Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PIK3CD	5293	broad.mit.edu	37	1	9781535	9781535	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9781535G>A	uc001aqb.3	+	15	2053	c.1845G>A	c.(1843-1845)CTG>CTA	p.L615L	PIK3CD_uc010oaf.1_Silent_p.L614L|PIK3CD_uc001aqe.3_Silent_p.L639L	NM_005026	NP_005017	O00329	PK3CD_HUMAN	catalytic phosphatidylinositol 3-kinase delta	615					phosphatidylinositol-mediated signaling|protein phosphorylation	phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(4)|skin(2)|central_nervous_system(1)	7	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)		TGCTGCAGCTGGTGCAGGTGC	0.627													16	41	---	---	---	---	PASS
AADACL3	126767	broad.mit.edu	37	1	12785921	12785921	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12785921G>A	uc009vnn.1	+	4	1244	c.1011G>A	c.(1009-1011)ATG>ATA	p.M337I	AADACL3_uc001aug.1_Missense_Mutation_p.M267I	NM_001103170	NP_001096640	Q5VUY0	ADCL3_HUMAN	arylacetamide deacetylase-like 3 isoform 1	337							hydrolase activity				0	Ovarian(185;0.249)	Lung NSC(185;8.27e-05)|all_lung(284;9.47e-05)|Renal(390;0.000147)|Colorectal(325;0.000583)|Breast(348;0.000596)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.00217)|KIRC - Kidney renal clear cell carcinoma(229;0.00579)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGCTCCATGAGAATTCTGA	0.512													30	43	---	---	---	---	PASS
TMEM82	388595	broad.mit.edu	37	1	16069353	16069353	+	Silent	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16069353T>C	uc001axc.2	+	2	250	c.112T>C	c.(112-114)TTG>CTG	p.L38L		NM_001013641	NP_001013663	A0PJX8	TMM82_HUMAN	transmembrane protein 82	38	Leu-rich.|Helical; (Potential).					integral to membrane				breast(1)|central_nervous_system(1)	2		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.73e-07)|COAD - Colon adenocarcinoma(227;3.49e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000114)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CCTTGGAGTCTTGGTCCTGAA	0.642													15	20	---	---	---	---	PASS
PADI4	23569	broad.mit.edu	37	1	17681188	17681188	+	Intron	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17681188G>A	uc001baj.2	+							NM_012387	NP_036519	Q9UM07	PADI4_HUMAN	peptidyl arginine deiminase, type IV						chromatin modification|peptidyl-citrulline biosynthetic process from peptidyl-arginine|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			ovary(1)|skin(1)	2		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000338)|Lung NSC(340;0.00042)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00537)|BRCA - Breast invasive adenocarcinoma(304;8.54e-06)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(64;0.000223)|KIRC - Kidney renal clear cell carcinoma(64;0.00313)|STAD - Stomach adenocarcinoma(196;0.00707)|READ - Rectum adenocarcinoma(331;0.0689)|Lung(427;0.199)	L-Citrulline(DB00155)	CCCAGGTAAGGAGGGGAGTAA	0.582													17	21	---	---	---	---	PASS
ACTL8	81569	broad.mit.edu	37	1	18152812	18152812	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18152812G>C	uc001bat.2	+	3	1115	c.899G>C	c.(898-900)GGC>GCC	p.G300A		NM_030812	NP_110439	Q9H568	ACTL8_HUMAN	actin-like 8	300						cytoplasm|cytoskeleton				ovary(4)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00186)|all_lung(284;0.0054)|Lung NSC(340;0.00566)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;6.43e-06)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.00652)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)		GCCTGCGGGGGCAACACCCTC	0.642											OREG0013157	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	34	54	---	---	---	---	PASS
IGSF21	84966	broad.mit.edu	37	1	18691941	18691941	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18691941C>T	uc001bau.1	+	6	1148	c.765C>T	c.(763-765)AAC>AAT	p.N255N	IGSF21_uc001bav.1_Silent_p.N76N	NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor	255						extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		CAGATCCCAACATCCTCCTCC	0.647													59	117	---	---	---	---	PASS
KIF17	57576	broad.mit.edu	37	1	21031387	21031387	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21031387G>A	uc001bdr.3	-	5	794	c.676C>T	c.(676-678)CGG>TGG	p.R226W	KIF17_uc001bds.3_Missense_Mutation_p.R226W	NM_020816	NP_065867	Q9P2E2	KIF17_HUMAN	kinesin family member 17 isoform a	226	Kinesin-motor.				microtubule-based movement|protein transport	cytoplasm|microtubule	ATP binding			ovary(3)|skin(1)	4		all_lung(284;2.99e-05)|Lung NSC(340;3.26e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|COAD - Colon adenocarcinoma(152;1.43e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000168)|Kidney(64;0.000221)|GBM - Glioblastoma multiforme(114;0.000651)|KIRC - Kidney renal clear cell carcinoma(64;0.0031)|STAD - Stomach adenocarcinoma(196;0.00336)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.209)		TCCTTGCCCCGCTCATCTGCA	0.527													27	37	---	---	---	---	PASS
MAN1C1	57134	broad.mit.edu	37	1	25944517	25944517	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25944517G>C	uc001bkm.2	+	1	559	c.229G>C	c.(229-231)GAG>CAG	p.E77Q	MAN1C1_uc009vry.1_5'UTR	NM_020379	NP_065112	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	77	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(1)	1		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		CCCGGCCCGCGAGCAGGAGCC	0.617													6	10	---	---	---	---	PASS
PUM1	9698	broad.mit.edu	37	1	31447598	31447598	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:31447598T>G	uc001bsi.1	-	10	1519	c.1406A>C	c.(1405-1407)TAC>TCC	p.Y469S	PUM1_uc001bsf.1_Missense_Mutation_p.Y135S|PUM1_uc001bsg.1_Missense_Mutation_p.Y282S|PUM1_uc001bsh.1_Missense_Mutation_p.Y469S|PUM1_uc001bsj.1_Missense_Mutation_p.Y470S|PUM1_uc010oga.1_Missense_Mutation_p.Y373S|PUM1_uc001bsk.1_Missense_Mutation_p.Y505S|PUM1_uc010ogb.1_Missense_Mutation_p.Y410S	NM_014676	NP_055491	Q14671	PUM1_HUMAN	pumilio 1 isoform 2	469	Ala-rich.				cellular membrane organization|post-Golgi vesicle-mediated transport|regulation of translation	cytosol	RNA binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		ACTGGCAGGGTAGACTCCCCA	0.517													4	34	---	---	---	---	PASS
COL9A2	1298	broad.mit.edu	37	1	40775613	40775613	+	Silent	SNP	G	A	A	rs140305893		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40775613G>A	uc001cfh.1	-	16	913	c.843C>T	c.(841-843)GAC>GAT	p.D281D	COL9A2_uc001cfi.1_Silent_p.D100D	NM_001852	NP_001843	Q14055	CO9A2_HUMAN	alpha 2 type IX collagen precursor	281	Triple-helical region 3 (COL3).				axon guidance|skeletal system development	collagen type IX				ovary(2)	2	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;2.08e-17)			GACTCACCTCGTCACCCTTCT	0.557													53	72	---	---	---	---	PASS
SLFNL1	200172	broad.mit.edu	37	1	41481770	41481770	+	3'UTR	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41481770C>T	uc001cgm.1	-	5					SLFNL1_uc009vwf.1_3'UTR|SLFNL1_uc001cgn.1_3'UTR|SLFNL1_uc009vwg.1_3'UTR	NM_144990	NP_659427	Q499Z3	SLNL1_HUMAN	schlafen-like 1								ATP binding			skin(1)	1	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Breast(333;0.1)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0393)				GCCTGCTCCCCAGGGCCCTCA	0.617													4	165	---	---	---	---	PASS
KDM4A	9682	broad.mit.edu	37	1	44169289	44169289	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44169289G>C	uc001cjx.2	+	20	3009	c.2843G>C	c.(2842-2844)AGC>ACC	p.S948T	uc001cjy.2_RNA|ST3GAL3_uc009vwu.1_5'Flank|KDM4A_uc010oki.1_Intron	NM_014663	NP_055478	O75164	KDM4A_HUMAN	jumonji domain containing 2A	948	Tudor 1.				interspecies interaction between organisms|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleolus	histone demethylase activity (H3-K36 specific)|nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|zinc ion binding			skin(1)	1						TTTCCTCAGAGCCAGGACTGT	0.532													8	227	---	---	---	---	PASS
RNF220	55182	broad.mit.edu	37	1	44878026	44878026	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44878026G>T	uc001clv.1	+	2	617	c.257G>T	c.(256-258)CGT>CTT	p.R86L	RNF220_uc001clw.1_Missense_Mutation_p.R86L	NM_018150	NP_060620	Q5VTB9	RN220_HUMAN	ring finger protein 220	86					protein autoubiquitination	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TTTGCCAATCGTGATTTCCCC	0.502													119	234	---	---	---	---	PASS
IPP	3652	broad.mit.edu	37	1	46180008	46180008	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46180008C>A	uc001cou.2	-	8	1707	c.1440G>T	c.(1438-1440)GTG>GTT	p.V480V	IPP_uc001cos.3_Silent_p.V480V	NM_005897	NP_005888	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	480	Kelch 4.					actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	Acute lymphoblastic leukemia(166;0.155)					TGAGTGCAGCCACACCAAGAT	0.428													4	73	---	---	---	---	PASS
DMRTB1	63948	broad.mit.edu	37	1	53925124	53925124	+	5'UTR	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53925124C>T	uc001cvq.1	+	1						NM_033067	NP_149056	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal,						sex differentiation	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						GCTGACCCTGCCAATGGCCGA	0.617													21	46	---	---	---	---	PASS
PCSK9	255738	broad.mit.edu	37	1	55529216	55529216	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55529216C>G	uc001cyf.1	+	12	2329	c.2038C>G	c.(2038-2040)CGG>GGG	p.R680G	PCSK9_uc010oom.1_RNA	NM_174936	NP_777596	Q8NBP7	PCSK9_HUMAN	proprotein convertase subtilisin/kexin type 9	680					cellular response to insulin stimulus|cellular response to starvation|cholesterol homeostasis|cholesterol metabolic process|kidney development|liver development|low-density lipoprotein particle receptor catabolic process|lysosomal transport|negative regulation of catalytic activity|negative regulation of low-density lipoprotein particle clearance|negative regulation of receptor recycling|neuron differentiation|positive regulation of neuron apoptosis|positive regulation of receptor internalization|protein autoprocessing|regulation of receptor activity	extracellular space|late endosome|lysosome|perinuclear region of cytoplasm	apolipoprotein receptor binding|identical protein binding|low-density lipoprotein particle receptor binding|serine-type endopeptidase activity|very-low-density lipoprotein particle receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4						CATCTGCTGCCGGAGCCGGCA	0.652													14	32	---	---	---	---	PASS
HOOK1	51361	broad.mit.edu	37	1	60314155	60314155	+	Silent	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60314155A>T	uc009wad.2	+	12	1200	c.1098A>T	c.(1096-1098)GCA>GCT	p.A366A	HOOK1_uc001czo.2_Silent_p.A366A|HOOK1_uc001czp.2_RNA|HOOK1_uc010oor.1_Silent_p.A324A	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	366	Potential.|Sufficient for interaction with microtubules.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					AAGCAAATGCAGCACGTACAC	0.308													38	78	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103471438	103471438	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103471438C>T	uc001dul.2	-	18	2119	c.1801G>A	c.(1801-1803)GGG>AGG	p.G601R	COL11A1_uc001duk.2_5'UTR|COL11A1_uc001dum.2_Missense_Mutation_p.G613R|COL11A1_uc001dun.2_Missense_Mutation_p.G562R|COL11A1_uc009weh.2_Missense_Mutation_p.G485R	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A	601	Triple-helical region.				collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CCATCAAACCCTCGATCTCCC	0.318													61	103	---	---	---	---	PASS
CELSR2	1952	broad.mit.edu	37	1	109793500	109793500	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:109793500C>T	uc001dxa.3	+	1	860	c.799C>T	c.(799-801)CCC>TCC	p.P267S		NM_001408	NP_001399	Q9HCU4	CELR2_HUMAN	cadherin EGF LAG seven-pass G-type receptor 2	267	Cadherin 1.|Extracellular (Potential).				dendrite morphogenesis|homophilic cell adhesion|neural plate anterior/posterior regionalization|neuropeptide signaling pathway|regulation of cell-cell adhesion|regulation of transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(4)|lung(3)|skin(1)	8		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCACGGCATGCCCCGACGAAG	0.597													21	45	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113637058	113637058	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113637058A>G	uc001edf.1	+	5	811	c.613A>G	c.(613-615)AGC>GGC	p.S205G	LRIG2_uc009wgn.1_Missense_Mutation_p.S102G	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	205	LRR 6.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TAACCGAATGAGCATGATTCC	0.368													3	122	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120483184	120483184	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120483184G>C	uc001eik.2	-	19	3433	c.3177C>G	c.(3175-3177)AAC>AAG	p.N1059K	NOTCH2_uc001eil.2_Missense_Mutation_p.N1059K	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein	1059	Extracellular (Potential).|EGF-like 27; calcium-binding (Potential).				anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTACCTGACAGTTTTTCCCAG	0.478			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	153	---	---	---	---	PASS
NOTCH2	4853	broad.mit.edu	37	1	120612030	120612030	+	5'UTR	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120612030C>A	uc001eik.2	-	1					NOTCH2_uc001eil.2_5'UTR|NOTCH2_uc001eim.3_5'UTR	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCTTCTCGGTCGCCTCCTCCT	0.627			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				3	12	---	---	---	---	PASS
PDE4DIP	9659	broad.mit.edu	37	1	144879561	144879561	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144879561A>G	uc001elw.3	-	27	4180	c.3889T>C	c.(3889-3891)TGT>CGT	p.C1297R	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_Missense_Mutation_p.C1253R|PDE4DIP_uc001elv.3_Missense_Mutation_p.C304R	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform	1297					cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGCTCCTCACACTCTGAAAAA	0.502			T	PDGFRB	MPD								3	127	---	---	---	---	PASS
NBPF9	400818	broad.mit.edu	37	1	145209096	145209096	+	Intron	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145209096G>A	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'Flank|NOTCH2NL_uc001emn.3_5'Flank|NOTCH2NL_uc001emm.3_5'Flank|NOTCH2NL_uc001emo.2_5'Flank|NOTCH2NL_uc010oyh.1_5'Flank			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						CGGCTGAGGCGGAAGGACACA	0.731													3	11	---	---	---	---	PASS
LINGO4	339398	broad.mit.edu	37	1	151774208	151774208	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151774208C>A	uc001ezf.1	-	2	1163	c.973G>T	c.(973-975)GCC>TCC	p.A325S		NM_001004432	NP_001004432	Q6UY18	LIGO4_HUMAN	leucine rich repeat and Ig domain containing 4	325	Extracellular (Potential).|LRR 11.					integral to membrane				large_intestine(1)	1	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGGTGGAAGGCAGTCAAGCCA	0.597													4	117	---	---	---	---	PASS
CRNN	49860	broad.mit.edu	37	1	152383038	152383038	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152383038G>A	uc001ezx.2	-	3	594	c.520C>T	c.(520-522)CAG>TAG	p.Q174*		NM_016190	NP_057274	Q9UBG3	CRNN_HUMAN	cornulin	174	Gln-rich.				cell-cell adhesion|response to heat	cytoplasm|membrane	calcium ion binding			ovary(2)|skin(1)	3	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTGGCTCTGGGACTCAGCT	0.577													136	216	---	---	---	---	PASS
LCE1A	353131	broad.mit.edu	37	1	152800058	152800058	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152800058G>T	uc010pdw.1	+	1	110	c.110G>T	c.(109-111)TGC>TTC	p.C37F		NM_178348	NP_848125	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	37	Cys-rich.				keratinization					ovary(1)|skin(1)	2	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ccccctaagtgcccTCCAGTC	0.433													31	65	---	---	---	---	PASS
DENND4B	9909	broad.mit.edu	37	1	153906318	153906318	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153906318G>A	uc001fdd.1	-	20	3372	c.2971C>T	c.(2971-2973)CGG>TGG	p.R991W	uc001fdc.1_Intron	NM_014856	NP_055671	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	991										ovary(1)	1	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGTGATCCCCGGGGTTCCAGG	0.612													17	26	---	---	---	---	PASS
RUSC1	23623	broad.mit.edu	37	1	155291733	155291733	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155291733G>A	uc001fkj.2	+	2	398	c.169G>A	c.(169-171)GGC>AGC	p.G57S	RAG1AP1_uc010pey.1_Intron|C1orf104_uc001fkh.1_5'Flank|C1orf104_uc001fki.2_Intron|RUSC1_uc001fkk.2_Missense_Mutation_p.G57S|RUSC1_uc009wqn.1_RNA|RUSC1_uc009wqo.1_5'Flank|RUSC1_uc001fkl.2_5'Flank|RUSC1_uc001fkp.2_5'Flank|RUSC1_uc001fkq.2_5'Flank|RUSC1_uc010pgb.1_5'Flank|RUSC1_uc009wqp.1_5'Flank|RUSC1_uc001fkn.2_5'Flank|RUSC1_uc001fko.2_5'Flank|RUSC1_uc001fkr.2_5'Flank	NM_001105203	NP_001098673	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1 isoform a	57						cytoplasm|nucleolus	SH3/SH2 adaptor activity			ovary(2)	2	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCCCTGCAGTGGCACCCTGGT	0.672													13	26	---	---	---	---	PASS
GON4L	54856	broad.mit.edu	37	1	155823173	155823173	+	Silent	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155823173T>C	uc001flz.2	-	2	496	c.399A>G	c.(397-399)AAA>AAG	p.K133K	GON4L_uc001fly.1_Silent_p.K133K|GON4L_uc009wrh.1_Silent_p.K133K|GON4L_uc001fma.1_Silent_p.K133K|GON4L_uc001fmc.2_Silent_p.K133K|GON4L_uc001fmd.3_Silent_p.K133K|GON4L_uc009wri.2_5'UTR	NM_001037533	NP_001032622	Q3T8J9	GON4L_HUMAN	gon-4-like isoform a	133					regulation of transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(3)	3	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGAGTGTCATTTTTTTCCCTC	0.463													9	213	---	---	---	---	PASS
ETV3L	440695	broad.mit.edu	37	1	157069063	157069063	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157069063G>T	uc001fqq.1	-	2	451	c.166C>A	c.(166-168)CAT>AAT	p.H56N		NM_001004341	NP_001004341	Q6ZN32	ETV3L_HUMAN	ets variant 3-like	56	ETS.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	Hepatocellular(266;0.158)	Prostate(1639;0.184)				GCGATGACATGGCGGAACTCT	0.592													20	43	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176661335	176661335	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176661335G>T	uc001gkz.2	+	6	3669	c.2505G>T	c.(2503-2505)CAG>CAT	p.Q835H	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	835					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TAGTCTATCAGCAGTGGACTG	0.498													71	136	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190195367	190195367	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190195367C>G	uc001gse.1	-	6	1038	c.806G>C	c.(805-807)GGA>GCA	p.G269A	FAM5C_uc010pot.1_Missense_Mutation_p.G167A	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	269						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					GATAAACTCTCCCTCTGAATT	0.443													22	61	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197091418	197091418	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197091418C>A	uc001gtu.2	-	15	3869	c.3612G>T	c.(3610-3612)GAG>GAT	p.E1204D	ASPM_uc001gtv.2_Missense_Mutation_p.E1204D|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	1204	CH 2.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTTTGTATAGCTCTGAAGTAT	0.368													13	25	---	---	---	---	PASS
GPR37L1	9283	broad.mit.edu	37	1	202092290	202092290	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202092290T>A	uc001gxj.2	+	1	262	c.199T>A	c.(199-201)TAC>AAC	p.Y67N		NM_004767	NP_004758	O60883	ETBR2_HUMAN	G-protein coupled receptor 37 like 1 precursor	67	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2						GTGGGCGGAGTACCCCCGGCC	0.672													15	7	---	---	---	---	PASS
LAX1	54900	broad.mit.edu	37	1	203743235	203743235	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203743235C>G	uc001haa.2	+	5	1033	c.623C>G	c.(622-624)TCT>TGT	p.S208C	LAX1_uc010pql.1_Missense_Mutation_p.S192C|LAX1_uc001hab.2_Missense_Mutation_p.S132C	NM_017773	NP_060243	Q8IWV1	LAX1_HUMAN	lymphocyte transmembrane adaptor 1 isoform a	208	Cytoplasmic (Potential).				B cell activation|immune response|inactivation of MAPK activity|intracellular signal transduction|negative regulation of T cell activation	Golgi apparatus|integral to membrane|plasma membrane	protein kinase binding|SH2 domain binding			central_nervous_system(2)	2	all_cancers(21;0.0915)		BRCA - Breast invasive adenocarcinoma(75;0.109)			ACTCTAGCTTCTACCAAAAGC	0.478													29	59	---	---	---	---	PASS
TRAF3IP3	80342	broad.mit.edu	37	1	209936905	209936905	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209936905G>A	uc001hho.2	+	8	965	c.675G>A	c.(673-675)CTG>CTA	p.L225L	TRAF3IP3_uc001hhl.2_Silent_p.L205L|TRAF3IP3_uc001hhm.1_Silent_p.L225L|TRAF3IP3_uc001hhn.2_Silent_p.L205L|TRAF3IP3_uc009xcr.2_Silent_p.L225L	NM_025228	NP_079504	Q9Y228	T3JAM_HUMAN	TRAF3-interacting JNK-activating modulator	225	Cytoplasmic (Potential).					integral to membrane	protein binding			large_intestine(1)|ovary(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.045)		TGTCCACTCTGATTCAGGCCT	0.473													24	34	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223567028	223567028	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223567028C>G	uc001hoa.2	+	1	314	c.211C>G	c.(211-213)CGC>GGC	p.R71G		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	71	Arg-rich.									central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		CCCGCGGCCTCGCAGGCGCGG	0.726													9	12	---	---	---	---	PASS
ACTN2	88	broad.mit.edu	37	1	236881198	236881198	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236881198G>A	uc001hyf.2	+	2	371	c.167G>A	c.(166-168)GGC>GAC	p.G56D	ACTN2_uc001hyg.2_5'UTR|ACTN2_uc009xgi.1_Missense_Mutation_p.G56D	NM_001103	NP_001094	P35609	ACTN2_HUMAN	actinin, alpha 2	56	CH 1.|Actin-binding.				focal adhesion assembly|microspike assembly|muscle filament sliding|platelet activation|platelet degranulation|protein homotetramerization|regulation of apoptosis|synaptic transmission	actin filament|cytosol|dendritic spine|extracellular region|filopodium|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|Z disc	actin binding|calcium ion binding|FATZ 1 binding|identical protein binding|integrin binding|protein dimerization activity|structural constituent of muscle|titin binding|titin Z domain binding|ZASP binding			ovary(4)|skin(1)	5	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			AGGAAAGCCGGCACCCAGATT	0.478													3	50	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240255893	240255893	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240255893G>T	uc010pyd.1	+	1	709	c.484G>T	c.(484-486)GAT>TAT	p.D162Y	FMN2_uc010pye.1_Missense_Mutation_p.D162Y	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	162					actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GATCGCCGAGGATGTGGAAAC	0.642													15	32	---	---	---	---	PASS
OR2M4	26245	broad.mit.edu	37	1	248402703	248402703	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248402703T>C	uc010pzh.1	+	1	473	c.473T>C	c.(472-474)ATA>ACA	p.I158T		NM_017504	NP_059974	Q96R27	OR2M4_HUMAN	olfactory receptor, family 2, subfamily M,	158	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			breast(2)	2	all_cancers(71;0.000124)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			GATGGGATCATAGTGCTTGCA	0.458													63	103	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525386	248525386	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525386G>T	uc001ieh.1	+	1	504	c.504G>T	c.(502-504)ATG>ATT	p.M168I		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	168	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGTCCTCATGAACCATAGGG	0.537													78	161	---	---	---	---	PASS
ASAP2	8853	broad.mit.edu	37	2	9531254	9531254	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9531254G>C	uc002qzh.2	+	23	2787	c.2447G>C	c.(2446-2448)AGC>ACC	p.S816T	ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH	816	Pro-rich.				regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						GACGGTGGAAGCCGGCAGCGA	0.448													10	162	---	---	---	---	PASS
FAM84A	151354	broad.mit.edu	37	2	14774494	14774494	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:14774494C>G	uc002rbz.1	+	2	633	c.391C>G	c.(391-393)CTG>GTG	p.L131V	FAM84A_uc002rca.1_5'Flank	NM_145175	NP_660158	Q96KN4	FA84A_HUMAN	family with sequence similarity 84, member A	131										pancreas(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)		GBM - Glioblastoma multiforme(1;0.00969)			GCTGCTGTGGCTGCAgcccgc	0.577													11	4	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21232182	21232182	+	Nonsense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21232182G>A	uc002red.2	-	26	7686	c.7558C>T	c.(7558-7560)CGA>TGA	p.R2520*		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2520					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity	p.R2520*(1)		ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	ATTCGGTCTCGTGTATCTTCT	0.428													20	39	---	---	---	---	PASS
MTA3	57504	broad.mit.edu	37	2	42871302	42871302	+	Silent	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42871302A>G	uc002rso.1	+	7	919	c.249A>G	c.(247-249)TCA>TCG	p.S83S	MTA3_uc002rsp.1_Silent_p.S83S|MTA3_uc002rsq.2_Silent_p.S139S|MTA3_uc002rsr.2_Silent_p.S139S	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	139	BAH.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ATGACCCCTCATTGAAAACAC	0.353													25	52	---	---	---	---	PASS
PLEK	5341	broad.mit.edu	37	2	68621263	68621263	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68621263C>T	uc002sen.3	+	8	1033	c.871C>T	c.(871-873)CAC>TAC	p.H291Y	PLEK_uc010fde.2_Silent_p.F289F	NM_002664	NP_002655	P08567	PLEK_HUMAN	pleckstrin	291	PH 2.				actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding			ovary(1)	1		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		GGGAGCAATTCACTTGAGAGG	0.458													65	116	---	---	---	---	PASS
PLEK	5341	broad.mit.edu	37	2	68621303	68621303	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:68621303C>T	uc002sen.3	+	8	1073	c.911C>T	c.(910-912)TCA>TTA	p.S304L	PLEK_uc010fde.2_3'UTR	NM_002664	NP_002655	P08567	PLEK_HUMAN	pleckstrin	304	PH 2.				actin cytoskeleton reorganization|cortical actin cytoskeleton organization|hemopoietic progenitor cell differentiation|inhibition of phospholipase C activity involved in G-protein coupled receptor signaling pathway|integrin-mediated signaling pathway|negative regulation of calcium-mediated signaling|negative regulation of inositol phosphate biosynthetic process|phosphatidylinositol metabolic process|platelet aggregation|positive regulation of actin filament bundle assembly|positive regulation of actin filament depolymerization|positive regulation of inositol-polyphosphate 5-phosphatase activity|positive regulation of integrin activation|positive regulation of platelet activation|protein kinase C signaling cascade|protein secretion by platelet|regulation of cell diameter|ruffle organization|thrombin receptor signaling pathway|vesicle docking involved in exocytosis	cytosol|extracellular region|membrane fraction|ruffle membrane|soluble fraction	phosphatidylinositol-3,4-bisphosphate binding|protein homodimerization activity|protein kinase C binding			ovary(1)	1		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		GAGAGCAACTCAAATGGTAAG	0.453													50	102	---	---	---	---	PASS
ANTXR1	84168	broad.mit.edu	37	2	69271902	69271902	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69271902T>C	uc002sfg.2	+	3	609	c.253T>C	c.(253-255)TTC>CTC	p.F85L	ANTXR1_uc002sfe.2_Missense_Mutation_p.F85L|ANTXR1_uc002sff.2_Missense_Mutation_p.F85L|ANTXR1_uc002sfd.2_Missense_Mutation_p.F85L	NM_032208	NP_115584	Q9H6X2	ANTR1_HUMAN	anthrax toxin receptor 1 isoform 1 precursor	85	Extracellular (Potential).|VWFA.				actin cytoskeleton reorganization|substrate adhesion-dependent cell spreading	filopodium membrane|integral to membrane|lamellipodium membrane	actin filament binding|collagen binding|metal ion binding|protein binding|transmembrane receptor activity			ovary(2)|skin(2)	4						CTTTATTGTTTTCTCCACCCG	0.453									Familial_Infantile_Hemangioma				36	86	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86361473	86361473	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86361473C>A	uc002sqw.2	+	20	1668	c.1602C>A	c.(1600-1602)CTC>CTA	p.L534L	PTCD3_uc002sqx.1_Silent_p.L124L|SNORD94_uc010fgr.1_5'Flank	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor	534						mitochondrion	protein binding			ovary(1)	1						TCCTGATGCTCATGGCAAGGG	0.448													15	37	---	---	---	---	PASS
AFF3	3899	broad.mit.edu	37	2	100209739	100209739	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:100209739T>C	uc002tag.2	-	14	2620	c.2384A>G	c.(2383-2385)AAG>AGG	p.K795R	AFF3_uc002taf.2_Missense_Mutation_p.K820R|AFF3_uc010fiq.1_Missense_Mutation_p.K795R|AFF3_uc010yvr.1_Missense_Mutation_p.K948R|AFF3_uc002tah.1_Missense_Mutation_p.K820R	NM_002285	NP_002276	P51826	AFF3_HUMAN	AF4/FMR2 family, member 3 isoform 1	795					multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)|lung(1)|kidney(1)|skin(1)	6						CTCAGAGTCCTTGGTGGCAGG	0.597													24	42	---	---	---	---	PASS
