339	ARM 1.				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GTTACCATATCATTTTTATTC	0.313													4	98	---	---	---	---	PASS
ANGPTL1	9068	broad.mit.edu	37	1	178834180	178834180	+	Silent	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178834180A>T	uc001gma.2	-	3	1208	c.732T>A	c.(730-732)GGT>GGA	p.G244G	RALGPS2_uc001gly.1_Intron|RALGPS2_uc001glz.2_Intron|RALGPS2_uc010pnb.1_Intron|ANGPTL1_uc001gmb.2_Silent_p.G244G|ANGPTL1_uc010pnc.1_Silent_p.G166G	NM_004673	NP_004664	O95841	ANGL1_HUMAN	angiopoietin-like 1 precursor	244						extracellular space	receptor binding				0						CTCTGGGATAACCTGGATCCC	0.488													63	146	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	182992985	182992985	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182992985G>T	uc001gpy.3	+	1	391	c.134G>T	c.(133-135)GGG>GTG	p.G45V	LAMC1_uc001gpx.2_Missense_Mutation_p.G45V	NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	45					axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GACGAGGGCGGGCGGCCGCAG	0.468													10	26	---	---	---	---	PASS
RGL1	23179	broad.mit.edu	37	1	183861272	183861272	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183861272A>T	uc001gqo.2	+	9	1274	c.1117A>T	c.(1117-1119)ACC>TCC	p.T373S	RGL1_uc010pof.1_Missense_Mutation_p.T178S|RGL1_uc001gqm.2_Missense_Mutation_p.T408S|RGL1_uc010pog.1_Missense_Mutation_p.T371S|RGL1_uc010poh.1_Missense_Mutation_p.T371S|RGL1_uc010poi.1_Missense_Mutation_p.T373S	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation	373	Ras-GEF.				cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						TAACCATTTGACCAGCCGAGA	0.413													31	63	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190067631	190067631	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190067631C>A	uc001gse.1	-	8	2050	c.1818G>T	c.(1816-1818)CAG>CAT	p.Q606H	FAM5C_uc010pot.1_Missense_Mutation_p.Q504H	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	606						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AGTTATAACACTGCAGGGGTA	0.473													167	429	---	---	---	---	PASS
DENND1B	163486	broad.mit.edu	37	1	197480035	197480035	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197480035T>C	uc010ppe.1	-	22	2161	c.1823A>G	c.(1822-1824)GAG>GGG	p.E608G	DENND1B_uc010ppf.1_RNA	NM_001142795	NP_001136267	Q6P3S1	DEN1B_HUMAN	DENN/MADD domain containing 1B isoform 1	Error:Variant_position_missing_in_Q6P3S1_after_alignment						clathrin-coated vesicle|cytosol	guanyl-nucleotide exchange factor activity				0						AAGATTCCACTCTGCTTGGTC	0.448													40	77	---	---	---	---	PASS
PRELP	5549	broad.mit.edu	37	1	203455842	203455842	+	Missense_Mutation	SNP	G	A	A	rs147252422		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203455842G>A	uc001gzs.2	+	3	1182	c.982G>A	c.(982-984)GGA>AGA	p.G328R	PRELP_uc001gzt.2_Missense_Mutation_p.G328R	NM_002725	NP_002716	P51888	PRELP_HUMAN	proline arginine-rich end leucine-rich repeat	328	LRR 11.				skeletal system development	proteinaceous extracellular matrix	extracellular matrix structural constituent			ovary(1)|central_nervous_system(1)|pancreas(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.109)			AGAAATCAACGGAACCCAGAT	0.562													21	75	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216219838	216219838	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216219838T>A	uc001hku.1	-	32	6647	c.6260A>T	c.(6259-6261)CAG>CTG	p.Q2087L		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2087	Extracellular (Potential).|Fibronectin type-III 7.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TAAACAGTACTGAGTTATAAT	0.458										HNSCC(13;0.011)			47	134	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240371017	240371017	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240371017C>A	uc010pyd.1	+	5	3130	c.2905C>A	c.(2905-2907)CCT>ACT	p.P969T	FMN2_uc010pye.1_Missense_Mutation_p.P973T	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	969	Pro-rich.|FH1.				actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			CCTTCCTCCCCCTCTTCCCGG	0.711													24	35	---	---	---	---	PASS
OR2W5	441932	broad.mit.edu	37	1	247655202	247655202	+	Missense_Mutation	SNP	G	T	T	rs118113848	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247655202G>T	uc001icz.1	+	1	773	c.773G>T	c.(772-774)CGT>CTT	p.R258L		NM_001004698	NP_001004698	A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W,	258					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)|skin(1)	3	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			CATCATCTACGTGTACCTGAA	0.532													68	134	---	---	---	---	PASS
OR2M7	391196	broad.mit.edu	37	1	248487855	248487855	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248487855G>C	uc010pzk.1	-	1	16	c.16C>G	c.(16-18)CAG>GAG	p.Q6E		NM_001004691	NP_001004691	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M,	6	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TTGAAGGTCTGATTCTCCCAT	0.443													111	252	---	---	---	---	PASS
OR2T10	127069	broad.mit.edu	37	1	248756807	248756807	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248756807T>A	uc010pzn.1	-	1	263	c.263A>T	c.(262-264)AAA>ATA	p.K88I		NM_001004693	NP_001004693	Q8NGZ9	O2T10_HUMAN	olfactory receptor, family 2, subfamily T,	88	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTCTTGTCTTTGGCCAGCTG	0.502													33	85	---	---	---	---	PASS
TSSC1	7260	broad.mit.edu	37	2	3200790	3200790	+	Splice_Site	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3200790T>A	uc002qxj.2	-	6	710	c.517_splice	c.e6-1	p.L173_splice	TSSC1_uc002qxi.2_Splice_Site	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GCTGGCCAGCTGGGAGTGTCA	0.368													25	55	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11696901	11696901	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11696901G>T	uc002rbk.1	+						GREB1_uc002rbl.2_Intron|GREB1_uc002rbm.2_Intron|GREB1_uc002rbn.1_Intron	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		CTAGAAGGTGGGAGACGCACG	0.478													20	38	---	---	---	---	PASS
DNMT3A	1788	broad.mit.edu	37	2	25457255	25457255	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25457255A>G	uc002rgc.2	-	23	2889	c.2632T>C	c.(2632-2634)TCC>CCC	p.S878P	DNMT3A_uc002rgd.2_Missense_Mutation_p.S878P|DNMT3A_uc010eyi.2_RNA|DNMT3A_uc002rgb.2_Missense_Mutation_p.S689P	NM_022552	NP_072046	Q9Y6K1	DNM3A_HUMAN	DNA cytosine methyltransferase 3 alpha isoform	878					regulation of gene expression by genetic imprinting	cytoplasm|euchromatin|nuclear matrix	DNA (cytosine-5-)-methyltransferase activity|DNA binding|metal ion binding|protein binding			haematopoietic_and_lymphoid_tissue(133)|lung(4)|ovary(3)	140	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCATGTTGGAGACGTCAGTA	0.607			Mis|F|N|S		AML								31	62	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27800362	27800362	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27800362C>G	uc002rkz.3	+	1	974	c.923C>G	c.(922-924)TCC>TGC	p.S308C		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	308										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					GCAGAGAGATCCCCAAGGCTC	0.453													48	108	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31637530	31637530	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31637530C>G	uc002rnv.1	-	1	82	c.3G>C	c.(1-3)ATG>ATC	p.M1I		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	TGTCTGCTGTCATTGTCACAG	0.502													60	169	---	---	---	---	PASS
SOCS5	9655	broad.mit.edu	37	2	46985978	46985978	+	Silent	SNP	C	A	A	rs17853110		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46985978C>A	uc002rvf.2	+	2	473	c.309C>A	c.(307-309)ACC>ACA	p.T103T	SOCS5_uc010yoe.1_Silent_p.T72T|SOCS5_uc002rvg.2_Silent_p.T103T	NM_014011	NP_054730	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	103					cell growth|cytokine-mediated signaling pathway|intracellular signal transduction|negative regulation of signal transduction|negative regulation of T-helper 2 cell differentiation|positive regulation of T-helper 1 cell differentiation|regulation of growth					ovary(1)|lung(1)|central_nervous_system(1)	3		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CTTGTGTTACCCCAGGAACAA	0.418													68	96	---	---	---	---	PASS
FOXN2	3344	broad.mit.edu	37	2	48573599	48573599	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48573599T>C	uc002rwh.1	+	3	561	c.246T>C	c.(244-246)GTT>GTC	p.V82V		NM_002158	NP_002149	P32314	FOXN2_HUMAN	T-cell leukemia virus enhancer factor	82					embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0272)|LUSC - Lung squamous cell carcinoma(58;0.036)			TTCCAATTGTTAGTCCATTGT	0.443													111	139	---	---	---	---	PASS
EHBP1	23301	broad.mit.edu	37	2	63176065	63176065	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63176065G>T	uc002sby.2	+	14	2671	c.2189G>T	c.(2188-2190)AGT>ATT	p.S730I	EHBP1_uc010fcp.2_Missense_Mutation_p.S695I|EHBP1_uc002sbz.2_Missense_Mutation_p.S695I|EHBP1_uc002scb.2_Missense_Mutation_p.S695I	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1	730						cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GACATCGGTAGTAACTTGGAG	0.348									Hereditary_Prostate_Cancer				39	142	---	---	---	---	PASS
WDR54	84058	broad.mit.edu	37	2	74652601	74652601	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74652601G>A	uc002slb.2	+	9	916	c.856G>A	c.(856-858)GAG>AAG	p.E286K		NM_032118	NP_115494	Q9H977	WDR54_HUMAN	WD repeat domain 54	286	WD 4.										0						CAGAAACCCAGAGAGTGGCTA	0.602													107	106	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89459382	89459382	+	RNA	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89459382G>A	uc010ytr.1	-	29		c.3812C>T			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		ACTTGATGAGGAGCTTTGGAG	0.527													45	120	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89952873	89952873	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89952873G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TCCCAACCAGGACACAGCATG	0.552													26	32	---	---	---	---	PASS
UXS1	80146	broad.mit.edu	37	2	106710576	106710576	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106710576T>A	uc002tdm.2	-	15	1267	c.1169A>T	c.(1168-1170)TAC>TTC	p.Y390F	UXS1_uc002tdk.2_Missense_Mutation_p.Y188F|UXS1_uc002tdl.2_Missense_Mutation_p.Y222F|UXS1_uc002tdn.2_Missense_Mutation_p.Y395F|UXS1_uc002tdo.2_Missense_Mutation_p.Y333F	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	390	Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						TTTACGGAAGTAGTGAATTGC	0.473													8	99	---	---	---	---	PASS
ST6GAL2	84620	broad.mit.edu	37	2	107450571	107450571	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107450571A>G	uc002tdq.2	-	3	1094	c.975T>C	c.(973-975)TCT>TCC	p.S325S	ST6GAL2_uc002tdr.2_Silent_p.S325S|ST6GAL2_uc002tds.3_Silent_p.S325S	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	325	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						GTGTAGGAGCAGAGTTAAATC	0.373													10	188	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	113993073	113993073	+	Missense_Mutation	SNP	A	T	T	rs3188996	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113993073A>T	uc010yxt.1	-	9	1151	c.985T>A	c.(985-987)TTT>ATT	p.F329I	PAX8_uc010yxu.1_Silent_p.P302P|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|uc002tjp.2_5'Flank|LOC654433_uc002tjq.3_5'Flank|LOC654433_uc010fks.2_5'Flank|LOC654433_uc010fkt.2_5'Flank|LOC654433_uc002tjr.3_5'Flank	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	329					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						AGATCCAAAAAGGCGGAGCTA	0.612			T	PPARG	follicular thyroid		Thyroid dysgenesis 						3	25	---	---	---	---	PASS
MYO7B	4648	broad.mit.edu	37	2	128384551	128384551	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128384551C>A	uc002top.2	+	31	4192	c.4139C>A	c.(4138-4140)GCC>GAC	p.A1380D	MYO7B_uc002toq.1_Missense_Mutation_p.A233D|MYO7B_uc002tor.1_Missense_Mutation_p.A233D	NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB	1380	FERM 1.					apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		CCCCCTCAGGCCCCATACACT	0.597													10	14	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133540268	133540268	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133540268G>A	uc002ttp.2	-	14	4490	c.4116C>T	c.(4114-4116)ATC>ATT	p.I1372I	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1372							protein binding				0						ACTTTGGAGGGATCCTCAAAG	0.627													36	57	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141625807	141625807	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141625807C>A	uc002tvj.1	-	26	5167	c.4195G>T	c.(4195-4197)GCA>TCA	p.A1399S	LRP1B_uc010fnl.1_Missense_Mutation_p.A581S	NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	1399	Extracellular (Potential).|LDL-receptor class B 11.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGAAAATTTGCATCCCAGTCT	0.294										TSP Lung(27;0.18)			6	108	---	---	---	---	PASS
SLC4A10	57282	broad.mit.edu	37	2	162719517	162719517	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162719517T>C	uc002ubx.3	+	6	895	c.711T>C	c.(709-711)CGT>CGC	p.R237R	SLC4A10_uc010fpa.1_Silent_p.R249R|SLC4A10_uc010zcr.1_RNA|SLC4A10_uc002uby.3_Silent_p.R237R|SLC4A10_uc010zcs.1_Silent_p.R248R	NM_022058	NP_071341	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate	237	Cytoplasmic (Potential).				bicarbonate transport|chloride transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity|symporter activity			ovary(2)|lung(2)|pancreas(1)	5						CCATTGTTCGTTCCTTTGCTG	0.383													28	42	---	---	---	---	PASS
KBTBD10	10324	broad.mit.edu	37	2	170366566	170366566	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170366566C>T	uc002ueu.1	+	1	355	c.278C>T	c.(277-279)TCT>TTT	p.S93F	KBTBD10_uc010zdh.1_Intron	NM_006063	NP_006054	O60662	KBTBA_HUMAN	kelch repeat and BTB (POZ) domain containing 10	93	BTB.				striated muscle contraction	centrosome|nucleolus|plasma membrane|pseudopodium|ruffle					0						TACCTGTACTCTGCCAGTATT	0.393													8	258	---	---	---	---	PASS
KLHL23	151230	broad.mit.edu	37	2	170592599	170592599	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170592599A>T	uc002ufh.1	+	4	1413	c.1075A>T	c.(1075-1077)AGG>TGG	p.R359W	KLHL23_uc002ufi.1_Missense_Mutation_p.R359W	NM_144711	NP_653312	Q8NBE8	KLH23_HUMAN	kelch-like 23	359	Kelch 2.										0						GCTCAATGCCAGGTATTACCA	0.473													115	173	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098959	178098959	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098959T>C	uc002ulh.3	-	2	641	c.86A>G	c.(85-87)GAT>GGT	p.D29G	NFE2L2_uc002ulg.3_Missense_Mutation_p.D13G|NFE2L2_uc010zfa.1_Missense_Mutation_p.D13G|NFE2L2_uc002uli.3_Missense_Mutation_p.D13G|NFE2L2_uc010fra.2_Missense_Mutation_p.D13G|NFE2L2_uc010frb.2_Missense_Mutation_p.D13G	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	29					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TACTCCAAGATCTATATCTTG	0.368			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			28	84	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179400809	179400809	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179400809G>T	uc010zfg.1	-	306	93185	c.92961C>A	c.(92959-92961)CTC>CTA	p.L30987L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.L24682L|TTN_uc010zfi.1_Silent_p.L24615L|TTN_uc010zfj.1_Silent_p.L24490L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	31914							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGCAATGATGAGCTGGTGGT	0.443													57	96	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179414546	179414546	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179414546C>A	uc010zfg.1	-	287	84423	c.84199G>T	c.(84199-84201)GAG>TAG	p.E28067*	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Nonsense_Mutation_p.E21762*|TTN_uc010zfi.1_Nonsense_Mutation_p.E21695*|TTN_uc010zfj.1_Nonsense_Mutation_p.E21570*	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28994							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCATCTTCTCCCCAGTAATA	0.428													65	168	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179428441	179428441	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179428441G>C	uc010zfg.1	-	275	74938	c.74714C>G	c.(74713-74715)CCC>CGC	p.P24905R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P18600R|TTN_uc010zfi.1_Missense_Mutation_p.P18533R|TTN_uc010zfj.1_Missense_Mutation_p.P18408R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	25832							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGGTGTTGAGGGAGGACCTGG	0.478													10	286	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179441390	179441390	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179441390A>T	uc010zfg.1	-	274	62101	c.61877T>A	c.(61876-61878)GTT>GAT	p.V20626D	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V14321D|TTN_uc010zfi.1_Missense_Mutation_p.V14254D|TTN_uc010zfj.1_Missense_Mutation_p.V14129D|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21553							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGATCGGAAACTGGTGTTTT	0.468													162	386	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179463280	179463280	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179463280C>T	uc010zfg.1	-	241	49584	c.49360G>A	c.(49360-49362)GGA>AGA	p.G16454R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.G10149R|TTN_uc010zfi.1_Missense_Mutation_p.G10082R|TTN_uc010zfj.1_Missense_Mutation_p.G9957R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	17381							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACGATGTATCCAGTTACTTTG	0.403													28	70	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179468995	179468995	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179468995C>T	uc010zfg.1	-	231	46939	c.46715G>A	c.(46714-46716)CGA>CAA	p.R15572Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9267Q|TTN_uc010zfi.1_Missense_Mutation_p.R9200Q|TTN_uc010zfj.1_Missense_Mutation_p.R9075Q	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16499							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCCCTGACTCGGAACTCATA	0.368													33	72	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179582750	179582750	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179582750T>C	uc010zfg.1	-	83	21475	c.21251A>G	c.(21250-21252)CAC>CGC	p.H7084R	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.H3745R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8011							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity	p.M7084I(1)		ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACATCACTGTGATCCACTTT	0.408													90	189	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179610863	179610863	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179610863G>T	uc002unb.2	-	46	16488	c.16264C>A	c.(16264-16266)CCA>ACA	p.P5422T	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	8930							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATTATCTGGCTCAATACAC	0.368													78	216	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179664562	179664562	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179664562C>G	uc002und.2	-	5	884	c.659G>C	c.(658-660)CGA>CCA	p.R220P	TTN_uc010zfg.1_Missense_Mutation_p.R220P|TTN_uc010zfh.1_Missense_Mutation_p.R220P|TTN_uc010zfi.1_Missense_Mutation_p.R220P|TTN_uc010zfj.1_Missense_Mutation_p.R220P|TTN_uc002unb.2_Missense_Mutation_p.R220P			Q8WZ42	TITIN_HUMAN	Homo sapiens cDNA FLJ32040 fis, clone NTONG2000858, highly similar to H.sapiens mRNA for titin protein.	220							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTTTTCAATTCGGGTTTGTCT	0.403													48	128	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801730	185801730	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801730G>A	uc002uph.2	+	4	2201	c.1607G>A	c.(1606-1608)TGT>TAT	p.C536Y		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	536						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TCCAGTAGTTGTGATTCTGGA	0.333													28	101	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185802102	185802102	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185802102C>G	uc002uph.2	+	4	2573	c.1979C>G	c.(1978-1980)CCC>CGC	p.P660R		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	660						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GATAAAAGGCCCAAATCAGAA	0.333													69	143	---	---	---	---	PASS
ANKAR	150709	broad.mit.edu	37	2	190541822	190541822	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:190541822G>T	uc002uqw.1	+						ANKAR_uc002uqu.2_Intron|ANKAR_uc002uqv.1_Intron	NM_144708	NP_653309	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing							integral to membrane	binding			ovary(2)|pancreas(1)|skin(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			CAGCAGGTAAGAGAATTTAAC	0.214													19	35	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196651817	196651817	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196651817C>A	uc002utj.3	-	58	10896	c.10795G>T	c.(10795-10797)GGG>TGG	p.G3599W	DNAH7_uc002uti.3_Missense_Mutation_p.G82W	NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3599	AAA 6 (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						ATATTCCACCCTAGGGGTCCA	0.403													88	144	---	---	---	---	PASS
BMPR2	659	broad.mit.edu	37	2	203379617	203379617	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203379617G>A	uc002uzf.3	+	5	1684	c.536G>A	c.(535-537)CGT>CAT	p.R179H	BMPR2_uc010ftr.2_Missense_Mutation_p.R179H	NM_001204	NP_001195	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor type II	179	Cytoplasmic (Potential).				anterior/posterior pattern formation|BMP signaling pathway|cellular response to starvation|lung alveolus development|mesoderm formation|negative regulation of cell growth|negative regulation of systemic arterial blood pressure|negative regulation of vasoconstriction|positive regulation of BMP signaling pathway|positive regulation of bone mineralization|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of epithelial cell migration|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|regulation of lung blood pressure|transcription from RNA polymerase II promoter|vascular endothelial growth factor receptor signaling pathway	integral to plasma membrane	ATP binding|metal ion binding|transforming growth factor beta receptor activity	p.R179H(1)		ovary(4)|breast(2)|large_intestine(1)|stomach(1)|pancreas(1)	9						ATAGGAGACCGTAAACAAGGT	0.348													58	124	---	---	---	---	PASS
COL4A3	1285	broad.mit.edu	37	2	228137730	228137730	+	Silent	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228137730A>T	uc002vom.1	+	26	1986	c.1824A>T	c.(1822-1824)GGA>GGT	p.G608G	COL4A3_uc002von.1_Silent_p.G608G|COL4A3_uc002voo.1_Silent_p.G608G|COL4A3_uc002vop.1_Silent_p.G608G|uc002voq.1_Intron|uc002vor.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor	608	Triple-helical region.				activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GGTCCCCAGGACCTGCAGGAC	0.622													33	103	---	---	---	---	PASS
TRIP12	9320	broad.mit.edu	37	2	230650556	230650556	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230650556C>G	uc002vpw.1	-	33	4895	c.4786G>C	c.(4786-4788)GAG>CAG	p.E1596Q	TRIP12_uc002vpx.1_Missense_Mutation_p.E1644Q|TRIP12_uc002vpy.1_Missense_Mutation_p.E1326Q	NM_004238	NP_004229	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1596					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	proteasome complex	thyroid hormone receptor binding|ubiquitin-protein ligase activity			ovary(4)|lung(2)|breast(1)|central_nervous_system(1)|skin(1)	9		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AGCAGCTCCTCTCGGTTCACA	0.458													53	105	---	---	---	---	PASS
CNTN4	152330	broad.mit.edu	37	3	2908505	2908505	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:2908505A>T	uc003bpc.2	+	7	745	c.524A>T	c.(523-525)GAG>GTG	p.E175V	CNTN4_uc003bpb.1_5'UTR|CNTN4_uc003bpd.1_Missense_Mutation_p.E175V	NM_175607	NP_783200	Q8IWV2	CNTN4_HUMAN	contactin 4 isoform a precursor	175	Ig-like C2-type 2.				axon guidance|axonal fasciculation|brain development|negative regulation of neuron differentiation|neuron cell-cell adhesion|regulation of synaptic plasticity	anchored to membrane|axon|extracellular region|plasma membrane	protein binding			large_intestine(2)|ovary(2)|lung(1)|central_nervous_system(1)|pancreas(1)	7		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		GTTTCTCAAGAGACTGGGAAT	0.403													112	127	---	---	---	---	PASS
OXNAD1	92106	broad.mit.edu	37	3	16312585	16312585	+	Intron	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16312585C>A	uc003caw.2	+						OXNAD1_uc010her.1_Intron|OXNAD1_uc003cax.2_Intron|OXNAD1_uc011awb.1_Intron	NM_138381	NP_612390	Q96HP4	OXND1_HUMAN	oxidoreductase NAD-binding domain containing 1								oxidoreductase activity			skin(1)	1						CCAGGTGAGTCATTAAGACTT	0.488													76	102	---	---	---	---	PASS
TRANK1	9881	broad.mit.edu	37	3	36898648	36898648	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36898648G>A	uc003cgj.2	-	3	1085	c.783C>T	c.(781-783)ATC>ATT	p.I261I		NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1	811					DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TTTTCTTCTTGATGACCTTGG	0.507													139	145	---	---	---	---	PASS
PLCD1	5333	broad.mit.edu	37	3	38053094	38053094	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38053094T>C	uc003chn.2	-	4	623	c.499A>G	c.(499-501)AAC>GAC	p.N167D	PLCD1_uc003chm.2_Missense_Mutation_p.N188D	NM_006225	NP_006216	P51178	PLCD1_HUMAN	phospholipase C, delta 1 isoform 2	167	EF-hand 1.				intracellular signal transduction|lipid catabolic process|phospholipid metabolic process	cytoplasm	calcium ion binding|GTPase activating protein binding|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TTCAGGAAGTTCTGCAGCTCC	0.542													12	45	---	---	---	---	PASS
