Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PADI2	11240	broad.mit.edu	37	1	17422416	17422416	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17422416G>T	uc001baf.2	-	4	481	c.399C>A	c.(397-399)AAC>AAA	p.N133K	PADI2_uc010ocm.1_Missense_Mutation_p.N133K|PADI2_uc001bag.1_Missense_Mutation_p.N133K	NM_007365	NP_031391	Q9Y2J8	PADI2_HUMAN	peptidyl arginine deiminase, type II	133					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity			ovary(3)|pancreas(1)|central_nervous_system(1)|skin(1)	6		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000422)|Renal(390;0.000518)|all_lung(284;0.000546)|Ovarian(437;0.00671)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00583)|BRCA - Breast invasive adenocarcinoma(304;1.49e-05)|COAD - Colon adenocarcinoma(227;1.54e-05)|Kidney(64;0.000258)|KIRC - Kidney renal clear cell carcinoma(64;0.00348)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0698)|Lung(427;0.201)	L-Citrulline(DB00155)	TCTTTGGGTTGTTCTTCTCCA	0.602													74	103	---	---	---	---	PASS
TRIM63	84676	broad.mit.edu	37	1	26387836	26387836	+	Intron	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26387836G>A	uc001bli.1	-							NM_032588	NP_115977	Q969Q1	TRI63_HUMAN	muscle specific ring finger protein 1							cytoplasm|microtubule|nucleus	ligase activity|signal transducer activity|titin binding|zinc ion binding			kidney(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		CTGCAGTGGAGAACAGTCACA	0.468													18	26	---	---	---	---	PASS
TTC22	55001	broad.mit.edu	37	1	55252623	55252623	+	Intron	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55252623C>A	uc009vzt.1	-						TTC22_uc001cxz.3_Intron	NM_001114108	NP_001107580	Q5TAA0	TTC22_HUMAN	tetratricopeptide repeat domain 22 isoform 1								binding				0						TGGCTGGGGGCAAGTACCTTG	0.632													5	22	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86905984	86905984	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86905984C>A	uc001dlr.3	+	8	1519	c.1357C>A	c.(1357-1359)CTG>ATG	p.L453M		NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor	453	VWFA.|Extracellular (Potential).				cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		AGCCCCAAATCTGGAGGAATT	0.423													5	66	---	---	---	---	PASS
LPPR5	163404	broad.mit.edu	37	1	99470041	99470041	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:99470041C>A	uc001dsb.2	-	1	409	c.187G>T	c.(187-189)GTG>TTG	p.V63L	uc001dsd.1_RNA|LPPR5_uc001dsc.2_Missense_Mutation_p.V63L	NM_001037317	NP_001032394	Q32ZL2	LPPR5_HUMAN	phosphatidic acid phosphatase type 2d isoform 1	63	Helical; (Potential).					integral to membrane	hydrolase activity				0						ACGGGGGGCACGGCGCTGCTG	0.697													13	28	---	---	---	---	PASS
SYCP1	6847	broad.mit.edu	37	1	115420804	115420804	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115420804T>A	uc001efr.2	+	12	1100	c.891T>A	c.(889-891)AAT>AAA	p.N297K	SYCP1_uc010owt.1_RNA|SYCP1_uc001efq.2_Missense_Mutation_p.N297K|SYCP1_uc009wgw.2_Missense_Mutation_p.N297K	NM_003176	NP_003167	Q15431	SYCP1_HUMAN	synaptonemal complex protein 1	297	Potential.				cell division|reciprocal meiotic recombination|spermatogenesis|synaptonemal complex assembly		DNA binding			skin(1)	1	Lung SC(450;0.211)	all_cancers(81;8.65e-08)|all_epithelial(167;3.32e-07)|all_lung(203;6.55e-06)|Lung NSC(69;1.11e-05)|Acute lymphoblastic leukemia(138;0.221)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATAAAGTTAATCAATTAGAGG	0.269													8	73	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152278012	152278012	+	Missense_Mutation	SNP	C	A	A	rs112911439		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152278012C>A	uc001ezu.1	-	3	9386	c.9350G>T	c.(9349-9351)AGC>ATC	p.S3117I		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	3117	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCTCCTCTGCTTGACCCCGG	0.582									Ichthyosis				195	138	---	---	---	---	PASS
HAX1	10456	broad.mit.edu	37	1	154245822	154245822	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154245822C>T	uc001fes.2	+	2	225	c.64C>T	c.(64-66)CCC>TCC	p.P22S	HAX1_uc001fet.2_Intron|HAX1_uc010peo.1_Missense_Mutation_p.P22S|HAX1_uc009wou.2_5'UTR|HAX1_uc009wov.2_5'UTR	NM_006118	NP_006109	O00165	HAX1_HUMAN	HCLS1 associated protein X-1 isoform a	22	Required for localization in mitochondria (By similarity).					actin cytoskeleton|cytoplasmic membrane-bounded vesicle|lamellipodium|mitochondrion|nuclear membrane|sarcoplasmic reticulum|soluble fraction	interleukin-1 binding|protein N-terminus binding				0	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCACAGAGATCCCTTTTTTGG	0.488									Kostmann_syndrome				5	125	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158669893	158669893	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158669893G>A	uc001fsu.1	-	1	550	c.550C>T	c.(550-552)CTG>TTG	p.L184L		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	184	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					GCCAGACGCAGCACTGGGAGG	0.478													25	62	---	---	---	---	PASS
OR6K2	81448	broad.mit.edu	37	1	158670088	158670088	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158670088A>T	uc001fsu.1	-	1	355	c.355T>A	c.(355-357)TTT>ATT	p.F119I		NM_001005279	NP_001005279	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K,	119	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_hematologic(112;0.0378)					TAGTGGTCAAAGGCCATAACT	0.473													26	43	---	---	---	---	PASS
DARC	2532	broad.mit.edu	37	1	159175750	159175750	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159175750G>T	uc001fto.2	+	2	761	c.521G>T	c.(520-522)TGG>TTG	p.W174L	DARC_uc001ftp.3_Missense_Mutation_p.W176L	NM_002036	NP_002027	Q16570	DUFFY_HUMAN	Duffy blood group antigen isoform b	174	Helical; Name=4; (Potential).				defense response	integral to membrane|plasma membrane	C-C chemokine binding|chemokine receptor activity			ovary(1)|lung(1)	2	all_hematologic(112;0.0429)					GTGGGAATTTGGGGAGTGGCT	0.622													3	44	---	---	---	---	PASS
USP21	27005	broad.mit.edu	37	1	161134051	161134051	+	Intron	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161134051G>T	uc010pke.1	+						USP21_uc010pkc.1_Intron|USP21_uc010pkd.1_Intron|USP21_uc010pkf.1_Intron|PPOX_uc001fyj.2_5'Flank|PPOX_uc001fyn.2_5'Flank|PPOX_uc001fyg.2_5'Flank|PPOX_uc001fyl.2_5'Flank|PPOX_uc001fym.2_5'Flank|PPOX_uc001fyk.2_5'Flank|PPOX_uc001fyh.2_5'Flank|PPOX_uc010pkg.1_5'Flank|PPOX_uc009wuc.1_5'Flank|PPOX_uc010pkh.1_5'Flank|PPOX_uc001fyi.2_5'Flank	NM_001014443	NP_001014443	Q9UK80	UBP21_HUMAN	ubiquitin-specific protease 21						histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)|prostate(1)|breast(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			GTATGTGGAGGTTCACAAGGG	0.468													10	84	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097527	167097527	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097527G>T	uc001geb.1	+	5	3159	c.3159G>T	c.(3157-3159)GAG>GAT	p.E1053D		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1053					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						AAAGGGAAGAGTCCCCAGAAC	0.562													20	41	---	---	---	---	PASS
SELE	6401	broad.mit.edu	37	1	169702053	169702053	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169702053G>C	uc001ggm.3	-	3	281	c.124C>G	c.(124-126)CAA>GAA	p.Q42E	C1orf112_uc001ggj.2_Intron	NM_000450	NP_000441	P16581	LYAM2_HUMAN	selectin E precursor	42	Extracellular (Potential).|C-type lectin.				actin filament-based process|activation of phospholipase C activity|calcium-mediated signaling|heterophilic cell-cell adhesion|leukocyte migration involved in inflammatory response|leukocyte tethering or rolling|positive regulation of receptor internalization|regulation of inflammatory response|response to interleukin-1|response to lipopolysaccharide|response to tumor necrosis factor	caveola|coated pit|cortical cytoskeleton|extracellular space|integral to membrane|perinuclear region of cytoplasm	oligosaccharide binding|phospholipase binding|sialic acid binding|transmembrane receptor activity			ovary(3)|skin(2)	5	all_hematologic(923;0.208)					GTGTACCTTTGCTGACAATAA	0.418													30	60	---	---	---	---	PASS
MYOC	4653	broad.mit.edu	37	1	171621272	171621272	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171621272C>T	uc001ghu.2	-	1	502	c.480G>A	c.(478-480)AGG>AGA	p.R160R	MYOC_uc010pmk.1_Silent_p.R102R	NM_000261	NP_000252	Q99972	MYOC_HUMAN	myocilin precursor	160	Potential.				anatomical structure morphogenesis	cilium|extracellular space|rough endoplasmic reticulum	structural molecule activity			lung(1)	1	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					CATTTTCTTGCCTTAGTCGCT	0.567													34	349	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	179965809	179965809	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179965809G>T	uc001gnt.2	+	6	900	c.517G>T	c.(517-519)GAA>TAA	p.E173*	CEP350_uc001gnr.1_Nonsense_Mutation_p.E147*|CEP350_uc009wxl.2_Nonsense_Mutation_p.E172*|CEP350_uc001gnu.2_Nonsense_Mutation_p.E7*	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	173						centrosome|nucleus|spindle				ovary(4)	4						CAGTCGAGAAGAACGGAATAT	0.403													6	27	---	---	---	---	PASS
CDC73	79577	broad.mit.edu	37	1	193218963	193218963	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193218963T>C	uc001gtb.2	+	16	1764	c.1521T>C	c.(1519-1521)GAT>GAC	p.D507D		NM_024529	NP_078805	Q6P1J9	CDC73_HUMAN	parafibromin	507					cell cycle|histone H2B ubiquitination|histone monoubiquitination|transcription, DNA-dependent	Cdc73/Paf1 complex	protein binding			parathyroid(46)|ovary(1)|breast(1)|pancreas(1)	49						GTCATTTGGATAGACCAGTGT	0.363									Hyperparathyroidism_Familial_Isolated|Hyperparathyroidism-Jaw_Tumor_Syndrome				3	29	---	---	---	---	PASS
PTPRC	5788	broad.mit.edu	37	1	198721755	198721755	+	Silent	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:198721755A>G	uc001gur.1	+	31	3537	c.3357A>G	c.(3355-3357)CAA>CAG	p.Q1119Q	PTPRC_uc001gus.1_Silent_p.Q1071Q|PTPRC_uc001gut.1_Silent_p.Q958Q	NM_002838	NP_002829	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	1119	Tyrosine-protein phosphatase 2.|Cytoplasmic (Potential).				axon guidance|B cell proliferation|B cell receptor signaling pathway|defense response to virus|immunoglobulin biosynthetic process|negative regulation of cytokine-mediated signaling pathway|negative regulation of protein kinase activity|negative regulation of T cell mediated cytotoxicity|positive regulation of antigen receptor-mediated signaling pathway|positive regulation of B cell proliferation|positive regulation of protein kinase activity|positive regulation of T cell proliferation|regulation of S phase|release of sequestered calcium ion into cytosol|T cell differentiation|T cell receptor signaling pathway	focal adhesion|integral to plasma membrane|membrane raft	protein kinase binding|transmembrane receptor protein tyrosine phosphatase activity			breast(4)|skin(3)|ovary(2)|lung(1)|kidney(1)|pancreas(1)	12						ACCAGTACCAATATACAAACT	0.393													9	15	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207680060	207680060	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207680060T>C	uc001hfy.2	+	3	443	c.303T>C	c.(301-303)CGT>CGC	p.R101R	CR1_uc009xcl.1_Silent_p.R101R|CR1_uc001hfx.2_Silent_p.R101R|CR1_uc010psg.1_Silent_p.R101R|CR1_uc009xcj.1_Silent_p.R101R|CR1_uc009xck.1_Silent_p.R101R	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	101	Sushi 1.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						TTCCTGTAGGTAAATCATGTC	0.393													11	76	---	---	---	---	PASS
FAM71A	149647	broad.mit.edu	37	1	212798756	212798756	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212798756G>T	uc001hjk.2	+	1	941	c.537G>T	c.(535-537)GAG>GAT	p.E179D	uc010pth.1_RNA	NM_153606	NP_705834	Q8IYT1	FA71A_HUMAN	hypothetical protein LOC149647	179										skin(3)|ovary(1)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		CACCCATGGAGAGTAACAGCA	0.507													20	209	---	---	---	---	PASS
PROX1	5629	broad.mit.edu	37	1	214209146	214209146	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214209146C>T	uc001hkh.2	+	5	2455	c.2183C>T	c.(2182-2184)CCG>CTG	p.P728L		NM_002763	NP_002754	Q92786	PROX1_HUMAN	prospero homeobox 1	728	Prospero-like.				aorta smooth muscle tissue morphogenesis|atrial cardiac muscle tissue morphogenesis|brain development|dorsal spinal cord development|embryonic retina morphogenesis in camera-type eye|endocardium formation|hepatocyte differentiation|kidney development|lens fiber cell morphogenesis|lung development|lymphangiogenesis|negative regulation of bile acid biosynthetic process|negative regulation of cell proliferation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of viral genome replication|neural tube development|olfactory placode formation|optic placode formation involved in camera-type eye formation|otic placode formation|pancreas development|positive regulation of cyclin-dependent protein kinase activity|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of heart growth|positive regulation of S phase of mitotic cell cycle|positive regulation of sarcomere organization|positive regulation of transcription, DNA-dependent|regulation of transcription involved in lymphatic endothelial cell fate commitment|skeletal muscle thin filament assembly|venous blood vessel morphogenesis|ventricular cardiac muscle tissue morphogenesis|ventricular cardiac myofibril development|ventricular septum morphogenesis	cytoplasm|nucleus	DBD domain binding|LBD domain binding|ligand-dependent nuclear receptor binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription corepressor activity|transcription regulatory region DNA binding			ovary(3)|lung(1)|central_nervous_system(1)|skin(1)	6				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		TTCAAATCCCCGAACTGCCTA	0.428													4	45	---	---	---	---	PASS