SLC9A2	6549	broad.mit.edu	37	2	103318900	103318900	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103318900C>G	uc002tca.2	+	9	1926	c.1784C>G	c.(1783-1785)TCC>TGC	p.S595C		NM_003048	NP_003039	Q9UBY0	SL9A2_HUMAN	solute carrier family 9 (sodium/hydrogen	595	Cytoplasmic (Potential).					integral to membrane|plasma membrane	sodium:hydrogen antiporter activity			central_nervous_system(3)|skin(3)|breast(2)	8						AAGGTCACGTCCAGTGAAACT	0.303													40	90	---	---	---	---	PASS
FAM123C	205147	broad.mit.edu	37	2	131519750	131519750	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131519750C>A	uc002trw.2	+	2	295	c.105C>A	c.(103-105)GGC>GGA	p.G35G	FAM123C_uc010fmv.2_Silent_p.G35G|FAM123C_uc010fms.1_Silent_p.G35G|FAM123C_uc010fmt.1_Silent_p.G35G|FAM123C_uc010fmu.1_Silent_p.G35G	NM_152698	NP_689911	Q8N944	F123C_HUMAN	hypothetical protein LOC205147	35										pancreas(2)|ovary(1)	3	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.13)		AGGGGACAGGCCCCTGGTCAG	0.617													9	7	---	---	---	---	PASS
FAP	2191	broad.mit.edu	37	2	163044862	163044862	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163044862G>T	uc002ucd.2	-	20	1839	c.1631C>A	c.(1630-1632)CCC>CAC	p.P544H	FAP_uc010fpc.2_Missense_Mutation_p.P93H|FAP_uc010zct.1_Missense_Mutation_p.P519H|FAP_uc010fpd.2_Missense_Mutation_p.P23H	NM_004460	NP_004451	Q12884	SEPR_HUMAN	fibroblast activation protein, alpha subunit	544	Extracellular (Potential).				endothelial cell migration|negative regulation of extracellular matrix disassembly|proteolysis	cell junction|integral to membrane|invadopodium membrane|lamellipodium membrane	dipeptidyl-peptidase activity|metalloendopeptidase activity|protein homodimerization activity|serine-type endopeptidase activity			ovary(3)	3						CTGACTGCAGGGACCACCATA	0.403													25	26	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170044654	170044654	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170044654C>A	uc002ues.2	-	49	9367	c.9154G>T	c.(9154-9156)GAT>TAT	p.D3052Y		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3052	LDL-receptor class A 24.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TTATCCTCATCACAGACGAAG	0.512													51	73	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179400049	179400049	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179400049C>T	uc010zfg.1	-	307	93813	c.93589G>A	c.(93589-93591)GAA>AAA	p.E31197K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E24892K|TTN_uc010zfi.1_Missense_Mutation_p.E24825K|TTN_uc010zfj.1_Missense_Mutation_p.E24700K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	32124							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTTATTTTCAGCTATTACC	0.423													69	117	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179418006	179418006	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179418006C>G	uc010zfg.1	-	284	82141	c.81917G>C	c.(81916-81918)AGA>ACA	p.R27306T	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R21001T|TTN_uc010zfi.1_Missense_Mutation_p.R20934T|TTN_uc010zfj.1_Missense_Mutation_p.R20809T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	28233							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTCATCTTTTCTCCATGTGAC	0.428													88	143	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	186672270	186672270	+	Intron	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:186672270A>G	uc002upm.2	+						uc010zfu.1_Silent_p.E577E					Homo sapiens cDNA FLJ44048 fis, clone TESTI4030669.																		ATGATGATGAAATTATTCAAT	0.333													6	188	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189975051	189975051	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189975051T>C	uc002uqk.2	-	2	497	c.222A>G	c.(220-222)ATA>ATG	p.I74M		NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	74	VWFC.				axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			CCTGGCATTCTATCTTGTCAC	0.507													42	64	---	---	---	---	PASS
FZD7	8324	broad.mit.edu	37	2	202900175	202900175	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202900175C>A	uc002uyw.1	+	1	866	c.805C>A	c.(805-807)CTC>ATC	p.L269I		NM_003507	NP_003498	O75084	FZD7_HUMAN	frizzled 7 precursor	269	Helical; Name=1; (Potential).				axonogenesis|brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|G-protein signaling, coupled to cGMP nucleotide second messenger|gonad development|mesenchymal to epithelial transition|negative regulation of cell-substrate adhesion|negative regulation of ectodermal cell fate specification|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of phosphorylation|positive regulation of transcription, DNA-dependent|regulation of catenin import into nucleus|vasculature development|Wnt receptor signaling pathway, calcium modulating pathway	apical part of cell|cytoplasm|integral to membrane|neuron projection membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			skin(2)|ovary(1)|breast(1)	4						CGCCTCGACGCTCTTTACCGT	0.642											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	194	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	206041301	206041301	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206041301G>C	uc002var.1	+	13	2131	c.1924G>C	c.(1924-1926)GGT>CGT	p.G642R	PARD3B_uc010fub.1_Missense_Mutation_p.G642R|PARD3B_uc002vao.1_Missense_Mutation_p.G642R|PARD3B_uc002vap.1_Missense_Mutation_p.G580R|PARD3B_uc002vaq.1_Missense_Mutation_p.G642R	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	642					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CAAACAGAAAGGTAAGAGTCT	0.353													11	38	---	---	---	---	PASS
UNC80	285175	broad.mit.edu	37	2	210642034	210642034	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210642034C>A	uc010zjc.1	+	4	431	c.351C>A	c.(349-351)CAC>CAA	p.H117Q	UNC80_uc002vdj.1_Missense_Mutation_p.H117Q	NM_032504	NP_115893	Q8N2C7	UNC80_HUMAN	chromosome 2 open reading frame 21 isoform 1	117						integral to membrane					0						ACACTCTACACTGGATGCTTC	0.542													40	89	---	---	---	---	PASS
TMBIM1	64114	broad.mit.edu	37	2	219143279	219143279	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219143279G>C	uc002vho.1	-	7	1158	c.432C>G	c.(430-432)TTC>TTG	p.F144L	PNKD_uc002vhn.2_Intron|TMBIM1_uc002vhp.1_Missense_Mutation_p.F144L|TMBIM1_uc010zjz.1_5'UTR|TMBIM1_uc010zka.1_Missense_Mutation_p.F33L	NM_022152	NP_071435	Q969X1	TMBI1_HUMAN	transmembrane BAX inhibitor motif containing 1	144	Helical; (Potential).					integral to membrane					0		Renal(207;0.0474)		Epithelial(149;8.56e-07)|all cancers(144;0.000154)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGTGACAACGAAGACAGCAC	0.587													29	36	---	---	---	---	PASS
TTLL4	9654	broad.mit.edu	37	2	219609911	219609911	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219609911C>T	uc002viy.2	+	6	2111	c.1741C>T	c.(1741-1743)CCC>TCC	p.P581S	TTLL4_uc010zkl.1_Missense_Mutation_p.P416S|TTLL4_uc010fvx.2_Missense_Mutation_p.P581S|TTLL4_uc010zkm.1_5'Flank	NM_014640	NP_055455	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	581					protein polyglutamylation	cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity			ovary(2)|skin(1)	3		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		CAGTCTCTTTCCCAACGTTCC	0.493													63	119	---	---	---	---	PASS
SLC4A3	6508	broad.mit.edu	37	2	220501117	220501117	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220501117T>C	uc002vmp.3	+	15	2554	c.2285T>C	c.(2284-2286)CTG>CCG	p.L762P	SLC4A3_uc002vmo.3_Missense_Mutation_p.L789P|SLC4A3_uc010fwm.2_Missense_Mutation_p.L312P|SLC4A3_uc010fwn.1_Missense_Mutation_p.L271P	NM_005070	NP_005061	P48751	B3A3_HUMAN	solute carrier family 4, anion exchanger, member	762	Helical; (Potential).|Membrane (anion exchange).				bicarbonate transport	integral to plasma membrane|membrane fraction	inorganic anion exchanger activity			ovary(2)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	5		Renal(207;0.0183)		Epithelial(149;2.53e-07)|all cancers(144;5.57e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCTCAGCCGCTGCTTGTGGTT	0.617													37	38	---	---	---	---	PASS
C2orf52	151477	broad.mit.edu	37	2	232374028	232374028	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232374028C>A	uc002vrx.1	-	3	391	c.63G>T	c.(61-63)AGG>AGT	p.R21S		NR_024079				RecName: Full=Uncharacterized protein C2orf52;												0		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;5.72e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)		TGGTATTCTTCCTGCAATTCT	0.478													45	63	---	---	---	---	PASS
SEPT2	4735	broad.mit.edu	37	2	242274555	242274555	+	Nonsense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242274555G>T	uc002wbc.2	+	5	566	c.145G>T	c.(145-147)GGA>TGA	p.G49*	SEPT2_uc002wbd.2_Nonsense_Mutation_p.G49*|SEPT2_uc002wbf.2_Nonsense_Mutation_p.G49*|SEPT2_uc002wbg.2_Nonsense_Mutation_p.G49*|SEPT2_uc002wbh.2_Nonsense_Mutation_p.G49*|SEPT2_uc010zop.1_Nonsense_Mutation_p.G84*	NM_001008491	NP_001008491	Q15019	SEPT2_HUMAN	septin 2	49	GTP.				cell division|mitosis	actin cytoskeleton|cleavage furrow|condensed chromosome kinetochore|midbody|nucleolus|septin complex|spindle	GTP binding			central_nervous_system(1)	1		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		ATCAGGTCTAGGAAAATCGAC	0.289													7	31	---	---	---	---	PASS
FARP2	9855	broad.mit.edu	37	2	242371150	242371150	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242371150G>A	uc002wbi.1	+	9	945	c.828G>A	c.(826-828)AAG>AAA	p.K276K	FARP2_uc010zoq.1_Silent_p.K276K|FARP2_uc010zor.1_Silent_p.K276K	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	276	FERM.				axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TAAGCTTCAAGAGGAAAAGAT	0.299													40	55	---	---	---	---	PASS
CYP8B1	1582	broad.mit.edu	37	3	42916392	42916392	+	Missense_Mutation	SNP	C	T	T	rs148690797		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:42916392C>T	uc003cmh.2	-	1	1242	c.917G>A	c.(916-918)CGG>CAG	p.R306Q	CCBP2_uc003cmd.1_Intron|CCBP2_uc003cmg.2_Intron|CYP8B1_uc010hif.2_Missense_Mutation_p.R306Q	NM_004391	NP_004382	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B,	306					bile acid biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity|electron carrier activity|heme binding|oxygen binding|sterol 12-alpha-hydroxylase activity			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		CCTCACAGCCCGAATAGCTTC	0.587													11	9	---	---	---	---	PASS
CCR2	729230	broad.mit.edu	37	3	46399319	46399319	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46399319T>C	uc003cpn.3	+	2	786	c.301T>C	c.(301-303)TCT>CCT	p.S101P	CCR2_uc003cpm.3_Missense_Mutation_p.S101P	NM_001123041	NP_001116513	P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2 isoform A	101	Extracellular (Potential).				astrocyte cell migration|blood vessel remodeling|cellular defense response|chemokine-mediated signaling pathway|dendritic cell chemotaxis|elevation of cytosolic calcium ion concentration|immune response|inflammatory response|interspecies interaction between organisms|JAK-STAT cascade|monocyte extravasation|negative regulation of adenylate cyclase activity|negative regulation of angiogenesis|negative regulation of eosinophil degranulation|negative regulation of type 2 immune response|positive regulation of alpha-beta T cell proliferation|positive regulation of immune complex clearance by monocytes and macrophages|positive regulation of inflammatory response|positive regulation of interferon-gamma production|positive regulation of interleukin-2 production|positive regulation of monocyte chemotaxis|positive regulation of T cell chemotaxis|positive regulation of T cell extravasation|positive regulation of T-helper 1 type immune response|positive regulation of tumor necrosis factor biosynthetic process|regulation of vascular endothelial growth factor production|T-helper 17 cell chemotaxis	cytosol|dendrite|integral to plasma membrane|perikaryon|perinuclear region of cytoplasm|soluble fraction	C-C chemokine receptor activity|CCR2 chemokine receptor binding|protein homodimerization activity			lung(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		GTGGGCTCACTCTGCTGCAAA	0.433													111	170	---	---	---	---	PASS
ALS2CL	259173	broad.mit.edu	37	3	46724759	46724759	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46724759C>A	uc003cqa.1	-	10	1160	c.970G>T	c.(970-972)GAC>TAC	p.D324Y	ALS2CL_uc003cpz.1_5'Flank|ALS2CL_uc003cqb.1_Missense_Mutation_p.D324Y|ALS2CL_uc003cqc.1_RNA	NM_147129	NP_667340	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like isoform 1	324					endosome organization|regulation of Rho protein signal transduction		GTPase activator activity|identical protein binding|Rho guanyl-nucleotide exchange factor activity			breast(2)|central_nervous_system(2)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		ACGGGGAAGTCCTTCTTCCCA	0.667													14	9	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47142990	47142990	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47142990G>A	uc003cqs.2	-	8	5026	c.4973C>T	c.(4972-4974)TCA>TTA	p.S1658L	SETD2_uc003cqv.2_Missense_Mutation_p.S1725L	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1658	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTCTGAGCCTGAAGGAACCAG	0.378			N|F|S|Mis		clear cell renal carcinoma								90	71	---	---	---	---	PASS
SLC25A20	788	broad.mit.edu	37	3	48895967	48895967	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48895967C>T	uc003cva.3	-	8	991	c.816G>A	c.(814-816)GTG>GTA	p.V272V	SLC25A20_uc011bbw.1_Silent_p.V222V|SLC25A20_uc010hkj.2_Silent_p.V199V	NM_000387	NP_000378	O43772	MCAT_HUMAN	carnitine/acylcarnitine translocase	272	Solcar 3.|Helical; Name=6; (Potential).				carnitine shuttle|cellular lipid metabolic process|regulation of fatty acid oxidation	integral to membrane|mitochondrial inner membrane	acyl carnitine transporter activity				0				BRCA - Breast invasive adenocarcinoma(193;0.000168)|Kidney(197;0.00231)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)	L-Carnitine(DB00583)	CTCGGATCATCACTGCATTGA	0.537													50	32	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65365050	65365050	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65365050C>T	uc003dmn.2	-	17	3407	c.2881G>A	c.(2881-2883)GTG>ATG	p.V961M	MAGI1_uc003dmm.2_Missense_Mutation_p.V989M|MAGI1_uc003dmo.2_Missense_Mutation_p.V989M|MAGI1_uc003dmp.2_Missense_Mutation_p.V961M|MAGI1_uc003dmq.1_RNA|MAGI1_uc010hnx.1_Missense_Mutation_p.V272M	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	989	PDZ 5.|Interaction with FCHSD2.				cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		GTGCTGACCAcgccgctgccc	0.493													13	6	---	---	---	---	PASS
CRYBG3	131544	broad.mit.edu	37	3	97611834	97611834	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97611834G>A	uc003drx.2	+	8	1791	c.1727G>A	c.(1726-1728)GGA>GAA	p.G576E		NM_153605	NP_705833			beta-gamma crystallin domain containing 3												0						GTCATTGGTGGAGTGTGAGTA	0.318													41	103	---	---	---	---	PASS
OR5H2	79310	broad.mit.edu	37	3	98002463	98002463	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98002463C>A	uc003dsj.1	+	1	732	c.732C>A	c.(730-732)TCC>TCA	p.S244S		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	244	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						AAGCCTTTTCCACCTGTGGAG	0.403													28	87	---	---	---	---	PASS
CLDND1	56650	broad.mit.edu	37	3	98240031	98240031	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98240031G>A	uc003dsp.2	-	2	1118	c.238C>T	c.(238-240)CGG>TGG	p.R80W	CLDND1_uc003dso.2_Missense_Mutation_p.R80W|CLDND1_uc003dsq.2_Missense_Mutation_p.R80W|CLDND1_uc003dss.2_Missense_Mutation_p.R80W|CLDND1_uc003dsr.2_Intron|CLDND1_uc003dst.2_Missense_Mutation_p.R103W|CLDND1_uc003dsu.2_Missense_Mutation_p.R80W|CLDND1_uc003dsv.2_Missense_Mutation_p.R80W	NM_019895	NP_063948	Q9NY35	CLDN1_HUMAN	claudin domain containing 1 protein isoform a	80						integral to membrane				ovary(1)	1						GTGATACACCGTCTCCACAAT	0.383													53	131	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114070355	114070355	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114070355C>T	uc003ebi.2	-	4	750	c.570G>A	c.(568-570)ACG>ACA	p.T190T	ZBTB20_uc003ebj.2_Silent_p.T117T|ZBTB20_uc010hqp.2_Silent_p.T117T|ZBTB20_uc003ebk.2_Silent_p.T117T|ZBTB20_uc003ebl.2_Silent_p.T117T|ZBTB20_uc003ebm.2_Silent_p.T117T|ZBTB20_uc003ebn.2_Silent_p.T117T|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	190					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		ACACGATGCGCGTGCACTCGT	0.637													22	65	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	129137108	129137108	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129137108C>T	uc003emg.2	-	3	833	c.670G>A	c.(670-672)GCT>ACT	p.A224T		NM_207307	NP_997190			hypothetical protein LOC90288																		GCCTTTACAGCCGCGATGAAC	0.562													33	24	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134851892	134851892	+	Splice_Site	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134851892G>C	uc003eqt.2	+	5	1517	c.1297_splice	c.e5+1	p.A433_splice	EPHB1_uc003equ.2_Splice_Site	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor							integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						AACCAAGCCGGTAAGTCTGGA	0.567													13	43	---	---	---	---	PASS
EPHB1	2047	broad.mit.edu	37	3	134881015	134881015	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134881015G>T	uc003eqt.2	+	7	1798	c.1578G>T	c.(1576-1578)CTG>CTT	p.L526L	EPHB1_uc003equ.2_Silent_p.L87L	NM_004441	NP_004432	P54762	EPHB1_HUMAN	ephrin receptor EphB1 precursor	526	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity|protein binding			lung(11)|ovary(6)|stomach(4)|breast(3)|central_nervous_system(2)|skin(2)|large_intestine(1)|pancreas(1)	30						TCCAGACTCTGACTGACGGTA	0.557													25	69	---	---	---	---	PASS
ATR	545	broad.mit.edu	37	3	142241604	142241604	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142241604C>A	uc003eux.3	-	23	4354	c.4232G>T	c.(4231-4233)AGC>ATC	p.S1411I		NM_001184	NP_001175	Q13535	ATR_HUMAN	ataxia telangiectasia and Rad3 related protein	1411					cell cycle|cellular response to gamma radiation|cellular response to UV|DNA damage checkpoint|DNA repair|DNA replication|multicellular organismal development|negative regulation of DNA replication|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|protein autophosphorylation|replicative senescence	PML body	ATP binding|DNA binding|MutLalpha complex binding|MutSalpha complex binding|protein serine/threonine kinase activity			lung(5)|skin(5)|breast(4)|ovary(3)|stomach(1)|central_nervous_system(1)|liver(1)	20						TTGAGCTCGGCTATTATCAGC	0.358								Other_conserved_DNA_damage_response_genes					83	233	---	---	---	---	PASS
SLITRK3	22865	broad.mit.edu	37	3	164906519	164906519	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164906519G>A	uc003fej.3	-	2	2544	c.2100C>T	c.(2098-2100)GGC>GGT	p.G700G	SLITRK3_uc003fek.2_Silent_p.G700G	NM_014926	NP_055741	O94933	SLIK3_HUMAN	slit and trk like 3 protein precursor	700	Cytoplasmic (Potential).					integral to membrane				ovary(6)|skin(3)|pancreas(1)	10						GCATTTGGATGCCAGTAAGGT	0.453										HNSCC(40;0.11)			33	63	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168807873	168807873	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168807873T>C	uc003ffi.3	-	14	3021	c.2752A>G	c.(2752-2754)ACA>GCA	p.T918A	MECOM_uc010hwk.1_Missense_Mutation_p.T932A|MECOM_uc003ffj.3_Missense_Mutation_p.T983A|MECOM_uc011bpi.1_Missense_Mutation_p.T910A|MECOM_uc003ffn.3_Missense_Mutation_p.T918A|MECOM_uc003ffk.2_Missense_Mutation_p.T909A|MECOM_uc003ffl.2_Missense_Mutation_p.T1069A|MECOM_uc011bpj.1_Missense_Mutation_p.T1106A|MECOM_uc011bpk.1_Missense_Mutation_p.T908A	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	918	Asp/Glu-rich (acidic).				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AAATTACTTGTCACTGGTTCC	0.433													58	207	---	---	---	---	PASS
MECOM	2122	broad.mit.edu	37	3	168807874	168807874	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:168807874C>A	uc003ffi.3	-	14	3020	c.2751G>T	c.(2749-2751)GTG>GTT	p.V917V	MECOM_uc010hwk.1_Silent_p.V931V|MECOM_uc003ffj.3_Silent_p.V982V|MECOM_uc011bpi.1_Silent_p.V909V|MECOM_uc003ffn.3_Silent_p.V917V|MECOM_uc003ffk.2_Silent_p.V908V|MECOM_uc003ffl.2_Silent_p.V1068V|MECOM_uc011bpj.1_Silent_p.V1105V|MECOM_uc011bpk.1_Silent_p.V907V	NM_005241	NP_005232	Q03112	EVI1_HUMAN	MDS1 and EVI1 complex locus isoform b	917	Asp/Glu-rich (acidic).				apoptosis|cell differentiation|hemopoietic stem cell proliferation|negative regulation of JNK cascade|negative regulation of programmed cell death|negative regulation of transcription, DNA-dependent|regulation of cell cycle	nuclear speck	DNA binding|protein binding|protein homodimerization activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(5)|skin(5)|upper_aerodigestive_tract(1)|central_nervous_system(1)|ovary(1)|pancreas(1)	14						AATTACTTGTCACTGGTTCCT	0.433													59	207	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184100484	184100484	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184100484C>A	uc003fov.2	+	8	1150	c.904C>A	c.(904-906)CTG>ATG	p.L302M	CHRD_uc003fow.2_Translation_Start_Site|CHRD_uc003fox.2_Missense_Mutation_p.L302M|CHRD_uc003foy.2_Translation_Start_Site|CHRD_uc010hyc.2_Translation_Start_Site|CHRD_uc011brr.1_Translation_Start_Site	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	302	CHRD 2.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			GGGCATCACCCTGCTCACTCT	0.592													89	67	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197431510	197431510	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197431510G>T	uc003fyc.2	-	4	549	c.366C>A	c.(364-366)GCC>GCA	p.A122A	KIAA0226_uc003fyd.3_Silent_p.A62A|KIAA0226_uc003fye.1_5'Flank|KIAA0226_uc003fyf.2_5'UTR|KIAA0226_uc003fyg.2_Silent_p.A115A	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	122	RUN.				autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GCCACAGCTCGGCAACAGCAC	0.557													4	91	---	---	---	---	PASS
ARAP2	116984	broad.mit.edu	37	4	36135012	36135012	+	Splice_Site	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:36135012C>T	uc003gsq.1	-	20	3602	c.3264_splice	c.e20-1	p.R1088_splice		NM_015230	NP_056045	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH						regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytosol	ARF GTPase activator activity|phosphatidylinositol-3,4,5-trisphosphate binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						GTATAATGTTCTGTAAAGTTT	0.338													21	9	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55958788	55958788	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55958788C>G	uc003has.2	-	22	3367	c.3065G>C	c.(3064-3066)CGA>CCA	p.R1022P	KDR_uc003hat.1_Missense_Mutation_p.R1022P	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	1022	Protein kinase.|Cytoplasmic (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	TCTTACCTTTCGCGATGCCAA	0.458			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			17	19	---	---	---	---	PASS
CDS1	1040	broad.mit.edu	37	4	85530642	85530642	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85530642G>A	uc011ccv.1	+	3	804	c.306G>A	c.(304-306)CTG>CTA	p.L102L		NM_001263	NP_001254	Q92903	CDS1_HUMAN	CDP-diacylglycerol synthase 1	102	Helical; (Potential).				signal transduction|visual perception	endoplasmic reticulum membrane|integral to membrane	diacylglycerol cholinephosphotransferase activity|phosphatidate cytidylyltransferase activity			large_intestine(2)|ovary(1)|breast(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		TGTTTTTCCTGATCATCTATA	0.343													50	29	---	---	---	---	PASS
LEF1	51176	broad.mit.edu	37	4	109002749	109002749	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:109002749T>C	uc003hyt.1	-	6	1370	c.715A>G	c.(715-717)ATG>GTG	p.M239V	LEF1_uc011cfj.1_Intron|LEF1_uc011cfk.1_Intron|LEF1_uc003hyu.1_Intron|LEF1_uc003hyv.1_Intron|LEF1_uc010imb.1_RNA|LEF1_uc003hyw.1_5'Flank	NM_016269	NP_057353	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1 isoform 1	239	Pro-rich.				canonical Wnt receptor signaling pathway|cell chemotaxis|cellular response to interleukin-4|epithelial to mesenchymal transition|histone H3 acetylation|histone H4 acetylation|negative regulation of apoptosis in bone marrow|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cell-cell adhesion|negative regulation of DNA binding|negative regulation of estrogen receptor binding|negative regulation of interleukin-13 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of transcription, DNA-dependent|neutrophil differentiation|osteoblast differentiation|palate development|positive regulation by host of viral transcription|positive regulation of cell cycle process|positive regulation of cell growth|positive regulation of cell migration|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of cell proliferation in bone marrow|positive regulation of cell-cell adhesion|positive regulation of epithelial to mesenchymal transition|positive regulation of granulocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|T-helper 1 cell differentiation	cytoplasm|protein-DNA complex|transcription factor complex	armadillo repeat domain binding|beta-catenin binding|C2H2 zinc finger domain binding|caspase inhibitor activity|DNA bending activity|enhancer binding|estrogen receptor activity|estrogen receptor binding|gamma-catenin binding|histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding			large_intestine(1)	1				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		TACCTGGACATGGAAGTGTCG	0.557													17	6	---	---	---	---	PASS
ALPK1	80216	broad.mit.edu	37	4	113351678	113351678	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113351678G>A	uc003iap.3	+	11	1254	c.975G>A	c.(973-975)CTG>CTA	p.L325L	ALPK1_uc003ian.3_Silent_p.L325L|ALPK1_uc011cfx.1_Silent_p.L247L|ALPK1_uc003iao.3_Intron|ALPK1_uc010imo.2_Silent_p.L153L	NM_025144	NP_079420	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	325							ATP binding|protein serine/threonine kinase activity			ovary(5)	5		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		ACTTACATCTGTGTGAAGCCA	0.428													30	17	---	---	---	---	PASS
LARP7	51574	broad.mit.edu	37	4	113565913	113565913	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:113565913C>T	uc003iay.2	+	2	366	c.88C>T	c.(88-90)CGA>TGA	p.R30*	LARP7_uc003iaz.2_Nonsense_Mutation_p.R37*|LARP7_uc003iba.2_Translation_Start_Site|LARP7_uc003ibb.2_Nonsense_Mutation_p.R30*	NM_016648	NP_057732	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7	30	HTH La-type RNA-binding.				RNA processing	nucleoplasm|ribonucleoprotein complex	nucleotide binding|RNA binding			ovary(3)	3		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		GAAACGGTCACGAGTTAAACA	0.373													4	69	---	---	---	---	PASS
MIR1243	100302188	broad.mit.edu	37	4	114028028	114028028	+	RNA	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114028028G>T	hsa-mir-1243|MI0006373	+			c.10G>T			ANK2_uc003ibd.3_Intron|ANK2_uc003ibe.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc003ibc.2_Intron|ANK2_uc011cgb.1_Intron																	0						ACTAAAACTGGATCAATTATA	0.348													18	14	---	---	---	---	PASS
SYNPO2	171024	broad.mit.edu	37	4	119979008	119979008	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:119979008G>T	uc010inb.2	+	5	3901	c.3705G>T	c.(3703-3705)ATG>ATT	p.M1235I	SYNPO2_uc011cgh.1_3'UTR|SYNPO2_uc010inc.2_Missense_Mutation_p.M1105I	NM_133477	NP_597734	Q9UMS6	SYNP2_HUMAN	synaptopodin 2 isoform a	Error:Variant_position_missing_in_Q9UMS6_after_alignment						nucleus|Z disc	14-3-3 protein binding|actin binding|muscle alpha-actinin binding			ovary(2)	2						TCATGTCCATGGAAACCAGGT	0.433													35	30	---	---	---	---	PASS
PRDM5	11107	broad.mit.edu	37	4	121616416	121616416	+	Silent	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:121616416A>T	uc003idn.2	-	16	1993	c.1743T>A	c.(1741-1743)GCT>GCA	p.A581A	PRDM5_uc003ido.2_Silent_p.A550A|PRDM5_uc010ine.2_3'UTR	NM_018699	NP_061169	Q9NQX1	PRDM5_HUMAN	PR domain containing 5	581	C2H2-type 15.				histone deacetylation|histone H3-K9 methylation|mitotic cell cycle|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	repressing transcription factor binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			central_nervous_system(1)|pancreas(1)	2						TCAGGCTAAAAGCCAAATCAC	0.358													25	14	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151773702	151773702	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151773702T>C	uc010ipj.2	-	23	3634	c.3160A>G	c.(3160-3162)ATA>GTA	p.I1054V	LRBA_uc003ilt.3_5'Flank|LRBA_uc003ilu.3_Missense_Mutation_p.I1054V	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1054						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					GCTTCTATTATGTCAGAAGAT	0.373													37	23	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183713537	183713537	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183713537C>A	uc003ivd.1	+	25	5749	c.5712C>A	c.(5710-5712)ACC>ACA	p.T1904T		NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1904	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		CCATGCAGACCATCCGATCCA	0.542													36	16	---	---	---	---	PASS
