Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
SSU72	29101	broad.mit.edu	37	1	1509849	1509849	+	Intron	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1509849C>A	uc001agd.2	-						SSU72_uc009vkg.1_Intron|SSU72_uc001age.1_Intron	NM_014188	NP_054907	Q9NP77	SSU72_HUMAN	Ssu72 RNA polymerase II CTD phosphatase homolog						mRNA processing	cytoplasm|nucleus	phosphoprotein phosphatase activity				0	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		CAGGGTGGAGCCCAACTACCT	0.741													6	13	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3427347	3427347	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3427347C>G	uc001akl.2	-	10	1461	c.1234G>C	c.(1234-1236)GAT>CAT	p.D412H	MEGF6_uc001akk.2_Missense_Mutation_p.D307H	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor	412	EGF-like 8; calcium-binding (Potential).					extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		CAGTGCTCACCCTCACAGCCG	0.687													5	13	---	---	---	---	PASS
CLSTN1	22883	broad.mit.edu	37	1	9791327	9791327	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9791327G>A	uc001aqh.2	-	18	3444	c.2685C>T	c.(2683-2685)ACC>ACT	p.T895T	CLSTN1_uc001aqi.2_Silent_p.T885T|CLSTN1_uc010oag.1_Silent_p.T876T|CLSTN1_uc001aqf.2_Silent_p.T131T	NM_001009566	NP_001009566	O94985	CSTN1_HUMAN	calsyntenin 1 isoform 1	895	Cytoplasmic (Potential).				homophilic cell adhesion	cell junction|cell projection|endoplasmic reticulum membrane|Golgi membrane|integral to membrane|nucleus|postsynaptic membrane	calcium ion binding			skin(1)	1	all_lung(157;0.222)	all_lung(284;4.03e-05)|Lung NSC(185;6.93e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0234)|Colorectal(212;8.36e-08)|COAD - Colon adenocarcinoma(227;1.93e-05)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(304;0.000949)|KIRC - Kidney renal clear cell carcinoma(229;0.00122)|STAD - Stomach adenocarcinoma(132;0.00644)|READ - Rectum adenocarcinoma(331;0.0419)		TCTCCTTCCCGGTGTCCTGAT	0.607													40	155	---	---	---	---	PASS
PRDM2	7799	broad.mit.edu	37	1	14106310	14106310	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14106310A>G	uc001avi.2	+	8	2876	c.2020A>G	c.(2020-2022)ACA>GCA	p.T674A	PRDM2_uc001avg.2_Intron|PRDM2_uc001avh.2_Missense_Mutation_p.T674A|PRDM2_uc001avj.2_Intron|PRDM2_uc009vod.1_Missense_Mutation_p.T431A|PRDM2_uc001avk.2_Missense_Mutation_p.T473A|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger	674						Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		CATATCAACAACAGAGGCAGT	0.443													86	110	---	---	---	---	PASS
PADI6	353238	broad.mit.edu	37	1	17699703	17699703	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17699703C>A	uc001bak.1	+	2	269	c.269C>A	c.(268-270)CCC>CAC	p.P90H		NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6	82					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	ATGACATCGCCCAGCCCTTCC	0.607													11	76	---	---	---	---	PASS
RHD	6007	broad.mit.edu	37	1	25627554	25627554	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25627554G>A	uc001bjz.2	+	4	662	c.604G>A	c.(604-606)GCA>ACA	p.A202T	RHD_uc010oep.1_Missense_Mutation_p.A202T|RHD_uc001bkc.2_Missense_Mutation_p.A202T|RHD_uc009vrm.2_Missense_Mutation_p.A34T|RHD_uc001bka.2_Missense_Mutation_p.A202T|RHD_uc001bkb.2_Missense_Mutation_p.A202T|RHD_uc009vrn.2_Missense_Mutation_p.A202T|RHD_uc009vro.2_Missense_Mutation_p.A202T|RHD_uc009vrp.2_Missense_Mutation_p.A202T	NM_016124	NP_057208	Q02161	RHD_HUMAN	Rh blood group D antigen isoform 1	202						integral to plasma membrane				breast(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		AGATCAGACAGCAACGATACC	0.547													112	31	---	---	---	---	PASS
TMEM57	55219	broad.mit.edu	37	1	25785216	25785216	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25785216G>A	uc001bkk.2	+	6	1189	c.987G>A	c.(985-987)GTG>GTA	p.V329V	TMEM57_uc009vru.2_Intron|TMEM57_uc009vrv.2_Intron|TMEM57_uc009vrt.2_RNA	NM_018202	NP_060672	Q8N5G2	MACOI_HUMAN	transmembrane protein 57	329						axon|integral to membrane|neuron projection terminus|nuclear membrane|synapse part					0		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00715)|all_lung(284;0.00989)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0675)|all_neural(195;0.201)		UCEC - Uterine corpus endometrioid carcinoma (279;0.042)|OV - Ovarian serous cystadenocarcinoma(117;1.85e-26)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|STAD - Stomach adenocarcinoma(196;0.000766)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|GBM - Glioblastoma multiforme(114;0.0191)|READ - Rectum adenocarcinoma(331;0.0649)		GTGGAGTTGTGAACTCTTCAC	0.398													28	278	---	---	---	---	PASS
EXTL1	2134	broad.mit.edu	37	1	26360264	26360264	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26360264C>T	uc001blf.2	+	9	2463	c.1596C>T	c.(1594-1596)GAC>GAT	p.D532D		NM_004455	NP_004446	Q92935	EXTL1_HUMAN	exostoses-like 1	532	Lumenal (Potential).				skeletal system development	integral to membrane|intrinsic to endoplasmic reticulum membrane	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity|protein binding			central_nervous_system(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.000954)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00594)|READ - Rectum adenocarcinoma(331;0.0649)		ATTTCTGGGACGAGGCCCATG	0.587													45	132	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38409540	38409540	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38409540T>C	uc001ccg.1	-	4	272	c.178A>G	c.(178-180)ATG>GTG	p.M60V	INPP5B_uc009vvk.1_Missense_Mutation_p.M1V|INPP5B_uc001cch.2_Missense_Mutation_p.M1V	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	60					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GTAATGGCCATCCTCCGGTGC	0.597													58	79	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39800990	39800990	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39800990G>C	uc010oiu.1	+	1	4181	c.4050G>C	c.(4048-4050)CAG>CAC	p.Q1350H	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	2915					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATGAAGAGCAGGAAAAAGCAG	0.353													71	87	---	---	---	---	PASS
HOOK1	51361	broad.mit.edu	37	1	60330309	60330309	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60330309C>A	uc009wad.2	+	18	1734	c.1632C>A	c.(1630-1632)AGC>AGA	p.S544R	HOOK1_uc001czo.2_Missense_Mutation_p.S544R|HOOK1_uc001czp.2_Intron|HOOK1_uc010oor.1_Missense_Mutation_p.S502R	NM_015888	NP_056972	Q9UJC3	HOOK1_HUMAN	hook homolog 1	544	Sufficient for interaction with microtubules.|Potential.				early endosome to late endosome transport|endosome organization|endosome to lysosome transport|lysosome organization|microtubule cytoskeleton organization|multicellular organismal development|protein transport	FHF complex|microtubule	identical protein binding			ovary(1)|breast(1)	2	all_cancers(7;0.000129)					TATAGTCCAGCAAATTAAAGC	0.328													42	77	---	---	---	---	PASS
C1orf87	127795	broad.mit.edu	37	1	60499141	60499141	+	Intron	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60499141T>C	uc001czs.1	-							NM_152377	NP_689590	Q8N0U7	CA087_HUMAN	hypothetical protein LOC127795								calcium ion binding			ovary(1)|breast(1)	2						AATTGAATTTTGGTTACCTTA	0.443													109	114	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75114930	75114930	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75114930C>T	uc001dgg.2	-	2	312	c.93G>A	c.(91-93)AGG>AGA	p.R31R		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	31										ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						AGAGATGACGCCTTATCCTTG	0.353													69	104	---	---	---	---	PASS
LHX8	431707	broad.mit.edu	37	1	75606791	75606791	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75606791G>T	uc001dgo.2	+	5	1053	c.389G>T	c.(388-390)AGA>ATA	p.R130I	LHX8_uc001dgq.2_Missense_Mutation_p.R69I	NM_001001933	NP_001001933	Q68G74	LHX8_HUMAN	LIM homeobox 8	130	LIM zinc-binding 1.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						GATTATTTCAGGTATGCTGTG	0.358													31	141	---	---	---	---	PASS
ELTD1	64123	broad.mit.edu	37	1	79404919	79404919	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79404919A>G	uc001diq.3	-	4	506	c.350T>C	c.(349-351)TTA>TCA	p.L117S		NM_022159	NP_071442	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain	117	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(1)|skin(1)	2				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		GACATTATCTAAATGGCAGTT	0.244													10	10	---	---	---	---	PASS
ABCA4	24	broad.mit.edu	37	1	94564446	94564446	+	Silent	SNP	C	A	A	rs140972064	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94564446C>A	uc001dqh.2	-	6	776	c.672G>T	c.(670-672)ACG>ACT	p.T224T	ABCA4_uc010otn.1_Silent_p.T224T	NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4	224	Extracellular.		T -> M (in a breast cancer sample; somatic mutation).		phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances	p.T224M(1)		ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CATAGCGCACCGTCTTTGCCC	0.597													22	84	---	---	---	---	PASS
ARHGAP29	9411	broad.mit.edu	37	1	94685905	94685905	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94685905G>T	uc001dqj.3	-	3	618	c.249C>A	c.(247-249)CTC>CTA	p.L83L	ARHGAP29_uc009wdq.1_RNA|ARHGAP29_uc001dql.2_Silent_p.L83L	NM_004815	NP_004806	Q52LW3	RHG29_HUMAN	PTPL1-associated RhoGAP 1	83					Rho protein signal transduction	cytosol	metal ion binding|Rho GTPase activator activity			breast(4)|skin(3)|lung(2)|upper_aerodigestive_tract(1)|ovary(1)	11		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		TTAAAACACGGAGCAGTTCCT	0.308													95	92	---	---	---	---	PASS
SLC25A24	29957	broad.mit.edu	37	1	108681680	108681680	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:108681680C>A	uc001dvn.3	-	9	1463	c.1249G>T	c.(1249-1251)GCC>TCC	p.A417S	SLC25A24_uc001dvm.2_Missense_Mutation_p.A398S	NM_013386	NP_037518	Q6NUK1	SCMC1_HUMAN	solute carrier family 25 member 24 isoform 1	417	Mitochondrial matrix (Potential).|Solcar 3.				transmembrane transport	integral to membrane|mitochondrial inner membrane	calcium ion binding			ovary(1)	1		all_epithelial(167;3.72e-05)|all_lung(203;0.000567)|Lung NSC(277;0.0011)|Melanoma(281;0.211)		Colorectal(144;0.0345)|Lung(183;0.0971)|COAD - Colon adenocarcinoma(174;0.127)|Epithelial(280;0.134)		AAAAATTCACCTTGAGCCTGC	0.473													17	95	---	---	---	---	PASS
CSDE1	7812	broad.mit.edu	37	1	115275301	115275301	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115275301C>T	uc001efk.2	-	10	1440	c.974G>A	c.(973-975)CGT>CAT	p.R325H	CSDE1_uc001efi.2_Missense_Mutation_p.R371H|CSDE1_uc001efj.2_RNA|CSDE1_uc001efl.2_Missense_Mutation_p.R294H|CSDE1_uc001efm.2_Missense_Mutation_p.R340H|CSDE1_uc009wgv.2_Missense_Mutation_p.R325H|CSDE1_uc001efn.2_Missense_Mutation_p.R294H	NM_001007553	NP_001007554	O75534	CSDE1_HUMAN	upstream of NRAS isoform 1	325	CSD 4; truncated.				male gonad development|regulation of transcription, DNA-dependent	cytoplasm	DNA binding|protein binding|RNA binding			ovary(1)	1	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAATTTGTCACGTCGGTCTGT	0.403													22	328	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115537564	115537564	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115537564G>A	uc001efr.2	+	32	3064	c.2855G>A	c.(2854-2856)CGG>CAG	p.R952Q	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.R952Q|SYCP1_uc009wgw.2_Missense_Mutation_p.R927Q	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	952					cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGAAAAATGCGGGAGGACCGT	0.333													7	214	---	---	---	---	PASS
TCHH	7062	broad.mit.edu	37	1	152084302	152084302	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152084302G>C	uc001ezp.2	-	2	1391	c.1391C>G	c.(1390-1392)ACG>AGG	p.T464R	TCHH_uc009wne.1_Missense_Mutation_p.T464R	NM_007113	NP_009044	Q07283	TRHY_HUMAN	trichohyalin	464	9 X 28 AA approximate tandem repeats.				keratinization	cytoskeleton	calcium ion binding			ovary(3)|kidney(1)|central_nervous_system(1)	5	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			gtgcctctccgtctcctcctc	0.139													22	158	---	---	---	---	PASS
HRNR	388697	broad.mit.edu	37	1	152193243	152193243	+	Missense_Mutation	SNP	A	T	T	rs150800529	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152193243A>T	uc001ezt.1	-	3	938	c.862T>A	c.(862-864)TCT>ACT	p.S288T		NM_001009931	NP_001009931	Q86YZ3	HORN_HUMAN	hornerin	288	3.				keratinization		calcium ion binding|protein binding			skin(2)|ovary(1)	3	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CGGGAACCAGACCCATGCTGA	0.597													77	733	---	---	---	---	PASS
LENEP	55891	broad.mit.edu	37	1	154966181	154966181	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154966181G>A	uc001fgi.2	+	1	120	c.98G>A	c.(97-99)GGC>GAC	p.G33D		NM_018655	NP_061125	Q9Y5L5	LENEP_HUMAN	lens epithelial protein	33					multicellular organismal development		DNA binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			ATTAAGATGGGCACAGGGTGG	0.607													9	210	---	---	---	---	PASS
MUC1	4582	broad.mit.edu	37	1	155162052	155162052	+	Silent	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155162052T>A	uc010pft.1	-	2	147	c.81A>T	c.(79-81)GCA>GCT	p.A27A	RAG1AP1_uc010pey.1_Intron|MUC1_uc001fhy.2_5'Flank|MUC1_uc001fhz.2_5'Flank|MUC1_uc010pfb.1_5'UTR|MUC1_uc010pfc.1_RNA|MUC1_uc009wph.2_5'UTR|MUC1_uc010pfd.1_Missense_Mutation_p.Q2L|MUC1_uc010pfe.1_RNA|MUC1_uc010pff.1_Missense_Mutation_p.Q76L|MUC1_uc009wpi.2_5'UTR|MUC1_uc010pfg.1_RNA|MUC1_uc010pfh.1_Missense_Mutation_p.Q76L|MUC1_uc010pfi.1_Missense_Mutation_p.Q76L|MUC1_uc010pfj.1_Missense_Mutation_p.Q76L|MUC1_uc010pfk.1_RNA|MUC1_uc010pfl.1_RNA|MUC1_uc001fin.2_Silent_p.A36A|MUC1_uc009wpk.2_Intron|MUC1_uc001fip.2_Missense_Mutation_p.Q2L|MUC1_uc009wqg.2_Missense_Mutation_p.Q2L|MUC1_uc009wpo.2_Intron|MUC1_uc009wps.2_Silent_p.A36A|MUC1_uc009wpt.2_Silent_p.A36A|MUC1_uc001fic.2_Silent_p.A27A|MUC1_uc009wpu.2_RNA|MUC1_uc009wpq.2_Intron|MUC1_uc009wpv.2_Missense_Mutation_p.Q2L|MUC1_uc001fim.2_Silent_p.A27A|MUC1_uc001fib.2_Missense_Mutation_p.Q2L|MUC1_uc009wpw.2_Silent_p.A36A|MUC1_uc001fie.2_Silent_p.A27A|MUC1_uc009wpr.2_Intron|MUC1_uc001fig.2_Silent_p.A36A|MUC1_uc001fif.2_Silent_p.A27A|MUC1_uc009wpx.2_Silent_p.A36A|MUC1_uc001fid.2_Silent_p.A27A|MUC1_uc009wpj.2_RNA|MUC1_uc001fij.2_Silent_p.A36A|MUC1_uc009wpy.2_RNA|MUC1_uc010pfm.1_5'UTR|MUC1_uc001fiq.2_5'UTR|MUC1_uc009wpz.2_Silent_p.A36A|MUC1_uc010pfn.1_Silent_p.A27A|MUC1_uc009wqa.2_Missense_Mutation_p.Q2L|MUC1_uc010pfo.1_Missense_Mutation_p.Q2L|MUC1_uc010pfp.1_Missense_Mutation_p.Q2L|MUC1_uc001fii.2_RNA|MUC1_uc001fih.2_RNA|MUC1_uc001fia.2_Silent_p.A27A|MUC1_uc009wqc.2_Missense_Mutation_p.Q2L|MUC1_uc009wqd.2_Missense_Mutation_p.Q2L|MUC1_uc009wqb.2_5'UTR|MUC1_uc010pfq.1_Missense_Mutation_p.Q2L|MUC1_uc010pfr.1_Silent_p.A36A|MUC1_uc001fit.2_5'UTR|MUC1_uc009wqe.2_Silent_p.A36A|MUC1_uc001fil.2_Silent_p.A27A|MUC1_uc009wpm.2_Silent_p.A27A|MUC1_uc009wpp.2_Silent_p.A27A|MUC1_uc010pfs.1_RNA|MUC1_uc001fik.2_Silent_p.A27A|MUC1_uc001fio.2_Silent_p.A27A|MUC1_uc009wqf.2_Missense_Mutation_p.Q2L|MUC1_uc009wpl.2_Silent_p.A36A|MUC1_uc009wpn.2_Silent_p.A36A|MUC1_uc001fis.1_Silent_p.A27A|uc009wqh.2_5'Flank|MUC1_uc001fiv.1_Silent_p.A36A|MUC1_uc001fiw.1_Silent_p.A27A|MIR92B_hsa-mir-92b|MI0003560_5'Flank			P15941	MUC1_HUMAN	SubName: Full=MUC1 isoform M13;	27	Extracellular (Potential).					apical plasma membrane|cell surface|cytoplasm|extracellular region|integral to plasma membrane|nucleus	protein binding			large_intestine(1)|pancreas(1)|breast(1)|skin(1)	4	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;5.31e-10)|all cancers(21;2.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGTAGAGCTTGCATGACCAG	0.483			T	IGH@	B-NHL								10	424	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158613124	158613124	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158613124C>T	uc001fst.1	-	31	4629	c.4430G>A	c.(4429-4431)CGT>CAT	p.R1477H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1477	Spectrin 14.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GTCTAGTACACGTTGGAGCCG	0.443													27	223	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158908901	158908901	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158908901G>C	uc001ftb.2	+	4	688	c.443G>C	c.(442-444)GGA>GCA	p.G148A	PYHIN1_uc001fta.3_Missense_Mutation_p.G148A|PYHIN1_uc001ftc.2_Missense_Mutation_p.G139A|PYHIN1_uc001ftd.2_Missense_Mutation_p.G148A|PYHIN1_uc001fte.2_Missense_Mutation_p.G139A	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	148					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					GAAGAGACTGGAACCAAAAGG	0.453													22	177	---	---	---	---	PASS
TNN	63923	broad.mit.edu	37	1	175086168	175086168	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175086168A>G	uc001gkl.1	+	10	2326	c.2213A>G	c.(2212-2214)TAT>TGT	p.Y738C		NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor	738	Fibronectin type-III 6.				cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ATTGACAGGTATGTGGTGCGC	0.612													189	82	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176563832	176563832	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176563832G>T	uc001gkz.2	+	3	2256	c.1092G>T	c.(1090-1092)TGG>TGT	p.W364C	PAPPA2_uc001gky.1_Missense_Mutation_p.W364C|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	364					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CAGGCACATGGACCCATGTGG	0.577													24	150	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179993629	179993629	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179993629C>T	uc001gnt.2	+	14	3845	c.3462C>T	c.(3460-3462)TCC>TCT	p.S1154S	CEP350_uc009wxl.2_Silent_p.S1153S|CEP350_uc001gnu.2_Silent_p.S987S	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1154	Ser-rich.					centrosome|nucleus|spindle				ovary(4)	4						ATGTTACCTCCCAGCATTCAT	0.413													36	232	---	---	---	---	PASS
LAMC1	3915	broad.mit.edu	37	1	183086726	183086726	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183086726G>T	uc001gpy.3	+	10	2002	c.1745G>T	c.(1744-1746)CGA>CTA	p.R582L		NM_002293	NP_002284	P11047	LAMC1_HUMAN	laminin, gamma 1 precursor	582	Laminin IV type A.				axon guidance|cell migration|endoderm development|extracellular matrix disassembly|hemidesmosome assembly|positive regulation of epithelial cell proliferation|protein complex assembly|substrate adhesion-dependent cell spreading	extracellular space|laminin-1 complex|laminin-10 complex|laminin-11 complex	extracellular matrix structural constituent			ovary(3)|large_intestine(1)|kidney(1)	5					Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TTCTCCTTTCGAGTGGACAGG	0.498													214	104	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186303672	186303672	+	Intron	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186303672G>A	uc001grv.2	-							NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR						carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GGCACTTATAGAGGAGAAAAT	0.358			T	NTRK1	papillary thyroid								11	305	---	---	---	---	PASS
CFH	3075	broad.mit.edu	37	1	196695983	196695983	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196695983T>A	uc001gtj.3	+	14	2389	c.2149T>A	c.(2149-2151)TTC>ATC	p.F717I		NM_000186	NP_000177	P08603	CFAH_HUMAN	complement factor H isoform a precursor	717	Sushi 12.				complement activation, alternative pathway	extracellular space				skin(4)|ovary(1)|breast(1)	6						TTCAGTGGAATTCAATTGCTC	0.438													59	314	---	---	---	---	PASS
KISS1	3814	broad.mit.edu	37	1	204159850	204159850	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204159850G>T	uc001har.2	-	3	333	c.179C>A	c.(178-180)GCT>GAT	p.A60D		NM_002256	NP_002247	Q15726	KISS1_HUMAN	KiSS-1 metastasis-suppressor	60					cytoskeleton organization	extracellular region	protein binding			ovary(1)	1	all_cancers(21;0.0165)|Breast(84;0.179)|all_epithelial(62;0.242)	Breast(1374;9.42e-05)	KIRC - Kidney renal clear cell carcinoma(13;0.0584)|BRCA - Breast invasive adenocarcinoma(75;0.069)|Kidney(21;0.0934)|Epithelial(59;0.239)	Colorectal(1306;0.0129)		CCTGGCAGTAGCAGCTGGCTT	0.721													12	11	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204951102	204951102	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204951102G>A	uc001hbj.2	+	21	2752	c.2424G>A	c.(2422-2424)GGG>GGA	p.G808G	NFASC_uc010pra.1_Silent_p.G804G|NFASC_uc001hbi.2_Silent_p.G804G|NFASC_uc010prb.1_Silent_p.G819G|NFASC_uc010prc.1_Silent_p.G375G|NFASC_uc001hbk.1_Silent_p.G614G|NFASC_uc001hbl.1_Silent_p.G58G	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	808	Extracellular (Potential).|Fibronectin type-III 2.				axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			ATGACTTCGGGAAGGGCCCTG	0.602													5	80	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216166470	216166470	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216166470C>T	uc001hku.1	-	35	7084	c.6697G>A	c.(6697-6699)GAG>AAG	p.E2233K		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2233	Extracellular (Potential).|Fibronectin type-III 8.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTTAGGGCCTCACTGGCCTCA	0.502										HNSCC(13;0.011)	OREG0014251	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	82	368	---	---	---	---	PASS
ESRRG	2104	broad.mit.edu	37	1	216737638	216737638	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216737638A>G	uc001hkw.1	-	5	951	c.785T>C	c.(784-786)ATC>ACC	p.I262T	ESRRG_uc001hky.1_Missense_Mutation_p.I239T|ESRRG_uc009xdp.1_Missense_Mutation_p.I239T|ESRRG_uc001hkz.1_Missense_Mutation_p.I200T|ESRRG_uc010puc.1_Missense_Mutation_p.I239T|ESRRG_uc001hla.1_Missense_Mutation_p.I239T|ESRRG_uc001hlb.1_Missense_Mutation_p.I239T|ESRRG_uc010pud.1_Missense_Mutation_p.I70T|ESRRG_uc001hlc.1_Missense_Mutation_p.I239T|ESRRG_uc001hld.1_Missense_Mutation_p.I239T|ESRRG_uc001hkx.1_Missense_Mutation_p.I274T|ESRRG_uc009xdo.1_Missense_Mutation_p.I239T|ESRRG_uc001hle.1_Missense_Mutation_p.I239T	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1	262					positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	GAGGGCTTTGATGTCACTGTC	0.478													54	265	---	---	---	---	PASS
TTC13	79573	broad.mit.edu	37	1	231067473	231067473	+	Intron	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231067473G>T	uc001huf.3	-						TTC13_uc009xfi.2_Intron|TTC13_uc009xfj.2_Intron|TTC13_uc001hug.3_Intron|TTC13_uc009xfk.1_Intron	NM_024525	NP_078801	Q8NBP0	TTC13_HUMAN	tetratricopeptide repeat domain 13 isoform a								binding			ovary(1)|skin(1)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.167)		COAD - Colon adenocarcinoma(196;0.243)		CTTATTTATGGATGCTCACCT	0.418													48	455	---	---	---	---	PASS
IRF2BP2	359948	broad.mit.edu	37	1	234743448	234743448	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234743448G>A	uc001hwg.2	-	2	1230	c.1199C>T	c.(1198-1200)CCG>CTG	p.P400L	IRF2BP2_uc009xfw.2_Missense_Mutation_p.P10L|IRF2BP2_uc001hwf.2_Missense_Mutation_p.P384L	NM_182972	NP_892017	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	400					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			GGGTGGTGGCGGAGACACAAA	0.612													24	148	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237905620	237905620	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237905620G>A	uc001hyl.1	+	80	11236	c.11116G>A	c.(11116-11118)GAT>AAT	p.D3706N	RYR2_uc010pya.1_Missense_Mutation_p.D102N	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	3706					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGAAGATGACGATGGTGAAGA	0.318													4	25	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240975293	240975293	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240975293T>A	uc001hyv.2	-	14	1337	c.1007A>T	c.(1006-1008)GAG>GTG	p.E336V	RGS7_uc010pyh.1_Missense_Mutation_p.E310V|RGS7_uc010pyj.1_Missense_Mutation_p.E252V|RGS7_uc001hyu.2_Missense_Mutation_p.E336V|RGS7_uc009xgn.1_Missense_Mutation_p.E283V|RGS7_uc001hyw.2_Missense_Mutation_p.E336V|RGS7_uc001hyt.2_Missense_Mutation_p.E168V	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	336	RGS.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTTCAATGCCTCGTCCATGCC	0.398													13	470	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	241262037	241262037	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241262037T>C	uc001hyv.2	-	3	434	c.104A>G	c.(103-105)CAA>CGA	p.Q35R	RGS7_uc010pyh.1_Missense_Mutation_p.Q9R|RGS7_uc010pyj.1_5'UTR|RGS7_uc001hyu.2_Missense_Mutation_p.Q35R|RGS7_uc009xgn.1_Missense_Mutation_p.Q35R|RGS7_uc001hyw.2_Missense_Mutation_p.Q35R	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	35					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTTTTCATCTTGCATCCGTGC	0.338													28	231	---	---	---	---	PASS
OPN3	23596	broad.mit.edu	37	1	241757787	241757787	+	Silent	SNP	G	A	A	rs151169647		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241757787G>A	uc001hza.2	-	4	1297	c.1152C>T	c.(1150-1152)GAC>GAT	p.D384D	KMO_uc009xgp.2_3'UTR|OPN3_uc001hzb.2_RNA|OPN3_uc001hzc.2_RNA	NM_014322	NP_055137	Q9H1Y3	OPN3_HUMAN	opsin 3	384	Cytoplasmic (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TGTCGCTGTCGTCAACTGACA	0.418													16	533	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242035439	242035439	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242035439T>C	uc001hzh.2	+	12	1913	c.1373T>C	c.(1372-1374)GTG>GCG	p.V458A	EXO1_uc001hzi.2_Missense_Mutation_p.V458A|EXO1_uc001hzj.2_Missense_Mutation_p.V458A|EXO1_uc009xgq.2_Missense_Mutation_p.V457A	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	458	Interaction with MLH1.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			TTTTCTGAAGTGTTTGTGCCT	0.368								Direct_reversal_of_damage|Editing_and_processing_nucleases					5	257	---	---	---	---	PASS
HNRNPU	3192	broad.mit.edu	37	1	245027151	245027151	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:245027151G>A	uc001iaz.1	-	1	677	c.459C>T	c.(457-459)GGC>GGT	p.G153G	HNRNPU_uc001iay.1_5'Flank|HNRNPU_uc001iba.1_Silent_p.G153G|HNRNPU_uc001ibb.1_Intron	NM_031844	NP_114032	Q00839	HNRPU_HUMAN	heterogeneous nuclear ribonucleoprotein U	153	Asp/Glu-rich (acidic).				CRD-mediated mRNA stabilization	catalytic step 2 spliceosome|cell surface|CRD-mediated mRNA stability complex|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	ATP binding|DNA binding|protein binding|RNA binding				0	all_cancers(71;6.97e-06)|all_epithelial(71;0.000104)|all_neural(11;0.0269)|Breast(184;0.0545)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0989)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.00868)			CGTTCTCGTCGCCCGCGCCTT	0.692													30	7	---	---	---	---	PASS
OR2G2	81470	broad.mit.edu	37	1	247752207	247752207	+	Silent	SNP	C	T	T	rs146695930	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247752207C>T	uc010pyy.1	+	1	546	c.546C>T	c.(544-546)TGC>TGT	p.C182C		NM_001001915	NP_001001915	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ATTTCATCTGCGAGGTCCCTG	0.537													329	131	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769576	247769576	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769576C>A	uc010pyz.1	+	1	689	c.689C>A	c.(688-690)TCA>TAA	p.S230*		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	230	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AGGATCAAATCAGTAGAGGCA	0.453													165	74	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525719	248525719	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525719G>T	uc001ieh.1	+	1	837	c.837G>T	c.(835-837)GTG>GTT	p.V279V		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	279	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCTGACTGTGGTCATCCTCT	0.532													69	416	---	---	---	---	PASS
OTOF	9381	broad.mit.edu	37	2	26741909	26741909	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26741909G>A	uc002rhk.2	-	4	423	c.296C>T	c.(295-297)ACG>ATG	p.T99M	OTOF_uc010ylb.1_5'Flank	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	99	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATCAATCAGCGTGTCAGTCAC	0.577													6	43	---	---	---	---	PASS
RASGRP3	25780	broad.mit.edu	37	2	33783884	33783884	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33783884A>T	uc002rox.2	+	18	2478	c.1851A>T	c.(1849-1851)GAA>GAT	p.E617D	RASGRP3_uc010ync.1_Missense_Mutation_p.E617D|RASGRP3_uc002roy.2_Missense_Mutation_p.E616D	NM_170672	NP_733772	Q8IV61	GRP3_HUMAN	RAS guanyl releasing protein 3 (calcium and	617					MAPKKK cascade|small GTPase mediated signal transduction	integral to plasma membrane|intracellular	calcium ion binding|diacylglycerol binding|guanyl-nucleotide exchange factor activity|protein binding|Rap GTPase activator activity|signal transducer activity			lung(3)|ovary(1)|pancreas(1)	5	all_hematologic(175;0.115)					CCCAGACTGAACCTGTCTGGT	0.552													15	152	---	---	---	---	PASS
PREPL	9581	broad.mit.edu	37	2	44569631	44569631	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44569631C>T	uc002ruf.2	-	5	712	c.677G>A	c.(676-678)CGC>CAC	p.R226H	PREPL_uc002rug.2_Missense_Mutation_p.R226H|PREPL_uc002ruh.2_Missense_Mutation_p.R226H|PREPL_uc010fax.2_Missense_Mutation_p.R226H|PREPL_uc002rui.3_Missense_Mutation_p.R137H|PREPL_uc002ruj.1_Missense_Mutation_p.R137H|PREPL_uc002ruk.1_Missense_Mutation_p.R226H	NM_006036	NP_006027	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like isoform C	226					proteolysis	cytosol	serine-type endopeptidase activity			ovary(1)	1		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GTCATGACAGCGAAGGTTCCT	0.348													153	177	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54146300	54146300	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54146300G>A	uc002rxp.2	-	20	2560	c.2504C>T	c.(2503-2505)CCA>CTA	p.P835L	PSME4_uc010yop.1_Missense_Mutation_p.P721L|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.P210L|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	835					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GTTAGTAACTGGCTCTCCTTT	0.323													61	21	---	---	---	---	PASS
SPTBN1	6711	broad.mit.edu	37	2	54859735	54859735	+	Silent	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54859735C>A	uc002rxu.2	+	17	3846	c.3597C>A	c.(3595-3597)ACC>ACA	p.T1199T	SPTBN1_uc002rxx.2_Silent_p.T1186T	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1	1199	Spectrin 9.				actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			AAATGCCTACCACCTTGGAAG	0.433													179	91	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77746338	77746338	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77746338C>T	uc002snr.2	-	3	1072	c.657G>A	c.(655-657)AAG>AAA	p.K219K	LRRTM4_uc002snq.2_Silent_p.K219K|LRRTM4_uc002sns.2_Silent_p.K219K|LRRTM4_uc002snt.2_Silent_p.K220K	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	219	LRR 7.|Extracellular (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		CAAAGTTGATCTTGGAAAACT	0.453													60	51	---	---	---	---	PASS
EIF2AK3	9451	broad.mit.edu	37	2	88890344	88890344	+	Missense_Mutation	SNP	C	T	T	rs121908570		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88890344C>T	uc002stc.3	-	5	1196	c.994G>A	c.(994-996)GAG>AAG	p.E332K		NM_004836	NP_004827	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha	332	Lumenal (Potential).				activation of caspase activity|bone mineralization|calcium-mediated signaling|chondrocyte development|endocrine pancreas development|endoplasmic reticulum organization|endoplasmic reticulum unfolded protein response|ER overload response|insulin secretion|insulin-like growth factor receptor signaling pathway|negative regulation of myelination|negative regulation of translational initiation in response to stress|protein autophosphorylation|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	ATP binding|eukaryotic translation initiation factor 2alpha kinase activity|identical protein binding			ovary(3)	3						ACCTGGTACTCCCATTCCAGA	0.433													11	441	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98914457	98914457	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98914457C>T	uc002syo.2	+	24	3509	c.3245C>T	c.(3244-3246)ACG>ATG	p.T1082M	VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.T739M|VWA3B_uc002syp.1_Missense_Mutation_p.T474M|VWA3B_uc002syq.1_Missense_Mutation_p.T358M|VWA3B_uc002syr.1_Missense_Mutation_p.T399M|VWA3B_uc002sys.2_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	1082										ovary(3)|large_intestine(2)|skin(1)	6						TCCTTCATCACGCCTGTGGGG	0.577													13	132	---	---	---	---	PASS