TARBP1	6894	broad.mit.edu	37	1	234561477	234561477	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234561477C>A	uc001hwd.2	-	20	3386	c.3386G>T	c.(3385-3387)GGC>GTC	p.G1129V		NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1	1129					regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CATATTGGAGCCATCTAATAA	0.274													20	35	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238051816	238051816	+	Intron	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238051816T>A	uc001hym.2	-						LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein						acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCGGGCTAGGTTTTGAAAAAG	0.438													7	67	---	---	---	---	PASS
OR2L2	26246	broad.mit.edu	37	1	248201738	248201738	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248201738C>G	uc001idw.2	+	1	265	c.169C>G	c.(169-171)CCT>GCT	p.P57A	OR2L13_uc001ids.2_Intron	NM_001004686	NP_001004686	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L,	57	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TCTCCACACACCTATGTATTT	0.323													22	170	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248570189	248570189	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570189G>A	uc010pzm.1	+	1	894	c.894G>A	c.(892-894)GTG>GTA	p.V298V		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	298	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGACTGTGGTGTCCTTGTTCT	0.512													43	59	---	---	---	---	PASS
TMEM18	129787	broad.mit.edu	37	2	669658	669658	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:669658C>T	uc002qwl.2	-	5	439	c.345G>A	c.(343-345)AAG>AAA	p.K115K	TMEM18_uc002qwk.2_RNA	NM_152834	NP_690047	Q96B42	TMM18_HUMAN	transmembrane protein 18	115					cell migration	integral to membrane|nuclear membrane				ovary(1)	1	all_hematologic(175;0.0429)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;5.27e-05)|all_epithelial(98;2.11e-06)|Ovarian(717;0.0253)		all cancers(51;1.95e-21)|Epithelial(75;9.47e-21)|OV - Ovarian serous cystadenocarcinoma(76;8.15e-18)|GBM - Glioblastoma multiforme(21;0.0285)		CATTCAAAGTCTTCCATACCC	0.328													22	53	---	---	---	---	PASS
RNF144A	9781	broad.mit.edu	37	2	7137071	7137071	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7137071G>C	uc002qys.2	+	3	456	c.14G>C	c.(13-15)AGG>ACG	p.R5T	RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144	5						Golgi apparatus|integral to membrane	ligase activity|zinc ion binding	p.R5R(1)		ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		ACCACAACAAGGTACCGGCCC	0.607													4	63	---	---	---	---	PASS
GREB1	9687	broad.mit.edu	37	2	11758996	11758996	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:11758996G>T	uc002rbk.1	+	22	4295	c.3995G>T	c.(3994-3996)CGC>CTC	p.R1332L	GREB1_uc002rbp.1_Missense_Mutation_p.R330L	NM_014668	NP_055483	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1332						integral to membrane				ovary(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GCCGAGGGCCGCGTGGACGGC	0.701													7	21	---	---	---	---	PASS
DDX1	1653	broad.mit.edu	37	2	15767167	15767167	+	Intron	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15767167C>G	uc002rce.2	+						DDX1_uc010yjq.1_Intron	NM_004939	NP_004930	Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 1						DNA duplex unwinding|double-strand break repair|multicellular organismal development|regulation of transcription, DNA-dependent|regulation of translational initiation|spliceosome assembly|transcription, DNA-dependent	cleavage body|stress granule|tRNA-splicing ligase complex	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding|DNA/RNA helicase activity|exonuclease activity|poly(A) RNA binding|protein binding|RNA helicase activity|transcription cofactor activity			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GCTTAATGTGCTTTTCACTAG	0.353													4	24	---	---	---	---	PASS
WDR35	57539	broad.mit.edu	37	2	20131147	20131147	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20131147T>C	uc002rdi.2	-	25	2988	c.2880A>G	c.(2878-2880)AAA>AAG	p.K960K	WDR35_uc002rdj.2_Silent_p.K949K|WDR35_uc010ext.2_RNA|WDR35_uc002rdh.2_Silent_p.K433K	NM_001006657	NP_001006658	Q9P2L0	WDR35_HUMAN	WD repeat domain 35 isoform 1	960										ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTTTACTTCCTTTCTTTGCCT	0.343													3	39	---	---	---	---	PASS
SNX17	9784	broad.mit.edu	37	2	27599539	27599539	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27599539G>T	uc002rkg.1	+	15	1588	c.1366G>T	c.(1366-1368)GTC>TTC	p.V456F	SNX17_uc010ylj.1_Missense_Mutation_p.V436F|SNX17_uc010ylk.1_Missense_Mutation_p.V242F|SNX17_uc010eza.1_Missense_Mutation_p.V242F|SNX17_uc002rki.1_RNA|SNX17_uc002rkh.1_Missense_Mutation_p.V242F|SNX17_uc010yll.1_Missense_Mutation_p.V242F|SNX17_uc010ylm.1_Missense_Mutation_p.V242F|SNX17_uc010yln.1_Missense_Mutation_p.V444F|SNX17_uc010ylo.1_Missense_Mutation_p.V374F|SNX17_uc010ylp.1_Missense_Mutation_p.V431F|SNX17_uc010ylq.1_Missense_Mutation_p.V242F	NM_014748	NP_055563	Q15036	SNX17_HUMAN	sorting nexin 17	456					cell communication|endosome transport|intracellular protein transport|regulation of endocytosis|signal transduction	cytoplasmic vesicle membrane|cytosol|early endosome|Golgi apparatus	low-density lipoprotein particle receptor binding|phosphatidylinositol binding|protein C-terminus binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCCAGTGATGTCCACGGCAA	0.532													39	48	---	---	---	---	PASS
SPAST	6683	broad.mit.edu	37	2	32361662	32361662	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:32361662C>G	uc002roc.2	+	10	1497	c.1276C>G	c.(1276-1278)CTT>GTT	p.L426V	SPAST_uc002rod.2_Missense_Mutation_p.L394V	NM_014946	NP_055761	Q9UBP0	SPAST_HUMAN	spastin isoform 1	426	Sufficient for microtubule severing.		L -> V (in SPG4; promotes microtubule binding and the formation of thick microtubule bundles).		cell cycle|cell death|cell differentiation|cytokinesis, completion of separation|ER to Golgi vesicle-mediated transport|microtubule bundle formation|microtubule severing|nervous system development|protein hexamerization|protein homooligomerization	endoplasmic reticulum|endosome|integral to membrane|microtubule|microtubule organizing center|nucleus|perinuclear region of cytoplasm|spindle	alpha-tubulin binding|ATP binding|beta-tubulin binding|microtubule binding|microtubule-severing ATPase activity			breast(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					GGTGAGGGCTCTTTTTGCTGT	0.323													12	94	---	---	---	---	PASS
HEATR5B	54497	broad.mit.edu	37	2	37280754	37280754	+	Intron	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:37280754T>C	uc002rpp.1	-							NM_019024	NP_061897	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B								binding			ovary(5)|skin(2)|breast(1)	8		all_hematologic(82;0.21)				TTGTAATCTATAACAATAAGA	0.328													4	25	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40656652	40656652	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40656652G>A	uc002rrx.2	-	1	793	c.769C>T	c.(769-771)CTG>TTG	p.L257L	SLC8A1_uc002rry.2_Silent_p.L257L|SLC8A1_uc002rrz.2_Silent_p.L257L|SLC8A1_uc002rsa.2_Silent_p.L257L|SLC8A1_uc002rsd.3_Silent_p.L257L|SLC8A1_uc002rsb.1_Silent_p.L257L|SLC8A1_uc010fan.1_Silent_p.L257L|SLC8A1_uc002rsc.1_Silent_p.L257L	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	257	Calmodulin-binding (Potential).|Cytoplasmic (Potential).				cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TTGTAAAACAGAAGTCTCCTA	0.448													15	128	---	---	---	---	PASS
ZFP36L2	678	broad.mit.edu	37	2	43452225	43452225	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452225C>T	uc002rsv.3	-	2	1009	c.718G>A	c.(718-720)GAT>AAT	p.D240N	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	240					cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TGCAACGCATCGCGCGTGCCA	0.612													5	43	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43520205	43520205	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43520205G>A	uc002rsw.3	-	32	4938	c.4586C>T	c.(4585-4587)GCC>GTC	p.A1529V	THADA_uc010far.2_Missense_Mutation_p.A724V|THADA_uc002rsx.3_Missense_Mutation_p.A1529V|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1529	Poly-Ala.						binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				GGCTGCCGCGGCCCACACTGC	0.577													11	91	---	---	---	---	PASS
SOCS5	9655	broad.mit.edu	37	2	46986955	46986955	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46986955G>T	uc002rvf.2	+	2	1450	c.1286G>T	c.(1285-1287)CGA>CTA	p.R429L	SOCS5_uc010yoe.1_Missense_Mutation_p.R398L|SOCS5_uc002rvg.2_Missense_Mutation_p.R429L	NM_014011	NP_054730	O75159	SOCS5_HUMAN	suppressor of cytokine signaling 5	429	SH2.				cell growth|cytokine-mediated signaling pathway|intracellular signal transduction|negative regulation of signal transduction|negative regulation of T-helper 2 cell differentiation|positive regulation of T-helper 1 cell differentiation|regulation of growth			p.R429*(1)|p.R429Q(1)		ovary(1)|lung(1)|central_nervous_system(1)	3		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			CTGCATGCCCGAATTGAGCAG	0.498													63	77	---	---	---	---	PASS
SMEK2	57223	broad.mit.edu	37	2	55795348	55795348	+	Missense_Mutation	SNP	C	G	G	rs143418918	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55795348C>G	uc002rzc.2	-	13	2292	c.1917G>C	c.(1915-1917)TTG>TTC	p.L639F	SMEK2_uc002rzb.2_Missense_Mutation_p.L554F|SMEK2_uc002rzd.2_Missense_Mutation_p.L607F|SMEK2_uc002ryz.2_Missense_Mutation_p.L73F|SMEK2_uc002rza.2_Missense_Mutation_p.L430F	NM_001122964	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 isoform 1	639						microtubule organizing center|nucleus	protein binding			skin(1)	1			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			TAAATTCAAACAACTCAATAA	0.269													6	30	---	---	---	---	PASS
IMMT	10989	broad.mit.edu	37	2	86374846	86374846	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86374846T>A	uc002sqz.3	-	13	1900	c.1512A>T	c.(1510-1512)GAA>GAT	p.E504D	IMMT_uc002sqy.3_Missense_Mutation_p.E245D|IMMT_uc002srb.3_Missense_Mutation_p.E493D|IMMT_uc002sra.3_Missense_Mutation_p.E503D|IMMT_uc010ytd.1_Missense_Mutation_p.E492D|IMMT_uc010yte.1_Missense_Mutation_p.E457D|IMMT_uc002src.1_Missense_Mutation_p.E240D	NM_006839	NP_006830	Q16891	IMMT_HUMAN	inner membrane protein, mitochondrial isoform 1	504	Mitochondrial intermembrane (Potential).					integral to mitochondrial inner membrane	protein binding			skin(1)	1						CAGACTTCAATTCCTGTTCTT	0.488													10	87	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89513339	89513339	+	RNA	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89513339A>T	uc010ytr.1	-	22		c.2673T>A			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGGGAGCCAGAGCAGCAGGAG	0.473													14	128	---	---	---	---	PASS
ARID5A	10865	broad.mit.edu	37	2	97217930	97217930	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97217930C>T	uc002swe.2	+	7	1765	c.1665C>T	c.(1663-1665)CCC>CCT	p.P555P	ARID5A_uc010yuq.1_Silent_p.P503P|ARID5A_uc002swf.2_Silent_p.P391P|ARID5A_uc002swg.2_Silent_p.P503P	NM_212481	NP_997646	Q03989	ARI5A_HUMAN	AT rich interactive domain 5A	555					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding				0						TGCACTTCCCCCCAACGTCCT	0.677													50	102	---	---	---	---	PASS
IL1R2	7850	broad.mit.edu	37	2	102644717	102644717	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102644717C>T	uc002tbm.2	+	9	1289	c.1060C>T	c.(1060-1062)CTG>TTG	p.L354L	IL1R2_uc002tbn.2_Silent_p.L354L	NM_004633	NP_004624	P27930	IL1R2_HUMAN	interleukin 1 receptor, type II precursor	354	Helical; (Potential).				immune response	integral to membrane|plasma membrane	interleukin-1, Type II, blocking receptor activity			ovary(1)|breast(1)	2					Anakinra(DB00026)	GGGCATTGTGCTGGCCCCACT	0.532													56	69	---	---	---	---	PASS