SCN5A	6331	broad.mit.edu	37	3	38649714	38649714	+	Intron	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38649714G>C	uc003cio.2	-						SCN5A_uc003cin.2_Intron|SCN5A_uc003cil.3_Intron|SCN5A_uc010hhi.2_Intron|SCN5A_uc010hhk.2_Intron|SCN5A_uc011ayr.1_Intron|SCN5A_uc010hhj.1_5'Flank	NM_198056	NP_932173	Q14524	SCN5A_HUMAN	voltage-gated sodium channel type V alpha						blood circulation|cellular response to calcium ion|muscle contraction|regulation of heart contraction	sarcolemma|voltage-gated sodium channel complex	protein binding|voltage-gated sodium channel activity			ovary(4)|pancreas(2)|skin(2)|central_nervous_system(1)	9	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Benzonatate(DB00868)|Bepridil(DB01244)|Carbamazepine(DB00564)|Cocaine(DB00907)|Dibucaine(DB00527)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lamotrigine(DB00555)|Lidocaine(DB00281)|Mephenytoin(DB00532)|Mexiletine(DB00379)|Mibefradil(DB01388)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine(DB00908)|Riluzole(DB00740)|Tocainide(DB01056)|Verapamil(DB00661)	TTCTGTAAGAGAAACATCATG	0.552													40	71	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40285962	40285962	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40285962A>G	uc003cka.2	+	13	2261	c.2126A>G	c.(2125-2127)TAT>TGT	p.Y709C	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Missense_Mutation_p.Y644C|MYRIP_uc010hhw.2_Missense_Mutation_p.Y620C|MYRIP_uc011ayz.1_Missense_Mutation_p.Y522C|uc003ckb.2_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	709	Actin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		GGCACTGTGTATGGACTGGAG	0.582													46	34	---	---	---	---	PASS
HYAL3	8372	broad.mit.edu	37	3	50332669	50332669	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50332669C>A	uc003czd.1	-	2	638	c.365G>T	c.(364-366)GGC>GTC	p.G122V	HYAL3_uc003czc.1_Missense_Mutation_p.G122V|HYAL3_uc003cze.1_Intron|HYAL3_uc003czf.1_Intron|HYAL3_uc003czg.1_Missense_Mutation_p.G122V	NM_003549	NP_003540	O43820	HYAL3_HUMAN	hyaluronoglucosaminidase 3 precursor	122					carbohydrate metabolic process	extracellular region|lysosome	hyalurononglucosaminidase activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)		CACTGCTGGGCCAGCAAAGCC	0.647													70	77	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109026913	109026913	+	Silent	SNP	A	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109026913A>C	uc003dxo.2	-	6	871	c.624T>G	c.(622-624)CCT>CCG	p.P208P		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	208						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						CAACAGAAACAGGAATGGAAC	0.448													66	81	---	---	---	---	PASS
DPPA2	151871	broad.mit.edu	37	3	109028125	109028125	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109028125G>T	uc003dxo.2	-	4	481	c.234C>A	c.(232-234)TGC>TGA	p.C78*		NM_138815	NP_620170	Q7Z7J5	DPPA2_HUMAN	developmental pluripotency associated 2	78						nucleus	nucleic acid binding			ovary(2)|upper_aerodigestive_tract(1)	3						CTGGTATTTTGCATCTAGCTT	0.418													81	247	---	---	---	---	PASS
GOLGB1	2804	broad.mit.edu	37	3	121415351	121415351	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121415351T>A	uc003eei.3	-	13	4130	c.4004A>T	c.(4003-4005)AAA>ATA	p.K1335I	GOLGB1_uc010hrc.2_Missense_Mutation_p.K1340I|GOLGB1_uc003eej.3_Missense_Mutation_p.K1301I|GOLGB1_uc011bjm.1_Missense_Mutation_p.K1221I|GOLGB1_uc010hrd.1_Missense_Mutation_p.K1299I	NM_004487	NP_004478	Q14789	GOGB1_HUMAN	golgi autoantigen, golgin subfamily b,	1335	Cytoplasmic (Potential).|Potential.				Golgi organization	ER-Golgi intermediate compartment|Golgi membrane|Golgi stack|integral to membrane	protein binding			ovary(6)|breast(2)|skin(2)	10				GBM - Glioblastoma multiforme(114;0.0989)		CTCTTCTGATTTTTTAGTAAG	0.388													223	314	---	---	---	---	PASS
IQCB1	9657	broad.mit.edu	37	3	121515990	121515990	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121515990A>G	uc010hre.1	-	9	1066	c.851T>C	c.(850-852)ATG>ACG	p.M284T	IQCB1_uc003eek.2_Intron|IQCB1_uc010hrf.1_RNA	NM_001023570	NP_001018864	Q15051	IQCB1_HUMAN	IQ motif containing B1 isoform a	284					cilium assembly|maintenance of organ identity|photoreceptor cell maintenance	centrosome|photoreceptor connecting cilium	calmodulin binding				0				GBM - Glioblastoma multiforme(114;0.0983)		CTGATAGACCATTGGGCTTAA	0.358													140	250	---	---	---	---	PASS
PDIA5	10954	broad.mit.edu	37	3	122880801	122880801	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122880801G>T	uc003egc.1	+	17	1610	c.1554G>T	c.(1552-1554)GAG>GAT	p.E518D	PDIA5_uc003egd.1_RNA	NM_006810	NP_006801	Q14554	PDIA5_HUMAN	protein disulfide isomerase A5 precursor	518	Prevents secretion from ER (Potential).				cell redox homeostasis|glycerol ether metabolic process|protein folding|response to stress	endoplasmic reticulum lumen	electron carrier activity|protein disulfide isomerase activity|protein disulfide oxidoreductase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.0427)		AGAAGGAAGAGTTATAATTCC	0.398													26	181	---	---	---	---	PASS
UROC1	131669	broad.mit.edu	37	3	126236546	126236546	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126236546G>T	uc003eiz.1	-	1	49	c.17C>A	c.(16-18)GCG>GAG	p.A6E	UROC1_uc010hsi.1_Missense_Mutation_p.A6E	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1	6					histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		AGAGCACAGCGCCTGGAGGCT	0.682													4	18	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129547191	129547191	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129547191C>T	uc003emz.3	-	4	532	c.31G>A	c.(31-33)GAG>AAG	p.E11K	TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	11						integral to membrane				skin(1)	1						TCAGGGTCCTCAAATAACTGT	0.398													85	362	---	---	---	---	PASS
DNAJC13	23317	broad.mit.edu	37	3	132211375	132211375	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132211375C>T	uc003eor.2	+	33	3806	c.3741C>T	c.(3739-3741)CTC>CTT	p.L1247L		NM_015268	NP_056083	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1247							heat shock protein binding			ovary(1)|breast(1)	2						ATCCACAACTCGAAAATGAAC	0.403													231	515	---	---	---	---	PASS
BFSP2	8419	broad.mit.edu	37	3	133119036	133119036	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133119036G>A	uc003epn.1	+	1	247	c.109G>A	c.(109-111)GAG>AAG	p.E37K		NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin	37	Head.				response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0						ATCCTCCCTGGAGAGCCCCCC	0.652													29	161	---	---	---	---	PASS
DBR1	51163	broad.mit.edu	37	3	137892435	137892435	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137892435G>A	uc003erv.2	-	2	367	c.231C>T	c.(229-231)CTC>CTT	p.L77L	DBR1_uc003eru.2_Silent_p.L26L	NM_016216	NP_057300	Q9UK59	DBR1_HUMAN	debranching enzyme homolog 1	77						nucleus	metal ion binding|RNA lariat debranching enzyme activity				0						TGAAGAGCGTGAGAACTGGAG	0.408													122	446	---	---	---	---	PASS
TXNDC6	347736	broad.mit.edu	37	3	138023787	138023787	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138023787T>A	uc003esg.2	-	9	747	c.719A>T	c.(718-720)GAC>GTC	p.D240V	TXNDC6_uc003esd.1_Intron|TXNDC6_uc010huf.1_Missense_Mutation_p.D155V|TXNDC6_uc003ese.1_Missense_Mutation_p.D179V	NM_178130	NP_835231	Q86XW9	TXND6_HUMAN	thioredoxin domain containing 6	240	NDK.				cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|UTP biosynthetic process	cytoplasm|cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			breast(3)|ovary(1)|pancreas(1)	5						AGTGACCACGTCCTCGAAGCC	0.587													166	316	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155206555	155206555	+	Silent	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155206555T>A	uc011bok.1	-	19	2674	c.2397A>T	c.(2395-2397)GTA>GTT	p.V799V	PLCH1_uc011boj.1_Silent_p.V799V|PLCH1_uc011bol.1_Silent_p.V781V	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	799	C2.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			CTGGCATGTGTACTGTAAATG	0.428													30	147	---	---	---	---	PASS
VEPH1	79674	broad.mit.edu	37	3	157081367	157081367	+	Silent	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:157081367T>A	uc003fbj.1	-	9	1838	c.1521A>T	c.(1519-1521)TCA>TCT	p.S507S	VEPH1_uc003fbk.1_Silent_p.S507S|VEPH1_uc010hvu.1_Silent_p.S507S	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1	507						plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GGTATGAAACTGAAGACTCCC	0.428													99	553	---	---	---	---	PASS
WDR49	151790	broad.mit.edu	37	3	167293742	167293742	+	Silent	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167293742T>A	uc003fev.1	-	4	756	c.450A>T	c.(448-450)GCA>GCT	p.A150A	WDR49_uc003feu.1_5'Flank|WDR49_uc011bpd.1_Silent_p.A203A|WDR49_uc003few.1_Silent_p.A491A	NM_178824	NP_849146	Q8IV35	WDR49_HUMAN	WD repeat domain 49	150	WD 3.									large_intestine(1)|ovary(1)|skin(1)	3						CACAAGTGACTGCTTTCTCAT	0.403													203	346	---	---	---	---	PASS
PRKCI	5584	broad.mit.edu	37	3	170009717	170009717	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170009717G>A	uc003fgs.2	+	13	1517	c.1279G>A	c.(1279-1281)GGA>AGA	p.G427R	PRKCI_uc003fgt.2_5'UTR	NM_002740	NP_002731	P41743	KPCI_HUMAN	protein kinase C, iota	427	Protein kinase.				anti-apoptosis|cellular membrane organization|cellular response to insulin stimulus|establishment or maintenance of epithelial cell apical/basal polarity|intracellular signal transduction|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|positive regulation of glucose import|protein targeting to membrane|secretion|tight junction assembly|vesicle-mediated transport	cytosol|endosome|nucleus|polarisome	ATP binding|phospholipid binding|protein binding|protein kinase C activity|zinc ion binding			lung(2)|ovary(1)|breast(1)|skin(1)	5	all_cancers(22;6.45e-23)|all_epithelial(15;8.52e-28)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.197)			AATTTTAAGAGGAGAAGATTA	0.343													65	117	---	---	---	---	PASS
CLCN2	1181	broad.mit.edu	37	3	184075201	184075201	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184075201T>A	uc003foi.2	-	8	971	c.847A>T	c.(847-849)ACC>TCC	p.T283S	CLCN2_uc003foh.2_5'Flank|CLCN2_uc010hya.1_Missense_Mutation_p.T283S|CLCN2_uc011brl.1_Missense_Mutation_p.T283S|CLCN2_uc011brm.1_Missense_Mutation_p.T239S|CLCN2_uc011brn.1_Missense_Mutation_p.T283S	NM_004366	NP_004357	P51788	CLCN2_HUMAN	chloride channel 2	283	Helical; (By similarity).					chloride channel complex	voltage-gated chloride channel activity				0	all_cancers(143;6.66e-11)|Ovarian(172;0.0339)		Epithelial(37;2.22e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Lubiprostone(DB01046)	GCACTGAAGGTGGCAGCGAAG	0.627													48	201	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186459738	186459738	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186459738G>T	uc011bsa.1	+	10	1765	c.1553G>T	c.(1552-1554)GGT>GTT	p.G518V	KNG1_uc003fqr.2_Intron	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	518					blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	AAGCACAATGGTTGGAAAACA	0.463													29	113	---	---	---	---	PASS
OPA1	4976	broad.mit.edu	37	3	193333491	193333491	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193333491C>T	uc003ftm.2	+	3	614	c.380C>T	c.(379-381)CCG>CTG	p.P127L	OPA1_uc003ftg.2_Missense_Mutation_p.P127L|OPA1_uc003fth.2_Missense_Mutation_p.P127L|OPA1_uc003fti.2_Missense_Mutation_p.P127L|OPA1_uc003ftj.2_Missense_Mutation_p.P127L|OPA1_uc003ftk.2_Missense_Mutation_p.P127L|OPA1_uc003ftl.2_Missense_Mutation_p.P127L|OPA1_uc003ftn.2_Missense_Mutation_p.P127L	NM_015560	NP_056375	O60313	OPA1_HUMAN	optic atrophy 1 isoform 1	127	Mitochondrial intermembrane (By similarity).				apoptosis|axon transport of mitochondrion|inner mitochondrial membrane organization|mitochondrial fission|mitochondrial fusion|positive regulation of anti-apoptosis|response to stimulus|visual perception	dendrite|integral to membrane|mitochondrial crista|mitochondrial intermembrane space|mitochondrial outer membrane	GTP binding|GTPase activity|magnesium ion binding|protein binding				0	all_cancers(143;9.56e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;9.19e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000162)		GATATGATACCGGACCTTAGT	0.308													104	591	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196387697	196387697	+	Missense_Mutation	SNP	C	G	G	rs150316796		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196387697C>G	uc003fwv.2	+	3	1287	c.1183C>G	c.(1183-1185)CCG>GCG	p.P395A		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	395	Extracellular (Potential).|LRR 13.					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GCACCTGGCTCCGGGGCTGGC	0.652													34	116	---	---	---	---	PASS
ACOX3	8310	broad.mit.edu	37	4	8372694	8372694	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8372694C>G	uc010idk.2	-	17	2069	c.1924G>C	c.(1924-1926)GAC>CAC	p.D642H	ACOX3_uc003glc.3_Missense_Mutation_p.D642H|ACOX3_uc003gld.3_Missense_Mutation_p.R619T	NM_003501	NP_003492	O15254	ACOX3_HUMAN	acyl-Coenzyme A oxidase 3 isoform a	642					bile acid metabolic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|pristanoyl-CoA oxidase activity			central_nervous_system(1)	1						GCGATCACGTCTACCAGGGCA	0.572													31	58	---	---	---	---	PASS
GABRB1	2560	broad.mit.edu	37	4	47034430	47034430	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47034430G>T	uc003gxh.2	+						GABRB1_uc011bze.1_Intron|GABRB1_uc011bzd.1_Intron|GABRB1_uc010igg.2_Intron	NM_000812	NP_000803	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta						synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2					Ethchlorvynol(DB00189)|Flurazepam(DB00690)|Lorazepam(DB00186)|Midazolam(DB00683)	CACCTCCCCGGCAGGGCCCCC	0.632													134	203	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62453084	62453084	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62453084T>C	uc010ihh.2	+	2	368	c.195T>C	c.(193-195)ATT>ATC	p.I65I	LPHN3_uc003hcq.3_Silent_p.I65I|LPHN3_uc010ihg.1_Silent_p.I133I	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	65	SUEL-type lectin.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						ATGACAAAATTTGTGACTCTG	0.418													27	46	---	---	---	---	PASS
HTN1	3346	broad.mit.edu	37	4	70921290	70921290	+	3'UTR	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:70921290C>G	uc003hex.2	+	5						NM_002159	NP_002150	P15515	HIS1_HUMAN	histatin 1 precursor						biomineral tissue development|defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			skin(1)	1						CAATTGATATCCTTAGTAATC	0.363													38	41	---	---	---	---	PASS
EGF	1950	broad.mit.edu	37	4	110897250	110897250	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110897250A>T	uc003hzy.3	+	13	2364	c.1912A>T	c.(1912-1914)AGC>TGC	p.S638C	EGF_uc011cfu.1_Missense_Mutation_p.S596C|EGF_uc011cfv.1_Missense_Mutation_p.S638C	NM_001963	NP_001954	P01133	EGF_HUMAN	epidermal growth factor precursor	638	Extracellular (Potential).|LDL-receptor class B 8.				angiogenesis|DNA replication|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of secretion|platelet activation|platelet degranulation|positive regulation of catenin import into nucleus|positive regulation of epidermal growth factor receptor activity|positive regulation of MAP kinase activity|positive regulation of mitosis|regulation of calcium ion import|regulation of protein localization at cell surface	integral to membrane|plasma membrane|platelet alpha granule lumen	calcium ion binding|epidermal growth factor receptor binding|growth factor activity|transmembrane receptor protein tyrosine kinase activator activity			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sulindac(DB00605)	GGTTATAGCCAGCTCTGATCT	0.443													110	135	---	---	---	---	PASS
GALNTL6	442117	broad.mit.edu	37	4	173730674	173730674	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:173730674T>A	uc003isv.2	+	6	1452	c.716T>A	c.(715-717)GTG>GAG	p.V239E		NM_001034845	NP_001030017	Q49A17	GLTL6_HUMAN	N-acetylgalactosaminyltransferase-like 6	239	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	metal ion binding|polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(2)|ovary(1)|skin(1)	4						GAGGTCAATGTGAACTGGCTG	0.542													28	34	---	---	---	---	PASS
CEP72	55722	broad.mit.edu	37	5	635485	635485	+	Splice_Site	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:635485A>G	uc003jbf.2	+	6	764	c.692_splice	c.e6-2	p.E231_splice	CEP72_uc011clz.1_Splice_Site	NM_018140	NP_060610	Q9P209	CEP72_HUMAN	centrosomal protein 72 kDa						G2/M transition of mitotic cell cycle|gamma-tubulin complex localization|spindle organization	centrosome|cytosol				ovary(1)	1			Epithelial(17;0.000339)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|Lung(60;0.0863)			ATATTTTAATAGAATCCAGAC	0.393													13	26	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37307492	37307492	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37307492G>A	uc003jku.1	-	25	2928	c.2810C>T	c.(2809-2811)GCA>GTA	p.A937V	NUP155_uc003jkt.1_Missense_Mutation_p.A878V|NUP155_uc010iuz.1_Missense_Mutation_p.A873V	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1	937					carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TTTTTTCTCTGCAGCCGTAAG	0.398													47	95	---	---	---	---	PASS
C6	729	broad.mit.edu	37	5	41160404	41160404	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41160404C>A	uc003jmk.2	-	11	1734	c.1524G>T	c.(1522-1524)AGG>AGT	p.R508S	C6_uc003jml.1_Missense_Mutation_p.R508S	NM_000065	NP_000056	P13671	CO6_HUMAN	complement component 6 precursor	508	MACPF.				complement activation, classical pathway|cytolysis|innate immune response	membrane attack complex	protein binding			ovary(3)|central_nervous_system(2)|skin(2)	7		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCAAAGCTTTCCTGAGGTTGT	0.522													53	128	---	---	---	---	PASS
ZNF131	7690	broad.mit.edu	37	5	43175067	43175067	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43175067C>A	uc011cpw.1	+	7	1740	c.1704C>A	c.(1702-1704)ACC>ACA	p.T568T	ZNF131_uc003jnj.3_Silent_p.T289T|ZNF131_uc003jnk.2_Silent_p.T534T|ZNF131_uc003jnn.3_Silent_p.T289T|ZNF131_uc003jnl.1_Intron|ZNF131_uc010ivm.1_Intron	NM_003432	NP_003423	P52739	ZN131_HUMAN	zinc finger protein 131	568						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						ACCACGTGACCCCAGAAATCA	0.483													30	91	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109106207	109106207	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109106207C>T	uc003kou.1	+	7	2124	c.1161C>T	c.(1159-1161)CCC>CCT	p.P387P		NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	387	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		GGGGAGTCCCCCCAGAAACAA	0.433													58	80	---	---	---	---	PASS
CXCL14	9547	broad.mit.edu	37	5	134910301	134910301	+	Missense_Mutation	SNP	C	T	T	rs139612389		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134910301C>T	uc003lay.2	-	3	746	c.281G>A	c.(280-282)CGC>CAC	p.R94H		NM_004887	NP_004878	O95715	CXL14_HUMAN	small inducible cytokine B14 precursor	94					cell-cell signaling|chemotaxis|immune response|signal transduction	extracellular space|Golgi apparatus	chemokine activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CTTGATGAAGCGCTTGGTGCT	0.572													26	45	---	---	---	---	PASS
PCDHGA8	9708	broad.mit.edu	37	5	140774454	140774454	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140774454T>C	uc003lkd.1	+	1	2972	c.2074T>C	c.(2074-2076)TAT>CAT	p.Y692H	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkb.3_Missense_Mutation_p.Y692H	NM_032088	NP_114477	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8 isoform 1	692	Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTACACTCTATCTCGTGGT	0.612													9	13	---	---	---	---	PASS
PRELID2	153768	broad.mit.edu	37	5	145199571	145199571	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145199571T>C	uc003lnp.1	-	3	197	c.144A>G	c.(142-144)ACA>ACG	p.T48T	PRELID2_uc003lnq.1_Silent_p.T48T|PRELID2_uc003lno.1_Silent_p.T19T|PRELID2_uc003lnr.1_Silent_p.T48T	NM_182960	NP_892005	Q8N945	PRLD2_HUMAN	PRELI domain containing 2 isoform a	48	PRELI/MSF1.										0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGATGACCCCTGTTGATTCAT	0.313													93	100	---	---	---	---	PASS
SH3RF2	153769	broad.mit.edu	37	5	145439657	145439657	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145439657C>T	uc003lnt.2	+	9	2022	c.1784C>T	c.(1783-1785)TCC>TTC	p.S595F	SH3RF2_uc011dbl.1_Missense_Mutation_p.S595F|SH3RF2_uc011dbm.1_Missense_Mutation_p.S80F|SH3RF2_uc003lnu.2_Missense_Mutation_p.S86F|SH3RF2_uc011dbn.1_Missense_Mutation_p.S86F|SH3RF2_uc011dbo.1_Missense_Mutation_p.S52F	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	595							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TGGATCCACTCCGCGGCCAGC	0.627													31	30	---	---	---	---	PASS
GPR151	134391	broad.mit.edu	37	5	145895656	145895656	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145895656T>C	uc003lod.1	-	1	21	c.21A>G	c.(19-21)GCA>GCG	p.A7A		NM_194251	NP_919227	Q8TDV0	GP151_HUMAN	G protein-coupled receptor 151	7	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(1)|pancreas(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTTAGAGTCTGCAAAGGCAG	0.488													60	70	---	---	---	---	PASS
C5orf41	153222	broad.mit.edu	37	5	172539351	172539351	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172539351A>T	uc003mch.2	+	7	1954	c.1650A>T	c.(1648-1650)AAA>AAT	p.K550N	C5orf41_uc011dfd.1_Missense_Mutation_p.K550N	NM_153607	NP_705835	Q8IUR6	CE041_HUMAN	luman-recruiting factor	550							protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Renal(175;0.000159)|Lung NSC(126;0.00223)|all_lung(126;0.00391)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			AAGCTAATAAAGTGAAATTAT	0.338													42	84	---	---	---	---	PASS
GRM6	2916	broad.mit.edu	37	5	178418943	178418943	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178418943C>A	uc003mjr.2	-	2	825	c.646G>T	c.(646-648)GTG>TTG	p.V216L	GRM6_uc010jla.1_5'Flank|GRM6_uc003mjs.1_5'Flank	NM_000843	NP_000834	O15303	GRM6_HUMAN	glutamate receptor, metabotropic 6 precursor	216	Extracellular (Potential).				detection of visible light|visual perception	integral to plasma membrane				lung(4)|ovary(2)|breast(1)|pancreas(1)	8	all_cancers(89;0.000828)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.0156)|all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.245)		AGCGTGGACACATAGTTCCAT	0.627													21	25	---	---	---	---	PASS
RASGEF1C	255426	broad.mit.edu	37	5	179554659	179554659	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:179554659C>G	uc003mlq.2	-	5	961	c.664G>C	c.(664-666)GAG>CAG	p.E222Q	RASGEF1C_uc003mlr.2_Missense_Mutation_p.E222Q|RASGEF1C_uc003mlp.3_Missense_Mutation_p.E71Q	NM_175062	NP_778232	Q8N431	RGF1C_HUMAN	RasGEF domain family, member 1C	222	Ras-GEF.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(89;3.44e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0242)|Medulloblastoma(196;0.00498)|all_neural(177;0.0137)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAAACTCCTCAGGCCCGATG	0.612													13	16	---	---	---	---	PASS
TAPBP	6892	broad.mit.edu	37	6	33281012	33281012	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33281012G>C	uc003odx.1	-	3	622	c.451C>G	c.(451-453)CTC>GTC	p.L151V	TAPBP_uc010jus.1_Missense_Mutation_p.L151V|TAPBP_uc003ody.2_Missense_Mutation_p.L151V|TAPBP_uc003odz.2_Missense_Mutation_p.L151V|TAPBP_uc010jut.1_Intron|TAPBP_uc011drc.1_Missense_Mutation_p.L151V	NM_003190	NP_003181	O15533	TPSN_HUMAN	tapasin isoform 1 precursor	151	Lumenal (Potential).				antigen processing and presentation of endogenous peptide antigen via MHC class I|immune response|peptide antigen stabilization|protein complex assembly|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane|MHC class I peptide loading complex|microsome	MHC class I protein binding|peptide antigen binding|peptide antigen-transporting ATPase activity|TAP1 binding|TAP2 binding|unfolded protein binding			ovary(1)	1						ATGGTGATGAGAACAGGCTCC	0.473													34	74	---	---	---	---	PASS
SPDEF	25803	broad.mit.edu	37	6	34508830	34508830	+	Nonsense_Mutation	SNP	C	A	A	rs138933709		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:34508830C>A	uc003ojq.1	-	3	980	c.565G>T	c.(565-567)GAG>TAG	p.E189*	SPDEF_uc011dsq.1_Nonsense_Mutation_p.E189*	NM_012391	NP_036523	O95238	SPDEF_HUMAN	SAM pointed domain containing ets transcription	189	PNT.				negative regulation of survival gene product expression|negative regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(3)|ovary(1)|central_nervous_system(1)	5						CGGAACTGCTCCTCCGACATG	0.662													13	9	---	---	---	---	PASS