EXOC3	11336	broad.mit.edu	37	5	447756	447756	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:447756G>T	uc003jba.2	+	3	381	c.253G>T	c.(253-255)GAC>TAC	p.D85Y		NM_007277	NP_009208	O60645	EXOC3_HUMAN	Sec6 protein	96					exocytosis|protein transport						0		Ovarian(839;0.0563)	Epithelial(17;0.000529)|OV - Ovarian serous cystadenocarcinoma(19;0.00153)|all cancers(22;0.00186)|Lung(60;0.0863)			CGTCAGCAAGGACTGGAGGCA	0.602													5	8	---	---	---	---	PASS
TRIO	7204	broad.mit.edu	37	5	14498619	14498619	+	Intron	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14498619G>A	uc003jff.2	+						TRIO_uc003jfg.2_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					GTTCCCATCTGTGCCGCAGTG	0.577													10	29	---	---	---	---	PASS
PAIP1	10605	broad.mit.edu	37	5	43535076	43535076	+	Intron	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43535076T>C	uc003job.2	-						PAIP1_uc003joa.2_Intron|PAIP1_uc010ivp.2_Intron|PAIP1_uc010ivo.2_Intron|PAIP1_uc003joc.2_Intron	NM_006451	NP_006442	Q9H074	PAIP1_HUMAN	poly(A) binding protein interacting protein 1						mRNA stabilization|nuclear-transcribed mRNA poly(A) tail shortening|translational initiation	cytosol	protein binding|RNA binding|translation activator activity			ovary(1)	1	Lung NSC(6;2.07e-05)					TACATCTCTGTAGACAAAGTT	0.393													23	40	---	---	---	---	PASS
PCDHA3	56145	broad.mit.edu	37	5	140182847	140182847	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140182847C>A	uc003lhf.2	+	1	2065	c.2065C>A	c.(2065-2067)CCG>ACG	p.P689T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA2_uc011czy.1_Intron|PCDHA3_uc011czz.1_Missense_Mutation_p.P689T	NM_018906	NP_061729	Q9Y5H8	PCDA3_HUMAN	protocadherin alpha 3 isoform 1 precursor	689	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(6)|skin(2)	8			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGCCACGGGCCCGGAAGCTGC	0.632													47	17	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140208462	140208462	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208462C>T	uc003lho.2	+	1	813	c.786C>T	c.(784-786)ATC>ATT	p.I262I	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Silent_p.I262I|PCDHA6_uc011dab.1_Silent_p.I262I	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	262	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACAGTTATCAGACTGAATG	0.413													10	73	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140801892	140801892	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140801892G>T	uc003lkq.1	+	1	1356	c.1098G>T	c.(1096-1098)GTG>GTT	p.V366V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Silent_p.V366V|PCDHGA11_uc003lkp.1_Silent_p.V366V	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	366	Extracellular (Potential).|Cadherin 4.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGGTACAGTGATTGCTCTTC	0.373													3	31	---	---	---	---	PASS
NR3C1	2908	broad.mit.edu	37	5	142680225	142680225	+	Silent	SNP	C	A	A	rs138266608		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:142680225C>A	uc003lmz.2	-	5	2064	c.1572G>T	c.(1570-1572)ACG>ACT	p.T524T	NR3C1_uc003lmy.2_Silent_p.T525T|NR3C1_uc003lna.2_Silent_p.T524T|NR3C1_uc003lnb.2_Silent_p.T524T|NR3C1_uc011dbk.1_Silent_p.T127T|NR3C1_uc003lnc.2_Silent_p.T524T|NR3C1_uc003lnd.2_Silent_p.T524T|NR3C1_uc003lne.2_Silent_p.T524T|NR3C1_uc003lnf.2_Silent_p.T525T	NM_000176	NP_000167	P04150	GCR_HUMAN	glucocorticoid receptor isoform alpha	524	Hinge.				chromatin modification|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus|transcription from RNA polymerase II promoter	mitochondrial matrix|nucleoplasm	glucocorticoid receptor activity|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|zinc ion binding			ovary(2)	2		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Amcinonide(DB00288)|Betamethasone(DB00443)|Budesonide(DB01222)|Dexamethasone(DB01234)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluticasone Propionate(DB00588)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol Etabonate(DB00873)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Prednisone(DB00635)	GTTGTGGTAACGTTGCAGGAA	0.413													62	50	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176696631	176696631	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176696631C>T	uc003mfr.3	+	16	5470	c.5332C>T	c.(5332-5334)CGA>TGA	p.R1778*	NSD1_uc003mft.3_Nonsense_Mutation_p.R1509*|NSD1_uc003mfs.1_Nonsense_Mutation_p.R1675*|NSD1_uc011dfx.1_Nonsense_Mutation_p.R1426*	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1778	PWWP 2.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTGCCATCCTCGAGCTGTTCC	0.468			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			45	16	---	---	---	---	PASS
TMED9	54732	broad.mit.edu	37	5	177019318	177019318	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177019318G>A	uc003mhx.2	+	1	106	c.103G>A	c.(103-105)GGA>AGA	p.G35R	TMED9_uc010jko.2_RNA	NM_017510	NP_059980	Q9BVK6	TMED9_HUMAN	transmembrane emp24 protein transport domain	35					transport	endoplasmic reticulum membrane|ER-Golgi intermediate compartment|integral to membrane					0	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCGACGCGCGGAAGCGCGCT	0.657													3	2	---	---	---	---	PASS
BTNL9	153579	broad.mit.edu	37	5	180486569	180486569	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180486569G>T	uc003mmt.2	+	11	1546	c.1315G>T	c.(1315-1317)GCG>TCG	p.A439S		NM_152547	NP_689760	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9 precursor	439	Cytoplasmic (Potential).|B30.2/SPRY.					integral to membrane				ovary(1)|central_nervous_system(1)	2	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCACCGCGTCGCGCTCACCCT	0.726													11	14	---	---	---	---	PASS
ZNF193	7746	broad.mit.edu	37	6	28200375	28200375	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28200375C>T	uc003nkq.1	+	4	719	c.604C>T	c.(604-606)CTA>TTA	p.L202L	ZNF193_uc003nkr.1_Silent_p.L202L|ZNF193_uc010jqz.1_Silent_p.L253L	NM_006299	NP_006290	O15535	ZN193_HUMAN	zinc finger protein 193	202					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						AGAGTTGGTGCTAAGGAAAGA	0.453													22	44	---	---	---	---	PASS
LTA	4049	broad.mit.edu	37	6	31541240	31541240	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31541240T>C	uc011dnu.1	+	4	601	c.388T>C	c.(388-390)TAC>CAC	p.Y130H	LTA_uc003nue.1_Missense_Mutation_p.Y130H|LTA_uc003nuf.2_Intron|LTA_uc003nuh.2_Intron|LTA_uc003nug.2_Intron|LTA_uc010jsr.2_Intron|TNF_uc003nui.2_5'Flank	NM_001159740	NP_001153212	P01374	TNFB_HUMAN	lymphotoxin alpha precursor	130					cell-cell signaling|induction of apoptosis|signal transduction	extracellular space|membrane	cytokine activity|tumor necrosis factor receptor binding				0					Etanercept(DB00005)	CTCCCCACTCTACCTGGCCCA	0.587													101	28	---	---	---	---	PASS
C6orf10	10665	broad.mit.edu	37	6	32261554	32261554	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32261554C>A	uc011dpy.1	-	12	1069	c.896G>T	c.(895-897)GGA>GTA	p.G299V	C6orf10_uc011dpx.1_Missense_Mutation_p.G81V	NM_006781	NP_006772	Q5SRN2	CF010_HUMAN	chromosome 6 open reading frame 10	299						integral to membrane				skin(1)	1						TTTTGGTATTCCAGCGTCACT	0.408													228	78	---	---	---	---	PASS
COL19A1	1310	broad.mit.edu	37	6	70909315	70909315	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70909315G>A	uc003pfc.1	+	49	3215	c.3098G>A	c.(3097-3099)AGG>AAG	p.R1033K		NM_001858	NP_001849	Q14993	COJA1_HUMAN	alpha 1 type XIX collagen precursor	1033					cell differentiation|cell-cell adhesion|extracellular matrix organization|skeletal system development	collagen	extracellular matrix structural constituent|protein binding, bridging			ovary(2)|breast(2)	4						CATGAAGAGAGGATGGCTGTA	0.393													50	20	---	---	---	---	PASS
MANEA	79694	broad.mit.edu	37	6	96054135	96054135	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96054135G>C	uc003poo.1	+	5	1383	c.1243G>C	c.(1243-1245)GTT>CTT	p.V415L		NM_024641	NP_078917	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	415	Catalytic (Probable).|Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	glycoprotein endo-alpha-1,2-mannosidase activity			ovary(2)|breast(1)	3		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		TGAAAAAGCTGTTCCCAAAAG	0.413													43	18	---	---	---	---	PASS
PEX7	5191	broad.mit.edu	37	6	137187869	137187869	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137187869G>C	uc003qhd.2	+	6	733	c.631G>C	c.(631-633)GAG>CAG	p.E211Q	PEX7_uc010kgx.2_RNA	NM_000288	NP_000279	O00628	PEX7_HUMAN	peroxisomal biogenesis factor 7	211	WD 4.				ether lipid biosynthetic process|protein import into peroxisome matrix	peroxisome	peroxisome matrix targeting signal-2 binding				0	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000257)|OV - Ovarian serous cystadenocarcinoma(155;0.00492)		TAAATACAATGAGGTATAGTG	0.403													10	38	---	---	---	---	PASS
PDE10A	10846	broad.mit.edu	37	6	165829708	165829708	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165829708G>C	uc003qun.2	-	13	1271	c.1030C>G	c.(1030-1032)CCA>GCA	p.P344A	PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Missense_Mutation_p.P274A|PDE10A_uc003quo.2_Missense_Mutation_p.P354A	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2	344	GAF 2.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	TAGGCATCTGGAATGTTCAGG	0.413													86	40	---	---	---	---	PASS
RPS6KA2	6196	broad.mit.edu	37	6	166918039	166918039	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166918039T>A	uc003qvb.1	-	6	740	c.521A>T	c.(520-522)CAT>CTT	p.H174L	RPS6KA2_uc011ego.1_Missense_Mutation_p.H85L|RPS6KA2_uc010kkl.1_Missense_Mutation_p.H85L|RPS6KA2_uc003qvc.1_Missense_Mutation_p.H182L|RPS6KA2_uc003qvd.1_Missense_Mutation_p.H199L	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	174	Protein kinase 1.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		GCTGTGGAGATGGTCTAAAGC	0.433													60	16	---	---	---	---	PASS
RPS6KA2	6196	broad.mit.edu	37	6	166918040	166918040	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166918040G>T	uc003qvb.1	-	6	739	c.520C>A	c.(520-522)CAT>AAT	p.H174N	RPS6KA2_uc011ego.1_Missense_Mutation_p.H85N|RPS6KA2_uc010kkl.1_Missense_Mutation_p.H85N|RPS6KA2_uc003qvc.1_Missense_Mutation_p.H182N|RPS6KA2_uc003qvd.1_Missense_Mutation_p.H199N	NM_021135	NP_066958	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide	174	Protein kinase 1.				axon guidance|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|stress-activated MAPK cascade|synaptic transmission|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(2)|lung(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		CTGTGGAGATGGTCTAAAGCC	0.433													60	16	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6031654	6031654	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6031654T>C	uc003spl.2	-	9	1025	c.938A>G	c.(937-939)TAT>TGT	p.Y313C	PMS2_uc003spj.2_Missense_Mutation_p.Y207C|PMS2_uc003spk.2_Missense_Mutation_p.Y178C|PMS2_uc011jwl.1_Missense_Mutation_p.Y178C|PMS2_uc010ktg.2_Missense_Mutation_p.Y2C|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Missense_Mutation_p.Y313C	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	313					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GTGTCGATTATACATGTGGTA	0.398			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				12	29	---	---	---	---	PASS
RAC1	5879	broad.mit.edu	37	7	6431584	6431584	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6431584T>G	uc003spx.2	+	3	378	c.137T>G	c.(136-138)GTA>GGA	p.V46G	RAC1_uc003spw.2_Missense_Mutation_p.V46G	NM_006908	NP_008839	P63000	RAC1_HUMAN	ras-related C3 botulinum toxin substrate 1	46					actin filament polymerization|apoptosis|axon guidance|cell motility|cell-matrix adhesion|induction of apoptosis by extracellular signals|inflammatory response|lamellipodium assembly|localization within membrane|negative regulation of interleukin-23 production|negative regulation of receptor-mediated endocytosis|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of lamellipodium assembly|positive regulation of Rho protein signal transduction|regulation of cell migration|regulation of defense response to virus by virus|regulation of hydrogen peroxide metabolic process|regulation of respiratory burst|ruffle organization|small GTPase mediated signal transduction|T cell costimulation|viral reproduction	cytosol|melanosome|plasma membrane	GTP binding|GTP-dependent protein binding|GTPase activity|thioesterase binding			lung(2)	2		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.104)	Pravastatin(DB00175)|Simvastatin(DB00641)	AATGTTATGGTAGATGGAAAA	0.433													26	68	---	---	---	---	PASS
C7orf26	79034	broad.mit.edu	37	7	6639817	6639817	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6639817G>T	uc003sqo.1	+	4	938	c.938G>T	c.(937-939)CGC>CTC	p.R313L	C7orf26_uc003sqp.1_Missense_Mutation_p.R216L|C7orf26_uc003sqq.1_Missense_Mutation_p.R114L	NM_024067	NP_076972	Q96N11	CG026_HUMAN	hypothetical protein LOC79034	313										ovary(1)	1		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		CTGTATGGGCGCCTGGGGCTG	0.572													10	31	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21939723	21939723	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21939723G>A	uc003svc.2	+	82	13340	c.13309G>A	c.(13309-13311)GGA>AGA	p.G4437R		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4437					microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						ATACCTCCACGGACTCTTCAT	0.483									Kartagener_syndrome				19	40	---	---	---	---	PASS
GHRHR	2692	broad.mit.edu	37	7	31009500	31009500	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31009500G>T	uc003tbx.2	+	4	335	c.287G>T	c.(286-288)TGT>TTT	p.C96F	GHRHR_uc003tbw.1_Missense_Mutation_p.C96F|GHRHR_uc003tby.2_Missense_Mutation_p.C32F|GHRHR_uc003tbz.2_5'UTR	NM_000823	NP_000814	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	96	Extracellular (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation|positive regulation of growth hormone secretion|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of multicellular organism growth|response to estrogen stimulus|response to glucocorticoid stimulus	cell surface|integral to membrane|nuclear inner membrane|nuclear matrix|nuclear outer membrane|plasma membrane|stored secretory granule	growth factor binding|growth hormone-releasing hormone receptor activity|peptide hormone binding			ovary(2)|lung(1)|breast(1)|large_intestine(1)	5					Sermorelin(DB00010)	AAACGGGATTGTACTATCACT	0.597													68	99	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38289084	38289084	+	5'UTR	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38289084G>A	uc003tfu.3	-	2					uc003tfv.2_5'UTR|uc003tfw.2_RNA|uc003tfx.1_RNA|uc003tfz.1_RNA					SubName: Full=TARP protein;																		AGAAGACAAAGGTATGTTCCA	0.413													98	200	---	---	---	---	PASS
FAM183B	340286	broad.mit.edu	37	7	38725441	38725441	+	3'UTR	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38725441C>A	uc011kbd.1	-	2						NR_028347				Homo sapiens cDNA FLJ42138 fis, clone TESTI2036684.												0						GGTTATCATGCCAAGACATAG	0.527													35	87	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507617	44507617	+	Intron	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507617C>T	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						CCCAGAGGCACTGACAACAGG	0.468													6	355	---	---	---	---	PASS
NUDCD3	23386	broad.mit.edu	37	7	44507678	44507678	+	Intron	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44507678G>A	uc003tkz.2	-						NUDCD3_uc010kye.2_Intron	NM_015332	NP_056147	Q8IVD9	NUDC3_HUMAN	NudC domain containing 3												0						TTGGTTATGGGAGCAACAAAA	0.478													5	326	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73811475	73811475	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73811475G>T	uc003uam.2	+	14	3119	c.2792G>T	c.(2791-2793)AGC>ATC	p.S931I	CLIP2_uc003uan.2_Missense_Mutation_p.S896I	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	931	Potential.					microtubule associated complex				skin(3)	3						AGGGACCTGAGCCGTGAGGTA	0.622													31	56	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88965368	88965368	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88965368C>G	uc011khi.1	+	4	3610	c.3072C>G	c.(3070-3072)AAC>AAG	p.N1024K		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1024						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATTGTGATAACCATCTTTCTA	0.333										HNSCC(36;0.09)			18	38	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92760528	92760528	+	3'UTR	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92760528T>C	uc003umh.1	-	5					SAMD9L_uc003umj.1_3'UTR|SAMD9L_uc003umi.1_3'UTR|SAMD9L_uc010lfb.1_3'UTR|SAMD9L_uc003umk.1_3'UTR|SAMD9L_uc010lfc.1_3'UTR|SAMD9L_uc010lfd.1_3'UTR	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like											ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TGATGTATTGTCTTAAATTAC	0.353													18	30	---	---	---	---	PASS
CALCR	799	broad.mit.edu	37	7	93067382	93067382	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93067382G>A	uc003umv.1	-	12	1283	c.1022C>T	c.(1021-1023)GCG>GTG	p.A341V	CALCR_uc011kia.1_Missense_Mutation_p.A121V|CALCR_uc003ums.1_RNA|CALCR_uc003umt.1_RNA|CALCR_uc003umu.1_Missense_Mutation_p.A307V|CALCR_uc003umw.2_Missense_Mutation_p.A307V	NM_001742	NP_001733	P30988	CALCR_HUMAN	calcitonin receptor isoform 2 precursor	323	Helical; Name=5; (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|elevation of cytosolic calcium ion concentration|positive regulation of adenylate cyclase activity|response to glucocorticoid stimulus	integral to plasma membrane	calcitonin binding|calcitonin binding|calcitonin receptor activity|calcitonin receptor activity|protein binding			ovary(3)|lung(3)|skin(2)|pancreas(1)	9	all_cancers(62;3.18e-12)|all_epithelial(64;1.34e-11)|Breast(17;0.000675)|Lung NSC(181;0.207)		STAD - Stomach adenocarcinoma(171;0.000244)		Salmon Calcitonin(DB00017)	CACAAGTGCCGCCATGACAGG	0.348													12	19	---	---	---	---	PASS
COL1A2	1278	broad.mit.edu	37	7	94049586	94049586	+	Silent	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94049586T>A	uc003ung.1	+	35	2592	c.2121T>A	c.(2119-2121)CCT>CCA	p.P707P	COL1A2_uc011kib.1_Intron|COL1A2_uc010lfi.1_Intron	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor	707			Missing (in OI2A).|Missing (in OI2A).		axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ctgctggtcctCGGGGAAGCC	0.353										HNSCC(75;0.22)			43	65	---	---	---	---	PASS
CYP3A4	1576	broad.mit.edu	37	7	99367429	99367429	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99367429C>T	uc003urv.1	-	6	587	c.483G>A	c.(481-483)AGG>AGA	p.R161R	CYP3A4_uc003urw.1_Silent_p.R161R|CYP3A4_uc011kiz.1_Silent_p.R120R|CYP3A4_uc011kja.1_Silent_p.R112R|CYP3A4_uc011kjb.1_Intron	NM_017460	NP_059488	P08684	CP3A4_HUMAN	cytochrome P450, family 3, subfamily A,	161					alkaloid catabolic process|androgen metabolic process|exogenous drug catabolic process|heterocycle metabolic process|monoterpenoid metabolic process|oxidative demethylation|steroid catabolic process|xenobiotic metabolic process	cell surface|endoplasmic reticulum membrane|integral to membrane|microsome	albendazole monooxygenase activity|caffeine oxidase activity|electron carrier activity|enzyme binding|heme binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen|oxygen binding|quinine 3-monooxygenase activity|steroid binding|taurochenodeoxycholate 6alpha-hydroxylase activity|testosterone 6-beta-hydroxylase activity|vitamin D 24-hydroxylase activity|vitamin D3 25-hydroxylase activity			central_nervous_system(3)|ovary(1)	4	Lung NSC(181;0.0144)|Esophageal squamous(72;0.0166)|all_lung(186;0.0228)				Albendazole(DB00518)|Alclometasone(DB00240)|Alfentanil(DB00802)|Alfuzosin(DB00346)|Aliskiren(DB01258)|Almotriptan(DB00918)|Alosetron(DB00969)|Alprazolam(DB00404)|Amlodipine(DB00381)|Amprenavir(DB00701)|Aprepitant(DB00673)|Aripiprazole(DB01238)|Astemizole(DB00637)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Benazepril(DB00542)|Bepridil(DB01244)|Betamethasone(DB00443)|Bexarotene(DB00307)|Bortezomib(DB00188)|Bosentan(DB00559)|Bromocriptine(DB01200)|Budesonide(DB01222)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Buspirone(DB00490)|Busulfan(DB01008)|Carbamazepine(DB00564)|Cevimeline(DB00185)|Chlorpheniramine(DB01114)|Ciclesonide(DB01410)|Cilostazol(DB01166)|Cinacalcet(DB01012)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clindamycin(DB01190)|Clofibrate(DB00636)|Clonazepam(DB01068)|Clopidogrel(DB00758)|Cocaine(DB00907)|Conivaptan(DB00872)|Conjugated Estrogens(DB00286)|Cyproterone(DB04839)|Darifenacin(DB00496)|Darunavir(DB01264)|Dasatinib(DB01254)|Delavirdine(DB00705)|Desogestrel(DB00304)|Dexamethasone(DB01234)|Diazepam(DB00829)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dofetilide(DB00204)|Dolasetron(DB00757)|Domperidone(DB01184)|Donepezil(DB00843)|Doxorubicin(DB00997)|Drospirenone(DB01395)|Dutasteride(DB01126)|Efavirenz(DB00625)|Eletriptan(DB00216)|Enalapril(DB00584)|Epirubicin(DB00445)|Eplerenone(DB00700)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Escitalopram(DB01175)|Esomeprazole(DB00736)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Ethosuximide(DB00593)|Etonogestrel(DB00294)|Etoposide(DB00773)|Etoricoxib(DB01628)|Exemestane(DB00990)|Felodipine(DB01023)|Fentanyl(DB00813)|Fexofenadine(DB00950)|Finasteride(DB01216)|Fluconazole(DB00196)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Flurandrenolide(DB00846)|Fluticasone Propionate(DB00588)|Fosamprenavir(DB01319)|Fulvestrant(DB00947)|Galantamine(DB00674)|Gefitinib(DB00317)|Gemfibrozil(DB01241)|Granisetron(DB00889)|Grepafloxacin(DB00365)|Halofantrine(DB01218)|Hydrocodone(DB00956)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Hydromorphone(DB00327)|Imatinib(DB00619)|Indinavir(DB00224)|Ipratropium(DB00332)|Irinotecan(DB00762)|Isosorbide Dinitrate(DB00883)|Isosorbide Mononitrate(DB01020)|Isradipine(DB00270)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Letrozole(DB01006)|Levobupivacaine(DB01002)|Levomethadyl Acetate(DB01227)|Levothyroxine(DB00451)|Lomustine(DB01206)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Maraviroc(DB04835)|Marinol(DB00470)|Mebendazole(DB00643)|Medroxyprogesterone(DB00603)|Methadone(DB00333)|Methylprednisolone(DB00959)|Metyrapone(DB01011)|Mibefradil(DB01388)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirtazapine(DB00370)|Modafinil(DB00745)|Mometasone(DB00764)|Montelukast(DB00471)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norgestrel(DB00506)|Nystatin(DB00646)|Ondansetron(DB00904)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Paricalcitol(DB00910)|Phenmetrazine(DB00830)|Pimecrolimus(DB00337)|Pimozide(DB01100)|Pioglitazone(DB01132)|Posaconazole(DB01263)|Pranlukast(DB01411)|Prednisolone(DB00860)|Prednisone(DB00635)|Prochlorperazine(DB00433)|Quetiapine(DB01224)|Quinapril(DB00881)|Quinine(DB00468)|Rabeprazole(DB01129)|Ranolazine(DB00243)|Reboxetine(DB00234)|Retapamulin(DB01256)|Rifabutin(DB00615)|Rifampin(DB01045)|Rimonabant(DB06155)|Ritonavir(DB00503)|Rofecoxib(DB00533)|Roxithromycin(DB00778)|Salmeterol(DB00938)|Saquinavir(DB01232)|Sertindole(DB06144)|Sibutramine(DB01105)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|Solifenacin(DB01591)|Sorafenib(DB00398)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tadalafil(DB00820)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Terconazole(DB00251)|Terfenadine(DB00342)|Testosterone(DB00624)|Tiagabine(DB00906)|Ticlopidine(DB00208)|Tinidazole(DB00911)|Tiotropium(DB01409)|Tipranavir(DB00932)|Toremifene(DB00539)|Triazolam(DB00897)|Trimetrexate(DB01157)|Troglitazone(DB00197)|Valdecoxib(DB00580)|Vardenafil(DB00862)|Vinblastine(DB00570)|Vincristine(DB00541)|Vindesine(DB00309)|Vinorelbine(DB00361)|Voriconazole(DB00582)|Zaleplon(DB00962)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolpidem(DB00425)|Zonisamide(DB00909)	CTGCTTCCCGCCTCAGATTTC	0.507													60	122	---	---	---	---	PASS
COG5	10466	broad.mit.edu	37	7	106897209	106897209	+	Intron	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106897209C>T	uc003ved.2	-						COG5_uc003vec.2_Missense_Mutation_p.A604T|COG5_uc003vee.2_Missense_Mutation_p.A604T	NM_181733	NP_859422	Q9UP83	COG5_HUMAN	component of oligomeric golgi complex 5 isoform						intra-Golgi vesicle-mediated transport|protein transport	cytosol|Golgi membrane|Golgi transport complex|nucleus	protein binding			central_nervous_system(2)|skin(2)	4						TGCTCAGCTGCCAGTGGGAAT	0.343													14	34	---	---	---	---	PASS
DLD	1738	broad.mit.edu	37	7	107542181	107542181	+	Splice_Site	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107542181A>G	uc003vet.2	+	3	229	c.119_splice	c.e3-2	p.I40_splice	DLD_uc010ljm.1_Splice_Site|DLD_uc011kmg.1_Splice_Site_p.I40_splice|DLD_uc011kmh.1_Splice_Site_p.I40_splice|DLD_uc011kmi.1_Intron	NM_000108	NP_000099	P09622	DLDH_HUMAN	dihydrolipoamide dehydrogenase precursor						branched chain family amino acid catabolic process|cell redox homeostasis|lysine catabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate|tricarboxylic acid cycle	mitochondrial matrix	dihydrolipoyl dehydrogenase activity			central_nervous_system(1)	1					NADH(DB00157)	CTTTTATCGTAGTTGATGCTG	0.353													29	64	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111487045	111487045	+	Intron	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111487045A>G	uc003vfx.2	-						DOCK4_uc003vfw.2_Intron|DOCK4_uc003vfy.2_Intron	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				TATGACCTGTATTTACTTACT	0.398													31	73	---	---	---	---	PASS
RNF133	168433	broad.mit.edu	37	7	122338572	122338572	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122338572C>G	uc003vkj.1	-	1	637	c.401G>C	c.(400-402)GGT>GCT	p.G134A	CADPS2_uc010lkp.2_Intron|CADPS2_uc010lkq.2_Intron	NM_139175	NP_631914	Q8WVZ7	RN133_HUMAN	ring finger protein 133	134	PA.					endoplasmic reticulum membrane|integral to membrane	ligase activity|zinc ion binding			skin(1)	1						GTTGCCAGTACCTGGAACGTT	0.428													51	108	---	---	---	---	PASS
FLNC	2318	broad.mit.edu	37	7	128496897	128496897	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128496897C>A	uc003vnz.3	+	45	7692	c.7483C>A	c.(7483-7485)CGC>AGC	p.R2495S	FLNC_uc003voa.3_Missense_Mutation_p.R2462S	NM_001458	NP_001449	Q14315	FLNC_HUMAN	gamma filamin isoform a	2495	Filamin 22.|Interaction with INPPL1.				cell junction assembly	cytoskeleton|cytosol|plasma membrane|sarcomere	actin binding			breast(5)|large_intestine(3)|ovary(2)|central_nervous_system(1)|skin(1)	12						CTTCAAGATCCGCGTTGGGGA	0.617													22	54	---	---	---	---	PASS
TSGA14	95681	broad.mit.edu	37	7	130040572	130040572	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130040572C>T	uc003vpz.2	-	9	780	c.733G>A	c.(733-735)GAA>AAA	p.E245K	TSGA14_uc003vpy.2_Missense_Mutation_p.E7K|TSGA14_uc010lmf.2_Missense_Mutation_p.E42K|TSGA14_uc003vqa.2_Missense_Mutation_p.E245K|TSGA14_uc011kpg.1_Missense_Mutation_p.E229K	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14	245	Rhodanese.				G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					AAGAGGTTTTCAAATCCACGC	0.502													12	21	---	---	---	---	PASS
TSGA14	95681	broad.mit.edu	37	7	130042478	130042478	+	Intron	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130042478C>T	uc003vpz.2	-						TSGA14_uc003vpy.2_5'Flank|TSGA14_uc010lmf.2_Intron|TSGA14_uc003vqa.2_Intron|TSGA14_uc011kpg.1_Intron	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14						G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					TTAAAGCCTTCTCTCTCTTAC	0.493													47	97	---	---	---	---	PASS
TSGA14	95681	broad.mit.edu	37	7	130042480	130042480	+	Intron	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:130042480C>T	uc003vpz.2	-						TSGA14_uc003vpy.2_5'Flank|TSGA14_uc010lmf.2_Intron|TSGA14_uc003vqa.2_Intron|TSGA14_uc011kpg.1_Intron	NM_018718	NP_061188	Q9BYV8	CEP41_HUMAN	testis specific, 14						G2/M transition of mitotic cell cycle	centrosome|cytosol					0	Melanoma(18;0.0435)					AAAGCCTTCTCTCTCTTACCT	0.498													48	99	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131870117	131870117	+	Silent	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131870117G>C	uc003vra.3	-	16	3328	c.3099C>G	c.(3097-3099)GTC>GTG	p.V1033V		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1033	IPT/TIG 2.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						CATACTGAAAGACCAGGTCCT	0.547													45	81	---	---	---	---	PASS