GTDC1	79712	broad.mit.edu	37	2	144764930	144764930	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:144764930G>C	uc002tvp.2	-	7	973	c.694C>G	c.(694-696)CGA>GGA	p.R232G	GTDC1_uc002tvo.2_Missense_Mutation_p.R232G|GTDC1_uc002tvq.2_Intron|GTDC1_uc002tvr.2_Missense_Mutation_p.R232G|GTDC1_uc010fnn.2_Missense_Mutation_p.R232G|GTDC1_uc002tvs.2_Missense_Mutation_p.R200G|GTDC1_uc010fno.2_Missense_Mutation_p.R103G|GTDC1_uc002tvt.1_Missense_Mutation_p.R232G	NM_001006636	NP_001006637	Q4AE62	GTDC1_HUMAN	glycosyltransferase-like domain containing 1	232					biosynthetic process		transferase activity, transferring glycosyl groups			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.0914)		TATTCTTGTCGTGCAGTATCA	0.388													27	49	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152289653	152289653	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152289653A>G	uc002txm.2	+	10	1118	c.988A>G	c.(988-990)AGA>GGA	p.R330G	RIF1_uc002txl.2_Missense_Mutation_p.R330G|RIF1_uc010fnv.1_Missense_Mutation_p.R294G|RIF1_uc002txn.2_Missense_Mutation_p.R330G|RIF1_uc002txo.2_Missense_Mutation_p.R330G|RIF1_uc010zby.1_RNA	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	330					cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		CATCCATGTGAGAACAGAAAC	0.363													20	50	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164466434	164466434	+	Silent	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164466434T>A	uc002uck.1	-	3	2219	c.1908A>T	c.(1906-1908)ATA>ATT	p.I636I		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	636						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GGGATTCATCTATTTCTTCTG	0.453													10	108	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179396364	179396364	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179396364G>T	uc010zfg.1	-	307	97498	c.97274C>A	c.(97273-97275)ACG>AAG	p.T32425K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.T26120K|TTN_uc010zfi.1_Missense_Mutation_p.T26053K|TTN_uc010zfj.1_Missense_Mutation_p.T25928K|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33352							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACTCCACTCGTGTTGGTGTA	0.453													35	63	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179413276	179413276	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179413276T>C	uc010zfg.1	-	288	85597	c.85373A>G	c.(85372-85374)AAA>AGA	p.K28458R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.K22153R|TTN_uc010zfi.1_Missense_Mutation_p.K22086R|TTN_uc010zfj.1_Missense_Mutation_p.K21961R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	29385							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTCACATCTTTGAAGGTAAT	0.483													29	206	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179443382	179443382	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179443382A>T	uc010zfg.1	-	270	60805	c.60581T>A	c.(60580-60582)CTA>CAA	p.L20194Q	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.L13889Q|TTN_uc010zfi.1_Missense_Mutation_p.L13822Q|TTN_uc010zfj.1_Missense_Mutation_p.L13697Q|uc002umv.1_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	21121							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTCCAAGTTAGAGATACTGA	0.378													5	28	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179451523	179451523	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179451523G>A	uc010zfg.1	-	257	56625	c.56401C>T	c.(56401-56403)CCC>TCC	p.P18801S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.P12496S|TTN_uc010zfi.1_Missense_Mutation_p.P12429S|TTN_uc010zfj.1_Missense_Mutation_p.P12304S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	19728							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTCCTTGGGGGATCCGGCTCA	0.408													35	71	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	205969167	205969167	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205969167G>T	uc002var.1	+	5	729	c.522G>T	c.(520-522)TTG>TTT	p.L174F	PARD3B_uc010fub.1_Missense_Mutation_p.L174F|PARD3B_uc002vao.1_Missense_Mutation_p.L174F|PARD3B_uc002vap.1_Missense_Mutation_p.L174F|PARD3B_uc002vaq.1_Missense_Mutation_p.L174F	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	174					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CGCAGAACTTGGAAGACAGAG	0.358													34	77	---	---	---	---	PASS
PARD3B	117583	broad.mit.edu	37	2	205969168	205969168	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:205969168G>T	uc002var.1	+	5	730	c.523G>T	c.(523-525)GAA>TAA	p.E175*	PARD3B_uc010fub.1_Nonsense_Mutation_p.E175*|PARD3B_uc002vao.1_Nonsense_Mutation_p.E175*|PARD3B_uc002vap.1_Nonsense_Mutation_p.E175*|PARD3B_uc002vaq.1_Nonsense_Mutation_p.E175*	NM_152526	NP_689739	Q8TEW8	PAR3L_HUMAN	par-3 partitioning defective 3 homolog B isoform	175					cell cycle|cell division	endomembrane system|tight junction				skin(2)|ovary(1)|breast(1)	4		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		GCAGAACTTGGAAGACAGAGA	0.363													34	76	---	---	---	---	PASS
FN1	2335	broad.mit.edu	37	2	216284091	216284091	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216284091C>G	uc002vfa.2	-	12	1959	c.1693G>C	c.(1693-1695)GAG>CAG	p.E565Q	FN1_uc002vfb.2_Missense_Mutation_p.E565Q|FN1_uc002vfc.2_Missense_Mutation_p.E565Q|FN1_uc002vfd.2_Missense_Mutation_p.E565Q|FN1_uc002vfe.2_Missense_Mutation_p.E565Q|FN1_uc002vff.2_Missense_Mutation_p.E565Q|FN1_uc002vfg.2_Missense_Mutation_p.E565Q|FN1_uc002vfh.2_Missense_Mutation_p.E565Q|FN1_uc002vfi.2_Missense_Mutation_p.E565Q|FN1_uc002vfj.2_Missense_Mutation_p.E565Q|FN1_uc002vfl.2_Missense_Mutation_p.E565Q	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein	565	Fibronectin type-I 9.|Collagen-binding.				acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	GTCCCAGTCTCTGAATCCTGG	0.423													5	49	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	228009244	228009244	+	Missense_Mutation	SNP	T	G	G	rs3817617	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228009244T>G	uc010zlt.1	-	3	756	c.102A>C	c.(100-102)CAA>CAC	p.Q34H		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	34					axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		CATATACATATTGTACAGAAA	0.279													22	74	---	---	---	---	PASS
WDR69	164781	broad.mit.edu	37	2	228770965	228770965	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228770965T>A	uc002vpn.1	+	9	848	c.769T>A	c.(769-771)TTA>ATA	p.L257I	WDR69_uc010zlw.1_Missense_Mutation_p.L242I|WDR69_uc002vpo.1_RNA	NM_178821	NP_849143	Q8N136	WDR69_HUMAN	WD repeat domain 69	257										breast(1)	1		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;1.22e-10)|all cancers(144;8.11e-08)|Lung(261;0.011)|LUSC - Lung squamous cell carcinoma(224;0.0148)		GGTAAATATCTTAATTGGTCA	0.358													39	61	---	---	---	---	PASS
SPHKAP	80309	broad.mit.edu	37	2	228881326	228881326	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228881326T>A	uc002vpq.2	-	7	4291	c.4244A>T	c.(4243-4245)AAC>ATC	p.N1415I	SPHKAP_uc002vpp.2_Missense_Mutation_p.N1415I|SPHKAP_uc010zlx.1_Missense_Mutation_p.N1415I	NM_001142644	NP_001136116	Q2M3C7	SPKAP_HUMAN	sphingosine kinase type 1-interacting protein	1415						cytoplasm	protein binding			skin(5)|ovary(4)|lung(1)	10		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CCTTTTGTGGTTTATTGGTAC	0.468													59	90	---	---	---	---	PASS
NISCH	11188	broad.mit.edu	37	3	52526092	52526092	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52526092C>G	uc011beg.1	+	22	4181	c.4109C>G	c.(4108-4110)CCC>CGC	p.P1370R	NISCH_uc003ded.3_Missense_Mutation_p.P1370R|NISCH_uc003dee.3_Missense_Mutation_p.P859R|NISCH_uc003deg.1_RNA|NISCH_uc003deh.3_Missense_Mutation_p.P119R	NM_007184	NP_009115	Q9Y2I1	NISCH_HUMAN	nischarin	1370					apoptosis|cell communication	cytosol|early endosome|plasma membrane|recycling endosome	phosphatidylinositol binding|receptor activity			ovary(3)|central_nervous_system(1)	4				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)		CCCCTGCGCCCCAAGACACTC	0.652													18	39	---	---	---	---	PASS
ACTR8	93973	broad.mit.edu	37	3	53908307	53908307	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53908307G>C	uc003dhd.2	-	8	1055	c.996C>G	c.(994-996)TGC>TGG	p.C332W	ACTR8_uc003dhb.2_Intron|ACTR8_uc003dhc.2_Missense_Mutation_p.C221W	NM_022899	NP_075050	Q9H981	ARP8_HUMAN	actin-related protein 8	332					cell division|DNA recombination|DNA repair|mitosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex	protein binding			ovary(1)|central_nervous_system(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000143)|KIRC - Kidney renal clear cell carcinoma(284;0.00544)|Kidney(284;0.00607)|OV - Ovarian serous cystadenocarcinoma(275;0.111)		TTGTTAACTGGCATTCTCTGT	0.383													6	46	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100594406	100594406	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100594406G>C	uc003dun.2	-	8	869	c.784C>G	c.(784-786)CAC>GAC	p.H262D	ABI3BP_uc003duo.2_Missense_Mutation_p.H255D|ABI3BP_uc003dup.3_Missense_Mutation_p.H255D	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	262						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						GAATCCTTGTGAGTAACATTC	0.443													16	38	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130187876	130187876	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130187876C>T	uc010htj.1	+	38	7522	c.7028C>T	c.(7027-7029)CCT>CTT	p.P2343L	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.P382L	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2343	VWFA 10.|Nonhelical region.				axon guidance|cell adhesion	collagen					0						AGCTACTCTCCTCCAGGCTAT	0.438													7	45	---	---	---	---	PASS
PRR23B	389151	broad.mit.edu	37	3	138739077	138739077	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138739077C>T	uc003esy.1	-	1	692	c.427G>A	c.(427-429)GCA>ACA	p.A143T		NM_001013650	NP_001013672	Q6ZRT6	PR23B_HUMAN	proline rich 23B	143										breast(1)	1						GGGACAGATGCGCAGAATTCC	0.667													18	86	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147128271	147128271	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147128271G>A	uc003ewe.2	+	1	1091	c.372G>A	c.(370-372)TCG>TCA	p.S124S		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	124					behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						TTGCTGCATCGGCCGGGGGCT	0.716													15	54	---	---	---	---	PASS
PLCH1	23007	broad.mit.edu	37	3	155206556	155206556	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:155206556A>T	uc011bok.1	-	19	2673	c.2396T>A	c.(2395-2397)GTA>GAA	p.V799E	PLCH1_uc011boj.1_Missense_Mutation_p.V799E|PLCH1_uc011bol.1_Missense_Mutation_p.V781E	NM_001130960	NP_001124432	Q4KWH8	PLCH1_HUMAN	phospholipase C eta 1 isoform a	799	C2.				lipid catabolic process|phosphatidylinositol-mediated signaling	membrane	calcium ion binding|calcium-dependent phospholipase C activity|phosphatidylinositol phospholipase C activity|signal transducer activity			skin(3)|ovary(1)	4			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			TGGCATGTGTACTGTAAATGT	0.428													17	59	---	---	---	---	PASS
ARL14	80117	broad.mit.edu	37	3	160395630	160395630	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160395630C>T	uc003fdq.2	+	1	683	c.496C>T	c.(496-498)CAG>TAG	p.Q166*		NM_025047	NP_079323	Q8N4G2	ARL14_HUMAN	ADP-ribosylation factor-like 14	166					small GTPase mediated signal transduction	intracellular	GTP binding				0			Lung(72;7.02e-05)|LUSC - Lung squamous cell carcinoma(72;7.23e-05)			GGGGCTGGCCCAGGGGTTCAG	0.502													4	113	---	---	---	---	PASS
LMLN	89782	broad.mit.edu	37	3	197710805	197710805	+	Intron	SNP	T	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197710805T>G	uc011buo.1	+						LMLN_uc003fyt.2_Intron|LMLN_uc010iar.2_Intron|LMLN_uc010ias.2_Intron|LMLN_uc003fyu.2_Intron	NM_033029	NP_149018	Q96KR4	LMLN_HUMAN	leishmanolysin-like isoform 2						cell adhesion|cell division|mitosis|proteolysis	cytoplasm|membrane	metalloendopeptidase activity|zinc ion binding			skin(1)	1	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		TCAATGTCTGTTTTGACAGGC	0.373													9	158	---	---	---	---	PASS
STK32B	55351	broad.mit.edu	37	4	5418612	5418612	+	Silent	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5418612G>T	uc003gih.1	+	6	577	c.513G>T	c.(511-513)GTG>GTT	p.V171V	STK32B_uc010ida.1_Silent_p.V124V	NM_018401	NP_060871	Q9NY57	ST32B_HUMAN	serine/threonine kinase 32B	171	Protein kinase.						ATP binding|metal ion binding|protein serine/threonine kinase activity			breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CGACGGTAGTGAAAGGAGCAG	0.502													10	16	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8588916	8588916	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8588916C>T	uc003glk.2	+	3	1337	c.918C>T	c.(916-918)GCC>GCT	p.A306A	CPZ_uc003gll.2_Intron	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	306	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						AAGTCCTGGCCGGCATGGTGC	0.652													14	32	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49063890	49063890	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49063890C>G	uc003gyv.2	+	16	2265	c.2083C>G	c.(2083-2085)CCC>GCC	p.P695A	CWH43_uc011bzl.1_Missense_Mutation_p.P668A	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	695					GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						TATGAATACTCCCAAATACTT	0.254													5	24	---	---	---	---	PASS
SRP72	6731	broad.mit.edu	37	4	57357606	57357606	+	Silent	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57357606A>G	uc003hbv.2	+	16	1552	c.1512A>G	c.(1510-1512)AAA>AAG	p.K504K	SRP72_uc010ihe.2_Silent_p.K443K|SRP72_uc003hbw.1_Silent_p.K265K	NM_006947	NP_008878	O76094	SRP72_HUMAN	signal recognition particle 72kDa	504					response to drug|SRP-dependent cotranslational protein targeting to membrane	cytosol|nucleolus|plasma membrane|signal recognition particle, endoplasmic reticulum targeting	7S RNA binding|signal recognition particle binding			ovary(1)	1	Glioma(25;0.08)|all_neural(26;0.101)					GTCTTAGTAAACACTTGCCAT	0.358													37	112	---	---	---	---	PASS
ADAMTS3	9508	broad.mit.edu	37	4	73186501	73186501	+	Silent	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73186501G>C	uc003hgk.1	-	7	1069	c.1032C>G	c.(1030-1032)CTC>CTG	p.L344L		NM_014243	NP_055058	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1	344	Peptidase M12B.				collagen catabolic process|collagen fibril organization|proteolysis	proteinaceous extracellular matrix	heparin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CAGAGTGGTTGAGATCAGATC	0.443													22	65	---	---	---	---	PASS
BMP3	651	broad.mit.edu	37	4	81952680	81952680	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81952680G>A	uc003hmg.3	+	1	562	c.242G>A	c.(241-243)GGA>GAA	p.G81E		NM_001201	NP_001192	P12645	BMP3_HUMAN	bone morphogenetic protein 3 preproprotein	81					cartilage development|cell differentiation|cell-cell signaling|growth|ossification	extracellular space	BMP receptor binding|cytokine activity|growth factor activity			ovary(4)|central_nervous_system(1)	5						TCCCTGGAGGGAGGCTCGCAG	0.672													7	27	---	---	---	---	PASS
AFF1	4299	broad.mit.edu	37	4	88035845	88035845	+	Silent	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:88035845C>G	uc003hqj.3	+	11	2246	c.1839C>G	c.(1837-1839)GCC>GCG	p.A613A	AFF1_uc011ccz.1_Silent_p.A620A|AFF1_uc003hqk.3_Silent_p.A613A|AFF1_uc011cda.1_Silent_p.A251A	NM_005935	NP_005926	P51825	AFF1_HUMAN	myeloid/lymphoid or mixed-lineage leukemia	613						nucleus	sequence-specific DNA binding transcription factor activity			breast(1)	1		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AGGCCTCTGCCCGGGCAGGTT	0.587													4	70	---	---	---	---	PASS