SLC22A7	10864	broad.mit.edu	37	6	43267162	43267162	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43267162G>C	uc003out.2	+	3	533	c.434G>C	c.(433-435)AGA>ACA	p.R145T	SLC22A7_uc010jyl.1_Missense_Mutation_p.R143T|SLC22A7_uc003ous.2_Missense_Mutation_p.R143T	NM_153320	NP_696961	Q9Y694	S22A7_HUMAN	solute carrier family 22 member 7 isoform b	145						basolateral plasma membrane|integral to plasma membrane|membrane fraction	anion:anion antiporter activity|sodium-independent organic anion transmembrane transporter activity				0			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)			GGTCTGAACAGAGCTGCGTCC	0.572													28	51	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	63990303	63990303	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63990303C>G	uc003peh.2	-	4	1187	c.1153G>C	c.(1153-1155)GGA>CGA	p.G385R	LGSN_uc003pei.2_3'UTR	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	385					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TCATTGTATCCCCATGTTGTA	0.463													103	178	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70852701	70852701	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70852701C>A	uc003pfc.1	+	23	1732	c.1615C>A	c.(1615-1617)CCA>ACA	p.P539T	COL19A1_uc010kam.1_Missense_Mutation_p.P435T	NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	539	Triple-helical region 3 (COL3).				cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CAGAGGACCGCCAGGAGATGT	0.358													56	50	---	---	---	---	PASS
EPHA7	2045	broad.mit.edu	37	6	93967179	93967179	+	Splice_Site	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:93967179C>A	uc003poe.2	-	12	2413	c.2172_splice	c.e12+1	p.R724_splice	EPHA7_uc003pof.2_Splice_Site_p.R719_splice|EPHA7_uc011eac.1_Splice_Site_p.R720_splice	NM_004440	NP_004431	Q15375	EPHA7_HUMAN	ephrin receptor EphA7 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity			lung(8)|ovary(7)|upper_aerodigestive_tract(3)|central_nervous_system(3)|skin(3)|large_intestine(2)|stomach(1)|pancreas(1)	28		all_cancers(76;7.47e-10)|Acute lymphoblastic leukemia(125;1.88e-09)|all_hematologic(75;1.75e-07)|all_epithelial(107;3.6e-05)|Lung NSC(302;0.0368)|all_lung(197;0.0509)|Colorectal(196;0.142)		BRCA - Breast invasive adenocarcinoma(108;0.0847)		TTGGTACTTACCCTGAGAAAT	0.318													35	45	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159653353	159653353	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159653353C>T	uc010kjv.2	+	11	2009	c.1809C>T	c.(1807-1809)TCC>TCT	p.S603S	FNDC1_uc010kjw.1_Silent_p.S488S	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	603						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CTGGCTTTTCCCTGGCCACGC	0.701													15	13	---	---	---	---	PASS
SLC22A2	6582	broad.mit.edu	37	6	160679418	160679418	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160679418G>A	uc003qtf.2	-	1	542	c.372C>T	c.(370-372)GAC>GAT	p.D124D	SLC22A2_uc003qte.1_Silent_p.D124D|SLC22A2_uc003qth.1_Silent_p.D124D	NM_003058	NP_003049	O15244	S22A2_HUMAN	solute carrier family 22 member 2	124	Extracellular (Potential).				body fluid secretion|neurotransmitter biosynthetic process|neurotransmitter secretion	integral to plasma membrane|membrane fraction	neurotransmitter transporter activity|organic cation transmembrane transporter activity			breast(1)|skin(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)		ACACCCAGCCGTCCCGGCAGG	0.627													39	71	---	---	---	---	PASS
THBS2	7058	broad.mit.edu	37	6	169648567	169648567	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169648567G>T	uc003qwt.2	-	4	802	c.554C>A	c.(553-555)GCG>GAG	p.A185E		NM_003247	NP_003238	P35442	TSP2_HUMAN	thrombospondin 2 precursor	185	TSP N-terminal.|Heparin-binding (Potential).				cell adhesion	extracellular region	calcium ion binding|heparin binding|protein binding|structural molecule activity			ovary(5)	5		Breast(66;1.78e-05)|Ovarian(120;0.0728)|Esophageal squamous(34;0.247)		OV - Ovarian serous cystadenocarcinoma(33;1.85e-21)|BRCA - Breast invasive adenocarcinoma(81;1.43e-06)|GBM - Glioblastoma multiforme(31;0.000379)		GCTCTTTTCCGCCTGCAGGTG	0.617													88	90	---	---	---	---	PASS
DLL1	28514	broad.mit.edu	37	6	170597490	170597490	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170597490C>T	uc003qxm.2	-	4	977	c.507G>A	c.(505-507)ACG>ACA	p.T169T	DLL1_uc011ehc.1_Silent_p.T169T	NM_005618	NP_005609	O00548	DLL1_HUMAN	delta-like 1 precursor	169	Extracellular (Potential).				cell communication|cell fate determination|hemopoiesis|Notch receptor processing|Notch signaling pathway|regulation of cell adhesion	extracellular region|integral to plasma membrane	calcium ion binding|Notch binding			lung(4)|ovary(1)	5		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.71e-23)|BRCA - Breast invasive adenocarcinoma(81;4.81e-06)|GBM - Glioblastoma multiforme(31;0.0584)		ACTTGAGGTCCGTGCGGCCGC	0.627													31	36	---	---	---	---	PASS
SNX8	29886	broad.mit.edu	37	7	2294689	2294689	+	3'UTR	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2294689C>A	uc003slw.2	-	11						NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		CAGCCTCAGGCGCTAGTGAGG	0.652													3	7	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18767272	18767272	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18767272G>C	uc003suh.2	+	12	1833	c.1792G>C	c.(1792-1794)GAT>CAT	p.D598H	HDAC9_uc003sue.2_Missense_Mutation_p.D598H|HDAC9_uc011jyd.1_Missense_Mutation_p.D598H|HDAC9_uc003sui.2_Missense_Mutation_p.D601H|HDAC9_uc003suj.2_Missense_Mutation_p.D557H|HDAC9_uc003sua.1_Missense_Mutation_p.D576H|HDAC9_uc010kue.1_Missense_Mutation_p.D253H	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1	598					B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	GGTTGGCATGGATGGATTAGA	0.582													9	27	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21747435	21747435	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21747435G>C	uc003svc.2	+	41	6717	c.6686G>C	c.(6685-6687)CGA>CCA	p.R2229P		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2229	AAA 2 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CATGCTACCCGAGAATGGAAA	0.373									Kartagener_syndrome				18	75	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21747436	21747436	+	Silent	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21747436A>T	uc003svc.2	+	41	6718	c.6687A>T	c.(6685-6687)CGA>CGT	p.R2229R		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2229	AAA 2 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ATGCTACCCGAGAATGGAAAG	0.373									Kartagener_syndrome				18	74	---	---	---	---	PASS
KLHL7	55975	broad.mit.edu	37	7	23205516	23205516	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23205516C>T	uc003svs.3	+	8	1429	c.1136C>T	c.(1135-1137)GCT>GTT	p.A379V	KLHL7_uc003svr.3_Missense_Mutation_p.A357V|KLHL7_uc011jys.1_Missense_Mutation_p.A303V|KLHL7_uc011jyt.1_Missense_Mutation_p.A154V|KLHL7_uc003svt.2_Missense_Mutation_p.A331V|KLHL7_uc011jyv.1_Missense_Mutation_p.A154V	NM_001031710	NP_001026880	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 1	379	Kelch 2.					Golgi apparatus|nucleolus|plasma membrane					0						GCTGCATGTGCTGCAGAAGGC	0.438													90	112	---	---	---	---	PASS
CCM2	83605	broad.mit.edu	37	7	45113885	45113885	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45113885C>T	uc003tmo.2	+	9	1078	c.932C>T	c.(931-933)TCA>TTA	p.S311L	CCM2_uc003tmn.2_RNA|CCM2_uc003tmp.2_Missense_Mutation_p.S253L|CCM2_uc003tmq.2_RNA|CCM2_uc003tmr.2_Missense_Mutation_p.S220L|CCM2_uc003tms.2_Missense_Mutation_p.S332L	NM_031443	NP_113631	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2 isoform 2	311					endothelial tube morphogenesis|integrin-mediated signaling pathway|stress-activated MAPK cascade|vasculogenesis	cytoplasm	protein binding				0						ACCAAGCTGTCATCACAGGAG	0.607									Familial_Cerebral_Cavernous_Angioma				29	53	---	---	---	---	PASS
DDC	1644	broad.mit.edu	37	7	50530953	50530953	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50530953G>T	uc003tpf.3	-	14	1505	c.1419C>A	c.(1417-1419)GAC>GAA	p.D473E	DDC_uc010kza.2_Missense_Mutation_p.D388E|DDC_uc003tpg.3_Missense_Mutation_p.D473E	NM_000790	NP_000781	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid	473					cellular amino acid metabolic process|hormone biosynthetic process|neurotransmitter secretion	cytosol	aromatic-L-amino-acid decarboxylase activity|protein binding|pyridoxal phosphate binding			ovary(2)	2	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Flupenthixol(DB00875)|L-Tryptophan(DB00150)|Levodopa(DB01235)|Pimozide(DB01100)|Pyridoxal Phosphate(DB00114)|Remoxipride(DB00409)	CTCGCAGCACGTCGGCCGCCA	0.597													12	22	---	---	---	---	PASS
SEC61G	23480	broad.mit.edu	37	7	54823501	54823501	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54823501C>G	uc003tqf.2	-	3	259	c.168G>C	c.(166-168)TTG>TTC	p.L56F	SEC61G_uc003tqg.2_Missense_Mutation_p.L56F	NM_001012456	NP_001012474	P60059	SC61G_HUMAN	Sec61 gamma subunit	56	Helical; (Potential).				protein targeting to ER	endoplasmic reticulum membrane|integral to membrane	P-P-bond-hydrolysis-driven protein transmembrane transporter activity			lung(1)	1	Esophageal squamous(2;7.55e-08)|Breast(14;0.0654)		Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)			GAATATGGATCAATTTCACAA	0.323													5	178	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88964016	88964016	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88964016G>T	uc011khi.1	+	4	2258	c.1720G>T	c.(1720-1722)GAA>TAA	p.E574*		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	574						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAATGATTTGGAAATGAAAAA	0.353										HNSCC(36;0.09)			41	112	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93106944	93106944	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93106944C>T	uc003umv.1	-	5	557	c.296G>A	c.(295-297)TGC>TAC	p.C99Y	CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.C81Y|CALCR_uc003umw.2_Missense_Mutation_p.C81Y	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	81	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	GTCATCCCAGCACAGCCATCC	0.413													26	64	---	---	---	---	PASS
EPO	2056	broad.mit.edu	37	7	100319236	100319236	+	Silent	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100319236C>G	uc003uwi.2	+	2	250	c.69C>G	c.(67-69)CTC>CTG	p.L23L	EPO_uc011kkc.1_Silent_p.L23L	NM_000799	NP_000790	P01588	EPO_HUMAN	erythropoietin precursor	23					blood circulation|cellular hyperosmotic response|erythrocyte maturation|negative regulation of apoptosis|negative regulation of ion transmembrane transporter activity|negative regulation of sodium ion transport|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of tyrosine phosphorylation of Stat5 protein|signal transduction	extracellular space	erythropoietin receptor binding|eukaryotic cell surface binding|hormone activity			central_nervous_system(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)	CTCTGGGCCTCCCAGTCCTGG	0.632													12	44	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100551264	100551264	+	RNA	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100551264C>G	uc003uxk.1	+	1		c.515C>G			uc003uxl.1_5'UTR					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		ACTCCACAGTCAGCACATCCA	0.517													60	147	---	---	---	---	PASS
RELN	5649	broad.mit.edu	37	7	103206705	103206705	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103206705A>G	uc003vca.2	-	33	5062	c.4902T>C	c.(4900-4902)TCT>TCC	p.S1634S	RELN_uc010liz.2_Silent_p.S1634S	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a	1634					axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		CAGTATCCATAGAGAGACAGT	0.358													7	132	---	---	---	---	PASS
CBLL1	79872	broad.mit.edu	37	7	107394329	107394329	+	Intron	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107394329C>G	uc003veq.2	+						CBLL1_uc011kme.1_Intron|CBLL1_uc011kmf.1_Intron	NM_024814	NP_079090	Q75N03	HAKAI_HUMAN	Cas-Br-M (murine) ecotropic retroviral						cell-cell adhesion|negative regulation of cell adhesion|positive regulation of cell migration|positive regulation of endocytosis		protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|skin(2)|lung(1)	5						TTAATTATATCATTTCAACAG	0.279													50	114	---	---	---	---	PASS
ZNF277	11179	broad.mit.edu	37	7	111936011	111936011	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111936011T>C	uc003vge.2	+	3	510	c.381T>C	c.(379-381)TTT>TTC	p.F127F	ZNF277_uc003vgd.2_Silent_p.F127F|ZNF277_uc003vgf.2_Silent_p.F49F|ZNF277_uc003vgg.2_5'UTR	NM_021994	NP_068834	Q9NRM2	ZN277_HUMAN	zinc finger protein (C2H2 type) 277	127						nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(2)	4						CTGCTCCATTTGGTAAGTGTA	0.313													5	218	---	---	---	---	PASS
TRIM24	8805	broad.mit.edu	37	7	138252398	138252398	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138252398A>C	uc003vuc.2	+	10	1918	c.1703A>C	c.(1702-1704)CAG>CCG	p.Q568P	TRIM24_uc003vub.2_Missense_Mutation_p.Q534P	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha	568					cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						GCCATAAAACAGGTATATATC	0.383													23	92	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140494110	140494110	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140494110C>G	uc003vwc.3	-	8	1199	c.1138G>C	c.(1138-1140)GAT>CAT	p.D380H		NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf	380		Breakpoint for translocation to form KIAA1549-BRAF fusion protein.			activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	ATACTTACATCAATATTGACA	0.348		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				276	149	---	---	---	---	PASS
BRAF	673	broad.mit.edu	37	7	140507751	140507751	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:140507751G>T	uc003vwc.3	-							NM_004333	NP_004324	P15056	BRAF_HUMAN	B-Raf						activation of MAPKK activity|anti-apoptosis|nerve growth factor receptor signaling pathway|organ morphogenesis|positive regulation of peptidyl-serine phosphorylation|small GTPase mediated signal transduction|synaptic transmission	cytosol|nucleus|plasma membrane	ATP binding|metal ion binding		KIAA1549/BRAF(229)|AKAP9_ENST00000356239/BRAF(10)|AGTRAP/BRAF(2)|FCHSD1/BRAF(2)|SLC45A3/BRAF(2)	thyroid(8166)|large_intestine(5052)|skin(3798)|NS(368)|central_nervous_system(284)|ovary(236)|lung(78)|eye(53)|prostate(44)|endometrium(30)|biliary_tract(28)|soft_tissue(27)|haematopoietic_and_lymphoid_tissue(22)|breast(18)|upper_aerodigestive_tract(13)|stomach(13)|pancreas(10)|small_intestine(10)|testis(7)|bone(6)|cervix(5)|genital_tract(4)|oesophagus(3)|urinary_tract(3)|adrenal_gland(3)|gastrointestinal_tract_(site_indeterminate)(2)|liver(2)|meninges(1)|kidney(1)|autonomic_ganglia(1)|pituitary(1)|salivary_gland(1)	18290	Melanoma(164;0.00956)				Sorafenib(DB00398)	AAAATGTAAAGATACATACAA	0.313		61	Mis|T|O	AKAP9|KIAA1549	melanoma|colorectal|papillary thyroid|borderline ov|Non small-cell lung cancer (NSCLC)|cholangiocarcinoma|pilocytic astrocytoma		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous_syndrome				63	218	---	---	---	---	PASS
SSBP1	6742	broad.mit.edu	37	7	141443496	141443496	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141443496A>T	uc003vwo.1	+	4	299	c.221A>T	c.(220-222)CAA>CTA	p.Q74L	SSBP1_uc011kri.1_Missense_Mutation_p.Q74L|SSBP1_uc010lnp.1_Missense_Mutation_p.Q74L	NM_003143	NP_003134	Q04837	SSBP_HUMAN	single-stranded DNA binding protein 1 precursor	74	SSB.				DNA replication|positive regulation of helicase activity	mitochondrial nucleoid	single-stranded DNA binding			ovary(1)	1	Melanoma(164;0.0171)					GAAGTTTACCAACTGGGTGAG	0.358													50	146	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143771480	143771480	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143771480C>A	uc011ktx.1	+	1	168	c.168C>A	c.(166-168)ACC>ACA	p.T56T		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	56	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					GACTCCACACCCCCATGTACT	0.572													92	108	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144708029	144708029	+	IGR	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144708029C>A								TPK1 (174883 upstream) : None (None downstream)																							CAAAATGTGCCAGACACTACC	0.373													85	119	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150698697	150698697	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150698697A>G	uc003wif.2	+	12	1790	c.1494A>G	c.(1492-1494)GAA>GAG	p.E498E	NOS3_uc011kuy.1_Silent_p.E292E|NOS3_uc011kuz.1_Silent_p.E498E|NOS3_uc011kva.1_Silent_p.E498E|NOS3_uc011kvb.1_Silent_p.E498E	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	498	Calmodulin-binding (Potential).				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CCTTTAAAGAAGTGGCCAAGT	0.652													92	157	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	28988108	28988108	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28988108G>T	uc003xhh.3	-	24	3076	c.3017C>A	c.(3016-3018)CCT>CAT	p.P1006H	uc003xhi.1_Intron	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	1006					microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		CACTTCTACAGGGCAGTATTC	0.423													4	147	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38961179	38961179	+	Missense_Mutation	SNP	G	A	A	rs147636313		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38961179G>A	uc003xmr.2	+	22	2498	c.2420G>A	c.(2419-2421)CGT>CAT	p.R807H	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA|ADAM9_uc003xms.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	807	Cytoplasmic (Potential).			Missing (in Ref. 2; no nucleotide entry).	activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			ATTCCTGCCCGTCCTGCTCCT	0.413													63	167	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48878739	48878739	+	Intron	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48878739C>T	uc003xqk.1	+						MCM4_uc003xql.1_Intron|MCM4_uc011ldi.1_Intron	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4						cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TCTCTTCTCCCCTCACAGACA	0.572													38	71	---	---	---	---	PASS
TOX	9760	broad.mit.edu	37	8	59851852	59851852	+	Intron	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:59851852G>A	uc003xtw.1	-							NM_014729	NP_055544	O94900	TOX_HUMAN	thymus high mobility group box protein TOX							nucleus	DNA binding			kidney(2)|lung(1)|skin(1)	4		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				CAGGTAAGCAGATTCTTACCA	0.458													41	122	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67547090	67547090	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67547090C>T	uc003xwn.2	-	3	3574	c.3315G>A	c.(3313-3315)CAG>CAA	p.Q1105Q		NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	1105					protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			ATTTTTTTCGCTGGGCCTCAA	0.448													79	159	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68140281	68140281	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68140281C>G	uc003xxo.1	-	25	3898	c.3508G>C	c.(3508-3510)GTA>CTA	p.V1170L	ARFGEF1_uc003xxl.1_Missense_Mutation_p.V624L|ARFGEF1_uc003xxn.1_Missense_Mutation_p.V153L	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	1170					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GATATTTCTACTATTTTTTGT	0.328													20	159	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73480279	73480279	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73480279C>T	uc003xzb.2	+	2	898	c.310C>T	c.(310-312)CGG>TGG	p.R104W		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	104	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			AAATTTCTACCGGACCGGGAA	0.463													48	108	---	---	---	---	PASS
PSKH2	85481	broad.mit.edu	37	8	87076470	87076470	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87076470A>G	uc011lfy.1	-	2	576	c.576T>C	c.(574-576)TAT>TAC	p.Y192Y		NM_033126	NP_149117	Q96QS6	KPSH2_HUMAN	protein serine kinase H2	192	Protein kinase.						ATP binding|protein serine/threonine kinase activity			stomach(2)|lung(2)|ovary(1)	5			STAD - Stomach adenocarcinoma(118;0.129)			CACCTGGATGATAGTATAAGA	0.433													14	146	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100779175	100779175	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100779175T>C	uc003yiv.2	+	40	7410	c.7299T>C	c.(7297-7299)AGT>AGC	p.S2433S	VPS13B_uc003yiw.2_Silent_p.S2408S	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2433					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGAACAGCAGTCAAAATGGAG	0.353													37	64	---	---	---	---	PASS
RGS22	26166	broad.mit.edu	37	8	101105711	101105711	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101105711G>C	uc003yjb.1	-	3	276	c.81C>G	c.(79-81)TTC>TTG	p.F27L	RGS22_uc003yja.1_5'UTR|RGS22_uc003yjc.1_Missense_Mutation_p.F27L|RGS22_uc010mbo.1_RNA	NM_015668	NP_056483	Q8NE09	RGS22_HUMAN	regulator of G-protein signaling 22	27					negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|signal transducer activity			ovary(3)|skin(2)|breast(1)|central_nervous_system(1)	7			Epithelial(11;6.71e-08)|all cancers(13;4.19e-06)|OV - Ovarian serous cystadenocarcinoma(57;0.000469)|STAD - Stomach adenocarcinoma(118;0.169)			AGTCTACAAGGAAATCATCTG	0.264													47	64	---	---	---	---	PASS
TM7SF4	81501	broad.mit.edu	37	8	105361290	105361290	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105361290C>A	uc003ylx.1	+	2	559	c.510C>A	c.(508-510)ACC>ACA	p.T170T		NM_030788	NP_110415	Q9H295	TM7S4_HUMAN	dendritic cell-specific transmembrane protein	170					osteoclast differentiation	cell surface|integral to membrane|plasma membrane				pancreas(2)|large_intestine(1)|ovary(1)	4			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GGAACCAGACCCTGGCAGTCT	0.453													79	129	---	---	---	---	PASS
NDRG1	10397	broad.mit.edu	37	8	134254284	134254284	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134254284C>T	uc003yuh.2	-	15	1511	c.925G>A	c.(925-927)GTG>ATG	p.V309M	NDRG1_uc003yue.1_Missense_Mutation_p.V24M|NDRG1_uc003yuf.1_Missense_Mutation_p.V120M|NDRG1_uc003yug.2_Missense_Mutation_p.V309M|NDRG1_uc010mee.2_Missense_Mutation_p.V228M|NDRG1_uc010mef.2_Missense_Mutation_p.V243M|NDRG1_uc011ljh.1_Missense_Mutation_p.V137M|NDRG1_uc011lji.1_Missense_Mutation_p.V56M|NDRG1_uc003yui.1_5'Flank	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	309					cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			ATGCCCTGCACGAAGTACTTG	0.587													20	39	---	---	---	---	PASS
ZFAT	57623	broad.mit.edu	37	8	135490822	135490822	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:135490822G>A	uc003yup.2	-	16	3810	c.3635C>T	c.(3634-3636)ACG>ATG	p.T1212M	ZFAT_uc011ljj.1_Missense_Mutation_p.T331M|ZFAT_uc003yun.2_Missense_Mutation_p.T1200M|ZFAT_uc003yuo.2_Missense_Mutation_p.T1200M|ZFAT_uc010meh.2_Missense_Mutation_p.T1114M|ZFAT_uc010mei.2_RNA|ZFAT_uc003yuq.2_Missense_Mutation_p.T1200M|ZFAT_uc010mej.2_Missense_Mutation_p.T1150M	NM_020863	NP_065914	Q9P243	ZFAT_HUMAN	zinc finger protein 406 isoform ZFAT-1	1212					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCCGCCCTGCGTGTAGACAGT	0.652													2	2	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139158241	139158241	+	Silent	SNP	A	T	T	rs143974870		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139158241A>T	uc003yuy.2	-	15	3672	c.3501T>A	c.(3499-3501)CCT>CCA	p.P1167P	FAM135B_uc003yux.2_Silent_p.P1068P|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.P729P|FAM135B_uc003yvb.2_Missense_Mutation_p.W695R	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1167										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			GTTTTCCTCCAGGGAGCCCCA	0.448										HNSCC(54;0.14)			14	109	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971036	21971036	+	Missense_Mutation	SNP	C	A	A	rs121913381		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971036C>A	uc003zpk.2	-	2	534	c.322G>T	c.(322-324)GAT>TAT	p.D108Y	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.R163L	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	108			D -> Y (in a head and neck tumor).|D -> H (in a bladder tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.D108Y(14)|p.?(13)|p.D108H(9)|p.D108N(5)|p.H83fs*2(2)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCCAGGCATCGCGCACGTCC	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			15	16	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73236184	73236184	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73236184T>C	uc004aid.2	-	14	2023	c.1779A>G	c.(1777-1779)AAA>AAG	p.K593K	TRPM3_uc004ahu.2_Silent_p.K423K|TRPM3_uc004ahv.2_Intron|TRPM3_uc004ahw.2_Silent_p.K465K|TRPM3_uc004ahx.2_Silent_p.K452K|TRPM3_uc004ahy.2_Intron|TRPM3_uc004ahz.2_Intron|TRPM3_uc004aia.2_Silent_p.K440K|TRPM3_uc004aib.2_Intron|TRPM3_uc004aic.2_Silent_p.K593K	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	618	Cytoplasmic (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						GTTTCAAGGCTTTGGGCTGTT	0.264													23	63	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79320513	79320513	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79320513G>C	uc010mpk.2	-	8	6801	c.6677C>G	c.(6676-6678)CCA>CGA	p.P2226R	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2226					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TTCAATCCTTGGGATTCTTCT	0.423													57	130	---	---	---	---	PASS
FRMD3	257019	broad.mit.edu	37	9	85905513	85905513	+	Intron	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:85905513C>G	uc004ams.1	-						FRMD3_uc004amr.1_Intron	NM_174938	NP_777598	A2A2Y4	FRMD3_HUMAN	FERM domain containing 3							cytoplasm|cytoskeleton|extrinsic to membrane|integral to membrane	cytoskeletal protein binding			ovary(1)|central_nervous_system(1)	2						AAGAGACAGACTTACCCTCAC	0.498													69	141	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90501062	90501062	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90501062G>A	uc004app.3	+	4	1695	c.1660G>A	c.(1660-1662)GAG>AAG	p.E554K	C9orf79_uc004apo.1_Missense_Mutation_p.E366K	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	554						integral to membrane				ovary(3)	3						TACATCCCAGGAGAGGACACA	0.438													106	192	---	---	---	---	PASS