RNF149	284996	broad.mit.edu	37	2	101893736	101893736	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101893736G>A	uc002taz.1	-	7	1269	c.1167C>T	c.(1165-1167)GGC>GGT	p.G389G	RNF149_uc002tax.1_Intron	NM_173647	NP_775918	Q8NC42	RN149_HUMAN	ring finger protein 149 precursor	389						integral to membrane	ligase activity|zinc ion binding			ovary(1)|breast(1)	2						AGTCACTCCTGCCGGCTTCTG	0.468													16	42	---	---	---	---	PASS
PTPN4	5775	broad.mit.edu	37	2	120672827	120672827	+	Intron	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:120672827G>A	uc002tmf.1	+						PTPN4_uc010flj.1_5'UTR	NM_002830	NP_002821	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type							cytoplasm|cytoskeleton|internal side of plasma membrane	cytoskeletal protein binding|non-membrane spanning protein tyrosine phosphatase activity			ovary(2)	2					Alendronate(DB00630)	TGGTGAGTACGGATTTAATAA	0.264													22	55	---	---	---	---	PASS
WDR33	55339	broad.mit.edu	37	2	128471314	128471314	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128471314C>A	uc002tpg.1	-	18	3334	c.3151G>T	c.(3151-3153)GGG>TGG	p.G1051W		NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1	1051					postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		AACGGAGGCCCAGGGCCCCCT	0.657													114	100	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133539998	133539998	+	Silent	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133539998C>A	uc002ttp.2	-	14	4760	c.4386G>T	c.(4384-4386)GTG>GTT	p.V1462V	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1462							protein binding				0						CTTCTGAACTCACAGCATCAG	0.498													19	51	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467354	164467354	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467354C>A	uc002uck.1	-	3	1299	c.988G>T	c.(988-990)GAC>TAC	p.D330Y		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	330						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						TAACTGGAGTCCATATCTCCT	0.468													105	232	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170029717	170029717	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170029717A>G	uc002ues.2	-	57	11245	c.11032T>C	c.(11032-11034)TGT>CGT	p.C3678R		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	3678	LDL-receptor class A 30.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	AAGTTGTCACAGAGATGGGCA	0.473													34	83	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170059405	170059405	+	Silent	SNP	C	T	T	rs144284604		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170059405C>T	uc002ues.2	-	43	8283	c.8070G>A	c.(8068-8070)AAG>AAA	p.K2690K		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	2690	EGF-like 10.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	CAATGCAGTGCTTCCTGTTGT	0.493													57	163	---	---	---	---	PASS
UBR3	130507	broad.mit.edu	37	2	170936431	170936431	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170936431C>T	uc010zdi.1	+	37	5307	c.5307C>T	c.(5305-5307)TGC>TGT	p.C1769C	UBR3_uc002ufr.3_RNA|UBR3_uc010fqa.2_Silent_p.C590C|UBR3_uc002uft.3_Silent_p.C626C|UBR3_uc010zdj.1_Silent_p.C460C|UBR3_uc002ufu.3_Silent_p.C275C	NM_172070	NP_742067	Q6ZT12	UBR3_HUMAN	E3 ubiquitin-protein ligase UBR3	1769	Cys-rich.				sensory perception of smell|suckling behavior|ubiquitin-dependent protein catabolic process	integral to membrane	ubiquitin-protein ligase activity|zinc ion binding				0						GTAGTGTCTGCACCAAGGTTC	0.403													143	144	---	---	---	---	PASS
KIAA1715	80856	broad.mit.edu	37	2	176794704	176794704	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176794704C>T	uc002ukc.1	-	13	1471	c.1278G>A	c.(1276-1278)ACG>ACA	p.T426T	KIAA1715_uc010zer.1_Silent_p.T457T|KIAA1715_uc010fqw.1_Silent_p.T492T|KIAA1715_uc010zes.1_Silent_p.T428T|KIAA1715_uc002ukd.1_Silent_p.T303T|KIAA1715_uc010zet.1_RNA	NM_030650	NP_085153	Q9C0E8	LNP_HUMAN	Lunapark	426	Cytoplasmic (Potential).					integral to membrane	protein binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			ACTACTCTGCCGTCAAAGATT	0.428													37	153	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179465987	179465987	+	Intron	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179465987C>A	uc010zfg.1	-						uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GATTTTAAAGCTTACATATCG	0.348													18	31	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179594173	179594173	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179594173C>T	uc010zfg.1	-	61	15202	c.14978G>A	c.(14977-14979)AGG>AAG	p.R4993K	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R1654K	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5920							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCGAATTTCCCTGTTATTCTT	0.458													66	222	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179614216	179614216	+	Nonsense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179614216G>C	uc002unb.2	-	46	13135	c.12911C>G	c.(12910-12912)TCA>TGA	p.S4304*	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCCTTACTGAATATTCTTT	0.408													86	99	---	---	---	---	PASS
NEUROD1	4760	broad.mit.edu	37	2	182543416	182543416	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:182543416C>G	uc002uof.2	-	2	408	c.172G>C	c.(172-174)GAG>CAG	p.E58Q	CERKL_uc002uod.1_Intron	NM_002500	NP_002491	Q13562	NDF1_HUMAN	neurogenic differentiation 1	58	Glu-rich (acidic).				amacrine cell differentiation|cerebellum development|dentate gyrus development|embryonic organ morphogenesis|enteroendocrine cell differentiation|glucose homeostasis|inner ear development|insulin secretion|negative regulation of apoptosis|nitric oxide mediated signal transduction|positive regulation of apoptosis|positive regulation of neuron differentiation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of cell cycle arrest|regulation of intestinal epithelial structure maintenance|response to glucose stimulus	cytoplasm|nucleus	chromatin binding|E-box binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.088)			tcctcctcctcTCCCCCGTTC	0.398													15	14	---	---	---	---	PASS
FAM171B	165215	broad.mit.edu	37	2	187625902	187625902	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187625902A>G	uc002ups.2	+	7	1187	c.1075A>G	c.(1075-1077)ATA>GTA	p.I359V	FAM171B_uc002upr.1_Missense_Mutation_p.I359V|FAM171B_uc002upt.2_5'Flank	NM_177454	NP_803237	Q6P995	F171B_HUMAN	KIAA1946	359	Helical; (Potential).					integral to membrane	DNA binding			ovary(6)|breast(3)|central_nervous_system(1)	10						TCTTACAGCCATATTAGGAGG	0.328													37	114	---	---	---	---	PASS
GLS	2744	broad.mit.edu	37	2	191795219	191795219	+	Missense_Mutation	SNP	T	A	A	rs3207595		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191795219T>A	uc002usf.2	+	13	1746	c.1482T>A	c.(1480-1482)AAT>AAA	p.N494K	GLS_uc002use.2_Missense_Mutation_p.N494K|GLS_uc002usg.1_Missense_Mutation_p.N155K|GLS_uc002ush.2_Missense_Mutation_p.N155K|GLS_uc010zgi.1_Missense_Mutation_p.N65K|GLS_uc010zgj.1_5'UTR	NM_014905	NP_055720	O94925	GLSK_HUMAN	glutaminase precursor	494					cellular amino acid biosynthetic process|glutamate secretion|glutamine catabolic process|neurotransmitter secretion	mitochondrial matrix	glutaminase activity			ovary(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)	TTGTCCCCAATGTTATGGGTA	0.373													22	157	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207173840	207173840	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207173840C>A	uc002vbp.2	+	5	4838	c.4588C>A	c.(4588-4590)CTG>ATG	p.L1530M		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1530							nucleic acid binding|zinc ion binding			ovary(3)	3						ACTTGTGGATCTGGTGCCCGG	0.398													8	65	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207176077	207176077	+	Silent	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207176077A>T	uc002vbp.2	+	5	7075	c.6825A>T	c.(6823-6825)CCA>CCT	p.P2275P		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	2275							nucleic acid binding|zinc ion binding			ovary(3)	3						CTTCAGTTCCACCAGCTGGTG	0.493													6	21	---	---	---	---	PASS
CAB39	51719	broad.mit.edu	37	2	231658041	231658041	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231658041G>T	uc002vqx.2	+	4	825	c.393G>T	c.(391-393)TTG>TTT	p.L131F	CAB39_uc010fxr.2_Missense_Mutation_p.L131F|CAB39_uc010fxq.2_Missense_Mutation_p.L131F	NM_016289	NP_057373	Q9Y376	CAB39_HUMAN	calcium binding protein 39	131					cell cycle arrest|insulin receptor signaling pathway|regulation of fatty acid oxidation	cytosol	kinase binding			central_nervous_system(1)	1		all_lung(227;4.63e-07)|all_hematologic(139;1.83e-06)|Lung NSC(271;2.11e-05)|Acute lymphoblastic leukemia(138;5.51e-05)|Hepatocellular(293;0.0207)|Lung SC(224;0.187)		all cancers(144;1.64e-12)|Epithelial(121;5.29e-11)|LUSC - Lung squamous cell carcinoma(224;0.0154)|Lung(119;0.0177)|COAD - Colon adenocarcinoma(134;0.226)		TCATGTTATTGAAAGGGTATG	0.343													26	81	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	234112939	234112939	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234112939C>A	uc010zmo.1	+	25	3296	c.3143C>A	c.(3142-3144)CCG>CAG	p.P1048Q	INPP5D_uc010zmp.1_Missense_Mutation_p.P1047Q	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	1048	SH3-binding 3.|Pro-rich.				apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		AAGGAACCCCCGCCCTGCCCG	0.657													47	40	---	---	---	---	PASS
ATG7	10533	broad.mit.edu	37	3	11350508	11350508	+	Silent	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:11350508C>G	uc003bwc.2	+	5	501	c.384C>G	c.(382-384)CTC>CTG	p.L128L	ATG7_uc003bwd.2_Silent_p.L128L|ATG7_uc011aum.1_Silent_p.L128L	NM_006395	NP_006386	O95352	ATG7_HUMAN	APG7 autophagy 7-like isoform a	128					autophagy|cellular membrane fusion|positive regulation of protein modification process|protein lipidation|protein transport	cytoplasm	APG12 activating enzyme activity|protein homodimerization activity|ubiquitin activating enzyme activity			central_nervous_system(1)	1						CTGTACTCCTCAACAAGTTCC	0.468													232	172	---	---	---	---	PASS
ZCWPW2	152098	broad.mit.edu	37	3	28566160	28566160	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:28566160C>A	uc003ceh.2	+	10	1220	c.1052C>A	c.(1051-1053)GCT>GAT	p.A351D	ZCWPW2_uc003cei.2_Missense_Mutation_p.A351D|ZCWPW2_uc010hfo.2_Missense_Mutation_p.A156D	NM_001040432	NP_001035522	Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	351							zinc ion binding			ovary(2)	2						GAAATAGATGCTTTGATGTCT	0.234													37	17	---	---	---	---	PASS
COL7A1	1294	broad.mit.edu	37	3	48622528	48622528	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48622528G>T	uc003ctz.2	-	32	3917	c.3916C>A	c.(3916-3918)CGT>AGT	p.R1306S		NM_000094	NP_000085	Q02388	CO7A1_HUMAN	alpha 1 type VII collagen precursor	1306	Triple-helical region.|Interrupted collagenous region.				cell adhesion|epidermis development	basement membrane|collagen type VII	protein binding|serine-type endopeptidase inhibitor activity			ovary(4)|breast(3)|skin(3)|central_nervous_system(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CTGCCTGGACGCCCATCTGCT	0.677													6	33	---	---	---	---	PASS
CNTN3	5067	broad.mit.edu	37	3	74383978	74383978	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:74383978C>T	uc003dpm.1	-	12	1656	c.1576G>A	c.(1576-1578)GAC>AAC	p.D526N		NM_020872	NP_065923	Q9P232	CNTN3_HUMAN	contactin 3 precursor	526	Ig-like C2-type 6.				cell adhesion	anchored to membrane|plasma membrane	protein binding			breast(3)|ovary(1)|skin(1)	5		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AACAGCGGGTCATGTTGTACC	0.418													52	74	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77571935	77571935	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77571935C>T	uc003dpy.3	+	6	1459	c.816C>T	c.(814-816)ATC>ATT	p.I272I	ROBO2_uc003dpz.2_Silent_p.I272I|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Silent_p.I272I	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	272	Ig-like C2-type 3.|Extracellular (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		GGTATGACATCAAAGACGATT	0.328													24	70	---	---	---	---	PASS
ROBO2	6092	broad.mit.edu	37	3	77637988	77637988	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:77637988G>A	uc003dpy.3	+	17	3230	c.2587G>A	c.(2587-2589)GCT>ACT	p.A863T	ROBO2_uc003dpz.2_Missense_Mutation_p.A867T|ROBO2_uc011bgj.1_RNA|ROBO2_uc011bgk.1_Missense_Mutation_p.A867T|ROBO2_uc003dqa.2_5'UTR	NM_002942	NP_002933	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2	863	Helical; (Potential).				apoptosis involved in luteolysis|axon midline choice point recognition|cellular response to hormone stimulus|homophilic cell adhesion|metanephros development|negative regulation of negative chemotaxis|negative regulation of synaptogenesis|olfactory bulb interneuron development|positive regulation of axonogenesis|retinal ganglion cell axon guidance|ureteric bud development	axolemma|cell surface|integral to membrane	axon guidance receptor activity|identical protein binding			lung(5)|skin(3)|ovary(1)|large_intestine(1)|liver(1)	11				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AGCCTTTATAGCTGGTATTGG	0.418													39	47	---	---	---	---	PASS
VGLL3	389136	broad.mit.edu	37	3	87018024	87018024	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:87018024G>C	uc003dqn.2	-	3	1017	c.653C>G	c.(652-654)TCC>TGC	p.S218C		NM_016206	NP_057290	A8MV65	VGLL3_HUMAN	colon carcinoma related protein	218					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	all_cancers(8;0.109)|Lung SC(3;0.184)	Lung NSC(201;0.0777)		LUSC - Lung squamous cell carcinoma(29;0.00241)|Lung(72;0.00712)		ATGGCTGTAGGATGGGCTCAC	0.483													3	61	---	---	---	---	PASS
ST3GAL6	10402	broad.mit.edu	37	3	98512603	98512603	+	Nonstop_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98512603T>A	uc003dsz.2	+	10	1230	c.994T>A	c.(994-996)TGA>AGA	p.*332R	ST3GAL6_uc003dsy.2_Nonstop_Mutation_p.*246R|ST3GAL6_uc003dta.2_Nonstop_Mutation_p.*214R|ST3GAL6_uc003dtb.2_Nonstop_Mutation_p.*188R|ST3GAL6_uc003dtc.2_Nonstop_Mutation_p.*332R|ST3GAL6_uc010hpd.2_Nonstop_Mutation_p.*385R	NM_006100	NP_006091	Q9Y274	SIA10_HUMAN	alpha2,3-sialyltransferase VI	332					amino sugar metabolic process|glycolipid metabolic process|protein glycosylation|protein lipoylation	integral to Golgi membrane	sialyltransferase activity			ovary(1)	1						GACTCAAGATTGACTCTACAG	0.323													239	132	---	---	---	---	PASS
MYH15	22989	broad.mit.edu	37	3	108220705	108220705	+	Intron	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108220705G>T	uc003dxa.1	-							NM_014981	NP_055796	Q9Y2K3	MYH15_HUMAN	myosin, heavy polypeptide 15							myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(5)|central_nervous_system(2)	7						CTCAGACTCTGCAGAGAGAAG	0.373													160	642	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108776294	108776294	+	Silent	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108776294T>A	uc003dxl.2	-	13	1158	c.1071A>T	c.(1069-1071)GGA>GGT	p.G357G	MORC1_uc011bhn.1_Silent_p.G357G	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	357					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CTACGTTCACTCCATAGAACA	0.338													42	382	---	---	---	---	PASS
BOC	91653	broad.mit.edu	37	3	112969595	112969595	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112969595C>A	uc003dzx.2	+	4	912	c.291C>A	c.(289-291)AAC>AAA	p.N97K	BOC_uc010hqi.2_Missense_Mutation_p.N97K|BOC_uc003dzy.2_Missense_Mutation_p.N97K|BOC_uc003dzz.2_Missense_Mutation_p.N97K|BOC_uc003dzw.1_Missense_Mutation_p.N97K|BOC_uc003eaa.1_Missense_Mutation_p.N97K	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor	97	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			CTGCCCTTAACAACCACACTG	0.597													18	173	---	---	---	---	PASS
WDR52	55779	broad.mit.edu	37	3	113145025	113145025	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113145025G>A	uc003eae.1	-	4	399	c.353C>T	c.(352-354)TCG>TTG	p.S118L		NM_018338	NP_060808	Q96MT7	WDR52_HUMAN	WD repeat domain 52 isoform 2	118										central_nervous_system(1)	1						AAAAGGCATCGAAGCAAGCTC	0.413													79	821	---	---	---	---	PASS
KIAA1407	57577	broad.mit.edu	37	3	113755617	113755617	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113755617C>T	uc003eax.2	-	5	579	c.432G>A	c.(430-432)TTG>TTA	p.L144L	KIAA1407_uc011bin.1_RNA|KIAA1407_uc011bio.1_Silent_p.L122L|KIAA1407_uc011bip.1_Silent_p.L131L	NM_020817	NP_065868	Q8NCU4	K1407_HUMAN	hypothetical protein LOC57577	144										ovary(2)	2						CTTCTTCCTCCAAATAGCCAC	0.308													37	244	---	---	---	---	PASS
ZBTB20	26137	broad.mit.edu	37	3	114070037	114070037	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:114070037C>T	uc003ebi.2	-	4	1068	c.888G>A	c.(886-888)CAG>CAA	p.Q296Q	ZBTB20_uc003ebj.2_Silent_p.Q223Q|ZBTB20_uc010hqp.2_Silent_p.Q223Q|ZBTB20_uc003ebk.2_Silent_p.Q223Q|ZBTB20_uc003ebl.2_Silent_p.Q223Q|ZBTB20_uc003ebm.2_Silent_p.Q223Q|ZBTB20_uc003ebn.2_Silent_p.Q223Q|uc003ebo.1_5'Flank	NM_015642	NP_056457	Q9HC78	ZBT20_HUMAN	zinc finger and BTB domain containing 20 isoform	296					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(1)	5				LUSC - Lung squamous cell carcinoma(41;0.0581)|Lung(219;0.191)		GCTCCATCTGCTGCGAGCGCT	0.667													49	336	---	---	---	---	PASS
KTELC1	56983	broad.mit.edu	37	3	119211230	119211230	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119211230C>T	uc003ecm.2	+	11	1208	c.1124C>T	c.(1123-1125)ACG>ATG	p.T375M	KTELC1_uc011bja.1_Missense_Mutation_p.T216M	NM_152305	NP_689518	Q8NBL1	PGLT1_HUMAN	KTEL (Lys-Tyr-Glu-Leu) containing 1 precursor	375						endoplasmic reticulum lumen	UDP-glucosyltransferase activity				0				GBM - Glioblastoma multiforme(114;0.233)		TATAATGTAACGAGAAGGAAA	0.383													84	310	---	---	---	---	PASS
HGD	3081	broad.mit.edu	37	3	120394658	120394658	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120394658C>T	uc003edw.2	-	2	438	c.68G>A	c.(67-69)GGT>GAT	p.G23D		NM_000187	NP_000178	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	23					L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	homogentisate 1,2-dioxygenase activity|metal ion binding				0				GBM - Glioblastoma multiforme(114;0.158)		TGGCAGGGAACCTGGGCAGCG	0.468													27	382	---	---	---	---	PASS
PARP15	165631	broad.mit.edu	37	3	122354820	122354820	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122354820C>T	uc003efm.2	+	12	1976	c.1910C>T	c.(1909-1911)CCC>CTC	p.P637L	PARP15_uc003efn.2_Missense_Mutation_p.P442L|PARP15_uc003efo.1_Missense_Mutation_p.P384L|PARP15_uc003efp.1_Missense_Mutation_p.P403L|PARP15_uc011bjt.1_Missense_Mutation_p.P334L	NM_001113523	NP_001106995	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	615	PARP catalytic.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	NAD+ ADP-ribosyltransferase activity			lung(3)|upper_aerodigestive_tract(1)|ovary(1)	5				GBM - Glioblastoma multiforme(114;0.0531)		ACCCCTCCACCCAAGAATCCT	0.458													32	258	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122645393	122645393	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122645393C>T	uc003efz.1	-	9	1286	c.982G>A	c.(982-984)GGC>AGC	p.G328S	SEMA5B_uc011bju.1_Missense_Mutation_p.G270S|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.G328S|SEMA5B_uc010hro.1_Missense_Mutation_p.G270S|SEMA5B_uc010hrp.1_RNA	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	328	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		AGGAATCGGCCCCCCACGTCA	0.612													18	97	---	---	---	---	PASS
IFT122	55764	broad.mit.edu	37	3	129183505	129183505	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129183505G>A	uc003emm.2	+	7	650	c.444G>A	c.(442-444)GCG>GCA	p.A148A	IFT122_uc003eml.2_Silent_p.A199A|IFT122_uc003emn.2_Silent_p.A148A|IFT122_uc003emo.2_Silent_p.A96A|IFT122_uc003emp.2_5'UTR|IFT122_uc010htc.2_Silent_p.A199A|IFT122_uc011bky.1_5'UTR|IFT122_uc003emq.2_Intron|IFT122_uc003emr.2_5'UTR|IFT122_uc011bla.1_5'UTR|IFT122_uc011bkx.1_Intron|IFT122_uc011bkz.1_RNA	NM_052989	NP_443715	Q9HBG6	IF122_HUMAN	WD repeat domain 10 isoform 2	148	WD 4.				camera-type eye morphogenesis|cilium morphogenesis|embryonic body morphogenesis|embryonic heart tube development|limb development|neural tube closure	microtubule basal body|photoreceptor connecting cilium				ovary(1)|skin(1)	2						AGTACCTGGCGCTGGGGATGT	0.517													60	536	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132294745	132294745	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132294745G>A	uc003eov.3	-	17	2252	c.1872C>T	c.(1870-1872)TCC>TCT	p.S624S		NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	624						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						GGCGGCCTTGGGAAATTTCAA	0.478													106	252	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147127973	147127973	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147127973C>T	uc003ewe.2	+	1	793	c.74C>T	c.(73-75)GCG>GTG	p.A25V		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	25					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CACCACTCCGCGGGCGACGTG	0.716													35	96	---	---	---	---	PASS
AADACL2	344752	broad.mit.edu	37	3	151458463	151458463	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151458463G>A	uc003ezc.2	+	2	288	c.168G>A	c.(166-168)ATG>ATA	p.M56I	AADACL2_uc010hvn.2_Intron	NM_207365	NP_997248	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2 precursor	56						extracellular region|integral to membrane	carboxylesterase activity				0			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TGCGTATTATGAGATATGAAG	0.274													84	209	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155199554	155199554	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155199554T>A	uc011bok.1	-	23	4562	c.4285A>T	c.(4285-4287)ACT>TCT	p.T1429S	PLCH1_uc011boj.1_3'UTR|PLCH1_uc011bol.1_Missense_Mutation_p.T1391S	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	1429					lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			ATACTTTGAGTTTTGACATCT	0.418													44	487	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	3	161147038	161147038	+	IGR	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161147038G>C								C3orf57 (57167 upstream) : OTOL1 (67558 downstream)																							CAATGTCATAGAGCTTCTTCA	0.448													19	450	---	---	---	---	PASS
SLC7A14	57709	broad.mit.edu	37	3	170198775	170198775	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170198775T>C	uc003fgz.2	-	7	1612	c.1296A>G	c.(1294-1296)CAA>CAG	p.Q432Q	CLDN11_uc011bpt.1_Intron|uc003fha.1_Intron	NM_020949	NP_066000	Q8TBB6	S7A14_HUMAN	solute carrier family 7 (cationic amino acid	432						integral to membrane	amino acid transmembrane transporter activity			ovary(2)|upper_aerodigestive_tract(1)|liver(1)|central_nervous_system(1)	5	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			CACTCTCAGGTTGGTATCGAA	0.498													45	458	---	---	---	---	PASS
GHSR	2693	broad.mit.edu	37	3	172165997	172165997	+	Silent	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:172165997C>A	uc003fib.1	-	1	207	c.207G>T	c.(205-207)TCG>TCT	p.S69S	GHSR_uc011bpv.1_Silent_p.S69S	NM_198407	NP_940799	Q92847	GHSR_HUMAN	growth hormone secretagogue receptor isoform 1a	69	Cytoplasmic (Potential).				actin polymerization or depolymerization|adult feeding behavior|decidualization|growth hormone secretion|hormone-mediated signaling pathway|negative regulation of inflammatory response|negative regulation of interleukin-1 beta production|negative regulation of interleukin-6 biosynthetic process|negative regulation of tumor necrosis factor biosynthetic process|positive regulation of appetite|positive regulation of multicellular organism growth	cell surface|integral to membrane|membrane raft|neuron projection|plasma membrane	growth hormone secretagogue receptor activity|growth hormone-releasing hormone receptor activity			lung(3)|ovary(1)|central_nervous_system(1)	5	Ovarian(172;0.00143)|Breast(254;0.197)		Lung(28;3.93e-15)|LUSC - Lung squamous cell carcinoma(14;1.48e-14)|STAD - Stomach adenocarcinoma(35;0.235)			CGCGGAAGCGCGACACCACCA	0.657													163	71	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179460014	179460014	+	Silent	SNP	C	T	T	rs140308745		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179460014C>T	uc003fkh.2	+	12	1491	c.1410C>T	c.(1408-1410)AGC>AGT	p.S470S	USP13_uc003fkf.2_Silent_p.S470S	NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	470					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			AAAACCCAAGCGATGTTTTTC	0.453													67	192	---	---	---	---	PASS
EHHADH	1962	broad.mit.edu	37	3	184910689	184910689	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184910689G>A	uc003fpf.2	-	7	1524	c.1497C>T	c.(1495-1497)GGC>GGT	p.G499G	EHHADH_uc011brs.1_Silent_p.G403G	NM_001966	NP_001957	Q08426	ECHP_HUMAN	enoyl-Coenzyme A, hydratase/3-hydroxyacyl	499	3-hydroxyacyl-CoA dehydrogenase.					peroxisome	3-hydroxyacyl-CoA dehydrogenase activity|coenzyme binding|dodecenoyl-CoA delta-isomerase activity|enoyl-CoA hydratase activity			ovary(3)	3	all_cancers(143;4.04e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.98e-32)|OV - Ovarian serous cystadenocarcinoma(80;5.55e-21)		NADH(DB00157)	CTGGTTTGCTGCCTTCTTCTA	0.418													73	531	---	---	---	---	PASS
TPRG1	285386	broad.mit.edu	37	3	188956628	188956628	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188956628C>T	uc003frv.1	+	9	1636	c.409C>T	c.(409-411)CGG>TGG	p.R137W	TPRG1_uc003frw.1_Missense_Mutation_p.R137W	NM_198485	NP_940887	Q6ZUI0	TPRG1_HUMAN	tumor protein p63 regulated 1	137											0	all_cancers(143;6.12e-12)|all_hematologic(3;0.0359)|Ovarian(172;0.0925)	all_lung(153;8.23e-09)|Lung NSC(153;3.55e-06)|all_neural(597;0.0019)|Myeloproliferative disorder(1037;0.0255)	Lung(62;6.93e-06)	GBM - Glioblastoma multiforme(93;4.77e-14)		GCAGCTGCAGCGGATTCCTCT	0.478													16	581	---	---	---	---	PASS
FYTTD1	84248	broad.mit.edu	37	3	197505211	197505211	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197505211C>T	uc003fyi.2	+	8	953	c.734C>T	c.(733-735)ACT>ATT	p.T245I	FYTTD1_uc011bui.1_Missense_Mutation_p.T219I|FYTTD1_uc011buj.1_RNA|FYTTD1_uc011buk.1_Missense_Mutation_p.T178I	NM_032288	NP_115664	Q96QD9	UIF_HUMAN	forty-two-three domain containing 1 isoform 1	245					mRNA export from nucleus	nuclear speck	mRNA binding|protein binding				0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.175)		TCTAATAGAACTCAGAAACCA	0.343													22	155	---	---	---	---	PASS
MAEA	10296	broad.mit.edu	37	4	1316281	1316281	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1316281G>A	uc003gda.2	+	4	599	c.569G>A	c.(568-570)CGG>CAG	p.R190Q	MAEA_uc010ibs.1_Intron|MAEA_uc003gdb.2_Intron|MAEA_uc011bvb.1_Missense_Mutation_p.R122Q|MAEA_uc003gdc.2_Intron|MAEA_uc003gdd.2_Intron|MAEA_uc011bvc.1_Missense_Mutation_p.R189Q|MAEA_uc011bvd.1_Missense_Mutation_p.R142Q|MAEA_uc010ibt.2_Intron	NM_001017405	NP_001017405	Q7L5Y9	MAEA_HUMAN	macrophage erythroblast attacher isoform 1	190	CTLH.				cell adhesion|cell cycle|cell division|erythrocyte maturation|negative regulation of myeloid cell apoptosis|regulation of mitotic cell cycle	actomyosin contractile ring|integral to plasma membrane|membrane fraction|nuclear matrix|spindle	actin binding			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(23;0.0201)			TCCCGGCTCCGGAAGATGAAG	0.657													38	31	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56823455	56823455	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56823455C>G	uc003hbi.2	+	5	773	c.539C>G	c.(538-540)TCT>TGT	p.S180C	CEP135_uc003hbh.1_Missense_Mutation_p.S180C|CEP135_uc010igz.1_Missense_Mutation_p.S10C	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	180					centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					GTTCCTCCCTCTGAAGTCAGT	0.418													55	177	---	---	---	---	PASS
WDFY3	23001	broad.mit.edu	37	4	85598453	85598453	+	Silent	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:85598453C>G	uc003hpd.2	-	67	10764	c.10356G>C	c.(10354-10356)GTG>GTC	p.V3452V	WDFY3_uc003hpc.2_Silent_p.V207V	NM_014991	NP_055806	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3 isoform	3452						cytoplasmic part|extrinsic to membrane|nuclear envelope	1-phosphatidylinositol binding|metal ion binding|protein binding			ovary(2)|central_nervous_system(1)	3		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTTCATCCTTCACCCAGTGAT	0.557													27	55	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762125	96762125	+	Missense_Mutation	SNP	A	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762125A>C	uc003htr.3	+	1	887	c.824A>C	c.(823-825)AAG>ACG	p.K275T		NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor	275					glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	AGATCTGGAAAGGGGCCCATA	0.453													10	110	---	---	---	---	PASS
NDST4	64579	broad.mit.edu	37	4	115997955	115997955	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115997955C>A	uc003ibu.2	-	2	917	c.238G>T	c.(238-240)GTC>TTC	p.V80F	NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase	80	Lumenal (Potential).|Heparan sulfate N-deacetylase 4.					Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		AAGAGAAGGACAGTAGGGTCC	0.443													47	108	---	---	---	---	PASS
LRBA	987	broad.mit.edu	37	4	151749383	151749383	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:151749383G>A	uc010ipj.2	-	30	5594	c.5120C>T	c.(5119-5121)GCC>GTC	p.A1707V	LRBA_uc003ilt.3_Missense_Mutation_p.A366V|LRBA_uc003ilu.3_Missense_Mutation_p.A1707V	NM_006726	NP_006717	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and	1707						endoplasmic reticulum|Golgi apparatus|integral to membrane|lysosome|plasma membrane	protein binding			ovary(3)|breast(3)|skin(1)	7	all_hematologic(180;0.151)					ATCACCAAGGGCTCCAAGGCA	0.433													73	70	---	---	---	---	PASS
GUCY1A3	2982	broad.mit.edu	37	4	156631983	156631983	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156631983T>C	uc003iov.2	+	7	1202	c.666T>C	c.(664-666)GCT>GCC	p.A222A	GUCY1A3_uc003iou.2_Silent_p.A222A|GUCY1A3_uc010iqc.2_Silent_p.A222A|GUCY1A3_uc003iow.2_Silent_p.A222A|GUCY1A3_uc010iqd.2_Silent_p.A221A|GUCY1A3_uc003iox.2_Silent_p.A222A|GUCY1A3_uc003ioz.2_5'UTR|GUCY1A3_uc003ioy.2_Silent_p.A222A|GUCY1A3_uc010iqe.2_5'UTR|GUCY1A3_uc003ipa.2_Intron|GUCY1A3_uc003ipb.2_Silent_p.A222A	NM_000856	NP_000847	Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3 isoform A	222					blood circulation|intracellular signal transduction|nitric oxide mediated signal transduction|platelet activation	guanylate cyclase complex, soluble	GTP binding|guanylate cyclase activity|heme binding|receptor activity			central_nervous_system(2)|ovary(1)|skin(1)	4	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		TAAAGGCAGCTGCTCACGTAT	0.443													42	66	---	---	---	---	PASS
TRIM60	166655	broad.mit.edu	37	4	165961430	165961430	+	Missense_Mutation	SNP	C	T	T	rs148893149	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:165961430C>T	uc003iqy.1	+	3	376	c.206C>T	c.(205-207)CCC>CTC	p.P69L	TRIM60_uc010iqx.1_Missense_Mutation_p.P69L	NM_152620	NP_689833	Q495X7	TRI60_HUMAN	ring finger protein 129	69						intracellular	zinc ion binding			skin(1)	1	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		AGGAGGAACCCCCAGCTCCGT	0.468													50	52	---	---	---	---	PASS
FLJ33360	401172	broad.mit.edu	37	5	6312634	6312634	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6312634A>G	uc003jdn.1	-	2	339	c.242T>C	c.(241-243)CTG>CCG	p.L81P		NM_001001702	NP_001001702			SubName: Full=FLJ33360 protein; SubName: Full=cDNA FLJ33360 fis, clone BRACE2005253;												0						GAGGAACCCCAGGAGAGGGGA	0.498													11	19	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13864617	13864617	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13864617G>T	uc003jfd.2	-	28	4527	c.4485C>A	c.(4483-4485)CAC>CAA	p.H1495Q		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1495	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCCTTTCCCAGTGCCGCTCCA	0.473									Kartagener_syndrome				68	111	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24491937	24491937	+	Splice_Site	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24491937C>A	uc003jgr.1	-	11	1957	c.1625_splice	c.e11-1	p.D542_splice	CDH10_uc011cnu.1_Splice_Site	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		GCAGTATTATCTAAAACAAAT	0.274										HNSCC(23;0.051)			14	41	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24498596	24498596	+	Missense_Mutation	SNP	A	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24498596A>C	uc003jgr.1	-	9	1758	c.1426T>G	c.(1426-1428)TTT>GTT	p.F476V	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	476	Cadherin 4.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		ATTCTCACAAAAACAGCCACG	0.393										HNSCC(23;0.051)			81	149	---	---	---	---	PASS