DCHS2	54798	broad.mit.edu	37	4	155237114	155237114	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155237114C>T	uc003inw.2	-	15	3681	c.3681G>A	c.(3679-3681)TTG>TTA	p.L1227L		NM_017639	NP_060109	Q6V1P9	PCD23_HUMAN	dachsous 2 isoform 1	1227	Cadherin 10.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(3)|pancreas(1)	4	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TTTCATAATCCAAAGGACAGG	0.383													7	17	---	---	---	---	PASS
FGG	2266	broad.mit.edu	37	4	155531250	155531250	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155531250G>T	uc003ioj.2	-	5	642	c.501C>A	c.(499-501)GAC>GAA	p.D167E	FGG_uc003iog.2_Missense_Mutation_p.D167E|FGG_uc003ioh.2_Missense_Mutation_p.D167E|FGG_uc010ipx.2_Intron|FGG_uc010ipy.2_Intron|FGG_uc003ioi.2_5'UTR|FGG_uc003iok.2_Missense_Mutation_p.D167E	NM_021870	NP_068656	P02679	FIBG_HUMAN	fibrinogen, gamma chain isoform gamma-B	167					platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding				0	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	TTTGCACCGTGTCTTTGCAAG	0.368													25	41	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5237099	5237099	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5237099C>A	uc003jdl.2	+	14	2179	c.2041C>A	c.(2041-2043)CTC>ATC	p.L681I	ADAMTS16_uc003jdk.1_Missense_Mutation_p.L681I|ADAMTS16_uc010itk.1_Intron	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	681	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						CTTATGCAAACTCTACTGTAT	0.333													10	94	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33588803	33588803	+	Silent	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33588803C>A	uc003jia.1	-	18	2929	c.2766G>T	c.(2764-2766)CCG>CCT	p.P922P	ADAMTS12_uc010iuq.1_Silent_p.P837P	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	922	TSP type-1 3.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						AGTCTGTGGGCGGGAGAGCCT	0.632										HNSCC(64;0.19)			18	102	---	---	---	---	PASS
RXFP3	51289	broad.mit.edu	37	5	33937435	33937435	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33937435G>T	uc003jic.1	+	1	947	c.590G>T	c.(589-591)GGC>GTC	p.G197V		NM_016568	NP_057652	Q9NSD7	RL3R1_HUMAN	relaxin/insulin-like family peptide receptor 3	197	Cytoplasmic (Potential).					integral to plasma membrane	N-formyl peptide receptor activity			upper_aerodigestive_tract(1)	1						CGAGGACACGGCCGGGGCGAC	0.662													12	54	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	36995735	36995735	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36995735C>G	uc003jkl.3	+	11	3632	c.3133C>G	c.(3133-3135)CAA>GAA	p.Q1045E	NIPBL_uc003jkk.3_Missense_Mutation_p.Q1045E|NIPBL_uc003jkm.1_Missense_Mutation_p.Q924E	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1045					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			TAGTATAGATCAATCAGTGTT	0.313													5	43	---	---	---	---	PASS
NUP155	9631	broad.mit.edu	37	5	37333556	37333556	+	Intron	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37333556C>T	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			TAACAGAATACGTACACACCT	0.323													6	63	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38350605	38350605	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38350605G>A	uc003jlc.1	+	4	618	c.294G>A	c.(292-294)GAG>GAA	p.E98E	EGFLAM_uc003jlb.1_Silent_p.E98E	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	98	Fibronectin type-III 1.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					ATTGACAGGAGGAAGTGATTG	0.468													19	87	---	---	---	---	PASS
PLCXD3	345557	broad.mit.edu	37	5	41382282	41382282	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41382282T>C	uc003jmm.1	-	2	560	c.458A>G	c.(457-459)TAT>TGT	p.Y153C		NM_001005473	NP_001005473	Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X	153	PI-PLC X-box.				intracellular signal transduction|lipid catabolic process		phospholipase C activity|signal transducer activity			skin(2)|urinary_tract(1)|ovary(1)|lung(1)|central_nervous_system(1)	6						TTCATGGTGATATTTCTGCAT	0.413													12	125	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45262686	45262686	+	Silent	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45262686C>A	uc003jok.2	-	8	2035	c.2010G>T	c.(2008-2010)GCG>GCT	p.A670A		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	670	Cytoplasmic (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						ACAGGCTGGTCGCTGTGTACA	0.582													19	80	---	---	---	---	PASS
SLCO4C1	353189	broad.mit.edu	37	5	101583092	101583092	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101583092C>A	uc003knm.2	-	10	1962	c.1675G>T	c.(1675-1677)GAA>TAA	p.E559*		NM_180991	NP_851322	Q6ZQN7	SO4C1_HUMAN	solute carrier organic anion transporter family,	559	Extracellular (Potential).				cell differentiation|multicellular organismal development|sodium-independent organic anion transport|spermatogenesis	basolateral plasma membrane|integral to membrane	sodium-independent organic anion transmembrane transporter activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)|pancreas(1)	4		all_cancers(142;1.86e-08)|all_epithelial(76;5.24e-12)|Prostate(80;0.00124)|Colorectal(57;0.00332)|Ovarian(225;0.024)|Lung NSC(167;0.0402)|all_lung(232;0.0486)		Epithelial(69;4.07e-14)|COAD - Colon adenocarcinoma(37;0.00986)		CCAAAAGTTTCTGCAGTGGAT	0.294													22	41	---	---	---	---	PASS
PHF15	23338	broad.mit.edu	37	5	133901824	133901824	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:133901824G>A	uc003kzo.1	+	9	1167	c.988G>A	c.(988-990)GTC>ATC	p.V330I	PHF15_uc011cxt.1_Missense_Mutation_p.V330I|PHF15_uc003kzk.2_Missense_Mutation_p.V346I|PHF15_uc003kzl.2_Missense_Mutation_p.V330I|PHF15_uc003kzm.2_Missense_Mutation_p.V330I|PHF15_uc003kzn.2_Missense_Mutation_p.V330I|PHF15_uc003kzp.2_Missense_Mutation_p.V38I	NM_015288	NP_056103	Q9NQC1	JADE2_HUMAN	PHD finger protein 15	330					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GCCTTCCTGCGTCACAGCGTT	0.572													13	113	---	---	---	---	PASS
PCDHB5	26167	broad.mit.edu	37	5	140515709	140515709	+	Silent	SNP	C	A	A	rs145844360		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140515709C>A	uc003liq.2	+	1	910	c.693C>A	c.(691-693)GTC>GTA	p.V231V		NM_015669	NP_056484	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5 precursor	231	Cadherin 2.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding|protein binding			skin(3)|ovary(2)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGCATTGTCGTCTTGGATA	0.547													105	180	---	---	---	---	PASS
PCDHB10	56126	broad.mit.edu	37	5	140574340	140574340	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140574340G>T	uc003lix.2	+	1	2389	c.2215G>T	c.(2215-2217)GTG>TTG	p.V739L		NM_018930	NP_061753	Q9UN67	PCDBA_HUMAN	protocadherin beta 10 precursor	739	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGGCATCTGGTGGACGTGAG	0.647													18	173	---	---	---	---	PASS
PCDHGA10	56106	broad.mit.edu	37	5	140793265	140793265	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140793265C>A	uc003lkl.1	+	1	523	c.523C>A	c.(523-525)CAG>AAG	p.Q175K	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc011day.1_Missense_Mutation_p.Q175K	NM_018913	NP_061736	Q9Y5H3	PCDGA_HUMAN	protocadherin gamma subfamily A, 10 isoform 1	175	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGAGCTATCAGCTCAGCCC	0.527													16	29	---	---	---	---	PASS
RARS	5917	broad.mit.edu	37	5	167933834	167933834	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167933834C>A	uc003lzx.2	+	11	1385	c.1344C>A	c.(1342-1344)GAC>GAA	p.D448E	RARS_uc011deo.1_Missense_Mutation_p.D242E	NM_002887	NP_002878	P54136	SYRC_HUMAN	arginyl-tRNA synthetase	448					arginyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	arginine-tRNA ligase activity|ATP binding|protein binding			ovary(2)|skin(1)	3	Renal(175;0.000159)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0208)|all_neural(177;0.0227)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0693)|Epithelial(171;0.131)|OV - Ovarian serous cystadenocarcinoma(192;0.156)		TAGGGGAAGACAAGTAAGTCT	0.393													15	49	---	---	---	---	PASS
CDHR2	54825	broad.mit.edu	37	5	176018407	176018407	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176018407C>A	uc003mem.1	+	30	3722	c.3656C>A	c.(3655-3657)GCC>GAC	p.A1219D	CDHR2_uc003men.1_Missense_Mutation_p.A1219D	NM_017675	NP_060145	Q9BYE9	CDHR2_HUMAN	protocadherin LKC precursor	1219	Cytoplasmic (Potential).				homophilic cell adhesion|negative regulation of cell growth	apical plasma membrane|cell junction|integral to membrane	calcium ion binding|protein binding			ovary(2)	2						CTCTCCAGAGCCAACCCCATG	0.592													7	49	---	---	---	---	PASS
GRK6	2870	broad.mit.edu	37	5	176859271	176859271	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176859271C>T	uc011dfz.1	+	4	459	c.299C>T	c.(298-300)GCA>GTA	p.A100V	GRK6_uc003mgp.2_Missense_Mutation_p.A100V|GRK6_uc003mgq.2_Missense_Mutation_p.A100V|GRK6_uc003mgs.1_Missense_Mutation_p.A70V	NM_002082	NP_002073	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6 isoform B	100	N-terminal.|RGS.				regulation of G-protein coupled receptor protein signaling pathway	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			large_intestine(1)|stomach(1)|breast(1)	3	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AAGCGGAAGGCATGTGGGCGG	0.602													6	89	---	---	---	---	PASS
EDN1	1906	broad.mit.edu	37	6	12290932	12290932	+	Intron	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12290932C>A	uc003nae.3	+						EDN1_uc010jpb.2_Intron|EDN1_uc003nad.2_Intron|EDN1_uc003naf.3_Intron	NM_001955	NP_001946	P05305	EDN1_HUMAN	endothelin 1 precursor						artery smooth muscle contraction|calcium-mediated signaling|leukocyte activation|negative regulation of blood coagulation|negative regulation of cellular protein metabolic process|negative regulation of nitric-oxide synthase biosynthetic process|negative regulation of transcription from RNA polymerase II promoter|nitric oxide transport|peptide hormone secretion|phosphatidylinositol 3-kinase cascade|positive regulation of cardiac muscle hypertrophy|positive regulation of cell size|positive regulation of endothelial cell migration|positive regulation of heart rate|positive regulation of hormone secretion|positive regulation of JUN kinase activity|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of sarcomere organization|positive regulation of smooth muscle cell proliferation|prostaglandin biosynthetic process|protein kinase C deactivation|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	cytoplasm|extracellular space	cytokine activity|endothelin A receptor binding|endothelin B receptor binding|hormone activity			skin(1)	1	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)				AACAGGTAGGCACGCTCGTTG	0.413											OREG0017197	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	73	---	---	---	---	PASS
MRS2	57380	broad.mit.edu	37	6	24418421	24418421	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24418421C>G	uc003neb.2	+	8	1068	c.946C>G	c.(946-948)CTG>GTG	p.L316V	MRS2_uc003nea.2_Missense_Mutation_p.L316V|MRS2_uc011djl.1_Missense_Mutation_p.L319V|MRS2_uc011djm.1_RNA|MRS2_uc011djn.1_Missense_Mutation_p.L266V|MRS2_uc003nec.2_Missense_Mutation_p.L193V	NM_020662	NP_065713	Q9HD23	MRS2_HUMAN	MRS2-like, magnesium homeostasis factor	316	Mitochondrial matrix (Potential).				ion transport	integral to membrane|mitochondrial inner membrane					0						GCTTAGGGTGCTGATTGATGA	0.348													3	94	---	---	---	---	PASS
TMEM63B	55362	broad.mit.edu	37	6	44116675	44116675	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44116675A>T	uc003owr.2	+	15	1470	c.1406A>T	c.(1405-1407)TAC>TTC	p.Y469F	TMEM63B_uc003owq.1_Missense_Mutation_p.Y469F|TMEM63B_uc003ows.2_Missense_Mutation_p.Y372F|TMEM63B_uc010jyz.2_RNA	NM_018426	NP_060896	Q5T3F8	TM63B_HUMAN	transmembrane protein 63B	469						integral to membrane	nucleotide binding|protein binding			pancreas(2)|central_nervous_system(1)	3	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CCTGTGGAGTACCTCAACGTG	0.557													35	92	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56462809	56462809	+	Intron	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56462809G>C	uc003pdf.2	-						DST_uc003pcz.3_Intron|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc003pcy.3_Intron|DST_uc010kaa.1_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TGCTACCTGGGAAGGGAAAGT	0.413													6	39	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56707879	56707879	+	Intron	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56707879T>A	uc003pdf.2	-						DST_uc003pcz.3_Missense_Mutation_p.Y22F|DST_uc011dxj.1_Intron|DST_uc011dxk.1_Intron|DST_uc011dxl.1_Intron	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2						cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GACATCCTCGTAGGCCTGGAG	0.557													15	24	---	---	---	---	PASS
PRIM2	5558	broad.mit.edu	37	6	57467213	57467213	+	Intron	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57467213G>T	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CATGGTAAGTGCCTCCACTGG	0.433													15	149	---	---	---	---	PASS