DIRAS2	54769	broad.mit.edu	37	9	93375779	93375779	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:93375779C>A	uc004aqx.1	-	2	442	c.331G>T	c.(331-333)GTG>TTG	p.V111L		NM_017594	NP_060064	Q96HU8	DIRA2_HUMAN	Di-Ras2	111					small GTPase mediated signal transduction	intracellular|plasma membrane	GTP binding|GTPase activity				0						ATGCTCTCCACGTCCCCTTTG	0.592													55	129	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	95050532	95050532	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95050532G>A	uc004art.1	-	3	409	c.152C>T	c.(151-153)ACT>ATT	p.T51I	IARS_uc004ars.1_5'UTR|IARS_uc004aru.3_Missense_Mutation_p.T51I|IARS_uc010mqr.2_Intron|IARS_uc010mqt.2_Silent_p.L7L	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	51	HIGH region.				isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	AGGCAGTCCAGTTGCAAAAGG	0.348													51	101	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101824556	101824556	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101824556C>A	uc004azb.1	+	38	3767	c.3561C>A	c.(3559-3561)GAC>GAA	p.D1187E		NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor	1187	Nonhelical region 10 (NC10).			Missing (in Ref. 2; AAC78500).	angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				TTCCTGCCGACAGCCCTCCAC	0.433													42	109	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114184296	114184296	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114184296G>C	uc004bfe.1	-	16	1894	c.1894C>G	c.(1894-1896)CAA>GAA	p.Q632E	KIAA0368_uc010muc.1_Missense_Mutation_p.Q454E	NM_001080398	NP_001073867			KIAA0368 protein												0						AAAGCTTCTTGAATAGCAAGT	0.433													34	68	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	118997697	118997697	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118997697C>G	uc004bjn.2	+	7	2894	c.2513C>G	c.(2512-2514)CCA>CGA	p.P838R	PAPPA_uc011lxp.1_Missense_Mutation_p.P533R|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	838					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TGTGATGTCCCACTGACCATC	0.532													16	41	---	---	---	---	PASS
OR1L4	254973	broad.mit.edu	37	9	125487040	125487040	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125487040T>C	uc004bmu.1	+	1	772	c.772T>C	c.(772-774)TAT>CAT	p.Y258H		NM_001005235	NP_001005235	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAGTGTCATCTATGTCTATTT	0.517													66	161	---	---	---	---	PASS
STRBP	55342	broad.mit.edu	37	9	125898705	125898705	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125898705G>A	uc004bns.2	-	15	2017	c.1587C>T	c.(1585-1587)CTC>CTT	p.L529L	STRBP_uc004bnt.2_Silent_p.L347L|STRBP_uc004bnu.2_Silent_p.L515L|STRBP_uc004bnv.2_Silent_p.L529L|STRBP_uc004bnr.2_Silent_p.L88L	NM_018387	NP_060857	Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein	529	DRBM 2.				multicellular organismal development	cytoplasm|nucleus	DNA binding			breast(1)|skin(1)	2						TCTCTGAGATGAGTTCATACT	0.443													5	198	---	---	---	---	PASS
SH3GLB2	56904	broad.mit.edu	37	9	131777040	131777040	+	Intron	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131777040G>A	uc004bwv.2	-						SH3GLB2_uc004bww.2_Intron|SH3GLB2_uc004bwx.1_Intron|SH3GLB2_uc011mbm.1_Intron	NM_020145	NP_064530	Q9NR46	SHLB2_HUMAN	SH3-domain GRB2-like endophilin B2						filopodium assembly|signal transduction	cytoplasm|nucleus	cytoskeletal adaptor activity|SH3 domain binding				0						AATAGTCCCAGGGCCCTCACC	0.582													44	113	---	---	---	---	PASS
FAM78A	286336	broad.mit.edu	37	9	134136488	134136488	+	Silent	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134136488G>C	uc004cak.2	-	2	913	c.573C>G	c.(571-573)ACC>ACG	p.T191T	FAM78A_uc004caj.2_Silent_p.T188T	NM_033387	NP_203745	Q5JUQ0	FA78A_HUMAN	hypothetical protein LOC286336	191										ovary(1)	1	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.15e-05)|Epithelial(140;0.000267)		CCACCAGCCAGGTGGTGAAGC	0.602													33	110	---	---	---	---	PASS
SETX	23064	broad.mit.edu	37	9	135202804	135202804	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135202804G>A	uc004cbk.2	-	10	4364	c.4181C>T	c.(4180-4182)TCA>TTA	p.S1394L	SETX_uc004cbj.2_Missense_Mutation_p.S1013L|SETX_uc010mzt.2_Missense_Mutation_p.S1013L	NM_015046	NP_055861	Q7Z333	SETX_HUMAN	senataxin	1394					cell death|double-strand break repair|RNA processing	cytoplasm|nucleolus|nucleoplasm	ATP binding|DNA helicase activity			ovary(2)|skin(1)	3		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		ATTATAATCTGACCTATCAGA	0.363													118	208	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27324214	27324214	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27324214T>C	uc001ith.2	-	24	3334	c.3162A>G	c.(3160-3162)CTA>CTG	p.L1054L	ANKRD26_uc001itg.2_Silent_p.L741L|ANKRD26_uc009xku.1_Silent_p.L1055L	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	1054	Potential.					centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						TGTTATCTTTTAGGTTAGACA	0.353													60	75	---	---	---	---	PASS
C10orf27	219793	broad.mit.edu	37	10	72535011	72535011	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72535011A>G	uc001jrj.1	-	8	1096	c.706T>C	c.(706-708)TGT>CGT	p.C236R	C10orf27_uc010qjm.1_Missense_Mutation_p.C237R|C10orf27_uc009xqh.1_Intron|C10orf27_uc010qjn.1_Missense_Mutation_p.C235R|C10orf27_uc009xqi.1_RNA	NM_152710	NP_689923	Q96M53	SPATL_HUMAN	stromal protein associated with thymii and lymph	236					cell differentiation|multicellular organismal development|spermatogenesis	cytosol				skin(1)	1						AGGATCCGACACAGGAGCTCC	0.592													10	30	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73571742	73571742	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73571742T>C	uc001jrx.3	+	64	9727	c.9350T>C	c.(9349-9351)ATG>ACG	p.M3117T	CDH23_uc001jsg.3_Missense_Mutation_p.M877T|CDH23_uc001jsh.3_Missense_Mutation_p.M877T|CDH23_uc001jsi.3_Missense_Mutation_p.M877T|CDH23_uc001jsj.3_5'UTR|CDH23_uc010qjr.1_5'UTR	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	3117	Cytoplasmic (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						ATCATGGACATGCCTAACACC	0.632											OREG0020259	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	32	55	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	10	134622290	134622290	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134622290C>A	uc010qux.1	-	50	6961	c.6961G>T	c.(6961-6963)GCC>TCC	p.A2321S		NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CAGGTCCAGGCCTGCACTACC	0.403													4	0	---	---	---	---	PASS
VENTX	27287	broad.mit.edu	37	10	135051452	135051452	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135051452C>T	uc010quy.1	+	1	45	c.34C>T	c.(34-36)CAG>TAG	p.Q12*		NM_014468	NP_055283	O95231	VENTX_HUMAN	VENT homeobox	12					multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		TCGTGGCCCGCAGCAGCTCTC	0.726													4	8	---	---	---	---	PASS
FRG2B	441581	broad.mit.edu	37	10	135440236	135440236	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135440236C>A	uc010qvg.1	-	1	64	c.11G>T	c.(10-12)GGA>GTA	p.G4V		NM_001080998	NP_001074467	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	4						nucleus					0		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		GTCTTCATTTCCCTTTCCCAT	0.522													17	391	---	---	---	---	PASS
IRF7	3665	broad.mit.edu	37	11	612717	612717	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:612717G>A	uc001lqh.2	-	11	1810	c.1440C>T	c.(1438-1440)CTC>CTT	p.L480L	IRF7_uc009ycb.2_Silent_p.L374L|IRF7_uc010qwf.1_Silent_p.L479L|IRF7_uc001lqf.2_Silent_p.L187L|IRF7_uc010qwg.1_Silent_p.L187L|IRF7_uc001lqg.2_Silent_p.L493L|IRF7_uc001lqi.2_Silent_p.L451L|IRF7_uc010qwh.1_Silent_p.L187L	NM_001572	NP_001563	Q92985	IRF7_HUMAN	interferon regulatory factor 7 isoform a	480					interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of interferon-alpha production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	cytosol|endosome membrane|nucleoplasm|plasma membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(49;1.69e-08)|all_epithelial(84;1.65e-05)|Breast(177;0.000231)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.106)|all_lung(207;0.136)		all cancers(45;7.68e-28)|Epithelial(43;7.44e-27)|OV - Ovarian serous cystadenocarcinoma(40;3.53e-21)|BRCA - Breast invasive adenocarcinoma(625;6.96e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGACAGGCAGAGGCTGAGGC	0.602													38	20	---	---	---	---	PASS
FXC1	26515	broad.mit.edu	37	11	6502739	6502739	+	5'UTR	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6502739G>T	uc001mdn.3	+	1					ARFIP2_uc001mdk.2_5'Flank|ARFIP2_uc001mdl.2_5'Flank|ARFIP2_uc010ral.1_5'Flank|ARFIP2_uc010ram.1_5'Flank|ARFIP2_uc010ran.1_5'Flank|ARFIP2_uc001mdm.2_5'Flank|ARFIP2_uc009yfe.1_5'Flank|FXC1_uc001mdo.3_RNA	NM_012192	NP_036324	Q9Y5J6	TIM9B_HUMAN	mitochondrial import inner membrane translocase						cell-matrix adhesion|protein import into mitochondrial inner membrane|transmembrane transport	mitochondrial inner membrane|mitochondrial intermembrane space protein transporter complex	metal ion binding				0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.26e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCATGCGCCGGTGGCGTGATG	0.517													6	8	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17552819	17552819	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17552819A>G	uc001mnf.2	-	4	378	c.269T>C	c.(268-270)CTG>CCG	p.L90P	USH1C_uc001mne.2_Missense_Mutation_p.L90P|USH1C_uc009yhb.2_Missense_Mutation_p.L90P|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.L54P	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	90	PDZ 1.				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						CAGACGGTCCAGACGCACCTC	0.647													14	21	---	---	---	---	PASS
WT1	7490	broad.mit.edu	37	11	32456334	32456334	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32456334G>C	uc001mtn.1	-	1	754	c.558C>G	c.(556-558)AGC>AGG	p.S186R	WT1_uc001mto.1_Missense_Mutation_p.S186R|WT1_uc001mtp.1_Missense_Mutation_p.S186R|WT1_uc001mtq.1_Missense_Mutation_p.S186R|WT1_uc009yjs.1_RNA|WIT1_uc010rec.1_5'Flank|WIT1_uc010red.1_5'Flank|WIT1_uc010ree.1_5'Flank	NM_024426	NP_077744	P19544	WT1_HUMAN	Wilms tumor 1 isoform D	118					adrenal cortex formation|branching involved in ureteric bud morphogenesis|camera-type eye development|cardiac muscle cell fate commitment|cellular response to cAMP|cellular response to gonadotropin stimulus|germ cell development|glomerular basement membrane development|glomerular visceral epithelial cell differentiation|induction of apoptosis|male genitalia development|male gonad development|mesenchymal to epithelial transition|metanephric epithelium development|metanephric S-shaped body morphogenesis|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of female gonad development|negative regulation of metanephric glomerular mesangial cell proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|negative regulation of translation|positive regulation of male gonad development|positive regulation of transcription, DNA-dependent|posterior mesonephric tubule development|regulation of organ formation|RNA splicing|sex determination|vasculogenesis|visceral serous pericardium development	cytoplasm|nuclear speck|nucleoplasm	C2H2 zinc finger domain binding|RNA binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding	p.P117fs*95(1)|p.G186fs*34(1)	EWSR1/WT1(231)	haematopoietic_and_lymphoid_tissue(318)|soft_tissue(231)|kidney(132)|pleura(2)|lung(2)|upper_aerodigestive_tract(1)|peritoneum(1)	687	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			ATGACGCCTGGCTGGGCGGAG	0.652			D|Mis|N|F|S	EWSR1	Wilms|desmoplastic small round cell tumor	Wilms			Denys-Drash_syndrome|Frasier_syndrome|Familial_Wilms_tumor|Wilms_tumor-Aniridia-ambiguous_Genitals-mental_Retardation				9	13	---	---	---	---	PASS
SYT13	57586	broad.mit.edu	37	11	45274136	45274136	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45274136G>T	uc001myq.2	-	4	808	c.682C>A	c.(682-684)CCC>ACC	p.P228T	SYT13_uc009yku.1_Missense_Mutation_p.P84T	NM_020826	NP_065877	Q7L8C5	SYT13_HUMAN	synaptotagmin XIII	228	Cytoplasmic (Potential).|C2 1.					transport vesicle				ovary(1)	1						TCCGCCAGGGGGAGCACCAGG	0.682											OREG0020928	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	29	---	---	---	---	PASS
KIAA0652	9776	broad.mit.edu	37	11	46690953	46690953	+	Splice_Site	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46690953G>C	uc009yld.2	+	17	2032	c.1348_splice	c.e17-1	p.K450_splice	KIAA0652_uc001nda.2_Splice_Site_p.K483_splice|KIAA0652_uc001ndb.2_Splice_Site_p.K450_splice|KIAA0652_uc001ncz.2_Splice_Site_p.K413_splice|KIAA0652_uc001ndc.2_Splice_Site_p.K413_splice|KIAA0652_uc010rgv.1_Splice_Site_p.K334_splice	NM_001142673	NP_001136145	O75143	ATG13_HUMAN	autophagy-related protein 13 isoform 1						autophagic vacuole assembly	cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding				0				GBM - Glioblastoma multiforme(35;0.226)		TGTTTTTGAAGAAACCAGCTT	0.428													82	127	---	---	---	---	PASS
OR5D13	390142	broad.mit.edu	37	11	55541774	55541774	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55541774G>T	uc010ril.1	+	1	861	c.861G>T	c.(859-861)CTG>CTT	p.L287L		NM_001001967	NP_001001967	Q8NGL4	OR5DD_HUMAN	olfactory receptor, family 5, subfamily D,	287	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3		all_epithelial(135;0.196)				TTCCAATGCTGAACCCATTGA	0.358													32	47	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904776	55904776	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904776A>C	uc010riz.1	-	1	419	c.419T>G	c.(418-420)CTC>CGC	p.L140R		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	140	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					CAGGAGGCAGAGCCGCCGAGA	0.468													44	71	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83673942	83673942	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83673942G>T	uc001paj.2	-	9	1314	c.1011C>A	c.(1009-1011)GAC>GAA	p.D337E	DLG2_uc001pai.2_Missense_Mutation_p.D286E|DLG2_uc010rsy.1_Missense_Mutation_p.D304E|DLG2_uc010rsz.1_Missense_Mutation_p.D337E|DLG2_uc010rta.1_Missense_Mutation_p.D337E|DLG2_uc001pak.2_Missense_Mutation_p.D442E|DLG2_uc010rtb.1_Missense_Mutation_p.D304E|DLG2_uc001pal.1_Missense_Mutation_p.D337E|DLG2_uc001pam.1_Missense_Mutation_p.D376E	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	337						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TGTAGTCGTCGTCAACAAGCA	0.423													75	161	---	---	---	---	PASS
ZC3H12C	85463	broad.mit.edu	37	11	110035605	110035605	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110035605C>A	uc009yxw.2	+	6	1846	c.1795C>A	c.(1795-1797)CTG>ATG	p.L599M	ZC3H12C_uc010rwc.1_Missense_Mutation_p.L600M|ZC3H12C_uc010rwd.1_Missense_Mutation_p.L600M|ZC3H12C_uc001pkr.3_Missense_Mutation_p.L568M	NM_033390	NP_203748	Q9C0D7	ZC12C_HUMAN	zinc finger CCCH-type containing 12C	599							endonuclease activity|nucleic acid binding|zinc ion binding				0		all_cancers(61;3.24e-13)|all_epithelial(67;1.27e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.72e-06)|BRCA - Breast invasive adenocarcinoma(274;1.17e-05)|all cancers(92;9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0279)		ATACTCAAATCTGAGTCTCTC	0.438													27	37	---	---	---	---	PASS
APOA5	116519	broad.mit.edu	37	11	116661365	116661365	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116661365A>G	uc001ppr.2	-	3	588	c.580T>C	c.(580-582)TAC>CAC	p.Y194H	ZNF259_uc001ppp.2_5'Flank|ZNF259_uc009yzd.2_5'Flank|ZNF259_uc001ppq.2_5'Flank|APOA5_uc009yze.2_Missense_Mutation_p.Y194H|APOA5_uc009yzf.2_Missense_Mutation_p.Y194H|APOA5_uc009yzg.2_Missense_Mutation_p.Y220H	NM_052968	NP_443200	Q6Q788	APOA5_HUMAN	apolipoprotein AV precursor	194					acylglycerol homeostasis|cholesterol homeostasis|lipid transport|lipoprotein metabolic process|positive regulation of fatty acid biosynthetic process|positive regulation of lipoprotein lipase activity|positive regulation of receptor-mediated endocytosis|positive regulation of triglyceride catabolic process|positive regulation of very-low-density lipoprotein particle remodeling|tissue regeneration|triglyceride catabolic process|triglyceride homeostasis	chylomicron|high-density lipoprotein particle|very-low-density lipoprotein particle	enzyme binding|heparin binding|lipoprotein lipase activator activity|low-density lipoprotein particle receptor binding|phosphatidylcholine binding				0	all_hematologic(175;0.0487)	all_cancers(61;3.31e-09)|all_epithelial(67;8.03e-06)|Breast(348;0.0126)|Melanoma(852;0.0153)|Acute lymphoblastic leukemia(157;0.0257)|Medulloblastoma(222;0.0425)|all_hematologic(158;0.0433)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;4.93e-06)|all cancers(92;0.000123)|OV - Ovarian serous cystadenocarcinoma(223;0.149)		CTCTCGGCGTATGGGTGGAAG	0.706													6	12	---	---	---	---	PASS
IL10RA	3587	broad.mit.edu	37	11	117863985	117863985	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117863985G>A	uc001prv.2	+	4	474	c.397G>A	c.(397-399)GAG>AAG	p.E133K	IL10RA_uc010rxl.1_Missense_Mutation_p.E113K|IL10RA_uc010rxm.1_Missense_Mutation_p.E113K|IL10RA_uc010rxn.1_5'UTR|IL10RA_uc001prw.2_5'UTR	NM_001558	NP_001549	Q13651	I10R1_HUMAN	interleukin 10 receptor, alpha precursor	133	Extracellular (Potential).					integral to membrane|plasma membrane	interleukin-10 receptor activity			ovary(1)	1	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.07e-05)|Epithelial(105;0.00108)		TGTGAACCTAGAGATCCACAA	0.552													35	53	---	---	---	---	PASS
OR8B2	26595	broad.mit.edu	37	11	124252357	124252357	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124252357C>T	uc010sai.1	-	1	883	c.883G>A	c.(883-885)GAT>AAT	p.D295N		NM_001005468	NP_001005468	Q96RD0	OR8B2_HUMAN	olfactory receptor, family 8, subfamily B,	295	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		ACTTTGACATCCTTGTTCCTC	0.368													67	128	---	---	---	---	PASS
ADIPOR2	79602	broad.mit.edu	37	12	1895244	1895244	+	3'UTR	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1895244A>T	uc001qjm.2	+	8					ADIPOR2_uc001qjn.2_3'UTR	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2						fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			TGTGATACCTACCAGTCTCCA	0.552													52	123	---	---	---	---	PASS
TULP3	7289	broad.mit.edu	37	12	3047270	3047270	+	Intron	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3047270C>T	uc010seh.1	+						TULP3_uc009zec.1_Intron|TULP3_uc010seg.1_Intron|TULP3_uc001qlj.2_Intron|TULP3_uc010sei.1_Intron	NM_003324	NP_003315	O75386	TULP3_HUMAN	tubby like protein 3 isoform 1						G-protein coupled receptor protein signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|extracellular region|nucleus|plasma membrane	phosphatidylinositol-4,5-bisphosphate binding				0			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			ATGATTTTCCCTTTGGACAGA	0.448													49	94	---	---	---	---	PASS
PEX5	5830	broad.mit.edu	37	12	7361113	7361113	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7361113C>T	uc009zfu.1	+	14	1822	c.1242C>T	c.(1240-1242)ACC>ACT	p.T414T	PEX5_uc001qsw.2_Silent_p.T414T|PEX5_uc010sgc.1_Silent_p.T429T|PEX5_uc001qsu.2_Silent_p.T377T|PEX5_uc010sgd.1_Silent_p.T435T|PEX5_uc001qsv.2_Silent_p.T406T	NM_001131026	NP_001124498	P50542	PEX5_HUMAN	peroxisomal biogenesis factor 5 isoform d	414	TPR 3.				protein import into peroxisome matrix, translocation|protein targeting to peroxisome|protein tetramerization|protein transport	cytosol|peroxisomal matrix|peroxisomal membrane	peroxisome matrix targeting signal-1 binding|protein C-terminus binding|protein N-terminus binding			ovary(1)	1						TGAGCTTCACCAACGAGTCCC	0.557													12	61	---	---	---	---	PASS
PZP	5858	broad.mit.edu	37	12	9304846	9304846	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9304846A>G	uc001qvl.2	-	32	4211	c.4182T>C	c.(4180-4182)GGT>GGC	p.G1394G	PZP_uc009zgl.2_Silent_p.G1180G	NM_002864	NP_002855			pregnancy-zone protein precursor											ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)	5						GGGGAATAAAACCAGATACCA	0.358													52	136	---	---	---	---	PASS
SLCO1C1	53919	broad.mit.edu	37	12	20854375	20854375	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20854375G>T	uc001rej.3	+	4	608	c.253G>T	c.(253-255)GAT>TAT	p.D85Y	SLCO1C1_uc010sii.1_Missense_Mutation_p.D85Y|SLCO1C1_uc010sij.1_Missense_Mutation_p.D85Y|SLCO1C1_uc009zip.2_Intron|SLCO1C1_uc001rei.2_Missense_Mutation_p.D85Y|SLCO1C1_uc010sik.1_Intron	NM_017435	NP_059131	Q9NYB5	SO1C1_HUMAN	solute carrier organic anion transporter family,	85	Helical; Name=2; (Potential).				sodium-independent organic anion transport	integral to membrane|plasma membrane	thyroid hormone transmembrane transporter activity			ovary(5)|pancreas(1)|skin(1)	7	Esophageal squamous(101;0.149)					GGGAGTTATTGATGGTAGTTT	0.403													75	196	---	---	---	---	PASS
ARID2	196528	broad.mit.edu	37	12	46246297	46246297	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46246297G>A	uc001ros.1	+	15	4391	c.4391G>A	c.(4390-4392)CGC>CAC	p.R1464H	ARID2_uc001ror.2_Missense_Mutation_p.R1464H|ARID2_uc009zkg.1_Missense_Mutation_p.R920H|ARID2_uc009zkh.1_Missense_Mutation_p.R1091H|ARID2_uc001rou.1_Missense_Mutation_p.R798H	NM_152641	NP_689854	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1464					chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(6)|skin(3)|upper_aerodigestive_tract(1)	10	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		CCTCAGCAACGCCCAAGTGTA	0.438													78	294	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49416382	49416382	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49416382G>T	uc001rta.3	-	51	16329	c.16329C>A	c.(16327-16329)TAC>TAA	p.Y5443*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5443	SET.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CCTGCTCTTCGTAGATTTTCT	0.537			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			119	295	---	---	---	---	PASS
OR9K2	441639	broad.mit.edu	37	12	55523991	55523991	+	Missense_Mutation	SNP	C	G	G	rs149479525	byFrequency	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55523991C>G	uc010spe.1	+	1	439	c.439C>G	c.(439-441)CGC>GGC	p.R147G		NM_001005243	NP_001005243	Q8NGE7	OR9K2_HUMAN	olfactory receptor, family 9, subfamily K,	147	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|pancreas(1)	2						GGCTTATGACCGCTTTATTGC	0.498													54	142	---	---	---	---	PASS
MIP	4284	broad.mit.edu	37	12	56848367	56848367	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56848367T>C	uc001slh.2	-	1	63	c.31A>G	c.(31-33)AGG>GGG	p.R11G		NM_012064	NP_036196	P30301	MIP_HUMAN	major intrinsic protein of lens fiber	11	Helical; (By similarity).				response to stimulus|visual perception	gap junction|integral to plasma membrane	structural constituent of eye lens			skin(1)	1						AATATGGCCCTCCAAAAGGAG	0.602													3	121	---	---	---	---	PASS
FAM19A2	338811	broad.mit.edu	37	12	62148664	62148664	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62148664G>C	uc001sqw.2	-	3	1761	c.248C>G	c.(247-249)TCA>TGA	p.S83*	FAM19A2_uc001sqv.2_RNA|FAM19A2_uc001sqx.2_Nonsense_Mutation_p.S83*|FAM19A2_uc001sqy.2_RNA	NM_178539	NP_848634	Q8N3H0	F19A2_HUMAN	family with sequence similarity 19 (chemokine	83						cytoplasm				ovary(1)	1			GBM - Glioblastoma multiforme(1;0.00484)	GBM - Glioblastoma multiforme(3;0.02)		ATCCACACATGATGGAGCAGC	0.493													6	109	---	---	---	---	PASS
AVPR1A	552	broad.mit.edu	37	12	63544086	63544086	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:63544086C>A	uc001sro.1	-	1	2505	c.531G>T	c.(529-531)CTG>CTT	p.L177L		NM_000706	NP_000697	P37288	V1AR_HUMAN	arginine vasopressin receptor 1A	177	Helical; Name=4; (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration|generation of precursor metabolites and energy	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity				0			BRCA - Breast invasive adenocarcinoma(9;0.193)	GBM - Glioblastoma multiforme(28;0.0569)	Conivaptan(DB00872)|Desmopressin(DB00035)|Felypressin(DB00093)|Terlipressin(DB02638)|Vasopressin(DB00067)	GCACGAAGCTCAGCACCCAGG	0.642													45	106	---	---	---	---	PASS
CNOT2	4848	broad.mit.edu	37	12	70723272	70723272	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70723272G>A	uc001svv.2	+	5	887	c.308G>A	c.(307-309)GGC>GAC	p.G103D	CNOT2_uc009zro.2_Missense_Mutation_p.G103D|CNOT2_uc009zrp.2_Missense_Mutation_p.G83D|CNOT2_uc009zrq.2_Missense_Mutation_p.G103D	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	103					nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TTATCACAAGGCACTCAGTTA	0.458													42	97	---	---	---	---	PASS