PTGER4	5734	broad.mit.edu	37	5	40692343	40692343	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40692343C>G	uc003jlz.2	+	3	1922	c.1330C>G	c.(1330-1332)CAG>GAG	p.Q444E		NM_000958	NP_000949	P35408	PE2R4_HUMAN	prostaglandin E receptor 4, subtype EP4	444	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|immune response	integral to membrane|plasma membrane	prostaglandin E receptor activity			lung(2)	2						AGACTCTTCACAGGGTCAGGA	0.587													45	68	---	---	---	---	PASS
HEATR7B2	133558	broad.mit.edu	37	5	41004483	41004483	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41004483C>A	uc003jmj.3	-	37	4649	c.4159G>T	c.(4159-4161)GAA>TAA	p.E1387*	HEATR7B2_uc003jmi.3_Nonsense_Mutation_p.E942*	NM_173489	NP_775760	Q7Z745	HTRB2_HUMAN	HEAT repeat family member 7B2	1387	HEAT 15.						binding			ovary(6)|central_nervous_system(2)	8						AGCACTATTTCCTTGAAGTAG	0.458													133	235	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45396630	45396630	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45396630C>T	uc003jok.2	-	4	1219	c.1194G>A	c.(1192-1194)CAG>CAA	p.Q398Q		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	398	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						AATCCAGAGACTGGATTAAAG	0.473													46	65	---	---	---	---	PASS
MAN2A1	4124	broad.mit.edu	37	5	109190950	109190950	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:109190950T>C	uc003kou.1	+	20	4049	c.3086T>C	c.(3085-3087)CTT>CCT	p.L1029P		NM_002372	NP_002363	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	1029	Lumenal (Potential).				mannose metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-mannosidase activity|carbohydrate binding|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity|zinc ion binding			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TCACCTACCCTTGAGCTGCAA	0.398													3	102	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120021815	120021815	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120021815A>T	uc003ksq.2	+	2	489	c.326A>T	c.(325-327)CAC>CTC	p.H109L	PRR16_uc003ksp.2_Missense_Mutation_p.H86L|PRR16_uc003ksr.2_Missense_Mutation_p.H39L	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	109	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		CCCCCAGCACACCCGTCTGCT	0.527													135	56	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140209305	140209305	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140209305G>A	uc003lho.2	+	1	1656	c.1629G>A	c.(1627-1629)CCG>CCA	p.P543P	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc011dab.1_Silent_p.P543P	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	543	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCGTGCCGCCTCTGGGCA	0.692													16	144	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140574310	140574310	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574310G>T	uc003lix.2	+	1	2359	c.2185G>T	c.(2185-2187)GTG>TTG	p.V729L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	729	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCGCTGCTCGGTGCCCGAGGG	0.672													88	48	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140711925	140711925	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140711925C>T	uc003lji.1	+	1	1674	c.1674C>T	c.(1672-1674)AAC>AAT	p.N558N	PCDHGA1_uc011dan.1_Silent_p.N558N	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	558	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGAACGACAACGCGCCCGAGA	0.647													10	254	---	---	---	---	PASS
PCDH1	5097	broad.mit.edu	37	5	141244788	141244788	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141244788G>A	uc003llq.2	-	3	1225	c.1108C>T	c.(1108-1110)CGT>TGT	p.R370C	PCDH1_uc003llp.2_Missense_Mutation_p.R370C|PCDH1_uc011dbf.1_Missense_Mutation_p.R348C	NM_002587	NP_002578	Q08174	PCDH1_HUMAN	protocadherin 1 isoform 1 precursor	370	Extracellular (Potential).|Cadherin 3.				cell-cell signaling|homophilic cell adhesion|nervous system development	cell-cell junction|integral to plasma membrane	calcium ion binding	p.R370C(1)		ovary(5)	5		Lung NSC(810;0.027)|all_lung(500;0.0321)|all_hematologic(541;0.0433)|Prostate(461;0.0453)|Breast(839;0.128)|Lung SC(612;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;1.06e-05)		ACCTGGGCACGGGCACTCTTG	0.572													13	134	---	---	---	---	PASS
FAM114A2	10827	broad.mit.edu	37	5	153413346	153413346	+	Intron	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153413346C>A	uc003lvb.2	-						FAM114A2_uc003lvc.2_Intron|FAM114A2_uc003lvd.2_Intron|FAM114A2_uc003lve.2_Intron|FAM114A2_uc011dda.1_Intron	NM_018691	NP_061161	Q9NRY5	F1142_HUMAN	hypothetical protein LOC10827								purine nucleotide binding				0						TTTCCATATACTGACCTGCTA	0.388													37	30	---	---	---	---	PASS
CYFIP2	26999	broad.mit.edu	37	5	156757807	156757807	+	Silent	SNP	G	A	A	rs141399379	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156757807G>A	uc003lwq.2	+	22	2352	c.2214G>A	c.(2212-2214)CCG>CCA	p.P738P	CYFIP2_uc011ddn.1_Silent_p.P712P|CYFIP2_uc011ddo.1_Silent_p.P542P|CYFIP2_uc003lwr.2_Silent_p.P738P|CYFIP2_uc003lws.2_Silent_p.P738P|CYFIP2_uc003lwt.2_Silent_p.P641P|CYFIP2_uc011ddp.1_Silent_p.P472P	NM_001037333	NP_001032410	Q96F07	CYFP2_HUMAN	cytoplasmic FMR1 interacting protein 2	763					apoptosis|cell-cell adhesion	cell junction|perinuclear region of cytoplasm|synapse|synaptosome	protein binding				0	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCATCATTCCGTATCCACCGT	0.483													28	82	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12120635	12120635	+	Missense_Mutation	SNP	A	G	G	rs140801617	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12120635A>G	uc003nac.2	+	4	786	c.607A>G	c.(607-609)ATG>GTG	p.M203V	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	203					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				ACTGAAAGCAATGGAGCCAGA	0.448													122	94	---	---	---	---	PASS
CDKAL1	54901	broad.mit.edu	37	6	20955827	20955827	+	Intron	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:20955827G>T	uc003ndc.1	+						CDKAL1_uc003ndd.1_Intron|CDKAL1_uc003nde.1_Intron	NM_017774	NP_060244	Q5VV42	CDKAL_HUMAN	CDK5 regulatory subunit associated protein						RNA modification	integral to membrane	4 iron, 4 sulfur cluster binding|metal ion binding|transferase activity			ovary(2)	2	all_epithelial(95;0.0708)|Breast(50;0.131)|Ovarian(93;0.227)		OV - Ovarian serous cystadenocarcinoma(7;0.0241)|all cancers(50;0.123)|Epithelial(50;0.248)			GTAAGGAAAAGCACCCTATTT	0.443													28	177	---	---	---	---	PASS
HIST1H4I	8294	broad.mit.edu	37	6	27107122	27107122	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27107122G>A	uc003niy.1	+	1	35	c.35G>A	c.(34-36)GGG>GAG	p.G12E	HIST1H2BK_uc003nix.1_Intron	NM_003495	NP_003486	P62805	H4_HUMAN	histone cluster 1, H4i	12					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			lung(1)	1						AAGGGCCTGGGGAAAGGGGGT	0.592			T	BCL6	NHL								20	115	---	---	---	---	PASS
OR2J3	442186	broad.mit.edu	37	6	29079672	29079672	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29079672A>T	uc011dll.1	+	1	5	c.5A>T	c.(4-6)AAT>ATT	p.N2I		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TAGGAAATGAATGATGATGGA	0.264													291	229	---	---	---	---	PASS
ZFP57	346171	broad.mit.edu	37	6	29640930	29640930	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29640930C>T	uc011dlw.1	-	4	1109	c.958G>A	c.(958-960)GAT>AAT	p.D320N	ZFP57_uc003nnl.3_Missense_Mutation_p.D300N	NM_001109809	NP_001103279	Q9NU63	ZFP57_HUMAN	zinc finger protein 57 homolog	236					DNA methylation involved in embryo development|regulation of gene expression by genetic imprinting|transcription, DNA-dependent		DNA binding|zinc ion binding			ovary(3)|skin(2)	5						TGGTTCACATCCAAAAGCCCC	0.537													236	173	---	---	---	---	PASS
CFB	629	broad.mit.edu	37	6	31914821	31914821	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31914821G>T	uc003nyj.3	+	3	614	c.336G>T	c.(334-336)GGG>GGT	p.G112G	CFB_uc011dor.1_Silent_p.G614G|CFB_uc011dos.1_3'UTR|CFB_uc003nyi.2_Silent_p.G112G	NM_001710	NP_001701	P00751	CFAB_HUMAN	complement factor B preproprotein	112	Sushi 2.				complement activation, alternative pathway|proteolysis	extracellular region|plasma membrane	complement binding|serine-type endopeptidase activity			skin(1)	1						TCGAGAACGGGGAATACTGGC	0.537													37	185	---	---	---	---	PASS
GLP1R	2740	broad.mit.edu	37	6	39046732	39046732	+	Splice_Site	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39046732G>A	uc003ooj.3	+	9	945	c.885_splice	c.e9-1	p.G295_splice	GLP1R_uc003ooh.2_Splice_Site|GLP1R_uc003ooi.2_Splice_Site	NM_002062	NP_002053	P43220	GLP1R_HUMAN	glucagon-like peptide 1 receptor precursor						activation of adenylate cyclase activity|cAMP-mediated signaling|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|regulation of insulin secretion	integral to membrane|plasma membrane	glucagon receptor activity|peptide receptor activity, G-protein coupled			lung(3)|breast(1)|pancreas(1)	5					Exenatide(DB01276)|Glucagon recombinant(DB00040)	TCCCTCCCCAGCTGCTGGACC	0.582													80	348	---	---	---	---	PASS
GCM1	8521	broad.mit.edu	37	6	52993720	52993720	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52993720G>T	uc003pbp.2	-	6	804	c.595C>A	c.(595-597)CAG>AAG	p.Q199K		NM_003643	NP_003634	Q9NP62	GCM1_HUMAN	glial cells missing homolog a	199						transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			central_nervous_system(1)	1	Lung NSC(77;0.0755)					AAACTCCCCTGACTTTGTGTT	0.433													175	132	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57472417	57472417	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57472417G>T	uc003pdx.2	+	13	1293	c.1206G>T	c.(1204-1206)AAG>AAT	p.K402N		NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2	402					DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AGTCATACAAGATCTCTCCTG	0.433													9	112	---	---	---	---	PASS
IBTK	25998	broad.mit.edu	37	6	82924287	82924287	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:82924287C>A	uc003pjl.1	-	12	2388	c.1861G>T	c.(1861-1863)GAG>TAG	p.E621*	IBTK_uc011dyv.1_Nonsense_Mutation_p.E621*|IBTK_uc011dyw.1_Intron|IBTK_uc010kbi.1_Nonsense_Mutation_p.E315*|IBTK_uc003pjm.2_Nonsense_Mutation_p.E621*	NM_015525	NP_056340	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton's tyrosine kinase	621	BTB 1.				negative regulation of protein phosphorylation|release of sequestered calcium ion into cytosol	cytoplasm|membrane|nucleus	protein kinase binding|protein tyrosine kinase inhibitor activity			ovary(2)|central_nervous_system(2)	4		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		TGAACCTTCTCTACCACAAAG	0.323													19	140	---	---	---	---	PASS
TBX18	9096	broad.mit.edu	37	6	85446865	85446865	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85446865A>G	uc003pkl.1	-	8	1362	c.1362T>C	c.(1360-1362)ACT>ACC	p.T454T	TBX18_uc010kbq.1_Intron	NM_001080508	NP_001073977	O95935	TBX18_HUMAN	T-box 18	454					multicellular organismal development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|pancreas(2)|lung(1)	5		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CATAGGAGGGAGTCCTGGGCG	0.602													42	287	---	---	---	---	PASS
SNX14	57231	broad.mit.edu	37	6	86253440	86253440	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86253440T>C	uc003pkr.2	-	13	1340	c.1147A>G	c.(1147-1149)AAT>GAT	p.N383D	SNX14_uc003pkp.2_Missense_Mutation_p.N246D|SNX14_uc003pkq.2_5'UTR|SNX14_uc011dzg.1_Missense_Mutation_p.N331D|SNX14_uc003pks.2_Missense_Mutation_p.N339D|SNX14_uc003pkt.2_Missense_Mutation_p.N383D	NM_153816	NP_722523	Q9Y5W7	SNX14_HUMAN	sorting nexin 14 isoform a	383	RGS.				cell communication|protein transport	integral to membrane	phosphatidylinositol binding|signal transducer activity				0		all_cancers(76;4.83e-07)|Acute lymphoblastic leukemia(125;3.3e-08)|Prostate(29;2.55e-07)|all_hematologic(105;3.66e-05)|all_epithelial(107;0.000695)|Lung NSC(302;0.197)|all_lung(197;0.24)		BRCA - Breast invasive adenocarcinoma(108;0.0423)		ATTTCATCATTTGATAATTCT	0.254													9	59	---	---	---	---	PASS
ZNF292	23036	broad.mit.edu	37	6	87965905	87965905	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:87965905A>T	uc003plm.3	+	8	2599	c.2558A>T	c.(2557-2559)CAG>CTG	p.Q853L		NM_015021	NP_055836	O60281	ZN292_HUMAN	zinc finger protein 292	853					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)	4		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GATTCCATTCAGCCTTCTGAA	0.413													19	154	---	---	---	---	PASS
CDC40	51362	broad.mit.edu	37	6	110541048	110541048	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110541048A>T	uc003pua.2	+	12	1340	c.1316A>T	c.(1315-1317)GAT>GTT	p.D439V		NM_015891	NP_056975	O60508	PRP17_HUMAN	cell division cycle 40 homolog	439	WD 4.				mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	catalytic step 2 spliceosome|nucleoplasm					0		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		ACATCTGATGATAAAAGCCTA	0.378													45	91	---	---	---	---	PASS
KIAA1244	57221	broad.mit.edu	37	6	138635047	138635047	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138635047C>T	uc003qhu.2	+	26	4316	c.4316C>T	c.(4315-4317)TCA>TTA	p.S1439L		NM_020340	NP_065073	Q5TH69	BIG3_HUMAN	brefeldin A-inhibited guanine	1439					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)|skin(1)	2	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GGAATTGAATCAGTCCTGTCT	0.428													18	29	---	---	---	---	PASS
TFB1M	51106	broad.mit.edu	37	6	155635434	155635434	+	Silent	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155635434C>G	uc003qqj.3	-	1	193	c.129G>C	c.(127-129)CTG>CTC	p.L43L	TFB1M_uc003qqk.2_RNA	NM_016020	NP_057104	Q8WVM0	TFB1M_HUMAN	transcription factor B1, mitochondrial	43					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial nucleoid	DNA binding|protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity			skin(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;1.48e-12)|BRCA - Breast invasive adenocarcinoma(81;0.0131)		ATCCACCTGTCAGCCTCAAGT	0.612													9	30	---	---	---	---	PASS
QKI	9444	broad.mit.edu	37	6	163956076	163956076	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163956076C>T	uc003qui.2	+	4	1016	c.465C>T	c.(463-465)ATC>ATT	p.I155I	QKI_uc003que.2_Silent_p.I155I|QKI_uc003quf.2_Silent_p.I155I|QKI_uc003qug.2_Silent_p.I155I|QKI_uc003quh.2_Silent_p.I155I|QKI_uc003quj.2_Silent_p.I155I	NM_006775	NP_006766	Q96PU8	QKI_HUMAN	quaking homolog, KH domain RNA binding isoform	155					mRNA processing|mRNA transport|regulation of translation|RNA splicing	cytoplasm|nucleus|plasma membrane	RNA binding|SH3 domain binding			large_intestine(1)|ovary(1)	2		Breast(66;5e-05)|Prostate(117;0.0235)|all_neural(5;0.0416)|Ovarian(120;0.0448)|Glioma(2;0.203)		all cancers(1;4.4e-46)|OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|GBM - Glioblastoma multiforme(1;2.94e-19)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|Kidney(3;0.000199)|KIRC - Kidney renal clear cell carcinoma(3;0.000234)		ATGTACTAATCACTGTGGAAG	0.348													13	128	---	---	---	---	PASS
C6orf70	55780	broad.mit.edu	37	6	170175438	170175438	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170175438G>T	uc003qxg.1	+	14	1423	c.1390G>T	c.(1390-1392)GTC>TTC	p.V464F	C6orf70_uc011ehb.1_Missense_Mutation_p.V338F|C6orf70_uc003qxh.1_Missense_Mutation_p.V464F|C6orf70_uc010kky.1_Missense_Mutation_p.V338F|C6orf70_uc003qxi.1_Missense_Mutation_p.V112F	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	464						integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		TCGGCAAGCCGTCAGGTGCGT	0.512													13	32	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11422150	11422150	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11422150G>A	uc003ssf.3	-	23	4757	c.4505C>T	c.(4504-4506)ACA>ATA	p.T1502I	uc003ssb.2_Intron|THSD7A_uc003ssd.3_5'Flank	NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1502	Extracellular (Potential).					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AGGTTTACCTGTTACATTTAT	0.403										HNSCC(18;0.044)			12	49	---	---	---	---	PASS
DPY19L1	23333	broad.mit.edu	37	7	34971211	34971211	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34971211T>C	uc003tem.3	-	22	2147	c.2002A>G	c.(2002-2004)AAA>GAA	p.K668E	DPY19L1_uc003tel.1_RNA	NM_015283	NP_056098	Q2PZI1	D19L1_HUMAN	dpy-19-like 1	668						integral to membrane					0						TCTAGGACTTTGTAAACACTG	0.408													23	137	---	---	---	---	PASS
TXNDC3	51314	broad.mit.edu	37	7	37907413	37907413	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37907413C>T	uc003tfn.2	+	11	1103	c.731C>T	c.(730-732)ACT>ATT	p.T244I		NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3	244	NDK 1.				cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						GAACCACAGACTGACACCGAA	0.433									Kartagener_syndrome				24	84	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	38402610	38402610	+	Intron	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38402610G>C	uc003tgp.1	+						uc003tgs.1_Missense_Mutation_p.S70C					Homo sapiens cDNA FLJ43658 fis, clone SYNOV4004184.																		GGAGTTGTAGGAGTCATAGTA	0.468													48	99	---	---	---	---	PASS
GTF2IRD1	9569	broad.mit.edu	37	7	73969796	73969796	+	Silent	SNP	C	T	T	rs145914970	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73969796C>T	uc003uaq.2	+	19	2433	c.2040C>T	c.(2038-2040)GAC>GAT	p.D680D	GTF2IRD1_uc010lbq.2_Silent_p.D697D|GTF2IRD1_uc003uap.2_Silent_p.D665D|GTF2IRD1_uc003uar.1_Silent_p.D665D	NM_016328	NP_057412	Q9UHL9	GT2D1_HUMAN	GTF2I repeat domain containing 1 isoform 1	680						nucleus	DNA binding|protein binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity			ovary(4)	4						CTCTGGTGGACGAGAGCCTGA	0.607													19	97	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81695831	81695831	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81695831C>A	uc003uhr.1	-	8	924	c.668G>T	c.(667-669)TGG>TTG	p.W223L		NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	223	Extracellular (Potential).					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	ATTATCAACCCATGGTGAAGC	0.279													14	33	---	---	---	---	PASS
SEMA3D	223117	broad.mit.edu	37	7	84649630	84649630	+	Silent	SNP	T	A	A	rs111882229		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:84649630T>A	uc003uic.2	-	12	1462	c.1422A>T	c.(1420-1422)GGA>GGT	p.G474G	SEMA3D_uc010led.2_Silent_p.G474G|SEMA3D_uc003uib.2_Silent_p.G113G	NM_152754	NP_689967	O95025	SEM3D_HUMAN	semaphorin 3D precursor	474	Sema.				cell differentiation|nervous system development	extracellular region|membrane	receptor activity			ovary(3)|large_intestine(2)	5						TGAGGACAGTTCCAATGTCTG	0.403													75	56	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95657515	95657515	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95657515G>A	uc003uoc.3	+	11	1326	c.1049G>A	c.(1048-1050)CGT>CAT	p.R350H	DYNC1I1_uc003uod.3_Missense_Mutation_p.R333H|DYNC1I1_uc003uob.2_Missense_Mutation_p.R313H|DYNC1I1_uc003uoe.3_Missense_Mutation_p.R330H|DYNC1I1_uc010lfl.2_Missense_Mutation_p.R339H	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	350	WD 2.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TGCTTCGCCCGTTTCCATCCT	0.512													377	282	---	---	---	---	PASS
ORC5L	5001	broad.mit.edu	37	7	103801611	103801611	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103801611C>A	uc003vcb.2	-	12	1169	c.1058G>T	c.(1057-1059)GGG>GTG	p.G353V	ORC5L_uc011klp.1_Missense_Mutation_p.G221V	NM_002553	NP_002544	O43913	ORC5_HUMAN	origin recognition complex subunit 5 isoform 1	353					cell cycle checkpoint|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	cytoplasm|nuclear origin of replication recognition complex|nucleoplasm	ATP binding|DNA replication origin binding|identical protein binding				0						TGGTTTTGGCCCAAGGAGATG	0.363													136	122	---	---	---	---	PASS
LHFPL3	375612	broad.mit.edu	37	7	103969662	103969662	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103969662G>T	uc003vce.2	+	1	559	c.435G>T	c.(433-435)CAG>CAT	p.Q145H	LHFPL3_uc003vcf.2_Missense_Mutation_p.Q145H	NM_199000	NP_945351	Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	131	Helical; (Potential).					integral to membrane					0						CCTGGATGCAGCTCACCTCCG	0.642													35	131	---	---	---	---	PASS
RINT1	60561	broad.mit.edu	37	7	105204390	105204390	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105204390G>C	uc003vda.1	+	12	2113	c.1882G>C	c.(1882-1884)GAA>CAA	p.E628Q	RINT1_uc010ljj.1_Missense_Mutation_p.E203Q	NM_021930	NP_068749	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	628	RINT1/TIP20.				cell cycle|G2/M transition DNA damage checkpoint|protein transport|vesicle-mediated transport	endoplasmic reticulum membrane	protein binding			ovary(3)|central_nervous_system(1)	4						GTATAAAAAAGAAAGGTATGT	0.353													83	57	---	---	---	---	PASS
FAM71F2	346653	broad.mit.edu	37	7	128317840	128317840	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128317840G>T	uc003vnk.3	+	3	694	c.588G>T	c.(586-588)AAG>AAT	p.K196N	FAM71F2_uc010llm.1_Missense_Mutation_p.K187N|FAM71F2_uc003vnl.2_RNA|FAM71F2_uc010lln.1_RNA	NM_001012454	NP_001012457	Q6NXP2	F71F2_HUMAN	hypothetical protein LOC346653 isoform a	196											0						TGGTGCCCAAGATGCCCACCA	0.453													12	45	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134878009	134878009	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134878009A>G	uc003vsp.2	-	11	1695	c.1633T>C	c.(1633-1635)TGG>CGG	p.W545R	WDR91_uc010lmq.2_Missense_Mutation_p.W134R|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	545	WD 3.									breast(2)|ovary(1)|skin(1)	4						TTCGTGTCCCACAGCAGCAGC	0.607													30	80	---	---	---	---	PASS
KLRG2	346689	broad.mit.edu	37	7	139164406	139164406	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139164406G>A	uc003vvb.2	-	3	1041	c.972C>T	c.(970-972)TAC>TAT	p.Y324Y	KLRG2_uc010lnc.2_Intron	NM_198508	NP_940910	A4D1S0	KLRG2_HUMAN	killer cell lectin-like receptor subfamily G,	324	C-type lectin.					integral to membrane	sugar binding			central_nervous_system(1)	1	Melanoma(164;0.233)					GGGTAGCGTGGTAGGCTGAGC	0.527													159	151	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142013418	142013418	+	Intron	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013418T>C	uc011kro.1	+						uc011krp.1_Intron|uc003vxg.2_Silent_p.S91S|uc003vxh.1_Silent_p.S88S					SubName: Full=V_segment translation product; Flags: Fragment;																		CCAACAGCTCTCTCTTAAACC	0.517													82	290	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142045388	142045388	+	Intron	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142045388C>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc003vxp.3_Missense_Mutation_p.A9V|uc011krt.1_5'Flank					SubName: Full=V_segment translation product; Flags: Fragment;																		CTCTGCTGTGCGGTTCTCTGT	0.587													44	280	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189091	11189091	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189091G>T	uc003wtp.1	+	1	597	c.476G>T	c.(475-477)TGG>TTG	p.W159L		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	159	DUF6 1.					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		GGCTACGAGTGGTGTGGACTG	0.597													297	103	---	---	---	---	PASS
TUSC3	7991	broad.mit.edu	37	8	15508305	15508305	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:15508305G>T	uc003wwt.2	+	3	618	c.408G>T	c.(406-408)GGG>GGT	p.G136G	TUSC3_uc003wwr.2_Silent_p.G136G|TUSC3_uc003wws.2_Silent_p.G136G|TUSC3_uc003wwu.2_Silent_p.G136G|TUSC3_uc003wwv.2_Silent_p.G136G|TUSC3_uc003www.2_Silent_p.G136G|TUSC3_uc003wwx.2_RNA|TUSC3_uc003wwy.2_Silent_p.G136G	NM_006765	NP_006756	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3 isoform a	136					cell redox homeostasis|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex				ovary(2)|central_nervous_system(1)	3				Colorectal(111;0.113)		ATGATGAGGGGACAGACGTTT	0.358													12	490	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16001066	16001066	+	Splice_Site	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16001066C>T	uc003wwz.2	-	8	1231	c.1033_splice	c.e8+1	p.T345_splice	MSR1_uc010lsu.2_Splice_Site_p.T363_splice|MSR1_uc003wxa.2_Splice_Site_p.S345_splice|MSR1_uc003wxb.2_Splice_Site_p.R345_splice|MSR1_uc011kxz.1_Splice_Site_p.R119_splice	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1						cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		TATATACTTACTTAATGTGTT	0.363													33	10	---	---	---	---	PASS
SCARA5	286133	broad.mit.edu	37	8	27729452	27729452	+	Nonstop_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:27729452C>A	uc003xgj.2	-	9	1927	c.1487G>T	c.(1486-1488)TGA>TTA	p.*496L	SCARA5_uc010luz.2_Nonstop_Mutation_p.*271L	NM_173833	NP_776194	Q6ZMJ2	SCAR5_HUMAN	scavenger receptor class A, member 5	496					cellular iron ion homeostasis|endocytosis|iron ion transmembrane transport|protein homotrimerization	integral to plasma membrane	ferritin receptor activity|scavenger receptor activity			central_nervous_system(1)|skin(1)	2		Ovarian(32;0.0218)		UCEC - Uterine corpus endometrioid carcinoma (27;0.023)|KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)|Colorectal(74;0.228)		TGCCCACTTTCAGTGTCTGTT	0.602													169	55	---	---	---	---	PASS
PDP1	54704	broad.mit.edu	37	8	94935238	94935238	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:94935238A>T	uc003yge.2	+	2	1220	c.951A>T	c.(949-951)CAA>CAT	p.Q317H	PDP1_uc003ygf.2_Missense_Mutation_p.Q342H|PDP1_uc010max.2_Missense_Mutation_p.Q342H|PDP1_uc011lgm.1_Missense_Mutation_p.Q317H|PDP1_uc011lgn.1_Missense_Mutation_p.Q376H	NM_018444	NP_060914	Q9P0J1	PDP1_HUMAN	pyruvate dehyrogenase phosphatase catalytic	317					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix|protein serine/threonine phosphatase complex	[pyruvate dehydrogenase (lipoamide)] phosphatase activity			ovary(1)|skin(1)|central_nervous_system(1)|pancreas(1)	4						ACAATGCTCAAAATGAAAGAG	0.498													136	80	---	---	---	---	PASS
KCNV1	27012	broad.mit.edu	37	8	110984722	110984722	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110984722C>A	uc003ynr.3	-	2	1098	c.756G>T	c.(754-756)TGG>TGT	p.W252C	KCNV1_uc010mcw.2_Missense_Mutation_p.W252C	NM_014379	NP_055194	Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	252	Helical; Name=Segment S2; (Potential).					voltage-gated potassium channel complex	ion channel inhibitor activity|potassium channel regulator activity|voltage-gated potassium channel activity			lung(1)|kidney(1)	2	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			CCCCGGTGAACCAGCTAATGC	0.537													108	67	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113702181	113702181	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113702181G>T	uc003ynu.2	-	14	2230	c.2071C>A	c.(2071-2073)CAG>AAG	p.Q691K	CSMD3_uc003yns.2_5'UTR|CSMD3_uc003ynt.2_Missense_Mutation_p.Q651K|CSMD3_uc011lhx.1_Missense_Mutation_p.Q587K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	691	Extracellular (Potential).|Sushi 3.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AACCCAAACTGGCATTCAAAC	0.373										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			72	395	---	---	---	---	PASS
HAS2	3037	broad.mit.edu	37	8	122641416	122641416	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:122641416T>C	uc003yph.2	-	2	703	c.165A>G	c.(163-165)TCA>TCG	p.S55S		NM_005328	NP_005319	Q92819	HAS2_HUMAN	hyaluronan synthase 2	55	Helical; Name=2; (Potential).					integral to plasma membrane	hyaluronan synthase activity		HAS2/PLAG1(10)	soft_tissue(10)|ovary(5)	15	Lung NSC(37;3.12e-08)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)|all_neural(195;0.142)		STAD - Stomach adenocarcinoma(47;0.00503)			TGATGAGGTGTGATGCCAAAA	0.408													7	601	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139155320	139155320	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139155320C>T	uc003yuy.2	-	16	3744	c.3573G>A	c.(3571-3573)ACG>ACA	p.T1191T	FAM135B_uc003yux.2_Silent_p.T1092T|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.T753T|FAM135B_uc003yvb.2_3'UTR	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	1191										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			ATAACCGATCCGTCATAGTAT	0.463										HNSCC(54;0.14)			6	215	---	---	---	---	PASS
MAPK15	225689	broad.mit.edu	37	8	144803720	144803720	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144803720G>A	uc003yzj.2	+	12	1247	c.1206G>A	c.(1204-1206)GAG>GAA	p.E402E		NM_139021	NP_620590	Q8TD08	MK15_HUMAN	mitogen-activated protein kinase 15	402					protein autophosphorylation	extracellular region	ATP binding|MAP kinase activity|SH3 domain binding			lung(2)	2	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACCCCACAGAGTCCCCCCGTG	0.647													28	147	---	---	---	---	PASS
SMARCA2	6595	broad.mit.edu	37	9	2081898	2081898	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:2081898A>G	uc003zhc.2	+	15	2350	c.2251A>G	c.(2251-2253)ATG>GTG	p.M751V	SMARCA2_uc003zhd.2_Missense_Mutation_p.M751V|SMARCA2_uc010mha.2_Missense_Mutation_p.M742V	NM_003070	NP_003061	P51531	SMCA2_HUMAN	SWI/SNF-related matrix-associated	751	ATP (Potential).|Helicase ATP-binding.				chromatin remodeling|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|nervous system development	intermediate filament cytoskeleton|nBAF complex|npBAF complex|nuclear chromatin|nucleoplasm|SWI/SNF complex|WINAC complex	ATP binding|DNA-dependent ATPase activity|helicase activity|protein binding|RNA polymerase II transcription coactivator activity|transcription regulatory region DNA binding			ovary(2)|central_nervous_system(1)	3		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		AGCCGATGAAATGGGGCTTGG	0.433													438	105	---	---	---	---	PASS
MIR876	100126310	broad.mit.edu	37	9	28863708	28863708	+	5'Flank	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:28863708T>G	hsa-mir-876|MI0005542	-																							0						CACTTCACAGTTTGTGTAAAG	0.393													19	5	---	---	---	---	PASS
BAG1	573	broad.mit.edu	37	9	33261080	33261080	+	Intron	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33261080T>C	uc003zsj.2	-						SUGT1P1_uc010mjq.1_Intron|BAG1_uc003zsi.2_Intron|BAG1_uc003zsk.2_Intron	NM_004323	NP_004314	Q99933	BAG1_HUMAN	BCL2-associated athanogene isoform 1L						anti-apoptosis|apoptosis|cell surface receptor linked signaling pathway|chaperone cofactor-dependent protein refolding	cytoplasm|intermediate filament cytoskeleton|nucleus	protein binding|receptor signaling protein activity			ovary(1)	1			LUSC - Lung squamous cell carcinoma(29;0.00506)			GAAAAAGCAATTTACCTTTTT	0.388													12	331	---	---	---	---	PASS
FAM75A2	642265	broad.mit.edu	37	9	39887386	39887386	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:39887386G>A	uc004abp.2	+	4	402	c.373G>A	c.(373-375)GAA>AAA	p.E125K		NM_001040065	NP_001035154	Q5RGS2	F75A2_HUMAN	hypothetical protein LOC642265	125	Pro-rich.					integral to membrane					0				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		CCCCCCAGGTGAAGTGGGCGA	0.602													30	139	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77435287	77435287	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77435287T>C	uc004ajl.1	-	9	1305	c.1067A>G	c.(1066-1068)AAC>AGC	p.N356S	TRPM6_uc004ajk.1_Missense_Mutation_p.N351S|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.N356S|TRPM6_uc010mpd.1_Missense_Mutation_p.N356S|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	356	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						AAGACTAAAGTTGAAAGTGTT	0.423													29	126	---	---	---	---	PASS