NT5E	4907	broad.mit.edu	37	6	86181079	86181079	+	Silent	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86181079C>A	uc003pko.3	+	3	1243	c.687C>A	c.(685-687)ATC>ATA	p.I229I	NT5E_uc003pkn.2_Silent_p.I229I|NT5E_uc010kbr.2_Silent_p.I229I	NM_002526	NP_002517	P21589	5NTD_HUMAN	5' nucleotidase, ecto precursor	229					DNA metabolic process|purine base metabolic process|pyrimidine base metabolic process|pyrimidine nucleoside catabolic process	anchored to membrane|cytoplasm|membrane fraction|plasma membrane	5'-nucleotidase activity|nucleotide binding			ovary(3)|central_nervous_system(1)	4		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Pentoxifylline(DB00806)	ATAAACTCATCGCTCAGAAAG	0.408													3	84	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106968897	106968897	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106968897A>G	uc003prh.2	+	2	3077	c.2590A>G	c.(2590-2592)ACT>GCT	p.T864A		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	864							sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		GGCTTTCAGTACTTCTCAGAA	0.453													28	73	---	---	---	---	PASS
SMPDL3A	10924	broad.mit.edu	37	6	123116872	123116872	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123116872A>G	uc003pzg.2	+	2	684	c.163A>G	c.(163-165)ACA>GCA	p.T55A	SMPDL3A_uc003pzh.2_Intron	NM_006714	NP_006705	Q92484	ASM3A_HUMAN	acid sphingomyelinase-like phosphodiesterase 3A	55					sphingomyelin catabolic process	extracellular space	hydrolase activity, acting on glycosyl bonds|protein binding|sphingomyelin phosphodiesterase activity				0				GBM - Glioblastoma multiforme(226;0.236)		TTACCACATCACAGATGACCA	0.403													24	57	---	---	---	---	PASS
TMEM200A	114801	broad.mit.edu	37	6	130762297	130762297	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130762297C>T	uc003qca.2	+	3	1601	c.730C>T	c.(730-732)CCC>TCC	p.P244S	TMEM200A_uc010kfh.2_Missense_Mutation_p.P244S|TMEM200A_uc010kfi.2_Missense_Mutation_p.P244S|TMEM200A_uc003qcb.2_Missense_Mutation_p.P244S	NM_052913	NP_443145	Q86VY9	T200A_HUMAN	transmembrane protein 200A	244	Cytoplasmic (Potential).					integral to membrane				ovary(1)	1				GBM - Glioblastoma multiforme(226;0.0139)|OV - Ovarian serous cystadenocarcinoma(155;0.12)		GCATCTTATGCCCCCTTTGCT	0.483													4	106	---	---	---	---	PASS
MED23	9439	broad.mit.edu	37	6	131946127	131946127	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:131946127C>T	uc003qcs.1	-	4	336	c.162G>A	c.(160-162)GAG>GAA	p.E54E	MED23_uc003qcq.2_Silent_p.E54E|MED23_uc003qct.1_Silent_p.E54E|MED23_uc011ecb.1_RNA	NM_004830	NP_004821	Q9ULK4	MED23_HUMAN	mediator complex subunit 23 isoform a	54					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor complex	protein binding|transcription coactivator activity			ovary(1)|kidney(1)|central_nervous_system(1)	3	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		GTTCATGAGACTCCTGGAAAA	0.338													14	57	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152576797	152576797	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152576797C>T	uc010kiw.2	-	103	19791	c.19189G>A	c.(19189-19191)GTT>ATT	p.V6397I	SYNE1_uc010kiv.2_Missense_Mutation_p.V921I|SYNE1_uc003qos.3_Missense_Mutation_p.V921I|SYNE1_uc003qot.3_Missense_Mutation_p.V6326I|SYNE1_uc003qou.3_Missense_Mutation_p.V6397I	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6397	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CGTTCTTCAACGTCATCCAAC	0.458										HNSCC(10;0.0054)			17	93	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159653483	159653483	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159653483T>C	uc010kjv.2	+	11	2139	c.1939T>C	c.(1939-1941)TCA>CCA	p.S647P	FNDC1_uc010kjw.1_Missense_Mutation_p.S532P	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	647						extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CTTGGTGGACTCAGACGAAGA	0.692													23	61	---	---	---	---	PASS
CYTH3	9265	broad.mit.edu	37	7	6213320	6213320	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6213320T>C	uc003spt.2	-	6	517	c.413A>G	c.(412-414)CAT>CGT	p.H138R	CYTH3_uc011jws.1_5'Flank	NM_004227	NP_004218	O43739	CYH3_HUMAN	cytohesin 3	138	SEC7.				regulation of ARF protein signal transduction|regulation of cell adhesion|vesicle-mediated transport	cytoplasm|membrane fraction|plasma membrane	1-phosphatidylinositol binding|ARF guanyl-nucleotide exchange factor activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity				0						AGCAAACTCATGGAGTTCAAC	0.398													35	79	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34009998	34009998	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34009998G>A	uc011kap.1	+	5	574	c.460G>A	c.(460-462)GAG>AAG	p.E154K		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	154	VWFC 2.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						AAACCCTTTGGAGCATCTGGG	0.498													58	189	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38505102	38505102	+	Missense_Mutation	SNP	G	C	C	rs146457438	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38505102G>C	uc003tgu.2	-	9	783	c.714C>G	c.(712-714)CAC>CAG	p.H238Q	AMPH_uc003tgv.2_Missense_Mutation_p.H238Q|AMPH_uc003tgt.2_5'Flank	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	238	BAR.				endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						CCTTGTCGGCGTGCTGGTCAC	0.502													6	13	---	---	---	---	PASS
C7orf10	79783	broad.mit.edu	37	7	40314128	40314128	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:40314128G>T	uc003thn.1	+	8	638	c.593G>T	c.(592-594)CGC>CTC	p.R198L	C7orf10_uc003thm.1_Missense_Mutation_p.R168L|C7orf10_uc003tho.1_Intron	NM_024728	NP_079004	Q9HAC7	CG010_HUMAN	dermal papilla derived protein 13	205							transferase activity			ovary(2)	2						GATCCAGTTCGCCCAGGAGTA	0.368													17	56	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82582540	82582540	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82582540T>C	uc003uhx.2	-	5	8018	c.7729A>G	c.(7729-7731)ACA>GCA	p.T2577A	PCLO_uc003uhv.2_Missense_Mutation_p.T2577A|PCLO_uc010lec.2_5'Flank	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	2508					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						TAAGTTTCTGTGAGGGATTTG	0.438													92	176	---	---	---	---	PASS
SRI	6717	broad.mit.edu	37	7	87846426	87846426	+	Intron	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87846426T>A	uc003ujq.1	-						SRI_uc011khg.1_Intron|SRI_uc003ujr.1_Intron|SRI_uc011khh.1_Intron|SRI_uc010lej.1_Intron	NM_003130	NP_003121	P30626	SORCN_HUMAN	sorcin isoform a						heart development|intracellular sequestering of iron ion|muscle organ development|regulation of action potential|regulation of heart contraction|regulation of striated muscle contraction|signal transduction	sarcoplasmic reticulum membrane	calcium channel regulator activity|calcium ion binding|receptor binding			upper_aerodigestive_tract(1)	1	Esophageal squamous(14;0.00202)					ACTTTGGGACTGTCAACTTAC	0.393													5	74	---	---	---	---	PASS
DYNC1I1	1780	broad.mit.edu	37	7	95709710	95709710	+	Silent	SNP	C	A	A	rs145003989		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95709710C>A	uc003uoc.3	+	16	2014	c.1737C>A	c.(1735-1737)TCC>TCA	p.S579S	DYNC1I1_uc003uod.3_Silent_p.S562S|DYNC1I1_uc003uob.2_Silent_p.S542S|DYNC1I1_uc003uoe.3_Silent_p.S559S|DYNC1I1_uc010lfl.2_Silent_p.S568S	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	579	WD 7.				vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			AGGGGGCATCCGCCCTAAACC	0.468													27	192	---	---	---	---	PASS
MIR106B	406900	broad.mit.edu	37	7	99691659	99691659	+	RNA	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99691659G>A	hsa-mir-106b|MI0000734	-			c.39G>A			MCM7_uc003usv.1_Intron|MCM7_uc003usw.1_Intron|MCM7_uc003usx.1_Intron|uc003usy.1_5'Flank|MIR25_hsa-mir-25|MI0000082_5'Flank|uc003usz.1_5'Flank|MIR93_hsa-mir-93|MI0000095_5'Flank|uc003uta.1_RNA																	0						GCACGGAGAGGACCACTATCT	0.602													11	29	---	---	---	---	PASS
AP4M1	9179	broad.mit.edu	37	7	99701047	99701047	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99701047C>A	uc003utb.3	+	5	575	c.367C>A	c.(367-369)CAG>AAG	p.Q123K	MCM7_uc003usv.1_5'Flank|MCM7_uc003usw.1_5'Flank|MCM7_uc003usx.1_5'Flank|AP4M1_uc011kjg.1_Intron|AP4M1_uc010lgl.1_Missense_Mutation_p.Q123K|AP4M1_uc003utc.3_Missense_Mutation_p.Q130K|AP4M1_uc010lgm.2_5'UTR|AP4M1_uc003utd.2_Missense_Mutation_p.Q123K|AP4M1_uc011kjh.1_Missense_Mutation_p.Q75K|AP4M1_uc003ute.3_5'UTR|AP4M1_uc003utf.3_5'UTR	NM_004722	NP_004713	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	123					intracellular protein transport|vesicle-mediated transport	clathrin adaptor complex|coated pit|Golgi trans cisterna	transporter activity				0	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGGCTATGTACAGACCACATC	0.478													47	66	---	---	---	---	PASS
PMPCB	9512	broad.mit.edu	37	7	102939977	102939977	+	Splice_Site	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102939977G>T	uc003vbl.2	+	3	361	c.327_splice	c.e3+1	p.K109_splice	PMPCB_uc010liu.1_Splice_Site_p.K109_splice|PMPCB_uc003vbk.1_Splice_Site_p.K109_splice|PMPCB_uc003vbm.2_Missense_Mutation_p.R17S|PMPCB_uc010liv.2_Missense_Mutation_p.R17S|PMPCB_uc010liw.2_Missense_Mutation_p.R17S|PMPCB_uc011kll.1_Splice_Site_p.K4_splice|PMPCB_uc011klm.1_5'Flank	NM_004279	NP_004270	O75439	MPPB_HUMAN	mitochondrial processing peptidase beta subunit						proteolysis	mitochondrial matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)	4						GGCTTTCAAGGCAAGTTGTAA	0.383													4	48	---	---	---	---	PASS
PSMC2	5701	broad.mit.edu	37	7	103002523	103002523	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103002523G>A	uc003vbs.2	+	5	480	c.410G>A	c.(409-411)GGG>GAG	p.G137E	SLC26A5_uc003vbt.1_Intron|SLC26A5_uc003vbu.1_Intron|SLC26A5_uc003vbv.1_Intron|PSMC2_uc011kln.1_Missense_Mutation_p.G137E|PSMC2_uc011klo.1_5'UTR	NM_002803	NP_002794	P35998	PRS7_HUMAN	proteasome 26S ATPase subunit 2	137					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding				0						ATTGAAGAAGGGATGAGAGTG	0.393													15	61	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131864544	131864544	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131864544G>A	uc003vra.3	-	20	4005	c.3776C>T	c.(3775-3777)GCC>GTC	p.A1259V		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	1259	Cytoplasmic (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GCGTTTATAGGCAATGAGCAC	0.607													13	41	---	---	---	---	PASS
EXOC4	60412	broad.mit.edu	37	7	132973849	132973849	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132973849T>C	uc003vrk.2	+	3	485	c.450T>C	c.(448-450)TAT>TAC	p.Y150Y	EXOC4_uc011kpo.1_Silent_p.Y49Y|EXOC4_uc003vri.2_Silent_p.Y150Y|EXOC4_uc003vrj.2_Silent_p.Y150Y	NM_021807	NP_068579	Q96A65	EXOC4_HUMAN	SEC8 protein isoform a	150					vesicle docking involved in exocytosis	exocyst	protein N-terminus binding			ovary(4)|large_intestine(3)|upper_aerodigestive_tract(1)|skin(1)	9		Esophageal squamous(399;0.129)				GCAAGCACTATCTCAGTGCCA	0.413													20	28	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144707928	144707928	+	IGR	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144707928T>A								TPK1 (174782 upstream) : None (None downstream)																							TAGACAAAATTGAAGCTCTAC	0.348													53	150	---	---	---	---	PASS
ZNF777	27153	broad.mit.edu	37	7	149148159	149148159	+	Missense_Mutation	SNP	C	A	A	rs73166023	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149148159C>A	uc003wfv.2	-	4	1181	c.1018G>T	c.(1018-1020)GGG>TGG	p.G340W		NM_015694	NP_056509	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	340	Glu-rich.|KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)	1	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			GGCCGCTCCCCGCGCTCCATC	0.547													40	122	---	---	---	---	PASS
UBE3C	9690	broad.mit.edu	37	7	156967697	156967697	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156967697C>T	uc010lqs.2	+	5	739	c.427C>T	c.(427-429)CAG>TAG	p.Q143*	UBE3C_uc003wnf.2_Nonsense_Mutation_p.Q100*|UBE3C_uc003wng.2_Nonsense_Mutation_p.Q143*	NM_014671	NP_055486	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	143					protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(2)|large_intestine(1)	5		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		ATGCTTATTTCAGATAAAAAG	0.363													23	70	---	---	---	---	PASS
PTPRN2	5799	broad.mit.edu	37	7	157926637	157926637	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157926637G>T	uc003wno.2	-	9	1409	c.1288C>A	c.(1288-1290)CAC>AAC	p.H430N	PTPRN2_uc003wnp.2_Missense_Mutation_p.H413N|PTPRN2_uc003wnq.2_Missense_Mutation_p.H430N|PTPRN2_uc003wnr.2_Missense_Mutation_p.H392N|PTPRN2_uc011kwa.1_Missense_Mutation_p.H453N	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N	430	Extracellular (Potential).					integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		GACTCAGGGTGCTCGGACTTC	0.602													15	178	---	---	---	---	PASS
SLC25A37	51312	broad.mit.edu	37	8	23428853	23428853	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23428853A>T	uc003xdo.2	+	4	655	c.502A>T	c.(502-504)AAG>TAG	p.K168*	SLC25A37_uc003xdp.2_RNA|SLC25A37_uc010ltz.2_RNA|SLC25A37_uc003xdq.2_RNA|SLC25A37_uc003xdr.1_RNA|uc003xds.2_5'Flank	NM_016612	NP_057696	Q9NYZ2	MFRN1_HUMAN	solute carrier family 25, member 37	168	Solcar 2.				ion transport|iron ion homeostasis	integral to membrane|mitochondrial inner membrane					0		Prostate(55;0.114)		Colorectal(74;0.0198)|COAD - Colon adenocarcinoma(73;0.0751)		CACAGTGGTGAAGCAGCGCTT	0.627													3	8	---	---	---	---	PASS
UNC5D	137970	broad.mit.edu	37	8	35648047	35648047	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:35648047C>A	uc003xjr.1	+	17	3156	c.2828C>A	c.(2827-2829)GCC>GAC	p.A943D	UNC5D_uc003xjs.1_Missense_Mutation_p.A938D|UNC5D_uc003xju.1_Missense_Mutation_p.A519D	NM_080872	NP_543148	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D precursor	943	Cytoplasmic (Potential).				apoptosis|axon guidance	integral to membrane	receptor activity			upper_aerodigestive_tract(2)|ovary(2)|pancreas(1)|skin(1)	6				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CTTGATGAAGCCGACTTCAAC	0.493													64	31	---	---	---	---	PASS