KCNC2	3747	broad.mit.edu	37	12	75444795	75444795	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75444795C>A	uc001sxg.1	-	3	1534	c.990G>T	c.(988-990)GTG>GTT	p.V330V	KCNC2_uc009zry.2_Silent_p.V330V|KCNC2_uc001sxe.2_Silent_p.V330V|KCNC2_uc001sxf.2_Silent_p.V330V|KCNC2_uc010stw.1_Silent_p.V330V	NM_139137	NP_631875	Q96PR1	KCNC2_HUMAN	Shaw-related voltage-gated potassium channel	330	Helical; Name=Segment S3; (Potential).				energy reserve metabolic process|regulation of insulin secretion	voltage-gated potassium channel complex	voltage-gated potassium channel activity			breast(2)|pancreas(2)|skin(1)|lung(1)	6						CACTGAGTCCCACCTCTAAGT	0.428													56	122	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88379738	88379738	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88379738T>C	uc001tam.1	-	11	1183	c.1015A>G	c.(1015-1017)AGA>GGA	p.R339G	C12orf50_uc001tan.2_Missense_Mutation_p.R354G	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	339										skin(2)|ovary(1)	3						ACAGCATCTCTTTGAACGTGG	0.473													94	217	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99223138	99223138	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99223138G>T	uc001tge.1	-						ANKS1B_uc001tgf.1_Intron|ANKS1B_uc001tgk.2_Intron|ANKS1B_uc010svd.1_Intron|ANKS1B_uc001tgd.1_Intron|ANKS1B_uc009ztq.2_Intron|ANKS1B_uc010sve.1_Intron|ANKS1B_uc001tgh.3_Intron|ANKS1B_uc001tgi.2_Intron|ANKS1B_uc009ztr.2_Intron|ANKS1B_uc001tgj.2_Intron|ANKS1B_uc009ztp.2_Intron|ANKS1B_uc010svf.1_Intron|ANKS1B_uc001tgg.3_Intron|ANKS1B_uc010svg.1_Intron|ANKS1B_uc009zts.1_Intron	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a							Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GTTCCTGAATGGAAATACATC	0.443													44	75	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102046455	102046455	+	Splice_Site	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102046455G>T	uc001tii.2	+	15	1554	c.1452_splice	c.e15-1	p.R484_splice	MYBPC1_uc001tig.2_Splice_Site_p.R509_splice|MYBPC1_uc010svq.1_Splice_Site_p.R471_splice|MYBPC1_uc001tih.2_Splice_Site_p.R509_splice|MYBPC1_uc001tij.2_Splice_Site_p.R484_splice|MYBPC1_uc010svr.1_Splice_Site_p.R484_splice|MYBPC1_uc010svs.1_Splice_Site_p.R484_splice|MYBPC1_uc010svt.1_Splice_Site_p.R472_splice|MYBPC1_uc010svu.1_Splice_Site_p.R465_splice|MYBPC1_uc001tik.2_Splice_Site_p.R458_splice	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						TGTTTCCTTAGGATCCACAAG	0.373													67	214	---	---	---	---	PASS
MYBPC1	4604	broad.mit.edu	37	12	102061515	102061515	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102061515G>T	uc001tii.2	+	22	2443	c.2341G>T	c.(2341-2343)GAC>TAC	p.D781Y	MYBPC1_uc001tig.2_Missense_Mutation_p.D788Y|MYBPC1_uc010svq.1_Missense_Mutation_p.D750Y|MYBPC1_uc001tih.2_Missense_Mutation_p.D788Y|MYBPC1_uc001tij.2_Missense_Mutation_p.D763Y|MYBPC1_uc010svr.1_Missense_Mutation_p.D763Y|MYBPC1_uc010svs.1_Missense_Mutation_p.D781Y|MYBPC1_uc010svt.1_Missense_Mutation_p.D751Y|MYBPC1_uc010svu.1_Missense_Mutation_p.D744Y|MYBPC1_uc001tik.2_Missense_Mutation_p.D737Y|MYBPC1_uc001til.2_5'UTR|MYBPC1_uc001tim.2_5'UTR	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3	781	Fibronectin type-III 2.				cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						TTCAGCTGAGGACTGGATAGT	0.383													26	92	---	---	---	---	PASS
C12orf48	55010	broad.mit.edu	37	12	102559614	102559614	+	Missense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102559614T>A	uc001tjf.2	+	6	886	c.774T>A	c.(772-774)AAT>AAA	p.N258K	C12orf48_uc001tjg.2_Missense_Mutation_p.N177K|C12orf48_uc010swa.1_Missense_Mutation_p.N335K|C12orf48_uc001tjh.2_Missense_Mutation_p.N177K|C12orf48_uc010swb.1_Missense_Mutation_p.N144K|C12orf48_uc009zuc.2_Intron|C12orf48_uc001tjj.2_5'UTR|C12orf48_uc001tjk.2_Missense_Mutation_p.N258K|C12orf48_uc009zud.2_Missense_Mutation_p.N258K	NM_017915	NP_060385	Q9NWS1	PR1BP_HUMAN	hypothetical protein LOC55010	258					response to DNA damage stimulus	cytoplasm|nucleus	DNA binding				0						ATTTTATTAATTTCATTGACA	0.308													55	184	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104014315	104014315	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104014315G>C	uc001tjw.2	+	4	587	c.401G>C	c.(400-402)GGA>GCA	p.G134A		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	134	Extracellular (Potential).|EGF-like 1.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GAAGGAAATGGAACCTGCTCC	0.458													5	20	---	---	---	---	PASS
HSP90B1	7184	broad.mit.edu	37	12	104341167	104341167	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104341167G>C	uc001tkb.1	+	17	2446	c.2341G>C	c.(2341-2343)GAA>CAA	p.E781Q	HSP90B1_uc010swg.1_Missense_Mutation_p.E446Q|HSP90B1_uc009zui.1_Missense_Mutation_p.K317N	NM_003299	NP_003290	P14625	ENPL_HUMAN	heat shock protein 90kDa beta, member 1	781					actin rod assembly|anti-apoptosis|cellular response to ATP|ER-associated protein catabolic process|protein folding|protein transport|regulation of phosphoprotein phosphatase activity|response to hypoxia|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|endoplasmic reticulum membrane|melanosome|microsome|midbody|perinuclear region of cytoplasm	ATP binding|calcium ion binding|low-density lipoprotein particle receptor binding|protein phosphatase binding|RNA binding|unfolded protein binding|virion binding			ovary(2)|skin(1)	3					Rifabutin(DB00615)	cgaagatgaagaaatggatgt	0.189													51	115	---	---	---	---	PASS
USP30	84749	broad.mit.edu	37	12	109520716	109520716	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109520716G>A	uc010sxi.1	+	11	1121	c.1017G>A	c.(1015-1017)CGG>CGA	p.R339R	USP30_uc001tnu.3_Silent_p.R308R|USP30_uc001tnw.3_Silent_p.R56R	NM_032663	NP_116052	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	339	Cytoplasmic (Potential).				ubiquitin-dependent protein catabolic process	integral to membrane|mitochondrial outer membrane	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(1)	1						CTCTGAAGCGGCATGAGCACG	0.532													4	85	---	---	---	---	PASS
DDX54	79039	broad.mit.edu	37	12	113601994	113601994	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113601994G>A	uc001tup.2	-	15	1844	c.1816C>T	c.(1816-1818)CAG>TAG	p.Q606*	DDX54_uc001tuq.3_Nonsense_Mutation_p.Q606*	NM_024072	NP_076977	Q8TDD1	DDX54_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 54	606	Interaction with nuclear receptors.				estrogen receptor signaling pathway|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nucleolus	ATP binding|ATP-dependent RNA helicase activity|estrogen receptor binding|RNA binding|transcription corepressor activity			skin(2)|central_nervous_system(1)	3						TGCTGTCCCTGCTGGAAGCGG	0.577													5	6	---	---	---	---	PASS
WDR66	144406	broad.mit.edu	37	12	122413512	122413512	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122413512G>C	uc009zxk.2	+	19	3069	c.2927G>C	c.(2926-2928)AGA>ACA	p.R976T		NM_144668	NP_653269	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	976							calcium ion binding			ovary(1)|skin(1)	2	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ATGGAGACCAGAAAGGTGTCA	0.438													50	97	---	---	---	---	PASS
TMEM132B	114795	broad.mit.edu	37	12	125834677	125834677	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125834677G>T	uc001uhe.1	+	2	740	c.732G>T	c.(730-732)TCG>TCT	p.S244S		NM_052907	NP_443139	Q14DG7	T132B_HUMAN	transmembrane protein 132B	244	Extracellular (Potential).					integral to membrane				skin(11)|ovary(5)|large_intestine(1)|pancreas(1)|breast(1)	19	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		ATATCCACTCGGGCCTGGAGA	0.592													51	91	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129558880	129558880	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129558880T>C	uc009zyl.1	-	9	3168	c.2840A>G	c.(2839-2841)CAC>CGC	p.H947R	TMEM132D_uc001uia.2_Missense_Mutation_p.H485R	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	947	Cytoplasmic (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AACCTGTTTGTGTCTGTATTT	0.443													76	179	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129559570	129559570	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129559570T>C	uc009zyl.1	-	9	2478	c.2150A>G	c.(2149-2151)GAT>GGT	p.D717G	TMEM132D_uc001uia.2_Missense_Mutation_p.D255G	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	717	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		GACTGAGCCATCACTGAACTG	0.458													40	104	---	---	---	---	PASS
SHISA2	387914	broad.mit.edu	37	13	26621149	26621149	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26621149G>C	uc001uqm.1	-	2	475	c.390C>G	c.(388-390)ATC>ATG	p.I130M		NM_001007538	NP_001007539	Q6UWI4	SHSA2_HUMAN	shisa homolog 2 precursor	130	Helical; (Potential).				multicellular organismal development	endoplasmic reticulum membrane|integral to membrane				ovary(1)|central_nervous_system(1)	2						GGGACCCCAAGATGATAAAGG	0.547													21	28	---	---	---	---	PASS
BRCA2	675	broad.mit.edu	37	13	32911360	32911360	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32911360A>G	uc001uub.1	+	11	3095	c.2868A>G	c.(2866-2868)AAA>AAG	p.K956K		NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset	956	Interaction with NPM1.				cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		AGGAGAACAAAAATAGTGTAA	0.313			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			3	119	---	---	---	---	PASS
AKAP11	11215	broad.mit.edu	37	13	42877380	42877380	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:42877380G>T	uc001uys.1	+	8	4673	c.4498G>T	c.(4498-4500)GAG>TAG	p.E1500*		NM_016248	NP_057332	Q9UKA4	AKA11_HUMAN	A-kinase anchor protein 11	1500					intracellular protein kinase cascade	microtubule organizing center	protein kinase A binding|protein phosphatase 1 binding			ovary(1)|central_nervous_system(1)	2		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		AGAAGATAATGAGTGTCACGT	0.403													82	130	---	---	---	---	PASS
DCT	1638	broad.mit.edu	37	13	95095744	95095744	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95095744C>A	uc001vlv.3	-	7	1754	c.1327G>T	c.(1327-1329)GAA>TAA	p.E443*	DCT_uc010afh.2_Nonsense_Mutation_p.E476*	NM_001922	NP_001913	P40126	TYRP2_HUMAN	dopachrome tautomerase isoform 1	443	Lumenal, melanosome (Potential).				epidermis development|melanin biosynthetic process from tyrosine	cytosol|integral to membrane|melanosome membrane|microsome	copper ion binding|dopachrome isomerase activity|oxidoreductase activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		AAAAAGAGTTCTTCATTAGTC	0.453													34	48	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	101763050	101763050	+	Intron	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101763050C>T	uc001vox.1	-							NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1							integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CTAAAACAACCACAGGCACTG	0.383													64	71	---	---	---	---	PASS
ARGLU1	55082	broad.mit.edu	37	13	107220071	107220071	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107220071G>A	uc001vqk.3	-	1	444	c.197C>T	c.(196-198)TCC>TTC	p.S66F		NM_018011	NP_060481	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	66	Arg-rich.										0	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					CTCGCGCCGGGACACGGCCGT	0.697													15	13	---	---	---	---	PASS
ABHD13	84945	broad.mit.edu	37	13	108882380	108882380	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108882380C>T	uc001vqq.2	+	2	1079	c.814C>T	c.(814-816)CCA>TCA	p.P272S		NM_032859	NP_116248	Q7L211	ABHDD_HUMAN	abhydrolase domain containing 13	272						integral to membrane	hydrolase activity			ovary(2)|upper_aerodigestive_tract(1)	3	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					TCAATTAATTCCACCAGTAAT	0.388													14	178	---	---	---	---	PASS
ZNF828	283489	broad.mit.edu	37	13	115091304	115091304	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115091304A>G	uc010ahb.2	+	3	2316	c.1987A>G	c.(1987-1989)ATT>GTT	p.I663V	ZNF828_uc001vuv.2_Missense_Mutation_p.I663V|ZNF828_uc010tko.1_Missense_Mutation_p.I663V	NM_001164144	NP_001157616	Q96JM3	ZN828_HUMAN	zinc finger protein 828	663	Mediates localization to the chromosome and the spindle and negatively regulates chromosome alignment.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation|protein localization to kinetochore|protein localization to microtubule|sister chromatid biorientation	condensed chromosome kinetochore|cytoplasm|nucleus|spindle	nucleic acid binding|protein binding|zinc ion binding			ovary(2)	2	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_epithelial(44;0.122)|all_lung(25;0.123)	BRCA - Breast invasive adenocarcinoma(86;0.104)	OV - Ovarian serous cystadenocarcinoma(48;0.193)|Epithelial(10;0.197)		TGTGGAATCCATTGATTTTAG	0.383													32	54	---	---	---	---	PASS
OR4K2	390431	broad.mit.edu	37	14	20344457	20344457	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20344457G>A	uc001vwh.1	+	1	31	c.31G>A	c.(31-33)GAA>AAA	p.E11K		NM_001005501	NP_001005501	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K,	11	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(2)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACCATGTCTGAATTTGTTTT	0.363													8	303	---	---	---	---	PASS
OR4K15	81127	broad.mit.edu	37	14	20443871	20443871	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20443871G>T	uc010tkx.1	+	1	194	c.194G>T	c.(193-195)GGC>GTC	p.G65V		NM_001005486	NP_001005486	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K,	65	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATTCTGTTGGGCAACTTTCTC	0.448													96	164	---	---	---	---	PASS
OR4K14	122740	broad.mit.edu	37	14	20483304	20483304	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20483304G>C	uc010tky.1	-	1	49	c.49C>G	c.(49-51)CTC>GTC	p.L17V		NM_001004712	NP_001004712	Q8NGD5	OR4KE_HUMAN	olfactory receptor, family 4, subfamily K,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|large_intestine(1)	3	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2e-06)	GBM - Glioblastoma multiforme(265;0.00124)		GAAGTGCAGAGTCCATGCAAC	0.348													3	95	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55643776	55643776	+	Intron	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55643776T>C	uc001xbs.2	-						DLGAP5_uc001xbt.2_Intron	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a						cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						GATCATATTCTTACACTTCTG	0.289													43	54	---	---	---	---	PASS
KCNH5	27133	broad.mit.edu	37	14	63174751	63174751	+	Silent	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63174751G>C	uc001xfx.2	-	11	2493	c.2442C>G	c.(2440-2442)CTC>CTG	p.L814L	KCNH5_uc001xfy.2_3'UTR	NM_139318	NP_647479	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,	814	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TATTATTCTTGAGTCGCAGCC	0.468													9	234	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93118824	93118824	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93118824C>T	uc001yap.2	+	6	1582	c.1430C>T	c.(1429-1431)CCC>CTC	p.P477L	RIN3_uc010auk.2_Missense_Mutation_p.P139L|RIN3_uc001yaq.2_Missense_Mutation_p.P402L|RIN3_uc001yar.1_Missense_Mutation_p.P139L|RIN3_uc001yas.1_Missense_Mutation_p.P139L	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	477	Pro-rich.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				CTCCCAGCTCCCTTAGAGAAC	0.632													45	81	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106405633	106405633	+	RNA	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106405633G>A	uc010tyt.1	-	2358		c.42431C>T								Parts of antibodies, mostly variable regions.												0						ATACACAGCCGTGTCCTCGGG	0.517													79	69	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25310188	25310188	+	Intron	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25310188C>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-2_uc001yxp.2_RNA|SNORD116-5_uc001yxq.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GATGATGAGTCCTCCAAAAAA	0.478													65	162	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25332819	25332819	+	Intron	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25332819T>A	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-20_uc001yyf.2_RNA|SNORD116-22_uc001yyg.1_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						GGATCGATGATGACTTCCATA	0.433													80	228	---	---	---	---	PASS
MTMR15	22909	broad.mit.edu	37	15	31197396	31197396	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31197396C>T	uc001zff.2	+	2	821	c.530C>T	c.(529-531)GCC>GTC	p.A177V	MTMR15_uc001zfc.3_Missense_Mutation_p.A177V|MTMR15_uc010azw.2_Missense_Mutation_p.A177V|MTMR15_uc001zfd.3_Missense_Mutation_p.A177V|MTMR15_uc001zfe.2_5'UTR	NM_014967	NP_055782	Q9Y2M0	FAN1_HUMAN	myotubularin related protein 15 isoform a	177					double-strand break repair via homologous recombination|nucleotide-excision repair, DNA incision	nucleus	5'-3' exonuclease activity|5'-flap endonuclease activity|DNA binding|magnesium ion binding|phosphodiesterase I activity|ubiquitin binding				0		all_lung(180;2.23e-09)		all cancers(64;4.72e-15)|Epithelial(43;5.4e-11)|GBM - Glioblastoma multiforme(186;0.000136)|BRCA - Breast invasive adenocarcinoma(123;0.00402)|Lung(196;0.168)		GAAGAATTTGCCGGTTCTAGT	0.373								Direct_reversal_of_damage|Editing_and_processing_nucleases					5	129	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33858998	33858998	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33858998C>A	uc001zhi.2	+	12	1336	c.1266C>A	c.(1264-1266)GTC>GTA	p.V422V	RYR3_uc010bar.2_Silent_p.V422V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	422	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GCCAGTTTGTCAGGTATGTTA	0.507													49	122	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34018666	34018666	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34018666G>T	uc001zhi.2	+	46	7062	c.6992G>T	c.(6991-6993)GGG>GTG	p.G2331V	RYR3_uc010bar.2_Missense_Mutation_p.G2331V	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2331	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GACCTGGTTGGGATCATCAGC	0.587													10	16	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34130643	34130643	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34130643C>T	uc001zhi.2	+	89	12532	c.12462C>T	c.(12460-12462)ACC>ACT	p.T4154T	RYR3_uc010bar.2_Silent_p.T4149T	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	4154					cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGAATGTCACCGACTTCCTGA	0.507													7	142	---	---	---	---	PASS
SPTBN5	51332	broad.mit.edu	37	15	42172460	42172460	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42172460A>C	uc001zos.2	-	14	2937	c.2604T>G	c.(2602-2604)AGT>AGG	p.S868R		NM_016642	NP_057726	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	903	Spectrin 7.				actin cytoskeleton organization|actin filament capping|axon guidance	cytosol|membrane|spectrin				ovary(1)|central_nervous_system(1)	2		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		CCCCACAGGAACTGCAGAAAC	0.647													3	9	---	---	---	---	PASS
PLA2G4F	255189	broad.mit.edu	37	15	42434795	42434795	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42434795C>T	uc001zoz.2	-	19	2323	c.2260G>A	c.(2260-2262)GAC>AAC	p.D754N	PLA2G4F_uc010bcq.2_Missense_Mutation_p.D51N|PLA2G4F_uc001zoy.2_Missense_Mutation_p.D386N|PLA2G4F_uc010bcr.2_Missense_Mutation_p.D505N|PLA2G4F_uc001zpa.2_Missense_Mutation_p.D505N|PLA2G4F_uc010bcs.2_Missense_Mutation_p.D541N	NM_213600	NP_998765	Q68DD2	PA24F_HUMAN	phospholipase A2, group IVF	754	PLA2c.				phospholipid catabolic process	cytosol|lysosomal membrane	metal ion binding|phospholipase A2 activity			ovary(4)	4		all_cancers(109;4.82e-12)|all_epithelial(112;5.64e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.97e-07)		GAGCGGGGGTCCTCAGCCTTG	0.627													40	89	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54006673	54006673	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54006673C>A	uc002acj.2	-	6	591	c.549G>T	c.(547-549)GAG>GAT	p.E183D	WDR72_uc010bfi.1_Missense_Mutation_p.E183D	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	183	WD 3.			E -> G (in Ref. 1; CAD97880).						lung(1)|skin(1)	2				all cancers(107;0.0511)		ATACTTTGAGCTCACCAGCTA	0.348													31	45	---	---	---	---	PASS
LCTL	197021	broad.mit.edu	37	15	66853529	66853529	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66853529G>T	uc002aqc.2	-	5	737	c.605C>A	c.(604-606)CCT>CAT	p.P202H	LCTL_uc002aqd.3_Missense_Mutation_p.P29H|LCTL_uc010bhw.2_5'UTR	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	202	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						GCTTACCCGAGGATCACTGAA	0.552													4	148	---	---	---	---	PASS
FBXO22	26263	broad.mit.edu	37	15	76222290	76222290	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76222290G>A	uc002bbk.2	+	6	799	c.694G>A	c.(694-696)GCC>ACC	p.A232T	FBXO22_uc002bbj.1_Missense_Mutation_p.A232T|FBXO22_uc002bbl.2_Missense_Mutation_p.A128T	NM_147188	NP_671717	Q8NEZ5	FBX22_HUMAN	F-box only protein 22 isoform a	232					ubiquitin-dependent protein catabolic process		ubiquitin-protein ligase activity				0						TAAGGTGGGAGCCAGTAATTA	0.433													98	222	---	---	---	---	PASS
TBC1D2B	23102	broad.mit.edu	37	15	78293997	78293997	+	Missense_Mutation	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78293997T>C	uc002bcy.3	-	12	2660	c.2660A>G	c.(2659-2661)TAT>TGT	p.Y887C	TBC1D2B_uc010bla.2_Missense_Mutation_p.Y887C	NM_144572	NP_653173	Q9UPU7	TBD2B_HUMAN	TBC1 domain family, member 2B isoform a	887						intracellular	protein binding|Rab GTPase activator activity			ovary(1)|large_intestine(1)|breast(1)	3						GTAGCGGAGATACTTAAATAT	0.443													15	18	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79298747	79298747	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79298747A>T	uc002beq.2	-	15	2270	c.1895T>A	c.(1894-1896)GTT>GAT	p.V632D	RASGRF1_uc002bep.2_Missense_Mutation_p.V619D|RASGRF1_uc010blm.1_Missense_Mutation_p.V541D|RASGRF1_uc002ber.3_Missense_Mutation_p.V619D|RASGRF1_uc010unh.1_Missense_Mutation_p.V27D	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	632					activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						GCGAATGTCAACATCATCACA	0.562													28	84	---	---	---	---	PASS
FURIN	5045	broad.mit.edu	37	15	91425048	91425048	+	Silent	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91425048A>T	uc002bpu.1	+	16	2541	c.2325A>T	c.(2323-2325)TCA>TCT	p.S775S	FES_uc010uqj.1_5'Flank|FES_uc010uqk.1_5'Flank|FES_uc002bpw.2_5'Flank|FES_uc002bpv.2_5'Flank	NM_002569	NP_002560	P09958	FURIN_HUMAN	furin preproprotein	775	Trans Golgi network signal.				cell proliferation|negative regulation of low-density lipoprotein particle receptor catabolic process|negative regulation of transforming growth factor-beta1 production|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|Notch signaling pathway|peptide biosynthetic process|peptidyl-glutamic acid carboxylation|post-translational protein modification|secretion by cell|signal peptide processing|transforming growth factor beta receptor signaling pathway|viral assembly, maturation, egress, and release	cell surface|Golgi lumen|Golgi membrane|integral to membrane|membrane raft|plasma membrane|trans-Golgi network|trans-Golgi network transport vesicle	metal ion binding|nerve growth factor binding|peptide binding|protease binding|serine-type endopeptidase activity|serine-type endopeptidase inhibitor activity			central_nervous_system(4)|lung(2)|breast(1)	7	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			CGTCTGACTCAGAAGAGGACG	0.622													41	65	---	---	---	---	PASS
UNC45A	55898	broad.mit.edu	37	15	91489919	91489919	+	Silent	SNP	A	T	T	rs12911432	byFrequency	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91489919A>T	uc002bqg.2	+	10	1615	c.1275A>T	c.(1273-1275)CCA>CCT	p.P425P	UNC45A_uc002bqd.2_Silent_p.P410P|UNC45A_uc010uqr.1_5'Flank|UNC45A_uc002bqi.2_5'Flank	NM_018671	NP_061141	Q9H3U1	UN45A_HUMAN	smooth muscle cell associated protein-1 isoform	425					cell differentiation|muscle organ development	nucleus|perinuclear region of cytoplasm	protein binding			ovary(2)	2	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.189)			TGCAGGGCCCATGTGACGCTG	0.657													14	39	---	---	---	---	PASS
ADAMTS17	170691	broad.mit.edu	37	15	100871133	100871133	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100871133C>T	uc002bvv.1	-	3	656	c.577G>A	c.(577-579)GAG>AAG	p.E193K	ADAMTS17_uc002bvx.1_5'UTR	NM_139057	NP_620688	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1	193					proteolysis	intracellular|proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		CTCTGGGCCTCAGCAGAAGGG	0.577													46	136	---	---	---	---	PASS
BAIAP3	8938	broad.mit.edu	37	16	1396058	1396058	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1396058C>A	uc002clk.1	+	24	2385	c.2385C>A	c.(2383-2385)GCC>GCA	p.A795A	BAIAP3_uc002clj.2_Silent_p.A777A|BAIAP3_uc010uuz.1_Silent_p.A760A|BAIAP3_uc010uva.1_Silent_p.A732A|BAIAP3_uc010uvc.1_Silent_p.A724A	NM_003933	NP_003924	O94812	BAIP3_HUMAN	BAI1-associated protein 3	795					G-protein coupled receptor protein signaling pathway|neurotransmitter secretion		protein C-terminus binding			pancreas(1)	1		Hepatocellular(780;0.0893)				CAGGGGCGGCCGGTGAAGCAG	0.677													4	7	---	---	---	---	PASS
UNKL	64718	broad.mit.edu	37	16	1417165	1417165	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1417165G>A	uc002cln.2	-	5	858	c.471C>T	c.(469-471)ATC>ATT	p.I157I	UNKL_uc010brn.1_Intron|UNKL_uc002clo.2_Silent_p.I154I|UNKL_uc002clp.2_Intron	NM_023076	NP_075564	Q9H9P5	UNKL_HUMAN	unkempt homolog (Drosophila)-like isoform 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				GAATGGTGCCGATGTCCCCAC	0.687													4	3	---	---	---	---	PASS