FLJ46321	389763	broad.mit.edu	37	9	84609543	84609543	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84609543G>C	uc004amn.2	+	4	4205	c.4158G>C	c.(4156-4158)CAG>CAC	p.Q1386H		NM_001001670	NP_001001670	Q6ZQQ2	F75D1_HUMAN	hypothetical protein LOC389763	1386						integral to membrane					0						CATGTGTGCAGAATATTGGTC	0.433													11	42	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102590726	102590726	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102590726C>A	uc004baf.1	+	3	1131	c.402C>A	c.(400-402)TAC>TAA	p.Y134*	NR4A3_uc004bae.2_Nonsense_Mutation_p.Y134*|NR4A3_uc004bag.1_Nonsense_Mutation_p.Y134*|NR4A3_uc004bai.2_Nonsense_Mutation_p.Y145*	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	134					regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CCTCCATGTACTTCAAGCAGT	0.612			T	EWSR1	extraskeletal myxoid chondrosarcoma								37	86	---	---	---	---	PASS
ZNF189	7743	broad.mit.edu	37	9	104171502	104171502	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104171502T>C	uc004bbh.1	+	3	1728	c.1452T>C	c.(1450-1452)TAT>TAC	p.Y484Y	ZNF189_uc004bbg.1_Silent_p.Y442Y|ZNF189_uc004bbi.1_Silent_p.Y470Y|ZNF189_uc011lvk.1_Silent_p.Y469Y	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	484	C2H2-type 12.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				AAAAGCCCTATCTATGTACTG	0.413													11	256	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104324201	104324201	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104324201T>C	uc004bbn.2	+	19	2749	c.2659T>C	c.(2659-2661)TCT>CCT	p.S887P		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	887	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		GGAGGACATCTCTAGACTTCG	0.393													107	468	---	---	---	---	PASS
CTNNAL1	8727	broad.mit.edu	37	9	111754347	111754347	+	Intron	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111754347T>C	uc004bdo.1	-						CTNNAL1_uc010mtt.1_Intron|CTNNAL1_uc004bdp.1_Intron	NM_003798	NP_003789	Q9UBT7	CTNL1_HUMAN	catenin, alpha-like 1						cell adhesion|Rho protein signal transduction	actin cytoskeleton|cytosol|plasma membrane	cadherin binding|structural molecule activity			ovary(1)	1				STAD - Stomach adenocarcinoma(157;0.0768)		ATTGTTAGTCTCTGATTTGGG	0.313													15	30	---	---	---	---	PASS
DFNB31	25861	broad.mit.edu	37	9	117188639	117188639	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117188639C>A	uc004biz.3	-	4	1667	c.1018G>T	c.(1018-1020)GAC>TAC	p.D340Y	DFNB31_uc004bix.2_5'Flank|DFNB31_uc004biy.3_5'UTR|DFNB31_uc004bja.3_Missense_Mutation_p.D340Y	NM_015404	NP_056219	Q9P202	WHRN_HUMAN	CASK-interacting protein CIP98 isoform 1	340	PDZ 2.				inner ear receptor stereocilium organization|retina homeostasis|sensory perception of light stimulus|sensory perception of sound	cytoplasm|growth cone|stereocilium				ovary(4)|central_nervous_system(1)|pancreas(1)	6						ACAGCCTCGTCGTGTAGGATG	0.567													25	128	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	118997639	118997639	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:118997639T>A	uc004bjn.2	+	7	2836	c.2455T>A	c.(2455-2457)TTG>ATG	p.L819M	PAPPA_uc011lxp.1_Missense_Mutation_p.L514M|PAPPA_uc011lxq.1_Intron	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	819					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						CATCAAACTGTTGGCTGTCAG	0.537													51	81	---	---	---	---	PASS
PAPPA	5069	broad.mit.edu	37	9	119033690	119033690	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119033690G>A	uc004bjn.2	+	9	3329	c.2948G>A	c.(2947-2949)TGT>TAT	p.C983Y	PAPPA_uc011lxp.1_Missense_Mutation_p.C678Y|PAPPA_uc011lxq.1_Missense_Mutation_p.C358Y	NM_002581	NP_002572	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A	983					cell differentiation|female pregnancy	cytoplasm|extracellular region|membrane	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(4)|pancreas(1)	9						TCCTTCAATTGTATTGGTACG	0.413													79	290	---	---	---	---	PASS
OR1B1	347169	broad.mit.edu	37	9	125391441	125391441	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:125391441T>A	uc011lyz.1	-	1	374	c.374A>T	c.(373-375)TAT>TTT	p.Y125F		NM_001004450	NP_001004450	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B,	125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GATGGCCACATAGCGATCCAG	0.512													39	80	---	---	---	---	PASS
CACNA1B	774	broad.mit.edu	37	9	140772528	140772528	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140772528C>A	uc004cog.2	+	1	288	c.143C>A	c.(142-144)TCG>TAG	p.S48*	uc004cof.1_Intron	NM_000718	NP_000709	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type,	48	Cytoplasmic (Potential).				membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	ATP binding|protein C-terminus binding|voltage-gated calcium channel activity			breast(3)|large_intestine(2)|ovary(1)	6	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)	TACAAGCAATCGATCGCGCAG	0.428													7	15	---	---	---	---	PASS
RSU1	6251	broad.mit.edu	37	10	16858988	16858988	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16858988C>T	uc001iok.2	-	1	395	c.93G>A	c.(91-93)CTG>CTA	p.L31L	RSU1_uc001iol.2_Silent_p.L31L|RSU1_uc001iom.2_Intron|RSU1_uc001ion.2_Silent_p.L31L	NM_152724	NP_689937	Q15404	RSU1_HUMAN	ras suppressor protein 1 isoform 2	31					cell junction assembly|signal transduction	cytosol	protein binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(1;7.54e-08)		CGTTGACATCCAGCATGTTGG	0.567													43	76	---	---	---	---	PASS
CACNB2	783	broad.mit.edu	37	10	18689954	18689954	+	Intron	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18689954C>A	uc001ipr.2	+						CACNB2_uc009xjz.1_Intron|CACNB2_uc001ips.2_Intron|CACNB2_uc001ipt.2_Intron|CACNB2_uc010qcl.1_Intron|CACNB2_uc001ipu.2_Intron|CACNB2_uc001ipv.2_Intron|CACNB2_uc009xka.1_Intron|CACNB2_uc001ipw.2_Intron|CACNB2_uc001ipx.2_Intron|CACNB2_uc009xkb.1_Intron|CACNB2_uc010qcm.1_Intron|CACNB2_uc001ipz.2_Intron|CACNB2_uc001ipy.2_Intron|CACNB2_uc010qcn.1_Translation_Start_Site|CACNB2_uc010qco.1_Translation_Start_Site|CACNB2_uc001iqa.2_Translation_Start_Site	NM_201596	NP_963890	Q08289	CACB2_HUMAN	calcium channel, voltage-dependent, beta 2						axon guidance|neuromuscular junction development	integral to plasma membrane|sarcolemma|voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			large_intestine(1)|central_nervous_system(1)|skin(1)	3					Magnesium Sulfate(DB00653)|Verapamil(DB00661)	AAGGCGCTGTCTGGCTCATGA	0.577													12	82	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27702960	27702960	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27702960C>A	uc001itu.2	-	1	338	c.220G>T	c.(220-222)GCA>TCA	p.A74S		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	74					spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						CGGGGGGGTGCATCGTCCCCC	0.716													38	47	---	---	---	---	PASS
SAMD8	142891	broad.mit.edu	37	10	76910296	76910296	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:76910296C>G	uc001jwx.1	+	2	113	c.10C>G	c.(10-12)CCT>GCT	p.P4A	SAMD8_uc001jwy.1_Missense_Mutation_p.P4A	NM_144660	NP_653261	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	4					sphingomyelin biosynthetic process	integral to membrane					0	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					AATGGCAGGTCCTAATCAACT	0.418													4	72	---	---	---	---	PASS
CYP2C18	1562	broad.mit.edu	37	10	96466684	96466684	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96466684C>G	uc001kjv.3	+	5	1112	c.786C>G	c.(784-786)GAC>GAG	p.D262E	CYP2C18_uc001kjw.3_Intron|CYP2C19_uc009xus.1_Intron|CYP2C19_uc010qny.1_5'UTR	NM_000772	NP_000763	P33260	CP2CI_HUMAN	cytochrome P450 family 2 subfamily C polypeptide	262					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding			ovary(3)|lung(1)|skin(1)	5		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)		GTGCTCGGGACTTTATTGATT	0.318													3	162	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114061861	114061861	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114061861A>T	uc001kzr.1	+	9	910	c.910A>T	c.(910-912)AGG>TGG	p.R304W		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	304						anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		CACTACAGGCAGGGGATTTTC	0.393													110	158	---	---	---	---	PASS
PNLIP	5406	broad.mit.edu	37	10	118307905	118307905	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118307905T>A	uc001lcm.2	+	4	278	c.235T>A	c.(235-237)TCC>ACC	p.S79T		NM_000936	NP_000927	P16233	LIPP_HUMAN	pancreatic lipase precursor	79					lipid catabolic process|retinoid metabolic process|steroid metabolic process	extracellular region	retinyl-palmitate esterase activity|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|skin(1)	3				all cancers(201;0.0131)	Bentiromide(DB00522)|Orlistat(DB01083)	CATCAGTGGCTCCAATTTCAA	0.398													98	243	---	---	---	---	PASS
TACC2	10579	broad.mit.edu	37	10	123845190	123845190	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123845190T>C	uc001lfv.2	+	4	3535	c.3175T>C	c.(3175-3177)TGC>CGC	p.C1059R	TACC2_uc001lfw.2_Intron|TACC2_uc009xzx.2_Missense_Mutation_p.C1059R|TACC2_uc010qtv.1_Missense_Mutation_p.C1059R	NM_206862	NP_996744	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing	1059						microtubule organizing center|nucleus	nuclear hormone receptor binding			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				TGCAGTTCCCTGCCTGCCAGC	0.632													13	59	---	---	---	---	PASS
TRIM68	55128	broad.mit.edu	37	11	4626667	4626667	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4626667A>T	uc001lzf.1	-	2	306	c.68T>A	c.(67-69)CTG>CAG	p.L23Q	TRIM68_uc001lzg.1_5'UTR|TRIM68_uc010qyj.1_Intron|TRIM68_uc009yek.1_Missense_Mutation_p.L23Q	NM_018073	NP_060543	Q6AZZ1	TRI68_HUMAN	ring finger protein 137	23	RING-type.				protein autoubiquitination|regulation of androgen receptor signaling pathway	Golgi apparatus|nucleolus|perinuclear region of cytoplasm	androgen receptor binding|histone acetyltransferase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.0025)|Breast(177;0.0101)|all_neural(188;0.0227)		Epithelial(150;9.49e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0288)|LUSC - Lung squamous cell carcinoma(625;0.192)		GGGCTCCCTCAGGAAGGTCAT	0.547													40	96	---	---	---	---	PASS
NLRP14	338323	broad.mit.edu	37	11	7083729	7083729	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7083729G>T	uc001mfb.1	+	10	3293	c.2970G>T	c.(2968-2970)AGG>AGT	p.R990S		NM_176822	NP_789792	Q86W24	NAL14_HUMAN	NLR family, pyrin domain containing 14	990	LRR 10.				cell differentiation|multicellular organismal development|spermatogenesis		ATP binding			ovary(3)|breast(2)|pancreas(1)|lung(1)|skin(1)	8				Epithelial(150;4.62e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0871)		ACATTCAGAGGCTCGGGTGAG	0.398													55	144	---	---	---	---	PASS
SOX6	55553	broad.mit.edu	37	11	16340072	16340072	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:16340072C>T	uc001mme.2	-	3	437	c.404G>A	c.(403-405)CGC>CAC	p.R135H	SOX6_uc001mmd.2_Missense_Mutation_p.R125H|SOX6_uc001mmf.2_Missense_Mutation_p.R122H|SOX6_uc001mmg.2_Missense_Mutation_p.R122H|SOX6_uc001mmh.1_RNA|SOX6_uc009ygs.2_RNA|SOX6_uc001mmi.3_Missense_Mutation_p.R122H|SOX6_uc001mmj.2_Missense_Mutation_p.R122H	NM_001145819	NP_001139291	P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6 isoform 4	122					muscle organ development	nucleus	sequence-specific DNA binding transcription factor activity			ovary(3)	3						CCCTTTGCGGCGCTCTGGGGT	0.498													18	335	---	---	---	---	PASS
GTF2H1	2965	broad.mit.edu	37	11	18380126	18380126	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18380126G>C	uc001moi.2	+	14	2100	c.1406G>C	c.(1405-1407)GGA>GCA	p.G469A	GTF2H1_uc001moh.2_Missense_Mutation_p.G469A|GTF2H1_uc009yhm.2_Missense_Mutation_p.G353A|GTF2H1_uc001moj.2_Missense_Mutation_p.G157A	NM_001142307	NP_001135779	P32780	TF2H1_HUMAN	general transcription factor IIH, polypeptide 1,	469					mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	protein binding				0						GTAGCTGTTGGAGAACTTCTA	0.383								NER					127	185	---	---	---	---	PASS
ANO5	203859	broad.mit.edu	37	11	22279222	22279222	+	Intron	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:22279222A>G	uc001mqi.2	+						ANO5_uc001mqj.2_Intron	NM_213599	NP_998764	Q75V66	ANO5_HUMAN	anoctamin 5 isoform a							chloride channel complex|endoplasmic reticulum membrane	chloride channel activity			central_nervous_system(3)|ovary(1)	4						CTTCAATATTACAGGAGATGG	0.403													34	137	---	---	---	---	PASS
FIBIN	387758	broad.mit.edu	37	11	27016253	27016253	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27016253C>A	uc001mrd.2	+	1	626	c.180C>A	c.(178-180)GAC>GAA	p.D60E		NM_203371	NP_976249	Q8TAL6	FIBIN_HUMAN	fin bud initiation factor homolog precursor	60						extracellular region|Golgi apparatus					0						GGGTGAGTGACCACAGGCGCT	0.637													11	46	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136054	40136054	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136054G>T	uc001mxa.1	-	2	3753	c.1789C>A	c.(1789-1791)CAC>AAC	p.H597N	LRRC4C_uc001mxc.1_Missense_Mutation_p.H593N|LRRC4C_uc001mxd.1_Missense_Mutation_p.H593N|LRRC4C_uc001mxb.1_Missense_Mutation_p.H593N	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	597					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GAGTTATAGTGATTTAGGTGC	0.408													65	231	---	---	---	---	PASS
KBTBD4	55709	broad.mit.edu	37	11	47597189	47597189	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47597189C>T	uc001nfx.2	-	3	823	c.652G>A	c.(652-654)GAG>AAG	p.E218K	NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Missense_Mutation_p.E243K|KBTBD4_uc001nfz.2_Missense_Mutation_p.E234K|KBTBD4_uc001nfy.2_Missense_Mutation_p.E218K	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	218	BACK.									ovary(1)|central_nervous_system(1)	2						TCTCTTTCCTCTTTATTAAAG	0.448													65	200	---	---	---	---	PASS
OR4C6	219432	broad.mit.edu	37	11	55433570	55433570	+	Nonstop_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55433570T>A	uc001nht.3	+	3	1193	c.928T>A	c.(928-930)TAA>AAA	p.*310K	OR4C6_uc010rik.1_3'UTR	NM_001004704	NP_001004704	Q8NH72	OR4C6_HUMAN	olfactory receptor, family 4, subfamily C,	310					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2						GGCTGGGAAATAACTGCAATG	0.423													4	137	---	---	---	---	PASS
OR5M3	219482	broad.mit.edu	37	11	56237459	56237459	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56237459A>T	uc010rjk.1	-	1	515	c.515T>A	c.(514-516)ATC>AAC	p.I172N		NM_001004742	NP_001004742	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M,	172	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GAAATGGTTGATCTCAATTTT	0.403													74	252	---	---	---	---	PASS
FERMT3	83706	broad.mit.edu	37	11	63990580	63990580	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63990580C>T	uc001nyl.2	+	14	1892	c.1743C>T	c.(1741-1743)ATC>ATT	p.I581I	FERMT3_uc001nym.2_Silent_p.I577I	NM_178443	NP_848537	Q86UX7	URP2_HUMAN	fermitin family homolog 3 long form	581					integrin activation|leukocyte cell-cell adhesion|platelet aggregation|regulation of cell-cell adhesion mediated by integrin	cell junction|cell projection|podosome	integrin binding			ovary(1)	1						TGATCCGCATCGACTTGGCCG	0.627													30	118	---	---	---	---	PASS
FOSL1	8061	broad.mit.edu	37	11	65660434	65660434	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65660434C>T	uc001ogg.1	-	4	926	c.739G>A	c.(739-741)GCT>ACT	p.A247T	FOSL1_uc010ros.1_Missense_Mutation_p.A145T	NM_005438	NP_005429	P15407	FOSL1_HUMAN	FOS-like antigen 1	247					cellular defense response|chemotaxis|positive regulation of cell proliferation|response to virus|transcription from RNA polymerase II promoter	nucleus	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0				READ - Rectum adenocarcinoma(159;0.168)		TTGCGATGAGCTGAGGCACAA	0.622													11	107	---	---	---	---	PASS
SUV420H1	51111	broad.mit.edu	37	11	67926107	67926107	+	Missense_Mutation	SNP	G	T	T	rs144521985	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67926107G>T	uc001onm.1	-	11	1962	c.1706C>A	c.(1705-1707)ACG>AAG	p.T569K	SUV420H1_uc009yse.1_Missense_Mutation_p.T155K|SUV420H1_uc001onn.1_Missense_Mutation_p.T397K|SUV420H1_uc009ysf.2_Missense_Mutation_p.T329K	NM_017635	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 isoform	569					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			ovary(2)|kidney(1)	3						GCAAGGTTCCGTCACACTGCT	0.507													143	141	---	---	---	---	PASS
MRPL21	219927	broad.mit.edu	37	11	68664068	68664068	+	Missense_Mutation	SNP	C	T	T	rs148535951	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68664068C>T	uc001ooi.2	-	4	336	c.311G>A	c.(310-312)CGC>CAC	p.R104H	MRPL21_uc001ooh.2_Missense_Mutation_p.R19H|MRPL21_uc010rqe.1_Missense_Mutation_p.R104H	NM_181514	NP_852615	Q7Z2W9	RM21_HUMAN	mitochondrial ribosomal protein L21 isoform d	104					translation	mitochondrion|ribosome	RNA binding|structural constituent of ribosome				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTTCCACTGGCGGCTGGCAAA	0.552													132	91	---	---	---	---	PASS
PPFIA1	8500	broad.mit.edu	37	11	70178186	70178186	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70178186G>C	uc001opo.2	+	9	1396	c.1198G>C	c.(1198-1200)GCA>CCA	p.A400P	PPFIA1_uc001opn.1_Missense_Mutation_p.A400P|PPFIA1_uc001opp.2_RNA|PPFIA1_uc001opq.1_RNA	NM_003626	NP_003617	Q13136	LIPA1_HUMAN	PTPRF interacting protein alpha 1 isoform b	400	Potential.				cell-matrix adhesion	cytoplasm	protein binding|signal transducer activity			lung(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CCAGAGGGTGGCAGCGCTTTC	0.562													122	157	---	---	---	---	PASS
PRSS23	11098	broad.mit.edu	37	11	86519229	86519229	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:86519229A>T	uc001pcb.2	+	2	760	c.544A>T	c.(544-546)ACC>TCC	p.T182S	PRSS23_uc001pcc.1_Intron|PRSS23_uc010rts.1_Missense_Mutation_p.T150S	NM_007173	NP_009104	O95084	PRS23_HUMAN	protease, serine, 23 precursor	182					proteolysis	extracellular region|nucleus	serine-type endopeptidase activity	p.I177fs*17(1)		central_nervous_system(1)|pancreas(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CGATGGAAAAACCTATGTGAA	0.542													23	86	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89896501	89896501	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89896501C>A	uc001pdf.3	+	10	1208	c.1099C>A	c.(1099-1101)CAC>AAC	p.H367N	NAALAD2_uc009yvx.2_Missense_Mutation_p.H334N|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pde.2_Missense_Mutation_p.H274N	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2	367	Extracellular (Potential).|NAALADase.	Zinc 2; catalytic.			proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				TCTGGGAGGTCACCGGGACTC	0.353													93	287	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102595586	102595586	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102595586T>G	uc001phe.2	-	1	100	c.1A>C	c.(1-3)ATG>CTG	p.M1L	MMP8_uc010rut.1_5'Flank|MMP8_uc010ruu.1_5'UTR	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein	1					collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		AGGGAGAACATGATCTTCTCT	0.473													10	262	---	---	---	---	PASS
GUCY1A2	2977	broad.mit.edu	37	11	106810256	106810256	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:106810256A>G	uc001pjg.1	-	4	1526	c.1136T>C	c.(1135-1137)CTG>CCG	p.L379P	GUCY1A2_uc010rvo.1_Missense_Mutation_p.L379P|GUCY1A2_uc009yxn.1_Missense_Mutation_p.L379P	NM_000855	NP_000846	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	379					intracellular signal transduction|platelet activation	cytoplasm	GTP binding|guanylate cyclase activity|heme binding			large_intestine(3)|lung(2)|pancreas(2)|ovary(1)	8		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)		CAGTCGCAGCAGGACCCTTTC	0.468													9	234	---	---	---	---	PASS
HTR3A	3359	broad.mit.edu	37	11	113848605	113848605	+	Silent	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113848605C>A	uc010rxb.1	+	2	431	c.198C>A	c.(196-198)ACC>ACA	p.T66T	HTR3A_uc010rxa.1_Silent_p.T66T|HTR3A_uc009yyx.2_RNA|HTR3A_uc010rxc.1_Silent_p.T45T	NM_213621	NP_998786	P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A	60	Extracellular (Potential).				digestion|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	serotonin binding|serotonin receptor activity|serotonin-activated cation-selective channel activity				0		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Dolasetron(DB00757)|Granisetron(DB00889)|Mirtazapine(DB00370)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Tubocurarine(DB01199)	AGCCAACCACCGTATCCATTG	0.587													28	102	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116734532	116734532	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116734532G>C	uc001ppy.2	-	15	1673	c.1637C>G	c.(1636-1638)TCT>TGT	p.S546C	SIK3_uc001ppz.2_Missense_Mutation_p.S445C|SIK3_uc001pqa.2_Missense_Mutation_p.S546C|SIK3_uc001ppw.2_5'UTR|SIK3_uc001ppx.2_Missense_Mutation_p.L21V|SIK3_uc001pqb.2_5'Flank	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	546						cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						CTTGTAGGTAGAGCTGAATAT	0.542													55	205	---	---	---	---	PASS
UBASH3B	84959	broad.mit.edu	37	11	122650303	122650303	+	Nonsense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122650303T>A	uc001pyi.3	+	4	861	c.501T>A	c.(499-501)TAT>TAA	p.Y167*		NM_032873	NP_116262	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing,	167						cytoplasm|nucleus	protein tyrosine phosphatase activity			central_nervous_system(1)	1		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		TGGAGCTCTATACGTCGTCCA	0.572													40	135	---	---	---	---	PASS
OR6T1	219874	broad.mit.edu	37	11	123814150	123814150	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123814150A>G	uc010sab.1	-	1	396	c.396T>C	c.(394-396)TAT>TAC	p.Y132Y		NM_001005187	NP_001005187	Q8NGN1	OR6T1_HUMAN	olfactory receptor, family 6, subfamily T,	132	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TCAGGGTCTCATAGCGGAGTG	0.557													15	59	---	---	---	---	PASS
OR10G4	390264	broad.mit.edu	37	11	123886690	123886690	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123886690G>T	uc010sac.1	+	1	409	c.409G>T	c.(409-411)GGG>TGG	p.G137W		NM_001004462	NP_001004462	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G,	137	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		CATGATGAGTGGGAGCAGGTG	0.562													212	281	---	---	---	---	PASS
OR10G9	219870	broad.mit.edu	37	11	123893724	123893724	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123893724C>T	uc010sad.1	+	1	5	c.5C>T	c.(4-6)TCC>TTC	p.S2F		NM_001001953	NP_001001953	Q8NGN4	O10G9_HUMAN	olfactory receptor, family 10, subfamily G,	2	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GAAGAAATGTCCAAGACCAGC	0.512													7	237	---	---	---	---	PASS
ESAM	90952	broad.mit.edu	37	11	124623856	124623856	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124623856C>A	uc001qav.3	-	7	1032	c.859G>T	c.(859-861)GAG>TAG	p.E287*	VSIG2_uc001qas.2_5'Flank|VSIG2_uc001qat.2_5'Flank|ESAM_uc010sao.1_Intron|ESAM_uc001qau.3_Nonsense_Mutation_p.E214*|ESAM_uc001qaw.3_RNA|ESAM_uc001qax.3_RNA|ESAM_uc009zbi.2_Intron	NM_138961	NP_620411	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule precursor	287	Cytoplasmic (Potential).				blood coagulation|leukocyte migration	adherens junction|integral to membrane|tight junction					0	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		ATGGCATCCTCCCTAGTCATC	0.552													14	35	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124765379	124765379	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124765379A>T	uc001qbg.2	-	6	1150	c.1010T>A	c.(1009-1011)GTG>GAG	p.V337E	ROBO4_uc010sas.1_Missense_Mutation_p.V192E|ROBO4_uc001qbh.2_Missense_Mutation_p.V227E|ROBO4_uc001qbi.2_5'Flank|ROBO4_uc010sat.1_5'Flank	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	337	Fibronectin type-III 1.				angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CAGGAGCAGCACGTTGCTGTC	0.602													30	106	---	---	---	---	PASS
SNX19	399979	broad.mit.edu	37	11	130784449	130784449	+	Silent	SNP	G	A	A	rs146738120	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130784449G>A	uc001qgk.3	-	1	1934	c.1386C>T	c.(1384-1386)ACC>ACT	p.T462T	SNX19_uc010sce.1_Intron|SNX19_uc010scf.1_Intron|SNX19_uc010scg.1_Intron|SNX19_uc001qgl.3_Silent_p.T462T|SNX19_uc009zcx.1_Intron	NM_014758	NP_055573	Q92543	SNX19_HUMAN	sorting nexin 19	462					cell communication|protein transport	cytoplasmic vesicle membrane	phosphatidylinositol binding|protein binding			ovary(2)|lung(2)	4	all_hematologic(175;0.0597)	Lung NSC(97;0.000272)|all_lung(97;0.000608)|Breast(109;0.000962)|all_neural(223;0.0298)|Medulloblastoma(222;0.0425)		OV - Ovarian serous cystadenocarcinoma(99;0.0195)|Lung(977;0.233)		TAACAGAGGCGGTAACATCTC	0.527													43	114	---	---	---	---	PASS
C12orf4	57102	broad.mit.edu	37	12	4627411	4627411	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4627411C>A	uc001qms.2	-	8	934	c.846G>T	c.(844-846)TTG>TTT	p.L282F	C12orf4_uc001qmt.2_Missense_Mutation_p.L282F	NM_020374	NP_065107	Q9NQ89	CL004_HUMAN	hypothetical protein LOC57102	282											0			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		GCATGGTCTTCAACTGGGCTC	0.428													139	138	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6131144	6131144	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6131144C>T	uc001qnn.1	-	27	3846	c.3596G>A	c.(3595-3597)TGT>TAT	p.C1199Y	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1199					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	AGCCACCTCACACACTGGACA	0.502													88	326	---	---	---	---	PASS
SLCO1B1	10599	broad.mit.edu	37	12	21391925	21391925	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21391925G>C	uc001req.3	+	15	1982	c.1878G>C	c.(1876-1878)TTG>TTC	p.L626F		NM_006446	NP_006437	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family,	626	Extracellular (Potential).				bile acid metabolic process|sodium-independent organic anion transport	basolateral plasma membrane|integral to plasma membrane|membrane fraction	bile acid transmembrane transporter activity|sodium-independent organic anion transmembrane transporter activity|thyroid hormone transmembrane transporter activity			ovary(3)|skin(3)|pancreas(1)|central_nervous_system(1)	8					Digoxin(DB00390)|Gemfibrozil(DB01241)|Pravastatin(DB00175)	GGGTCTACTTGGGCTTGTCTT	0.284													33	52	---	---	---	---	PASS
KCNJ8	3764	broad.mit.edu	37	12	21919054	21919054	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21919054A>G	uc001rff.2	-	3	1216	c.878T>C	c.(877-879)ATA>ACA	p.I293T		NM_004982	NP_004973	Q15842	IRK8_HUMAN	potassium inwardly-rectifying channel J8	293	Cytoplasmic (By similarity).					voltage-gated potassium channel complex					0					Levosimendan(DB00922)	CAGAATAACTATGACCTCCAA	0.517													79	79	---	---	---	---	PASS
PTHLH	5744	broad.mit.edu	37	12	28114818	28114818	+	Intron	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28114818G>T	uc001rik.2	-						PTHLH_uc001ril.2_Intron	NM_198966	NP_945317	P12272	PTHR_HUMAN	parathyroid hormone-like hormone isoform 1						activation of adenylate cyclase activity by G-protein signaling pathway|cAMP metabolic process|cell-cell signaling|epidermis development|female pregnancy|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation	cytoplasm|extracellular space|nucleus	hormone activity|peptide hormone receptor binding			breast(1)	1	Lung SC(9;0.184)					AGAGTCAAAGGAAATGACTAA	0.363													13	14	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	31298407	31298407	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31298407G>A	uc010sjy.1	-	12	1578	c.1578C>T	c.(1576-1578)CAC>CAT	p.H526H						RecName: Full=Ovostatin homolog 1; Flags: Precursor;																		CCCCACTGGGGTGAAGGGTGT	0.498													18	31	---	---	---	---	PASS
PRKAG1	5571	broad.mit.edu	37	12	49412534	49412534	+	5'UTR	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49412534G>A	uc001rsy.2	-	1					uc001rsw.2_3'UTR|PRKAG1_uc010smd.1_5'Flank|PRKAG1_uc001rsx.2_5'UTR|PRKAG1_uc001rsz.2_5'UTR|PRKAG1_uc009zlb.2_5'UTR|PRKAG1_uc010sme.1_5'UTR	NM_002733	NP_002724	P54619	AAKG1_HUMAN	AMP-activated protein kinase, noncatalytic						cell cycle arrest|fatty acid biosynthetic process|insulin receptor signaling pathway|positive regulation of protein kinase activity|regulation of fatty acid oxidation|regulation of glycolysis|spermatogenesis	cytosol	cAMP-dependent protein kinase activity|cAMP-dependent protein kinase regulator activity|protein kinase binding			kidney(1)	1						TGCAAGAGGCGCCCGGCTTGG	0.682													101	59	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49420841	49420841	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49420841C>A	uc001rta.3	-	48	14908	c.14908G>T	c.(14908-14910)GAA>TAA	p.E4970*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4970	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						TCTTCACCTTCTTCAGGGGGC	0.647			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			75	77	---	---	---	---	PASS
DIP2B	57609	broad.mit.edu	37	12	51079640	51079640	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51079640T>G	uc001rwv.2	+	11	1498	c.1342T>G	c.(1342-1344)TTC>GTC	p.F448V	DIP2B_uc009zlt.2_5'UTR	NM_173602	NP_775873	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B	448						nucleus	catalytic activity|transcription factor binding			ovary(4)|breast(1)|pancreas(1)	6						GCAGATTGGCTTCTTGCTAGG	0.438													19	61	---	---	---	---	PASS
KRT83	3889	broad.mit.edu	37	12	52715021	52715021	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52715021G>T	uc001saf.2	-	1	162	c.99C>A	c.(97-99)ACC>ACA	p.T33T		NM_002282	NP_002273	P78385	KRT83_HUMAN	keratin 83	33	Head.				epidermis development	keratin filament	structural molecule activity			skin(1)	1	Myeloproliferative disorder(4;0.0484)|all_hematologic(5;0.088)			BRCA - Breast invasive adenocarcinoma(357;0.189)		AGGGGGCGGCGGTGATGCAGC	0.692													6	27	---	---	---	---	PASS
TBK1	29110	broad.mit.edu	37	12	64860870	64860870	+	Intron	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64860870A>G	uc001ssc.1	+							NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1						I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)		TTGGTAAGTCATGTATCACTA	0.313													39	165	---	---	---	---	PASS
TPH2	121278	broad.mit.edu	37	12	72388230	72388230	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:72388230A>G	uc009zrw.1	+	8	1094	c.953A>G	c.(952-954)CAT>CGT	p.H318R	TPH2_uc001swy.2_Missense_Mutation_p.H228R	NM_173353	NP_775489	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2	318		Iron (By similarity).			aromatic amino acid family metabolic process|hormone biosynthetic process|serotonin biosynthetic process	cytosol	amino acid binding|iron ion binding|tryptophan 5-monooxygenase activity			ovary(2)|central_nervous_system(1)|skin(1)	4					L-Tryptophan(DB00150)	GACACATGCCATGAACTCTTG	0.393													86	222	---	---	---	---	PASS
NTS	4922	broad.mit.edu	37	12	86272120	86272120	+	Intron	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86272120C>G	uc001tag.2	+							NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein						regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						TAATATATTTCAGATTAGTAA	0.244													82	229	---	---	---	---	PASS
NTS	4922	broad.mit.edu	37	12	86272219	86272219	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:86272219G>A	uc001tag.2	+	3	339	c.232G>A	c.(232-234)GTT>ATT	p.V78I		NM_006183	NP_006174	P30990	NEUT_HUMAN	neurotensin/neuromedin N preproprotein	78					regulation of blood vessel size|signal transduction	extracellular region|soluble fraction|transport vesicle	neuropeptide hormone activity				0						AACAGGAGAAGTTCATGAAGA	0.408													92	214	---	---	---	---	PASS
SLC25A3	5250	broad.mit.edu	37	12	98987856	98987856	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98987856C>G	uc001tfo.2	+	2	220	c.100C>G	c.(100-102)CCA>GCA	p.P34A	SLC25A3_uc001tfm.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfn.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfp.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfq.2_5'UTR|SLC25A3_uc001tfr.2_Missense_Mutation_p.P34A|SLC25A3_uc001tfs.2_5'UTR|SLC25A3_uc009ztn.2_Missense_Mutation_p.P34A|SLC25A3_uc001tft.2_Missense_Mutation_p.P34A	NM_005888	NP_005879	Q00325	MPCP_HUMAN	solute carrier family 25 member 3 isoform a	34					generation of precursor metabolites and energy	integral to plasma membrane|mitochondrial inner membrane	phosphate carrier activity|symporter activity				0		Lung NSC(355;4.08e-05)|Breast(359;0.00191)|Colorectal(145;0.00205)|Myeloproliferative disorder(1001;0.0255)		GBM - Glioblastoma multiforme(134;1.36e-23)|BRCA - Breast invasive adenocarcinoma(302;0.000115)		CAGCAGCTCCCCAGGGCCCAC	0.677													6	12	---	---	---	---	PASS