ADAM18	8749	broad.mit.edu	37	8	39525515	39525515	+	Splice_Site	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39525515A>T	uc003xni.2	+	14	1327	c.1327_splice	c.e14-2	p.L443_splice	ADAM18_uc010lww.2_Splice_Site|ADAM18_uc010lwx.2_Splice_Site_p.L419_splice	NM_014237	NP_055052	Q9Y3Q7	ADA18_HUMAN	a disintegrin and metalloprotease domain 18						cell differentiation|multicellular organismal development|proteolysis|spermatogenesis	integral to membrane|membrane fraction	metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)|kidney(1)|skin(1)	6		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			TTTTCCTCCCAGTTGTCAATA	0.318													76	39	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41615632	41615632	+	Silent	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41615632C>G	uc003xok.2	-	2	135	c.51G>C	c.(49-51)CTG>CTC	p.L17L	NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoi.2_Silent_p.L17L|ANK1_uc003xoj.2_Silent_p.L17L|ANK1_uc003xol.2_Silent_p.L17L|ANK1_uc003xom.2_Silent_p.L50L	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1	17	89 kDa domain.				axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			TTGCTGCTCTCAGAAAGCTGG	0.527													8	605	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48868517	48868517	+	Intron	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48868517T>A	uc003xqi.2	-						PRKDC_uc003xqj.2_Intron|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic						cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TTCTAGGTTTTAAAAAAAAAA	0.308								NHEJ					14	13	---	---	---	---	PASS
RB1CC1	9821	broad.mit.edu	37	8	53586629	53586629	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53586629T>A	uc003xre.3	-	7	1336	c.778A>T	c.(778-780)AAG>TAG	p.K260*	RB1CC1_uc003xrf.3_Nonsense_Mutation_p.K260*	NM_014781	NP_055596	Q8TDY2	RBCC1_HUMAN	Rb1-inducible coiled coil protein 1 isoform 1	260					autophagy|cell cycle|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytosol|nucleus|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	protein binding			ovary(8)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	11		all_cancers(86;0.137)|all_epithelial(80;0.00494)|Lung NSC(129;0.011)|all_lung(136;0.023)				TCCACTGACTTGGGAAATGAG	0.418													133	100	---	---	---	---	PASS
ATP6V0D2	245972	broad.mit.edu	37	8	87126017	87126017	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87126017T>G	uc003ydp.1	+	2	279	c.210T>G	c.(208-210)ATT>ATG	p.I70M		NM_152565	NP_689778	Q8N8Y2	VA0D2_HUMAN	ATPase, H+ transporting, lysosomal 38kDa, V0	70					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|endosome membrane|proton-transporting V-type ATPase, V0 domain|vacuolar proton-transporting V-type ATPase complex	hydrogen ion transmembrane transporter activity|protein binding				0						TTTCCAAAATTGACACTGAGA	0.388													96	165	---	---	---	---	PASS
ZC3H3	23144	broad.mit.edu	37	8	144550572	144550572	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144550572C>T	uc003yyd.2	-	7	2114	c.2085G>A	c.(2083-2085)GAG>GAA	p.E695E		NM_015117	NP_055932	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	695	C3H1-type 1.				mRNA polyadenylation|poly(A)+ mRNA export from nucleus|regulation of mRNA export from nucleus	nucleus	nucleic acid binding|zinc ion binding			skin(1)	1	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			CGGCCACCTTCTCGGGATCGT	0.667													19	14	---	---	---	---	PASS
C9orf93	203238	broad.mit.edu	37	9	15745613	15745613	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15745613C>T	uc003zmd.2	+	18	2970	c.2655C>T	c.(2653-2655)GAC>GAT	p.D885D	C9orf93_uc003zme.2_Silent_p.D800D|C9orf93_uc011lmu.1_Silent_p.D893D|C9orf93_uc003zmf.1_Silent_p.D193D	NM_173550	NP_775821	Q6TFL3	CI093_HUMAN	hypothetical protein LOC203238	885											0				GBM - Glioblastoma multiforme(50;4.84e-07)		AATTACAAGACGTCATTGGTA	0.363													20	177	---	---	---	---	PASS
TAF1L	138474	broad.mit.edu	37	9	32634826	32634826	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32634826G>T	uc003zrg.1	-	1	842	c.752C>A	c.(751-753)CCA>CAA	p.P251Q	uc003zrh.1_RNA	NM_153809	NP_722516	Q8IZX4	TAF1L_HUMAN	TBP-associated factor RNA polymerase 1-like	251					male meiosis|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription initiation, DNA-dependent	transcription factor TFIID complex	DNA binding|histone acetyltransferase activity|protein serine/threonine kinase activity|TBP-class protein binding			lung(8)|skin(6)|central_nervous_system(4)|large_intestine(3)|ovary(2)|stomach(1)|breast(1)|pancreas(1)	26			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCGAAATTCTGGAAAAAGTTC	0.488													59	101	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130206949	130206949	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130206949C>T	uc004bqw.3	+	5	1384	c.970C>T	c.(970-972)CAG>TAG	p.Q324*	ZNF79_uc011maf.1_Nonsense_Mutation_p.Q300*|ZNF79_uc011mag.1_Nonsense_Mutation_p.Q300*	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	324	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						CACGAACCATCAGAGGACTCA	0.552													4	99	---	---	---	---	PASS
C9orf96	169436	broad.mit.edu	37	9	136253268	136253268	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136253268A>T	uc004cdk.2	+	5	393	c.332A>T	c.(331-333)AAT>ATT	p.N111I	C9orf96_uc004cdl.2_RNA	NM_153710	NP_714921	Q8NE28	SGK71_HUMAN	hypothetical protein LOC169436	111	Protein kinase.						ATP binding|protein kinase activity			stomach(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		ATGGAGTTCAATGAGCTCAGC	0.577													14	123	---	---	---	---	PASS
COL5A1	1289	broad.mit.edu	37	9	137642656	137642656	+	Silent	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137642656C>A	uc004cfe.2	+	13	1972	c.1590C>A	c.(1588-1590)GGC>GGA	p.G530G		NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein	530	Interrupted collagenous region.				axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GAGGTGGCGGCGATGCGGGCT	0.632													13	28	---	---	---	---	PASS
SPAG6	9576	broad.mit.edu	37	10	22676859	22676859	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22676859C>A	uc001iri.2	+	6	928	c.786C>A	c.(784-786)GAC>GAA	p.D262E	SPAG6_uc001irj.2_Missense_Mutation_p.D262E|SPAG6_uc010qct.1_Missense_Mutation_p.D232E|SPAG6_uc009xkh.2_Missense_Mutation_p.D240E	NM_012443	NP_036575	O75602	SPAG6_HUMAN	sperm associated antigen 6 isoform 1	262	ARM 6.				cell projection organization|spermatid development	axoneme|cilium|cytoplasm|flagellum|microtubule	binding			breast(1)	1						GTCTGAAGGACAAGGATGAAT	0.388													13	19	---	---	---	---	PASS
CTNNA3	29119	broad.mit.edu	37	10	68979440	68979440	+	Silent	SNP	T	G	G	rs140926333	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68979440T>G	uc009xpn.1	-	6	891	c.768A>C	c.(766-768)TCA>TCC	p.S256S	CTNNA3_uc001jmw.2_Silent_p.S256S|CTNNA3_uc001jmx.3_Silent_p.S256S|CTNNA3_uc009xpo.1_Silent_p.S116S|CTNNA3_uc001jna.2_Silent_p.S268S	NM_001127384	NP_001120856	Q9UI47	CTNA3_HUMAN	catenin, alpha 3	256					cell-cell adhesion	actin cytoskeleton|cytoplasm|fascia adherens	cadherin binding|structural molecule activity			skin(3)|ovary(2)|pancreas(1)|lung(1)|central_nervous_system(1)	8						GGATCCCTTGTGAAGCATTTG	0.458													62	107	---	---	---	---	PASS
PBLD	64081	broad.mit.edu	37	10	70051922	70051922	+	Silent	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:70051922G>T	uc001jns.1	-	5	560	c.357C>A	c.(355-357)ATC>ATA	p.I119I	PBLD_uc001jnr.1_Silent_p.I86I|PBLD_uc001jnt.1_Silent_p.I119I|PBLD_uc001jnu.1_Silent_p.I119I|PBLD_uc001jnv.1_Silent_p.I86I	NM_022129	NP_071412	P30039	PBLD_HUMAN	MAWD binding protein isoform a	119					biosynthetic process		isomerase activity			skin(2)|ovary(1)	3						AGTCCAGGACGATGCCATCCT	0.468													15	79	---	---	---	---	PASS
ZMIZ1	57178	broad.mit.edu	37	10	81070737	81070737	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81070737C>A	uc001kaf.2	+	24	3464	c.2892C>A	c.(2890-2892)CAC>CAA	p.H964Q	ZMIZ1_uc001kag.2_Missense_Mutation_p.H840Q|ZMIZ1_uc010qlq.1_Intron	NM_020338	NP_065071	Q9ULJ6	ZMIZ1_HUMAN	retinoic acid induced 17	964	Pro-rich.				transcription, DNA-dependent	cytoplasm|nuclear speck	zinc ion binding			ovary(2)|breast(1)|skin(1)	4	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			AAGGTTTGCACGTACCACACC	0.522													47	86	---	---	---	---	PASS
ACSL5	51703	broad.mit.edu	37	10	114170256	114170256	+	Intron	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114170256A>T	uc001kzs.2	+						ACSL5_uc001kzt.2_Intron|ACSL5_uc001kzu.2_Intron|ACSL5_uc009xxz.2_Intron|ACSL5_uc010qrj.1_Intron	NM_203379	NP_976313	Q9ULC5	ACSL5_HUMAN	acyl-CoA synthetase long-chain family member 5						fatty acid metabolic process|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|mitochondrial outer membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(2)|skin(1)	3		Colorectal(252;0.117)|Breast(234;0.222)		Epithelial(162;0.0343)|all cancers(201;0.137)		AACCTGTGGTAAGTTTTCTTC	0.438													16	24	---	---	---	---	PASS
PRKCDBP	112464	broad.mit.edu	37	11	6340731	6340731	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:6340731G>A	uc001mcu.1	-	2	482	c.448C>T	c.(448-450)CAG>TAG	p.Q150*		NM_145040	NP_659477	Q969G5	PRDBP_HUMAN	protein kinase C, delta binding protein	150											0		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AGCTCGGACTGGTCCGCCGGG	0.677													8	16	---	---	---	---	PASS
USH1C	10083	broad.mit.edu	37	11	17542900	17542900	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17542900T>C	uc001mnf.2	-	13	1187	c.1078A>G	c.(1078-1080)ATG>GTG	p.M360V	USH1C_uc001mne.2_Missense_Mutation_p.M360V|USH1C_uc009yhb.2_Missense_Mutation_p.M341V|USH1C_uc001mng.2_RNA|USH1C_uc001mnd.2_Missense_Mutation_p.M324V	NM_005709	NP_005700	Q9Y6N9	USH1C_HUMAN	harmonin isoform a	360	Potential.				equilibrioception|G2/M transition of mitotic cell cycle|photoreceptor cell maintenance|sensory perception of sound	apical part of cell|cytoplasm|stereocilium	protein binding			ovary(1)	1						CACTGTTCCATCTCCTTCCGG	0.512													90	138	---	---	---	---	PASS
OR5D18	219438	broad.mit.edu	37	11	55587340	55587340	+	Missense_Mutation	SNP	G	T	T	rs142474714	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55587340G>T	uc010rin.1	+	1	235	c.235G>T	c.(235-237)GCT>TCT	p.A79S		NM_001001952	NP_001001952	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D,	79	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|ovary(1)	3		all_epithelial(135;0.208)				CTCCATCATTGCTCCCAAGAT	0.408													63	133	---	---	---	---	PASS
OR5D16	390144	broad.mit.edu	37	11	55607000	55607000	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55607000T>C	uc010rio.1	+	1	773	c.773T>C	c.(772-774)CTC>CCC	p.L258P		NM_001005496	NP_001005496	Q8NGK9	OR5DG_HUMAN	olfactory receptor, family 5, subfamily D,	258	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_epithelial(135;0.208)				GGCACCATCCTCTTCCTCTAC	0.537													7	110	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904449	55904449	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904449G>T	uc010riz.1	-	1	746	c.746C>A	c.(745-747)ACG>AAG	p.T249K		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					ATAGAAAACCGTGACTGCTAT	0.398													5	77	---	---	---	---	PASS
P2RX3	5024	broad.mit.edu	37	11	57117346	57117346	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57117346C>A	uc001nju.2	+	7	755	c.679C>A	c.(679-681)CAG>AAG	p.Q227K		NM_002559	NP_002550	P56373	P2RX3_HUMAN	purinergic receptor P2X3	227	Extracellular (Potential).				positive regulation of calcium ion transport into cytosol|positive regulation of calcium-mediated signaling	integral to plasma membrane	ATP binding|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity				0						GTTTGCGGGGCAGGATTTTGC	0.602											OREG0020966	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	15	36	---	---	---	---	PASS
HNRNPUL2	221092	broad.mit.edu	37	11	62483404	62483404	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62483404C>A	uc001nuw.2	-	12	2180	c.1987G>T	c.(1987-1989)GGG>TGG	p.G663W	HNRNPUL2_uc001nuu.1_RNA	NM_001079559	NP_001073027	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like	663					cell killing	nucleus	ATP binding|nucleic acid binding				0						CGGCGCTGCCCGCCCACTGGA	0.602													8	22	---	---	---	---	PASS
SLC22A10	387775	broad.mit.edu	37	11	63071614	63071614	+	Silent	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63071614G>T	uc009yor.2	+	8	1528	c.1320G>T	c.(1318-1320)CTG>CTT	p.L440L	SLC22A10_uc010rmo.1_Intron|SLC22A10_uc001nwu.3_RNA|SLC22A10_uc010rmp.1_Missense_Mutation_p.W234L	NM_001039752	NP_001034841	Q63ZE4	S22AA_HUMAN	solute carrier family 22, member 10	440	Helical; (Potential).					integral to membrane	transmembrane transporter activity			ovary(2)	2						TGGCATGTCTGGGAATCGGCT	0.488													56	113	---	---	---	---	PASS
TMEM151A	256472	broad.mit.edu	37	11	66062455	66062455	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66062455C>T	uc001ohl.2	+	2	850	c.738C>T	c.(736-738)AAC>AAT	p.N246N		NM_153266	NP_694998	Q8N4L1	T151A_HUMAN	transmembrane protein 151A	246						integral to membrane				central_nervous_system(1)	1						TCAGCGCCAACGAGGGCCTGG	0.692													6	8	---	---	---	---	PASS
PELI3	246330	broad.mit.edu	37	11	66243384	66243384	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66243384C>G	uc001oic.3	+	8	1320	c.1156C>G	c.(1156-1158)CTC>GTC	p.L386V	PELI3_uc001oid.3_Missense_Mutation_p.L362V|PELI3_uc001oie.3_Missense_Mutation_p.L237V	NM_145065	NP_659502	Q8N2H9	PELI3_HUMAN	pellino 3 alpha isoform 1	386						cytosol	protein binding			ovary(1)	1						CGAATGTCCTCTCTGCCGCCT	0.697													10	21	---	---	---	---	PASS