AKR1D1	6718	broad.mit.edu	37	7	137773401	137773401	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137773401C>A	uc003vtz.2	+	2	217	c.148C>A	c.(148-150)CGA>AGA	p.R50R	AKR1D1_uc011kqb.1_Silent_p.R50R|AKR1D1_uc011kqc.1_RNA|AKR1D1_uc011kqd.1_Intron|AKR1D1_uc011kqe.1_Silent_p.R50R|AKR1D1_uc011kqf.1_Silent_p.R50R	NM_005989	NP_005980	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	50					androgen metabolic process|bile acid biosynthetic process|bile acid catabolic process|C21-steroid hormone metabolic process|cholesterol catabolic process|digestion	cytosol	aldo-keto reductase (NADP) activity|delta4-3-oxosteroid 5beta-reductase activity|steroid binding			skin(1)	1						CACAGGGTACCGACATATTGA	0.488													25	40	---	---	---	---	PASS
REPIN1	29803	broad.mit.edu	37	7	150069034	150069034	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150069034C>A	uc010lpq.1	+	4	1193	c.704C>A	c.(703-705)CCC>CAC	p.P235H	REPIN1_uc003whd.2_Missense_Mutation_p.P224H|REPIN1_uc010lpr.1_Missense_Mutation_p.P292H|REPIN1_uc003whc.2_Missense_Mutation_p.P235H|REPIN1_uc003whe.2_Missense_Mutation_p.P235H	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	235					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GTCGACCGCCCCTTCCAGTGT	0.527													16	26	---	---	---	---	PASS
ARHGEF10	9639	broad.mit.edu	37	8	1828220	1828220	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1828220C>G	uc003wpr.2	+	9	1028	c.850C>G	c.(850-852)CAT>GAT	p.H284D	ARHGEF10_uc003wpq.1_Missense_Mutation_p.H309D|ARHGEF10_uc003wps.2_Intron|ARHGEF10_uc003wpt.2_Intron|ARHGEF10_uc003wpv.2_Intron|ARHGEF10_uc010lre.2_5'Flank	NM_014629	NP_055444	O15013	ARHGA_HUMAN	Rho guanine nucleotide exchange factor 10	309	Potential.				centrosome duplication|myelination in peripheral nervous system|positive regulation of GTP catabolic process|positive regulation of stress fiber assembly|regulation of Rho protein signal transduction|spindle assembly involved in mitosis	centrosome|cytosol|soluble fraction	kinesin binding|Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1		Colorectal(14;3.46e-05)|Renal(68;0.000518)|Ovarian(12;0.00409)|Myeloproliferative disorder(644;0.0255)|Hepatocellular(245;0.0834)		COAD - Colon adenocarcinoma(149;1.62e-05)|BRCA - Breast invasive adenocarcinoma(11;1.68e-05)|KIRC - Kidney renal clear cell carcinoma(542;0.00361)|READ - Rectum adenocarcinoma(644;0.0718)		GTAGCTTTCTCATGACCTAAC	0.458													30	51	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16012606	16012606	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16012606C>G	uc003wwz.2	-	6	1063	c.865G>C	c.(865-867)GAA>CAA	p.E289Q	MSR1_uc010lsu.2_Missense_Mutation_p.E307Q|MSR1_uc003wxa.2_Missense_Mutation_p.E289Q|MSR1_uc003wxb.2_Missense_Mutation_p.E289Q|MSR1_uc011kxz.1_Missense_Mutation_p.E63Q	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	289	Collagen-like.|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		GGACCACTTTCTCCAGTGGGA	0.403													43	37	---	---	---	---	PASS
EBF2	64641	broad.mit.edu	37	8	25897621	25897621	+	Intron	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25897621T>C	uc003xes.1	-						PPP2R2A_uc003xek.2_Intron|EBF2_uc003xet.1_Intron	NM_022659	NP_073150	Q9HAK2	COE2_HUMAN	early B-cell factor 2						multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|metal ion binding			ovary(3)|skin(1)	4		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		CGATGGGCTGTGAAGGAGGTA	0.542													43	32	---	---	---	---	PASS
EPHX2	2053	broad.mit.edu	37	8	27373843	27373843	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27373843G>T	uc003xfu.2	+	8	919	c.838G>T	c.(838-840)GCT>TCT	p.A280S	EPHX2_uc010lut.1_Missense_Mutation_p.A280S|EPHX2_uc010luu.2_Missense_Mutation_p.A248S|EPHX2_uc010luv.2_Missense_Mutation_p.A214S|EPHX2_uc003xfv.2_Missense_Mutation_p.A227S|EPHX2_uc010luw.2_Missense_Mutation_p.A214S|EPHX2_uc011lam.1_Missense_Mutation_p.A136S	NM_001979	NP_001970	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	280	Epoxide hydrolase.				aromatic compound catabolic process|cellular calcium ion homeostasis|drug metabolic process|inflammatory response|positive regulation of vasodilation|reactive oxygen species metabolic process|regulation of blood pressure|response to toxin|xenobiotic metabolic process	cytosol|focal adhesion|Golgi apparatus|nucleolus|peroxisome|soluble fraction	epoxide hydrolase activity|metal ion binding|protein homodimerization activity			ovary(1)	1		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)	Tamoxifen(DB00675)	CTAGATCCCTGCTCTGGCCCA	0.542											OREG0018668	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	178	---	---	---	---	PASS
NRG1	3084	broad.mit.edu	37	8	32505416	32505416	+	Intron	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32505416G>A	uc003xiv.2	+						NRG1_uc003xip.2_Intron|NRG1_uc003xir.2_Intron|NRG1_uc010lvl.2_Intron|NRG1_uc010lvm.2_Intron|NRG1_uc010lvn.2_Intron|NRG1_uc003xis.2_Intron|NRG1_uc011lbf.1_Intron|NRG1_uc010lvo.2_Intron|NRG1_uc003xiu.2_Intron|NRG1_uc003xiw.2_Intron|NRG1_uc003xit.2_Intron|NRG1_uc010lvr.2_Intron|NRG1_uc010lvs.2_Intron|NRG1_uc010lvp.2_Intron|NRG1_uc010lvq.2_Intron|NRG1_uc003xix.2_Intron|NRG1_uc003xiy.2_Silent_p.A60A|NRG1_uc010lvt.2_Silent_p.A60A	NM_013964	NP_039258	Q02297	NRG1_HUMAN	neuregulin 1 isoform HRG-alpha						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		CCTGCTGTGCGTGCCTAGAAG	0.607													5	53	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48719804	48719804	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48719804G>T	uc003xqi.2	-	70	9698	c.9641C>A	c.(9640-9642)CCC>CAC	p.P3214H	PRKDC_uc003xqj.2_Missense_Mutation_p.P3214H|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	3214	FAT.				cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				CCTGTCACTGGGGTCTCCATC	0.428								NHEJ					52	108	---	---	---	---	PASS
CA13	377677	broad.mit.edu	37	8	86193528	86193528	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:86193528C>T	uc003ydg.2	+	7	1081	c.739C>T	c.(739-741)CGC>TGC	p.R247C	CA13_uc003ydf.1_Intron	NM_198584	NP_940986	Q8N1Q1	CAH13_HUMAN	carbonic anhydrase XIII	247					one-carbon metabolic process		carbonate dehydratase activity|zinc ion binding				0						GAGCAATCACCGCCCACCACA	0.498													123	202	---	---	---	---	PASS
MATN2	4147	broad.mit.edu	37	8	98973728	98973728	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98973728G>A	uc003yic.2	+	5	1159	c.928G>A	c.(928-930)GCC>ACC	p.A310T	MATN2_uc003yib.1_Missense_Mutation_p.A310T|MATN2_uc010mbh.1_Missense_Mutation_p.A310T|MATN2_uc003yid.2_Missense_Mutation_p.A310T|MATN2_uc003yie.1_Missense_Mutation_p.A310T|MATN2_uc010mbi.1_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor	310	EGF-like 2.					proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			CAGTGGCTACGCCCTGGCTGA	0.582													37	50	---	---	---	---	PASS
NIPAL2	79815	broad.mit.edu	37	8	99248401	99248401	+	Nonsense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99248401T>A	uc003yil.1	-	4	674	c.418A>T	c.(418-420)AGA>TGA	p.R140*	NIPAL2_uc011lgw.1_5'UTR|NIPAL2_uc003yim.1_Nonsense_Mutation_p.R140*	NM_024759	NP_079035	Q9H841	NPAL2_HUMAN	NIPA-like domain containing 2	140						integral to membrane					0						TCTGAGGCTCTCAAATTGTCT	0.313													21	36	---	---	---	---	PASS
FBXO43	286151	broad.mit.edu	37	8	101146192	101146192	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101146192C>G	uc003yjd.2	-	5	2678	c.1965G>C	c.(1963-1965)AGG>AGC	p.R655S	FBXO43_uc003yje.2_Missense_Mutation_p.R621S	NM_001029860	NP_001025031	Q4G163	FBX43_HUMAN	F-box protein 43 isoform b	655	IBR-type.				meiosis		zinc ion binding			kidney(1)|skin(1)	2	all_cancers(14;0.000139)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000274)|all_lung(17;0.000798)		Epithelial(11;1.17e-09)|all cancers(13;1.34e-07)|OV - Ovarian serous cystadenocarcinoma(57;3.82e-05)|STAD - Stomach adenocarcinoma(118;0.0957)			TACACAGTCCCCTTTTCTTAT	0.453													43	65	---	---	---	---	PASS
SPAG1	6674	broad.mit.edu	37	8	101245659	101245659	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101245659T>G	uc003yjh.1	+	16	2095	c.2009T>G	c.(2008-2010)CTG>CGG	p.L670R	SPAG1_uc003yji.1_Missense_Mutation_p.L670R	NM_172218	NP_757367	Q07617	SPAG1_HUMAN	sperm associated antigen 1	670	TPR 8.				single fertilization	cytoplasm	GTP binding|hydrolase activity			ovary(2)|central_nervous_system(1)	3	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		TACTTGAAGCTGTGCCAGTTT	0.423													46	53	---	---	---	---	PASS
RNF19A	25897	broad.mit.edu	37	8	101281076	101281076	+	Silent	SNP	A	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101281076A>C	uc003yjj.1	-	6	1445	c.1128T>G	c.(1126-1128)GCT>GCG	p.A376A	RNF19A_uc003yjk.1_Silent_p.A376A	NM_015435	NP_056250	Q9NV58	RN19A_HUMAN	ring finger protein 19	376	Helical; (Potential).				microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CAGCTATTAAAGCGATTCCGA	0.438													48	91	---	---	---	---	PASS
KLF10	7071	broad.mit.edu	37	8	103662514	103662514	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103662514G>A	uc011lhk.1	-	4	1443	c.1289C>T	c.(1288-1290)GCG>GTG	p.A430V	KLF10_uc011lhj.1_Missense_Mutation_p.A419V	NM_005655	NP_005646	Q13118	KLF10_HUMAN	Kruppel-like factor 10 isoform a	430	C2H2-type 3.				cell proliferation|cell-cell signaling|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|skeletal system development|transforming growth factor beta receptor signaling pathway	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			CATGGGGCACGCAAATTTCTT	0.532													36	77	---	---	---	---	PASS
RSPO2	340419	broad.mit.edu	37	8	109001416	109001416	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109001416C>G	uc003yms.2	-	3	809	c.151G>C	c.(151-153)GGG>CGG	p.G51R	RSPO2_uc003ymq.2_5'UTR|RSPO2_uc003ymr.2_Intron	NM_178565	NP_848660	Q6UXX9	RSPO2_HUMAN	R-spondin family, member 2 precursor	51					Wnt receptor signaling pathway	extracellular region	heparin binding			skin(3)|ovary(2)|pancreas(1)|lung(1)	7			OV - Ovarian serous cystadenocarcinoma(57;1.55e-09)			CGGCTACACCCATTGTCCTTT	0.413													37	49	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113326189	113326189	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113326189G>T	uc003ynu.2	-	49	7801	c.7642C>A	c.(7642-7644)CAG>AAG	p.Q2548K	CSMD3_uc003yns.2_Missense_Mutation_p.Q1750K|CSMD3_uc003ynt.2_Missense_Mutation_p.Q2508K|CSMD3_uc011lhx.1_Missense_Mutation_p.Q2444K|CSMD3_uc003ynw.1_Missense_Mutation_p.Q259K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2548	CUB 14.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GCTGACCACTGAAGAAATACT	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			35	66	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	114326923	114326923	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:114326923C>T	uc003ynu.2	-	2	437	c.278G>A	c.(277-279)TGG>TAG	p.W93*	CSMD3_uc003ynt.2_Nonsense_Mutation_p.W53*|CSMD3_uc011lhx.1_Nonsense_Mutation_p.W93*|CSMD3_uc010mcx.1_Nonsense_Mutation_p.W93*|CSMD3_uc003ynx.3_Nonsense_Mutation_p.W93*	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	93	Extracellular (Potential).|CUB 1.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TATTATTACCCATGTGCAGTT	0.343										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			87	122	---	---	---	---	PASS
FAM49B	51571	broad.mit.edu	37	8	130861552	130861552	+	Silent	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130861552A>G	uc003yss.2	-	13	1326	c.777T>C	c.(775-777)GGT>GGC	p.G259G	FAM49B_uc003yst.2_Silent_p.G259G|FAM49B_uc003ysu.2_Silent_p.G259G|FAM49B_uc003ysv.2_Silent_p.G113G|FAM49B_uc003ysw.2_Silent_p.G259G|FAM49B_uc003ysx.2_Silent_p.G259G|FAM49B_uc003ysy.1_Silent_p.G259G	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571	259											0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			GTATTATGACACCCACCATTA	0.358													23	57	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139180146	139180146	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139180146G>A	uc003yuy.2	-	12	1421	c.1250C>T	c.(1249-1251)CCT>CTT	p.P417L	FAM135B_uc003yux.2_Missense_Mutation_p.P318L|FAM135B_uc003yuz.2_RNA	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	417										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ACCTGTCGCAGGGCAGTCCAC	0.507										HNSCC(54;0.14)			60	88	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144943648	144943648	+	Silent	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144943648G>C	uc003zaa.1	-	1	3787	c.3774C>G	c.(3772-3774)GCC>GCG	p.A1258A		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	1258	Plectin 21.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TGCTGGCCTTGGCCCCAGAGG	0.711													13	24	---	---	---	---	PASS
JAK2	3717	broad.mit.edu	37	9	5070053	5070053	+	Splice_Site	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:5070053G>T	uc010mhm.2	+	11	1754	c.1641_splice	c.e11+1	p.F547_splice	JAK2_uc003ziw.2_Splice_Site_p.F547_splice	NM_004972	NP_004963	O60674	JAK2_HUMAN	Janus kinase 2						actin filament polymerization|activation of caspase activity by protein phosphorylation|activation of JAK2 kinase activity|blood coagulation|cellular component movement|erythrocyte differentiation|interferon-gamma-mediated signaling pathway|interleukin-12-mediated signaling pathway|JAK-STAT cascade involved in growth hormone signaling pathway|mammary gland epithelium development|mesoderm development|negative regulation of cell proliferation|negative regulation of DNA binding|positive regulation of apoptosis|positive regulation of cell-substrate adhesion|positive regulation of growth hormone receptor signaling pathway|positive regulation of nitric-oxide synthase 2 biosynthetic process|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of tumor necrosis factor production|positive regulation of tyrosine phosphorylation of Stat3 protein|positive regulation of tyrosine phosphorylation of Stat5 protein|protein autophosphorylation|regulation of inflammatory response|regulation of interferon-gamma-mediated signaling pathway|response to antibiotic|response to lipopolysaccharide|STAT protein import into nucleus|tumor necrosis factor-mediated signaling pathway|tyrosine phosphorylation of STAT protein	caveola|cytoskeleton|cytosol|endomembrane system|nucleus	ATP binding|growth hormone receptor binding|heme binding|histone binding|histone kinase activity (H3-Y41 specific)|interleukin-12 receptor binding|non-membrane spanning protein tyrosine kinase activity|protein kinase binding|SH2 domain binding	p.F547_N548ins12(2)|p.F547_N548ins11(1)|p.F547_N548insLIRNEDLIF(1)	PCM1/JAK2(30)|PAX5/JAK2(18)|ETV6/JAK2(11)|BCR/JAK2(6)|SSBP2/JAK2(4)|SEC31A/JAK2(4)	haematopoietic_and_lymphoid_tissue(28629)|lung(5)|breast(5)|ovary(1)|liver(1)	28641	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.0198)|Breast(48;0.147)		GBM - Glioblastoma multiforme(50;0.0237)|Lung(218;0.133)		TTTGATATTTGTAAGTCATTA	0.308		1	T|Mis|O	ETV6|PCM1|BCR	ALL|AML|MPD| CML				Polycythemia_Vera_Familial				3	29	---	---	---	---	PASS
TTC39B	158219	broad.mit.edu	37	9	15192599	15192599	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15192599C>A	uc003zlr.1	-	9	842	c.721G>T	c.(721-723)GCC>TCC	p.A241S	TTC39B_uc003zlq.1_Missense_Mutation_p.A210S|TTC39B_uc011lmp.1_Missense_Mutation_p.A142S|TTC39B_uc010mie.1_Missense_Mutation_p.A239S|TTC39B_uc011lmq.1_Missense_Mutation_p.A241S|TTC39B_uc011lmr.1_Missense_Mutation_p.A172S|TTC39B_uc010mif.1_Missense_Mutation_p.A241S|TTC39B_uc003zls.1_Missense_Mutation_p.A142S|TTC39B_uc010mig.1_Missense_Mutation_p.A210S|TTC39B_uc011lms.1_RNA	NM_152574	NP_689787	Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	241							binding			ovary(1)	1						AAATTAAAGGCCCCACTGCCA	0.418													72	23	---	---	---	---	PASS
KIF27	55582	broad.mit.edu	37	9	86482779	86482779	+	Intron	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86482779C>A	uc004ana.2	-						KIF27_uc010mpw.2_Intron|KIF27_uc010mpx.2_Intron	NM_017576	NP_060046	Q86VH2	KIF27_HUMAN	kinesin family member 27						cilium assembly|microtubule-based movement	cilium|cytoplasm|microtubule	ATP binding|microtubule motor activity			lung(4)|skin(1)	5						CCAATTTCTACATTAAAATTA	0.303													49	22	---	---	---	---	PASS
BICD2	23299	broad.mit.edu	37	9	95481276	95481276	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95481276G>A	uc004aso.1	-	5	1708	c.1651C>T	c.(1651-1653)CGT>TGT	p.R551C	BICD2_uc004asp.1_Missense_Mutation_p.R551C	NM_015250	NP_056065	Q8TD16	BICD2_HUMAN	bicaudal D homolog 2 isoform 2	551					microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule	cytoplasmic vesicle|cytoskeleton|Golgi apparatus|plasma membrane	Rab GTPase binding			skin(1)	1						AGCATGACACGGTTGGGTGTC	0.677													48	22	---	---	---	---	PASS
COL15A1	1306	broad.mit.edu	37	9	101797285	101797285	+	Intron	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101797285C>G	uc004azb.1	+							NM_001855	NP_001846	P39059	COFA1_HUMAN	alpha 1 type XV collagen precursor						angiogenesis|cell differentiation|signal transduction	collagen type XV|extracellular space|integral to membrane	binding			ovary(6)	6		Acute lymphoblastic leukemia(62;0.0562)				AGCCTGCCCTCTTTCCTACAG	0.537													43	14	---	---	---	---	PASS
NUP214	8021	broad.mit.edu	37	9	134025771	134025771	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134025771C>T	uc004cag.2	+	15	2212	c.2101C>T	c.(2101-2103)CCT>TCT	p.P701S	NUP214_uc004cah.2_Missense_Mutation_p.P691S|NUP214_uc004cai.2_Missense_Mutation_p.P131S|NUP214_uc004caf.1_Missense_Mutation_p.P690S|NUP214_uc010mzf.2_5'UTR	NM_005085	NP_005076	P35658	NU214_HUMAN	nucleoporin 214kDa	701	11 X 5 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mRNA metabolic process|protein export from nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore|nucleoplasm	protein binding			breast(7)|lung(3)|skin(3)|ovary(2)|central_nervous_system(1)	16	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		AGATTCAGATCCTGTAATGGC	0.453			T	DEK|SET|ABL1	AML|T-ALL								43	20	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17107605	17107605	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17107605G>T	uc001ioo.2	-	22	3093	c.3041C>A	c.(3040-3042)ACA>AAA	p.T1014K		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	1014	CUB 5.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ACCACTGCTTGTGAGAGATGG	0.408													53	88	---	---	---	---	PASS
NEBL	10529	broad.mit.edu	37	10	21120411	21120411	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:21120411C>T	uc001iqi.2	-	15	1948	c.1551G>A	c.(1549-1551)ATG>ATA	p.M517I	NEBL_uc001iqj.2_RNA|NEBL_uc001iqk.2_Intron|NEBL_uc001iql.1_RNA	NM_006393	NP_006384	O76041	NEBL_HUMAN	nebulette sarcomeric isoform	517	Nebulin 14.				regulation of actin filament length		actin binding|structural constituent of muscle			ovary(2)	2						CCTGGCTGGCCATCTCGGATG	0.428													42	69	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25887113	25887113	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25887113C>A	uc001isj.2	+	11	2618	c.2558C>A	c.(2557-2559)TCG>TAG	p.S853*	GPR158_uc001isk.2_Nonsense_Mutation_p.S228*	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	853	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GAATCCCTGTCGGGTAAAAAA	0.502													42	86	---	---	---	---	PASS
CSGALNACT2	55454	broad.mit.edu	37	10	43654346	43654346	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43654346C>T	uc001jan.2	+	3	1180	c.845C>T	c.(844-846)ACT>ATT	p.T282I	CSGALNACT2_uc001jam.1_Missense_Mutation_p.T282I	NM_018590	NP_061060	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate	282	Lumenal (Potential).				chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process	Golgi cisterna membrane|integral to Golgi membrane	glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding			ovary(1)	1						GCTGAAAGAACTGAAGCATTT	0.373													12	41	---	---	---	---	PASS
ZNF488	118738	broad.mit.edu	37	10	48371120	48371120	+	Silent	SNP	C	T	T	rs149528341		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:48371120C>T	uc001jex.2	+	2	750	c.588C>T	c.(586-588)CTC>CTT	p.L196L	ZNF488_uc001jey.2_Silent_p.L89L	NM_153034	NP_694579	Q96MN9	ZN488_HUMAN	zinc finger protein 488	196					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CTGGACTCCTCAACACTACAG	0.532													50	21	---	---	---	---	PASS
KIAA1274	27143	broad.mit.edu	37	10	72289798	72289798	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72289798C>T	uc001jrd.3	+	4	723	c.442C>T	c.(442-444)CAG>TAG	p.Q148*		NM_014431	NP_055246	Q9ULE6	PALD_HUMAN	KIAA1274	148										ovary(2)|central_nervous_system(1)	3						GCGGGTCCTCCAGAAACTCCA	0.632													12	8	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73326642	73326642	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73326642G>T	uc001jrx.3	+	7	950	c.573G>T	c.(571-573)CGG>CGT	p.R191R	CDH23_uc001jrw.3_Silent_p.R191R|CDH23_uc001jrv.2_Silent_p.R186R|CDH23_uc009xql.2_Silent_p.R236R	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	191	Cadherin 2.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						CAGTGATCCGGGAGCTGGACT	0.657													22	11	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87487767	87487767	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87487767G>A	uc001kdl.1	-	10	1479	c.1378C>T	c.(1378-1380)CCC>TCC	p.P460S	GRID1_uc009xsu.1_RNA|GRID1_uc010qmf.1_Missense_Mutation_p.P31S	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	460	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	TAGCGCTTGGGCTGTCCTAGG	0.473										Multiple Myeloma(13;0.14)			105	59	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94409662	94409662	+	Silent	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94409662C>G	uc001kic.2	+	20	3149	c.2841C>G	c.(2839-2841)CTC>CTG	p.L947L	KIF11_uc010qnq.1_RNA	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	947					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						GTGAACATCTCCTTGATCAGC	0.373													25	24	---	---	---	---	PASS
KIF11	3832	broad.mit.edu	37	10	94410206	94410206	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:94410206C>G	uc001kic.2	+	21	3279	c.2971C>G	c.(2971-2973)CTA>GTA	p.L991V	KIF11_uc010qnq.1_RNA	NM_004523	NP_004514	P52732	KIF11_HUMAN	kinesin family member 11	991					blood coagulation|cell division|microtubule-based movement|spindle assembly involved in mitosis	chromatin remodeling complex|cytosol|kinesin complex|microtubule|spindle pole	ATP binding|microtubule motor activity|protein kinase binding			skin(1)	1						TGAAGAACCTCTAAGTCAAGA	0.438													45	28	---	---	---	---	PASS
ABCC2	1244	broad.mit.edu	37	10	101590552	101590552	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101590552G>A	uc001kqf.2	+	21	2966	c.2827G>A	c.(2827-2829)GAA>AAA	p.E943K		NM_000392	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP),	943	Cytoplasmic (By similarity).					apical plasma membrane|integral to plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Norgestimate(DB00957)|Pravastatin(DB00175)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	GAAGGAAGACGAAGAACTAGT	0.418													42	23	---	---	---	---	PASS
ELOVL3	83401	broad.mit.edu	37	10	103988822	103988822	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103988822A>G	uc001kut.2	+	4	789	c.626A>G	c.(625-627)CAG>CGG	p.Q209R		NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like	209	Helical; (Potential).				fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CAGATCTTGCAGATGTTTGTA	0.527													3	38	---	---	---	---	PASS
DPYSL4	10570	broad.mit.edu	37	10	134012417	134012417	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134012417C>T	uc009ybb.2	+	8	907	c.753C>T	c.(751-753)TAC>TAT	p.Y251Y		NM_006426	NP_006417	O14531	DPYL4_HUMAN	dihydropyrimidinase-like 4	251					axon guidance|pyrimidine base catabolic process	cytosol	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides			central_nervous_system(2)	2		all_cancers(35;4.33e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;7.21e-05)|Epithelial(32;8.01e-05)|all cancers(32;9.29e-05)|BRCA - Breast invasive adenocarcinoma(275;0.206)		GCCCGCTGTACGTCACCAAGG	0.667													34	23	---	---	---	---	PASS
MRGPRE	116534	broad.mit.edu	37	11	3249621	3249621	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3249621G>A	uc001lxq.3	-	2	716	c.406C>T	c.(406-408)CGC>TGC	p.R136C		NM_001039165	NP_001034254	Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	136	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			large_intestine(1)|ovary(1)	2		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTCAGGTGGCGTGGGCGGCGG	0.692													6	7	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080587	5080587	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080587G>T	uc010qyw.1	-	1	271	c.271C>A	c.(271-273)CTC>ATC	p.L91I		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	91	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ATCCCTCTGAGGTTGATCCAG	0.488													15	15	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080588	5080588	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080588G>T	uc010qyw.1	-	1	270	c.270C>A	c.(268-270)AAC>AAA	p.N90K		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	90	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		TCCCTCTGAGGTTGATCCAGA	0.483													15	15	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080785	5080785	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080785G>T	uc010qyw.1	-	1	73	c.73C>A	c.(73-75)CTT>ATT	p.L25I		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		CAGATGTGAAGTGTTTCTAGT	0.488													24	43	---	---	---	---	PASS
OR56A4	120793	broad.mit.edu	37	11	6023926	6023926	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6023926G>T	uc010qzv.1	-	1	453	c.453C>A	c.(451-453)GCC>GCA	p.A151A		NM_001005179	NP_001005179	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A,	99	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)|skin(1)	2		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGGAAGCAGGCTGGGAAGC	0.542													28	48	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048912	6048912	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048912G>T	uc010qzw.1	-	1	23	c.23C>A	c.(22-24)CCC>CAC	p.P8H		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.P8T(1)		ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCTGTTGCTGGGTGACGCCAT	0.488													70	119	---	---	---	---	PASS
OR56A1	120796	broad.mit.edu	37	11	6048913	6048913	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6048913G>T	uc010qzw.1	-	1	22	c.22C>A	c.(22-24)CCC>ACC	p.P8T		NM_001001917	NP_001001917	Q8NGH5	O56A1_HUMAN	olfactory receptor, family 56, subfamily A,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.P8T(1)		ovary(2)|breast(1)	3		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CTGTTGCTGGGTGACGCCATA	0.488													70	118	---	---	---	---	PASS
SYT9	143425	broad.mit.edu	37	11	7324593	7324593	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7324593C>A	uc001mfe.2	+	2	706	c.469C>A	c.(469-471)CAA>AAA	p.Q157K	SYT9_uc001mfd.2_RNA|SYT9_uc009yfi.2_RNA	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX	157	Cytoplasmic (Potential).					cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		CGTGCAGCGCCAAGTCACAGA	0.587													8	21	---	---	---	---	PASS
WEE1	7465	broad.mit.edu	37	11	9603115	9603115	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9603115G>C	uc001mhs.2	+	6	1431	c.1178G>C	c.(1177-1179)AGA>ACA	p.R393T	WEE1_uc001mht.2_Missense_Mutation_p.R179T	NM_003390	NP_003381	P30291	WEE1_HUMAN	WEE1 tyrosine kinase isoform 1	393	Protein kinase.				blood coagulation|cell cycle checkpoint|cell division|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mitosis|S phase of mitotic cell cycle	nucleoplasm	ATP binding|magnesium ion binding|non-membrane spanning protein tyrosine kinase activity|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	5				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		GAAAACTACAGAATCATGAGT	0.338													28	48	---	---	---	---	PASS
INSC	387755	broad.mit.edu	37	11	15247298	15247298	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15247298A>G	uc001mly.2	+	9	1281	c.1235A>G	c.(1234-1236)CAG>CGG	p.Q412R	INSC_uc001mlz.2_Missense_Mutation_p.Q365R|INSC_uc001mma.2_Missense_Mutation_p.Q365R|INSC_uc010rcs.1_Missense_Mutation_p.Q400R|INSC_uc001mmb.2_Missense_Mutation_p.Q365R|INSC_uc001mmc.2_Missense_Mutation_p.Q323R	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a	412					cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						ATGCTCCTGCAGTTGAATGCC	0.572													20	20	---	---	---	---	PASS