ACTR6	64431	broad.mit.edu	37	12	100617652	100617652	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100617652G>A	uc001thb.1	+	11	1206	c.1150G>A	c.(1150-1152)GAA>AAA	p.E384K	ACTR6_uc001thc.1_Missense_Mutation_p.E276K|ACTR6_uc001thd.1_Missense_Mutation_p.E364K|ACTR6_uc009ztu.1_Intron|ACTR6_uc001the.1_Missense_Mutation_p.E302K|ACTR6_uc001thf.1_Missense_Mutation_p.E282K|uc001thg.1_5'Flank	NM_022496	NP_071941	Q9GZN1	ARP6_HUMAN	ARP6 actin-related protein 6 homolog	384						cytoplasm|cytoskeleton				ovary(1)	1						AGATTACGAAGAAAATGGACA	0.318													6	243	---	---	---	---	PASS
RFX4	5992	broad.mit.edu	37	12	107080755	107080755	+	Silent	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:107080755C>A	uc001tlr.2	+	6	537	c.471C>A	c.(469-471)GGC>GGA	p.G157G	RFX4_uc010swv.1_RNA|RFX4_uc001tls.2_Silent_p.G166G|RFX4_uc001tlt.2_Silent_p.G166G|RFX4_uc001tlv.2_Silent_p.G63G|uc001tlu.3_5'Flank	NM_213594	NP_998759	Q33E94	RFX4_HUMAN	regulatory factor X4 isoform c	157					transcription, DNA-dependent	nucleus	DNA binding			upper_aerodigestive_tract(1)	1						GTGAGACGGGCAAGAAAGAAG	0.473													162	239	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111758477	111758477	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111758477C>T	uc001tsa.1	+	17	2817	c.2664C>T	c.(2662-2664)TAC>TAT	p.Y888Y		NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	888	CUT 2.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						CCGAGCAGTACGAGCTGTACA	0.682													15	41	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120567262	120567262	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120567262C>T	uc001txo.2	-	57	7721	c.7708G>A	c.(7708-7710)GCT>ACT	p.A2570T		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	2570	HEAT 23.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATCTTCTCAGCCACCAGCCTG	0.522													122	399	---	---	---	---	PASS
GCN1L1	10985	broad.mit.edu	37	12	120587435	120587435	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120587435C>T	uc001txo.2	-	36	4534	c.4521G>A	c.(4519-4521)GAG>GAA	p.E1507E		NM_006836	NP_006827	Q92616	GCN1L_HUMAN	GCN1 general control of amino-acid synthesis	1507	HEAT 8.				regulation of translation	ribosome	protein binding|translation factor activity, nucleic acid binding			ovary(4)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ACGATTCCTCCTCCAGGGCAG	0.587													22	130	---	---	---	---	PASS
MLEC	9761	broad.mit.edu	37	12	121132908	121132908	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121132908A>G	uc001tyy.1	+	4	753	c.602A>G	c.(601-603)GAC>GGC	p.D201G		NM_014730	NP_055545	Q14165	MLEC_HUMAN	malectin precursor	201	Lumenal (Potential).	Carbohydrate (By similarity).			post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane|integral to membrane	carbohydrate binding			ovary(1)	1						GGGTACTATGACAATCCCAAG	0.498													18	784	---	---	---	---	PASS
DHX37	57647	broad.mit.edu	37	12	125473500	125473500	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125473500G>T	uc001ugy.2	-	1	168	c.69C>A	c.(67-69)GGC>GGA	p.G23G		NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	23							ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		GCTCGGGGGGGCCCTTCGAGG	0.721													11	19	---	---	---	---	PASS
PIWIL1	9271	broad.mit.edu	37	12	130831046	130831046	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130831046C>A	uc001uik.2	+	5	538	c.448C>A	c.(448-450)CTT>ATT	p.L150I	PIWIL1_uc001uij.1_Missense_Mutation_p.L150I	NM_004764	NP_004755	Q96J94	PIWL1_HUMAN	piwi-like 1	150					gene silencing by RNA|meiosis|multicellular organismal development|regulation of translation|spermatid development	chromatoid body|P granule	mRNA binding|piRNA binding|protein binding			ovary(2)	2	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TTCAGCTCTTCTTTTTCAACA	0.413													61	174	---	---	---	---	PASS
PARP4	143	broad.mit.edu	37	13	25000673	25000673	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25000673C>T	uc001upl.2	-	33	5016	c.4910G>A	c.(4909-4911)CGC>CAC	p.R1637H		NM_006437	NP_006428	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1637	Interaction with the major vault protein.				cell death|DNA repair|inflammatory response|protein ADP-ribosylation|response to drug|transport	cytoplasm|nucleus|ribonucleoprotein complex|spindle microtubule	DNA binding|enzyme binding|NAD+ ADP-ribosyltransferase activity			ovary(3)|skin(1)	4		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		CAACCTGGTGCGAATAAACTG	0.383													78	135	---	---	---	---	PASS
PDS5B	23047	broad.mit.edu	37	13	33223009	33223009	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:33223009C>T	uc010abf.2	+	2	258	c.100C>T	c.(100-102)CGA>TGA	p.R34*	PDS5B_uc001uun.2_Nonsense_Mutation_p.R34*|PDS5B_uc001uuo.2_Nonsense_Mutation_p.R34*|PDS5B_uc010abg.2_RNA|PDS5B_uc001uuq.2_RNA	NM_015032	NP_055847	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog	34					cell division|cell proliferation|mitotic sister chromatid cohesion|negative regulation of cell proliferation	chromatin|nucleus	ATP binding|DNA binding|identical protein binding			ovary(2)|lung(1)|pancreas(1)	4		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GATGGTGAGACGATTAAAGGT	0.398													27	103	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	93518682	93518682	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:93518682G>T	uc010tif.1	+	8	2075	c.1709G>T	c.(1708-1710)GGG>GTG	p.G570V		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	570						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				TTACTTCCCGGGATTTGGTAA	0.433													87	61	---	---	---	---	PASS
OR4K5	79317	broad.mit.edu	37	14	20389500	20389500	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20389500A>G	uc010tkw.1	+	1	735	c.735A>G	c.(733-735)GCA>GCG	p.A245A		NM_001005483	NP_001005483	Q8NGD3	OR4K5_HUMAN	olfactory receptor, family 4, subfamily K,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCCATATTGCAGTAGTAATAT	0.398													287	148	---	---	---	---	PASS
RNF31	55072	broad.mit.edu	37	14	24619858	24619858	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24619858C>A	uc001wmn.1	+	8	1498	c.1249C>A	c.(1249-1251)CAC>AAC	p.H417N	RNF31_uc001wml.1_Missense_Mutation_p.H266N|RNF31_uc001wmm.1_Intron|RNF31_uc010alg.1_Missense_Mutation_p.H232N|RNF31_uc001wmo.1_5'Flank|RNF31_uc001wmp.2_5'Flank	NM_017999	NP_060469	Q96EP0	RNF31_HUMAN	ring finger protein 31	417	Polyubiquitin-binding.|RanBP2-type 3.				CD40 signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|protein linear polyubiquitination|T cell receptor signaling pathway	CD40 receptor complex|internal side of plasma membrane|LUBAC complex	ubiquitin binding|ubiquitin-protein ligase activity|zinc ion binding			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(265;0.00861)		GTACTGTATTCACTGTACCTT	0.562													6	335	---	---	---	---	PASS
DHRS1	115817	broad.mit.edu	37	14	24765707	24765707	+	Intron	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24765707G>A	uc001woj.1	-						DHRS1_uc010aln.1_5'Flank|DHRS1_uc001wok.2_Intron	NM_138452	NP_612461	Q96LJ7	DHRS1_HUMAN	dehydrogenase/reductase (SDR family) member 1							endoplasmic reticulum	binding|oxidoreductase activity				0				GBM - Glioblastoma multiforme(265;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(311;0.0442)		TGGCAGTGGAGCACCCACCTG	0.572											OREG0022622	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	121	---	---	---	---	PASS
FOXG1	2290	broad.mit.edu	37	14	29237227	29237227	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:29237227G>A	uc001wqe.2	+	1	941	c.742G>A	c.(742-744)GAC>AAC	p.D248N		NM_005249	NP_005240	P55316	FOXG1_HUMAN	forkhead box G1	248	Fork-head.				axon midline choice point recognition|central nervous system neuron development|dorsal/ventral pattern formation|embryo development ending in birth or egg hatching|hindbrain development|inner ear morphogenesis|negative regulation of neuron differentiation|negative regulation of transcription, DNA-dependent|nonmotile primary cilium assembly|nose development|positive regulation of cell cycle|positive regulation of neuroblast proliferation|positive regulation of transcription from RNA polymerase II promoter|regulation of mitotic cell cycle|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(2)|lung(2)	4			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CCACTACGACGACCCGGGCAA	0.642													56	18	---	---	---	---	PASS
GPR135	64582	broad.mit.edu	37	14	59930635	59930635	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:59930635C>T	uc010apj.2	-	1	1425	c.1310G>A	c.(1309-1311)CGG>CAG	p.R437Q	GPR135_uc001xed.2_RNA	NM_022571	NP_072093	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	437	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity				0				OV - Ovarian serous cystadenocarcinoma(108;0.134)		GGCCCCCAGCCGGTTGGCATA	0.632													18	11	---	---	---	---	PASS
PPP2R5E	5529	broad.mit.edu	37	14	63842716	63842716	+	3'UTR	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63842716C>T	uc001xgd.1	-	14					PPP2R5E_uc010tsf.1_3'UTR|PPP2R5E_uc010tsg.1_3'UTR|PPP2R5E_uc001xge.2_3'UTR|PPP2R5E_uc010tsh.1_3'UTR	NM_006246	NP_006237	Q16537	2A5E_HUMAN	epsilon isoform of regulatory subunit B56,						signal transduction	cytoplasm|intracellular membrane-bounded organelle|protein phosphatase type 2A complex	protein binding|protein phosphatase type 2A regulator activity			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(108;0.00197)|all cancers(60;0.0153)|BRCA - Breast invasive adenocarcinoma(234;0.128)		ATGTTGTTGTCATTGTTTTTG	0.363													50	25	---	---	---	---	PASS
PLEKHG3	26030	broad.mit.edu	37	14	65203602	65203602	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65203602C>T	uc001xho.1	+	13	1646	c.1377C>T	c.(1375-1377)AAC>AAT	p.N459N	PLEKHG3_uc001xhn.1_Silent_p.N403N|PLEKHG3_uc001xhp.2_Silent_p.N459N|PLEKHG3_uc010aqh.1_Translation_Start_Site|PLEKHG3_uc001xhq.1_5'Flank	NM_015549	NP_056364	A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G,	459				QGRRQSEPTKHLLRQLNEKARAAGMK -> KGAGPEPPGSE EEEEEQEESLAVAEQ (in Ref. 2; AAH04298).	regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)	1				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		GGCAACTCAACGAGAAAGGTG	0.617													24	15	---	---	---	---	PASS
RAD51L1	5890	broad.mit.edu	37	14	68331863	68331863	+	Intron	SNP	G	A	A	rs71421392		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:68331863G>A	uc001xkf.1	+						RAD51L1_uc010aqq.2_Intron|RAD51L1_uc001xkd.2_Intron|RAD51L1_uc010aqr.2_Intron|RAD51L1_uc001xke.2_Intron|RAD51L1_uc010aqs.1_Intron|RAD51L1_uc001xkg.1_Intron	NM_133509	NP_598193	O15315	RA51B_HUMAN	RAD51-like 1 isoform 3						blood coagulation|DNA repair|reciprocal meiotic recombination	nucleoplasm	ATP binding|DNA binding|DNA-dependent ATPase activity				0				UCEC - Uterine corpus endometrioid carcinoma (185;0.163)|all cancers(60;3.9e-06)|OV - Ovarian serous cystadenocarcinoma(108;0.000103)|BRCA - Breast invasive adenocarcinoma(234;0.000421)		AAAGGTATGAGATTTTATTTT	0.368			T	HMGA2	lipoma|uterine leiomyoma			Direct_reversal_of_damage|Homologous_recombination					16	55	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81743259	81743259	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81743259G>C	uc010tvu.1	-	4	2597	c.2396C>G	c.(2395-2397)CCG>CGG	p.P799R	STON2_uc001xvk.1_Missense_Mutation_p.P799R|STON2_uc010tvt.1_Missense_Mutation_p.P596R	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	799	MHD.				endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GTTTTTGTCCGGCAGTCGGTT	0.463													237	62	---	---	---	---	PASS
CATSPERB	79820	broad.mit.edu	37	14	92088265	92088265	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92088265A>G	uc001xzs.1	-	19	2087	c.1947T>C	c.(1945-1947)TTT>TTC	p.F649F	CATSPERB_uc010aub.1_Silent_p.F171F	NM_024764	NP_079040	Q9H7T0	CTSRB_HUMAN	cation channel, sperm-associated, beta	649					cell differentiation|multicellular organismal development|spermatogenesis	integral to membrane				breast(2)|skin(2)|ovary(1)	5		all_cancers(154;0.0663)|all_epithelial(191;0.236)				CTGTATCTTCAAACAAGGCCT	0.383													28	47	---	---	---	---	PASS
SERPINA9	327657	broad.mit.edu	37	14	94935676	94935676	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94935676G>T	uc001ydf.2	-	2	717	c.556C>A	c.(556-558)CCC>ACC	p.P186T	SERPINA9_uc001yde.2_Intron|SERPINA9_uc010avc.2_Missense_Mutation_p.P37T|SERPINA9_uc001ydg.2_Missense_Mutation_p.P150T|SERPINA9_uc001ydh.1_Missense_Mutation_p.P186T|SERPINA9_uc001ydi.1_Missense_Mutation_p.P150T	NM_175739	NP_783866	Q86WD7	SPA9_HUMAN	serine (or cysteine) proteinase inhibitor, clade	168					regulation of proteolysis	cytoplasm|extracellular region|membrane	serine-type endopeptidase inhibitor activity			lung(1)|central_nervous_system(1)	2		all_cancers(154;0.0691)|all_epithelial(191;0.233)		Epithelial(152;0.144)|COAD - Colon adenocarcinoma(157;0.224)|all cancers(159;0.24)		GCAATGGAGGGGTTGGAGAAA	0.498													65	415	---	---	---	---	PASS
SERPINA3	12	broad.mit.edu	37	14	95081219	95081219	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95081219C>T	uc001ydp.2	+	2	520	c.441C>T	c.(439-441)CTC>CTT	p.L147L	SERPINA3_uc001ydo.3_Silent_p.L172L|SERPINA3_uc010avf.1_RNA|SERPINA3_uc001ydr.2_RNA|SERPINA3_uc001ydq.2_Silent_p.L147L|SERPINA3_uc001yds.2_Silent_p.L147L|SERPINA3_uc010avg.2_Silent_p.L147L	NM_001085	NP_001076	P01011	AACT_HUMAN	serpin peptidase inhibitor, clade A, member 3	147					acute-phase response|maintenance of gastrointestinal epithelium|regulation of lipid metabolic process|regulation of proteolysis	extracellular region|nucleus	DNA binding|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|skin(1)	6		all_cancers(154;0.0525)|all_epithelial(191;0.179)		COAD - Colon adenocarcinoma(157;0.212)|Epithelial(152;0.228)		AAGAGCAACTCAGTCTGCTGG	0.532													23	114	---	---	---	---	PASS
CLMN	79789	broad.mit.edu	37	14	95670677	95670677	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95670677T>G	uc001yef.2	-	9	1125	c.1009A>C	c.(1009-1011)ACT>CCT	p.T337P		NM_024734	NP_079010	Q96JQ2	CLMN_HUMAN	calmin	337						integral to membrane	actin binding				0				Epithelial(152;0.193)		TGGTTAACAGTGTAGGTACGC	0.483													58	309	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106066995	106066995	+	Intron	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106066995C>T	uc010tyt.1	-						uc001yrs.2_Intron|uc001yrt.2_Intron|uc001yrw.1_Missense_Mutation_p.G274R|uc001yrx.1_Missense_Mutation_p.G221R|uc010axp.1_5'Flank|uc001yrv.1_5'Flank|uc001yru.2_5'Flank|uc010axq.1_5'Flank					Parts of antibodies, mostly variable regions.												0						ACAGGCTTCCCACTGGCCCGG	0.627													93	22	---	---	---	---	PASS
GABRA5	2558	broad.mit.edu	37	15	27188527	27188527	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27188527G>A	uc001zbd.1	+	11	1382	c.1043G>A	c.(1042-1044)GGC>GAC	p.G348D	GABRA5_uc001zbe.1_5'Flank	NM_000810	NP_000801	P31644	GBRA5_HUMAN	gamma-aminobutyric acid A receptor, alpha 5	348	Cytoplasmic (Potential).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity			ovary(1)	1		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	ACCAAGAGAGGCTGGGCCTGG	0.527													4	9	---	---	---	---	PASS
CASC5	57082	broad.mit.edu	37	15	40933128	40933128	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40933128C>G	uc010bbs.1	+	15	5940	c.5779C>G	c.(5779-5781)CCT>GCT	p.P1927A	CASC5_uc010bbt.1_Missense_Mutation_p.P1901A	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1	1927	Necessary for kinetochore localization and for interaction with NSL1 and DSN1.				acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		AAACACACCACCTACTCCAGA	0.373													61	189	---	---	---	---	PASS
SECISBP2L	9728	broad.mit.edu	37	15	49329785	49329785	+	Intron	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49329785T>G	uc001zxe.1	-						SECISBP2L_uc001zxd.1_Intron|SECISBP2L_uc010bep.1_Intron|SECISBP2L_uc010beq.1_Intron	NM_014701	NP_055516	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like											breast(1)|skin(1)	2						ATAAACAAATTACCTATTGGA	0.363													18	35	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86284378	86284378	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86284378G>T	uc002blv.1	+	35	7880	c.7710G>T	c.(7708-7710)GAG>GAT	p.E2570D	AKAP13_uc002blu.1_Missense_Mutation_p.E2574D|AKAP13_uc002blw.1_Missense_Mutation_p.E1035D|AKAP13_uc002blx.1_Missense_Mutation_p.E815D	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	2570	Interaction with ESR1.|Potential.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						CCCTCATTGAGCAGGAGAAGC	0.642													13	21	---	---	---	---	PASS
SLCO3A1	28232	broad.mit.edu	37	15	92690227	92690227	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92690227G>C	uc002bqx.2	+	8	1727	c.1526G>C	c.(1525-1527)TGT>TCT	p.C509S	SLCO3A1_uc002bqy.2_Missense_Mutation_p.C509S|SLCO3A1_uc010boc.1_RNA|SLCO3A1_uc002bqz.1_Missense_Mutation_p.C451S	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,	509	Extracellular (Potential).|Kazal-like.				sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			CTCACGGGCTGTGCGTGCCTC	0.562													18	48	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	708258	708258	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:708258C>T	uc002cii.1	+	22	2734	c.2680C>T	c.(2680-2682)CCT>TCT	p.P894S	WDR90_uc002cij.1_Intron|WDR90_uc002cik.1_Missense_Mutation_p.P421S|WDR90_uc002cil.1_RNA|WDR90_uc002cim.1_Missense_Mutation_p.P68S|WDR90_uc002cin.1_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	894	WD 9.									ovary(1)	1		Hepatocellular(780;0.0218)				GTGCTTTGGCCCTGCAGCTCT	0.652													11	136	---	---	---	---	PASS
MSLNL	401827	broad.mit.edu	37	16	819471	819471	+	Nonsense_Mutation	SNP	A	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:819471A>C	uc002cjz.1	-	16	3119	c.3119T>G	c.(3118-3120)TTA>TGA	p.L1040*	MIR662_hsa-mir-662|MI0003670_5'Flank	NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	689	Cytoplasmic (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						AGCTGAATCTAACACCTCTGT	0.627													52	53	---	---	---	---	PASS
PRSS27	83886	broad.mit.edu	37	16	2765890	2765890	+	Intron	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2765890G>T	uc002crf.2	-						PRSS27_uc002cre.2_5'Flank|PRSS27_uc002crg.2_Intron|PRSS27_uc010bst.1_Intron	NM_031948	NP_114154	Q9BQR3	PRS27_HUMAN	marapsin precursor						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						GGCTGGGGGAGCATGGGGAGC	0.697													5	21	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19033051	19033051	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19033051C>T	uc002dfq.2	+	4	691	c.561C>T	c.(559-561)CTC>CTT	p.L187L	TMC7_uc010vao.1_Silent_p.L187L|TMC7_uc002dfp.2_Silent_p.L187L|TMC7_uc010vap.1_Silent_p.L77L	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	187	Helical; (Potential).					integral to membrane				skin(2)|ovary(1)	3						TGGTTTTGCTCCCAGTCTTAC	0.433													45	144	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24373168	24373168	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24373168G>A	uc002dmf.2	+	4	2132	c.932G>A	c.(931-933)CGC>CAC	p.R311H		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	311					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		GCCAACAGGCGCACCACGCCC	0.562													29	105	---	---	---	---	PASS
TMEM219	124446	broad.mit.edu	37	16	29979362	29979362	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29979362A>G	uc002duw.2	+	4	539	c.372A>G	c.(370-372)CAA>CAG	p.Q124Q	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|TMEM219_uc002duy.2_Silent_p.Q124Q|TMEM219_uc010bzk.1_Silent_p.Q124Q|TMEM219_uc002duz.2_Silent_p.Q124Q|TMEM219_uc010bzl.1_RNA	NM_194280	NP_919256	Q86XT9	TM219_HUMAN	transmembrane protein 219	124						integral to membrane					0						CTGCAGGACAACTGGTCCTTA	0.483													147	179	---	---	---	---	PASS
SALL1	6299	broad.mit.edu	37	16	51171083	51171083	+	Missense_Mutation	SNP	G	T	T	rs140524372		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:51171083G>T	uc010vgs.1	-	3	3946	c.3915C>A	c.(3913-3915)AAC>AAA	p.N1305K	SALL1_uc010vgr.1_Missense_Mutation_p.N1208K|SALL1_uc010cbv.2_Missense_Mutation_p.N157K	NM_002968	NP_002959	Q9NSC2	SALL1_HUMAN	sal-like 1 isoform a	1305					adrenal gland development|branching involved in ureteric bud morphogenesis|embryonic digestive tract development|embryonic digit morphogenesis|gonad development|histone deacetylation|inductive cell-cell signaling|mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of transcription from RNA polymerase II promoter|olfactory bulb interneuron differentiation|olfactory bulb mitral cell layer development|olfactory nerve development|outer ear morphogenesis|pituitary gland development|positive regulation of transcription from RNA polymerase II promoter|positive regulation of Wnt receptor signaling pathway|ureteric bud invasion|ventricular septum development	chromocenter|cytoplasm|heterochromatin|nucleus	beta-catenin binding|DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(5)|ovary(3)	8		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AGTTGGTTCCGTTCTCACTGC	0.567													140	100	---	---	---	---	PASS
CHD9	80205	broad.mit.edu	37	16	53243469	53243469	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53243469G>C	uc002ehb.2	+	2	1692	c.1528G>C	c.(1528-1530)GAG>CAG	p.E510Q	CHD9_uc002egy.2_Missense_Mutation_p.E510Q|CHD9_uc002egz.1_Missense_Mutation_p.E510Q|CHD9_uc002eha.1_Missense_Mutation_p.E510Q|CHD9_uc002ehc.2_Missense_Mutation_p.E510Q|CHD9_uc002ehd.2_Missense_Mutation_p.E36Q	NM_025134	NP_079410	Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	510					cellular lipid metabolic process|chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleoplasm	ATP binding|DNA binding|helicase activity|protein binding			lung(2)|central_nervous_system(1)|breast(1)|skin(1)|ovary(1)|kidney(1)	7		all_cancers(37;0.0212)				GGTCATGTCTGAGAAGAAGCA	0.418													20	138	---	---	---	---	PASS
KATNB1	10300	broad.mit.edu	37	16	57778433	57778433	+	Intron	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57778433C>T	uc002eml.1	+							NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1						cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				AGTAGGCCTCCGAGCTTGCCT	0.617													38	158	---	---	---	---	PASS
CNGB1	1258	broad.mit.edu	37	16	57991254	57991254	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57991254C>A	uc002emt.2	-	12	930	c.865G>T	c.(865-867)GTG>TTG	p.V289L	CNGB1_uc010cdh.2_Missense_Mutation_p.V283L|CNGB1_uc002emu.2_Missense_Mutation_p.V289L	NM_001297	NP_001288	Q14028	CNGB1_HUMAN	cyclic nucleotide gated channel beta 1 isoform	289					sensory perception of smell	intracellular cyclic nucleotide activated cation channel complex	cAMP binding|intracellular cAMP activated cation channel activity			breast(3)|pancreas(1)	4						CTGGTCTGCACATCACATATC	0.522													45	141	---	---	---	---	PASS
PLEKHG4	25894	broad.mit.edu	37	16	67318231	67318231	+	Silent	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67318231G>T	uc002eso.3	+	11	4098	c.1563G>T	c.(1561-1563)GCG>GCT	p.A521A	PLEKHG4_uc002esp.3_Silent_p.A328A|PLEKHG4_uc002esq.3_Silent_p.A521A|PLEKHG4_uc010cef.2_Silent_p.A521A|PLEKHG4_uc002ess.3_Silent_p.A521A|PLEKHG4_uc010ceg.2_Silent_p.A440A	NM_015432	NP_056247	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G	521					regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(1)|pancreas(1)	2				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		GCTGGGAGGCGGCTGAACTGG	0.657													19	26	---	---	---	---	PASS
SF3B3	23450	broad.mit.edu	37	16	70602973	70602973	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70602973G>A	uc002ezf.2	+	23	3404	c.3193G>A	c.(3193-3195)GAA>AAA	p.E1065K		NM_012426	NP_036558	Q15393	SF3B3_HUMAN	splicing factor 3b, subunit 3	1065					protein complex assembly	catalytic step 2 spliceosome|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	nucleic acid binding|protein binding			ovary(1)	1		Ovarian(137;0.0694)				CACCAATGATGAAGTAGATGA	0.557													5	35	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74499645	74499645	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74499645G>A	uc002fcy.3	-	19	2646	c.2596C>T	c.(2596-2598)CTG>TTG	p.L866L	GLG1_uc002fcx.2_Silent_p.L866L|GLG1_uc002fcw.3_Silent_p.L855L|GLG1_uc002fcz.3_Silent_p.L283L	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	866	Cys-rich GLG1 13.|Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						GTCTCCTGCAGCTTAAATACT	0.463													246	356	---	---	---	---	PASS
GLG1	2734	broad.mit.edu	37	16	74511410	74511410	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74511410C>T	uc002fcy.3	-	12	1899	c.1849G>A	c.(1849-1851)GAA>AAA	p.E617K	GLG1_uc002fcx.2_Missense_Mutation_p.E617K|GLG1_uc002fcw.3_Missense_Mutation_p.E606K|GLG1_uc002fcz.3_Missense_Mutation_p.E34K	NM_001145667	NP_001139139	Q92896	GSLG1_HUMAN	golgi apparatus protein 1 isoform 3	617	Cys-rich GLG1 9.|Extracellular (Potential).					Golgi membrane|integral to membrane	receptor binding			ovary(1)|breast(1)	2						CTTTGGACTTCAGCTCGGCAC	0.453													50	156	---	---	---	---	PASS
OR3A4	390756	broad.mit.edu	37	17	3214467	3214467	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3214467T>G	uc002fvi.2	+	1	929	c.863T>G	c.(862-864)CTG>CGG	p.L288R		NR_024128				RecName: Full=Olfactory receptor 3A4; AltName: Full=Olfactory receptor 17-24;          Short=OR17-24;											ovary(1)	1						AGCCCCATGCTGAACCCACTC	0.572													201	79	---	---	---	---	PASS
ARRB2	409	broad.mit.edu	37	17	4624342	4624342	+	3'UTR	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4624342G>A	uc002fyj.2	+	15					ARRB2_uc002fyk.2_3'UTR|ARRB2_uc002fyl.2_3'UTR|ARRB2_uc010vsg.1_3'UTR|ARRB2_uc002fym.2_3'UTR|ARRB2_uc002fyn.2_3'UTR|ARRB2_uc010ckq.2_3'UTR|ARRB2_uc002fyo.2_3'UTR	NM_004313	NP_004304	P32121	ARRB2_HUMAN	arrestin, beta 2 isoform 1						cell chemotaxis|desensitization of G-protein coupled receptor protein signaling pathway by arrestin|G-protein coupled receptor internalization|negative regulation of natural killer cell mediated cytotoxicity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|transcription from RNA polymerase II promoter|transforming growth factor beta receptor signaling pathway	coated pit|cytoplasmic membrane-bounded vesicle|cytosol|nucleus|plasma membrane	angiotensin receptor binding|ubiquitin protein ligase binding				0						TAGGAAGCGGGGTGGGAAGAA	0.552													82	79	---	---	---	---	PASS
SPEM1	374768	broad.mit.edu	37	17	7324849	7324849	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7324849C>A	uc002ggv.2	+	3	880	c.855C>A	c.(853-855)TAC>TAA	p.Y285*	FGF11_uc010vtw.1_Nonsense_Mutation_p.Y19*	NM_199339	NP_955371	Q8N4L4	SPEM1_HUMAN	spermatid maturation 1	285	Potential.				cell differentiation|multicellular organismal development|spermatogenesis	cytoplasm|integral to membrane					0		Prostate(122;0.173)				CCGGCTGCTACCCCCTAGCCT	0.592													15	34	---	---	---	---	PASS
MYH8	4626	broad.mit.edu	37	17	10322230	10322230	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10322230C>G	uc002gmm.2	-	4	423	c.328G>C	c.(328-330)GAG>CAG	p.E110Q	uc002gml.1_Intron	NM_002472	NP_002463	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle,	110	Myosin head-like.				muscle filament sliding	cytosol|muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			skin(6)|ovary(3)|breast(2)	11						GCATAGCGCTCTTTGAGGTTG	0.428									Trismus-Pseudocamptodactyly_Syndrome_with_Cardiac_Myxoma_and_Freckling				223	108	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10408730	10408730	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10408730G>T	uc002gmo.2	-	20	2367	c.2273C>A	c.(2272-2274)ACC>AAC	p.T758N	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	758	Myosin head-like.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TTTATACTGGGTGTGGTCAAT	0.398													182	68	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17696440	17696440	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17696440G>C	uc002grm.2	+	3	647	c.178G>C	c.(178-180)GAG>CAG	p.E60Q	RAI1_uc002grn.1_Missense_Mutation_p.E60Q	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	60						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		CCCGAGCTATGAGGGTGGCGC	0.662													26	9	---	---	---	---	PASS
C17orf53	78995	broad.mit.edu	37	17	42225981	42225981	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42225981G>A	uc002ifi.1	+	3	995	c.810G>A	c.(808-810)CCG>CCA	p.P270P	C17orf53_uc010czq.1_Silent_p.P270P|C17orf53_uc002ifj.1_Silent_p.P270P|C17orf53_uc002ifk.1_RNA	NM_024032	NP_076937	Q8N3J3	CQ053_HUMAN	hypothetical protein LOC78995	270											0		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		AAGTCTGTCCGCAACGCTCCC	0.562													80	311	---	---	---	---	PASS
ANKFN1	162282	broad.mit.edu	37	17	54428148	54428148	+	Silent	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54428148G>C	uc002iun.1	+	4	254	c.219G>C	c.(217-219)ACG>ACC	p.T73T		NM_153228	NP_694960	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain	73										large_intestine(1)|ovary(1)	2						TGAAAATGACGCAACAAATGC	0.388													46	243	---	---	---	---	PASS
USP32	84669	broad.mit.edu	37	17	58260814	58260814	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58260814T>C	uc002iyo.1	-	31	4121	c.3835A>G	c.(3835-3837)ATT>GTT	p.I1279V	USP32_uc002iyn.1_Missense_Mutation_p.I949V	NM_032582	NP_115971	Q8NFA0	UBP32_HUMAN	ubiquitin specific protease 32	1279					protein deubiquitination|ubiquitin-dependent protein catabolic process	Golgi apparatus|membrane	calcium ion binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|breast(2)|large_intestine(1)	5	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			AGGTGAATAATCTGGAGAAGT	0.323													118	97	---	---	---	---	PASS
ABCA8	10351	broad.mit.edu	37	17	66871872	66871872	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66871872T>C	uc002jhp.2	-	34	4432	c.4253A>G	c.(4252-4254)CAG>CGG	p.Q1418R	ABCA8_uc002jhq.2_Missense_Mutation_p.Q1458R|ABCA8_uc010wqq.1_Missense_Mutation_p.Q1453R	NM_007168	NP_009099	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A member 8	1418	ABC transporter 2.					integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(2)|skin(1)	3	Breast(10;4.56e-13)					CCGGATGGCCTGCCTATAATG	0.453													12	102	---	---	---	---	PASS
TSEN54	283989	broad.mit.edu	37	17	73512834	73512834	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73512834G>T	uc002jof.1	+	2	97	c.64G>T	c.(64-66)GAG>TAG	p.E22*	CASKIN2_uc002joc.2_5'Flank|CASKIN2_uc002jod.2_5'Flank|TSEN54_uc002joe.1_Nonsense_Mutation_p.E22*	NM_207346	NP_997229	Q7Z6J9	SEN54_HUMAN	tRNA splicing endonuclease 54 homolog	22					mRNA processing|tRNA splicing, via endonucleolytic cleavage and ligation	nucleolus				ovary(1)	1	all_cancers(13;3.15e-09)|all_epithelial(9;5.78e-10)|Breast(9;5.8e-10)|all_lung(278;0.246)		all cancers(21;4.57e-07)|Epithelial(20;2.92e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CAGCGCCCGGGAGCTCTTCGC	0.776													12	9	---	---	---	---	PASS
SFRS2	6427	broad.mit.edu	37	17	74732326	74732326	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74732326C>G	uc002jsv.2	-	2	753	c.583G>C	c.(583-585)GTG>CTG	p.V195L	SFRS2_uc002jsw.1_RNA|SFRS2_uc002jsx.1_RNA|SFRS2_uc002jsy.3_Missense_Mutation_p.V195L|SFRS2_uc010wtg.1_Missense_Mutation_p.V183L|MFSD11_uc002jsz.1_RNA|MFSD11_uc002jta.2_5'UTR|MFSD11_uc002jtb.2_5'Flank|MFSD11_uc010dha.2_5'Flank|MFSD11_uc002jtc.2_5'Flank|MFSD11_uc002jtd.3_5'Flank|MFSD11_uc010dhb.2_5'Flank|MFSD11_uc002jte.2_5'Flank	NM_003016	NP_003007	Q01130	SRSF2_HUMAN	splicing factor, arginine/serine-rich 2	195	Arg/Ser-rich (RS domain).				mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	nuclear speck	nucleotide binding|protein binding|RNA binding|transcription corepressor activity				0						CTCTTGGACACTGGGGGAGGA	0.572													6	332	---	---	---	---	PASS
USP36	57602	broad.mit.edu	37	17	76795029	76795029	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76795029G>A	uc002jvz.1	-	19	3526	c.3201C>T	c.(3199-3201)ACC>ACT	p.T1067T	USP36_uc002jwa.1_Silent_p.T1067T|USP36_uc002jvy.1_Silent_p.T127T	NM_025090	NP_079366	Q9P275	UBP36_HUMAN	ubiquitin specific peptidase 36	1065					ubiquitin-dependent protein catabolic process	nucleolus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			lung(2)|ovary(1)|breast(1)|kidney(1)	5			BRCA - Breast invasive adenocarcinoma(99;0.000842)|OV - Ovarian serous cystadenocarcinoma(97;0.151)			CATCAACCACGGTCTCAGTCC	0.587													68	343	---	---	---	---	PASS