XRRA1	143570	broad.mit.edu	37	11	74644890	74644890	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74644890A>G	uc009yub.2	-	5	639	c.307T>C	c.(307-309)TCA>CCA	p.S103P	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovo.2_5'UTR|XRRA1_uc001ovq.3_Missense_Mutation_p.S103P|XRRA1_uc001ovp.3_5'UTR|XRRA1_uc001ovr.2_5'UTR	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	103					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						CACAGATCTGATGGCTTCCTC	0.478													9	8	---	---	---	---	PASS
KCTD21	283219	broad.mit.edu	37	11	77885071	77885071	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77885071T>C	uc001ozb.2	-	2	605	c.530A>G	c.(529-531)CAC>CGC	p.H177R		NM_001029859	NP_001025030	Q4G0X4	KCD21_HUMAN	potassium channel tetramerisation domain	177						voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			GTCCTGCAAGTGGCTGGTGAT	0.567													60	85	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83809999	83809999	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83809999G>T	uc001paj.2	-	5	704	c.401C>A	c.(400-402)CCA>CAA	p.P134Q	DLG2_uc001pai.2_Missense_Mutation_p.P83Q|DLG2_uc010rsy.1_Missense_Mutation_p.P101Q|DLG2_uc010rsz.1_Missense_Mutation_p.P134Q|DLG2_uc010rta.1_Missense_Mutation_p.P134Q|DLG2_uc001pak.2_Missense_Mutation_p.P239Q|DLG2_uc010rtb.1_Missense_Mutation_p.P101Q|DLG2_uc001pal.1_Missense_Mutation_p.P134Q|DLG2_uc001pam.1_Missense_Mutation_p.P173Q	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	134	PDZ 1.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AGCACCTCCTGGTATAATCTT	0.428													5	9	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83810000	83810000	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83810000G>T	uc001paj.2	-	5	703	c.400C>A	c.(400-402)CCA>ACA	p.P134T	DLG2_uc001pai.2_Missense_Mutation_p.P83T|DLG2_uc010rsy.1_Missense_Mutation_p.P101T|DLG2_uc010rsz.1_Missense_Mutation_p.P134T|DLG2_uc010rta.1_Missense_Mutation_p.P134T|DLG2_uc001pak.2_Missense_Mutation_p.P239T|DLG2_uc010rtb.1_Missense_Mutation_p.P101T|DLG2_uc001pal.1_Missense_Mutation_p.P134T|DLG2_uc001pam.1_Missense_Mutation_p.P173T	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	134	PDZ 1.					cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GCACCTCCTGGTATAATCTTC	0.428													5	9	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89135487	89135487	+	Intron	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89135487A>T	uc001pct.2	-						NOX4_uc009yvr.2_Intron|NOX4_uc001pcu.2_Intron|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Intron|NOX4_uc009yvo.2_Intron|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Intron|NOX4_uc010rtv.1_Intron|NOX4_uc009yvq.2_Intron	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a						cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				CACAAAATTAATCTGACCTGT	0.353													12	16	---	---	---	---	PASS
VWA5A	4013	broad.mit.edu	37	11	124005701	124005701	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124005701C>T	uc001pzu.2	+	12	1528	c.1319C>T	c.(1318-1320)ACC>ATC	p.T440I	VWA5A_uc001pzt.2_Missense_Mutation_p.T440I	NM_001130142	NP_001123614	O00534	VMA5A_HUMAN	BCSC-1 isoform 1	440	VWFA.									upper_aerodigestive_tract(1)|ovary(1)	2						TCAGGGGGCACCTCAGAATTT	0.507													13	75	---	---	---	---	PASS
CHD4	1108	broad.mit.edu	37	12	6700653	6700653	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6700653C>G	uc001qpo.2	-	22	3483	c.3319G>C	c.(3319-3321)GAG>CAG	p.E1107Q	CHD4_uc001qpn.2_Missense_Mutation_p.E1100Q|CHD4_uc001qpp.2_Missense_Mutation_p.E1104Q	NM_001273	NP_001264	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1107	Helicase C-terminal.				chromatin modification|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	microtubule organizing center|NuRD complex	ATP binding|ATP-dependent DNA helicase activity|DNA binding|zinc ion binding			central_nervous_system(2)	2						TCAATGGCCTCTTGCCGCATG	0.443													14	112	---	---	---	---	PASS
PRB4	5545	broad.mit.edu	37	12	11461806	11461806	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11461806T>C	uc001qzf.1	-	3	145	c.111A>G	c.(109-111)GAA>GAG	p.E37E	PRB4_uc001qzt.2_Silent_p.E37E	NM_002723	NP_002714	P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	37	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.|1.			LISGKPEGR -> IIPPKPPG (in Ref. 5; AA sequence).|E -> Q (in Ref. 2; CAA30543 and 7; CAA30542).		extracellular region				ovary(1)	1						GGCGTCGTCCTTCTGGCTTTC	0.532										HNSCC(22;0.051)			45	416	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	22068692	22068692	+	Silent	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22068692A>T	uc001rfi.1	-	5	746	c.726T>A	c.(724-726)CCT>CCA	p.P242P	ABCC9_uc001rfh.2_Silent_p.P242P|ABCC9_uc001rfj.1_Silent_p.P242P	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	242	Cytoplasmic (Potential).				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	TCAGATCAATAGGCTTTTTGT	0.368													9	110	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22646146	22646146	+	Intron	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22646146T>C	uc001rfq.2	-						KIAA0528_uc010sir.1_Intron|KIAA0528_uc010sis.1_Intron|KIAA0528_uc010sit.1_Intron|KIAA0528_uc010siu.1_Intron|KIAA0528_uc001rfr.2_Intron|KIAA0528_uc009ziy.1_Intron	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847								protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						CAAGTTGTTATTATCATTTAC	0.328													37	50	---	---	---	---	PASS
ITPR2	3709	broad.mit.edu	37	12	26636760	26636760	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26636760G>T	uc001rhg.2	-	42	6300	c.5883C>A	c.(5881-5883)TGC>TGA	p.C1961*	ITPR2_uc009zjg.1_Nonsense_Mutation_p.C112*	NM_002223	NP_002214	Q14571	ITPR2_HUMAN	inositol 1,4,5-triphosphate receptor, type 2	1961	Cytoplasmic (Potential).				activation of phospholipase C activity|energy reserve metabolic process|nerve growth factor receptor signaling pathway|platelet activation|regulation of insulin secretion|response to hypoxia	integral to membrane|plasma membrane enriched fraction|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	calcium ion transmembrane transporter activity|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity			kidney(6)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)	14	Colorectal(261;0.0847)					TTCCACAAATGCAGTCCAGAA	0.438													5	230	---	---	---	---	PASS
PTHLH	5744	broad.mit.edu	37	12	28122817	28122817	+	5'UTR	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:28122817T>C	uc001rik.2	-	1					PTHLH_uc001ril.2_Intron|PTHLH_uc001rim.2_5'UTR|PTHLH_uc001rin.2_Intron	NM_198966	NP_945317	P12272	PTHR_HUMAN	parathyroid hormone-like hormone isoform 1						activation of adenylate cyclase activity by G-protein signaling pathway|cAMP metabolic process|cell-cell signaling|epidermis development|female pregnancy|negative regulation of cell proliferation|negative regulation of chondrocyte differentiation|positive regulation of cAMP biosynthetic process|positive regulation of cell proliferation	cytoplasm|extracellular space|nucleus	hormone activity|peptide hormone receptor binding			breast(1)	1	Lung SC(9;0.184)					GCAGTTCTCCTGGGTTCGTGG	0.438													91	118	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49439754	49439754	+	Intron	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49439754T>C	uc001rta.3	-							NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2						chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						ACAGGCGCTATGGAGAGAAGG	0.458			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			9	47	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53448212	53448212	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53448212G>C	uc001sbp.2	+	7	644	c.509G>C	c.(508-510)CGG>CCG	p.R170P	uc001sbk.1_RNA|TENC1_uc001sbl.2_Missense_Mutation_p.R46P|TENC1_uc001sbm.2_Missense_Mutation_p.R180P|TENC1_uc001sbn.2_Missense_Mutation_p.R180P|TENC1_uc001sbo.1_Missense_Mutation_p.R170P	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	170	Phosphatase tensin-type.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding	p.R170P(1)		ovary(1)|pancreas(1)	2						TCCAAGCACCGGGACAAGTAC	0.672													4	34	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53453230	53453230	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53453230G>T	uc001sbp.2	+	18	1940	c.1805G>T	c.(1804-1806)TGC>TTC	p.C602F	TENC1_uc001sbl.2_Missense_Mutation_p.C478F|TENC1_uc001sbn.2_Missense_Mutation_p.C612F|TENC1_uc001sbq.2_Missense_Mutation_p.C97F|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Missense_Mutation_p.C97F|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	602					intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						CGGGAGCCCTGCGGGGTTCCC	0.706													6	11	---	---	---	---	PASS
TENC1	23371	broad.mit.edu	37	12	53454751	53454751	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53454751C>T	uc001sbp.2	+	20	3196	c.3061C>T	c.(3061-3063)CGA>TGA	p.R1021*	TENC1_uc001sbl.2_Nonsense_Mutation_p.R897*|TENC1_uc001sbn.2_Nonsense_Mutation_p.R1031*|TENC1_uc001sbq.2_Nonsense_Mutation_p.R419*|TENC1_uc001sbr.2_RNA|TENC1_uc009zmr.2_Nonsense_Mutation_p.R516*|TENC1_uc001sbs.2_5'Flank	NM_170754	NP_736610	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase	1021	Pro-rich.				intracellular signal transduction|negative regulation of cell proliferation	focal adhesion	metal ion binding|phosphoprotein phosphatase activity|protein binding			ovary(1)|pancreas(1)	2						GCAAGGCCCTCGAGGCCCCCC	0.687													9	15	---	---	---	---	PASS
HOXC5	3222	broad.mit.edu	37	12	54427002	54427002	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54427002G>A	uc001sew.2	+	1	171	c.96G>A	c.(94-96)GAG>GAA	p.E32E	HOXC5_uc001set.2_Intron|HOXC4_uc001seu.2_Intron|MIR615_hsa-mir-615|MI0003628_5'Flank	NM_018953	NP_061826	Q00444	HXC5_HUMAN	homeobox C5	32					regulation of transcription from RNA polymerase II promoter	cell junction|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						CGGCCTCAGAGGTGCAGGCAT	0.542													49	58	---	---	---	---	PASS
IFNG	3458	broad.mit.edu	37	12	68551865	68551865	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68551865C>G	uc001stw.1	-	3	320	c.194G>C	c.(193-195)AGA>ACA	p.R65T		NM_000619	NP_000610	P01579	IFNG_HUMAN	interferon, gamma precursor	65					cell cycle arrest|interferon-gamma-mediated signaling pathway|negative regulation of interleukin-17 production|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|negative regulation of metanephric nephron tubule epithelial cell differentiation|negative regulation of smooth muscle cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of calcidiol 1-monooxygenase activity|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity|positive regulation of fructose 1,6-bisphosphate metabolic process|positive regulation of interleukin-12 production|positive regulation of interleukin-23 production|positive regulation of killing of cells of other organism|positive regulation of membrane protein ectodomain proteolysis|positive regulation of mesenchymal cell proliferation|positive regulation of nitric oxide biosynthetic process|positive regulation of osteoclast differentiation|positive regulation of peptidyl-serine phosphorylation of STAT protein|positive regulation of smooth muscle cell apoptosis|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production|positive regulation of tyrosine phosphorylation of Stat1 protein|positive regulation of vitamin D biosynthetic process|protein import into nucleus, translocation|regulation of insulin secretion|regulation of interferon-gamma-mediated signaling pathway|response to virus	extracellular space	cytokine activity|interferon-gamma receptor binding				0			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Interferon gamma-1b(DB00033)|Simvastatin(DB00641)	CATTATTTTTCTGTCACTCTC	0.373													12	12	---	---	---	---	PASS
UBE2N	7334	broad.mit.edu	37	12	93804506	93804506	+	Intron	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93804506A>G	uc001tcp.2	-							NM_003348	NP_003339	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N						DNA double-strand break processing|double-strand break repair via homologous recombination|histone ubiquitination|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of DNA repair|positive regulation of histone modification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity|postreplication repair|protein K63-linked ubiquitination|proteolysis|regulation of histone ubiquitination|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-MMS2 complex|UBC13-UEV1A complex|ubiquitin ligase complex	ATP binding|ubiquitin binding|ubiquitin-protein ligase activity				0						TGAATATTAGATACCTGTTTC	0.393								Direct_reversal_of_damage|Rad6_pathway					12	139	---	---	---	---	PASS
UBE2N	7334	broad.mit.edu	37	12	93804845	93804845	+	Silent	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93804845A>G	uc001tcp.2	-	2	627	c.261T>C	c.(259-261)TGT>TGC	p.C87C		NM_003348	NP_003339	P61088	UBE2N_HUMAN	ubiquitin-conjugating enzyme E2N	87		Glycyl thioester intermediate.		C->A: Loss of polyubiquitination of PCNA. Impairs interaction with SHPRH.	DNA double-strand break processing|double-strand break repair via homologous recombination|histone ubiquitination|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of DNA repair|positive regulation of histone modification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of ubiquitin-protein ligase activity|postreplication repair|protein K63-linked ubiquitination|proteolysis|regulation of histone ubiquitination|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleus|UBC13-MMS2 complex|UBC13-UEV1A complex|ubiquitin ligase complex	ATP binding|ubiquitin binding|ubiquitin-protein ligase activity				0						AAATATCTAAACATATTCTTC	0.323								Direct_reversal_of_damage|Rad6_pathway					15	41	---	---	---	---	PASS