KCNA4	3739	broad.mit.edu	37	11	30033036	30033036	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30033036G>T	uc001msk.2	-	2	2342	c.1190C>A	c.(1189-1191)GCA>GAA	p.A397E		NM_002233	NP_002224	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related	397						voltage-gated potassium channel complex	potassium ion binding|protein binding|voltage-gated potassium channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAAGAAGAGTGCTTGGCTGGG	0.463													27	31	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30925146	30925146	+	RNA	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30925146A>T	uc001mss.1	-	10		c.1496T>A			uc009yjk.1_Missense_Mutation_p.L913M|uc009yjj.1_RNA					Homo sapiens mRNA for KIAA1493 protein, partial cds.																		AAATCACGCAAGGTAAAGATT	0.433													12	18	---	---	---	---	PASS
CCDC73	493860	broad.mit.edu	37	11	32697138	32697138	+	Silent	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32697138T>C	uc001mtv.2	-	9	662	c.618A>G	c.(616-618)CAA>CAG	p.Q206Q	CCDC73_uc001mtw.1_Silent_p.Q206Q	NM_001008391	NP_001008392	Q6ZRK6	CCD73_HUMAN	sarcoma antigen NY-SAR-79	206	Potential.									ovary(1)|central_nervous_system(1)	2	Breast(20;0.112)					TTTCAGCTTCTTGTTTTTTAT	0.274													8	14	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33566385	33566385	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33566385C>A	uc001mup.3	+	2	2097	c.1973C>A	c.(1972-1974)CCA>CAA	p.P658Q	C11orf41_uc001mun.1_Missense_Mutation_p.P658Q	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	652						integral to membrane				ovary(2)	2						AAATCAAGTCCACCTGCACTG	0.512													15	17	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40137244	40137244	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137244C>T	uc001mxa.1	-	2	2563	c.599G>A	c.(598-600)AGG>AAG	p.R200K	LRRC4C_uc001mxc.1_Missense_Mutation_p.R196K|LRRC4C_uc001mxd.1_Missense_Mutation_p.R196K|LRRC4C_uc001mxb.1_Missense_Mutation_p.R196K	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	200	LRR 6.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GTTCAAATACCTCAAGTTGGA	0.438													25	65	---	---	---	---	PASS
ACCS	84680	broad.mit.edu	37	11	44099414	44099414	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44099414G>T	uc009yks.1	+	8	818	c.674G>T	c.(673-675)CGC>CTC	p.R225L	EXT2_uc010rfo.1_Intron|ACCS_uc010rfm.1_3'UTR|ACCS_uc001mxx.2_Missense_Mutation_p.R225L	NM_001127219	NP_001120691	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase	225							1-aminocyclopropane-1-carboxylate synthase activity|protein homodimerization activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups			breast(2)|ovary(1)|lung(1)	4						CTAGACACACGCCCCTTCCAG	0.552													18	36	---	---	---	---	PASS
PHF21A	51317	broad.mit.edu	37	11	45970434	45970434	+	Intron	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45970434C>G	uc001ncc.3	-						PHF21A_uc001ncb.3_Intron|PHF21A_uc009ykx.2_Intron|PHF21A_uc001nce.2_Intron|PHF21A_uc001nca.1_Intron	NM_001101802	NP_001095272	Q96BD5	PF21A_HUMAN	BRAF35/HDAC2 complex isoform a						blood coagulation|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|transcription, DNA-dependent	histone deacetylase complex	DNA binding|zinc ion binding			central_nervous_system(1)|skin(1)	2						AAAAGGTCCTCACCTCTCTTC	0.478													49	91	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48346889	48346889	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48346889G>A	uc010rhv.1	+	1	397	c.397G>A	c.(397-399)GGA>AGA	p.G133R		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	106	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TCATTTTTTGGGAGGTGTTGA	0.473													25	340	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681934	55681934	+	Missense_Mutation	SNP	T	A	A	rs139033114	byFrequency	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681934T>A	uc010rir.1	-	1	125	c.125A>T	c.(124-126)AAT>ATT	p.N42I		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	42	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CATTCCAAGATTTGCTGAGAA	0.343													20	41	---	---	---	---	PASS
OR8K5	219453	broad.mit.edu	37	11	55927561	55927561	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55927561C>A	uc010rja.1	-	1	233	c.233G>T	c.(232-234)TGT>TTT	p.C78F		NM_001004058	NP_001004058	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K,	78	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|skin(1)	4	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				CACCTTGGGACAAATGACAGT	0.378													33	55	---	---	---	---	PASS
DTX4	23220	broad.mit.edu	37	11	58972338	58972338	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58972338G>C	uc001nns.2	+	9	2073	c.1816G>C	c.(1816-1818)GCC>CCC	p.A606P	DTX4_uc001nnr.2_Missense_Mutation_p.A500P	NM_015177	NP_055992	Q9Y2E6	DTX4_HUMAN	deltex 4 homolog	606					Notch signaling pathway	cytoplasm	zinc ion binding			lung(2)|central_nervous_system(1)	3		all_epithelial(135;0.125)				TGAACTGGCTGCCCAGGGCAT	0.557													4	11	---	---	---	---	PASS
TCN1	6947	broad.mit.edu	37	11	59626613	59626613	+	Silent	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59626613A>T	uc001noj.2	-	5	782	c.684T>A	c.(682-684)ATT>ATA	p.I228I		NM_001062	NP_001053	P20061	TCO1_HUMAN	transcobalamin I precursor	228					cobalamin metabolic process|cobalamin transport|cobalt ion transport	extracellular region	cobalamin binding			ovary(2)	2		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCTCAGACAGAATCTTTTCTA	0.408													47	91	---	---	---	---	PASS
SLC22A6	9356	broad.mit.edu	37	11	62751953	62751953	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62751953G>C	uc001nwk.2	-	1	517	c.210C>G	c.(208-210)GAC>GAG	p.D70E	SLC22A6_uc001nwl.2_Missense_Mutation_p.D70E|SLC22A6_uc001nwj.2_Missense_Mutation_p.D70E|SLC22A6_uc001nwm.2_Missense_Mutation_p.D70E	NM_004790	NP_004781	Q4U2R8	S22A6_HUMAN	solute carrier family 22 member 6 isoform a	70	Extracellular (Potential).				alpha-ketoglutarate transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	inorganic anion exchanger activity|protein binding				0						GCCCCTGCCTGTCCCGGGGCA	0.662													34	61	---	---	---	---	PASS
SLC22A9	114571	broad.mit.edu	37	11	63177263	63177263	+	Intron	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63177263A>G	uc001nww.2	+						SLC22A9_uc001nwx.2_Intron	NM_080866	NP_543142	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion/cation						transmembrane transport	integral to membrane				breast(2)|large_intestine(1)	3						GTTTCTTTGTATTTGTTCTAG	0.393													11	19	---	---	---	---	PASS
DNAJC4	3338	broad.mit.edu	37	11	63999935	63999935	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63999935C>A	uc001nys.2	+	4	676	c.214C>A	c.(214-216)CTG>ATG	p.L72M	uc001nyr.1_5'Flank|DNAJC4_uc001nyt.2_Missense_Mutation_p.L72M|DNAJC4_uc001nyu.2_Missense_Mutation_p.L72M|VEGFB_uc001nyw.2_5'Flank|VEGFB_uc001nyx.2_5'Flank	NM_005528	NP_005519	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	72	J.				protein folding|response to unfolded protein	integral to membrane|membrane fraction	heat shock protein binding|unfolded protein binding				0						GAACCCAAGCCTGCACAGCCG	0.647													12	34	---	---	---	---	PASS
DPF2	5977	broad.mit.edu	37	11	65113462	65113462	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65113462C>G	uc001odm.2	+	8	849	c.837C>G	c.(835-837)GAC>GAG	p.D279E	DPF2_uc001odn.2_Missense_Mutation_p.D293E|DPF2_uc010roe.1_Intron	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	279	PHD-type 1.				apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						GCCTGGGGGACTCAAAGATTA	0.542													67	116	---	---	---	---	PASS
TIGD3	220359	broad.mit.edu	37	11	65124453	65124453	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65124453T>C	uc001odo.3	+	2	1337	c.1174T>C	c.(1174-1176)TTT>CTT	p.F392L		NM_145719	NP_663771	Q6B0B8	TIGD3_HUMAN	tigger transposable element derived 3	392					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						CCTGGAGGAGTTTTCCCGCTT	0.597													52	87	---	---	---	---	PASS
PACS1	55690	broad.mit.edu	37	11	65838208	65838208	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65838208C>T	uc001oha.1	+	1	385	c.251C>T	c.(250-252)TCC>TTC	p.S84F	PACS1_uc001ogz.1_Missense_Mutation_p.S84F	NM_018026	NP_060496	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	84	Ser-rich.				interspecies interaction between organisms|regulation of defense response to virus by virus|viral reproduction	cytosol	protein binding			ovary(6)	6						GCCTCGGGCTCCGCGCCTCCC	0.746													3	9	---	---	---	---	PASS
NADSYN1	55191	broad.mit.edu	37	11	71166186	71166186	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:71166186G>T	uc001oqn.2	+	2	242	c.116G>T	c.(115-117)AGA>ATA	p.R39I	NADSYN1_uc001oqm.2_RNA|NADSYN1_uc001oqo.2_5'UTR	NM_018161	NP_060631	Q6IA69	NADE_HUMAN	NAD synthetase 1	39	CN hydrolase.				NAD biosynthetic process|water-soluble vitamin metabolic process	cytosol	ATP binding|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds|NAD+ synthase (glutamine-hydrolyzing) activity|protein binding			ovary(2)	2					L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	AGAGGAGCAAGATACAGGCTT	0.443													33	62	---	---	---	---	PASS
PAAF1	80227	broad.mit.edu	37	11	73611311	73611311	+	Intron	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:73611311C>G	uc001ouk.1	+						PAAF1_uc001oul.1_Intron|PAAF1_uc009ytx.1_Intron|PAAF1_uc001oum.1_Intron	NM_025155	NP_079431	Q9BRP4	PAAF1_HUMAN	proteasomal ATPase-associated factor 1						interspecies interaction between organisms	proteasome complex	protein binding			ovary(1)|skin(1)	2	Breast(11;7.42e-05)					TTTTGTTTTTCCAGAGAGTAT	0.433													77	138	---	---	---	---	PASS
PRSS23	11098	broad.mit.edu	37	11	86519529	86519529	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86519529T>C	uc001pcb.2	+	2	1060	c.844T>C	c.(844-846)TAT>CAT	p.Y282H	PRSS23_uc001pcc.1_Intron|PRSS23_uc010rts.1_Missense_Mutation_p.Y250H	NM_007173	NP_009104	O95084	PRS23_HUMAN	protease, serine, 23 precursor	282					proteolysis	extracellular region|nucleus	serine-type endopeptidase activity			central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CTTCTCTGGTTATGACAATGA	0.517													44	98	---	---	---	---	PASS
CASP5	838	broad.mit.edu	37	11	104869685	104869685	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104869685C>T	uc010rva.1	-	7	1055	c.1023G>A	c.(1021-1023)GAG>GAA	p.E341E	CASP5_uc010ruz.1_Silent_p.E354E|CASP5_uc010rvb.1_Silent_p.E283E|CASP5_uc010rvc.1_Silent_p.E199E|CASP5_uc009yxh.2_Silent_p.E123E|CASP5_uc010rvd.1_Silent_p.E123E	NM_004347	NP_004338	P51878	CASP5_HUMAN	caspase 5 isoform a precursor	341					apoptosis|cellular response to mechanical stimulus|proteolysis|regulation of apoptosis	intracellular	cysteine-type endopeptidase activity|protein binding			ovary(2)|lung(1)	3		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Melanoma(852;0.0047)		BRCA - Breast invasive adenocarcinoma(274;0.000943)|Epithelial(105;0.0104)|all cancers(92;0.042)		CCTCCAGGTTCTCAGATGACT	0.418													5	119	---	---	---	---	PASS
KBTBD3	143879	broad.mit.edu	37	11	105924321	105924321	+	Silent	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:105924321T>C	uc001pja.2	-	4	1735	c.1095A>G	c.(1093-1095)TCA>TCG	p.S365S	KBTBD3_uc001pjb.2_Silent_p.S365S|KBTBD3_uc009yxm.2_Silent_p.S286S	NM_198439	NP_940841	Q8NAB2	KBTB3_HUMAN	BTB and kelch domain containing 3	361	Kelch 2.									ovary(1)|central_nervous_system(1)	2		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		CATCATGATATGACTCGGCAA	0.423													39	37	---	---	---	---	PASS
C11orf87	399947	broad.mit.edu	37	11	109294504	109294504	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:109294504C>A	uc001pkn.2	+	2	519	c.145C>A	c.(145-147)CAG>AAG	p.Q49K	C11orf87_uc010rwb.1_5'Flank	NM_207645	NP_997528	Q6NUJ2	CK087_HUMAN	hypothetical protein LOC399947 precursor	49	Extracellular (Potential).					integral to membrane				ovary(2)	2						CTGCATCACGCAGGTGGGACA	0.632													14	35	---	---	---	---	PASS
LAYN	143903	broad.mit.edu	37	11	111430955	111430955	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111430955G>A	uc001plr.1	+	8	1257	c.921G>A	c.(919-921)CGG>CGA	p.R307R	LAYN_uc001plp.1_Silent_p.R299R|LAYN_uc001plq.1_3'UTR|LAYN_uc001pls.1_3'UTR|LAYN_uc010rwg.1_Silent_p.R154R|LAYN_uc010rwh.1_Silent_p.R155R	NM_178834	NP_849156	Q6UX15	LAYN_HUMAN	layilin	307	Cytoplasmic (Potential).					cell surface|integral to membrane|ruffle	hyaluronic acid binding|sugar binding				0		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)		CTGAGACCCGGCCAGACCTGA	0.498													4	104	---	---	---	---	PASS
NNMT	4837	broad.mit.edu	37	11	114167442	114167442	+	Intron	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114167442T>C	uc001por.1	+						NNMT_uc001pos.1_Intron	NM_006169	NP_006160	P40261	NNMT_HUMAN	nicotinamide N-methyltransferase						xenobiotic metabolic process	cytosol	nicotinamide N-methyltransferase activity|pyridine N-methyltransferase activity			ovary(1)	1		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	GGTAAGTCTGTTGTCTGCATG	0.428													27	51	---	---	---	---	PASS
TECTA	7007	broad.mit.edu	37	11	121058628	121058628	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121058628C>T	uc010rzo.1	+	20	6087	c.6087C>T	c.(6085-6087)TTC>TTT	p.F2029F		NM_005422	NP_005413	O75443	TECTA_HUMAN	tectorin alpha precursor	2029	ZP.				cell-matrix adhesion|sensory perception of sound	anchored to membrane|plasma membrane|proteinaceous extracellular matrix				breast(6)|ovary(2)|skin(2)	10	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		TCTTTAAATTCATAGGGGATT	0.438													41	75	---	---	---	---	PASS
SC5DL	6309	broad.mit.edu	37	11	121175181	121175181	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121175181G>C	uc001pxu.2	+	3	470	c.322G>C	c.(322-324)GAC>CAC	p.D108H	SC5DL_uc001pxs.1_3'UTR|SC5DL_uc001pxt.2_Missense_Mutation_p.D108H|SC5DL_uc001pxv.2_Missense_Mutation_p.D108H	NM_006918	NP_008849	O75845	SC5D_HUMAN	sterol-C5-desaturase	108					fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	C-5 sterol desaturase activity|iron ion binding|lathosterol oxidase activity			ovary(1)	1		Breast(109;0.00328)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)	OV - Ovarian serous cystadenocarcinoma(1;0.0334)	BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		ATTACATGATGACCTAGGAGA	0.393													33	51	---	---	---	---	PASS
OR10G7	390265	broad.mit.edu	37	11	123909601	123909601	+	Silent	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123909601A>G	uc001pzq.1	-	1	108	c.108T>C	c.(106-108)ACT>ACC	p.T36T		NM_001004463	NP_001004463	Q8NGN6	O10G7_HUMAN	olfactory receptor, family 10, subfamily G,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		TCCCCAGCACAGTGAGCACGT	0.577													24	94	---	---	---	---	PASS
ADAMTS15	170689	broad.mit.edu	37	11	130343465	130343465	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130343465G>T	uc010scd.1	+	8	2602	c.2602G>T	c.(2602-2604)GGC>TGC	p.G868C		NM_139055	NP_620686	Q8TE58	ATS15_HUMAN	a disintegrin-like and metalloprotease	868	TSP type-1 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(2)|pancreas(1)|lung(1)|skin(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0631)|Lung(977;0.215)		GGACTGCCGGGGCTCCGCCGG	0.756													26	20	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134038875	134038875	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134038875C>A	uc001qhd.1	-	25	3782	c.3176G>T	c.(3175-3177)TGT>TTT	p.C1059F	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|NCAPD3_uc001qhc.1_Missense_Mutation_p.C9F	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1059					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GTGAAAAATACATTCAATGAA	0.443													3	64	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134093809	134093809	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134093809C>A	uc001qhd.1	-	1	618	c.12G>T	c.(10-12)TTG>TTT	p.L4F	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_RNA|VPS26B_uc001qhe.2_5'Flank	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	4					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		CAAGGCCCCGCAACGCCACCA	0.687													4	39	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22623838	22623838	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22623838A>T	uc001rfq.2	-	21	2594	c.2366T>A	c.(2365-2367)GTC>GAC	p.V789D	KIAA0528_uc010sir.1_Missense_Mutation_p.V604D|KIAA0528_uc010sis.1_Missense_Mutation_p.V789D|KIAA0528_uc010sit.1_Missense_Mutation_p.V791D|KIAA0528_uc010siu.1_Missense_Mutation_p.V789D|KIAA0528_uc001rfr.2_Missense_Mutation_p.V780D	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	789							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						GACTGCCGTGACTGTAACCTA	0.343													28	45	---	---	---	---	PASS
OVCH1	341350	broad.mit.edu	37	12	29631832	29631832	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:29631832C>A	uc001rix.1	-	9	1005	c.1005G>T	c.(1003-1005)ATG>ATT	p.M335I		NM_183378	NP_899234	Q7RTY7	OVCH1_HUMAN	ovochymase 1 precursor	335	CUB 1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			ovary(3)|central_nervous_system(3)|pancreas(3)|large_intestine(1)	10	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					CTTGCTTTTCCATGTCTAAAC	0.313													11	26	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39760235	39760235	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39760235C>G	uc001rly.2	-	6	966	c.820G>C	c.(820-822)GAT>CAT	p.D274H	KIF21A_uc001rlx.2_Missense_Mutation_p.D274H|KIF21A_uc001rlz.2_Missense_Mutation_p.D274H|KIF21A_uc010skl.1_Missense_Mutation_p.D274H|KIF21A_uc001rma.1_Missense_Mutation_p.D282H	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	274	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				CCTGCGAGATCAACAAAATGG	0.383													42	44	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40734125	40734125	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40734125G>T	uc001rmg.3	+	41	6099	c.5978G>T	c.(5977-5979)CGA>CTA	p.R1993L	LRRK2_uc009zjw.2_Missense_Mutation_p.R831L|LRRK2_uc001rmi.2_Missense_Mutation_p.R826L	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1993	Protein kinase.				activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				ATTATATACCGAGACCTGAAA	0.398													50	127	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826243	43826243	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826243C>A	uc010skx.1	-	21	2960	c.2960G>T	c.(2959-2961)AGG>ATG	p.R987M	ADAMTS20_uc001rno.1_Missense_Mutation_p.R141M|ADAMTS20_uc001rnp.1_Missense_Mutation_p.R141M	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	987	TSP type-1 4.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		TTCTCGAGACCTTTCCCCTCC	0.363													36	69	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49434903	49434903	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49434903C>T	uc001rta.3	-	31	6650	c.6650G>A	c.(6649-6651)CGT>CAT	p.R2217H		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2217	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AGCCCCAGGACGAGATGAGGC	0.701			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			24	23	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51121588	51121588	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51121588G>C	uc001rwv.2	+	29	3659	c.3503G>C	c.(3502-3504)GGA>GCA	p.G1168A	DIP2B_uc009zlt.2_Missense_Mutation_p.G598A	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	1168						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						ATGCTTACAGGAGTGAAGGTA	0.458													75	114	---	---	---	---	PASS
ESPL1	9700	broad.mit.edu	37	12	53663320	53663320	+	Silent	SNP	G	T	T	rs147703740		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53663320G>T	uc001sck.2	+	3	685	c.594G>T	c.(592-594)GCG>GCT	p.A198A	ESPL1_uc001scj.2_5'UTR	NM_012291	NP_036423	Q14674	ESPL1_HUMAN	separase	198					apoptosis|cytokinesis|establishment of mitotic spindle localization|mitotic sister chromatid segregation|negative regulation of sister chromatid cohesion|positive regulation of mitotic metaphase/anaphase transition|proteolysis	centrosome|nucleus	cysteine-type peptidase activity|protein binding			lung(1)|kidney(1)|skin(1)	3						CCTGTCGAGCGGTAGCTGCCC	0.522													153	274	---	---	---	---	PASS
AMHR2	269	broad.mit.edu	37	12	53819263	53819263	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53819263G>C	uc001scx.1	+	5	605	c.527G>C	c.(526-528)AGA>ACA	p.R176T	AMHR2_uc009zmy.1_Missense_Mutation_p.R176T	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	176	Cytoplasmic (Potential).				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	AAGAACTACAGAGTGCGAGGT	0.582									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				33	74	---	---	---	---	PASS
USP15	9958	broad.mit.edu	37	12	62708619	62708619	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:62708619C>G	uc001src.1	+	4	406	c.397C>G	c.(397-399)CTC>GTC	p.L133V	USP15_uc001srb.1_Missense_Mutation_p.L133V|USP15_uc001sra.2_Missense_Mutation_p.L133V	NM_006313	NP_006304	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	133					protein deubiquitination|ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)	3			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		AGAAGTATATCTCACAGAATT	0.333													176	292	---	---	---	---	PASS
PPP1R12A	4659	broad.mit.edu	37	12	80203635	80203635	+	Silent	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80203635T>A	uc001syz.2	-	10	1662	c.1395A>T	c.(1393-1395)GCA>GCT	p.A465A	PPP1R12A_uc010suc.1_Silent_p.A378A|PPP1R12A_uc001sza.2_Silent_p.A465A|PPP1R12A_uc010sud.1_Silent_p.A465A|PPP1R12A_uc001szb.2_Silent_p.A465A|PPP1R12A_uc001szc.2_Silent_p.A465A	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)	465						contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						GTGTAACACCTGCAGTATCTT	0.413													14	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80651772	80651772	+	IGR	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80651772G>A								PPP1R12A (322537 upstream) : PTPRQ (186354 downstream)																							CAACATAAGGGATGATTTTCT	0.303													17	39	---	---	---	---	PASS
C12orf26	84190	broad.mit.edu	37	12	82824688	82824688	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:82824688G>T	uc001szq.2	+	6	1317	c.1296G>T	c.(1294-1296)AAG>AAT	p.K432N		NM_032230	NP_115606	Q8N6Q8	CL026_HUMAN	hypothetical protein LOC84190	432											0						CTCAGGAAAAGTGGGGATTTC	0.353													68	95	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94543741	94543741	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94543741A>T	uc001tdc.2	+	1	1243	c.994A>T	c.(994-996)AGA>TGA	p.R332*		NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	332	Extracellular (Potential).|Sema.				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						CTGCCTCTTCAGAATGAGTGA	0.701													7	14	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101413845	101413845	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101413845C>G	uc010svm.1	+	9	1340	c.768C>G	c.(766-768)AAC>AAG	p.N256K	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Missense_Mutation_p.N221K|ANO4_uc001thx.2_Missense_Mutation_p.N256K	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	256	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CGTTCTTCAACAATGCCACAA	0.294										HNSCC(74;0.22)			23	55	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101442178	101442178	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101442178G>C	uc010svm.1	+	14	1883	c.1311G>C	c.(1309-1311)TGG>TGC	p.W437C	ANO4_uc001thw.2_Missense_Mutation_p.W402C|ANO4_uc001thx.2_Missense_Mutation_p.W437C|ANO4_uc001thy.2_Missense_Mutation_p.W4C	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	437	Helical; (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						TGGCAGTCTGGGGTAAGTGTT	0.373										HNSCC(74;0.22)			25	48	---	---	---	---	PASS
PAH	5053	broad.mit.edu	37	12	103246696	103246696	+	Missense_Mutation	SNP	C	T	T	rs62508731		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103246696C>T	uc001tjq.1	-	8	1211	c.739G>A	c.(739-741)GGC>AGC	p.G247S		NM_000277	NP_000268	P00439	PH4H_HUMAN	phenylalanine hydroxylase	247			G -> V (in PKU; haplotype 4).		catecholamine biosynthetic process|L-phenylalanine catabolic process|neurotransmitter biosynthetic process	cytosol	phenylalanine 4-monooxygenase activity			ovary(4)	4					Epinephrine(DB00668)|L-Phenylalanine(DB00120)|Levodopa(DB01235)|Norepinephrine(DB00368)|Tetrahydrobiopterin(DB00360)	GAAAGCAGGCCAGCCACAGGT	0.532													20	55	---	---	---	---	PASS
MYL2	4633	broad.mit.edu	37	12	111348877	111348877	+	3'UTR	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111348877C>T	uc001try.3	-	7					MYL2_uc001trx.3_3'UTR	NM_000432	NP_000423	P10916	MLRV_HUMAN	slow cardiac myosin regulatory light chain 2						cardiac myofibril assembly|heart contraction|muscle filament sliding|negative regulation of cell growth|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	cytosol|myosin complex|sarcomere	actin monomer binding|calcium ion binding|myosin heavy chain binding|structural constituent of muscle			ovary(1)	1						CAGCGAGCCCCCTCCTAGTCC	0.602													40	67	---	---	---	---	PASS
MED13L	23389	broad.mit.edu	37	12	116429247	116429247	+	Missense_Mutation	SNP	T	G	G	rs147863200	byFrequency	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116429247T>G	uc001tvw.2	-	17	3567	c.3512A>C	c.(3511-3513)AAA>ACA	p.K1171T		NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1171					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		GTAGCCAAGTTTGCGGTTCAT	0.463													26	62	---	---	---	---	PASS
TCTN2	79867	broad.mit.edu	37	12	124172644	124172644	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124172644G>T	uc001ufp.2	+	7	939	c.811G>T	c.(811-813)GCA>TCA	p.A271S	TCTN2_uc009zya.2_Missense_Mutation_p.A270S	NM_024809	NP_079085	Q96GX1	TECT2_HUMAN	tectonic family member 2 isoform 1	271	Extracellular (Potential).				cilium assembly|smoothened signaling pathway	integral to membrane				ovary(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		GGATACTGACGCAAAAGACTT	0.363													52	146	---	---	---	---	PASS
GPR133	283383	broad.mit.edu	37	12	131569199	131569199	+	Silent	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:131569199C>G	uc001uit.3	+	15	2221	c.1662C>G	c.(1660-1662)GTC>GTG	p.V554V	GPR133_uc010tbm.1_Silent_p.V586V|GPR133_uc009zyo.2_Silent_p.V4V|GPR133_uc001uiv.1_Silent_p.V73V	NM_198827	NP_942122	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133 precursor	554	GPS.|Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			pancreas(5)|ovary(3)|skin(2)	10	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		TGCAGGTGGTCCCGCTGGAGG	0.652													13	22	---	---	---	---	PASS
GOLGA3	2802	broad.mit.edu	37	12	133354336	133354336	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133354336G>A	uc001ukz.1	-	19	4197	c.3638C>T	c.(3637-3639)TCC>TTC	p.S1213F	GOLGA3_uc001ula.1_Missense_Mutation_p.S1213F	NM_005895	NP_005886	Q08378	GOGA3_HUMAN	Golgi autoantigen, golgin subfamily a, 3	1213	Potential.				intra-Golgi vesicle-mediated transport	Golgi cisterna membrane|Golgi transport complex	protein binding|transporter activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		CAGCTCCAAGGAGGCCGCCTT	0.637													16	24	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567346	20567346	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567346G>C	uc001umr.2	+	4	432	c.134G>C	c.(133-135)AGA>ACA	p.R45T	ZMYM2_uc001umq.2_Missense_Mutation_p.R45T|ZMYM2_uc001ums.2_Missense_Mutation_p.R45T|ZMYM2_uc001umt.2_Missense_Mutation_p.R45T|ZMYM2_uc009zzn.1_Missense_Mutation_p.R67T	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	45					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TTAGTGTCTAGATCTAATAAG	0.428													21	116	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567525	20567525	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567525G>C	uc001umr.2	+	4	611	c.313G>C	c.(313-315)GAG>CAG	p.E105Q	ZMYM2_uc001umq.2_Missense_Mutation_p.E105Q|ZMYM2_uc001ums.2_Missense_Mutation_p.E105Q|ZMYM2_uc001umt.2_Missense_Mutation_p.E105Q|ZMYM2_uc009zzn.1_Missense_Mutation_p.E127Q	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	105					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TTCCTCAAAAGAGTTGGCATC	0.363													16	48	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567573	20567573	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567573G>T	uc001umr.2	+	4	659	c.361G>T	c.(361-363)GAT>TAT	p.D121Y	ZMYM2_uc001umq.2_Missense_Mutation_p.D121Y|ZMYM2_uc001ums.2_Missense_Mutation_p.D121Y|ZMYM2_uc001umt.2_Missense_Mutation_p.D121Y|ZMYM2_uc009zzn.1_Missense_Mutation_p.D143Y	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	121					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TGTCATTGATGATGAAGAGGA	0.368													25	64	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567803	20567803	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567803G>A	uc001umr.2	+	4	889	c.591G>A	c.(589-591)GTG>GTA	p.V197V	ZMYM2_uc001umq.2_Intron|ZMYM2_uc001ums.2_Silent_p.V197V|ZMYM2_uc001umt.2_Silent_p.V197V|ZMYM2_uc009zzn.1_Intron	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	197					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TAAGCTCTGTGAATGATGGCC	0.393													115	306	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20567851	20567851	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20567851G>A	uc001umr.2	+	4	937	c.639G>A	c.(637-639)ATG>ATA	p.M213I	ZMYM2_uc001umq.2_Intron|ZMYM2_uc001ums.2_Missense_Mutation_p.M213I|ZMYM2_uc001umt.2_Missense_Mutation_p.M213I|ZMYM2_uc009zzn.1_Intron	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	213					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		TGAACTTAATGATTACACATG	0.373													88	246	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20568004	20568004	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20568004G>T	uc001umr.2	+	4	1090	c.792G>T	c.(790-792)ATG>ATT	p.M264I	ZMYM2_uc001umq.2_Missense_Mutation_p.M177I|ZMYM2_uc001ums.2_Missense_Mutation_p.M264I|ZMYM2_uc001umt.2_Missense_Mutation_p.M264I|ZMYM2_uc009zzn.1_Missense_Mutation_p.M199I	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	264					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CTGGTAGAATGAATGTGGCAG	0.373													62	217	---	---	---	---	PASS