TBCD	6904	broad.mit.edu	37	17	80828207	80828207	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80828207C>T	uc002kfz.2	+	14	1556	c.1426C>T	c.(1426-1428)CGT>TGT	p.R476C	TBCD_uc002kfx.1_Missense_Mutation_p.R459C|TBCD_uc002kfy.1_Missense_Mutation_p.R476C	NM_005993	NP_005984	Q9BTW9	TBCD_HUMAN	beta-tubulin cofactor D	476					'de novo' posttranslational protein folding|adherens junction assembly|negative regulation of cell-substrate adhesion|negative regulation of microtubule polymerization|post-chaperonin tubulin folding pathway|tight junction assembly	adherens junction|cytoplasm|lateral plasma membrane|microtubule|tight junction	beta-tubulin binding|chaperone binding|GTPase activator activity				0	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GGCCTTCGCGCGTGCCTATGA	0.652													45	41	---	---	---	---	PASS
ASXL3	80816	broad.mit.edu	37	18	31320005	31320005	+	Silent	SNP	A	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31320005A>C	uc010dmg.1	+	11	2692	c.2637A>C	c.(2635-2637)TCA>TCC	p.S879S	ASXL3_uc002kxq.2_Silent_p.S586S	NM_030632	NP_085135	Q9C0F0	ASXL3_HUMAN	additional sex combs like 3	879					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding			ovary(2)|pancreas(1)	3						TGTTACCTTCACCATTGGAAT	0.368													10	97	---	---	---	---	PASS
NOL4	8715	broad.mit.edu	37	18	31673472	31673472	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:31673472T>C	uc010dmi.2	-	5	958	c.729A>G	c.(727-729)GAA>GAG	p.E243E	NOL4_uc002kxr.3_Silent_p.E79E|NOL4_uc010xbt.1_Silent_p.E169E|NOL4_uc010dmh.2_Silent_p.E169E|NOL4_uc010xbu.1_Silent_p.E243E|NOL4_uc002kxt.3_Silent_p.E243E|NOL4_uc010xbw.1_Silent_p.E129E	NM_003787	NP_003778	O94818	NOL4_HUMAN	nucleolar protein 4	243						nucleolus	RNA binding			ovary(3)	3						GCATTCTTTCTTCAAGATTGG	0.373													49	158	---	---	---	---	PASS
SLC14A1	6563	broad.mit.edu	37	18	43329865	43329865	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43329865C>T	uc010xcn.1	+	11	1438	c.1119C>T	c.(1117-1119)AAC>AAT	p.N373N	SLC14A1_uc010dnk.2_Silent_p.N429N|SLC14A1_uc002lbf.3_Silent_p.N373N|SLC14A1_uc002lbg.3_RNA|SLC14A1_uc010xco.1_Silent_p.N268N|SLC14A1_uc002lbh.3_Silent_p.N265N|SLC14A1_uc002lbi.3_Silent_p.N241N|SLC14A1_uc002lbj.3_Silent_p.N429N|SLC14A1_uc002lbk.3_Silent_p.N373N	NM_001146036	NP_001139508	Q13336	UT1_HUMAN	solute carrier family 14 (urea transporter),	373						integral to plasma membrane	urea transmembrane transporter activity			central_nervous_system(1)|pancreas(1)	2						CTGAAGAAAACCGCATCTTCT	0.463													83	122	---	---	---	---	PASS
MAPK4	5596	broad.mit.edu	37	18	48190555	48190555	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48190555A>G	uc002lev.2	+	2	1227	c.227A>G	c.(226-228)AAC>AGC	p.N76S	MAPK4_uc010xdm.1_Intron|MAPK4_uc010doz.2_Missense_Mutation_p.N76S	NM_002747	NP_002738	P31152	MK04_HUMAN	mitogen-activated protein kinase 4	76	Protein kinase.				cell cycle		ATP binding|MAP kinase activity			lung(4)|skin(2)	6		Colorectal(6;0.0297)		Colorectal(21;0.156)		GACCACGACAACATCGTCAAA	0.582													29	75	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56196470	56196470	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56196470G>A	uc002lhj.3	-	6	5568	c.5354C>T	c.(5353-5355)GCT>GTT	p.A1785V	ALPK2_uc002lhk.1_Missense_Mutation_p.A1116V	NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	1785							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TAATACTGGAGCTAGAAACAA	0.219													48	132	---	---	---	---	PASS
ZNF532	55205	broad.mit.edu	37	18	56620813	56620813	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56620813A>G	uc002lho.2	+	8	3479	c.2932A>G	c.(2932-2934)AGC>GGC	p.S978G	ZNF532_uc002lhp.2_Missense_Mutation_p.S976G|ZNF532_uc010xeg.1_Missense_Mutation_p.S976G|ZNF532_uc002lhr.2_Missense_Mutation_p.S976G|ZNF532_uc002lhs.2_Missense_Mutation_p.S976G|ZNF532_uc010xeh.1_Missense_Mutation_p.S70G	NM_018181	NP_060651	Q9HCE3	ZN532_HUMAN	zinc finger protein 532	978					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			breast(1)|skin(1)	2						CTTGCCTTTGAGCATTAAGCC	0.353													30	96	---	---	---	---	PASS
GIPC3	126326	broad.mit.edu	37	19	3586840	3586840	+	Missense_Mutation	SNP	G	A	A	rs141293401		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3586840G>A	uc002lyd.3	+	3	467	c.440G>A	c.(439-441)CGG>CAG	p.R147Q		NM_133261	NP_573568	Q8TF64	GIPC3_HUMAN	GIPC PDZ domain containing family, member 3	147	PDZ.									breast(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0025)|STAD - Stomach adenocarcinoma(1328;0.18)		ATCATCAACCGGATCGAGGCA	0.622											OREG0025154	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	13	---	---	---	---	PASS
ZNF317	57693	broad.mit.edu	37	19	9267288	9267288	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9267288C>G	uc002mku.2	+	3	301	c.26C>G	c.(25-27)GCC>GGC	p.A9G	ZNF317_uc010xkm.1_Silent_p.V50V|ZNF317_uc002mkv.2_5'UTR|ZNF317_uc002mkw.2_Missense_Mutation_p.A9G|ZNF317_uc002mkx.2_5'UTR|ZNF317_uc002mky.2_5'UTR	NM_020933	NP_065984	Q96PQ6	ZN317_HUMAN	zinc finger protein 317	9					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCTCCTCCAGCCACGTCCACC	0.483													116	171	---	---	---	---	PASS
TYK2	7297	broad.mit.edu	37	19	10469918	10469918	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10469918C>A	uc002moc.3	-	15	2486	c.2108G>T	c.(2107-2109)CGG>CTG	p.R703L	TYK2_uc010dxe.2_Missense_Mutation_p.R518L|TYK2_uc002mod.2_Missense_Mutation_p.R703L	NM_003331	NP_003322	P29597	TYK2_HUMAN	tyrosine kinase 2	703	Protein kinase 1.				intracellular protein kinase cascade|regulation of type I interferon-mediated signaling pathway|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			lung(5)|large_intestine(2)|ovary(1)|breast(1)	9			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CACATGGCCCCGCTCCCTCCG	0.637													8	7	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10602850	10602850	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10602850G>C	uc002moq.1	-	3	884	c.728C>G	c.(727-729)TCC>TGC	p.S243C	KEAP1_uc002mop.1_5'UTR|KEAP1_uc002mor.1_Missense_Mutation_p.S243C	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	243	BACK.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			GAAGACCTCGGACTCGCAGCG	0.632													45	24	---	---	---	---	PASS
KANK2	25959	broad.mit.edu	37	19	11304076	11304076	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11304076G>A	uc010dxv.2	-	6	1238	c.680C>T	c.(679-681)ACA>ATA	p.T227I	KANK2_uc002mqm.2_Missense_Mutation_p.T227I|KANK2_uc002mqo.3_Missense_Mutation_p.T227I|KANK2_uc002mqp.1_Missense_Mutation_p.T36I|KANK2_uc002mqq.2_Missense_Mutation_p.T227I	NM_015493	NP_056308	Q63ZY3	KANK2_HUMAN	ankyrin repeat domain 25 isoform 1	227	Potential.										0						AAGTTGTACTGTGAGCTGCCG	0.652													9	40	---	---	---	---	PASS
ASNA1	439	broad.mit.edu	37	19	12848341	12848341	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12848341T>G	uc002muv.2	+	1	36	c.22T>G	c.(22-24)TGG>GGG	p.W8G	C19orf43_uc002muu.2_5'Flank|ASNA1_uc002muw.2_Missense_Mutation_p.W8G	NM_004317	NP_004308	O43681	ASNA_HUMAN	arsA arsenite transporter, ATP-binding, homolog	8					response to arsenic-containing substance	endoplasmic reticulum|nucleolus|soluble fraction	arsenite-transporting ATPase activity|ATP binding|metal ion binding			ovary(2)	2					Adenosine triphosphate(DB00171)	GGTGGCCGGGTGGGGGGTTGA	0.567													4	4	---	---	---	---	PASS
NWD1	284434	broad.mit.edu	37	19	16910814	16910814	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16910814T>G	uc002neu.3	+	17	3999	c.3577T>G	c.(3577-3579)TCT>GCT	p.S1193A	NWD1_uc002net.3_Missense_Mutation_p.S1058A|NWD1_uc002nev.3_Missense_Mutation_p.S987A			Q149M9	NWD1_HUMAN	RecName: Full=NACHT and WD repeat domain-containing protein 1;	1193	WD 9.						ATP binding			skin(3)|ovary(2)|pancreas(2)	7						ACAGTCCTCATCTTTCAAGGT	0.637													24	182	---	---	---	---	PASS
CPAMD8	27151	broad.mit.edu	37	19	17085976	17085976	+	Silent	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17085976T>C	uc002nfb.2	-	17	2174	c.2142A>G	c.(2140-2142)CAA>CAG	p.Q714Q		NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain	667						extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						GCCGGCGTCGTTGTGCCGTCA	0.577													17	31	---	---	---	---	PASS
UNC13A	23025	broad.mit.edu	37	19	17720816	17720816	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17720816T>C	uc002nhd.2	-	42	5008	c.5008A>G	c.(5008-5010)AAA>GAA	p.K1670E		NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A	1582	C2 3.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						AACTTGCGTTTCTTGTCGCTG	0.527													126	226	---	---	---	---	PASS
ZNF626	199777	broad.mit.edu	37	19	20828524	20828524	+	Silent	SNP	G	A	A	rs3209057		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:20828524G>A	uc002npb.1	-	3	342	c.192C>T	c.(190-192)ACC>ACT	p.T64T	ZNF626_uc002npc.1_Intron|ZNF626_uc002npd.1_Silent_p.T64T	NM_001076675	NP_001070143	Q68DY1	ZN626_HUMAN	zinc finger protein 626 isoform 1	64	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1						TTCTCTTCATGGTCAAAGGTT	0.383													134	121	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22375821	22375821	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22375821G>T	uc002nqs.1	-	2	445	c.127C>A	c.(127-129)CCA>ACA	p.P43T		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	43	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CACCTACCTGGGGGTTCTTCC	0.433													109	279	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24309055	24309055	+	Splice_Site	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24309055G>C	uc002nru.2	+	4	388	c.254_splice	c.e4-1	p.G85_splice	ZNF254_uc010xrk.1_Splice_Site	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				ttttttttCAGGTATGTGTCC	0.303													4	68	---	---	---	---	PASS
ANKRD27	84079	broad.mit.edu	37	19	33113383	33113383	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33113383G>A	uc002ntn.1	-	18	1928	c.1772C>T	c.(1771-1773)ACC>ATC	p.T591I		NM_032139	NP_115515	Q96NW4	ANR27_HUMAN	ankyrin repeat domain 27 (VPS9 domain)	591	ANK 5.				early endosome to late endosome transport	early endosome|lysosome	GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|skin(2)|pancreas(1)	5	Esophageal squamous(110;0.137)					CTGGATCTCGGTGGACGCTCC	0.522													111	343	---	---	---	---	PASS
DPF1	8193	broad.mit.edu	37	19	38713068	38713068	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38713068C>A	uc002ohl.2	-	3	335	c.308G>T	c.(307-309)CGC>CTC	p.R103L	DPF1_uc002ohm.2_Missense_Mutation_p.R103L|DPF1_uc002ohn.2_Missense_Mutation_p.R21L|DPF1_uc010xtu.1_Missense_Mutation_p.R77L|DPF1_uc010xtv.1_Missense_Mutation_p.R77L|DPF1_uc010xtw.1_Missense_Mutation_p.R77L	NM_004647	NP_004638	Q92782	DPF1_HUMAN	D4, zinc and double PHD fingers family 1 isoform	103					induction of apoptosis|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nBAF complex	zinc ion binding				0	all_cancers(60;1.24e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			CCTCCAACAGCGGGCGGGGTA	0.517													126	144	---	---	---	---	PASS
SPTBN4	57731	broad.mit.edu	37	19	41010051	41010051	+	Intron	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41010051G>A	uc002ony.2	+						SPTBN4_uc002onx.2_Intron|SPTBN4_uc002onz.2_Intron	NM_020971	NP_066022	Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4 isoform						actin filament capping|axon guidance|cytoskeletal anchoring at plasma membrane|vesicle-mediated transport	cytosol|nuclear matrix|PML body|spectrin	actin binding|ankyrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(1)|skin(1)	5			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TGCCGGCGGGGGGGCGGGGAT	0.602													18	55	---	---	---	---	PASS
EGLN2	112398	broad.mit.edu	37	19	41306706	41306706	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41306706C>T	uc010ehd.2	+	8	1230	c.229C>T	c.(229-231)CGG>TGG	p.R77W	EGLN2_uc002opg.3_Missense_Mutation_p.R77W|EGLN2_uc002oph.2_Missense_Mutation_p.R77W|EGLN2_uc002opi.2_Missense_Mutation_p.R77W	NM_080732	NP_542770	Q96KS0	EGLN2_HUMAN	EGL nine (C.elegans) homolog 2	77					cell redox homeostasis|estrogen receptor signaling pathway|positive regulation of protein catabolic process|regulation of cell growth|response to hypoxia	cytoplasm|nucleus	ferrous iron binding|L-ascorbic acid binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|oxygen sensor activity			ovary(2)	2			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)		Vitamin C(DB00126)	CAGCCCTCTTCGGGACGGTTT	0.672													8	19	---	---	---	---	PASS
ZNF155	7711	broad.mit.edu	37	19	44500911	44500911	+	Nonsense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44500911C>G	uc002oxy.1	+	5	1107	c.902C>G	c.(901-903)TCA>TGA	p.S301*	ZNF155_uc002oxz.1_Nonsense_Mutation_p.S301*|ZNF155_uc010xwt.1_Nonsense_Mutation_p.S312*	NM_003445	NP_003436	Q12901	ZN155_HUMAN	zinc finger protein 155	301	C2H2-type 5.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			large_intestine(1)|ovary(1)	2		Prostate(69;0.0352)				TATTTTAGGTCAAGACTTAAG	0.388													69	204	---	---	---	---	PASS
TBC1D17	79735	broad.mit.edu	37	19	50384664	50384664	+	Silent	SNP	A	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50384664A>C	uc002pqo.2	+	5	611	c.459A>C	c.(457-459)GCA>GCC	p.A153A	TBC1D17_uc010enn.1_RNA|TBC1D17_uc010ybg.1_Silent_p.A120A|TBC1D17_uc002pqp.2_5'UTR|TBC1D17_uc002pqq.1_RNA|TBC1D17_uc002pqr.2_5'UTR|TBC1D17_uc002pqs.2_5'Flank	NM_024682	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	153						intracellular	Rab GTPase activator activity				0		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		CCCTGCCCGCACTGCACTTCC	0.672													15	75	---	---	---	---	PASS
SHANK1	50944	broad.mit.edu	37	19	51169587	51169587	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51169587T>G	uc002psx.1	-	22	5649	c.5630A>C	c.(5629-5631)AAG>ACG	p.K1877T	SHANK1_uc002psw.1_Missense_Mutation_p.K1261T	NM_016148	NP_057232	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1877					cytoskeletal anchoring at plasma membrane	cell junction|cytoplasm|dendrite|membrane fraction|postsynaptic density|postsynaptic membrane	ionotropic glutamate receptor binding			large_intestine(2)	2		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		CTGCTGAAGCTTGGAGCTGAG	0.697													19	19	---	---	---	---	PASS
ZNF175	7728	broad.mit.edu	37	19	52076626	52076626	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52076626G>T	uc002pxb.2	+	2	422	c.44G>T	c.(43-45)GGT>GTT	p.G15V		NM_007147	NP_009078	Q9Y473	ZN175_HUMAN	zinc finger protein 175	15					response to virus	cytoplasm|intermediate filament cytoskeleton|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_neural(266;0.0299)		GBM - Glioblastoma multiforme(134;0.000426)|OV - Ovarian serous cystadenocarcinoma(262;0.0257)		CAGGTCCTGGGTCCAGAGAAG	0.557													43	207	---	---	---	---	PASS
ZNF836	162962	broad.mit.edu	37	19	52660359	52660359	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52660359T>C	uc010ydi.1	-	5	951	c.577A>G	c.(577-579)AAA>GAA	p.K193E	ZNF836_uc010ydj.1_Missense_Mutation_p.K193E	NM_001102657	NP_001096127	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	193					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						TCATATTTTTTAGAAATGTTG	0.363													53	41	---	---	---	---	PASS
ZNF610	162963	broad.mit.edu	37	19	52869896	52869896	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52869896A>G	uc002pyx.3	+	6	1671	c.1265A>G	c.(1264-1266)CAT>CGT	p.H422R	ZNF610_uc002pyy.3_Missense_Mutation_p.H422R|ZNF610_uc002pyz.3_Missense_Mutation_p.H379R|ZNF610_uc002pza.2_Missense_Mutation_p.H422R	NM_001161426	NP_001154898	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610 isoform a	422	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)	3				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		CAGAGAATTCATACTGGAGAG	0.403													64	104	---	---	---	---	PASS
ZNF813	126017	broad.mit.edu	37	19	53994103	53994103	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53994103A>T	uc002qbu.2	+	4	745	c.617A>T	c.(616-618)CAG>CTG	p.Q206L	ZNF813_uc010eqq.1_Intron	NM_001004301	NP_001004301	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	206					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		ACACAAAAACAGGAGGTACAC	0.348													52	180	---	---	---	---	PASS
LILRB1	10859	broad.mit.edu	37	19	55148333	55148333	+	3'UTR	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55148333A>T	uc002qgj.2	+	16					LILRB1_uc002qgl.2_3'UTR|LILRB1_uc002qgk.2_3'UTR|LILRB1_uc002qgm.2_3'UTR|LILRB1_uc010erq.2_3'UTR|LILRB1_uc010err.2_RNA	NM_006669	NP_006660	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor,						regulation of immune response|response to virus	integral to membrane|plasma membrane	protein phosphatase 1 binding|receptor activity			large_intestine(1)|ovary(1)|skin(1)	3				GBM - Glioblastoma multiforme(193;0.0188)		CCACTAGCCCAGGGGGGGACG	0.647										HNSCC(37;0.09)			32	41	---	---	---	---	PASS
NCR1	9437	broad.mit.edu	37	19	55418006	55418006	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55418006C>A	uc002qib.2	+	3	234	c.196C>A	c.(196-198)CTT>ATT	p.L66I	NCR1_uc002qic.2_Missense_Mutation_p.L66I|NCR1_uc002qie.2_Missense_Mutation_p.L66I|NCR1_uc002qid.2_Intron|NCR1_uc002qif.2_Intron|NCR1_uc010esj.2_Intron	NM_004829	NP_004820	O76036	NCTR1_HUMAN	natural cytotoxicity triggering receptor 1	66	Ig-like 1.|Extracellular (Potential).				cellular defense response|natural killer cell activation|regulation of natural killer cell mediated cytotoxicity	integral to plasma membrane|SWI/SNF complex	receptor activity|receptor signaling protein activity			large_intestine(1)|ovary(1)	2				GBM - Glioblastoma multiforme(193;0.0449)		TGAAGGAAGCCTTTTTGCCGT	0.502													45	140	---	---	---	---	PASS
NLRP2	55655	broad.mit.edu	37	19	55493679	55493679	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55493679T>G	uc002qij.2	+	6	699	c.613T>G	c.(613-615)TTC>GTC	p.F205V	NLRP2_uc010yfp.1_Missense_Mutation_p.F182V|NLRP2_uc010esn.2_Missense_Mutation_p.F181V|NLRP2_uc010eso.2_Missense_Mutation_p.F202V|NLRP2_uc010esp.2_Missense_Mutation_p.F183V	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	205					apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TCCCGGGCCCTTCTCATACAC	0.552													50	196	---	---	---	---	PASS
ANGPT4	51378	broad.mit.edu	37	20	896737	896737	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:896737C>T	uc002wei.2	-	1	224	c.121G>A	c.(121-123)GGC>AGC	p.G41S	ANGPT4_uc010zpn.1_Missense_Mutation_p.G35S	NM_015985	NP_057069	Q9Y264	ANGP4_HUMAN	angiopoietin 4 precursor	41					anti-apoptosis|blood coagulation|cellular response to hypoxia|leukocyte migration|negative regulation of angiogenesis|negative regulation of blood vessel endothelial cell migration|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of peptidyl-tyrosine phosphorylation|signal transduction	extracellular space	receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			ovary(2)	2						CTACAGTGGCCGTGCTGGACT	0.617													63	78	---	---	---	---	PASS
SNPH	9751	broad.mit.edu	37	20	1277791	1277791	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1277791G>T	uc002wes.2	+	4	289	c.53G>T	c.(52-54)CGC>CTC	p.R18L	SNPH_uc002wet.2_Missense_Mutation_p.R62L	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin	18					synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						GCCTCCAGGCGCACCTCTCCA	0.662													7	46	---	---	---	---	PASS
SNPH	9751	broad.mit.edu	37	20	1286156	1286156	+	Missense_Mutation	SNP	C	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1286156C>G	uc002wes.2	+	6	1179	c.943C>G	c.(943-945)CAG>GAG	p.Q315E	SNPH_uc002wet.2_Missense_Mutation_p.Q359E	NM_014723	NP_055538	O15079	SNPH_HUMAN	syntaphilin	315					synaptic vesicle docking involved in exocytosis	cell junction|integral to membrane|synapse|synaptosome	syntaxin-1 binding			ovary(2)	2						GCGTGCCATCCAGACAGACTT	0.627													63	150	---	---	---	---	PASS
C20orf79	140856	broad.mit.edu	37	20	18794887	18794887	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18794887G>A	uc002wrk.2	+	1	518	c.428G>A	c.(427-429)AGC>AAC	p.S143N	uc002wrj.1_Intron	NM_178483	NP_848578	Q9UJQ7	CT079_HUMAN	hypothetical protein LOC140856	143	SCP2.						sterol binding			skin(3)	3						GTTCTGCTTAGCTGGAAGCTG	0.443													6	172	---	---	---	---	PASS
RALGAPA2	57186	broad.mit.edu	37	20	20552580	20552580	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20552580T>C	uc002wrz.2	-	22	3055	c.2912A>G	c.(2911-2913)AAT>AGT	p.N971S	RALGAPA2_uc010gcx.2_Missense_Mutation_p.N675S|RALGAPA2_uc010zsg.1_Missense_Mutation_p.N419S	NM_020343	NP_065076	Q2PPJ7	RGPA2_HUMAN	akt substrate AS250	971					activation of Ral GTPase activity	cytosol|nucleus	protein heterodimerization activity|Ral GTPase activator activity			ovary(1)	1						TATTGCTAGATTATCCCGTAT	0.403													20	16	---	---	---	---	PASS
CD93	22918	broad.mit.edu	37	20	23065010	23065010	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23065010C>T	uc002wsv.2	-	1	1968	c.1820G>A	c.(1819-1821)CGC>CAC	p.R607H		NM_012072	NP_036204	Q9NPY3	C1QR1_HUMAN	CD93 antigen precursor	607	Cytoplasmic (Potential).				cell-cell adhesion|interspecies interaction between organisms|macrophage activation|phagocytosis	plasma membrane	calcium ion binding|complement component C1q binding|receptor activity|sugar binding			large_intestine(2)	2	Colorectal(13;0.0352)|Lung NSC(19;0.0542)|all_lung(19;0.118)					TCTCCGCTTGCGATAGACCAG	0.582													101	288	---	---	---	---	PASS
NINL	22981	broad.mit.edu	37	20	25434199	25434199	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25434199G>T	uc002wux.1	-	24	4111	c.4037C>A	c.(4036-4038)GCC>GAC	p.A1346D	NINL_uc010gdn.1_Missense_Mutation_p.A997D|NINL_uc002wuw.1_Missense_Mutation_p.A137D	NM_025176	NP_079452	Q9Y2I6	NINL_HUMAN	ninein-like	1346	Potential.				G2/M transition of mitotic cell cycle	cytosol|microtubule|microtubule organizing center	calcium ion binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5						CTCCTCGGTGGCCTGAAGTGC	0.567													7	118	---	---	---	---	PASS
POFUT1	23509	broad.mit.edu	37	20	30822339	30822339	+	Missense_Mutation	SNP	G	T	T	rs35259534	byFrequency	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30822339G>T	uc002wxp.2	+	7	1091	c.1042G>T	c.(1042-1044)GAC>TAC	p.D348Y	POFUT1_uc010ztt.1_Missense_Mutation_p.D240Y|POFUT1_uc010ztu.1_Missense_Mutation_p.D137Y	NM_015352	NP_056167	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1 isoform 1	348					fucose metabolic process|Notch signaling pathway|O-glycan processing|regulation of transcription, DNA-dependent	endoplasmic reticulum|membrane	peptide-O-fucosyltransferase activity			breast(1)	1			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CGGCCAAGCCGACCACTTTAT	0.592													254	104	---	---	---	---	PASS
BPIL3	128859	broad.mit.edu	37	20	31622902	31622902	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31622902G>T	uc010zuc.1	+	5	468	c.468G>T	c.(466-468)ATG>ATT	p.M156I	BPIL3_uc010zud.1_Missense_Mutation_p.M95I	NM_174897	NP_777557	Q8NFQ5	BPIL3_HUMAN	bactericidal/permeability-increasing	156						extracellular region	lipid binding			ovary(1)|pancreas(1)	2						TCCCCAAGATGGTCAACAAGT	0.572													11	253	---	---	---	---	PASS
KIAA0406	9675	broad.mit.edu	37	20	36611922	36611922	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36611922C>A	uc002xhl.2	-	9	3415	c.3206G>T	c.(3205-3207)GGG>GTG	p.G1069V	KIAA0406_uc002xhm.2_Missense_Mutation_p.G1069V	NM_014657	NP_055472	O43156	TTI1_HUMAN	hypothetical protein LOC9675	1069							binding				0		Myeloproliferative disorder(115;0.00874)				CCCGCTGGCCCCGTGCAGCTG	0.652													12	35	---	---	---	---	PASS
ZSWIM3	140831	broad.mit.edu	37	20	44506879	44506879	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44506879G>A	uc002xqd.2	+	2	1885	c.1682G>A	c.(1681-1683)TGC>TAC	p.C561Y	ZSWIM3_uc010zxg.1_Missense_Mutation_p.C555Y|ZSWIM1_uc010zxh.1_5'Flank|ZSWIM1_uc010ghi.2_5'Flank	NM_080752	NP_542790	Q96MP5	ZSWM3_HUMAN	zinc finger, SWIM domain containing 3	561	SWIM-type.						zinc ion binding			ovary(2)	2		Myeloproliferative disorder(115;0.0122)				CACCTGCCATGCCGACACATT	0.572													20	54	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44685078	44685078	+	Silent	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44685078G>A	uc010zxl.1	+	23	3130	c.3054G>A	c.(3052-3054)GGG>GGA	p.G1018G	SLC12A5_uc002xrb.2_Silent_p.G995G	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride	1018	Cytoplasmic (Potential).				potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	AGCCTGAGGGGGAAGGGGAGA	0.617													21	43	---	---	---	---	PASS
SLC13A3	64849	broad.mit.edu	37	20	45228639	45228639	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228639C>T	uc002xsf.1	-	4	617	c.579G>A	c.(577-579)ACG>ACA	p.T193T	SLC13A3_uc010ghn.1_Silent_p.T162T|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Silent_p.T146T|SLC13A3_uc010gho.1_Silent_p.T146T|SLC13A3_uc010zxx.1_Silent_p.T95T	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a	193	Cytoplasmic (Potential).					integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	ACTGCATCTCCGTGGGCACAG	0.468													36	121	---	---	---	---	PASS
GNAS	2778	broad.mit.edu	37	20	57415276	57415276	+	Missense_Mutation	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57415276A>G	uc002xzt.2	+	1	482	c.115A>G	c.(115-117)ATC>GTC	p.I39V	GNASAS_uc002xzs.1_Intron|GNAS_uc002xzu.3_5'Flank|GNAS_uc010gjq.2_5'Flank	NM_016592	NP_057676	P63092	GNAS2_HUMAN	GNAS complex locus NESP55	Error:Variant_position_missing_in_P63092_after_alignment					activation of adenylate cyclase activity|cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|intracellular transport|platelet activation|regulation of insulin secretion|sensory perception of smell|transmembrane transport|water transport	heterotrimeric G-protein complex|intrinsic to membrane|trans-Golgi network membrane	adenylate cyclase activity|GTP binding|GTPase activity|guanyl-nucleotide exchange factor activity|identical protein binding|signal transducer activity			pituitary(201)|thyroid(35)|ovary(15)|adrenal_gland(9)|liver(7)|large_intestine(5)|parathyroid(5)|kidney(5)|haematopoietic_and_lymphoid_tissue(3)|lung(2)|testis(1)|stomach(1)|small_intestine(1)|autonomic_ganglia(1)|pancreas(1)	292	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			CTCCTGCTCCATCGCGCTCCT	0.716			Mis		pituitary adenoma		McCune-Albright syndrome; pseudohypoparathyroidism|type IA		3-Methylglutaconic_Aciduria_and_Myelodysplasia|McCune-Albright_syndrome|Mazabraud_syndrome	TSP Lung(22;0.16)			22	34	---	---	---	---	PASS
CTSZ	1522	broad.mit.edu	37	20	57576578	57576578	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57576578G>T	uc002yai.2	-	3	555	c.429C>A	c.(427-429)TAC>TAA	p.Y143*	CTSZ_uc002yaj.3_Nonsense_Mutation_p.Y143*	NM_001336	NP_001327	Q9UBR2	CATZ_HUMAN	cathepsin Z preproprotein	143					proteolysis	endoplasmic reticulum|extracellular space|lysosome	cysteine-type endopeptidase activity			kidney(1)	1	all_lung(29;0.00711)		Colorectal(105;0.109)			GCTGGTGGGCGTAGTCCCACA	0.652													19	32	---	---	---	---	PASS
BAGE2	85319	broad.mit.edu	37	21	11097576	11097576	+	Nonsense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11097576C>T	uc002yit.1	-	2	294	c.86G>A	c.(85-87)TGG>TAG	p.W29*	BAGE_uc002yix.2_RNA	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ctccaacctccagctcaccac	0.095													11	123	---	---	---	---	PASS
SFRS15	57466	broad.mit.edu	37	21	33044665	33044665	+	Missense_Mutation	SNP	T	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33044665T>A	uc002ypd.2	-	20	2917	c.2491A>T	c.(2491-2493)ACT>TCT	p.T831S	SFRS15_uc002ype.2_Missense_Mutation_p.T809S|SFRS15_uc010glu.2_Missense_Mutation_p.T816S	NM_020706	NP_065757	O95104	SFR15_HUMAN	splicing factor, arginine/serine-rich 15 isoform	831						nucleus	nucleotide binding|RNA binding				0						ACTCCTTGAGTGCCTAAAAGA	0.507													51	25	---	---	---	---	PASS
BRWD1	54014	broad.mit.edu	37	21	40558971	40558971	+	Missense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40558971C>A	uc002yxk.1	-	42	7083	c.6944G>T	c.(6943-6945)TGG>TTG	p.W2315L	BRWD1_uc010goc.1_Missense_Mutation_p.W958L	NM_018963	NP_061836	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	2315					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				skin(3)|ovary(1)	4		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ATTTTCTTTCCAGGATCTGAA	0.343													5	211	---	---	---	---	PASS
TFF1	7031	broad.mit.edu	37	21	43783371	43783371	+	Silent	SNP	A	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43783371A>G	uc002zax.1	-	2	271	c.231T>C	c.(229-231)CCT>CCC	p.P77P		NM_003225	NP_003216	P04155	TFF1_HUMAN	trefoil factor 1 precursor	77					carbohydrate metabolic process|response to estradiol stimulus		growth factor activity				0						TACCTTCTGGAGGGACGTCGA	0.483													29	64	---	---	---	---	PASS
WDR4	10785	broad.mit.edu	37	21	44273748	44273748	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:44273748C>T	uc002zci.2	-	9	979	c.906G>A	c.(904-906)GGG>GGA	p.G302G	WDR4_uc002zck.1_Silent_p.G302G|WDR4_uc002zcl.1_Silent_p.G156G|WDR4_uc010gpg.1_Silent_p.G301G|WDR4_uc011aew.1_Silent_p.G156G|WDR4_uc010gph.1_Silent_p.G156G	NM_033661	NP_387510	P57081	WDR4_HUMAN	WD repeat domain 4 protein	302	WD 4.				tRNA modification	cytoplasm|nucleoplasm	protein binding			ovary(1)	1				Colorectal(79;0.0165)|Lung(125;0.0484)|STAD - Stomach adenocarcinoma(101;0.0624)|COAD - Colon adenocarcinoma(84;0.128)|LUSC - Lung squamous cell carcinoma(216;0.244)		GCACCCACAGCCCCTGGGTCT	0.632													15	7	---	---	---	---	PASS
KRTAP10-12	386685	broad.mit.edu	37	21	46117824	46117824	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46117824C>A	uc002zfw.1	+	1	738	c.708C>A	c.(706-708)TGC>TGA	p.C236*	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198699	NP_941972	P60413	KR10C_HUMAN	keratin associated protein 10-12	236						keratin filament					0						CCCTCCTCTGCCGCCCCACAT	0.716													30	29	---	---	---	---	PASS
IGLL3	91353	broad.mit.edu	37	22	25716034	25716034	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25716034C>T	uc003abr.2	+	2	756	c.656C>T	c.(655-657)GCC>GTC	p.A219V		NM_001013618	NP_001013640			immunoglobulin lambda-like polypeptide 3												0						AAGACGGTGGCCCCTGCAGAA	0.637													38	63	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26264284	26264284	+	Intron	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26264284C>T	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						ATTTTTTCCCCAGGCCGTGGA	0.542													9	27	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32242824	32242824	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32242824G>A	uc003als.2	+	31	3141	c.2999G>A	c.(2998-3000)GGG>GAG	p.G1000E	DEPDC5_uc011als.1_Missense_Mutation_p.G931E|DEPDC5_uc011alu.1_Missense_Mutation_p.G1009E|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Missense_Mutation_p.G1000E|DEPDC5_uc003alu.2_Missense_Mutation_p.G449E|DEPDC5_uc003alv.2_RNA|DEPDC5_uc011alw.1_Missense_Mutation_p.G330E|DEPDC5_uc003alw.2_Missense_Mutation_p.G298E|DEPDC5_uc011alx.1_Intron|DEPDC5_uc010gwk.2_Missense_Mutation_p.G4E	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1000					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						CTTTAGAAAGGGACCGCCATG	0.582													14	92	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36886290	36886290	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36886290G>A	uc003apn.3	-	8	1928	c.1820C>T	c.(1819-1821)ACG>ATG	p.T607M	FOXRED2_uc003apm.3_Missense_Mutation_p.T159M|FOXRED2_uc003apo.3_Missense_Mutation_p.T607M|FOXRED2_uc003app.3_Missense_Mutation_p.T607M	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	607				T -> A (in Ref. 2; BAB15227).	ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						CTTCTGGCGCGTGAGGGCGAA	0.582													187	280	---	---	---	---	PASS