CORO7	79585	broad.mit.edu	37	16	4411466	4411466	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4411466C>T	uc002cwh.3	-	17	1703	c.1583G>A	c.(1582-1584)CGG>CAG	p.R528Q	CORO7_uc002cwe.2_RNA|CORO7_uc002cwf.2_Missense_Mutation_p.R528Q|CORO7_uc002cwg.3_Missense_Mutation_p.R308Q|CORO7_uc010uxh.1_Missense_Mutation_p.R510Q|CORO7_uc010uxi.1_Missense_Mutation_p.R443Q|CORO7_uc002cwi.1_Missense_Mutation_p.R308Q|CORO7_uc010uxj.1_RNA	NM_024535	NP_078811	P57737	CORO7_HUMAN	coronin 7	528						cytoplasmic membrane-bounded vesicle|cytosol|Golgi membrane|integral to membrane of membrane fraction|soluble fraction					0						GCCAGGCTTCCGTAGCTGTGG	0.682													29	25	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9857192	9857192	+	Silent	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9857192C>G	uc002czo.3	-	13	4757	c.4209G>C	c.(4207-4209)TCG>TCC	p.S1403S	GRIN2A_uc010uym.1_Silent_p.S1403S|GRIN2A_uc010uyn.1_3'UTR|GRIN2A_uc002czr.3_3'UTR	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1403	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ACCTCAAGGACGACCGAAGAT	0.512													40	35	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17294508	17294508	+	Missense_Mutation	SNP	T	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17294508T>G	uc002dfa.2	-	4	1002	c.917A>C	c.(916-918)AAA>ACA	p.K306T		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	306	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						CTTGTTGGCTTTACCTGGGGA	0.547													82	89	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18847672	18847672	+	Intron	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18847672C>G	uc002dfm.2	-						SMG1_uc010bwb.2_Intron|SMG1_uc010bwa.2_Intron	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TAAAATAAGTCAACCCATACC	0.398													22	42	---	---	---	---	PASS
EEF2K	29904	broad.mit.edu	37	16	22262526	22262526	+	Silent	SNP	C	T	T	rs55959085	byFrequency	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22262526C>T	uc002dki.2	+	6	986	c.501C>T	c.(499-501)TAC>TAT	p.Y167Y	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	167	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		CCTCCAACTACGTGGCGAAGC	0.592													55	122	---	---	---	---	PASS
GTF3C1	2975	broad.mit.edu	37	16	27497348	27497348	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:27497348G>A	uc002dov.1	-	24	3868	c.3828C>T	c.(3826-3828)TGC>TGT	p.C1276C	GTF3C1_uc002dou.2_Silent_p.C1276C	NM_001520	NP_001511	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide	1276						transcription factor TFIIIC complex	DNA binding|protein binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5						TGGCAATGCGGCACAGCACAA	0.632													4	161	---	---	---	---	PASS
TRIM72	493829	broad.mit.edu	37	16	31235551	31235551	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31235551G>T	uc002ebn.1	+	7	1138	c.909G>T	c.(907-909)GTG>GTT	p.V303V	uc002ebp.1_5'Flank	NM_001008274	NP_001008275	Q6ZMU5	TRI72_HUMAN	tripartite motif-containing 72	303	B30.2/SPRY.				exocytosis|muscle organ development|muscle system process|plasma membrane repair|protein homooligomerization	cytoplasmic vesicle membrane|sarcolemma	phosphatidylserine binding|zinc ion binding				0						CGAGCCTGGTGGTGTCTTCCT	0.687													7	14	---	---	---	---	PASS
CBLN1	869	broad.mit.edu	37	16	49315138	49315138	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:49315138C>T	uc002efq.2	-	1	578	c.239G>A	c.(238-240)CGC>CAC	p.R80H		NM_004352	NP_004343	P23435	CBLN1_HUMAN	cerebellin 1 precursor	80	C1q.|Necessary for interaction with CBLN3, and homotrimerization (By similarity).				nervous system development|synaptic transmission	cell junction|extracellular region|synapse					0		all_cancers(37;0.0766)|all_lung(18;0.24)				GATCATGGTGCGATTACTCAT	0.607													25	42	---	---	---	---	PASS
FAM65A	79567	broad.mit.edu	37	16	67579917	67579917	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67579917G>A	uc010vjp.1	+	20	3609	c.3513G>A	c.(3511-3513)CTG>CTA	p.L1171L	FAM65A_uc002eth.2_Silent_p.L1151L|FAM65A_uc010cej.2_Silent_p.L1154L|FAM65A_uc010vjq.1_Silent_p.L1165L|FAM65A_uc002etk.2_Silent_p.L1149L	NM_024519	NP_078795	Q6ZS17	FA65A_HUMAN	hypothetical protein LOC79567	1155						cytoplasm	binding			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		CTGGCTGCCTGGCCCTAGGCT	0.652													9	94	---	---	---	---	PASS
FOXC2	2303	broad.mit.edu	37	16	86602312	86602312	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86602312C>T	uc002fjq.2	+	1	1456	c.1371C>T	c.(1369-1371)CAC>CAT	p.H457H		NM_005251	NP_005242	Q99958	FOXC2_HUMAN	forkhead box C2	457					anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding				0						TCAACTCCCACCGGCTGGGGA	0.637									Late-onset_Hereditary_Lymphedema				17	28	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89350274	89350274	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89350274G>C	uc002fmx.1	-	9	3137	c.2676C>G	c.(2674-2676)AGC>AGG	p.S892R	ANKRD11_uc002fmy.1_Missense_Mutation_p.S892R|ANKRD11_uc002fnc.1_Missense_Mutation_p.S892R|ANKRD11_uc002fnb.1_Missense_Mutation_p.S849R	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	892	Lys-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		CCCGGGCCCGGCTGTCCCGCC	0.547													51	61	---	---	---	---	PASS
GLTPD2	388323	broad.mit.edu	37	17	4692356	4692356	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4692356C>T	uc002fza.1	+	1	103	c.50C>T	c.(49-51)TCA>TTA	p.S17L	VMO1_uc002fyx.2_5'Flank|VMO1_uc010vsh.1_5'Flank|VMO1_uc010vsi.1_5'Flank|VMO1_uc002fyy.2_5'Flank|uc002fyz.2_3'UTR	NM_001014985	NP_001014985			glycolipid transfer protein domain containing 2												0						TTCAGCCACTCAATTCCTCTC	0.662													5	31	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577025	7577025	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577025T>A	uc002gim.2	-	8	1107	c.913A>T	c.(913-915)AAG>TAG	p.K305*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.K305*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.K173*|TP53_uc010cng.1_Nonsense_Mutation_p.K173*|TP53_uc002gii.1_Nonsense_Mutation_p.K173*|TP53_uc010cnh.1_Nonsense_Mutation_p.K305*|TP53_uc010cni.1_Nonsense_Mutation_p.K305*|TP53_uc002gij.2_Nonsense_Mutation_p.K305*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	305	Bipartite nuclear localization signal.|Interaction with HIPK1 (By similarity).|Interaction with CARM1.		K -> E (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in a sporadic cancer; somatic mutation).|K -> N (in sporadic cancers; somatic mutation; loss of nuclear localization).|K -> M (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.K305*(15)|p.0?(7)|p.?(3)|p.K305N(3)|p.K305R(2)|p.K305K(1)|p.L265_K305del41(1)|p.K305E(1)|p.K305fs*1(1)|p.K305fs*32(1)|p.K305T(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TTACCTCGCTTAGTGCTCCCT	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			108	66	---	---	---	---	PASS
TRAPPC1	58485	broad.mit.edu	37	17	7834841	7834841	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7834841C>T	uc002gjo.1	-	2	269	c.153G>A	c.(151-153)AAG>AAA	p.K51K	KCNAB3_uc002gjm.1_5'Flank|KCNAB3_uc010vul.1_5'Flank|CNTROB_uc002gjp.2_5'Flank|CNTROB_uc002gjq.2_5'Flank|CNTROB_uc002gjr.2_5'Flank	NM_021210	NP_067033	Q9Y5R8	TPPC1_HUMAN	trafficking protein particle complex 1	51					ER to Golgi vesicle-mediated transport	endoplasmic reticulum					0		Prostate(122;0.173)				GCGGGGACATCTTGCTGACAA	0.542													26	63	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11666769	11666769	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11666769C>A	uc002gne.2	+	36	7076	c.7008C>A	c.(7006-7008)ATC>ATA	p.I2336I	DNAH9_uc010coo.2_Silent_p.I1630I	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	2336					cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTAAGAAGATCATTCCCATCC	0.498													5	259	---	---	---	---	PASS
ACCN1	40	broad.mit.edu	37	17	32483431	32483431	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32483431G>A	uc002hhu.2	-	1	395	c.121C>T	c.(121-123)CGG>TGG	p.R41W		NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	41	Helical; (Potential).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	AGCACACGCCGGATGGTCAGC	0.602													4	69	---	---	---	---	PASS
KRT24	192666	broad.mit.edu	37	17	38857508	38857508	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38857508C>T	uc002hvd.2	-	3	796	c.739G>A	c.(739-741)GAC>AAC	p.D247N		NM_019016	NP_061889	Q2M2I5	K1C24_HUMAN	keratin 24	247	Rod.|Coil 1B.					cytoplasm|intermediate filament	structural molecule activity				0		Breast(137;0.00526)				CCATTGATGTCAGCCTCCACG	0.547													31	72	---	---	---	---	PASS
KIAA1267	284058	broad.mit.edu	37	17	44109491	44109491	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44109491A>G	uc002ikb.2	-	13	3097	c.3012T>C	c.(3010-3012)CCT>CCC	p.P1004P	KIAA1267_uc002ikc.2_Silent_p.P1004P|KIAA1267_uc002ikd.2_Silent_p.P1004P|KIAA1267_uc010dav.2_Silent_p.P1003P|KIAA1267_uc010wkb.1_Silent_p.P335P|KIAA1267_uc010wkc.1_Silent_p.P272P	NM_015443	NP_056258	Q7Z3B3	K1267_HUMAN	hypothetical protein LOC284058	1004						MLL1 complex	protein binding			skin(2)	2		Melanoma(429;0.211)				CCCGAGCCACAGGGGTGAGGG	0.592													3	118	---	---	---	---	PASS
LPO	4025	broad.mit.edu	37	17	56320361	56320361	+	Silent	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56320361C>G	uc002ivt.2	+	2	337	c.21C>G	c.(19-21)CTC>CTG	p.L7L	LPO_uc010dco.2_Silent_p.L7L|LPO_uc010wnr.1_Silent_p.L7L|LPO_uc010wns.1_5'UTR|LPO_uc010dcp.2_Silent_p.L7L	NM_006151	NP_006142	P22079	PERL_HUMAN	lactoperoxidase isoform 1 preproprotein	7					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|breast(1)	2						TTCTCCATCTCCCAGCCCTCC	0.468													83	235	---	---	---	---	PASS
HEATR6	63897	broad.mit.edu	37	17	58128309	58128309	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58128309G>T	uc002iyk.1	-	15	2336	c.2319C>A	c.(2317-2319)AAC>AAA	p.N773K	HEATR6_uc010ddk.1_Missense_Mutation_p.N312K|HEATR6_uc010wos.1_Intron	NM_022070	NP_071353	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	773							binding			ovary(1)|skin(1)	2	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			GTAAAGGACCGTTCAGCATCA	0.537													18	59	---	---	---	---	PASS
ABCA9	10350	broad.mit.edu	37	17	67028385	67028385	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67028385A>G	uc002jhu.2	-	10	1452	c.1309T>C	c.(1309-1311)TTC>CTC	p.F437L	ABCA9_uc010dez.2_Missense_Mutation_p.F437L	NM_080283	NP_525022	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A, member 9	437					transport	integral to membrane	ATP binding|ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	Breast(10;1.47e-12)					GATTTCAGGAAAAACAAGGGA	0.423													37	80	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67109871	67109871	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67109871C>A	uc002jhw.1	-	14	1965	c.1790G>T	c.(1789-1791)CGA>CTA	p.R597L	ABCA6_uc002jhx.1_Missense_Mutation_p.R50L	NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	597	ABC transporter 1.				transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					CAATAATATTCGTTGTACCTA	0.224													3	98	---	---	---	---	PASS
TSEN54	283989	broad.mit.edu	37	17	73517590	73517590	+	Silent	SNP	C	A	A	rs147165460		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73517590C>A	uc002jof.1	+	7	655	c.622C>A	c.(622-624)CGG>AGG	p.R208R	TSEN54_uc002joe.1_3'UTR	NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog	208					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTCCAGCCCTCGGTAACTCCC	0.587													6	67	---	---	---	---	PASS
EVPL	2125	broad.mit.edu	37	17	74013980	74013980	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74013980G>C	uc002jqi.2	-	14	1778	c.1550C>G	c.(1549-1551)TCA>TGA	p.S517*	EVPL_uc010wss.1_Nonsense_Mutation_p.S539*|EVPL_uc010wst.1_5'UTR	NM_001988	NP_001979	Q92817	EVPL_HUMAN	envoplakin	517	Globular 1.				keratinization|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural molecule activity			pancreas(2)|central_nervous_system(1)|skin(1)	4						GGCCAGGTCTGAGCCAGATGG	0.657													24	57	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80828142	80828142	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80828142G>T	uc002kfz.2	+	14	1491	c.1361G>T	c.(1360-1362)CGG>CTG	p.R454L	TBCD_uc002kfx.1_Missense_Mutation_p.R437L|TBCD_uc002kfy.1_Missense_Mutation_p.R454L	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	454					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GACGAGAAGCGGGGTGCCTGC	0.632													23	58	---	---	---	---	PASS
COLEC12	81035	broad.mit.edu	37	18	346755	346755	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:346755C>A	uc002kkm.2	-	5	1082	c.867G>T	c.(865-867)CAG>CAT	p.Q289H		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	289	Potential.|Extracellular (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ATGAGTTGAGCTGGCTGTTCA	0.507													106	70	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5395077	5395077	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5395077C>T	uc002kmt.1	-	21	3228	c.3142G>A	c.(3142-3144)GAC>AAC	p.D1048N	EPB41L3_uc010wzh.1_Missense_Mutation_p.D879N|EPB41L3_uc002kmu.1_Missense_Mutation_p.D826N|EPB41L3_uc010dkq.1_Missense_Mutation_p.D717N|EPB41L3_uc002kms.1_Missense_Mutation_p.D283N|EPB41L3_uc010wze.1_Missense_Mutation_p.D353N|EPB41L3_uc010wzf.1_Missense_Mutation_p.D345N|EPB41L3_uc010wzg.1_Missense_Mutation_p.D320N|EPB41L3_uc010dkr.2_Missense_Mutation_p.D440N	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	1048	Carboxyl-terminal (CTD).				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						TGGTCATGGTCAATGTCTGCA	0.448													77	57	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30321982	30321982	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30321982C>A	uc002kxm.1	-	3	1366	c.978G>T	c.(976-978)TTG>TTT	p.L326F	KLHL14_uc010dmd.1_5'UTR	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	326	Kelch 1.					cytosol|endoplasmic reticulum membrane				ovary(1)	1						GCCCTCCAACCAATAACAGCA	0.433													56	35	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56585940	56585940	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56585940G>C	uc002lho.2	+	4	968	c.421G>C	c.(421-423)GAC>CAC	p.D141H	ZNF532_uc002lhp.2_Missense_Mutation_p.D139H|ZNF532_uc010xeg.1_Missense_Mutation_p.D139H|ZNF532_uc002lhr.2_Missense_Mutation_p.D139H|ZNF532_uc002lhs.2_Missense_Mutation_p.D139H	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	141					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						GTTTGATGACGACGAGAAGAT	0.532													106	83	---	---	---	---	PASS
EBI3	10148	broad.mit.edu	37	19	4234833	4234833	+	Intron	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4234833G>A	uc002lzu.2	+							NM_005755	NP_005746	Q14213	IL27B_HUMAN	Epstein-Barr virus induced 3 precursor						humoral immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of interferon-gamma biosynthetic process|T-helper 1 type immune response	extracellular space|plasma membrane	cytokine activity|cytokine receptor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0336)|STAD - Stomach adenocarcinoma(1328;0.18)		TGAGGAGGATGAGGGGGAGGC	0.597													67	160	---	---	---	---	PASS
ZNF557	79230	broad.mit.edu	37	19	7082904	7082904	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7082904G>C	uc002mgb.2	+	8	906	c.421G>C	c.(421-423)GGA>CGA	p.G141R	ZNF557_uc002mga.2_Missense_Mutation_p.G148R|ZNF557_uc002mgc.2_Missense_Mutation_p.G148R	NM_001044388	NP_001037853	Q8N988	ZN557_HUMAN	zinc finger protein 557 isoform b	141					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2				Lung(535;0.179)		GAATCATCTTGGAGCAACACT	0.373													39	104	---	---	---	---	PASS
PRAM1	84106	broad.mit.edu	37	19	8555650	8555650	+	Intron	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8555650G>T	uc002mkd.2	-						PRAM1_uc002mkc.2_Intron	NM_032152	NP_115528	Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1								lipid binding|protein binding				0						ACTGGGGCGCGAGATGTTAGG	0.632													3	63	---	---	---	---	PASS
ACTL9	284382	broad.mit.edu	37	19	8808393	8808393	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8808393C>T	uc002mkl.2	-	1	780	c.659G>A	c.(658-660)CGT>CAT	p.R220H		NM_178525	NP_848620	Q8TC94	ACTL9_HUMAN	actin-like 9	220						cytoplasm|cytoskeleton		p.R220H(1)		large_intestine(2)|pancreas(1)	3						CAGGTCCAGACGCTCCGTGGC	0.682													27	53	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9048969	9048969	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9048969C>A	uc002mkp.2	-	5	32866	c.32662G>T	c.(32662-32664)GTG>TTG	p.V10888L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	10890	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GTACTGATCACTGCCCTAGAA	0.498													62	129	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9071041	9071041	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9071041G>A	uc002mkp.2	-	3	16609	c.16405C>T	c.(16405-16407)CCT>TCT	p.P5469S		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	5471	Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						GAGATATTAGGAGTTGATGTG	0.502													67	187	---	---	---	---	PASS
ZNF878	729747	broad.mit.edu	37	19	12155941	12155941	+	Missense_Mutation	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12155941A>G	uc002mta.1	-	5	416	c.416T>C	c.(415-417)CTG>CCG	p.L139P		NM_001080404	NP_001073873	C9JN71	ZN878_HUMAN	zinc finger protein 878	92					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding				0						TTTCTTCTTCAGTGTGTCATC	0.423													22	35	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15132615	15132615	+	Intron	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15132615C>A	uc002nae.2	+							NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105						microtubule cytoskeleton organization	microtubule				ovary(1)	1						CGCACCCCACCAGGGTCCTCT	0.632													33	84	---	---	---	---	PASS
EPS15L1	58513	broad.mit.edu	37	19	16514640	16514640	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16514640C>T	uc002ndz.1	-	15	1536	c.1530G>A	c.(1528-1530)CAG>CAA	p.Q510Q	EPS15L1_uc002ndx.2_Silent_p.Q510Q|EPS15L1_uc002ndy.2_RNA|EPS15L1_uc010xpe.1_Silent_p.Q400Q|EPS15L1_uc010xpf.1_Silent_p.Q413Q|EPS15L1_uc002nea.1_Silent_p.Q510Q|EPS15L1_uc010eah.1_Silent_p.Q510Q|EPS15L1_uc002neb.1_Silent_p.Q356Q|EPS15L1_uc002nec.1_Silent_p.Q510Q	NM_021235	NP_067058	Q9UBC2	EP15R_HUMAN	epidermal growth factor receptor pathway	510					endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	coated pit|nucleus|plasma membrane	calcium ion binding			ovary(3)|skin(2)	5						GGGTTTCCTCCTGCTGCAATC	0.512													46	129	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22940575	22940575	+	Silent	SNP	T	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22940575T>C	uc010xrh.1	-	5	1863	c.1863A>G	c.(1861-1863)AAA>AAG	p.K621K		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GGCTAAAAGCTTTGCCACATT	0.378													3	161	---	---	---	---	PASS
CD22	933	broad.mit.edu	37	19	35823511	35823511	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35823511C>T	uc010edt.2	+	3	173	c.96C>T	c.(94-96)CTC>CTT	p.L32L	CD22_uc010xst.1_5'UTR|CD22_uc010edu.2_Silent_p.L32L|CD22_uc010edv.2_Silent_p.L32L|CD22_uc002nzb.3_Silent_p.L32L	NM_001771	NP_001762	P20273	CD22_HUMAN	CD22 molecule precursor	32	Extracellular (Potential).|Ig-like V-type.				cell adhesion		protein binding|sugar binding			ovary(5)|lung(3)|breast(1)	9	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)		OspA lipoprotein(DB00045)	CTGAAACCCTCTACGCCTGGG	0.502													33	97	---	---	---	---	PASS
ATP4A	495	broad.mit.edu	37	19	36050967	36050967	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36050967G>T	uc002oal.1	-	7	825	c.796C>A	c.(796-798)CAG>AAG	p.Q266K	ATP4A_uc010eee.1_5'Flank	NM_000704	NP_000695	P20648	ATP4A_HUMAN	hydrogen/potassium-exchanging ATPase 4A	266	Cytoplasmic (Potential).				ATP biosynthetic process|ATP hydrolysis coupled proton transport	integral to plasma membrane	ATP binding|hydrogen:potassium-exchanging ATPase activity|magnesium ion binding			ovary(1)	1	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		Esomeprazole(DB00736)|Lansoprazole(DB00448)|Omeprazole(DB00338)|Pantoprazole(DB00213)|Rabeprazole(DB01129)|Trifluoperazine(DB00831)	ACCAGGCCCTGCACGGTGCCT	0.652													23	53	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36322217	36322217	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36322217C>A	uc002oby.2	-	26	3368	c.3368G>T	c.(3367-3369)CGG>CTG	p.R1123L	NPHS1_uc010eem.1_RNA	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	1123	Cytoplasmic (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CTGAGTGTCCCGCTCTCCTGT	0.612													38	96	---	---	---	---	PASS
C19orf46	163183	broad.mit.edu	37	19	36499208	36499208	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36499208C>T	uc002ocq.1	-	2	279	c.190G>A	c.(190-192)GGG>AGG	p.G64R	C19orf46_uc002ocr.1_Missense_Mutation_p.G64R|C19orf46_uc002ocs.1_Missense_Mutation_p.G64R|C19orf46_uc010een.1_Intron	NM_001039876	NP_001034965	Q8N205	SYNE4_HUMAN	hypothetical protein LOC163183	64	Cytoplasmic (Potential).				establishment of epithelial cell apical/basal polarity	integral to nuclear outer membrane	actin binding			ovary(1)	1	all_lung(56;1.35e-06)|Lung NSC(56;2.15e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CCCCTTGGCCCACCCTGGAAG	0.657													14	55	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39329235	39329235	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39329235G>A	uc010xul.1	-	10	1370	c.1359C>T	c.(1357-1359)GTC>GTT	p.V453V	HNRNPL_uc010ege.1_Intron|HNRNPL_uc002ojj.1_Silent_p.V109V|HNRNPL_uc002ojo.1_Silent_p.V31V|HNRNPL_uc002ojk.2_Silent_p.V109V|HNRNPL_uc002ojl.2_Silent_p.V109V|HNRNPL_uc010xum.1_Silent_p.V320V	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	453	RRM 3.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GCTGCTTGGAGACACTGCAGC	0.537													15	36	---	---	---	---	PASS
LRFN1	57622	broad.mit.edu	37	19	39805491	39805491	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39805491G>A	uc002okw.2	-	1	486	c.486C>T	c.(484-486)TCC>TCT	p.S162S		NM_020862	NP_065913	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III	162	Extracellular (Potential).					cell junction|integral to membrane|postsynaptic density|postsynaptic membrane				ovary(2)	2	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			CCTCCACGGTGGACAGGAAGG	0.652													5	13	---	---	---	---	PASS
SAMD4B	55095	broad.mit.edu	37	19	39847546	39847546	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39847546G>A	uc002olb.2	+	5	1048	c.13G>A	c.(13-15)GAC>AAC	p.D5N	SAMD4B_uc002ola.2_Missense_Mutation_p.D5N	NM_018028	NP_060498	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	5							protein binding				0	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GATGTTCCGAGACCAGGTGGG	0.657													5	31	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41120238	41120238	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41120238G>C	uc002ooh.1	+	22	2899	c.2899G>C	c.(2899-2901)GAG>CAG	p.E967Q	LTBP4_uc002oog.1_Missense_Mutation_p.E930Q|LTBP4_uc002ooi.1_Missense_Mutation_p.E900Q|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Missense_Mutation_p.E187Q|LTBP4_uc002ool.1_Missense_Mutation_p.E65Q|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	967	Cys-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGAATGTCGCGAGCGAGGCCC	0.587													18	42	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41120242	41120242	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41120242G>T	uc002ooh.1	+	22	2903	c.2903G>T	c.(2902-2904)CGA>CTA	p.R968L	LTBP4_uc002oog.1_Missense_Mutation_p.R931L|LTBP4_uc002ooi.1_Missense_Mutation_p.R901L|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Missense_Mutation_p.R188L|LTBP4_uc002ool.1_Missense_Mutation_p.R66L|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	968	Cys-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGTCGCGAGCGAGGCCCAGCC	0.607													18	40	---	---	---	---	PASS
LTBP4	8425	broad.mit.edu	37	19	41120337	41120337	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41120337G>A	uc002ooh.1	+	22	2998	c.2998G>A	c.(2998-3000)GAG>AAG	p.E1000K	LTBP4_uc002oog.1_Missense_Mutation_p.E963K|LTBP4_uc002ooi.1_Missense_Mutation_p.E933K|LTBP4_uc002ooj.1_5'UTR|LTBP4_uc002ook.1_Missense_Mutation_p.E220K|LTBP4_uc002ool.1_Missense_Mutation_p.E98K|LTBP4_uc002oom.1_RNA|LTBP4_uc010xvp.1_5'UTR	NM_001042544	NP_001036009	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding	1000	Cys-rich.				growth hormone secretion|multicellular organismal development|protein folding|regulation of cell differentiation|regulation of cell growth|regulation of proteolysis|regulation of transforming growth factor beta receptor signaling pathway	extracellular space|proteinaceous extracellular matrix	calcium ion binding|glycosaminoglycan binding|integrin binding|transforming growth factor beta binding|transforming growth factor beta receptor activity			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CGCGGGCCCCGAGGGCACCTG	0.716													5	17	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41596057	41596057	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41596057A>T	uc002opt.2	+	3	458	c.449A>T	c.(448-450)CAG>CTG	p.Q150L		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	150					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	GAACGCATCCAGGAGGAGGCG	0.692													18	75	---	---	---	---	PASS