ZMYM2	7750	broad.mit.edu	37	13	20568028	20568028	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20568028G>C	uc001umr.2	+	4	1114	c.816G>C	c.(814-816)CAG>CAC	p.Q272H	ZMYM2_uc001umq.2_Missense_Mutation_p.Q185H|ZMYM2_uc001ums.2_Missense_Mutation_p.Q272H|ZMYM2_uc001umt.2_Missense_Mutation_p.Q272H|ZMYM2_uc009zzn.1_Missense_Mutation_p.Q207H	NM_003453	NP_003444	Q9UBW7	ZMYM2_HUMAN	zinc finger protein 198	272					regulation of transcription, DNA-dependent|transcription, DNA-dependent	PML body	ubiquitin conjugating enzyme binding|zinc ion binding			lung(3)|ovary(2)|prostate(1)	6		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		ACGTTTTTCAGAATGGAGAAT	0.368													70	240	---	---	---	---	PASS
PCDH8	5100	broad.mit.edu	37	13	53421590	53421590	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53421590C>A	uc001vhi.2	-	1	1185	c.982G>T	c.(982-984)GAC>TAC	p.D328Y	PCDH8_uc001vhj.2_Missense_Mutation_p.D328Y	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	328	Extracellular (Potential).|Cadherin 3.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GGTCCGCGGTCCTGCGCCCGC	0.706													20	12	---	---	---	---	PASS
PCDH8	5100	broad.mit.edu	37	13	53421591	53421591	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:53421591C>A	uc001vhi.2	-	1	1184	c.981G>T	c.(979-981)CAG>CAT	p.Q327H	PCDH8_uc001vhj.2_Missense_Mutation_p.Q327H	NM_002590	NP_002581	O95206	PCDH8_HUMAN	protocadherin 8 isoform 1 precursor	327	Extracellular (Potential).|Cadherin 3.				cell-cell signaling|homophilic cell adhesion	cell junction|dendrite|integral to plasma membrane|postsynaptic membrane|presynaptic membrane	calcium ion binding			breast(1)	1		Lung NSC(96;0.0019)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.19e-08)		GTCCGCGGTCCTGCGCCCGCA	0.706													21	12	---	---	---	---	PASS
NALCN	259232	broad.mit.edu	37	13	102029054	102029054	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:102029054G>T	uc001vox.1	-	6	830	c.641C>A	c.(640-642)CCA>CAA	p.P214Q	NALCN_uc001voy.2_5'UTR|NALCN_uc001voz.2_Missense_Mutation_p.P214Q|NALCN_uc001vpa.2_Missense_Mutation_p.P214Q	NM_052867	NP_443099	Q8IZF0	NALCN_HUMAN	voltage gated channel like 1	214	Extracellular (Potential).					integral to membrane	sodium channel activity|voltage-gated ion channel activity			ovary(8)|breast(4)|skin(2)|pancreas(1)|central_nervous_system(1)	16	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AACTTACCCTGGCTTTGTGTC	0.284													56	126	---	---	---	---	PASS
ATP11A	23250	broad.mit.edu	37	13	113527896	113527896	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113527896G>A	uc001vsi.3	+	27	3155	c.3067G>A	c.(3067-3069)GAC>AAC	p.D1023N	ATP11A_uc001vsj.3_Missense_Mutation_p.D1023N|ATP11A_uc010ago.2_RNA	NM_015205	NP_056020	P98196	AT11A_HUMAN	ATPase, class VI, type 11A isoform a	1023	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			large_intestine(2)|ovary(2)	4	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GCTTGCATTGGACACACACTA	0.493											OREG0003854	type=REGULATORY REGION|Gene=ATP11A|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	41	63	---	---	---	---	PASS
DCUN1D2	55208	broad.mit.edu	37	13	114112392	114112392	+	Silent	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114112392T>C	uc001vtr.1	-	7	771	c.732A>G	c.(730-732)GTA>GTG	p.V244V	DCUN1D2_uc001vts.1_RNA|DCUN1D2_uc010agw.1_Silent_p.V111V	NM_001014283	NP_001014305	Q6PH85	DCNL2_HUMAN	DCN1, defective in cullin neddylation 1, domain	244	DCUN1.										0	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0395)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.029)|GBM - Glioblastoma multiforme(44;0.234)			GTGCATATTCTACAAAATCAT	0.433											OREG0022535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	170	266	---	---	---	---	PASS
SALL2	6297	broad.mit.edu	37	14	21990847	21990847	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21990847C>T	uc001wbe.2	-	2	3297	c.3015G>A	c.(3013-3015)ACG>ACA	p.T1005T	SALL2_uc010tly.1_Silent_p.T1003T|SALL2_uc010tlz.1_Intron|SALL2_uc001wbf.3_Intron|SALL2_uc010tma.1_Intron|SALL2_uc001wbg.1_Intron	NM_005407	NP_005398	Q9Y467	SALL2_HUMAN	sal-like 2	1005							DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|large_intestine(1)	3	all_cancers(95;0.000662)			GBM - Glioblastoma multiforme(265;0.0151)		CTCATGGGATCGTGGGGTCAT	0.522													37	30	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58598408	58598408	+	Silent	SNP	C	T	T	rs76381572		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58598408C>T	uc001xdc.2	-	4	1764	c.1653G>A	c.(1651-1653)GAG>GAA	p.E551E	C14orf37_uc010tro.1_Silent_p.E589E|C14orf37_uc001xdd.2_Silent_p.E551E|C14orf37_uc001xde.2_Silent_p.E551E	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	551	Extracellular (Potential).					integral to membrane	binding				0						GTGTGAACTCCTCATTTGGCC	0.493													57	70	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106725471	106725471	+	RNA	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106725471C>T	uc010tyt.1	-	588		c.18076G>A								Parts of antibodies, mostly variable regions.												0						CCAAGCCTCCCCCAGACTCCA	0.557													39	123	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28465667	28465667	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28465667G>A	uc001zbj.2	-	37	5882	c.5776C>T	c.(5776-5778)CTC>TTC	p.L1926F		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1926	MIB/HERC2.				DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GCCAGCTTGAGGTCGTATTTT	0.567													70	113	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33955780	33955780	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33955780C>A	uc001zhi.2	+	36	5531	c.5461C>A	c.(5461-5463)CAC>AAC	p.H1821N	RYR3_uc010bar.2_Missense_Mutation_p.H1821N	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	1821	4 X approximate repeats.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGAGCTGCAGCACCGAGTGGA	0.473													13	30	---	---	---	---	PASS
SLC12A1	6557	broad.mit.edu	37	15	48525041	48525041	+	Intron	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48525041T>C	uc001zwn.3	+						SLC12A1_uc010uew.1_Intron|SLC12A1_uc010bem.2_Intron|SLC12A1_uc010uex.1_Intron|SLC12A1_uc001zwq.3_Intron|SLC12A1_uc001zwr.3_Intron	NM_000338	NP_000329	Q13621	S12A1_HUMAN	sodium potassium chloride cotransporter 2						potassium ion transport|sodium ion transport	integral to membrane|membrane fraction	sodium:potassium:chloride symporter activity			ovary(1)|central_nervous_system(1)	2		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Metolazone(DB00524)|Potassium Chloride(DB00761)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CCAAGGTACATGGAATAAATT	0.423													55	73	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50271902	50271902	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50271902C>A	uc001zxu.2	-	12	1088	c.946G>T	c.(946-948)GAG>TAG	p.E316*	ATP8B4_uc010ber.2_Nonsense_Mutation_p.E189*|ATP8B4_uc010ufd.1_Nonsense_Mutation_p.E189*|ATP8B4_uc010ufe.1_RNA	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	316	Extracellular (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		GAGCTCTTCTCTCCTTCATTC	0.378													84	142	---	---	---	---	PASS
PIF1	80119	broad.mit.edu	37	15	65108795	65108795	+	Missense_Mutation	SNP	C	A	A	rs78139154	byFrequency	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65108795C>A	uc002ant.2	-	12	1910	c.1844G>T	c.(1843-1845)CGG>CTG	p.R615L	PIF1_uc002anr.2_Missense_Mutation_p.R163L|PIF1_uc002ans.2_Missense_Mutation_p.R306L|PIF1_uc010uiq.1_Missense_Mutation_p.R615L	NM_025049	NP_079325	Q9H611	PIF1_HUMAN	DNA helicase homolog PIF1	615	Hydrolyzes ATP in the presence of both magnesium and single-stranded DNA; weak activity in the presence of RNA or double-stranded DNA; No unwinding activity.				negative regulation of telomerase activity|regulation of telomere maintenance|viral genome replication	nuclear chromosome, telomeric region	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' DNA/RNA helicase activity|magnesium ion binding|single-stranded DNA-dependent ATP-dependent DNA helicase activity|telomeric DNA binding				0						CCTGCCCCGCCGCAGGGTGGC	0.672													38	73	---	---	---	---	PASS
CT62	196993	broad.mit.edu	37	15	71404546	71404546	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:71404546G>T	uc002ata.2	-	3	589	c.76C>A	c.(76-78)CAC>AAC	p.H26N		NM_001102658	NP_001096128	P0C5K7	CT62_HUMAN	cancer/testis antigen 62	26											0						AATGTTCTGTGGGTGTGGCTG	0.473													8	25	---	---	---	---	PASS
CYP1A1	1543	broad.mit.edu	37	15	75012843	75012843	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75012843T>A	uc002ayp.3	-	7	1648	c.1526A>T	c.(1525-1527)CAG>CTG	p.Q509L	CYP1A1_uc010bjv.2_RNA|CYP1A1_uc010bjw.2_RNA|CYP1A1_uc010bju.2_Missense_Mutation_p.Q245L|CYP1A1_uc010bjx.2_Missense_Mutation_p.Q245L|CYP1A1_uc002ayq.3_Missense_Mutation_p.Q509L|CYP1A1_uc010bjy.2_Missense_Mutation_p.Q480L	NM_000499	NP_000490	P04798	CP1A1_HUMAN	cytochrome P450, family 1, subfamily A,	509					cellular lipid metabolic process|drug metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding|vitamin D 24-hydroxylase activity			ovary(2)|breast(2)|pancreas(1)	5					Arsenic trioxide(DB01169)|Benzphetamine(DB00865)|Bleomycin(DB00290)|Chlorzoxazone(DB00356)|Dacarbazine(DB00851)|Dactinomycin(DB00970)|Esomeprazole(DB00736)|Estrone(DB00655)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Ginseng(DB01404)|Granisetron(DB00889)|Ketoconazole(DB01026)|Menadione(DB00170)|Picrotoxin(DB00466)|Primaquine(DB01087)|Quinidine(DB00908)|Quinine(DB00468)|Thiabendazole(DB00730)	AGAGCGCAGCTGCATTTGGAA	0.572									Endometrial_Cancer_Familial_Clustering_of|ACTH-independent_macronodular_adrenal_hyperplasia				48	75	---	---	---	---	PASS
ARNT2	9915	broad.mit.edu	37	15	80872844	80872844	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80872844A>G	uc002bfr.2	+	16	1872	c.1706A>G	c.(1705-1707)CAG>CGG	p.Q569R	ARNT2_uc010unm.1_Missense_Mutation_p.Q558R|ARNT2_uc002bfs.2_Missense_Mutation_p.Q558R	NM_014862	NP_055677	Q9HBZ2	ARNT2_HUMAN	aryl hydrocarbon receptor nuclear translocator	569					central nervous system development|in utero embryonic development|response to hypoxia		aryl hydrocarbon receptor binding|DNA binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity			central_nervous_system(3)|ovary(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.134)			CAGCTAAACCAGAGTCAGGTG	0.557													28	46	---	---	---	---	PASS
CPEB1	64506	broad.mit.edu	37	15	83224681	83224681	+	Silent	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83224681G>T	uc002bit.2	-	5	1115	c.978C>A	c.(976-978)CTC>CTA	p.L326L	CPEB1_uc002biq.2_Silent_p.L191L|CPEB1_uc002bir.2_Silent_p.L191L|CPEB1_uc002bis.2_Silent_p.L191L|CPEB1_uc010uod.1_Silent_p.L40L|CPEB1_uc010uoe.1_Silent_p.L269L|CPEB1_uc002biu.2_Silent_p.L293L|CPEB1_uc010uof.1_Silent_p.L191L|CPEB1_uc002biv.2_Silent_p.L266L|CPEB1_uc002bip.2_Silent_p.L40L	NM_001079533	NP_001073001	Q9BZB8	CPEB1_HUMAN	cytoplasmic polyadenylation element binding	266					mRNA processing|regulation of translation	cell junction|cytoplasmic mRNA processing body|dendrite|postsynaptic density|postsynaptic membrane	nucleotide binding|RNA binding			ovary(1)|breast(1)	2			BRCA - Breast invasive adenocarcinoma(143;0.229)			TGGGAGCTTCGAGGAGGTCCC	0.592													30	47	---	---	---	---	PASS
ZNF774	342132	broad.mit.edu	37	15	90897909	90897909	+	Nonsense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90897909C>A	uc002bpk.3	+	2	203	c.17C>A	c.(16-18)TCA>TAA	p.S6*		NM_001004309	NP_001004309	Q6NX45	ZN774_HUMAN	zinc finger protein 774	6	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(11;0.00551)|Lung NSC(78;0.0158)|all_lung(78;0.0331)		BRCA - Breast invasive adenocarcinoma(143;0.0224)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			CTGGGGACTTCAGGGAAGAGT	0.483													10	23	---	---	---	---	PASS
RUNDC2A	84127	broad.mit.edu	37	16	12142233	12142233	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:12142233G>A	uc002dbw.1	+	7	566	c.504G>A	c.(502-504)CTG>CTA	p.L168L		NM_032167	NP_115543	Q9HA26	RUN2A_HUMAN	RUN domain containing 2A	168	RUN.									ovary(1)	1						GGGCAGGTCTGAACTCCATAC	0.473			T	CIITA	PMBL|Hodgkin Lymphona|								69	101	---	---	---	---	PASS
ERCC4	2072	broad.mit.edu	37	16	14014057	14014057	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14014057T>C	uc002dce.2	+	1	44	c.35T>C	c.(34-36)ATG>ACG	p.M12T	ERCC4_uc010bva.2_Missense_Mutation_p.M12T	NM_005236	NP_005227	Q92889	XPF_HUMAN	excision repair cross-complementing rodent	12					double-strand break repair via homologous recombination|meiotic mismatch repair|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|resolution of meiotic recombination intermediates|telomere maintenance via telomere shortening|transcription-coupled nucleotide-excision repair	nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair factor 1 complex	damaged DNA binding|protein C-terminus binding|protein N-terminus binding|single-stranded DNA binding|single-stranded DNA specific endodeoxyribonuclease activity			lung(4)|ovary(3)|skin(2)|pancreas(1)	10						CGGATTGCCATGGCGCCGCTG	0.677			Mis|N|F			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				20	47	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20442601	20442601	+	Silent	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20442601T>A	uc002dhe.2	+	10	1413	c.1266T>A	c.(1264-1266)CGT>CGA	p.R422R		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	422					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						TTGCCGTCCGTATCAGACCCA	0.453													67	135	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20554474	20554474	+	Silent	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20554474A>G	uc002dhj.3	-	12	1602	c.1392T>C	c.(1390-1392)GAT>GAC	p.D464D	ACSM2B_uc002dhk.3_Silent_p.D464D|ACSM2B_uc010bwf.1_Silent_p.D464D	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	464					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						AGTTAATGATATCATCTGCCC	0.502													150	480	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25264286	25264286	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25264286C>T	uc002dod.3	-	3	1066	c.659G>A	c.(658-660)CGG>CAG	p.R220Q	ZKSCAN2_uc010vcl.1_Silent_p.T12T|ZKSCAN2_uc002doe.2_Missense_Mutation_p.R220Q	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2	220					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		AGCAGGAAGCCGTGTGGTTGT	0.328													10	879	---	---	---	---	PASS
HS3ST4	9951	broad.mit.edu	37	16	26147451	26147451	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26147451C>T	uc002dof.2	+	2	1645	c.1253C>T	c.(1252-1254)CCT>CTT	p.P418L		NM_006040	NP_006031	Q9Y661	HS3S4_HUMAN	heparan sulfate D-glucosaminyl	418	Lumenal (Potential).				heparan sulfate proteoglycan metabolic process	extracellular region|Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			large_intestine(1)|breast(1)	2				GBM - Glioblastoma multiforme(48;0.0988)		CGGACTCATCCTCGCATTGAC	0.463													11	154	---	---	---	---	PASS
SRCAP	10847	broad.mit.edu	37	16	30724634	30724634	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30724634G>C	uc002dze.1	+	15	2621	c.2236G>C	c.(2236-2238)GAT>CAT	p.D746H	SRCAP_uc002dzf.2_RNA|SRCAP_uc002dzg.1_Missense_Mutation_p.D603H|SRCAP_uc010bzz.1_Missense_Mutation_p.D316H	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein	746	Helicase ATP-binding.				interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			TCTCATTCTGGATGAGGCGCA	0.527													40	208	---	---	---	---	PASS
GNAO1	2775	broad.mit.edu	37	16	56385452	56385452	+	Intron	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56385452G>T	uc002eiu.3	+							NM_020988	NP_066268	P09471	GNAO_HUMAN	guanine nucleotide binding protein, alpha						dopamine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|muscle contraction	heterotrimeric G-protein complex	G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|metabotropic serotonin receptor binding|signal transducer activity			lung(1)|breast(1)	2		all_neural(199;0.159)				ATACACAGGTGGGTGCCAGGC	0.557													19	20	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57059850	57059850	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57059850G>A	uc002ekk.1	+	6	1220	c.995G>A	c.(994-996)TGC>TAC	p.C332Y	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.C137Y|NLRC5_uc002ekl.2_Missense_Mutation_p.C137Y|NLRC5_uc002ekm.2_Missense_Mutation_p.C137Y|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	332	NACHT.				defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TCCCATCTCTGCAATGGGACC	0.547													4	65	---	---	---	---	PASS
SF3B3	23450	broad.mit.edu	37	16	70604043	70604043	+	Silent	SNP	G	A	A	rs117807189	by1000genomes	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70604043G>A	uc002ezf.2	+	24	3610	c.3399G>A	c.(3397-3399)ACG>ACA	p.T1133T		NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	1133					protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				TGCCATTCACGTCCCATGAGG	0.502													35	27	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1538132	1538132	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1538132G>C	uc002fsz.1	-	11	2463	c.2413C>G	c.(2413-2415)CAG>GAG	p.Q805E	SCARF1_uc002fsy.1_3'UTR|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Missense_Mutation_p.Q719E	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	805	Cytoplasmic (Potential).				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		GCCTGCTTCTGGGGATCCTGT	0.592													5	186	---	---	---	---	PASS
PRPF8	10594	broad.mit.edu	37	17	1585180	1585180	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1585180T>A	uc002fte.2	-	5	701	c.587A>T	c.(586-588)GAC>GTC	p.D196V		NM_006445	NP_006436	Q6P2Q9	PRP8_HUMAN	U5 snRNP-specific protein	196						catalytic step 2 spliceosome|nuclear speck|U5 snRNP	protein binding|RNA binding			lung(4)|ovary(2)	6				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		CTCCTCAGGGTCCAGCTCTAG	0.547													5	138	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578382	7578382	+	Nonsense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578382G>C	uc002gim.2	-	5	742	c.548C>G	c.(547-549)TCA>TGA	p.S183*	TP53_uc002gig.1_Nonsense_Mutation_p.S183*|TP53_uc002gih.2_Nonsense_Mutation_p.S183*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.S51*|TP53_uc010cng.1_Nonsense_Mutation_p.S51*|TP53_uc002gii.1_Nonsense_Mutation_p.S51*|TP53_uc010cnh.1_Nonsense_Mutation_p.S183*|TP53_uc010cni.1_Nonsense_Mutation_p.S183*|TP53_uc002gij.2_Nonsense_Mutation_p.S183*|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Nonsense_Mutation_p.S90*|TP53_uc002gio.2_Nonsense_Mutation_p.S51*|TP53_uc010vug.1_Nonsense_Mutation_p.S144*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	183	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		S -> P (in sporadic cancers; somatic mutation).|S -> L (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.S183*(21)|p.0?(7)|p.R174fs*24(3)|p.S183P(3)|p.?(2)|p.S183L(2)|p.V173fs*59(2)|p.K164_P219del(1)|p.E180_S183del(1)|p.E171fs*61(1)|p.V173fs*23(1)|p.R81fs*24(1)|p.R42fs*24(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATCGCTATCTGAGCAGCGCTC	0.647		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			51	22	---	---	---	---	PASS
FBXW10	10517	broad.mit.edu	37	17	18668086	18668086	+	Nonsense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18668086C>T	uc002guk.2	+	8	1697	c.1465C>T	c.(1465-1467)CGA>TGA	p.R489*	FBXW10_uc002guj.2_Nonsense_Mutation_p.R489*|FBXW10_uc002gul.2_Nonsense_Mutation_p.R518*|FBXW10_uc010cqh.1_Nonsense_Mutation_p.R489*	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10	489	WD 3.									ovary(1)	1						GGTTTGCACACGAATCTTCGG	0.493													6	103	---	---	---	---	PASS
SLFN11	91607	broad.mit.edu	37	17	33689942	33689942	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33689942G>A	uc010ctp.2	-	4	1327	c.885C>T	c.(883-885)TTC>TTT	p.F295F	SLFN11_uc010ctq.2_Silent_p.F295F|SLFN11_uc002hjh.3_Silent_p.F295F|SLFN11_uc002hjg.3_Silent_p.F295F|SLFN11_uc010ctr.2_Silent_p.F295F	NM_001104588	NP_001098058	Q7Z7L1	SLN11_HUMAN	schlafen family member 11	295						nucleus	ATP binding			large_intestine(1)|ovary(1)|skin(1)	3		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TTTTGAGTGTGAAGGTTATCG	0.418													118	41	---	---	---	---	PASS
KRTAP9-8	83901	broad.mit.edu	37	17	39394625	39394625	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39394625C>A	uc002hwh.3	+	1	356	c.322C>A	c.(322-324)CCC>ACC	p.P108T	KRTAP9-9_uc010wfq.1_Intron	NM_031963	NP_114169	Q9BYQ0	KRA98_HUMAN	keratin associated protein 9.8	108	15 X 5 AA repeats of C-C-[RQVSGE]- [SPSNQ]-[TASPI].					keratin filament				ovary(1)	1		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CTGCTACCACCCCACGACTGT	0.627													82	40	---	---	---	---	PASS
C17orf57	124989	broad.mit.edu	37	17	45452306	45452306	+	Missense_Mutation	SNP	C	T	T	rs144496511	by1000genomes	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45452306C>T	uc002iln.2	+	12	1757	c.1346C>T	c.(1345-1347)ACG>ATG	p.T449M	C17orf57_uc002ilm.2_Missense_Mutation_p.T353M|C17orf57_uc002ill.1_Missense_Mutation_p.T205M|C17orf57_uc010daz.1_Missense_Mutation_p.T401M	NM_152347	NP_689560	Q8IY85	CQ057_HUMAN	hypothetical protein LOC124989	449							calcium ion binding			breast(1)|central_nervous_system(1)|skin(1)	3						GTTTCGTCTACGGAAAAAACT	0.358													13	25	---	---	---	---	PASS
CCDC46	201134	broad.mit.edu	37	17	63746836	63746836	+	Missense_Mutation	SNP	T	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63746836T>G	uc002jfl.2	-	22	2620	c.2401A>C	c.(2401-2403)AGC>CGC	p.S801R	CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Missense_Mutation_p.S801R|CCDC46_uc010dep.2_Missense_Mutation_p.S759R|CCDC46_uc002jfk.2_Missense_Mutation_p.S57R	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a	801	Potential.					centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			TTCAGCTTGCTGTTGGCCTGA	0.443													3	88	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72344020	72344020	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72344020C>A	uc002jkm.3	+	9	1167	c.1029C>A	c.(1027-1029)GCC>GCA	p.A343A	KIF19_uc002jkj.2_Silent_p.A343A|KIF19_uc002jkk.2_Silent_p.A301A|KIF19_uc002jkl.2_Silent_p.A301A	NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	343					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						CCGGCCGGGCCAAGAACATTA	0.627													6	4	---	---	---	---	PASS
LLGL2	3993	broad.mit.edu	37	17	73566264	73566264	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73566264G>A	uc002joh.2	+	15	1956	c.1802G>A	c.(1801-1803)CGG>CAG	p.R601Q	LLGL2_uc002joi.2_Missense_Mutation_p.R601Q|LLGL2_uc010dgg.1_Missense_Mutation_p.R601Q|LLGL2_uc002joj.2_Missense_Mutation_p.R590Q|LLGL2_uc010wsd.1_Missense_Mutation_p.R228Q	NM_001031803	NP_001026973	Q6P1M3	L2GL2_HUMAN	lethal giant larvae homolog 2 isoform c	601	WD 10.				cell cycle|cell division|exocytosis|regulation of establishment or maintenance of cell polarity	cytoplasm|intracellular membrane-bounded organelle	PDZ domain binding			ovary(2)	2	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;1.8e-07)|Epithelial(20;1.38e-06)|Lung(188;0.0696)|LUSC - Lung squamous cell carcinoma(166;0.112)			TCTGAGTGGCGGCTCGTGGCC	0.662													5	6	---	---	---	---	PASS
UBE2O	63893	broad.mit.edu	37	17	74387085	74387085	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74387085A>T	uc002jrm.3	-	18	3883	c.3818T>A	c.(3817-3819)CTG>CAG	p.L1273Q	UBE2O_uc002jrl.3_Missense_Mutation_p.L877Q	NM_022066	NP_071349	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	1273							ATP binding|ubiquitin-protein ligase activity			breast(2)|skin(2)|lung(1)	5						GAACTGCGTCAGGACACCCCG	0.592													4	188	---	---	---	---	PASS
ACTG1	71	broad.mit.edu	37	17	79479272	79479272	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79479272G>A	uc002kaj.1	-	1	134	c.109C>T	c.(109-111)CGC>TGC	p.R37C	ACTG1_uc002kah.1_5'Flank|ACTG1_uc002kai.1_5'Flank|ACTG1_uc002kak.1_Missense_Mutation_p.R37C|ACTG1_uc010wun.1_Missense_Mutation_p.R37C|ACTG1_uc002kal.1_Missense_Mutation_p.R37C|ACTG1_uc002kag.2_RNA	NM_001614	NP_001605	P63261	ACTG_HUMAN	actin, gamma 1 propeptide	37					adherens junction organization|axon guidance|blood coagulation|cell junction assembly|cellular component movement	cytoskeleton|cytosol	ATP binding|identical protein binding			ovary(1)|central_nervous_system(1)	2	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			TGTCTGGGGCGCCCGACGATG	0.672													4	104	---	---	---	---	PASS
MC5R	4161	broad.mit.edu	37	18	13826449	13826449	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13826449C>T	uc010xaf.1	+	1	685	c.685C>T	c.(685-687)CGG>TGG	p.R229W		NM_005913	NP_005904	P33032	MC5R_HUMAN	melanocortin 5 receptor	229	Cytoplasmic (Potential).			ALPGASSARQRTSM -> LCPGPALRGRGPAW (in Ref. 1).	G-protein signaling, coupled to cyclic nucleotide second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocortin receptor activity|protein binding			ovary(3)|lung(2)|breast(1)	6						CAGCTCTGCGCGGCAGAGGAC	0.617													103	151	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31325999	31325999	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31325999A>G	uc010dmg.1	+	12	6242	c.6187A>G	c.(6187-6189)ACC>GCC	p.T2063A	ASXL3_uc002kxq.2_Missense_Mutation_p.T1770A	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	2063					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TACCATGGAAACCACTAAGAG	0.333													41	46	---	---	---	---	PASS
KIAA0427	9811	broad.mit.edu	37	18	46284319	46284319	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46284319A>T	uc002ldc.2	+	8	899	c.614A>T	c.(613-615)AAG>ATG	p.K205M	KIAA0427_uc002ldd.2_Missense_Mutation_p.K205M|KIAA0427_uc002lde.3_5'Flank	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1	205	Interaction with NCBP1/CBP80.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						GGGGGCAACAAGCCCCAACAG	0.642													68	92	---	---	---	---	PASS
PHLPP1	23239	broad.mit.edu	37	18	60642823	60642823	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60642823A>G	uc002lis.2	+	17	2591	c.2413A>G	c.(2413-2415)AAG>GAG	p.K805E		NM_194449	NP_919431	O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein	1317	PP2C-like.				apoptosis|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling	cytosol|membrane|nucleus	metal ion binding|protein serine/threonine phosphatase activity				0						AGAAGAGCTGAAGAGGATTAA	0.448													62	114	---	---	---	---	PASS
ZNF407	55628	broad.mit.edu	37	18	72343774	72343774	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72343774A>G	uc002llw.2	+	1	856	c.799A>G	c.(799-801)ACA>GCA	p.T267A	ZNF407_uc010xfc.1_Missense_Mutation_p.T267A|ZNF407_uc010dqu.1_Missense_Mutation_p.T267A|ZNF407_uc002llu.2_Missense_Mutation_p.T266A	NM_017757	NP_060227	Q9C0G0	ZN407_HUMAN	zinc finger protein 407 isoform 1	267	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TCTTGGCAAAACACATCTCCG	0.393													46	84	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74625758	74625758	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74625758C>T	uc002lmi.2	+	18	3157	c.2959C>T	c.(2959-2961)CGG>TGG	p.R987W	ZNF236_uc002lmj.2_RNA	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	987	C2H2-type 18.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCAGCATGTGCGGTCGCACAC	0.507													27	47	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76753910	76753910	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76753910C>A	uc002lmt.2	+	2	1919	c.1919C>A	c.(1918-1920)TCC>TAC	p.S640Y	SALL3_uc010dra.2_Missense_Mutation_p.S247Y	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	640					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		CCCGCCGTCTCCGAGCAGTTC	0.682													8	5	---	---	---	---	PASS