SSTR3	6753	broad.mit.edu	37	22	37603578	37603578	+	Missense_Mutation	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37603578C>T	uc003ara.2	-	2	327	c.265G>A	c.(265-267)GCC>ACC	p.A89T	SSTR3_uc003arb.2_Missense_Mutation_p.A89T	NM_001051	NP_001042	P32745	SSR3_HUMAN	somatostatin receptor 3	89	Helical; Name=2; (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|induction of apoptosis by hormones|negative regulation of cell proliferation	integral to plasma membrane|nonmotile primary cilium	somatostatin receptor activity			lung(1)	1						AGCTCGTCGGCCAGCGCCAGG	0.652													72	89	---	---	---	---	PASS
FAM83F	113828	broad.mit.edu	37	22	40417597	40417597	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40417597C>T	uc003ayk.1	+	4	1177	c.1083C>T	c.(1081-1083)GGC>GGT	p.G361G		NM_138435	NP_612444	Q8NEG4	FA83F_HUMAN	hypothetical protein LOC113828	361										breast(1)	1						AGGAGGAGGGCGCCAGCGGTG	0.721													14	25	---	---	---	---	PASS
PLCXD1	55344	broad.mit.edu	37	X	205453	205453	+	Nonsense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:205453G>T	uc004cpc.2	+	3	493	c.181G>T	c.(181-183)GAG>TAG	p.E61*	PLCXD1_uc011mgx.1_RNA	NM_018390	NP_060860	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X	61	PI-PLC X-box.				intracellular signal transduction|lipid metabolic process		phospholipase C activity				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CATTTCGCACGAGGAGTCCCG	0.622													100	115	---	---	---	---	PASS
CD99	4267	broad.mit.edu	37	X	2637713	2637713	+	Missense_Mutation	SNP	G	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2637713G>C	uc004cqm.2	+	4	334	c.160G>C	c.(160-162)GAC>CAC	p.D54H	CD99_uc010nda.2_Missense_Mutation_p.D38H|CD99_uc004cqn.2_RNA|CD99_uc004cqo.2_Missense_Mutation_p.D54H	NM_002414	NP_002405	P14209	CD99_HUMAN	CD99 antigen isoform a precursor	54	Extracellular (Potential).				cell adhesion	cytoplasm|integral to plasma membrane				skin(1)	1						GGATGACTTTGACTTAGGAGA	0.403													9	891	---	---	---	---	PASS
CNKSR2	22866	broad.mit.edu	37	X	21450923	21450923	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21450923G>T	uc004czx.1	+	3	458	c.422G>T	c.(421-423)TGG>TTG	p.W141L	CNKSR2_uc004czw.2_Missense_Mutation_p.W141L|CNKSR2_uc011mjn.1_Missense_Mutation_p.W141L|CNKSR2_uc011mjo.1_Missense_Mutation_p.W141L	NM_014927	NP_055742	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras	141	CRIC.				regulation of signal transduction	cytoplasm|membrane	protein binding			large_intestine(1)|lung(1)	2						CTGCTTGCCTGGTTGGACAGG	0.443													109	33	---	---	---	---	PASS
MAGEB18	286514	broad.mit.edu	37	X	26158006	26158006	+	Missense_Mutation	SNP	T	G	G			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:26158006T>G	uc004dbq.1	+	2	1091	c.904T>G	c.(904-906)TGC>GGC	p.C302G		NM_173699	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	302	MAGE.						protein binding			central_nervous_system(1)	1						CTTCCCATCCTGCTATGAAGA	0.522													26	3	---	---	---	---	PASS
FAM47A	158724	broad.mit.edu	37	X	34148451	34148451	+	Nonsense_Mutation	SNP	C	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:34148451C>A	uc004ddg.2	-	1	1978	c.1945G>T	c.(1945-1947)GAG>TAG	p.E649*		NM_203408	NP_981953	Q5JRC9	FA47A_HUMAN	hypothetical protein LOC158724	649										ovary(4)|central_nervous_system(1)	5						GAGGAACACTCCTTTACTTTC	0.453													115	33	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37029404	37029404	+	Missense_Mutation	SNP	A	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37029404A>T	uc004ddl.1	+	1	2935	c.2921A>T	c.(2920-2922)GAC>GTC	p.D974V		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	974										ovary(3)	3						GACATTCTTGACGGTCTTTAT	0.458													190	58	---	---	---	---	PASS
ZNF81	347344	broad.mit.edu	37	X	47774987	47774987	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47774987G>T	uc010nhy.1	+	6	1310	c.942G>T	c.(940-942)AAG>AAT	p.K314N		NM_007137	NP_009068	P51508	ZNF81_HUMAN	zinc finger protein 81	314						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(315;0.0973)				TTACACAGAAGCCACTACTCA	0.358													63	15	---	---	---	---	PASS
SSX7	280658	broad.mit.edu	37	X	52679419	52679419	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52679419T>C	uc004dqx.1	-	5	473	c.314A>G	c.(313-315)CAG>CGG	p.Q105R		NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7	105					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					GAAGATTCTCTGGAGCCTGCA	0.408													12	172	---	---	---	---	PASS
RPS6KA6	27330	broad.mit.edu	37	X	83419352	83419352	+	Missense_Mutation	SNP	T	C	C			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83419352T>C	uc004eej.1	-	2	202	c.125A>G	c.(124-126)GAA>GGA	p.E42G	RPS6KA6_uc011mqt.1_Missense_Mutation_p.E42G|RPS6KA6_uc011mqu.1_5'UTR	NM_014496	NP_055311	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase polypeptide 6	42					axon guidance|central nervous system development|intracellular protein kinase cascade|synaptic transmission	cytosol|nucleoplasm	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(5)|stomach(1)|central_nervous_system(1)|skin(1)	8						AGAATCTGCTTCTCCCTCTTC	0.313													4	117	---	---	---	---	PASS
TCEAL2	140597	broad.mit.edu	37	X	101382147	101382147	+	Missense_Mutation	SNP	G	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101382147G>T	uc004eip.2	+	3	564	c.345G>T	c.(343-345)GAG>GAT	p.E115D		NM_080390	NP_525129	Q9H3H9	TCAL2_HUMAN	transcription elongation factor A (SII)-like 2	115					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0						cagagagtgagggagagCCAG	0.239													64	13	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105152720	105152720	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105152720G>A	uc004emd.2	+	13	1390	c.1087G>A	c.(1087-1089)GGA>AGA	p.G363R	NRK_uc010npc.1_Missense_Mutation_p.G31R	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	363							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TTATTTTAGAGGACCCTCTTG	0.443										HNSCC(51;0.14)			39	16	---	---	---	---	PASS
MCF2	4168	broad.mit.edu	37	X	138671994	138671994	+	Silent	SNP	C	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:138671994C>T	uc004fau.2	-	20	2664	c.2370G>A	c.(2368-2370)CAG>CAA	p.Q790Q	MCF2_uc004fav.2_Silent_p.Q806Q|MCF2_uc011mwl.1_Silent_p.Q767Q|MCF2_uc010nsh.1_Silent_p.Q790Q|MCF2_uc011mwm.1_Silent_p.Q751Q|MCF2_uc011mwn.1_Silent_p.Q935Q|MCF2_uc004faw.2_Silent_p.Q850Q|MCF2_uc011mwo.1_Silent_p.Q866Q	NM_005369	NP_005360	P10911	MCF2_HUMAN	MCF.2 cell line derived transforming sequence	790	PH.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytoskeleton|cytosol|membrane|membrane fraction	protein binding|Rho guanyl-nucleotide exchange factor activity			lung(1)|pleura(1)	2	Acute lymphoblastic leukemia(192;0.000127)					AATGACCAACCTGGACAATAT	0.318													72	19	---	---	---	---	PASS
MAGEC1	9947	broad.mit.edu	37	X	140995192	140995192	+	Missense_Mutation	SNP	G	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:140995192G>A	uc004fbt.2	+	4	2288	c.2002G>A	c.(2002-2004)GAG>AAG	p.E668K	MAGEC1_uc010nsl.1_Intron	NM_005462	NP_005453	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	668							protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4	Acute lymphoblastic leukemia(192;6.56e-05)					GAGCCCTCCTGAGGGGATGCA	0.577										HNSCC(15;0.026)			6	417	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	30196436	30196436	+	IGR	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30196436delC								PTPRU (543121 upstream) : MATN1 (987690 downstream)																							ccaccaccatcaccactacca	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	51681704	51681705	+	IGR	DEL	AC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51681704_51681705delAC								C1orf185 (67952 upstream) : RNF11 (20240 downstream)																							acacacacatacacacacacac	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	89860784	89860807	+	IGR	DEL	AGGAAGGAAGGAAGGAAGCAAGCA	-	-	rs72125855	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89860784_89860807delAGGAAGGAAGGAAGGAAGCAAGCA								GBP6 (7065 upstream) : LOC400759 (12431 downstream)																							gaaggaaggcaggaaggaaggaaggaagcaagcaaggaaggaag	0.165													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	160905975	160905975	+	IGR	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160905975delT								ITLN1 (51015 upstream) : ITLN2 (8842 downstream)																							cttcttcttcttttttttttt	0.124													4	3	---	---	---	---	
PCNXL2	80003	broad.mit.edu	37	1	233135199	233135199	+	Intron	DEL	T	-	-	rs137857886		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233135199delT	uc001hvl.2	-						PCNXL2_uc001hvk.1_Intron|PCNXL2_uc001hvm.1_Intron	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2							integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				tttctttttcttttttttttt	0.219													6	3	---	---	---	---	
ARID4B	51742	broad.mit.edu	37	1	235465579	235465580	+	Intron	INS	-	AGGG	AGGG	rs139132686	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235465579_235465580insAGGG	uc001hwq.2	-						ARID4B_uc001hwr.2_Intron|ARID4B_uc001hws.3_Intron|ARID4B_uc001hwu.1_Intron	NM_016374	NP_057458	Q4LE39	ARI4B_HUMAN	AT rich interactive domain 4B isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding			ovary(2)|lung(1)	3	Ovarian(103;0.0473)|Breast(184;0.23)	all_cancers(173;0.000782)|Prostate(94;0.0132)|all_epithelial(177;0.0808)|Lung SC(1967;0.24)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)			gggaagtgtaaagggagggagg	0.020													4	2	---	---	---	---	
RGS7	6000	broad.mit.edu	37	1	241384294	241384295	+	Intron	INS	-	AAGAAAGA	AAGAAAGA	rs12039594	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241384294_241384295insAAGAAAGA	uc001hyv.2	-						RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			aggaaggaaggaagagagagag	0.015													6	8	---	---	---	---	
WDR64	128025	broad.mit.edu	37	1	241850606	241850607	+	Intron	INS	-	A	A	rs67963688		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241850606_241850607insA	uc001hze.1	+						WDR64_uc001hzf.1_Intron			B1ANS9	WDR64_HUMAN	RecName: Full=WD repeat-containing protein 64;											skin(1)	1	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			agactccatctaaaaaaaaaaa	0.139													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	242995203	242995204	+	IGR	INS	-	GAAA	GAAA	rs10926878	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242995203_242995204insGAAA								PLD5 (307205 upstream) : CEP170 (292527 downstream)																							aaggaaggaaggaaggaaggag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	247801399	247801400	+	IGR	DEL	AC	-	-	rs36228205		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247801399_247801400delAC								OR2G3 (31583 upstream) : OR13G1 (34020 downstream)																							TAGTTTGCAAacacacacacac	0.416													4	2	---	---	---	---	
COLEC11	78989	broad.mit.edu	37	2	3651821	3651821	+	Intron	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3651821delC	uc002qya.2	+						COLEC11_uc002qxz.2_Intron|COLEC11_uc002qyb.2_Intron|COLEC11_uc002qyc.2_Intron|COLEC11_uc010ewo.2_Intron|COLEC11_uc010ewp.2_5'Flank|COLEC11_uc010ewq.2_5'Flank|COLEC11_uc010ewr.2_5'Flank|COLEC11_uc010ews.2_5'Flank	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a							collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		GAGGGCTACACCCCTTGCCTC	0.597													125	325	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8891387	8891387	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8891387delT	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qzb.2_5'Flank|KIDINS220_uc002qze.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					CAGGAttttcttttttttttt	0.348													3	3	---	---	---	---	
NOL10	79954	broad.mit.edu	37	2	10822020	10822020	+	Intron	DEL	A	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10822020delA	uc002raq.2	-						NOL10_uc010yje.1_Intron|NOL10_uc010yjf.1_Intron|NOL10_uc002rap.2_Intron|NOL10_uc002rar.2_Intron	NM_024894	NP_079170	Q9BSC4	NOL10_HUMAN	nucleolar protein 10							nucleolus					0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.207)		tattaggGTTAAAAAAAAAAA	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	11060846	11060847	+	IGR	INS	-	TG	TG	rs149638295	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11060846_11060847insTG								KCNF1 (6496 upstream) : C2orf50 (212332 downstream)																							gtgcgtgtgcctgtgtgtgtgt	0.386													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	12293418	12293419	+	Intron	DEL	TT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:12293418_12293419delTT	uc002rbu.1	+											Homo sapiens cDNA FLJ10696 fis, clone NT2RP3000484.																		cttttctttctttctttctttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	37799969	37799970	+	IGR	INS	-	CACA	CACA	rs140944296	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37799969_37799970insCACA								QPCT (199505 upstream) : CDC42EP3 (70773 downstream)																							acacactctgtcacacacacac	0.000													4	5	---	---	---	---	
SRBD1	55133	broad.mit.edu	37	2	45645816	45645816	+	Intron	DEL	A	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45645816delA	uc002rus.2	-						SRBD1_uc010yoc.1_Intron	NM_018079	NP_060549	Q8N5C6	SRBD1_HUMAN	S1 RNA binding domain 1						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process		hydrolase activity, acting on ester bonds|RNA binding			central_nervous_system(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)	LUSC - Lung squamous cell carcinoma(58;0.0917)|Lung(47;0.154)			AAGGGAGTTTaaaaaaaaaaa	0.199													13	7	---	---	---	---	
PRKCE	5581	broad.mit.edu	37	2	45971675	45971678	+	Intron	DEL	TTCT	-	-	rs71971050		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45971675_45971678delTTCT	uc002rut.2	+						PRKCE_uc002ruu.2_Intron	NM_005400	NP_005391	Q02156	KPCE_HUMAN	protein kinase C, epsilon						activation of phospholipase C activity|induction of apoptosis|intracellular signal transduction|nerve growth factor receptor signaling pathway|platelet activation	cytosol|endoplasmic reticulum|plasma membrane	ATP binding|enzyme activator activity|metal ion binding|signal transducer activity			lung(4)|ovary(3)|kidney(1)|breast(1)|large_intestine(1)	10		all_hematologic(82;0.155)|Acute lymphoblastic leukemia(82;0.209)	LUSC - Lung squamous cell carcinoma(58;0.171)			ttttctttccttctttctttcttt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91764930	91764935	+	IGR	DEL	TGTGTA	-	-	rs4005278		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91764930_91764935delTGTGTA								None (None upstream) : LOC654342 (40257 downstream)																							tgtgtgtgtgtgtgtatatatataca	0.015													8	5	---	---	---	---	
SULT1C4	27233	broad.mit.edu	37	2	108998124	108998125	+	Intron	INS	-	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:108998124_108998125insA	uc002tea.1	+						SULT1C4_uc002tdz.2_Intron|SULT1C4_uc010ywr.1_Intron|SULT1C4_uc002teb.1_Intron	NM_006588	NP_006579	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member						3'-phosphoadenosine 5'-phosphosulfate metabolic process|sulfation|xenobiotic metabolic process	cytosol	sulfotransferase activity				0						caaaacaaaacaaaaGACATAG	0.149													25	30	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	153779755	153779764	+	IGR	DEL	TCCCTTCCCT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153779755_153779764delTCCCTTCCCT								ARL6IP6 (161988 upstream) : RPRM (554088 downstream)																							actttctctctcccttcccttcccttccct	0.038													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	158771043	158771046	+	IGR	DEL	AAGG	-	-	rs71404320		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:158771043_158771046delAAGG								ACVR1 (38669 upstream) : UPP2 (80645 downstream)																							aaaaaaaTAAaaggaaggaaggaa	0.005													4	2	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179655297	179655297	+	Intron	DEL	G	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179655297delG	uc010zfg.1	-						TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002unb.2_Intron|TTN_uc010frg.1_Intron	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A								ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTAGCTGTGTGGGAAAAGAAA	0.308													19	16	---	---	---	---	
RQCD1	9125	broad.mit.edu	37	2	219447953	219447978	+	Intron	DEL	TGTGTCTCTCTCTCTCTCTCTCTCTC	-	-	rs36210927	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219447953_219447978delTGTGTCTCTCTCTCTCTCTCTCTCTC	uc010zkh.1	+						RQCD1_uc002vih.1_Intron|RQCD1_uc010zki.1_Intron	NM_005444	NP_005435	Q92600	RCD1_HUMAN	RCD1 required for cell differentiation1 homolog						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription, DNA-dependent|sex differentiation|transcription, DNA-dependent	cytoplasmic mRNA processing body|cytosol|nucleus	protein binding			ovary(1)|skin(1)	2		Renal(207;0.0915)		Epithelial(149;1.13e-06)|all cancers(144;0.000192)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		tgtgtgtgtgtgtgtctctctctctctctctctctctctctctctc	0.226													8	4	---	---	---	---	
COL4A3	1285	broad.mit.edu	37	2	228058585	228058587	+	Intron	DEL	AAG	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228058585_228058587delAAG	uc002vom.1	+						COL4A3_uc002von.1_Intron|COL4A3_uc002voo.1_Intron|COL4A3_uc002vop.1_Intron	NM_000091	NP_000082	Q01955	CO4A3_HUMAN	alpha 3 type IV collagen isoform 1 precursor						activation of caspase activity|axon guidance|blood circulation|cell adhesion|cell proliferation|cell surface receptor linked signaling pathway|glomerular basement membrane development|induction of apoptosis|negative regulation of angiogenesis|negative regulation of cell proliferation|sensory perception of sound	collagen type IV	extracellular matrix structural constituent|integrin binding|metalloendopeptidase inhibitor activity			skin(2)|ovary(1)	3		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		gaagggaaataaggagagaggga	0.000													5	5	---	---	---	---	
TRANK1	9881	broad.mit.edu	37	3	36879646	36879647	+	Intron	DEL	AC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:36879646_36879647delAC	uc003cgj.2	-							NM_014831	NP_055646	O15050	TRNK1_HUMAN	lupus brain antigen 1						DNA repair		ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|central_nervous_system(1)	2						TAacacacaaacacacacacac	0.391													3	3	---	---	---	---	
ADAMTS9	56999	broad.mit.edu	37	3	64640145	64640146	+	Intron	INS	-	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64640145_64640146insA	uc003dmg.2	-						ADAMTS9_uc011bfo.1_Intron|ADAMTS9_uc003dmh.1_Intron|ADAMTS9_uc003dmk.1_Intron	NM_182920	NP_891550	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1						glycoprotein catabolic process|multicellular organismal development|proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(2)|urinary_tract(1)|skin(1)	4		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		CTATTAGAAGGAAAAAAACCAA	0.396													92	79	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	94403335	94403336	+	IGR	DEL	TG	-	-	rs34765594		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:94403335_94403336delTG								NSUN3 (557705 upstream) : LOC255025 (253771 downstream)																							TTCTGATAATtgtgtgtgtgtg	0.243													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	128772569	128772576	+	IGR	DEL	ACACACAC	-	-	rs147101636		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128772569_128772576delACACACAC								CCDC48 (12986 upstream) : GP9 (7069 downstream)																							CTGTGTTAAAacacacacacacacacac	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	154452007	154452008	+	IGR	INS	-	TG	TG	rs145810325	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154452007_154452008insTG								GPR149 (304503 upstream) : MME (289905 downstream)																							TTGCAtgtgcatgtgtgtgtgt	0.144													4	2	---	---	---	---	
PLCH1	23007	broad.mit.edu	37	3	155314368	155314368	+	Intron	DEL	A	-	-	rs62708860		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155314368delA	uc011bok.1	-						PLCH1_uc011boj.1_Intron|PLCH1_uc011bol.1_Intron	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a						lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TTACTAACAGAAAAAAAAAAA	0.328													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166492922	166492923	+	IGR	INS	-	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166492922_166492923insA								BCHE (937669 upstream) : ZBBX (465158 downstream)																							aagaaagaaagaaagaaagaaa	0.000													4	2	---	---	---	---	
LOC100128164	100128164	broad.mit.edu	37	3	169664945	169664946	+	RNA	DEL	GT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169664945_169664946delGT	uc011bpp.1	-	2		c.2857_2858delAC				NR_027622				Homo sapiens cDNA FLJ41016 fis, clone UTERU2018784.												0						AGGTATATTCgtgtgtgtgtgt	0.168													4	2	---	---	---	---	
PSMD2	5708	broad.mit.edu	37	3	184019125	184019125	+	Intron	DEL	A	-	-	rs112455702		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184019125delA	uc003fnn.1	+						PSMD2_uc011brj.1_Intron|PSMD2_uc011brk.1_Intron	NM_002808	NP_002799	Q13200	PSMD2_HUMAN	proteasome 26S non-ATPase subunit 2						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding				0	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	actgagtctcaaaaaaaaaaa	0.000													16	7	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186014835	186014838	+	Intron	DEL	TCTG	-	-	rs72347529		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186014835_186014838delTCTG	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	GCCACCTCTCTCTGTCTGTCTGTC	0.422													1	6	---	---	---	---	
MASP1	5648	broad.mit.edu	37	3	186969200	186969201	+	Intron	INS	-	A	A	rs11454655		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186969200_186969201insA	uc003frh.1	-						MASP1_uc003fri.2_Intron|MASP1_uc003frj.2_Intron|MASP1_uc003frk.1_Intron|MASP1_uc011bse.1_Intron	NM_001879	NP_001870	P48740	MASP1_HUMAN	mannan-binding lectin serine protease 1 isoform						complement activation, lectin pathway|negative regulation of complement activation|proteolysis	extracellular space	calcium ion binding|calcium-dependent protein binding|protein binding|protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|breast(1)|liver(1)	4	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		ATGCTCTGATTAAAAAAAAAAA	0.396													8	7	---	---	---	---	
LPP	4026	broad.mit.edu	37	3	188302334	188302335	+	Intron	INS	-	GT	GT	rs144557143	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:188302334_188302335insGT	uc003frs.1	+						LPP_uc011bsg.1_Intron|LPP_uc011bsi.1_Intron|LPP_uc003frt.2_Intron|LPP_uc011bsj.1_Intron	NM_005578	NP_005569	Q93052	LPP_HUMAN	LIM domain containing preferred translocation						cell adhesion	cytoplasm|focal adhesion|nucleus	protein binding|zinc ion binding		HMGA2/LPP(161)	soft_tissue(134)|bone(27)|lung(2)|ovary(1)|breast(1)	165	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TAATTTTAGTCgtgtgtgtgtg	0.198			T	HMGA2|MLL|C12orf9	lipoma|leukemia								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194582319	194582320	+	IGR	DEL	AC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194582319_194582320delAC								FAM43A (172555 upstream) : C3orf21 (206695 downstream)																							TCAGACTAGAacacacacacac	0.337													9	4	---	---	---	---	
TCTEX1D2	255758	broad.mit.edu	37	3	196044026	196044027	+	Intron	DEL	GT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196044026_196044027delGT	uc003fwi.2	-						TM4SF19_uc003fwj.2_Intron|uc003fwk.1_5'Flank	NM_152773	NP_689986	Q8WW35	TC1D2_HUMAN	Tctex1 domain containing 2								protein binding			ovary(1)|breast(1)	2	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TTTTTTTTCAgtgtgtgtgtgt	0.292													6	3	---	---	---	---	
SLC2A9	56606	broad.mit.edu	37	4	9982892	9982894	+	Intron	DEL	TAG	-	-	rs67090256	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9982892_9982894delTAG	uc003gmc.2	-						SLC2A9_uc003gmd.2_Intron	NM_020041	NP_064425	Q9NRM0	GTR9_HUMAN	solute carrier family 2, member 9 protein						glucose transport|urate metabolic process	integral to membrane|plasma membrane	sugar:hydrogen symporter activity			ovary(3)	3						atgatggtgatagtggtggtggt	0.005													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	19482727	19482728	+	IGR	INS	-	T	T	rs147414373	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:19482727_19482728insT								None (None upstream) : SLIT2 (772507 downstream)																							CTTTGAAAATATTTTTttttct	0.050													4	2	---	---	---	---	
HHIP	64399	broad.mit.edu	37	4	145628141	145628141	+	Intron	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:145628141delC	uc003ijs.1	+							NM_022475	NP_071920	Q96QV1	HHIP_HUMAN	hedgehog-interacting protein precursor							cytoplasm|extracellular region	catalytic activity|protein binding|zinc ion binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		TTACTATGTGCCAGGAGTTTG	0.313													7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4642490	4642491	+	IGR	INS	-	TGTG	TGTG	rs141628851	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4642490_4642491insTGTG								None (None upstream) : LOC340094 (391981 downstream)																							AATTAACTATAtgtgtgtgtgt	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	44688797	44688797	+	IGR	DEL	G	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44688797delG								FGF10 (300013 upstream) : MRPS30 (120230 downstream)																							aagaaagaaaggaaggaaaga	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	82272390	82272399	+	IGR	DEL	AGACTGTGAC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:82272390_82272399delAGACTGTGAC								ATP6AP1L (658244 upstream) : TMEM167A (76268 downstream)																							CTGCTATCTGAGACTGTGACAGAGCCATTG	0.462													160	73	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	172631919	172631922	+	IGR	DEL	TCCC	-	-	rs10069842		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172631919_172631922delTCCC								BNIP1 (40530 upstream) : NKX2-5 (27216 downstream)																							catccttccttccctccttccatc	0.059													4	2	---	---	---	---	
MYLK4	340156	broad.mit.edu	37	6	2692888	2692889	+	Intron	DEL	GC	-	-	rs5873836		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2692888_2692889delGC	uc003mty.3	-							NM_001012418	NP_001012418	Q86YV6	MYLK4_HUMAN	myosin light chain kinase family, member 4								ATP binding|protein serine/threonine kinase activity			breast(3)|ovary(1)	4	Ovarian(93;0.0412)	all_hematologic(90;0.0897)				GGGGGGGGGGGCATTTTTTTAT	0.371													4	2	---	---	---	---	
HLA-C	3107	broad.mit.edu	37	6	31239170	31239171	+	Intron	INS	-	A	A	rs149444854	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31239170_31239171insA	uc003nsy.2	-						HLA-C_uc011dnj.1_Intron|HLA-C_uc003nsx.2_5'UTR|HLA-C_uc003nsz.2_Intron|HLA-C_uc010jsl.2_Intron|HLA-C_uc003nta.2_Intron|HLA-C_uc003ntb.2_Intron|HLA-C_uc003ntc.1_Intron|HLA-B_uc010jsm.1_Intron|HLA-B_uc011dnk.1_Intron|HLA-C_uc011dnl.1_Intron|HLA-B_uc003ntf.2_Intron	NM_002117	NP_002108	Q9TNN7	1C05_HUMAN	major histocompatibility complex, class I, C						antigen processing and presentation of peptide antigen via MHC class I|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of immune response|type I interferon-mediated signaling pathway	integral to membrane|MHC class I protein complex					0						AGCCCCGCCCCGCCCCGACCAA	0.708													3	3	---	---	---	---	
NCR2	9436	broad.mit.edu	37	6	41301865	41301866	+	5'Flank	DEL	AC	-	-	rs71745323		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41301865_41301866delAC	uc003oqh.2	+						NCR2_uc003oqi.2_5'Flank|NCR2_uc003oqj.2_5'Flank	NM_004828	NP_004819	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2						cellular defense response	integral to plasma membrane	transmembrane receptor activity			ovary(1)	1	Ovarian(28;0.0327)|Colorectal(47;0.196)					ACAGTTGCTGacacacacacac	0.470													5	4	---	---	---	---	
ME1	4199	broad.mit.edu	37	6	84079375	84079390	+	Intron	DEL	GAAGGAAGGAAGGAAC	-	-	rs71872919		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84079375_84079390delGAAGGAAGGAAGGAAC	uc003pjy.2	-						ME1_uc011dzb.1_Intron|ME1_uc011dzc.1_Intron	NM_002395	NP_002386	P48163	MAOX_HUMAN	cytosolic malic enzyme 1						carbohydrate metabolic process|cellular lipid metabolic process|malate metabolic process|NADP biosynthetic process|response to carbohydrate stimulus|response to hormone stimulus	cytosol	ADP binding|electron carrier activity|malate dehydrogenase (oxaloacetate-decarboxylating) (NADP+) activity|manganese ion binding|NAD binding|NADP binding			upper_aerodigestive_tract(1)|ovary(1)	2		all_cancers(76;1.28e-06)|Acute lymphoblastic leukemia(125;5.03e-07)|all_hematologic(105;0.000238)|all_epithelial(107;0.00218)		BRCA - Breast invasive adenocarcinoma(397;0.0641)	NADH(DB00157)	ACAGAGAGaggaaggaaggaaggaacgaaggaagga	0.079													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	91601615	91601616	+	IGR	INS	-	AC	AC	rs146082625	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:91601615_91601616insAC								MAP3K7 (304708 upstream) : None (None downstream)																							GAAAAAAGGTAacacacacaca	0.262													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71041514	71041515	+	Intron	INS	-	TG	TG	rs35776950		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71041514_71041515insTG	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ttttttaactttgtgtgtgtgt	0.000													4	2	---	---	---	---	
CROT	54677	broad.mit.edu	37	7	87027922	87027923	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87027922_87027923delCA	uc003uit.2	+	18	2046_2047	c.1801_1802delCA	c.(1801-1803)CATfs	p.H601fs	CROT_uc003uiu.2_Frame_Shift_Del_p.H629fs	NM_021151	NP_066974	Q9UKG9	OCTC_HUMAN	peroxisomal carnitine O-octanoyltransferase	601					fatty acid beta-oxidation using acyl-CoA oxidase|generation of precursor metabolites and energy|transport	peroxisomal matrix	carnitine O-octanoyltransferase activity			ovary(2)|lung(1)	3	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TTGTGCTTTTCATGATATGATA	0.396													107	133	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	90076038	90076039	+	IGR	INS	-	CTTCCTTC	CTTCCTTC	rs149264284	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90076038_90076039insCTTCCTTC								CLDN12 (30772 upstream) : CDK14 (19699 downstream)																							ctttctctcttcttccttcctt	0.059													6	4	---	---	---	---	
HEPACAM2	253012	broad.mit.edu	37	7	92848753	92848754	+	Frame_Shift_Ins	INS	-	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92848753_92848754insA	uc003umm.2	-	2	113_114	c.90_91insT	c.(88-93)TCGGGGfs	p.S30fs	HEPACAM2_uc003uml.2_Frame_Shift_Ins_p.S18fs|HEPACAM2_uc010lff.2_Frame_Shift_Ins_p.S18fs|HEPACAM2_uc011khy.1_Frame_Shift_Ins_p.S53fs	NM_001039372	NP_001034461	A8MVW5	HECA2_HUMAN	HEPACAM family member 2 isoform 1	30_31			G -> R (in a breast cancer sample; somatic mutation).			integral to membrane		p.G19R(1)		ovary(3)|breast(1)|kidney(1)	5						ACCTTCAGCCCCGAGCAAGCAC	0.515													198	190	---	---	---	---	
COL1A2	1278	broad.mit.edu	37	7	94059919	94059920	+	3'UTR	INS	-	T	T	rs71754529		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:94059919_94059920insT	uc003ung.1	+	52					COL1A2_uc011kib.1_3'UTR	NM_000089	NP_000080	P08123	CO1A2_HUMAN	alpha 2 type I collagen precursor						axon guidance|blood vessel development|collagen fibril organization|leukocyte migration|odontogenesis|platelet activation|regulation of blood pressure|Rho protein signal transduction|skeletal system development|skin morphogenesis|transforming growth factor beta receptor signaling pathway	collagen type I|extracellular space|plasma membrane	extracellular matrix structural constituent|identical protein binding|platelet-derived growth factor binding|protein binding, bridging		COL1A2/PLAG1(3)	soft_tissue(3)|central_nervous_system(3)|ovary(2)|skin(1)	9	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AAAAATTTGAATTTTTTTTTCA	0.332										HNSCC(75;0.22)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	121243444	121243447	+	IGR	DEL	TTTT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121243444_121243447delTTTT								FAM3C (207022 upstream) : PTPRZ1 (269712 downstream)																							ctttcttttcttttccttccttcc	0.000													1	8	---	---	---	---	