ERF	2077	broad.mit.edu	37	19	42752689	42752689	+	Silent	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42752689G>C	uc002ote.3	-	4	1733	c.1575C>G	c.(1573-1575)CTC>CTG	p.L525L	ERF_uc002otd.3_Silent_p.L256L	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	525					cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)				GCCTTGGGGTGAGGGGCCCCC	0.711													13	45	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44933863	44933863	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44933863G>C	uc002oze.1	-	6	1527	c.1093C>G	c.(1093-1095)CTT>GTT	p.L365V	ZNF229_uc010ejk.1_Missense_Mutation_p.L19V|ZNF229_uc010ejl.1_Missense_Mutation_p.L359V	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	365	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				TGATGAATAAGAAGAACCGAT	0.493													69	219	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46328447	46328447	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46328447C>T	uc002pdn.2	-	18	2717	c.2472G>A	c.(2470-2472)CTG>CTA	p.L824L	SYMPK_uc002pdo.1_Silent_p.L824L|SYMPK_uc002pdp.1_Silent_p.L824L	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	824					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CAATGACCCTCAGCACCGTCC	0.647													42	70	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51920496	51920496	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51920496C>A	uc002pwo.2	-	2	877	c.261G>T	c.(259-261)CGG>CGT	p.R87R	SIGLEC10_uc002pwp.2_Silent_p.R87R|SIGLEC10_uc002pwq.2_Silent_p.R87R|SIGLEC10_uc002pwr.2_Silent_p.R87R|SIGLEC10_uc010ycy.1_Silent_p.R87R|SIGLEC10_uc010ycz.1_Silent_p.R87R|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Silent_p.R71R	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	87	Extracellular (Potential).|Ig-like V-type.				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GGAATCGGCCCCGGGTGCTCA	0.577													34	105	---	---	---	---	PASS
SIGLEC10	89790	broad.mit.edu	37	19	51920497	51920497	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51920497C>A	uc002pwo.2	-	2	876	c.260G>T	c.(259-261)CGG>CTG	p.R87L	SIGLEC10_uc002pwp.2_Missense_Mutation_p.R87L|SIGLEC10_uc002pwq.2_Missense_Mutation_p.R87L|SIGLEC10_uc002pwr.2_Missense_Mutation_p.R87L|SIGLEC10_uc010ycy.1_Missense_Mutation_p.R87L|SIGLEC10_uc010ycz.1_Missense_Mutation_p.R87L|SIGLEC10_uc010eow.2_Intron|SIGLEC10_uc002pws.1_Missense_Mutation_p.R71L	NM_033130	NP_149121	Q96LC7	SIG10_HUMAN	sialic acid binding Ig-like lectin 10 precursor	87	Extracellular (Potential).|Ig-like V-type.				cell adhesion	extracellular region|integral to membrane|plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000668)|OV - Ovarian serous cystadenocarcinoma(262;0.0101)		GAATCGGCCCCGGGTGCTCAT	0.572													35	105	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52618244	52618244	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52618244C>A	uc002pym.2	-	4	2456	c.2173G>T	c.(2173-2175)GCC>TCC	p.A725S	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	725	C2H2-type 20.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		CGCCCAAAGGCTTTGCCACAT	0.393													5	275	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53959386	53959386	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53959386G>C	uc010eqp.2	+	7	2083	c.1625G>C	c.(1624-1626)AGA>ACA	p.R542T	ZNF761_uc010ydy.1_Missense_Mutation_p.R488T|ZNF761_uc002qbt.1_Missense_Mutation_p.R488T	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	542	C2H2-type 12.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		TGCCATCGTAGACTTCATTCT	0.448													6	180	---	---	---	---	PASS
HSPBP1	23640	broad.mit.edu	37	19	55785929	55785929	+	Silent	SNP	C	A	A	rs141770023	byFrequency	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55785929C>A	uc002qjx.2	-	3	725	c.615G>T	c.(613-615)GCG>GCT	p.A205A	HSPBP1_uc002qjy.2_Silent_p.A159A|HSPBP1_uc002qkb.2_Silent_p.A159A|HSPBP1_uc002qka.2_Silent_p.A159A|HSPBP1_uc002qkd.2_Silent_p.A159A|HSPBP1_uc002qkc.2_Silent_p.A159A	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein	162	ARM 1.				positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		ACCGCAGTCCCGCAGCCCCCG	0.662													8	20	---	---	---	---	PASS
ZNF787	126208	broad.mit.edu	37	19	56600255	56600255	+	Missense_Mutation	SNP	A	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56600255A>T	uc010eth.1	-	3	405	c.286T>A	c.(286-288)TGC>AGC	p.C96S		NM_001002836	NP_001002836	Q6DD87	ZN787_HUMAN	zinc finger protein 787	96	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1		Colorectal(82;3.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0559)		CAGTCGGCGCAGGCGTTGGGC	0.627													5	14	---	---	---	---	PASS
VN1R1	57191	broad.mit.edu	37	19	57966810	57966810	+	Missense_Mutation	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57966810G>T	uc002qos.1	-	1	1045	c.1045C>A	c.(1045-1047)CTG>ATG	p.L349M	ZNF547_uc002qpm.3_Intron	NM_020633	NP_065684	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	349	Cytoplasmic (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		ATGACAACCAGATTAGGAAAG	0.378													31	67	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9438113	9438113	+	Missense_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9438113C>G	uc002wnf.2	+	32	3149	c.3013C>G	c.(3013-3015)CTG>GTG	p.L1005V	PLCB4_uc010gbw.1_Missense_Mutation_p.L1005V|PLCB4_uc010gbx.2_Missense_Mutation_p.L1017V|PLCB4_uc002wne.2_Missense_Mutation_p.L1005V|PLCB4_uc002wnh.2_Missense_Mutation_p.L852V	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	1005					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						AATTCAGACGCTGACATCAGA	0.348													40	129	---	---	---	---	PASS
SEL1L2	80343	broad.mit.edu	37	20	13869147	13869147	+	Missense_Mutation	SNP	A	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13869147A>C	uc010gcf.2	-	6	643	c.561T>G	c.(559-561)TTT>TTG	p.F187L	SEL1L2_uc002woq.3_Missense_Mutation_p.F48L|SEL1L2_uc010zrl.1_Missense_Mutation_p.F187L|SEL1L2_uc002wor.2_RNA	NM_025229	NP_079505	Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 precursor	187	Extracellular (Potential).|Sel1-like 3.					integral to membrane	binding			ovary(2)	2						AAGAAGACAAAAATCCTAATG	0.284													16	48	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16492131	16492131	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16492131C>A	uc002wpg.1	-	6	646	c.488G>T	c.(487-489)CGG>CTG	p.R163L	KIF16B_uc010gch.1_Missense_Mutation_p.R163L|KIF16B_uc010gci.1_Missense_Mutation_p.R163L|KIF16B_uc010gcj.1_Missense_Mutation_p.R163L	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	163	Kinesin-motor.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						TGACTTCCGCCGAAGTAGATC	0.333													57	129	---	---	---	---	PASS
DSTN	11034	broad.mit.edu	37	20	17587741	17587741	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17587741G>A	uc002wpr.2	+	4	703	c.448G>A	c.(448-450)GAA>AAA	p.E150K	DSTN_uc002wpq.2_Missense_Mutation_p.E133K|DSTN_uc010gck.2_Missense_Mutation_p.E133K	NM_006870	NP_006861	P60981	DEST_HUMAN	destrin isoform a	150	ADF-H.				actin filament severing|actin polymerization or depolymerization		actin binding			large_intestine(1)|skin(1)	2						TTGTATTGCTGAAAAGTTAGG	0.373													5	228	---	---	---	---	PASS
COMMD7	149951	broad.mit.edu	37	20	31291229	31291229	+	Silent	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31291229C>A	uc002wya.3	-	9	1175	c.558G>T	c.(556-558)CTG>CTT	p.L186L	COMMD7_uc010ged.2_Silent_p.L185L|COMMD7_uc002wyb.2_3'UTR	NM_053041	NP_444269	Q86VX2	COMD7_HUMAN	COMM domain containing 7 isoform 1	186	COMM.				negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent|tumor necrosis factor-mediated signaling pathway		NF-kappaB binding			breast(1)	1						CCATCTCGTGCAGGAAGCTGT	0.493													21	71	---	---	---	---	PASS
SUN5	140732	broad.mit.edu	37	20	31577456	31577456	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31577456C>A	uc002wyi.2	-	9	676	c.583G>T	c.(583-585)GAA>TAA	p.E195*		NM_080675	NP_542406	Q8TC36	SUN5_HUMAN	sperm associated antigen 4-like	195					spermatogenesis					skin(1)	1						TCTGGCTTTTCGATGTAATCT	0.488													16	61	---	---	---	---	PASS
IFT52	51098	broad.mit.edu	37	20	42271136	42271136	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42271136G>A	uc002xkw.2	+	13	1260	c.1138G>A	c.(1138-1140)GAA>AAA	p.E380K	IFT52_uc002xky.2_Missense_Mutation_p.E380K|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Missense_Mutation_p.E356K|IFT52_uc002xkz.2_Intron	NM_016004	NP_057088	Q9Y366	IFT52_HUMAN	intraflagellar transport 52 homolog	380						intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGAAGACCTGGAATTTTATGT	0.413													37	115	---	---	---	---	PASS
CTSA	5476	broad.mit.edu	37	20	44521454	44521454	+	Missense_Mutation	SNP	T	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44521454T>G	uc002xqj.3	+	6	1009	c.535T>G	c.(535-537)TAT>GAT	p.Y179D	NEURL2_uc002xqg.1_5'Flank|CTSA_uc002xqh.2_Missense_Mutation_p.Y197D|CTSA_uc002xqi.2_RNA|CTSA_uc010zxi.1_Missense_Mutation_p.Y180D|CTSA_uc002xqk.3_Missense_Mutation_p.Y179D	NM_001127695	NP_001121167	P10619	PPGB_HUMAN	cathepsin A isoform b precursor	179					intracellular protein transport|proteolysis	endoplasmic reticulum|lysosome|nucleus	enzyme activator activity|protein binding|serine-type carboxypeptidase activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				CGGGGAGAGCTATGCTGGCAT	0.562													35	69	---	---	---	---	PASS
STX16	8675	broad.mit.edu	37	20	57251323	57251323	+	Silent	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57251323C>G	uc002xzi.2	+	9	1689	c.954C>G	c.(952-954)GTC>GTG	p.V318V	STX16_uc010zzq.1_Silent_p.V132V|STX16_uc002xzk.2_Silent_p.V301V|STX16_uc002xzm.2_Silent_p.V314V|STX16_uc002xzj.2_Silent_p.V297V|STX16_uc002xzl.2_Silent_p.V132V	NM_001001433	NP_001001433	O14662	STX16_HUMAN	syntaxin 16 isoform a	318	Helical; Anchor for type IV membrane protein; (Potential).				intra-Golgi vesicle-mediated transport|intracellular protein transport|retrograde transport, endosome to Golgi	Golgi membrane|integral to membrane|microsome|SNARE complex	SNAP receptor activity			ovary(1)	1	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			TCATTGTTGTCCTCGTTGGCG	0.493													64	109	---	---	---	---	PASS
ARFGAP1	55738	broad.mit.edu	37	20	61914209	61914209	+	Intron	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61914209A>G	uc002yem.2	+						ARFGAP1_uc011aas.1_Intron|ARFGAP1_uc011aat.1_Intron|ARFGAP1_uc002yel.2_Intron|ARFGAP1_uc002yen.2_Intron|ARFGAP1_uc002yeo.1_5'Flank	NM_018209	NP_060679	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating						COPI coating of Golgi vesicle|protein transport|regulation of ARF GTPase activity|retrograde vesicle-mediated transport, Golgi to ER	cytosol|Golgi-associated vesicle membrane	ARF GTPase activator activity|zinc ion binding			pancreas(1)	1	all_cancers(38;1.59e-09)					AGAAGGTAACAGAGGAGAAGC	0.502													43	46	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61936824	61936824	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61936824G>T	uc011aau.1	+	4	349	c.249G>T	c.(247-249)GGG>GGT	p.G83G	COL20A1_uc011aav.1_5'Flank	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	83	Fibronectin type-III 1.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					CCACAGTGGGGGGCCTGAGCC	0.612													3	20	---	---	---	---	PASS
DSCAM	1826	broad.mit.edu	37	21	42064818	42064818	+	Silent	SNP	G	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42064818G>T	uc002yyq.1	-	3	878	c.426C>A	c.(424-426)GTC>GTA	p.V142V	DSCAM_uc002yyr.1_RNA	NM_001389	NP_001380	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule isoform	142	Ig-like C2-type 2.|Extracellular (Potential).				cell adhesion|dendrite self-avoidance|negative regulation of cell adhesion|positive regulation of axon extension involved in axon guidance|positive regulation of phosphorylation	axon|extracellular region|growth cone|integral to plasma membrane|membrane fraction	protein binding			ovary(6)|skin(4)|upper_aerodigestive_tract(1)	11		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCACTTGAAGACCGCAACAT	0.522													72	62	---	---	---	---	PASS
TOP3B	8940	broad.mit.edu	37	22	22316909	22316909	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22316909C>A	uc002zvs.2	-	13	1852	c.1417G>T	c.(1417-1419)GGT>TGT	p.G473C	TOP3B_uc010gtm.1_Missense_Mutation_p.G18C|TOP3B_uc002zvr.2_Missense_Mutation_p.G198C|TOP3B_uc010gtl.2_Missense_Mutation_p.G473C|TOP3B_uc002zvt.3_Missense_Mutation_p.G473C	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	473					DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		AAGGCATCACCCCGCTGGCAA	0.642													29	68	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22453448	22453448	+	RNA	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22453448C>A	uc011aim.1	+	7		c.581C>A								Parts of antibodies, mostly variable regions.												0						TACCAGCAGACCCCAGGCCAG	0.577													43	132	---	---	---	---	PASS
CYTSA	23384	broad.mit.edu	37	22	24718188	24718188	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24718188C>T	uc002zzw.2	+	5	1547	c.1240C>T	c.(1240-1242)CTC>TTC	p.L414F	CYTSA_uc002zzv.3_Missense_Mutation_p.L414F|CYTSA_uc011ajq.1_Missense_Mutation_p.L414F	NM_015330	NP_056145	Q69YQ0	CYTSA_HUMAN	cytospin A	414	Potential.				cell cycle|cell division						0						AAGTGAGGAACTCCAGGCAAC	0.502													52	88	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31722878	31722878	+	Nonstop_Mutation	SNP	C	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31722878C>G	uc003akq.2	-	5	2724	c.2063G>C	c.(2062-2064)TGA>TCA	p.*688S	PATZ1_uc003akp.2_3'UTR|PATZ1_uc003akr.2_Nonstop_Mutation_p.*642S	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	688					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						GCAGCTGCCTCATTTCCCTTC	0.527													25	47	---	---	---	---	PASS
ATF4	468	broad.mit.edu	37	22	39917481	39917481	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39917481G>C	uc003axz.2	+	2	311	c.31G>C	c.(31-33)GTG>CTG	p.V11L	ATF4_uc011aol.1_5'UTR|ATF4_uc003aya.2_Missense_Mutation_p.V11L	NM_182810	NP_877962	P18848	ATF4_HUMAN	activating transcription factor 4	11					cellular amino acid metabolic process|gluconeogenesis|positive regulation of transcription from RNA polymerase II promoter|response to endoplasmic reticulum stress|transcription from RNA polymerase II promoter	cytoplasm|plasma membrane	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.04)					GAGCAGCGAGGTGTTGGTGGG	0.527													38	177	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42607698	42607698	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42607698C>T	uc003bcj.1	-	1	3748	c.3614G>A	c.(3613-3615)GGA>GAA	p.G1205E	TCF20_uc003bck.1_Missense_Mutation_p.G1205E|TCF20_uc003bnt.2_Missense_Mutation_p.G1205E	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1205					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						ACTGGACATTCCTGGAGGACC	0.493													48	75	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	31196890	31196890	+	Silent	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:31196890G>A	uc004dda.1	-	70	10363	c.10119C>T	c.(10117-10119)GCC>GCT	p.A3373A	DMD_uc004dcq.1_Silent_p.A644A|DMD_uc004dcr.1_Silent_p.A913A|DMD_uc004dcs.1_Silent_p.A913A|DMD_uc004dct.1_Silent_p.A913A|DMD_uc004dcu.1_Silent_p.A913A|DMD_uc004dcv.1_Silent_p.A913A|DMD_uc004dcw.2_Silent_p.A2029A|DMD_uc004dcx.2_Silent_p.A2032A|DMD_uc004dcz.2_Silent_p.A3250A|DMD_uc004dcy.1_Silent_p.A3369A|DMD_uc004ddb.1_Silent_p.A3365A|DMD_uc004dcm.1_Silent_p.A305A|DMD_uc004dcn.1_Silent_p.A305A|DMD_uc004dco.1_Silent_p.A305A|DMD_uc004dcp.1_Silent_p.A305A|DMD_uc011mkb.1_Silent_p.A305A|DMD_uc010ngm.2_Silent_p.A305A	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	3373	Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTAGTACCTTGGCAAAGTCTC	0.438													67	42	---	---	---	---	PASS
EFHC2	80258	broad.mit.edu	37	X	44109544	44109544	+	Missense_Mutation	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:44109544G>A	uc004dgb.3	-	6	844	c.754C>T	c.(754-756)CAT>TAT	p.H252Y		NM_025184	NP_079460	Q5JST6	EFHC2_HUMAN	EF-hand domain (C-terminal) containing 2	252	DM10 2.						calcium ion binding			breast(3)|ovary(2)|central_nervous_system(1)	6						AAGAAGTAATGCAGGATGAGT	0.443													24	22	---	---	---	---	PASS
GRIPAP1	56850	broad.mit.edu	37	X	48834858	48834858	+	Intron	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48834858G>C	uc004dly.1	-						GRIPAP1_uc004dlz.2_Intron|GRIPAP1_uc004dma.2_Intron	NM_020137	NP_064522	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1 isoform 1							early endosome				breast(2)|kidney(1)	3						CTGGGTGGTGGAGGGAAGAGA	0.473													10	22	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49075166	49075166	+	Missense_Mutation	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49075166C>T	uc004dnb.2	-	23	2857	c.2795G>A	c.(2794-2796)CGC>CAC	p.R932H	CACNA1F_uc010nip.2_Missense_Mutation_p.R921H	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	932	III.|Cytoplasmic (Potential).				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	GAAGGAGCCGCGGTGCAGGAA	0.587													4	4	---	---	---	---	PASS
CCNB3	85417	broad.mit.edu	37	X	50054016	50054016	+	Silent	SNP	A	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50054016A>G	uc004dox.3	+	6	3145	c.2847A>G	c.(2845-2847)TTA>TTG	p.L949L	CCNB3_uc004doy.2_Silent_p.L949L|CCNB3_uc004doz.2_Intron|CCNB3_uc010njq.2_Intron	NM_033031	NP_149020	Q8WWL7	CCNB3_HUMAN	cyclin B3 isoform 3	949					cell division|meiosis|regulation of cyclin-dependent protein kinase activity|regulation of G2/M transition of mitotic cell cycle	nucleus	protein kinase binding			ovary(4)|lung(3)|large_intestine(1)|pancreas(1)	9	Ovarian(276;0.236)					AGGAGCCATTAGCCTTACAAG	0.483													3	134	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54565513	54565513	+	Missense_Mutation	SNP	G	C	C			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54565513G>C	uc004dth.1	+	3	199	c.60G>C	c.(58-60)AAG>AAC	p.K20N	GNL3L_uc004dti.2_RNA	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3	20	Required for nucleolar localization.			KK->AA: Loss of nuclear location; when associated with 9-A-A-10. Loss of nuclear location; when associated with 34-A-A-35.	ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						GCCACAAGAAGATAAGTTGGC	0.433													10	7	---	---	---	---	PASS
MORF4L2	9643	broad.mit.edu	37	X	102931645	102931645	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102931645C>A	uc004ekw.2	-	4	1543	c.311G>T	c.(310-312)CGG>CTG	p.R104L	MORF4L2_uc004ela.2_Missense_Mutation_p.R104L|MORF4L2_uc004ekx.2_Missense_Mutation_p.R104L|MORF4L2_uc004elb.2_Missense_Mutation_p.R104L|MORF4L2_uc004eky.2_Missense_Mutation_p.R104L|MORF4L2_uc010nos.2_Missense_Mutation_p.R104L|MORF4L2_uc004ekz.2_Missense_Mutation_p.R104L|MORF4L2_uc011mry.1_Missense_Mutation_p.R104L|MORF4L2_uc011mrz.1_Missense_Mutation_p.R104L|MORF4L2_uc004elc.2_Missense_Mutation_p.R104L|MORF4L2_uc004elf.2_Missense_Mutation_p.R104L|MORF4L2_uc004ele.2_Missense_Mutation_p.R104L|MORF4L2_uc011msa.1_Missense_Mutation_p.R104L|MORF4L2_uc011msb.1_Missense_Mutation_p.R104L|MORF4L2_uc011msc.1_Missense_Mutation_p.R104L|MORF4L2_uc011msd.1_Missense_Mutation_p.R104L|MORF4L2_uc004eld.2_Missense_Mutation_p.R104L	NM_012286	NP_036418	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	104					chromatin modification|DNA repair|regulation of cell growth|transcription, DNA-dependent	nucleolus	protein binding				0						GGGGTCTGCCCGGGCCCTTTT	0.507													134	70	---	---	---	---	PASS
ENOX2	10495	broad.mit.edu	37	X	129843210	129843210	+	Intron	SNP	G	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129843210G>A	uc004evw.2	-						ENOX2_uc004evx.2_Intron|ENOX2_uc004evy.2_Intron	NM_182314	NP_872114	Q16206	ENOX2_HUMAN	ecto-NOX disulfide-thiol exchanger 2 isoform b						cell growth|electron transport chain|regulation of growth|transport|ultradian rhythm	cytosol|external side of plasma membrane|extracellular space	nucleic acid binding|nucleotide binding|protein disulfide oxidoreductase activity			ovary(1)	1						TACAAAGTGGGGCTTACCTGC	0.294													55	41	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135428802	135428802	+	Silent	SNP	C	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135428802C>T	uc004ezu.1	+	6	3228	c.2937C>T	c.(2935-2937)TCC>TCT	p.S979S	GPR112_uc010nsb.1_Silent_p.S774S|GPR112_uc010nsc.1_Silent_p.S746S	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	979	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					CCAGTTTCTCCACTACCCCTA	0.512													162	94	---	---	---	---	PASS
FATE1	89885	broad.mit.edu	37	X	150891157	150891157	+	Missense_Mutation	SNP	C	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150891157C>A	uc004fex.2	+	5	562	c.478C>A	c.(478-480)CAC>AAC	p.H160N		NM_033085	NP_149076	Q969F0	FATE1_HUMAN	fetal and adult testis expressed transcript	160						endoplasmic reticulum|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					CACCTGGCGCCACAGGGAGAC	0.647													46	24	---	---	---	---	PASS
EIF4G3	8672	broad.mit.edu	37	1	21299378	21299378	+	Intron	DEL	A	-	-	rs76449388		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21299378delA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beg.2_Intron|EIF4G3_uc010odk.1_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AGGGAAGAATAAAAAAAAAAA	0.284													4	2	---	---	---	---	
TCTEX1D1	200132	broad.mit.edu	37	1	67242261	67242262	+	Intron	DEL	TA	-	-	rs60960124		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67242261_67242262delTA	uc001dcv.2	+						TCTEX1D1_uc009wau.2_Intron|TCTEX1D1_uc009wav.2_Intron	NM_152665	NP_689878	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1												0						tgtgtgtgtgtATATACATAAA	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247347833	247347834	+	IGR	DEL	CT	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247347833_247347834delCT								ZNF124 (12515 upstream) : VN1R5 (71540 downstream)																							CTCTGCAATGCTCTGATGGCTC	0.530													41	24	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603286	64603288	+	IGR	DEL	CAC	-	-	rs141929982		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603286_64603288delCAC								PELI1 (231681 upstream) : HSPC159 (78039 downstream)																							ccaccaccatcaccaccatcacc	0.000													5	3	---	---	---	---	
LRRTM1	347730	broad.mit.edu	37	2	80530563	80530564	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80530563_80530564insT	uc002sok.1	-	2	651_652	c.381_382insA	c.(379-384)CAACTGfs	p.Q127fs	CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron|CTNNA2_uc010ysh.1_Intron|CTNNA2_uc010ysi.1_5'Flank|LRRTM1_uc002soj.3_RNA	NM_178839	NP_849161	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	127_128	LRR 2.|Lumenal (Potential).					axon|endoplasmic reticulum membrane|growth cone|integral to membrane				ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5						GTGTTGGGCAGTTGGGTGATCT	0.604										HNSCC(69;0.2)			181	132	---	---	---	---	
CYTIP	9595	broad.mit.edu	37	2	158300322	158300323	+	Intron	DEL	TG	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158300322_158300323delTG	uc002tzj.1	-						CYTIP_uc010zcl.1_Intron	NM_004288	NP_004279	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein						regulation of cell adhesion	cell cortex|early endosome	protein binding			ovary(1)|kidney(1)|skin(1)	3						CTCAAGAGAATGTGAACACTCT	0.421													66	31	---	---	---	---	
CDCA7	83879	broad.mit.edu	37	2	174229327	174229328	+	Intron	INS	-	TAT	TAT	rs143428036	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174229327_174229328insTAT	uc002uid.1	+						CDCA7_uc002uic.1_Intron|CDCA7_uc010zej.1_Intron|CDCA7_uc010zek.1_Intron	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2						regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			ACTGGGCTTGGTATTACAAAAG	0.302													5	4	---	---	---	---	
MFF	56947	broad.mit.edu	37	2	228204807	228204808	+	Intron	INS	-	GT	GT	rs139635640	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228204807_228204808insGT	uc002vos.2	+						MFF_uc002vot.2_Intron|MFF_uc002vou.2_Intron|MFF_uc002vov.2_Intron|MFF_uc002vow.2_Intron|MFF_uc002vox.2_Intron|MFF_uc002voy.2_Intron|MFF_uc002voz.2_Intron	NM_020194	NP_064579	Q9GZY8	MFF_HUMAN	mitochondrial fission factor							integral to membrane|mitochondrial outer membrane				large_intestine(1)	1						TAGTAAGTAGGGTGTGTGTGTG	0.337													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5124705	5124709	+	IGR	DEL	TTTTT	-	-	rs72175262		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5124705_5124709delTTTTT								BHLHE40 (97842 upstream) : ARL8B (39221 downstream)																							CATTTCAGCCttttttttttttttt	0.459													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125943968	125943971	+	IGR	DEL	TGTG	-	-	rs111834429		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125943968_125943971delTGTG								ALDH1L1 (44483 upstream) : KLF15 (117507 downstream)																							actacaattatgtgtgtgtgtgtg	0.167													5	4	---	---	---	---	
TM4SF4	7104	broad.mit.edu	37	3	149213962	149213962	+	Intron	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149213962delT	uc003exd.1	+							NM_004617	NP_004608	P48230	T4S4_HUMAN	transmembrane 4 superfamily member 4							integral to membrane					0			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			CCATTTGGGATTTTTTTTTTT	0.224													4	2	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41689701	41689701	+	Intron	DEL	A	-	-	rs5857811		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41689701delA	uc003gvu.3	+						LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron|LIMCH1_uc003gvy.3_Intron|LIMCH1_uc003gwa.3_Intron|LIMCH1_uc003gvz.3_Intron|LIMCH1_uc011byu.1_Intron|LIMCH1_uc003gwc.3_Intron|LIMCH1_uc003gwd.3_Intron|LIMCH1_uc011byv.1_Intron|LIMCH1_uc011byw.1_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						TTTGTTCATTAAAAAAAAAAA	0.289													7	4	---	---	---	---	
ENPEP	2028	broad.mit.edu	37	4	111441213	111441213	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:111441213delG	uc003iab.3	+	9	1901	c.1559delG	c.(1558-1560)TGGfs	p.W520fs		NM_001977	NP_001968	Q07075	AMPE_HUMAN	glutamyl aminopeptidase	520	Extracellular (Potential).				cell migration|cell proliferation|cell-cell signaling|proteolysis	integral to plasma membrane	aminopeptidase activity|metalloexopeptidase activity|zinc ion binding			skin(3)|ovary(1)|breast(1)	5		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)	L-Glutamic Acid(DB00142)	TCTGATTTTTGGGCAGCACTG	0.323													69	30	---	---	---	---	