CREB3L3	84699	broad.mit.edu	37	19	4154889	4154889	+	Intron	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4154889G>T	uc002lzl.2	+						CREB3L3_uc002lzm.2_Intron|CREB3L3_uc010xib.1_Intron|CREB3L3_uc010xic.1_Intron	NM_032607	NP_115996	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like						response to unfolded protein	endoplasmic reticulum membrane|integral to membrane|nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTTCCTCGCGCCCCAGATGG	0.597													31	54	---	---	---	---	PASS
NDUFB7	4713	broad.mit.edu	37	19	14676967	14676967	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14676967A>G	uc002mzg.2	-	3	466	c.392T>C	c.(391-393)GTG>GCG	p.V131A		NM_004146	NP_004137	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	131					mitochondrial electron transport, NADH to ubiquinone|transport	mitochondrial intermembrane space|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			ovary(1)	1					NADH(DB00157)	CTTGGGGTCCACTTCCCCGGG	0.632													11	21	---	---	---	---	PASS
EMR2	30817	broad.mit.edu	37	19	14884813	14884813	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14884813G>T	uc002mzp.1	-	4	592	c.136C>A	c.(136-138)CGC>AGC	p.R46S	EMR2_uc010xnw.1_Missense_Mutation_p.R46S|EMR2_uc002mzo.1_Missense_Mutation_p.R46S|EMR2_uc002mzq.1_Missense_Mutation_p.R46S|EMR2_uc002mzr.1_Missense_Mutation_p.R46S|EMR2_uc002mzs.1_Missense_Mutation_p.R46S|EMR2_uc002mzt.1_Missense_Mutation_p.R46S|EMR2_uc002mzu.1_Missense_Mutation_p.R46S|EMR2_uc010xnx.1_5'Flank|EMR2_uc010xny.1_RNA	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	46	Extracellular (Potential).|EGF-like 1.				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						GGATTGCAGCGACAGGCGGTG	0.597													79	120	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17759744	17759744	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17759744T>C	uc002nhd.2	-	15	1837	c.1837A>G	c.(1837-1839)AGC>GGC	p.S613G		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	525					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						TTCAACGTGCTGGAGGCCAAG	0.607													4	11	---	---	---	---	PASS
FCHO1	23149	broad.mit.edu	37	19	17885100	17885100	+	Intron	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17885100C>A	uc010ebb.2	+						FCHO1_uc002nhg.3_Intron|FCHO1_uc002nhh.2_Intron|FCHO1_uc010xpw.1_Intron|FCHO1_uc010ebc.1_Intron	NM_001161358	NP_001154830	O14526	FCHO1_HUMAN	FCH domain only 1 isoform b											breast(1)	1						AAGGCAAGTACGTCTGGGCCT	0.537													31	58	---	---	---	---	PASS
IL12RB1	3594	broad.mit.edu	37	19	18188455	18188455	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18188455C>T	uc002nhw.1	-	5	484	c.420G>A	c.(418-420)GAG>GAA	p.E140E	IL12RB1_uc010xqb.1_Silent_p.E140E|IL12RB1_uc002nhx.1_Silent_p.E180E|IL12RB1_uc002nhy.2_Silent_p.E140E	NM_005535	NP_005526	P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1 isoform 1	140	Extracellular (Potential).				cellular response to interferon-gamma|interleukin-12-mediated signaling pathway|positive regulation of activated T cell proliferation|positive regulation of defense response to virus by host|positive regulation of interferon-gamma production|positive regulation of memory T cell differentiation|positive regulation of T cell mediated cytotoxicity|positive regulation of T-helper 1 type immune response|positive regulation of T-helper 17 cell lineage commitment|positive regulation of T-helper 17 type immune response	interleukin-12 receptor complex|interleukin-23 receptor complex	cytokine receptor activity			pancreas(1)	1						CCAGAGGAGGCTCATATTTAA	0.572													11	31	---	---	---	---	PASS
KLHL26	55295	broad.mit.edu	37	19	18779702	18779702	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18779702G>A	uc002njz.1	+	3	1522	c.1495G>A	c.(1495-1497)GTG>ATG	p.V499M		NM_018316	NP_060786	Q53HC5	KLH26_HUMAN	kelch-like 26	499	Kelch 4.									ovary(1)	1						CGAACCCCGCGTGCTACACGC	0.667													20	38	---	---	---	---	PASS
ZNF486	90649	broad.mit.edu	37	19	20307846	20307846	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20307846G>A	uc002nou.2	+	4	384	c.327G>A	c.(325-327)CTG>CTA	p.L109L		NM_052852	NP_443084	Q96H40	ZN486_HUMAN	zinc finger protein 486	109					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAGTGATACTGAGAAAATTTG	0.343													38	67	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155843	22155843	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155843A>T	uc002nqp.2	-	5	1842	c.1693T>A	c.(1693-1695)TAC>AAC	p.Y565N	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTACATTTGTAGGGCTTCTCT	0.383													25	60	---	---	---	---	PASS
ZNF681	148213	broad.mit.edu	37	19	23938269	23938269	+	Missense_Mutation	SNP	T	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23938269T>A	uc002nrk.3	-	2	230	c.88A>T	c.(88-90)AGG>TGG	p.R30W	ZNF681_uc002nrl.3_Intron|ZNF681_uc002nrj.3_Intron|ZNF681_uc002nrm.1_5'Flank	NM_138286	NP_612143	Q96N22	ZN681_HUMAN	zinc finger protein 681	30	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				ATCACATTCCTATATAAATTC	0.353													70	110	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24310244	24310244	+	Missense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24310244A>T	uc002nru.2	+	4	1576	c.1442A>T	c.(1441-1443)AAG>ATG	p.K481M	ZNF254_uc010xrk.1_Missense_Mutation_p.K396M	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	481	C2H2-type 10.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ACTAGACATAAGAGGATGCAC	0.383													28	40	---	---	---	---	PASS
RGS9BP	388531	broad.mit.edu	37	19	33167314	33167314	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33167314G>A	uc002ntp.1	+	1	1002	c.145G>A	c.(145-147)GAG>AAG	p.E49K	ANKRD27_uc002ntn.1_5'Flank|ANKRD27_uc002nto.1_5'Flank	NM_207391	NP_997274	Q6ZS82	R9BP_HUMAN	RGS9 anchor protein	49	Potential.|Cytoplasmic (Potential).				negative regulation of signal transduction	integral to membrane				central_nervous_system(1)	1	Esophageal squamous(110;0.137)					GAAGGCGCAGGAGCTGGCGGT	0.711													3	12	---	---	---	---	PASS
CCDC123	84902	broad.mit.edu	37	19	33417844	33417844	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33417844C>A	uc002nty.2	-	10	1165	c.1076G>T	c.(1075-1077)TGG>TTG	p.W359L	CCDC123_uc002ntx.2_Missense_Mutation_p.W112L|CCDC123_uc010edg.2_RNA|CCDC123_uc002ntz.1_Missense_Mutation_p.W359L	NM_032816	NP_116205	Q96ST8	CEP89_HUMAN	coiled-coil domain containing 123	359						centrosome|spindle pole					0	Esophageal squamous(110;0.137)					ACTTACCAACCAGGGTGGTAT	0.318													12	24	---	---	---	---	PASS
WDR88	126248	broad.mit.edu	37	19	33628589	33628589	+	Missense_Mutation	SNP	T	C	C	rs147156559	byFrequency	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33628589T>C	uc002nui.2	+	2	361	c.283T>C	c.(283-285)TTT>CTT	p.F95L		NM_173479	NP_775750	Q6ZMY6	WDR88_HUMAN	PQQ repeat and WD repeat domain containing	95										ovary(1)|breast(1)|central_nervous_system(1)	3	Esophageal squamous(110;0.137)					TCAGATCCCATTTAAAATTCT	0.338													24	52	---	---	---	---	PASS
SELV	348303	broad.mit.edu	37	19	40006578	40006578	+	Silent	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40006578C>G	uc010xvc.1	+	1	826	c.726C>G	c.(724-726)TCC>TCG	p.S242S		NM_182704	NP_874363	P59797	SELV_HUMAN	selenoprotein V	242					cell redox homeostasis		selenium binding				0	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;8.61e-26)|all cancers(26;2.76e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CGGCCATCTCCTTACAGAATT	0.612													15	3	---	---	---	---	PASS
CYP2A7	1549	broad.mit.edu	37	19	41387489	41387489	+	Intron	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41387489C>T	uc002opm.2	-						CYP2A7_uc002opo.2_Intron|CYP2A7_uc002opn.2_Intron	NM_000764	NP_000755	P20853	CP2A7_HUMAN	cytochrome P450, family 2, subfamily A,							endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(1)|haematopoietic_and_lymphoid_tissue(1)|skin(1)	3			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TGGGCACCCCCTCACCATAGC	0.622													65	21	---	---	---	---	PASS
ERCC1	2067	broad.mit.edu	37	19	45924470	45924470	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45924470G>A	uc002pbs.1	-	3	433	c.287C>T	c.(286-288)GCA>GTA	p.A96V	ERCC1_uc002pbt.1_Missense_Mutation_p.A96V|ERCC1_uc002pbu.1_Intron|ERCC1_uc002pbv.2_Missense_Mutation_p.A96V	NM_001983	NP_001974	P07992	ERCC1_HUMAN	excision repair cross-complementing 1 isofrom 2	96					mitotic recombination|negative regulation of telomere maintenance|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA incision, 3'-to lesion|nucleotide-excision repair, DNA incision, 5'-to lesion|response to oxidative stress|transcription-coupled nucleotide-excision repair	cytoplasm|nuclear chromosome, telomeric region|nucleoplasm|nucleotide-excision repair complex	damaged DNA binding|endonuclease activity|protein C-terminus binding|protein domain specific binding|single-stranded DNA binding			ovary(2)	2		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		GTTGGATTTTGCCCCGGGTTT	0.607								NER					69	17	---	---	---	---	PASS
SIGLEC9	27180	broad.mit.edu	37	19	51628948	51628948	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51628948G>A	uc002pvu.2	+	2	583	c.516G>A	c.(514-516)CAG>CAA	p.Q172Q	SIGLEC9_uc010yct.1_Silent_p.Q172Q	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	172	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CCTGTGAGCAGGGGACACCCC	0.667													4	99	---	---	---	---	PASS
ZNF835	90485	broad.mit.edu	37	19	57175283	57175283	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57175283G>T	uc010ygo.1	-	2	1350	c.1350C>A	c.(1348-1350)AGC>AGA	p.S450R	ZNF835_uc010ygn.1_Missense_Mutation_p.S428R	NM_001005850	NP_001005850			zinc finger protein 835											pancreas(3)|skin(1)	4						AGGAGCCCTGGCTGAAAGCTT	0.672													42	11	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9404577	9404577	+	Silent	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9404577A>G	uc002wnf.2	+	26	2602	c.2466A>G	c.(2464-2466)ACA>ACG	p.T822T	PLCB4_uc010gbw.1_Silent_p.T822T|PLCB4_uc010gbx.2_Silent_p.T834T|PLCB4_uc002wne.2_Silent_p.T822T|PLCB4_uc002wnh.2_Silent_p.T669T	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	822					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TTCTTAAAACATATGTGCCTG	0.363													16	36	---	---	---	---	PASS
ZNF133	7692	broad.mit.edu	37	20	18296189	18296189	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18296189C>A	uc010gcq.2	+	5	999	c.694C>A	c.(694-696)CAC>AAC	p.H232N	ZNF133_uc010zrv.1_Missense_Mutation_p.H235N|ZNF133_uc010zrw.1_Missense_Mutation_p.H169N|ZNF133_uc010gcr.2_Missense_Mutation_p.H232N|ZNF133_uc010zrx.1_Missense_Mutation_p.H137N|ZNF133_uc002wql.3_Missense_Mutation_p.H231N|ZNF133_uc010gcs.2_Missense_Mutation_p.H231N|ZNF133_uc010zry.1_Missense_Mutation_p.H137N|ZNF133_uc002wqm.2_Missense_Mutation_p.H232N	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	232	C2H2-type 1.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2						CCTGCTCAGTCACCAGCGGAT	0.502													44	49	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18395156	18395156	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18395156G>T	uc010zsa.1	-	12	1344	c.1135C>A	c.(1135-1137)CTC>ATC	p.L379I	C20orf12_uc010zrz.1_5'Flank|C20orf12_uc002wqp.3_Missense_Mutation_p.L70I|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.L246I|C20orf12_uc002wqq.3_Missense_Mutation_p.L360I|C20orf12_uc002wqu.1_RNA|C20orf12_uc010gct.1_RNA	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184	187						intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				GGAATGCCGAGCTAGAGGATA	0.368													10	7	---	---	---	---	PASS
ELMO2	63916	broad.mit.edu	37	20	45000526	45000526	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45000526C>A	uc002xrt.1	-	17	1709	c.1499G>T	c.(1498-1500)CGT>CTT	p.R500L	ELMO2_uc010zxq.1_Missense_Mutation_p.R232L|ELMO2_uc002xrs.1_Missense_Mutation_p.R247L|ELMO2_uc002xru.1_Missense_Mutation_p.R500L|ELMO2_uc010zxr.1_Missense_Mutation_p.R512L|ELMO2_uc010zxs.1_Missense_Mutation_p.R317L|ELMO2_uc002xrv.1_Missense_Mutation_p.R219L	NM_133171	NP_573403	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2	500					apoptosis|cell chemotaxis|phagocytosis	cytoskeleton|cytosol|membrane	lyase activity|receptor tyrosine kinase binding|SH3 domain binding			ovary(1)	1		Myeloproliferative disorder(115;0.0122)				ACTCAGGCTACGCAATTTGCT	0.502													3	99	---	---	---	---	PASS
FAM65C	140876	broad.mit.edu	37	20	49224934	49224934	+	Silent	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49224934C>T	uc002xvm.2	-	11	1254	c.936G>A	c.(934-936)GTG>GTA	p.V312V	FAM65C_uc010zyt.1_Silent_p.V316V|FAM65C_uc010zyu.1_RNA|FAM65C_uc002xvn.1_Silent_p.V312V	NM_080829	NP_543019	Q96MK2	FA65C_HUMAN	hypothetical protein LOC140876	312										ovary(2)	2						ACTTCCACTGCACCTCCAGCT	0.652													17	42	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57480498	57480498	+	Missense_Mutation	SNP	C	T	T	rs137854532		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57480498C>T	uc002xzw.2	+	6	2707	c.2422C>T	c.(2422-2424)CGC>TGC	p.R808C	GNAS_uc002xzt.2_3'UTR|GNAS_uc010gjq.2_Missense_Mutation_p.R106C|GNAS_uc002xzx.2_Missense_Mutation_p.R106C|GNAS_uc010gjr.2_Missense_Mutation_p.R56C|GNAS_uc002xzy.2_Missense_Mutation_p.R91C|GNAS_uc002yaa.2_Missense_Mutation_p.R151C|GNAS_uc010zzt.1_Missense_Mutation_p.R166C|GNAS_uc002yab.2_Intron|GNAS_uc002yad.2_Missense_Mutation_p.R56C|GNAS_uc002yae.2_Missense_Mutation_p.R90C	NM_080425	NP_536350	P63092	GNAS2_HUMAN	GNAS complex locus XLas	165			R -> C (in AHO).		activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTGCTACGAACGCTCCAACGA	0.468			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			8	105	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10969131	10969131	+	Intron	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10969131A>T	uc002yip.1	-						TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology						signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TGTGTGGGCTAGAGGATGATA	0.264													30	147	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34923873	34923873	+	Missense_Mutation	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34923873G>C	uc002yse.1	+	3	2385	c.2336G>C	c.(2335-2337)AGC>ACC	p.S779T	SON_uc002ysb.1_Missense_Mutation_p.S779T|SON_uc002ysc.2_Missense_Mutation_p.S779T|SON_uc002ysd.2_Intron|SON_uc002ysf.1_Intron|SON_uc002ysg.2_5'Flank	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	779	17 X 10 AA tandem repeats of L-A-[ST]- [NSG]-[TS]-MDSQM.				anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						TTAGCAACTAGCTCCATGGAC	0.507													15	194	---	---	---	---	PASS
TRAPPC10	7109	broad.mit.edu	37	21	45513965	45513965	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45513965G>T	uc002zea.2	+	20	3188	c.3019G>T	c.(3019-3021)GTG>TTG	p.V1007L	TRAPPC10_uc010gpo.2_Missense_Mutation_p.V718L|TRAPPC10_uc011afa.1_Missense_Mutation_p.V385L|TRAPPC10_uc011afb.1_Missense_Mutation_p.V112L	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10	1007					vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						CAAGCAGTCGGTGTTCTTCGT	0.542													14	94	---	---	---	---	PASS
PRAME	23532	broad.mit.edu	37	22	22890661	22890661	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22890661C>A	uc002zwf.2	-	5	1514	c.1358G>T	c.(1357-1359)GGT>GTT	p.G453V	LOC96610_uc011aim.1_Intron|PRAME_uc011air.1_Missense_Mutation_p.G437V|PRAME_uc010gtr.2_Missense_Mutation_p.G453V|PRAME_uc002zwg.2_Missense_Mutation_p.G453V|PRAME_uc002zwh.2_Missense_Mutation_p.G453V|PRAME_uc002zwi.2_Missense_Mutation_p.G453V|PRAME_uc002zwj.2_Missense_Mutation_p.G453V|PRAME_uc002zwk.2_Missense_Mutation_p.G453V	NM_206956	NP_996839	P78395	PRAME_HUMAN	preferentially expressed antigen in melanoma	453	Mediates interaction with RARA.				apoptosis|cell differentiation|negative regulation of apoptosis|negative regulation of cell differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|positive regulation of cell proliferation|regulation of growth|transcription, DNA-dependent	nucleus|plasma membrane	retinoic acid receptor binding			central_nervous_system(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)|all_lung(157;4.03e-05)		READ - Rectum adenocarcinoma(21;0.0649)		GTGGAGGGTACCATGGATGTC	0.587													30	52	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26688413	26688413	+	Missense_Mutation	SNP	C	A	A	rs140163670		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26688413C>A	uc003acb.2	+	2	292	c.136C>A	c.(136-138)CTC>ATC	p.L46I	SEZ6L_uc003acc.2_Missense_Mutation_p.L46I|SEZ6L_uc011akc.1_Missense_Mutation_p.L46I|SEZ6L_uc003acd.2_Missense_Mutation_p.L46I|SEZ6L_uc011akd.1_Missense_Mutation_p.L46I|SEZ6L_uc003ace.2_Missense_Mutation_p.L46I|SEZ6L_uc003acf.1_5'UTR|SEZ6L_uc010gvc.1_5'UTR	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	46	Extracellular (Potential).					endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						GGGTCCTTACCTCCTGCCCTC	0.572													18	18	---	---	---	---	PASS
MN1	4330	broad.mit.edu	37	22	28192792	28192792	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28192792G>A	uc003adj.2	-	1	4695	c.3740C>T	c.(3739-3741)CCC>CTC	p.P1247L		NM_002430	NP_002421	Q10571	MN1_HUMAN	meningioma  1	1247							binding			central_nervous_system(3)|lung(3)|large_intestine(1)|breast(1)|skin(1)|ovary(1)	10						CTTCTCCCAGGGCGCCAACGT	0.617			T	ETV6	AML|meningioma								69	97	---	---	---	---	PASS
APOL6	80830	broad.mit.edu	37	22	36054912	36054912	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36054912G>A	uc003aoe.2	+	3	595	c.301G>A	c.(301-303)GCA>ACA	p.A101T	APOL6_uc003aod.2_RNA	NM_030641	NP_085144	Q9BWW8	APOL6_HUMAN	apolipoprotein L6	101					lipoprotein metabolic process	cytoplasm|extracellular region	lipid binding|lipid transporter activity				0						CCTTGCCCCAGCAACAGGAGG	0.557													18	32	---	---	---	---	PASS
CYB5R3	1727	broad.mit.edu	37	22	43023325	43023325	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43023325C>A	uc003bcz.2	-	7	702	c.618G>T	c.(616-618)CTG>CTT	p.L206L	CYB5R3_uc010gzc.1_Silent_p.L80L|CYB5R3_uc003bcw.2_Silent_p.L196L|CYB5R3_uc011aps.1_Silent_p.L239L|CYB5R3_uc003bcy.2_Silent_p.L183L|CYB5R3_uc003bcx.2_Silent_p.L183L	NM_000398	NP_000389	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3 isoform m	206	FAD (By similarity).				blood circulation|cholesterol biosynthetic process|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|hemoglobin complex|mitochondrial outer membrane	cytochrome-b5 reductase activity			skin(1)	1					NADH(DB00157)	TGGCAAAGAGCAGGTGGCACA	0.612													11	29	---	---	---	---	PASS
GRAMD4	23151	broad.mit.edu	37	22	47069654	47069654	+	Nonsense_Mutation	SNP	A	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47069654A>T	uc003bhx.2	+	14	1366	c.1327A>T	c.(1327-1329)AAG>TAG	p.K443*	GRAMD4_uc010had.2_Nonsense_Mutation_p.K382*|GRAMD4_uc003bhy.2_5'Flank	NM_015124	NP_055939	Q6IC98	GRAM4_HUMAN	death-inducing-protein	443					apoptosis	integral to membrane|mitochondrial membrane				ovary(1)	1		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CCACAGCACCAAGAAGGGCAA	0.622													66	110	---	---	---	---	PASS
NCAPH2	29781	broad.mit.edu	37	22	50957764	50957764	+	Intron	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50957764G>T	uc003blr.3	+						NCAPH2_uc003blq.3_Missense_Mutation_p.W292C|NCAPH2_uc003blv.2_Intron|NCAPH2_uc010hbb.2_Intron|NCAPH2_uc003blu.3_Intron|NCAPH2_uc003bls.3_Intron|NCAPH2_uc003blt.3_Intron|NCAPH2_uc003blw.3_Intron|NCAPH2_uc003blx.3_Intron|NCAPH2_uc003bly.3_Intron	NM_152299	NP_689512	Q6IBW4	CNDH2_HUMAN	kleisin beta isoform 2						chromosome condensation	chromosome|nucleus				ovary(1)|skin(1)	2		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		GACCCACATGGAGGCCTGCAG	0.647													6	16	---	---	---	---	PASS
SFRS17A	8227	broad.mit.edu	37	X	1720006	1720006	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1720006G>T	uc004cqa.2	+	5	1803	c.1607G>T	c.(1606-1608)GGC>GTC	p.G536V	SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_Intron	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	536					B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CCCGAGGATGGCTCTCCAGAG	0.642													16	18	---	---	---	---	PASS
FOXR2	139628	broad.mit.edu	37	X	55650591	55650591	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:55650591C>A	uc004duo.2	+	1	759	c.447C>A	c.(445-447)CCC>CCA	p.P149P		NM_198451	NP_940853	Q6PJQ5	FOXR2_HUMAN	forkhead box R2	149					embryo development|organ development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			lung(2)|central_nervous_system(1)	3						TCCATTCCCCCAGTGACTTTG	0.502													26	21	---	---	---	---	PASS
FAM123B	139285	broad.mit.edu	37	X	63412728	63412728	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63412728C>A	uc004dvo.2	-	2	712	c.439G>T	c.(439-441)GTG>TTG	p.V147L		NM_152424	NP_689637	Q5JTC6	F123B_HUMAN	family with sequence similarity 123B	147					Wnt receptor signaling pathway	cytoplasm|nucleus|plasma membrane		p.0?(40)|p.V147fs*11(1)		kidney(99)|large_intestine(6)|ovary(3)|lung(2)|breast(1)|liver(1)	112						GCTCCAGCCACAGATGTCTTA	0.532													29	53	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65409596	65409596	+	Missense_Mutation	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65409596C>A	uc011moz.1	+	6	948	c.888C>A	c.(886-888)CAC>CAA	p.H296Q	HEPH_uc004dwn.2_Missense_Mutation_p.H296Q|HEPH_uc004dwo.2_Missense_Mutation_p.H26Q|HEPH_uc010nkr.2_Missense_Mutation_p.H296Q|HEPH_uc011mpa.1_Missense_Mutation_p.H296Q	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	293	Extracellular (Potential).|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						TGGCCTGGCACTTGTTTGGCA	0.443													42	61	---	---	---	---	PASS
OPHN1	4983	broad.mit.edu	37	X	67283739	67283739	+	Silent	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67283739G>A	uc004dww.3	-	21	2409	c.2115C>T	c.(2113-2115)CAC>CAT	p.H705H	OPHN1_uc011mpg.1_Intron	NM_002547	NP_002538	O60890	OPHN1_HUMAN	oligophrenin 1	705	Pro-rich.				axon guidance|endocytosis|filopodium assembly|small GTPase mediated signal transduction|substrate-dependent cell migration, cell extension	axon|cell junction|cytosol|dendritic spine|synapse	cytoskeletal adaptor activity|Rho GTPase activator activity|SH3 domain binding			ovary(2)	2						GTCTCTTTATGTGGAAAGAGG	0.587													6	11	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70342205	70342205	+	Intron	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70342205G>C	uc004dyy.2	+						MED12_uc011mpq.1_Intron|MED12_uc004dyz.2_Intron|MED12_uc004dza.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					AGGTATGTCTGACCACTAGCC	0.502													22	53	---	---	---	---	PASS
ZMYM3	9203	broad.mit.edu	37	X	70468981	70468981	+	Silent	SNP	G	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70468981G>C	uc004dzh.1	-	8	1596	c.1509C>G	c.(1507-1509)ACC>ACG	p.T503T	BCYRN1_uc011mpt.1_Intron|ZMYM3_uc004dzi.1_Silent_p.T503T|ZMYM3_uc004dzj.1_Silent_p.T503T	NM_201599	NP_963893	Q14202	ZMYM3_HUMAN	zinc finger protein 261	503	MYM-type 4.				multicellular organismal development	nucleus	DNA binding|zinc ion binding			ovary(1)	1	Renal(35;0.156)					TCTTACACAGGGTCTTGCACC	0.453													59	136	---	---	---	---	PASS
TGIF2LX	90316	broad.mit.edu	37	X	89177498	89177498	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89177498C>A	uc004efe.2	+	2	463	c.414C>A	c.(412-414)ACC>ACA	p.T138T		NM_138960	NP_620410	Q8IUE1	TF2LX_HUMAN	TGFB-induced factor homeobox 2-like, X-linked	138						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|skin(1)	2						TGCAGAGCACCGAGGCGTCTG	0.587													22	48	---	---	---	---	PASS
DRP2	1821	broad.mit.edu	37	X	100510221	100510221	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100510221G>T	uc004egz.2	+	20	2598	c.2229G>T	c.(2227-2229)TTG>TTT	p.L743F	DRP2_uc011mrh.1_Missense_Mutation_p.L665F	NM_001939	NP_001930	Q13474	DRP2_HUMAN	dystrophin related protein 2	743					central nervous system development	cytoplasm|cytoskeleton	zinc ion binding			ovary(2)	2						ATGACAGCTTGTCCCCAGATG	0.463													85	124	---	---	---	---	PASS
BTK	695	broad.mit.edu	37	X	100613622	100613622	+	Silent	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100613622C>G	uc004ehg.2	-	11	1150	c.957G>C	c.(955-957)GTG>GTC	p.V319V	BTK_uc004ehf.2_5'Flank|BTK_uc010nnh.2_5'Flank|BTK_uc010nni.2_5'Flank|BTK_uc004ehe.2_5'Flank|BTK_uc010nnj.2_5'Flank|BTK_uc010nnk.2_5'Flank|BTK_uc010nnl.2_5'Flank|BTK_uc010nnm.2_5'Flank|BTK_uc010nnn.2_Silent_p.V319V|BTK_uc010nno.2_Silent_p.V353V|BTK_uc004ehh.1_5'Flank|BTK_uc004ehi.2_Silent_p.V319V	NM_000061	NP_000052	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	319	SH2.		V -> A (in XLA; moderate).		calcium-mediated signaling|induction of apoptosis by extracellular signals|mesoderm development	cytosol|membrane raft|nucleus|plasma membrane	ATP binding|identical protein binding|metal ion binding|non-membrane spanning protein tyrosine kinase activity|phosphatidylinositol-3,4,5-trisphosphate binding			lung(3)|central_nervous_system(2)|ovary(1)	6						ATTTAGCAAACACAGACACTG	0.483									Agammaglobulinemia_X-linked				18	381	---	---	---	---	PASS
BEX1	55859	broad.mit.edu	37	X	102317851	102317851	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102317851G>T	uc004ejt.1	-	3	592	c.352C>A	c.(352-354)CAT>AAT	p.H118N		NM_018476	NP_060946	Q9HBH7	BEX1_HUMAN	brain expressed, X-linked 1	118					cell differentiation|nervous system development	cytoplasm|nucleus				ovary(1)	1						AACTCATCATGATGGTCATGG	0.488													78	107	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105179165	105179165	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105179165A>G	uc004emd.2	+	21	3806	c.3503A>G	c.(3502-3504)TAC>TGC	p.Y1168C	NRK_uc010npc.1_Missense_Mutation_p.Y836C	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1168							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TTTGCAGTATACGCTGGATTC	0.383										HNSCC(51;0.14)			57	103	---	---	---	---	PASS
AGTR2	186	broad.mit.edu	37	X	115304242	115304242	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115304242C>T	uc004eqh.3	+	3	916	c.709C>T	c.(709-711)CAC>TAC	p.H237Y		NM_000686	NP_000677	P50052	AGTR2_HUMAN	angiotensin II receptor, type 2	237	Cytoplasmic (Potential).				behavior|blood vessel remodeling|brain development|G-protein signaling, coupled to cGMP nucleotide second messenger|intracellular protein kinase cascade|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of heart rate|negative regulation of nerve growth factor receptor signaling pathway|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of nitric-oxide synthase activity|positive regulation of phosphoprotein phosphatase activity|positive regulation of vasodilation|regulation of systemic arterial blood pressure by circulatory renin-angiotensin		angiotensin type II receptor activity|receptor antagonist activity			ovary(2)|lung(1)	3						AATTAGAAAACACTTACTGAA	0.403													35	59	---	---	---	---	PASS
WDR44	54521	broad.mit.edu	37	X	117527019	117527019	+	Missense_Mutation	SNP	C	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117527019C>G	uc004eqn.2	+	4	1036	c.611C>G	c.(610-612)GCC>GGC	p.A204G	WDR44_uc004eqo.2_Missense_Mutation_p.A204G|WDR44_uc011mtr.1_Missense_Mutation_p.A179G|WDR44_uc010nqi.2_5'UTR	NM_019045	NP_061918	Q5JSH3	WDR44_HUMAN	WD repeat domain 44 protein	204						cytosol|endosome membrane|Golgi apparatus|perinuclear region of cytoplasm				lung(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5						AAAGATTTTGCCGCTGTGGAA	0.488													36	107	---	---	---	---	PASS