CADPS2	93664	broad.mit.edu	37	7	122316892	122316893	+	Intron	INS	-	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122316892_122316893insT	uc010lkp.2	-						CADPS2_uc010lkq.2_Intron	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2						exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						TGGTGACAGTATTTTTTTTTTC	0.431													22	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125460585	125460585	+	IGR	DEL	G	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125460585delG								POT1 (890548 upstream) : GRM8 (618067 downstream)																							gaggaaggaaggaaggaagga	0.010													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143644098	143644099	+	IGR	INS	-	TG	TG	rs150839296	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143644098_143644099insTG								OR2F2 (10820 upstream) : OR2F1 (12058 downstream)																							ttccagggttctgtgtgtgtgt	0.000													4	2	---	---	---	---	
MLL3	58508	broad.mit.edu	37	7	152100795	152100802	+	Intron	DEL	ACACATAC	-	-	rs71273890	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152100795_152100802delACACATAC	uc003wla.2	-							NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3						intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		aaaaactgggacacatacacacacacac	0.000			N		medulloblastoma								5	4	---	---	---	---	
MYOM2	9172	broad.mit.edu	37	8	2047842	2047844	+	Intron	DEL	CTT	-	-	rs71993575		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2047842_2047844delCTT	uc003wpx.3	+						MYOM2_uc011kwi.1_Intron	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2						muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		tccttccttccttctttctttcc	0.123													6	4	---	---	---	---	
FGL1	2267	broad.mit.edu	37	8	17758463	17758463	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:17758463delT	uc003wye.2	-						FGL1_uc003wyd.2_Intron|FGL1_uc003wyf.2_Intron	NM_201553	NP_963847	Q08830	FGL1_HUMAN	fibrinogen-like 1 precursor						signal transduction	fibrinogen complex	receptor binding				0				Colorectal(111;0.0573)|COAD - Colon adenocarcinoma(73;0.215)		tctttctttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23380376	23380376	+	IGR	DEL	T	-	-	rs11777570	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23380376delT								ENTPD4 (65132 upstream) : SLC25A37 (5987 downstream)																							tctttctttctttccttcctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	30181786	30181789	+	IGR	DEL	AAGA	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30181786_30181789delAAGA								DCTN6 (140727 upstream) : RBPMS (60155 downstream)																							ggaaggaaggaagaaagaaagaaa	0.083													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	93538491	93538492	+	IGR	DEL	AC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93538491_93538492delAC								RUNX1T1 (430785 upstream) : C8orf83 (357373 downstream)																							tgccactggtacacacacacac	0.000													6	3	---	---	---	---	
C8orf83	286144	broad.mit.edu	37	8	93961854	93961857	+	Intron	DEL	AGGA	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93961854_93961857delAGGA	uc003yfk.3	-						C8orf83_uc003yfr.3_Intron|C8orf83_uc010map.2_Intron|C8orf83_uc003yfo.3_Intron|C8orf83_uc003yfn.3_Intron|C8orf83_uc003yfq.3_Intron|C8orf83_uc003yfl.3_Intron|C8orf83_uc003yfm.3_Intron	NR_015339		Q629K1	TRIQK_HUMAN	RecName: Full=UPF0599 protein C8orf83;							endoplasmic reticulum membrane|integral to membrane					0						ggagggagggaggaaggaaggaag	0.000													3	5	---	---	---	---	
CSMD3	114788	broad.mit.edu	37	8	113332151	113332151	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113332151delC	uc003ynu.2	-	46	7384	c.7225delG	c.(7225-7227)GAAfs	p.E2409fs	CSMD3_uc003yns.2_Frame_Shift_Del_p.E1611fs|CSMD3_uc003ynt.2_Frame_Shift_Del_p.E2369fs|CSMD3_uc011lhx.1_Frame_Shift_Del_p.E2305fs|CSMD3_uc003ynw.1_Frame_Shift_Del_p.E120fs	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2409	Extracellular (Potential).|Sushi 13.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						TCATCATCTTCCGTCAAAATT	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			157	195	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125759656	125759657	+	IGR	INS	-	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125759656_125759657insT								MTSS1 (18926 upstream) : LOC157381 (192227 downstream)																							ttttttctttctttctttctct	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	19383918	19383921	+	IGR	DEL	TTTG	-	-	rs111414173		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19383918_19383921delTTTG								RPS6 (3683 upstream) : ACER2 (13886 downstream)																							AAAAAAAAGATTtgtgtgtgtgtg	0.230													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	84030236	84030237	+	IGR	INS	-	GT	GT	rs149934022	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:84030236_84030237insGT								None (None upstream) : TLE1 (168363 downstream)																							TATATGAGCACgtgtgtgtgtg	0.238													3	4	---	---	---	---	
GOLM1	51280	broad.mit.edu	37	9	88650798	88650799	+	Intron	INS	-	A	A	rs12343088	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88650798_88650799insA	uc004aol.2	-						GOLM1_uc004aom.2_Intron	NM_016548	NP_057632	Q8NBJ4	GOLM1_HUMAN	golgi membrane protein 1							Golgi apparatus|integral to plasma membrane					0						aaaaacaaaacaaaaaaaaaaa	0.446													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	104211257	104211258	+	IGR	INS	-	GAAGGAAG	GAAGGAAG	rs144112817	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104211257_104211258insGAAGGAAG								ALDOB (13195 upstream) : C9orf125 (26351 downstream)																							aaagaaagaaagaaggaaggaa	0.000													4	3	---	---	---	---	
ANKRD30A	91074	broad.mit.edu	37	10	37440998	37440998	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37440998delC	uc001iza.1	+	12	1587	c.1488delC	c.(1486-1488)TTCfs	p.F496fs		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	552						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						ATCCGATGTTCCCACCAGAAT	0.284													85	37	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	67367527	67367528	+	IGR	INS	-	TTCT	TTCT			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:67367527_67367528insTTCT								ANXA2P3 (780893 upstream) : CTNNA3 (312197 downstream)																							tccttcttccctccctccctct	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	77089189	77089196	+	Intron	DEL	CTTCCTTT	-	-	rs4746286		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:77089189_77089196delCTTCCTTT	uc001jxd.1	+											Homo sapiens cDNA FLJ13383 fis, clone PLACE1001024.																		tccttccttccttcctttctttctttct	0.000													5	3	---	---	---	---	
PIK3AP1	118788	broad.mit.edu	37	10	98357029	98357036	+	Intron	DEL	TTCCTTCC	-	-	rs140576354	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98357029_98357036delTTCCTTCC	uc001kmq.2	-						PIK3AP1_uc001kmo.2_Intron|PIK3AP1_uc001kmp.2_Intron	NM_152309	NP_689522	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1							cytoplasm|plasma membrane				upper_aerodigestive_tract(3)|ovary(1)|skin(1)	5		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		ctttctttctttccttccttccttcctt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	42010511	42010512	+	IGR	INS	-	AA	AA			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:42010511_42010512insAA								LRRC4C (529188 upstream) : None (None downstream)																							aagaaagaaagaaagaaaagaa	0.153													4	2	---	---	---	---	
AMBRA1	55626	broad.mit.edu	37	11	46450139	46450140	+	Intron	INS	-	T	T	rs142253407	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46450139_46450140insT	uc010rgu.1	-						AMBRA1_uc010rgt.1_Intron|AMBRA1_uc009ylc.1_Intron|AMBRA1_uc001ncu.1_Intron|AMBRA1_uc001ncv.2_Intron|AMBRA1_uc001ncw.2_Intron|AMBRA1_uc001ncx.2_Intron	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated						autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		tcttcttcttcttctttttttt	0.376													10	6	---	---	---	---	
PLCB3	5331	broad.mit.edu	37	11	64035101	64035101	+	3'UTR	DEL	T	-	-	rs71789407		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64035101delT	uc009ypg.1	+	31					PLCB3_uc009yph.1_3'UTR|PLCB3_uc009ypi.2_Intron|GPR137_uc009ypj.1_5'Flank	NM_000932	NP_000923	Q01970	PLCB3_HUMAN	phospholipase C beta 3						intracellular signal transduction|lipid catabolic process|synaptic transmission	cytosol	calcium ion binding|calmodulin binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|pancreas(1)	2						ACACTAATGCttttttttttt	0.493													4	2	---	---	---	---	
GDPD5	81544	broad.mit.edu	37	11	75152589	75152590	+	Intron	DEL	GT	-	-	rs34643232		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:75152589_75152590delGT	uc001owo.3	-						GDPD5_uc001owp.3_Intron|GDPD5_uc001own.3_Intron|GDPD5_uc009yuc.2_Intron|GDPD5_uc009yud.2_Intron	NM_030792	NP_110419	Q8WTR4	GDPD5_HUMAN	glycerophosphodiester phosphodiesterase domain						glycerol metabolic process|lipid metabolic process|nervous system development	endomembrane system|growth cone|integral to membrane|perinuclear region of cytoplasm	glycerophosphodiester phosphodiesterase activity			ovary(1)	1						CTGCCCGACCgtgtgtgtgtgt	0.569													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	121859324	121859325	+	IGR	INS	-	AA	AA			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121859324_121859325insAA								SORL1 (354853 upstream) : LOC399959 (100486 downstream)																							aagaaagaaagagagaaagaaa	0.000													6	3	---	---	---	---	
OPCML	4978	broad.mit.edu	37	11	133120327	133120327	+	Intron	DEL	A	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:133120327delA	uc001qgu.2	-							NM_001012393	NP_001012393	Q14982	OPCM_HUMAN	opioid binding protein/cell adhesion						cell adhesion|neuron recognition	anchored to membrane|integral to plasma membrane	opioid receptor activity			ovary(2)|skin(1)	3	all_hematologic(175;0.019)	all_cancers(12;5.86e-24)|all_epithelial(12;2.65e-17)|all_lung(97;2.89e-05)|Lung NSC(97;6.16e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0269)|all_neural(223;0.0326)|Esophageal squamous(93;0.129)		all cancers(11;4.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.012)		ggaaagaaggaaggaaggaag	0.000													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2681795	2681796	+	Intron	INS	-	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2681795_2681796insT	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	tcctcctcctctcctcctcctt	0.000													4	2	---	---	---	---	
CLSTN3	9746	broad.mit.edu	37	12	7295314	7295315	+	Intron	INS	-	TT	TT			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7295314_7295315insTT	uc001qsr.2	+						CLSTN3_uc001qss.2_Intron	NM_014718	NP_055533	Q9BQT9	CSTN3_HUMAN	calsyntenin 3 precursor						homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			large_intestine(1)	1						ctCttttttccttttttttttt	0.030											OREG0021650	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	3	---	---	---	---	
OLR1	4973	broad.mit.edu	37	12	10311911	10311912	+	3'UTR	DEL	TC	-	-	rs58628154		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10311911_10311912delTC	uc001qxo.1	-	6					OLR1_uc010sgz.1_3'UTR|OLR1_uc010sha.1_3'UTR	NM_002543	NP_002534	P78380	OLR1_HUMAN	oxidized low density lipoprotein (lectin-like)						blood circulation|blood coagulation|inflammatory response|leukocyte migration|proteolysis	extracellular region|integral to plasma membrane|membrane fraction	sugar binding			ovary(1)	1						tgtgtgtgtgtctgtctgtctg	0.312													6	3	---	---	---	---	
KIF21A	55605	broad.mit.edu	37	12	39757027	39757030	+	Intron	DEL	AGAA	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39757027_39757030delAGAA	uc001rly.2	-						KIF21A_uc001rlx.2_Intron|KIF21A_uc001rlz.2_Intron|KIF21A_uc010skl.1_Intron|KIF21A_uc001rma.1_Intron	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A						microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TAAAAGAAAGAGAAAGAAAGACAG	0.314													94	56	---	---	---	---	
SP7	121340	broad.mit.edu	37	12	53728116	53728127	+	Intron	DEL	ACACACACACAC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53728116_53728127delACACACACACAC	uc001sct.2	-						SP7_uc001scu.2_Intron|SP7_uc001scv.2_Intron	NM_152860	NP_690599	Q8TDD2	SP7_HUMAN	osterix						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GGCCCAACTTacacacacacacacacacacac	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	122140329	122140330	+	IGR	DEL	AC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122140329_122140330delAC								MORN3 (29792 upstream) : TMEM120B (10328 downstream)																							taatgcatgtacacacacacac	0.119													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	31591168	31591171	+	IGR	DEL	TCCT	-	-	rs56131851		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31591168_31591171delTCCT								C13orf26 (42017 upstream) : HSPH1 (119594 downstream)																							cttccctccctccttccttccttc	0.167													4	2	---	---	---	---	
BRCA2	675	broad.mit.edu	37	13	32950658	32950659	+	Intron	INS	-	A	A			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32950658_32950659insA	uc001uub.1	+							NM_000059	NP_000050	P51587	BRCA2_HUMAN	breast cancer 2, early onset						cell cycle cytokinesis|centrosome duplication|double-strand break repair via homologous recombination|negative regulation of mammary gland epithelial cell proliferation|nucleotide-excision repair|positive regulation of transcription, DNA-dependent|regulation of S phase of mitotic cell cycle	BRCA2-MAGE-D1 complex|centrosome|nucleoplasm|stored secretory granule	gamma-tubulin binding|H3 histone acetyltransferase activity|H4 histone acetyltransferase activity|protease binding|single-stranded DNA binding			ovary(20)|endometrium(8)|lung(7)|breast(7)|oesophagus(5)|large_intestine(4)|central_nervous_system(3)|pancreas(3)|skin(2)|upper_aerodigestive_tract(1)|cervix(1)|salivary_gland(1)|liver(1)|kidney(1)	64		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		gaccctgtctcaaaaaaaaaaa	0.124			D|Mis|N|F|S		breast|ovarian|pancreatic	breast|ovarian|pancreatic|leukemia  (FANCB|FANCD1)		Direct_reversal_of_damage|Homologous_recombination	Fanconi_Anemia_type_D1_bi-allelic_BRCA2_mutations|Fanconi_Anemia|Pancreatic_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_BRCA2_type|Hereditary_Prostate_Cancer|Li-Fraumeni_syndrome	TCGA Ovarian(8;0.087)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	81753657	81753658	+	IGR	INS	-	TGTG	TGTG	rs36126584		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:81753657_81753658insTGTG								SPRY2 (838571 upstream) : None (None downstream)																							ATGGGTGCTTTtgtgtgtgtgt	0.238													4	2	---	---	---	---	
ACOT2	10965	broad.mit.edu	37	14	74036674	74036675	+	Intron	INS	-	C	C	rs139052625	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036674_74036675insC	uc001xon.3	+						ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2						acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		TTATGTGTATgcccccccgccg	0.272													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	84258839	84258840	+	IGR	INS	-	T	T	rs60252900		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:84258839_84258840insT								None (None upstream) : None (None downstream)																							ttctttctttctttctttcttt	0.139													4	3	---	---	---	---	
KIAA1409	57578	broad.mit.edu	37	14	94065700	94065701	+	Intron	DEL	GT	-	-	rs138845262		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94065700_94065701delGT	uc001ybv.1	+						KIAA1409_uc001ybs.1_Intron	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578							integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		ACATACTTAAgtgtgtgtgtgt	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22490714	22490715	+	IGR	DEL	TC	-	-	rs28582454	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490714_22490715delTC								OR4N3P (76329 upstream) : MIR1268 (22514 downstream)																							TCCTGGTGAGTCACACAACGAG	0.495													4	3	---	---	---	---	
NUSAP1	51203	broad.mit.edu	37	15	41663386	41663388	+	Intron	DEL	GGA	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41663386_41663388delGGA	uc001zns.3	+						NUSAP1_uc001znq.3_Intron|NUSAP1_uc001znr.3_Intron|NUSAP1_uc010bce.2_Intron|NUSAP1_uc001znt.3_Intron|NUSAP1_uc001znv.3_Intron|NUSAP1_uc001znu.3_Intron|NUSAP1_uc010ucw.1_Intron|NUSAP1_uc001znw.3_Intron	NM_016359	NP_057443	Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1						cytokinesis after mitosis|establishment of mitotic spindle localization|mitotic chromosome condensation|positive regulation of mitosis	chromosome|cytoplasm|nucleolus	DNA binding				0		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		CCCCTAACCTggaggaggaggag	0.389													4	2	---	---	---	---	
PARN	5073	broad.mit.edu	37	16	14700252	14700252	+	Intron	DEL	G	-	-	rs62037478		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14700252delG	uc010uzd.1	-						PARN_uc010uzc.1_Intron|PARN_uc010uze.1_Intron|PARN_uc010uzf.1_Intron|PARN_uc010uzg.1_Intron	NM_002582	NP_002573	O95453	PARN_HUMAN	poly(A)-specific ribonuclease (deadenylation						female gamete generation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|RNA modification	cytosol|nucleolus	metal ion binding|mRNA 3'-UTR binding|nucleotide binding|poly(A)-specific ribonuclease activity|protein binding			ovary(2)	2						aagaccctgagggaaaaaaaa	0.139													5	4	---	---	---	---	
MT1A	4489	broad.mit.edu	37	16	56673436	56673437	+	Intron	INS	-	AG	AG	rs149759075	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56673436_56673437insAG	uc002ejq.2	+						MT1A_uc002eji.2_Intron	NM_005946	NP_005937	P04731	MT1A_HUMAN	metallothionein 1A							cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						AACTGAGGCCAAGAGTGCACCA	0.505													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6464640	6464641	+	IGR	INS	-	CTC	CTC	rs143155894	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6464640_6464641insCTC								PITPNM3 (4763 upstream) : KIAA0753 (17005 downstream)																							tcttcctccttctcttctttct	0.000													13	6	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7578195	7578197	+	In_Frame_Del	DEL	CAC	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578195_7578197delCAC	uc002gim.2	-	6	846_848	c.652_654delGTG	c.(652-654)GTGdel	p.V218del	TP53_uc002gig.1_In_Frame_Del_p.V218del|TP53_uc002gih.2_In_Frame_Del_p.V218del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.V86del|TP53_uc010cng.1_In_Frame_Del_p.V86del|TP53_uc002gii.1_In_Frame_Del_p.V86del|TP53_uc010cnh.1_In_Frame_Del_p.V218del|TP53_uc010cni.1_In_Frame_Del_p.V218del|TP53_uc002gij.2_In_Frame_Del_p.V218del|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_In_Frame_Del_p.V125del|TP53_uc002gio.2_In_Frame_Del_p.V86del|TP53_uc010vug.1_In_Frame_Del_p.V179del	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	218	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> A (in sporadic cancers; somatic mutation).|V -> M (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> E (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V218E(8)|p.V218M(7)|p.0?(7)|p.V218G(5)|p.V218del(5)|p.V218A(3)|p.K164_P219del(1)|p.S215fs*27(1)|p.S215fs*29(1)|p.V218_P219insX(1)|p.V218_Y220delVPY(1)|p.V216_Y220delVVVPY(1)|p.D208fs*1(1)|p.V216fs*28(1)|p.?(1)|p.V218L(1)|p.V218_E221delVPYE(1)|p.V218V(1)|p.V218fs*26(1)|p.S215_V218>R(1)|p.T211fs*28(1)|p.V218_E224delVPYEPPE(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GCTCATAGGGCACCACCACACTA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			25	45	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	15708346	15708347	+	IGR	INS	-	T	T			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15708346_15708347insT								MEIS3P1 (15329 upstream) : ADORA2B (139884 downstream)																							tccttccttccttccttccttc	0.099													6	3	---	---	---	---	
NOS2	4843	broad.mit.edu	37	17	26115222	26115223	+	Intron	INS	-	CACA	CACA	rs138491079	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26115222_26115223insCACA	uc002gzu.2	-						NOS2_uc010crh.1_Intron|NOS2_uc010wab.1_Intron	NM_000625	NP_000616	P35228	NOS2_HUMAN	nitric oxide synthase 2A						arginine catabolic process|defense response to Gram-negative bacterium|innate immune response in mucosa|nitric oxide biosynthetic process|peptidyl-cysteine S-nitrosylation|platelet activation|positive regulation of killing of cells of other organism|positive regulation of leukocyte mediated cytotoxicity|regulation of cellular respiration|regulation of insulin secretion|superoxide metabolic process	cytosol|nucleus	arginine binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|protein homodimerization activity|tetrahydrobiopterin binding			skin(2)|ovary(1)|breast(1)	4					Dexamethasone(DB01234)|Hydrocortisone(DB00741)|L-Arginine(DB00125)|L-Citrulline(DB00155)	Gcacacgcgtgcacacacacac	0.347													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36575824	36575827	+	IGR	DEL	CACA	-	-	rs72397128		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36575824_36575827delCACA								SOCS7 (19807 upstream) : ARHGAP23 (37817 downstream)																							ACACAGAGCTcacacacacacaca	0.544													4	2	---	---	---	---	
SRCIN1	80725	broad.mit.edu	37	17	36696976	36696977	+	Intron	DEL	GT	-	-	rs67872749		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36696976_36696977delGT	uc002hqd.2	-							NM_025248	NP_079524	Q9C0H9	SRCN1_HUMAN	SNAP25-interacting protein						exocytosis|negative regulation of protein tyrosine kinase activity|positive regulation of protein tyrosine kinase activity|regulation of cell migration|regulation of dendritic spine morphogenesis|substrate adhesion-dependent cell spreading	actin cytoskeleton|axon|cell junction|cytoplasm|dendrite|postsynaptic density|postsynaptic membrane	protein kinase binding				0						GCTGGCAGGGgtgtgtgtgtgt	0.465													3	3	---	---	---	---	
SPOP	8405	broad.mit.edu	37	17	47700373	47700373	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47700373delT	uc010dbk.2	-						SPOP_uc002ipb.2_Intron|SPOP_uc002ipc.2_Intron|SPOP_uc002ipd.2_Intron|SPOP_uc002ipe.2_Intron|SPOP_uc002ipf.2_Intron|SPOP_uc002ipg.2_Intron|SPOP_uc010wlx.1_Intron	NM_003563	NP_003554	O43791	SPOP_HUMAN	speckle-type POZ protein						mRNA processing	nucleus	protein binding			prostate(2)|ovary(2)|lung(2)	6						GGTCCTAAAAttttttttttt	0.194										Prostate(2;0.17)			5	3	---	---	---	---	
SLC35B1	10237	broad.mit.edu	37	17	47783728	47783728	+	Intron	DEL	G	-	-	rs138147992		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47783728delG	uc002iph.1	-						SLC35B1_uc002ipi.1_Intron|SLC35B1_uc002ipj.1_Intron|SLC35B1_uc010wly.1_Intron	NM_005827	NP_005818	P78383	S35B1_HUMAN	solute carrier family 35, member B1							endoplasmic reticulum membrane|integral to membrane|microsome	UDP-galactose transmembrane transporter activity				0						aaaaaaaaaagaaaagaaaag	0.378													22	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	52302407	52302408	+	IGR	DEL	AC	-	-	rs111773394		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52302407_52302408delAC								KIF2B (399834 upstream) : TOM1L1 (675644 downstream)																							CACATGCAAAacacacacacac	0.297													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025826	64025829	+	Intron	DEL	AAAC	-	-	rs67867456		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025826_64025829delAAAC	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gtctctaaataaacaaacaaacaa	0.123													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	69497761	69497764	+	IGR	DEL	ACAC	-	-	rs35698370		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:69497761_69497764delACAC								None (None upstream) : SOX9 (619397 downstream)																							TTTTCTacagacacacacacacac	0.250													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3568335	3568335	+	IGR	DEL	T	-	-	rs112290116		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3568335delT								C19orf28 (10764 upstream) : HMG20B (4608 downstream)																							GTTAAAAAAAttttttttttt	0.159													6	3	---	---	---	---	
HNRNPM	4670	broad.mit.edu	37	19	8538907	8538907	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8538907delT	uc010dwe.2	+						HNRNPM_uc010dwc.1_Intron|HNRNPM_uc010xke.1_Intron|HNRNPM_uc010dwd.2_Intron|HNRNPM_uc002mka.2_Intron	NM_005968	NP_005959	P52272	HNRPM_HUMAN	heterogeneous nuclear ribonucleoprotein M						alternative nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|integral to plasma membrane|nuclear matrix|nucleolus|paraspeckles	nucleotide binding|protein domain specific binding|RNA binding				0						GGTGCTAGCATTTTTTTTGTT	0.234													11	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42107414	42107415	+	IGR	DEL	CA	-	-	rs72172011		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42107414_42107415delCA								CEACAM21 (14218 upstream) : CEACAM4 (17929 downstream)																							Gacacgcacgcacgcgcgcgcg	0.183													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	19831702	19831705	+	IGR	DEL	AAGG	-	-	rs145309073	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19831702_19831705delAAGG								SLC24A3 (128162 upstream) : RIN2 (38505 downstream)																							aggagaaagaaaggaaggaaggaa	0.098													3	3	---	---	---	---	
VSX1	30813	broad.mit.edu	37	20	25059184	25059184	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25059184delT	uc002wuf.2	-						VSX1_uc002wue.2_Intron|VSX1_uc010gdd.1_Intron|VSX1_uc010gde.1_Intron|VSX1_uc010gdf.1_Intron	NM_014588	NP_055403	Q9NZR4	VSX1_HUMAN	visual system homeobox 1 isoform a						response to stimulus|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AGGTAGTCTCTTTTTTTTTTT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31551839	31551841	+	IGR	DEL	CTC	-	-	rs58506386		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31551839_31551841delCTC								MAPRE1 (113629 upstream) : SUN5 (19741 downstream)																							ccttcttcttctccttcttctca	0.000													4	2	---	---	---	---	
ZNF341	84905	broad.mit.edu	37	20	32371883	32371900	+	Intron	DEL	TCCTCCTCCCCATCTCCT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32371883_32371900delTCCTCCTCCCCATCTCCT	uc002wzy.2	+						ZNF341_uc002wzx.2_Intron|ZNF341_uc010geq.2_Intron|ZNF341_uc010ger.2_Intron	NM_032819	NP_116208	Q9BYN7	ZN341_HUMAN	zinc finger protein 341						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						cccatctccctcctcctccccatctccttcctcctccc	0.037													1	6	---	---	---	---	
RBL1	5933	broad.mit.edu	37	20	35646023	35646024	+	Intron	INS	-	TG	TG	rs147347259	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35646023_35646024insTG	uc002xgi.2	-						RBL1_uc010zvt.1_Intron|RBL1_uc002xgj.1_Intron	NM_002895	NP_002886	P28749	RBL1_HUMAN	retinoblastoma-like protein 1 isoform a						cell cycle|chromatin modification|interspecies interaction between organisms|regulation of cell cycle|regulation of lipid kinase activity|transcription, DNA-dependent		transcription factor binding			lung(5)|skin(3)|ovary(2)	10		Myeloproliferative disorder(115;0.00878)				GGACATTTTCTtgtgtgtgtgt	0.208													3	5	---	---	---	---	
SLC13A3	64849	broad.mit.edu	37	20	45228952	45228953	+	Intron	INS	-	GGAAGGAA	GGAAGGAA	rs144741251	by1000genomes	TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45228952_45228953insGGAAGGAA	uc002xsf.1	-						SLC13A3_uc010ghn.1_Intron|SLC13A3_uc010zxw.1_Intron|SLC13A3_uc002xsg.1_Intron|SLC13A3_uc010gho.1_Intron|SLC13A3_uc010zxx.1_Intron	NM_022829	NP_073740	Q8WWT9	S13A3_HUMAN	solute carrier family 13 member 3 isoform a							integral to membrane|plasma membrane	high affinity sodium:dicarboxylate symporter activity			ovary(1)	1		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	gaaagaaagagggaaggaagga	0.000													3	3	---	---	---	---	
MC3R	4159	broad.mit.edu	37	20	54823995	54823995	+	Frame_Shift_Del	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54823995delC	uc002xxb.2	+	1	208	c.96delC	c.(94-96)AGCfs	p.S32fs		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	69	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			AGAGCAGCAGCGCCTTCTGTG	0.562													195	86	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16244063	16244064	+	IGR	DEL	GT	-	-	rs67059536		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16244063_16244064delGT								SAMSN1 (288340 upstream) : NRIP1 (89492 downstream)																							gttcaggtcagtgtgtgtgtgt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	20336975	20336976	+	IGR	DEL	CA	-	-	rs111985464		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:20336975_20336976delCA								TMPRSS15 (561005 upstream) : None (None downstream)																							atggtctcaccacacacacaca	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	34527501	34527502	+	IGR	INS	-	AG	AG			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34527501_34527502insAG								OLIG1 (82774 upstream) : C21orf54 (10275 downstream)																							aagagagagaaagagagagaaa	0.000													4	2	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37619142	37619156	+	Intron	DEL	TTATGTTATGTTATG	-	-	rs67162183		TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37619142_37619156delTTATGTTATGTTATG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron|DOPEY2_uc002yvh.2_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TTCTGATCCAttatgttatgttatgttatgttatg	0.205													4	3	---	---	---	---	
TTC3	7267	broad.mit.edu	37	21	38536643	38536643	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:38536643delT	uc002yvz.2	+						TTC3_uc011aee.1_Intron|TTC3_uc002ywa.2_Intron|TTC3_uc002ywb.2_Intron|TTC3_uc010gnf.2_Intron|TTC3_uc002ywc.2_Intron|TTC3_uc002ywd.1_Intron	NM_001001894	NP_001001894	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3						protein K48-linked ubiquitination|ubiquitin-dependent protein catabolic process	nucleus	protein binding|ubiquitin-protein ligase activity|zinc ion binding			skin(3)|ovary(2)|lung(2)|breast(2)	9		Myeloproliferative disorder(46;0.0412)				TAATTTAGGAttttttttttt	0.144													4	2	---	---	---	---	
PFKL	5211	broad.mit.edu	37	21	45743627	45743627	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45743627delT	uc002zel.2	+						PFKL_uc002zek.2_Intron|PFKL_uc002zem.2_Intron|PFKL_uc002zen.2_Intron	NM_002626	NP_002617	P17858	K6PL_HUMAN	liver phosphofructokinase						fructose 6-phosphate metabolic process|glycolysis|protein oligomerization	6-phosphofructokinase complex	6-phosphofructokinase activity|ATP binding|fructose-6-phosphate binding|identical protein binding|kinase binding|metal ion binding				0				Colorectal(79;0.0811)		GCCCTTGACCTGCCCCGTCCC	0.692													7	10	---	---	---	---	
MKL1	57591	broad.mit.edu	37	22	40984032	40984033	+	Intron	DEL	TT	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40984032_40984033delTT	uc003ayw.1	-						MKL1_uc010gye.1_Intron|MKL1_uc010gyf.1_Intron|MKL1_uc003ayy.1_Intron	NM_020831	NP_065882	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia 1 protein						positive regulation of transcription from RNA polymerase II promoter|smooth muscle cell differentiation|transcription, DNA-dependent	cytoplasm|nucleus	actin monomer binding|leucine zipper domain binding|nucleic acid binding|transcription coactivator activity			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5						CACTCCAACAtttttttttttt	0.228			T	RBM15	acute megakaryocytic leukemia								4	2	---	---	---	---	
IL13RA2	3598	broad.mit.edu	37	X	114242454	114242454	+	Intron	DEL	C	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114242454delC	uc004epx.2	-						IL13RA2_uc010nqd.1_Intron	NM_000640	NP_000631	Q14627	I13R2_HUMAN	interleukin 13 receptor, alpha 2 precursor							extracellular space|integral to membrane|soluble fraction	cytokine receptor activity			upper_aerodigestive_tract(1)|ovary(1)|lung(1)	3						ATTTTGCTAGCAAAGAGCTCA	0.353													35	124	---	---	---	---	
PHF6	84295	broad.mit.edu	37	X	133528164	133528164	+	Intron	DEL	T	-	-			TCGA-37-4133-01	TCGA-37-4133-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133528164delT	uc004exj.2	+						PHF6_uc004exk.2_Intron|PHF6_uc011mvk.1_Intron|PHF6_uc004exh.2_Intron|PHF6_uc010nrr.2_Intron|PHF6_uc004exi.2_Intron	NM_001015877	NP_001015877	Q8IWS0	PHF6_HUMAN	PHD finger protein 6 isoform 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TCTGAACttcttttttttttt	0.139													5	3	---	---	---	---	