HSPA4L	22824	broad.mit.edu	37	4	128733756	128733757	+	Intron	INS	-	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128733756_128733757insT	uc003ifm.2	+						HSPA4L_uc010iny.1_Intron|HSPA4L_uc011cgr.1_Intron	NM_014278	NP_055093	O95757	HS74L_HUMAN	heat shock 70kDa protein 4-like						protein folding|response to unfolded protein	cytoplasm|nucleus	ATP binding|protein binding			ovary(2)|central_nervous_system(1)|skin(1)	4						ATGGCATTAGATTTTTTGTCTA	0.252													3	6	---	---	---	---	
RAPGEF6	51735	broad.mit.edu	37	5	131046228	131046228	+	Intron	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131046228delT	uc003kvp.1	-						FNIP1_uc003kvs.1_Intron|FNIP1_uc003kvt.1_Intron|FNIP1_uc010jdm.1_Intron|FNIP1_uc003kvu.2_Intron	NM_016340	NP_057424	Q8TEU7	RPGF6_HUMAN	PDZ domain-containing guanine nucleotide						Ras protein signal transduction|regulation of GTPase activity|regulation of small GTPase mediated signal transduction	cytoplasm|plasma membrane	GTP-dependent protein binding|guanyl-nucleotide exchange factor activity|Ras GTPase binding			ovary(1)|lung(1)|central_nervous_system(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		ATTCTAGCCGTTGGGGCACAC	0.483													11	15	---	---	---	---	
PCDHB12	56124	broad.mit.edu	37	5	140590646	140590646	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590646delG	uc003liz.2	+	1	2356	c.2167delG	c.(2167-2169)GGTfs	p.G723fs	PCDHB12_uc011dak.1_Frame_Shift_Del_p.G386fs|PCDHB13_uc003lja.1_5'Flank	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	723	Cytoplasmic (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GGCCCCGGTCGGTCGCTGCTC	0.662													106	58	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57512916	57512917	+	Splice_Site	INS	-	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57512916_57512917insT	uc003pdx.2	+	16	1839	c.1752_splice	c.e16+1			NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ttttttttcaattttttttgta	0.000													4	2	---	---	---	---	
GRIK2	2898	broad.mit.edu	37	6	101967177	101967180	+	Intron	DEL	GTGT	-	-	rs145458737		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101967177_101967180delGTGT	uc003pqp.3	+						GRIK2_uc003pqn.2_Intron|GRIK2_uc003pqo.3_Intron|GRIK2_uc010kcw.2_Intron	NM_021956	NP_068775	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2						glutamate signaling pathway|induction of programmed cell death in response to chemical stimulus|neuron apoptosis|positive regulation of synaptic transmission|regulation of short-term neuronal synaptic plasticity	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|pancreas(1)|breast(1)|skin(1)	5		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	L-Glutamic Acid(DB00142)	GGAGTTAAACgtgtgtgtgtgtgt	0.245													3	4	---	---	---	---	
ATG5	9474	broad.mit.edu	37	6	106764250	106764250	+	Intron	DEL	A	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106764250delA	uc003prf.2	-						ATG5_uc010kdb.2_Intron|ATG5_uc003prg.2_Intron|ATG5_uc010kdc.2_Intron	NM_004849	NP_004840	Q9H1Y0	ATG5_HUMAN	APG5 autophagy 5-like						apoptosis|autophagic vacuole assembly|negative regulation of type I interferon production|post-translational protein modification	autophagic vacuole|pre-autophagosomal structure membrane	protein binding			large_intestine(1)	1	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		TATCCACTTCAAAAAAAAAAA	0.269													5	3	---	---	---	---	
LRWD1	222229	broad.mit.edu	37	7	102106858	102106861	+	Intron	DEL	TTTA	-	-	rs66463732		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102106858_102106861delTTTA	uc003uzn.2	+						ALKBH4_uc003uzl.2_5'Flank|ALKBH4_uc003uzm.2_5'Flank|LRWD1_uc003uzo.2_Intron	NM_152892	NP_690852	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain						chromatin modification|DNA-dependent DNA replication initiation|establishment of protein localization to chromatin|G1 phase of mitotic cell cycle	centromeric heterochromatin|nuclear origin of replication recognition complex|telomeric heterochromatin	chromatin binding|methyl-CpG binding|methylated histone residue binding			skin(1)	1						GATGTGCTACtttatttatttatt	0.260													2	6	---	---	---	---	
DNAJB9	4189	broad.mit.edu	37	7	108213939	108213939	+	3'UTR	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108213939delT	uc003vfn.2	+	3						NM_012328	NP_036460	Q9UBS3	DNJB9_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 9						ER-associated protein catabolic process|protein folding	endoplasmic reticulum|nucleolus	heat shock protein binding|misfolded protein binding|unfolded protein binding				0						TATTTAAGGGTTTTTTTTTTT	0.264													8	4	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													7	4	---	---	---	---	
WDR60	55112	broad.mit.edu	37	7	158704301	158704302	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158704301_158704302insT	uc003woe.3	+	12	1679_1680	c.1521_1522insT	c.(1519-1524)CTCTTGfs	p.L507fs	WDR60_uc010lqv.2_RNA|WDR60_uc010lqw.2_Frame_Shift_Ins_p.L139fs	NM_018051	NP_060521	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	507_508										ovary(2)|breast(1)|central_nervous_system(1)	4	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		CTTTCTCTCTCTTGGATCTACC	0.322													77	55	---	---	---	---	
ANGPT1	284	broad.mit.edu	37	8	108315806	108315806	+	Intron	DEL	T	-	-	rs3840711		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:108315806delT	uc003ymn.2	-						ANGPT1_uc011lhv.1_Intron|ANGPT1_uc003ymo.2_Intron|ANGPT1_uc003ymp.3_Intron	NM_001146	NP_001137	Q15389	ANGP1_HUMAN	angiopoietin 1 precursor						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|blood coagulation|cell differentiation|heparin biosynthetic process|leukocyte migration|negative regulation of cell adhesion|negative regulation of endothelial cell apoptosis|negative regulation of vascular permeability|positive chemotaxis|positive regulation of blood vessel endothelial cell migration|positive regulation of ERK1 and ERK2 cascade|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein ubiquitination|positive regulation of receptor internalization|protein localization at cell surface|regulation of satellite cell proliferation|sprouting angiogenesis|Tie receptor signaling pathway	extracellular space|membrane raft|microvillus|plasma membrane	receptor tyrosine kinase binding			ovary(3)|skin(3)|upper_aerodigestive_tract(1)	7	Breast(1;5.06e-08)		OV - Ovarian serous cystadenocarcinoma(57;5.53e-09)			TGTAGAGCCATTTTTAACTGA	0.279													3	7	---	---	---	---	
CAMK2G	818	broad.mit.edu	37	10	75587897	75587913	+	Intron	DEL	AGAGGGAAAGAGAAGGG	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:75587897_75587913delAGAGGGAAAGAGAAGGG	uc001jvv.1	-						CAMK2G_uc001jvm.1_Intron|CAMK2G_uc001jvo.1_Intron|CAMK2G_uc001jvq.1_Intron|CAMK2G_uc001jvr.1_Intron|CAMK2G_uc001jvp.1_Intron|CAMK2G_uc001jvs.1_Intron|CAMK2G_uc001jvt.1_Intron|CAMK2G_uc001jvu.1_Intron|CAMK2G_uc010qkv.1_Intron|CAMK2G_uc009xrp.1_Intron|CAMK2G_uc001jvw.1_Intron|CAMK2G_uc001jvx.1_Intron	NM_172171	NP_751911	Q13555	KCC2G_HUMAN	calcium/calmodulin-dependent protein kinase II						insulin secretion|interferon-gamma-mediated signaling pathway|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calcium-dependent protein serine/threonine phosphatase activity|calmodulin binding|calmodulin-dependent protein kinase activity			lung(1)|stomach(1)	2	Prostate(51;0.0112)					CACCACAGCAagagggaaagagaaggggaaagaggag	0.484													31	17	---	---	---	---	
SORCS3	22986	broad.mit.edu	37	10	106581907	106581914	+	Intron	DEL	TCTGTATC	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106581907_106581914delTCTGTATC	uc001kyi.1	+							NM_014978	NP_055793	Q9UPU3	SORC3_HUMAN	VPS10 domain receptor protein SORCS 3 precursor							integral to membrane	neuropeptide receptor activity			ovary(6)|skin(3)|central_nervous_system(1)	10		Colorectal(252;0.134)|Breast(234;0.142)|Lung NSC(174;0.191)		Epithelial(162;1.58e-07)|all cancers(201;1.02e-05)|BRCA - Breast invasive adenocarcinoma(275;0.0628)		GTCCTCAGTTTCTGTATCTGTATCTGAC	0.433													29	29	---	---	---	---	
NPS	594857	broad.mit.edu	37	10	129350870	129350871	+	Frame_Shift_Ins	INS	-	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129350870_129350871insA	uc001ljx.1	+	3	257_258	c.237_238insA	c.(235-240)ATGAAAfs	p.M79fs		NM_001030013	NP_001025184	P0C0P6	NPS_HUMAN	neuropeptide S precursor	79_80					neuropeptide signaling pathway	extracellular region					0						GCACAGGGATGAAAAAAACTTC	0.411													174	121	---	---	---	---	
PRMT3	10196	broad.mit.edu	37	11	20483506	20483506	+	Intron	DEL	G	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20483506delG	uc001mqb.2	+						PRMT3_uc001mqc.2_Intron|PRMT3_uc010rdn.1_Intron	NM_005788	NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3 isoform 1								zinc ion binding				0						CTTAATTGTTGGGCATTTTGT	0.338													93	81	---	---	---	---	
LOC646813	646813	broad.mit.edu	37	11	50378075	50378075	+	RNA	DEL	G	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50378075delG	uc001nhe.2	+	5		c.705delG			LOC646813_uc001nhf.1_RNA|LOC646813_uc001nhg.1_RNA|LOC646813_uc001nhh.1_RNA|LOC646813_uc010rib.1_RNA	NR_024504				Homo sapiens mRNA for hypothetical protein, partial sequence, clone:Hsa11-digit09-11-09-R.												0						AATATTTTCTGGAAGACTGCA	0.398													133	61	---	---	---	---	
OSBP	5007	broad.mit.edu	37	11	59368588	59368589	+	Intron	INS	-	A	A	rs11405726		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59368588_59368589insA	uc001noc.1	-						OSBP_uc009ymr.1_5'Flank	NM_002556	NP_002547	P22059	OSBP1_HUMAN	oxysterol binding protein						lipid transport	Golgi membrane	oxysterol binding			large_intestine(1)	1		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		GATCTTGAGACAAAAAAAAAAA	0.282													4	3	---	---	---	---	
PHOX2A	401	broad.mit.edu	37	11	71952356	71952357	+	Intron	INS	-	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71952356_71952357insG	uc001osh.3	-							NM_005169	NP_005160	O14813	PHX2A_HUMAN	paired-like homeobox 2a						noradrenergic neuron differentiation|positive regulation of transcription from RNA polymerase II promoter	nuclear chromatin	RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						GCAGGGGGGCCGGGGGGGGGGC	0.658													4	2	---	---	---	---	
OR4D5	219875	broad.mit.edu	37	11	123810461	123810461	+	Frame_Shift_Del	DEL	G	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123810461delG	uc001pzk.1	+	1	138	c.138delG	c.(136-138)GTGfs	p.V46fs		NM_001001965	NP_001001965	Q8NGN0	OR4D5_HUMAN	olfactory receptor, family 4, subfamily D,	46	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		TTCTTATTGTGGTCATAGTGA	0.448													119	97	---	---	---	---	
OR8B4	283162	broad.mit.edu	37	11	124294406	124294407	+	Frame_Shift_Ins	INS	-	G	G			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294406_124294407insG	uc010sak.1	-	1	361_362	c.361_362insC	c.(361-363)CGCfs	p.R121fs		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	121	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		GGCCACATAGCGATCATAGGCC	0.455													62	65	---	---	---	---	
KRT8	3856	broad.mit.edu	37	12	53291007	53291008	+	3'UTR	INS	-	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53291007_53291008insA	uc001sbd.2	-	8					KRT8_uc009zmj.2_3'UTR|KRT8_uc009zmk.1_3'UTR|KRT8_uc009zml.1_3'UTR|KRT8_uc009zmm.1_3'UTR	NM_002273	NP_002264	P05787	K2C8_HUMAN	keratin 8						cytoskeleton organization|interspecies interaction between organisms	cytoplasm|keratin filament|nuclear matrix|nucleoplasm	protein binding|structural molecule activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(357;0.108)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TATTTTGGACCAAAAAAAAAAA	0.530													6	3	---	---	---	---	
ZNF268	10795	broad.mit.edu	37	12	133764702	133764702	+	Intron	DEL	T	-	-	rs72400258		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133764702delT	uc010tcf.1	+						ZNF268_uc010tbv.1_Intron|ZNF268_uc010tbw.1_Intron|ZNF268_uc010tbx.1_Intron|ZNF268_uc010tby.1_Intron|ZNF268_uc010tbz.1_Intron|ZNF268_uc010tca.1_Intron|ZNF268_uc010tcb.1_Intron|ZNF268_uc010tcc.1_Intron|ZNF268_uc010tcd.1_Intron|ZNF268_uc010tce.1_Intron|ZNF268_uc010tcg.1_Intron|ZNF268_uc010tch.1_Intron	NM_003415	NP_003406	Q14587	ZN268_HUMAN	zinc finger protein 268 isoform a							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_cancers(7;0.000215)|all_epithelial(31;0.096)		OV - Ovarian serous cystadenocarcinoma(86;3.58e-08)|Epithelial(86;6.6e-07)|all cancers(50;2.28e-05)		CTTTATTACCTTTTTTTTTTT	0.259													5	3	---	---	---	---	
PHF11	51131	broad.mit.edu	37	13	50092461	50092462	+	Intron	DEL	TA	-	-	rs36052789		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50092461_50092462delTA	uc001vdb.2	+						PHF11_uc010tgl.1_3'UTR|PHF11_uc001vdc.2_Intron|PHF11_uc001vdd.2_Intron	NM_001040443	NP_001035533	Q9UIL8	PHF11_HUMAN	PHD finger protein 11 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding				0		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		GTGAAAAATCtatatatatata	0.277													3	3	---	---	---	---	
YLPM1	56252	broad.mit.edu	37	14	75269231	75269233	+	Intron	DEL	GTA	-	-	rs139100773	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75269231_75269233delGTA	uc001xqj.3	+						YLPM1_uc001xql.3_Intron	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CATGCTTTATGTACTATGTCAAT	0.369													52	30	---	---	---	---	
RYR3	6263	broad.mit.edu	37	15	33831532	33831532	+	Intron	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33831532delT	uc001zhi.2	+						RYR3_uc010bar.2_Intron	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3						cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AATGACTAACTCAAGGAGCCT	0.478													10	10	---	---	---	---	
ATP2A3	489	broad.mit.edu	37	17	3854837	3854838	+	Intron	INS	-	C	C	rs144318844	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3854837_3854838insC	uc002fxb.1	-						ATP2A3_uc002fwx.1_Intron|ATP2A3_uc002fwy.1_Intron|ATP2A3_uc002fwz.1_Intron|ATP2A3_uc002fxa.1_Intron|ATP2A3_uc002fxc.1_Intron|ATP2A3_uc002fxd.1_Intron	NM_174955	NP_777615	Q93084	AT2A3_HUMAN	ATPase, Ca++ transporting, ubiquitous isoform b						ATP biosynthetic process|platelet activation	integral to membrane|nuclear membrane|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|metal ion binding|protein binding			ovary(3)|breast(1)|central_nervous_system(1)	5				LUAD - Lung adenocarcinoma(1115;0.000692)|Lung(3;0.0766)		TGGCTGGGAGACCGCCCCCCGC	0.678													4	2	---	---	---	---	
FBXW10	10517	broad.mit.edu	37	17	18652860	18652860	+	Intron	DEL	A	-	-	rs140182637		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18652860delA	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10											ovary(1)	1						actccgtctcaaaaaaaaaaa	0.184													3	4	---	---	---	---	
FOXN1	8456	broad.mit.edu	37	17	26851370	26851371	+	Intron	INS	-	CTT	CTT	rs138715148	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26851370_26851371insCTT	uc010crm.2	+						FOXN1_uc002hbj.2_Intron	NM_003593	NP_003584	O15353	FOXN1_HUMAN	forkhead box N1						defense response|embryo development|epithelial cell proliferation|keratinocyte differentiation|organ morphogenesis|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|thymus development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			skin(1)	1	Lung NSC(42;0.00431)					TGAAATCGGGGCCAAGGGTAGG	0.574													10	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46754509	46754512	+	IGR	DEL	CCTT	-	-	rs143755906		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46754509_46754512delCCTT								MIR196A1 (44588 upstream) : PRAC (44580 downstream)																							ttccttcctcccttccttccttcc	0.005													5	3	---	---	---	---	
MGAT5B	146664	broad.mit.edu	37	17	74901902	74901924	+	Intron	DEL	TGAGGGCAAGCACGTGACTATCT	-	-	rs79729877		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74901902_74901924delTGAGGGCAAGCACGTGACTATCT	uc002jti.2	+						MGAT5B_uc002jth.2_Intron	NM_198955	NP_945193	Q3V5L5	MGT5B_HUMAN	N-acetylglucosaminyltranferase VB isoform 2							Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity|metal ion binding			ovary(2)|skin(1)	3						attagctccatgagggcaagcacgtgactatcttgttcgcccg	0.233													4	2	---	---	---	---	
SPIRE1	56907	broad.mit.edu	37	18	12451071	12451072	+	Intron	INS	-	A	A	rs80045636		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12451071_12451072insA	uc002kre.2	-						SPIRE1_uc002krc.2_Intron|SPIRE1_uc010wzw.1_Intron|SPIRE1_uc010wzx.1_Intron|SPIRE1_uc010wzy.1_Intron	NM_001128626	NP_001122098	Q08AE8	SPIR1_HUMAN	spire homolog 1 isoform a							cytoskeleton|perinuclear region of cytoplasm	actin binding				0						CTGTCCATTTGAAAAAAAAAAA	0.183													3	3	---	---	---	---	
ATP5A1	498	broad.mit.edu	37	18	43665899	43665900	+	Intron	INS	-	A	A	rs34456835		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43665899_43665900insA	uc002lbr.1	-						ATP5A1_uc010dnl.1_Intron|ATP5A1_uc002lbs.1_Intron|ATP5A1_uc002lbt.1_Intron	NM_004046	NP_004037	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1						ATP hydrolysis coupled proton transport|embryo development|lipid metabolic process|negative regulation of endothelial cell proliferation|respiratory electron transport chain	mitochondrial matrix|plasma membrane	ATP binding|eukaryotic cell surface binding|hydrogen ion transporting ATP synthase activity, rotational mechanism|MHC class I protein binding|proton-transporting ATPase activity, rotational mechanism				0						aacttcgtctcaaaaaaaaaaa	0.124													4	2	---	---	---	---	
GRIN3B	116444	broad.mit.edu	37	19	1008327	1008332	+	Intron	DEL	GTGGGC	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1008327_1008332delGTGGGC	uc002lqo.1	+						uc002lqp.1_RNA	NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,						ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	gggggtgggggtgggcgtgggggGCC	0.500													4	3	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153106	7153109	+	Intron	DEL	ACAC	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153106_7153109delACAC	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	caccacacatacacacaccacaaa	0.000													5	3	---	---	---	---	
SMARCA4	6597	broad.mit.edu	37	19	11113476	11113478	+	Intron	DEL	AAA	-	-	rs112892853		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11113476_11113478delAAA	uc002mqf.3	+						SMARCA4_uc010dxp.2_Intron|SMARCA4_uc010dxo.2_Intron|SMARCA4_uc002mqg.1_Intron|SMARCA4_uc010dxq.2_Intron|SMARCA4_uc010dxr.2_Intron|SMARCA4_uc002mqj.3_Intron|SMARCA4_uc010dxs.2_Intron	NM_003072	NP_003063	P51532	SMCA4_HUMAN	SWI/SNF-related matrix-associated						chromatin remodeling|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|negative regulation of transcription from RNA polymerase II promoter|nervous system development|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nBAF complex|npBAF complex|nuclear chromatin|SWI/SNF complex|WINAC complex	androgen receptor binding|ATP binding|DNA binding|DNA-dependent ATPase activity|helicase activity|histone acetyl-lysine binding|identical protein binding|p53 binding|protein N-terminus binding|transcription corepressor activity	p.?(1)		lung(29)|ovary(8)|pancreas(7)|large_intestine(5)|central_nervous_system(5)|skin(3)|prostate(3)|breast(2)|adrenal_gland(1)|stomach(1)|liver(1)|autonomic_ganglia(1)|kidney(1)	67		all_lung(6;0.0512)|Lung NSC(9;0.0568)				actccgtctcaaaaaaaaaaaaa	0.138			F|N|Mis		NSCLC				Rhabdoid_Predisposition_syndrome				4	2	---	---	---	---	
ZNF829	374899	broad.mit.edu	37	19	37393071	37393072	+	Intron	INS	-	A	A			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37393071_37393072insA	uc002ofa.1	-						ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAAAAAAAAGAAAAAAAAAAA	0.342													5	3	---	---	---	---	
NUCB1	4924	broad.mit.edu	37	19	49409222	49409232	+	Intron	DEL	GTGCTAGGCAG	-	-	rs113033245		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49409222_49409232delGTGCTAGGCAG	uc002plb.3	+						NUCB1_uc002pla.2_Intron|NUCB1_uc002plc.2_Intron	NM_006184	NP_006175	Q02818	NUCB1_HUMAN	nucleobindin 1 precursor							ER-Golgi intermediate compartment|extracellular space|Golgi apparatus|membrane|microtubule cytoskeleton	calcium ion binding|DNA binding				0		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		AGGTGGTTGTGTGCTAGGCAGGTGAGGCCTC	0.602													4	2	---	---	---	---	
PPP1R12C	54776	broad.mit.edu	37	19	55605558	55605559	+	Intron	INS	-	TTA	TTA			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55605558_55605559insTTA	uc002qix.2	-						PPP1R12C_uc010yfs.1_Intron|PPP1R12C_uc002qiy.2_Intron	NM_017607	NP_060077	Q9BZL4	PP12C_HUMAN	protein phosphatase 1, regulatory subunit 12C							cytoplasm				ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0449)		acctccagcccctcctccctca	0.000													3	4	---	---	---	---	
ZNF471	57573	broad.mit.edu	37	19	57022721	57022721	+	Intron	DEL	A	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57022721delA	uc002qnh.2	+							NM_020813	NP_065864	Q9BX82	ZN471_HUMAN	zinc finger protein 471						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		CTCAAGCATGAAAAAAAAAAA	0.373													3	3	---	---	---	---	
KCNQ2	3785	broad.mit.edu	37	20	62076856	62076857	+	Intron	INS	-	CCCCAAAGGG	CCCCAAAGGG	rs138698925	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62076856_62076857insCCCCAAAGGG	uc002yey.1	-						KCNQ2_uc002yez.1_Intron|KCNQ2_uc002yfa.1_Intron|KCNQ2_uc002yfb.1_Intron|KCNQ2_uc011aax.1_Intron|KCNQ2_uc002yfc.1_Intron	NM_172107	NP_742105	O43526	KCNQ2_HUMAN	potassium voltage-gated channel KQT-like protein						axon guidance|synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			upper_aerodigestive_tract(1)|ovary(1)	2	all_cancers(38;1.24e-11)		BRCA - Breast invasive adenocarcinoma(10;1.04e-05)		Amitriptyline(DB00321)	GCAAGCTGACCCCCCCACCCCT	0.678													3	4	---	---	---	---	
IFNGR2	3460	broad.mit.edu	37	21	34809434	34809434	+	3'UTR	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34809434delT	uc002yrp.3	+	7					IFNGR2_uc002yrq.3_3'UTR|IFNGR2_uc010gma.2_3'UTR|IFNGR2_uc002yrr.3_3'UTR|TMEM50B_uc002yrs.1_Intron	NM_005534	NP_005525	P38484	INGR2_HUMAN	interferon gamma receptor 2 precursor						regulation of interferon-gamma-mediated signaling pathway|response to virus	endoplasmic reticulum|integral to plasma membrane	interferon-gamma receptor activity				0					Interferon gamma-1b(DB00033)	GGTGACAAGCTTTTTTTTTTT	0.398													7	4	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	22657422	22657422	+	Intron	DEL	T	-	-			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22657422delT	uc011aim.1	+						LOC96610_uc011aiq.1_Intron|LOC96610_uc011aip.1_Intron|LOC96610_uc010gto.2_Intron					Parts of antibodies, mostly variable regions.												0						AAATACTAACTGTTTTACGAA	0.403													4	3	---	---	---	---	
SEZ6L	23544	broad.mit.edu	37	22	26709538	26709539	+	Intron	DEL	AC	-	-	rs68081834		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26709538_26709539delAC	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						TTTAATCATTacacacacacac	0.401													9	9	---	---	---	---	
TCN2	6948	broad.mit.edu	37	22	31012013	31012016	+	Intron	DEL	TGGA	-	-	rs145631512		TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31012013_31012016delTGGA	uc003aip.1	+						TCN2_uc003aiq.1_Intron|TCN2_uc003air.1_Intron	NM_000355	NP_000346	P20062	TCO2_HUMAN	transcobalamin II precursor						cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular space	cobalamin binding			central_nervous_system(1)	1					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CAGAAATGTTtggatggatggatg	0.333													4	2	---	---	---	---	
MYH9	4627	broad.mit.edu	37	22	36708400	36708401	+	Intron	INS	-	A	A	rs143290016	by1000genomes	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36708400_36708401insA	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						CCAGGAGAAGCAAAGCACTGTT	0.574			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				7	4	---	---	---	---	
POLA1	5422	broad.mit.edu	37	X	24735993	24735994	+	Intron	INS	-	T	T			TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24735993_24735994insT	uc004dbl.2	+						POLA1_uc004dbm.2_Intron|POLA1_uc004dbn.2_Intron	NM_016937	NP_058633	P09884	DPOLA_HUMAN	DNA-directed DNA polymerase alpha 1						cell proliferation|DNA replication checkpoint|DNA replication, synthesis of RNA primer|DNA-dependent DNA replication initiation|double-strand break repair via nonhomologous end joining|interspecies interaction between organisms|lagging strand elongation|leading strand elongation|M/G1 transition of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|cytoplasm|nuclear envelope|nuclear matrix|nucleolus|nucleoplasm	chromatin binding|DNA-directed DNA polymerase activity|metal ion binding|nucleoside binding			ovary(2)|skin(1)	3					Clofarabine(DB00631)|Fludarabine(DB01073)	gtttatttctgttttttttttc	0.252													4	2	---	---	---	---	
IL9R	3581	broad.mit.edu	37	X	155239822	155239827	+	In_Frame_Del	DEL	CAACAA	-	-	rs150178903	byFrequency	TCGA-34-2596-01	TCGA-34-2596-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155239822_155239827delCAACAA	uc004fnv.1	+	9	1493_1498	c.1314_1319delCAACAA	c.(1312-1320)AGCAACAAC>AGC	p.NN441del	IL9R_uc004fnu.1_3'UTR	NM_002186	NP_002177	Q01113	IL9R_HUMAN	interleukin 9 receptor precursor	441_442	Poly-Asn.|Cytoplasmic (Potential).				cell proliferation	extracellular space|integral to plasma membrane	interleukin-9 receptor activity				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					gcagcagcagcaacaacaacaACTAC	0.519													4	2	---	---	---	---	