DOCK11	139818	broad.mit.edu	37	X	117731508	117731508	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:117731508C>T	uc004eqp.2	+	21	2441	c.2378C>T	c.(2377-2379)TCA>TTA	p.S793L	DOCK11_uc004eqq.2_Missense_Mutation_p.S559L	NM_144658	NP_653259	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	793	DHR-1.				blood coagulation	cytosol	GTP binding			ovary(3)	3						GATGCAGAATCAAGAAGGGTA	0.368													47	72	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123034478	123034478	+	Missense_Mutation	SNP	C	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123034478C>T	uc010nqu.2	+	6	1361	c.1235C>T	c.(1234-1236)GCA>GTA	p.A412V	XIAP_uc004etx.2_Missense_Mutation_p.A412V|XIAP_uc010nqv.2_Missense_Mutation_p.A38V	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	412					anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						GTTCTGGTTGCAGATCTAGTG	0.343									X-linked_Lymphoproliferative_syndrome				25	62	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123197734	123197734	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123197734G>T	uc004etz.3	+	19	2197	c.1858G>T	c.(1858-1860)GTA>TTA	p.V620L	STAG2_uc004eua.2_Missense_Mutation_p.V620L|STAG2_uc004eub.2_Missense_Mutation_p.V620L|STAG2_uc004euc.2_Missense_Mutation_p.V620L|STAG2_uc004eud.2_Missense_Mutation_p.V620L|STAG2_uc004eue.2_Missense_Mutation_p.V620L	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	620					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						CCGGAATATTGTAGAGAAGCA	0.338													48	70	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123516596	123516596	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123516596G>T	uc004euj.2	-	30	7407	c.7343C>A	c.(7342-7344)CCT>CAT	p.P2448H	ODZ1_uc011muj.1_Missense_Mutation_p.P2454H|ODZ1_uc010nqy.2_Missense_Mutation_p.P2455H	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2448	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TTCTAATTCAGGTTTGGGAAA	0.353													117	213	---	---	---	---	PASS
ACTRT1	139741	broad.mit.edu	37	X	127185764	127185764	+	Missense_Mutation	SNP	G	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:127185764G>A	uc004eum.2	-	1	619	c.422C>T	c.(421-423)GCG>GTG	p.A141V		NM_138289	NP_612146	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	141						cytoplasm|cytoskeleton				ovary(2)|central_nervous_system(2)|skin(1)	5						CGCTGCCACCGCATGATTAGA	0.522													4	215	---	---	---	---	PASS
MAP7D3	79649	broad.mit.edu	37	X	135326828	135326828	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135326828G>T	uc004ezt.2	-	4	471	c.380C>A	c.(379-381)GCA>GAA	p.A127E	MAP7D3_uc004ezs.2_Missense_Mutation_p.A126E|MAP7D3_uc011mwc.1_Missense_Mutation_p.A109E|MAP7D3_uc010nsa.1_Missense_Mutation_p.A126E	NM_024597	NP_078873	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	127	Potential.					cytoplasm|spindle				ovary(2)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;0.000127)					TTTTTCTTCTGCAGCTATTCT	0.398													40	119	---	---	---	---	PASS
ZIC3	7547	broad.mit.edu	37	X	136649893	136649893	+	Missense_Mutation	SNP	A	G	G			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:136649893A>G	uc004fak.2	+	1	1548	c.1043A>G	c.(1042-1044)CAC>CGC	p.H348R		NM_003413	NP_003404	O60481	ZIC3_HUMAN	zinc finger protein of the cerebellum 3	348	C2H2-type 3.|Nuclear localization signal.				cell differentiation|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|breast(1)	3	Acute lymphoblastic leukemia(192;0.000127)					CTCAAGATCCACAAGAGGACC	0.612													44	88	---	---	---	---	PASS
RENBP	5973	broad.mit.edu	37	X	153209819	153209819	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153209819G>T	uc004fjo.1	-	2	249	c.79C>A	c.(79-81)CAG>AAG	p.Q27K	RENBP_uc011mzh.1_Missense_Mutation_p.Q27K|RENBP_uc011mzi.1_5'Flank	NM_002910	NP_002901	P51606	RENBP_HUMAN	renin binding protein	27					mannose metabolic process|regulation of blood pressure		endopeptidase inhibitor activity|mannose-6-phosphate isomerase activity|N-acylglucosamine 2-epimerase activity			ovary(1)|pancreas(1)	2	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				N-Acetyl-D-glucosamine(DB00141)	TCCAGCTCCTGCCCCACGCGC	0.637													40	104	---	---	---	---	PASS
MECP2	4204	broad.mit.edu	37	X	153296299	153296299	+	Missense_Mutation	SNP	G	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153296299G>T	uc004fjv.2	-	4	1206	c.980C>A	c.(979-981)ACC>AAC	p.T327N	MECP2_uc004fjw.2_Missense_Mutation_p.T339N	NM_004992	NP_004983	P51608	MECP2_HUMAN	methyl CpG binding protein 2 isoform 1	327					negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CTCACCGAGGGTGGACACCAG	0.617													43	75	---	---	---	---	PASS
MECP2	4204	broad.mit.edu	37	X	153297676	153297676	+	Missense_Mutation	SNP	T	C	C			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153297676T>C	uc004fjv.2	-	3	585	c.359A>G	c.(358-360)TAT>TGT	p.Y120C	MECP2_uc004fjw.2_Missense_Mutation_p.Y132C	NM_004992	NP_004983	P51608	MECP2_HUMAN	methyl CpG binding protein 2 isoform 1	120	MBD.		Y -> D (in RTT).		negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	heterochromatin|nucleus	double-stranded methylated DNA binding|protein domain specific binding|protein N-terminus binding|transcription corepressor activity				0	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATACACATCATACTTCCCAGC	0.522													36	83	---	---	---	---	PASS
SLC10A3	8273	broad.mit.edu	37	X	153716116	153716116	+	Silent	SNP	C	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153716116C>A	uc004flq.2	-	3	1428	c.1164G>T	c.(1162-1164)GTG>GTT	p.V388V	UBL4A_uc004flo.2_5'Flank|SLC10A3_uc004flr.2_Silent_p.V359V|SLC10A3_uc004flp.2_Silent_p.V388V	NM_001142392	NP_001135864	P09131	P3_HUMAN	solute carrier family 10, member 3 isoform 1	388	Helical; (Potential).				organic anion transport	integral to membrane	bile acid:sodium symporter activity			ovary(1)|skin(1)	2	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCGTGATACCCACCAGTACGA	0.627													24	41	---	---	---	---	PASS
C1orf83	127428	broad.mit.edu	37	1	54561861	54561861	+	Intron	DEL	G	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54561861delG	uc001cwt.1	+						C1orf83_uc001cwu.1_Intron	NM_153035	NP_694580	Q96MN5	TEAN2_HUMAN	hypothetical protein LOC127428						transcription, DNA-dependent	nucleus	DNA binding				0						AATTTCAGTTGATTAATGGAG	0.408													26	13	---	---	---	---	
CRB1	23418	broad.mit.edu	37	1	197298001	197298002	+	Frame_Shift_Del	DEL	TG	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197298001_197298002delTG	uc001gtz.2	+	2	655_656	c.520_521delTG	c.(520-522)TGTfs	p.C174fs	CRB1_uc010poz.1_Frame_Shift_Del_p.C105fs|CRB1_uc001gty.1_Frame_Shift_Del_p.C174fs|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Frame_Shift_Del_p.C174fs|CRB1_uc010ppb.1_Frame_Shift_Del_p.C174fs	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	174	Extracellular (Potential).|EGF-like 4; calcium-binding (Potential).				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						CTCCTGCTTCTGTGTCCCAGGA	0.495													21	10	---	---	---	---	
KIF3C	3797	broad.mit.edu	37	2	26152486	26152486	+	Intron	DEL	T	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26152486delT	uc002rgu.2	-						KIF3C_uc010eyj.1_Intron|KIF3C_uc010ykr.1_Intron	NM_002254	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C						blood coagulation|microtubule-based movement	cytosol|kinesin complex|microtubule	ATP binding|microtubule motor activity			ovary(3)|skin(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCATAGGCTCttttttttttt	0.294													4	2	---	---	---	---	
C2orf16	84226	broad.mit.edu	37	2	27799780	27799780	+	Frame_Shift_Del	DEL	A	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27799780delA	uc002rkz.3	+	1	392	c.341delA	c.(340-342)CAAfs	p.Q114fs		NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	114										large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					ACAAATTATCAAATCATGGAA	0.418													57	39	---	---	---	---	
REG1P	5969	broad.mit.edu	37	2	79364081	79364081	+	Intron	DEL	G	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79364081delG	uc002soa.1	-						REG1P_uc002sob.1_Intron|REG1P_uc002soc.1_RNA					Homo sapiens mRNA for Reg-related sequence derived peptide-1, complete cds.												0						GGAGCACTCAGTGAAGGAGGA	0.502													60	33	---	---	---	---	
LIMS1	3987	broad.mit.edu	37	2	109297018	109297021	+	Intron	DEL	AAAG	-	-	rs59337195		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109297018_109297021delAAAG	uc002teg.2	+						LIMS1_uc002tef.2_Intron|LIMS1_uc002teh.2_Intron|LIMS1_uc002tei.2_Intron|LIMS1_uc002tej.2_Intron|LIMS1_uc002tek.3_Intron	NM_004987	NP_004978	P48059	LIMS1_HUMAN	LIM and senescent cell antigen-like domains 1						cell aging|cell junction assembly|cellular response to transforming growth factor beta stimulus|negative regulation of transcription, DNA-dependent	cytosol|focal adhesion|perinuclear region of cytoplasm	protein binding|zinc ion binding				0						aaaaaaaaaaaaaGGTTCTTGAGA	0.230													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	132795504	132795505	+	IGR	INS	-	GCCACCCTCCGCA	GCCACCCTCCGCA	rs138246521	by1000genomes	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:132795504_132795505insGCCACCCTCCGCA								C2orf27B (236270 upstream) : NCRNA00164 (109659 downstream)																							GCGGCCCCTGCGCCACCCCATC	0.723													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	200524506	200524506	+	IGR	DEL	G	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200524506delG								FLJ32063 (182848 upstream) : C2orf69 (251473 downstream)																							TTTGAGGCACGGTGGGCTTTC	0.473													121	78	---	---	---	---	
FARP2	9855	broad.mit.edu	37	2	242373787	242373787	+	Intron	DEL	G	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242373787delG	uc002wbi.1	+						FARP2_uc010zoq.1_Intron|FARP2_uc010zor.1_Intron	NM_014808	NP_055623	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2						axon guidance|neuron remodeling|Rac protein signal transduction|regulation of Rho protein signal transduction	cytoskeleton|cytosol|extrinsic to membrane	cytoskeletal protein binding|Rho guanyl-nucleotide exchange factor activity			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TTGTAAAGCTGAGAAAATAGG	0.443													35	20	---	---	---	---	
ZNF621	285268	broad.mit.edu	37	3	40571112	40571115	+	Intron	DEL	TTTG	-	-	rs72322611		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40571112_40571115delTTTG	uc003ckm.2	+						ZNF621_uc003ckn.2_Intron|ZNF621_uc003cko.2_Intron|ZNF621_uc011aze.1_Intron	NM_001098414	NP_001091884	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		gtttgtttgttttgtttgtttgtt	0.176													3	6	---	---	---	---	
G3BP2	9908	broad.mit.edu	37	4	76583911	76583912	+	Intron	INS	-	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76583911_76583912insA	uc003hir.2	-						G3BP2_uc003his.2_Intron|G3BP2_uc003hit.2_Intron	NM_012297	NP_036429	Q9UN86	G3BP2_HUMAN	Ras-GTPase activating protein SH3 domain-binding						cytoplasmic sequestering of NF-kappaB|mRNA transport|Ras protein signal transduction|regulation of small GTPase mediated signal transduction	cytosol	GTPase activator activity|nucleotide binding|receptor signaling complex scaffold activity|RNA binding			breast(2)|central_nervous_system(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			aactccgtctcaaaaaaaaaag	0.104													11	10	---	---	---	---	
TET2	54790	broad.mit.edu	37	4	106156934	106156935	+	Frame_Shift_Ins	INS	-	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106156934_106156935insT	uc003hxk.2	+	3	2221_2222	c.1835_1836insT	c.(1834-1836)CCTfs	p.P612fs	TET2_uc011cez.1_Frame_Shift_Ins_p.P633fs|TET2_uc003hxj.2_RNA|TET2_uc010ilp.1_Frame_Shift_Ins_p.P612fs|TET2_uc003hxi.1_Frame_Shift_Ins_p.P612fs	NM_001127208	NP_001120680	Q6N021	TET2_HUMAN	tet oncogene family member 2 isoform a	612	Gln-rich.				cell cycle|myeloid cell differentiation		metal ion binding|methylcytosine dioxygenase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen	p.L590_H650del(1)		haematopoietic_and_lymphoid_tissue(732)|pancreas(1)	733		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCCAACATGCCTGGGGGGCTCC	0.450			Mis N|F		MDS								22	22	---	---	---	---	
DST	667	broad.mit.edu	37	6	56507088	56507089	+	Intron	DEL	TT	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56507088_56507089delTT	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron|DST_uc003pcy.3_Intron|DST_uc003pdb.2_Intron|DST_uc003pdc.3_Intron|DST_uc003pdd.3_Intron|DST_uc003pde.2_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTTAACAAACTTTAAGTTTCAG	0.366													11	5	---	---	---	---	
SNORD93	692210	broad.mit.edu	37	7	22896087	22896089	+	5'Flank	DEL	AAA	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:22896087_22896089delAAA	uc003svl.2	+							NR_003075				Homo sapiens small nucleolar RNA, C/D box 93 (SNORD93), non-coding RNA.												0						ACCACTCATTAAAAAACAAAATT	0.345													6	3	---	---	---	---	
DPY19L1	23333	broad.mit.edu	37	7	34979738	34979739	+	Intron	INS	-	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34979738_34979739insT	uc003tem.3	-						DPY19L1_uc003tel.1_5'Flank	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1							integral to membrane					0						AATAATATGACtttttttttct	0.317													4	2	---	---	---	---	
GTF2IRD2P1	401375	broad.mit.edu	37	7	72662348	72662349	+	Intron	INS	-	A	A			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72662348_72662349insA	uc003txs.1	-						FKBP6_uc003twz.2_Intron	NR_002164				RecName: Full=General transcription factor II-I repeat domain-containing protein 2B; AltName: Full=GTF2I repeat domain-containing protein 2B; AltName: Full=Transcription factor GTF2IRD2-beta;												0						actctgtctccaaaaaaaaaaa	0.183													4	3	---	---	---	---	
BAZ1B	9031	broad.mit.edu	37	7	72877570	72877570	+	Intron	DEL	T	-	-	rs72371247		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72877570delT	uc003tyc.2	-							NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B						ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				ttcttttttcttttttttttt	0.129													10	5	---	---	---	---	
FAM71F2	346653	broad.mit.edu	37	7	128317558	128317559	+	Intron	INS	-	AAAAA	AAAAA	rs10659136		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317558_128317559insAAAAA	uc003vnk.3	+						FAM71F2_uc010llm.1_Intron|FAM71F2_uc003vnl.2_Intron|FAM71F2_uc010lln.1_Intron	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a												0						gactccgtctcaaaaaaaaaaa	0.223													4	3	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149515189	149515189	+	Splice_Site	DEL	A	-	-	rs112122477		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149515189delA	uc010lpk.2	+	81	11577	c.11577_splice	c.e81+2	p.E3859_splice		NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GACCTCGAGTAACTGCCCCAG	0.562													8	4	---	---	---	---	
CCDC25	55246	broad.mit.edu	37	8	27593580	27593580	+	3'UTR	DEL	A	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27593580delA	uc003xgc.2	-	9					CCDC25_uc003xgd.2_3'UTR|CCDC25_uc011lan.1_RNA|CCDC25_uc011lao.1_RNA|CCDC25_uc003xge.2_RNA	NM_018246	NP_060716	Q86WR0	CCD25_HUMAN	coiled-coil domain containing 25												0		Ovarian(32;0.000953)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0223)|KIRC - Kidney renal clear cell carcinoma(542;0.11)|Kidney(114;0.131)|Colorectal(74;0.154)		AAAAAGGTACAATTTTTTTAA	0.294													4	2	---	---	---	---	
POTEA	340441	broad.mit.edu	37	8	43173537	43173537	+	Intron	DEL	C	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43173537delC	uc003xpz.1	+						POTEA_uc003xqa.1_Intron	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2											ovary(1)	1						TCAATTAAAACAAAAAGGTAC	0.264													12	8	---	---	---	---	
AZIN1	51582	broad.mit.edu	37	8	103846382	103846383	+	Intron	DEL	AT	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103846382_103846383delAT	uc003ykx.2	-						AZIN1_uc003yky.2_Intron	NM_015878	NP_056962	O14977	AZIN1_HUMAN	ornithine decarboxylase antizyme inhibitor						polyamine biosynthetic process|regulation of cellular amino acid metabolic process	cytosol	catalytic activity|protein binding				0	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			AAAGAAAGCAATTATTCTGTTA	0.347													60	31	---	---	---	---	
GLDC	2731	broad.mit.edu	37	9	6639010	6639011	+	Intron	INS	-	A	A	rs78066890		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6639010_6639011insA	uc003zkc.2	-							NM_000170	NP_000161	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)						glycine catabolic process	mitochondrion	electron carrier activity|glycine dehydrogenase (decarboxylating) activity|lyase activity|pyridoxal phosphate binding			ovary(2)	2		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	ctctgtctcagaaaaaaaaaaa	0.158													2	4	---	---	---	---	
NR4A3	8013	broad.mit.edu	37	9	102589219	102589220	+	Intron	INS	-	T	T	rs142732047	by1000genomes	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102589219_102589220insT	uc004baf.1	+						NR4A3_uc004bae.2_Intron|NR4A3_uc004bag.1_Intron|NR4A3_uc004bai.2_Intron	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AAAAACCGCCGTTTTTTACCAT	0.386			T	EWSR1	extraskeletal myxoid chondrosarcoma								0	10	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113192388	113192388	+	Intron	DEL	T	-	-	rs11331398		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113192388delT	uc010mtz.2	-						SVEP1_uc010mty.2_5'Flank	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						gtttgttttcttttttttttt	0.303													6	3	---	---	---	---	
UGCG	7357	broad.mit.edu	37	9	114694304	114694304	+	Intron	DEL	A	-	-	rs34569956		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114694304delA	uc004bft.2	+							NM_003358	NP_003349	Q16739	CEGT_HUMAN	ceramide glucosyltransferase						epidermis development|glucosylceramide biosynthetic process	Golgi membrane|integral to membrane|membrane fraction	ceramide glucosyltransferase activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.0433)	Miglustat(DB00419)	cgtctcaagtaaaaaaaaaaa	0.104													4	4	---	---	---	---	
INSC	387755	broad.mit.edu	37	11	15134193	15134194	+	Intron	INS	-	G	G	rs148001480	by1000genomes	TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15134193_15134194insG	uc001mly.2	+						INSC_uc001mlz.2_5'Flank	NM_001031853	NP_001027024	Q1MX18	INSC_HUMAN	inscuteable isoform a						cell differentiation|nervous system development	cytoplasm	binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)	5						tATTGGGAAGTGGGGGGGGGGC	0.401													10	5	---	---	---	---	
MYBPC3	4607	broad.mit.edu	37	11	47359930	47359930	+	Intron	DEL	G	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47359930delG	uc001nfa.3	-						MYBPC3_uc010rhl.1_Intron	NM_000256	NP_000247	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac						cardiac muscle contraction|cell adhesion|muscle filament sliding|regulation of muscle filament sliding|regulation of striated muscle contraction|ventricular cardiac muscle tissue morphogenesis	C zone|cytosol|striated muscle myosin thick filament	actin binding|ATPase activator activity|metal ion binding|myosin heavy chain binding|structural constituent of muscle|titin binding			ovary(2)|central_nervous_system(1)	3				Lung(87;0.176)		GGCTCCTTTTGGGCAGAAAAA	0.602													6	3	---	---	---	---	
GRM5	2915	broad.mit.edu	37	11	88300875	88300875	+	Frame_Shift_Del	DEL	T	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88300875delT	uc001pcq.2	-	7	2176	c.1976delA	c.(1975-1977)TACfs	p.Y659fs	GRM5_uc009yvm.2_Frame_Shift_Del_p.Y659fs	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	659	Helical; Name=3; (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	AAGGGCTGAGTAGCTCATGGC	0.498													42	23	---	---	---	---	
PCBP2	5094	broad.mit.edu	37	12	53865708	53865709	+	Intron	INS	-	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53865708_53865709insT	uc001sdl.3	+						PCBP2_uc001sdc.3_Intron|PCBP2_uc001sdb.3_Intron|PCBP2_uc001sde.3_Intron|PCBP2_uc001sdi.3_Intron|PCBP2_uc001sdd.3_Intron|PCBP2_uc001sdf.3_Intron|PCBP2_uc009zna.2_Intron|PCBP2_uc010soi.1_Intron|PCBP2_uc001sdj.3_Intron|PCBP2_uc010soj.1_Intron|PCBP2_uc001sdk.3_Intron	NM_001128911	NP_001122383	Q15366	PCBP2_HUMAN	poly(rC) binding protein 2 isoform d						innate immune response|negative regulation of defense response to virus|negative regulation of type I interferon production|nuclear mRNA splicing, via spliceosome|proteasomal ubiquitin-dependent protein catabolic process|response to virus	cytosol|nucleoplasm|ribonucleoprotein complex	DNA binding|RNA binding|ubiquitin protein ligase binding				0						TGGCCAAAAGGTTTTTTTTTTT	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594096	69594102	+	IGR	DEL	AAGAGAT	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594096_69594102delAAGAGAT								CPM (237076 upstream) : CPSF6 (39215 downstream)																							agagataagaaagagataagagataag	0.024													6	3	---	---	---	---	
COL4A1	1282	broad.mit.edu	37	13	110908093	110908093	+	Intron	DEL	A	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110908093delA	uc001vqw.3	-						COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein						angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			gcaggaagggaagggggaagg	0.025													4	2	---	---	---	---	
HOMEZ	57594	broad.mit.edu	37	14	23764353	23764353	+	Intron	DEL	A	-	-	rs71425083		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23764353delA	uc001wjb.2	-							NM_020834	NP_065885	Q8IX15	HOMEZ_HUMAN	homeodomain leucine zipper protein							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		TCCCCCCACCAAAAAAAAAAA	0.328													2	4	---	---	---	---	
MDGA2	161357	broad.mit.edu	37	14	47669737	47669738	+	Intron	INS	-	TTT	TTT	rs10639284		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47669737_47669738insTTT	uc001wwj.3	-						MDGA2_uc001wwi.3_Intron|MDGA2_uc010ani.2_Intron	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1						spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						tttttcttttcttttttttttt	0.272													7	5	---	---	---	---	
CCNDBP1	23582	broad.mit.edu	37	15	43481303	43481304	+	Intron	INS	-	AAAA	AAAA			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43481303_43481304insAAAA	uc001zqv.2	+						CCNDBP1_uc001zqu.2_Intron|CCNDBP1_uc010bdc.2_Intron|CCNDBP1_uc010bdb.2_Intron|CCNDBP1_uc010udl.1_Intron|CCNDBP1_uc001zqw.2_Intron|CCNDBP1_uc001zqx.2_Intron|CCNDBP1_uc010bdd.2_Intron|CCNDBP1_uc001zqy.2_Intron	NM_012142	NP_036274	O95273	CCDB1_HUMAN	cyclin D-type binding-protein 1 isoform 1						cell cycle	cytoplasm|nucleus	protein binding			ovary(1)|kidney(1)	2		all_cancers(109;3.31e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.42e-07)		aaaaaaaaaagaaaaagaaaga	0.149													4	2	---	---	---	---	
MFAP1	4236	broad.mit.edu	37	15	44105706	44105706	+	Intron	DEL	C	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44105706delC	uc001zth.1	-							NM_005926	NP_005917	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1							microfibril				skin(1)	1		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		CATCCCAGGTCtttttttttt	0.204													7	4	---	---	---	---	
ACAN	176	broad.mit.edu	37	15	89398163	89398172	+	Frame_Shift_Del	DEL	GCCTCAGAGG	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89398163_89398172delGCCTCAGAGG	uc010upo.1	+	12	2721_2730	c.2347_2356delGCCTCAGAGG	c.(2347-2358)GCCTCAGAGGAAfs	p.A783fs	ACAN_uc010upp.1_Frame_Shift_Del_p.A783fs|ACAN_uc002bna.2_RNA	NM_013227	NP_037359	E7EX88	E7EX88_HUMAN	aggrecan isoform 2 precursor	783_786					cell adhesion		hyaluronic acid binding|sugar binding			ovary(2)|central_nervous_system(1)	3	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			AGTGCCCTCTGCCTCAGAGGAACCATCCCC	0.576													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16463436	16463436	+	5'Flank	DEL	C	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16463436delC	uc002dey.2	+											SubName: Full=cDNA FLJ42525 fis, clone BRACE3001391, highly similar to Polycystin;																		CTGCTCACCACCCCCCTCTGC	0.692													16	8	---	---	---	---	
DULLARD	23399	broad.mit.edu	37	17	7150790	7150790	+	Intron	DEL	T	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7150790delT	uc002gfd.2	-						DULLARD_uc002gfe.2_Intron|DULLARD_uc002gff.2_Intron|DULLARD_uc002gfc.2_Intron	NM_001143775	NP_001137247	O95476	CNEP1_HUMAN	dullard homolog						nuclear envelope organization|protein dephosphorylation	endoplasmic reticulum membrane|integral to membrane|nuclear membrane	protein serine/threonine phosphatase activity				0						tttcttcttcttttttttttt	0.075													4	2	---	---	---	---	
GPRC5C	55890	broad.mit.edu	37	17	72437119	72437120	+	Intron	INS	-	T	T	rs141781708		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72437119_72437120insT	uc002jks.2	+						GPRC5C_uc002jkp.2_Intron|GPRC5C_uc002jkq.2_Intron|GPRC5C_uc002jkr.2_Intron|GPRC5C_uc002jkt.2_Intron|GPRC5C_uc002jku.2_5'Flank	NM_018653	NP_061123	Q9NQ84	GPC5C_HUMAN	G protein-coupled receptor family C, group 5,							cytoplasmic vesicle membrane|integral to plasma membrane	G-protein coupled receptor activity|protein binding			ovary(2)|prostate(1)|central_nervous_system(1)|pancreas(1)	5						TAATTTAAAGATTTTTTTTTTT	0.198													4	5	---	---	---	---	
FOXK2	3607	broad.mit.edu	37	17	80544375	80544375	+	Intron	DEL	C	-	-	rs72318042		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80544375delC	uc002kfn.2	+						FOXK2_uc002kfm.1_Intron|FOXK2_uc010diu.2_Intron	NM_004514	NP_004505	Q01167	FOXK2_HUMAN	forkhead box K2						embryo development|pattern specification process|regulation of sequence-specific DNA binding transcription factor activity|regulation of transcription from RNA polymerase II promoter|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|magnesium ion binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding				0	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			caaaggtgggccgggggggaa	0.095													3	3	---	---	---	---	
KCNG2	26251	broad.mit.edu	37	18	77623691	77623692	+	In_Frame_Ins	INS	-	GGC	GGC	rs71338073		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77623691_77623692insGGC	uc010xfl.1	+	1	24_25	c.24_25insGGC	c.(22-27)insGGC	p.13_14insG		NM_012283	NP_036415	Q9UJ96	KCNG2_HUMAN	potassium voltage-gated channel, subfamily G,	13_14	Cytoplasmic (Potential).				energy reserve metabolic process|regulation of heart contraction|regulation of insulin secretion	voltage-gated potassium channel complex	delayed rectifier potassium channel activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;6.92e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0244)		CCTGCTccccgggcggcggcgg	0.614													8	4	---	---	---	---	
ZNF562	54811	broad.mit.edu	37	19	9767378	9767379	+	Intron	INS	-	T	T			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9767378_9767379insT	uc010xks.1	-						ZNF562_uc002mly.2_Intron|ZNF562_uc002mlx.2_Intron|ZNF562_uc010xkt.1_Intron|ZNF562_uc010xku.1_Intron|ZNF562_uc010xkv.1_Intron|ZNF562_uc010xkw.1_Intron	NM_001130032	NP_001123504	Q6V9R5	ZN562_HUMAN	zinc finger protein 562 isoform a						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTCATTTGTCCTTGTTTTCAAA	0.213													32	15	---	---	---	---	
PIH1D1	55011	broad.mit.edu	37	19	49954283	49954285	+	Intron	DEL	TTT	-	-	rs141324756		TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49954283_49954285delTTT	uc002pns.2	-						PIH1D1_uc010yap.1_Intron|PIH1D1_uc010yaq.1_Intron|ALDH16A1_uc002pnt.2_5'Flank|ALDH16A1_uc010yar.1_5'Flank|ALDH16A1_uc010yas.1_5'Flank|ALDH16A1_uc010yat.1_5'Flank	NM_017916	NP_060386	Q9NWS0	PIHD1_HUMAN	NOP17						box C/D snoRNP assembly	pre-snoRNP complex					0		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00152)|GBM - Glioblastoma multiforme(486;0.0244)		TTCCCAtttcttttttttttttt	0.222													4	2	---	---	---	---	
ERG	2078	broad.mit.edu	37	21	39774634	39774634	+	Intron	DEL	C	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39774634delC	uc010gnw.2	-						ERG_uc002yxa.2_Intron|ERG_uc011aek.1_Intron|ERG_uc010gnv.2_Intron|ERG_uc010gnx.2_Intron|ERG_uc011ael.1_Intron|ERG_uc002yxb.2_Intron|ERG_uc011aem.1_Intron|ERG_uc002yxc.3_Intron|ERG_uc010gny.1_Intron	NM_001136155	NP_001129627	P11308	ERG_HUMAN	ets-related isoform 4						cell proliferation|multicellular organismal development|protein phosphorylation	cytoplasm|nucleus|ribonucleoprotein complex	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity		TMPRSS2/ERG(2499)|FUS/ERG(163)|EWSR1/ERG(162)	prostate(2499)|bone(167)|haematopoietic_and_lymphoid_tissue(153)|soft_tissue(5)|lung(2)|skin(1)|ovary(1)	2828		Prostate(19;3.6e-06)				ACCTTTCTTACaaaaaaaaaa	0.303													6	3	---	---	---	---	
USP9X	8239	broad.mit.edu	37	X	41064887	41064887	+	Intron	DEL	T	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:41064887delT	uc004dfb.2	+						USP9X_uc004dfc.2_Intron	NM_001039590	NP_001034679	Q93008	USP9X_HUMAN	ubiquitin specific protease 9, X-linked isoform						BMP signaling pathway|cell division|chromosome segregation|female gamete generation|mitosis|protein deubiquitination|transforming growth factor beta receptor signaling pathway|ubiquitin-dependent protein catabolic process	cytoplasm	co-SMAD binding|cysteine-type endopeptidase activity|ubiquitin thiolesterase activity			lung(3)|breast(2)|ovary(1)	6						ATTGGGTGGGTTTTTTTTTTT	0.323													6	3	---	---	---	---	
MAGEA3	4102	broad.mit.edu	37	X	151935707	151935707	+	Frame_Shift_Del	DEL	C	-	-			TCGA-34-5927-01	TCGA-34-5927-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151935707delC	uc004fgp.2	-	3	669	c.460delG	c.(460-462)GCTfs	p.A154fs		NM_005362	NP_005353	P43357	MAGA3_HUMAN	melanoma antigen family A, 3	154	MAGE.										0	Acute lymphoblastic leukemia(192;6.56e-05)					GAACTGGAAGCTTTGCTGAAG	0.542													174	84	---	---	---	---	