PLXNC1	10154	broad.mit.edu	37	12	94697543	94697543	+	Silent	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94697543T>A	uc001tdc.2	+	29	4647	c.4398T>A	c.(4396-4398)ACT>ACA	p.T1466T	PLXNC1_uc010sut.1_Silent_p.T513T|PLXNC1_uc009zsv.2_Silent_p.T205T	NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor	1466	Cytoplasmic (Potential).				axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						AAGCACCAACTAATAAGCTTC	0.274													3	28	---	---	---	---	PASS
FGD6	55785	broad.mit.edu	37	12	95602706	95602706	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95602706T>C	uc001tdp.3	-	2	2578	c.2354A>G	c.(2353-2355)GAC>GGC	p.D785G	FGD6_uc009zsx.2_Intron	NM_018351	NP_060821	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	785					actin cytoskeleton organization|filopodium assembly|regulation of Cdc42 GTPase activity|regulation of cell shape	cytoskeleton|Golgi apparatus|lamellipodium|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(2)|breast(1)	3						TGCATCAGCGTCCTCCATGCT	0.463													12	104	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95656769	95656769	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95656769G>C	uc001tdz.2	+	4	451	c.346G>C	c.(346-348)GAT>CAT	p.D116H	VEZT_uc009zsy.1_Intron|VEZT_uc001tdr.2_Intron|VEZT_uc001tds.2_Missense_Mutation_p.D68H|VEZT_uc001tdt.2_Missense_Mutation_p.D68H|VEZT_uc009zsz.1_Missense_Mutation_p.D116H|VEZT_uc001tdv.2_Missense_Mutation_p.D85H|VEZT_uc001tdw.1_Missense_Mutation_p.D68H|VEZT_uc009zta.1_Missense_Mutation_p.D68H	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	116						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						TGAGCTACTTGATCCCAGTAT	0.458													5	186	---	---	---	---	PASS
C12orf63	374467	broad.mit.edu	37	12	97093757	97093757	+	Silent	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:97093757C>A	uc001tet.1	+	13	1713	c.1635C>A	c.(1633-1635)GTC>GTA	p.V545V		NM_198520	NP_940922	Q6ZTY8	CL063_HUMAN	hypothetical protein LOC374467	545										skin(6)|ovary(1)	7						AGATAGAAGTCCTTATAGATT	0.313													21	49	---	---	---	---	PASS
ISCU	23479	broad.mit.edu	37	12	108960978	108960978	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:108960978T>C	uc010sxc.1	+	4	457	c.352T>C	c.(352-354)TTG>CTG	p.L118L	ISCU_uc010sxa.1_Silent_p.L118L|ISCU_uc010sxb.1_Silent_p.L118L|ISCU_uc001tnc.3_Silent_p.L93L|ISCU_uc009zuy.2_Silent_p.L93L|ISCU_uc010sxd.1_Silent_p.L118L	NM_213595	NP_998760	Q9H1K1	ISCU_HUMAN	iron-sulfur cluster assembly enzyme isoform	118					iron-sulfur cluster assembly|nitrogen fixation	cytosol|mitochondrion|nucleus	iron ion binding|iron-sulfur cluster binding|protein complex scaffold				0						GGAGGAAGCCTTGACTATCAA	0.498													5	152	---	---	---	---	PASS
DNAH10	196385	broad.mit.edu	37	12	124311350	124311350	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124311350C>T	uc001uft.3	+	24	3967	c.3942C>T	c.(3940-3942)GGC>GGT	p.G1314G		NM_207437	NP_997320	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1314	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(3)|skin(2)|central_nervous_system(1)	6	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		CAGTCCGTGGCTTATCAGTGA	0.458													60	83	---	---	---	---	PASS
GLT1D1	144423	broad.mit.edu	37	12	129431905	129431905	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129431905G>T	uc010tbh.1	+	11	706	c.697G>T	c.(697-699)GGA>TGA	p.G233*	GLT1D1_uc001uhx.1_Nonsense_Mutation_p.G148*|GLT1D1_uc001uhy.1_RNA	NM_144669	NP_653270	Q96MS3	GL1D1_HUMAN	glycosyltransferase 1 domain containing 1	228					biosynthetic process	extracellular region	transferase activity, transferring glycosyl groups				0	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.97e-06)|Epithelial(86;3.97e-05)|all cancers(50;0.00019)		ACGATTGATTGGAGAGATGCC	0.512													9	65	---	---	---	---	PASS
FZD10	11211	broad.mit.edu	37	12	130649114	130649114	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130649114A>T	uc001uii.2	+	1	2083	c.1627A>T	c.(1627-1629)AGC>TGC	p.S543C	uc001uig.1_5'Flank|uc001uih.1_5'Flank	NM_007197	NP_009128	Q9ULW2	FZD10_HUMAN	frizzled 10 precursor	543	Cytoplasmic (Potential).				brain development|canonical Wnt receptor signaling pathway|cellular response to retinoic acid|embryo development|gonad development|negative regulation of Rho GTPase activity|neuron differentiation|non-canonical Wnt receptor signaling pathway|positive regulation of JUN kinase activity|positive regulation of Rac GTPase activity|regulation of actin cytoskeleton organization|vasculature development	cell projection|cell surface|cytoplasm|integral to plasma membrane	G-protein coupled receptor activity|PDZ domain binding|Wnt receptor activity|Wnt-protein binding			lung(3)|breast(1)|central_nervous_system(1)	5	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.3e-06)|Epithelial(86;1.66e-05)|all cancers(50;5.18e-05)		AAAGAAGAAGAGCCGGAGAAA	0.552													28	42	---	---	---	---	PASS
TUBA3C	7278	broad.mit.edu	37	13	19751242	19751242	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19751242G>C	uc009zzj.2	-	4	930	c.881C>G	c.(880-882)GCC>GGC	p.A294G		NM_006001	NP_005992	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	294					'de novo' posttranslational protein folding|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(3)|skin(2)	5		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		CTCGAAGCAGGCATTGGTGAT	0.612													7	178	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29599515	29599515	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29599515C>A	uc001usl.3	+	1	768	c.710C>A	c.(709-711)GCA>GAA	p.A237E		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	227						cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						GCTGTCCCGGCAGCTTTCCCT	0.582													24	38	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35769999	35769999	+	Splice_Site	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35769999A>G	uc001uvb.2	+	31	5134	c.4928_splice	c.e31-2	p.E1643_splice	NBEA_uc010abi.2_Splice_Site_p.E299_splice	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTTTCATTACAGAAACACCTG	0.308													24	47	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77743836	77743836	+	Silent	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77743836T>C	uc001vkf.2	-	40	5785	c.5694A>G	c.(5692-5694)CCA>CCG	p.P1898P	MYCBP2_uc010aev.2_Silent_p.P1302P	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	1898					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCAGCAGTTCTGGAATGTCAT	0.383													33	35	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109365035	109365035	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109365035G>T	uc001vqt.1	+	3	379	c.253G>T	c.(253-255)GAC>TAC	p.D85Y	MYO16_uc010agk.1_Missense_Mutation_p.D107Y	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	85	ANK 1.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			GGAGGGGGCAGACCCCCACAC	0.567													43	76	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19553578	19553578	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19553578G>A	uc001vuz.1	+	1	214	c.162G>A	c.(160-162)ATG>ATA	p.M54I	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	54										ovary(1)	1						ATTCTGCTATGAAGACACTCA	0.617													52	561	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249408	20249408	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249408G>A	uc010tku.1	+	1	927	c.927G>A	c.(925-927)TTG>TTA	p.L309L		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	309	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		AATATATTTTGTGTGAAGAGA	0.343													9	15	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	14	22600770	22600770	+	Intron	SNP	A	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22600770A>C	uc001wbw.2	+						uc010aiv.1_Intron|uc010tmi.1_Intron|uc010tmj.1_Intron|uc010aja.1_Intron|uc010tmk.1_Intron|uc010tmo.1_Intron|uc001wco.2_Intron|uc010aje.1_Intron|uc001wcp.2_Intron|uc001wcr.1_Intron|uc001wcs.1_Intron|uc010ajf.1_Intron|uc010ajg.1_Intron|uc001wcx.3_Intron|uc001wdd.2_Intron|uc010ajj.1_Intron|uc001wde.1_Intron|uc010tmq.1_5'Flank					SubName: Full=Alpha-chain C region; Flags: Fragment;																		TCTGGAACTGAAGTGCAACTA	0.498													25	28	---	---	---	---	PASS
MMP14	4323	broad.mit.edu	37	14	23313949	23313949	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23313949T>C	uc001whc.2	+	8	1495	c.1261T>C	c.(1261-1263)TGG>CGG	p.W421R		NM_004995	NP_004986	P50281	MMP14_HUMAN	matrix metalloproteinase 14 preproprotein	421	Hemopexin-like 3.|Extracellular (Potential).					extracellular matrix|integral to plasma membrane|melanosome	calcium ion binding|metalloendopeptidase activity|zinc ion binding				0	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)		TGCTCTCTTCTGGATGCCCAA	0.547													6	148	---	---	---	---	PASS
MYH6	4624	broad.mit.edu	37	14	23855298	23855298	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23855298C>A	uc001wjv.2	-	34	5069	c.5002G>T	c.(5002-5004)GAC>TAC	p.D1668Y		NM_002471	NP_002462	P13533	MYH6_HUMAN	myosin heavy chain 6	1668	Potential.				adult heart development|atrial cardiac muscle tissue morphogenesis|cardiac muscle fiber development|in utero embryonic development|muscle filament sliding|regulation of ATPase activity|regulation of blood pressure|regulation of heart rate|regulation of the force of heart contraction|sarcomere organization|striated muscle contraction|ventricular cardiac muscle tissue morphogenesis|visceral muscle development	cytosol|focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|protein kinase binding|structural constituent of muscle			pancreas(2)|ovary(1)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TCCTTCAGGTCGTCGTTGGCA	0.642													27	41	---	---	---	---	PASS
RTN1	6252	broad.mit.edu	37	14	60193847	60193847	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60193847G>T	uc001xen.1	-	3	1764	c.1555C>A	c.(1555-1557)CCG>ACG	p.P519T	RTN1_uc001xem.1_Missense_Mutation_p.P99T	NM_021136	NP_066959	Q16799	RTN1_HUMAN	reticulon 1 isoform A	519					neuron differentiation	integral to endoplasmic reticulum membrane	signal transducer activity			ovary(2)|central_nervous_system(2)	4				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		AAGGAACCCGGCTCGGCCAGG	0.721													7	8	---	---	---	---	PASS
EXD2	55218	broad.mit.edu	37	14	69704299	69704299	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69704299G>A	uc001xkt.2	+	10	1584	c.925G>A	c.(925-927)GTG>ATG	p.V309M	EXD2_uc001xku.2_Missense_Mutation_p.V179M|EXD2_uc001xkv.2_Missense_Mutation_p.V434M|EXD2_uc001xkw.2_Missense_Mutation_p.V309M|EXD2_uc010aqt.2_Missense_Mutation_p.V434M|EXD2_uc010tte.1_Missense_Mutation_p.V434M|EXD2_uc001xky.2_Missense_Mutation_p.V309M	NM_018199	NP_060669	Q9NVH0	EXD2_HUMAN	exonuclease 3'-5' domain containing 2	309					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						CAGGAAGAACGTGATTCCACA	0.547													30	44	---	---	---	---	PASS
ACOT2	10965	broad.mit.edu	37	14	74036246	74036246	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74036246G>T	uc001xon.3	+	1	475	c.302G>T	c.(301-303)CGC>CTC	p.R101L	ACOT1_uc010tuc.1_Intron|ACOT2_uc001xom.2_Intron	NM_006821	NP_006812	P49753	ACOT2_HUMAN	acyl-CoA thioesterase 2	101					acyl-CoA metabolic process|long-chain fatty acid metabolic process|very long-chain fatty acid metabolic process	mitochondrion	carboxylesterase activity|palmitoyl-CoA hydrolase activity|protein binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0033)|OV - Ovarian serous cystadenocarcinoma(108;0.0639)		GCGTCCCTGCGCGACGAGAAG	0.746													6	10	---	---	---	---	PASS
STON2	85439	broad.mit.edu	37	14	81744701	81744701	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81744701C>T	uc010tvu.1	-	4	1155	c.954G>A	c.(952-954)GAG>GAA	p.E318E	STON2_uc001xvk.1_Silent_p.E318E|STON2_uc010tvt.1_Silent_p.E115E	NM_033104	NP_149095	Q8WXE9	STON2_HUMAN	stonin 2	318					endocytosis|intracellular protein transport|regulation of endocytosis	clathrin adaptor complex|nucleolus	protein binding			skin(3)|pancreas(2)	5				BRCA - Breast invasive adenocarcinoma(234;0.0348)		CCTGCAGAGTCTCATTCAGGA	0.502													5	101	---	---	---	---	PASS
SNRPN	6638	broad.mit.edu	37	15	25232096	25232096	+	Intron	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25232096C>G	uc001ywz.1	+						PAR-SN_uc001yxa.1_Intron|PAR-SN_uc001yxc.2_Intron|PAR5_uc001yxd.2_RNA			P63162	RSMN_HUMAN	Homo sapiens SNRPN upstream reading frame protein (SNURF) mRNA, complete cds.						RNA splicing	small nuclear ribonucleoprotein complex|spliceosomal complex	identical protein binding|RNA binding			ovary(1)	1		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		ATCATTATTTCTTGAATTGGA	0.323									Prader-Willi_syndrome				33	78	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86124576	86124576	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86124576G>T	uc002blv.1	+	7	3447	c.3277G>T	c.(3277-3279)GGG>TGG	p.G1093W	AKAP13_uc002blt.1_Missense_Mutation_p.G1093W|AKAP13_uc002blu.1_Missense_Mutation_p.G1093W|AKAP13_uc010bne.1_5'Flank	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	1093					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						GGATGTTACAGGGGTTAATGC	0.478													51	75	---	---	---	---	PASS
BLM	641	broad.mit.edu	37	15	91326040	91326040	+	Intron	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:91326040G>A	uc002bpr.2	+						BLM_uc010uqh.1_Intron|BLM_uc010uqi.1_Intron|BLM_uc010bnx.2_Intron|BLM_uc002bps.1_Intron	NM_000057	NP_000048	P54132	BLM_HUMAN	Bloom syndrome protein						double-strand break repair via homologous recombination|G2 phase of mitotic cell cycle|G2/M transition DNA damage checkpoint|negative regulation of cell division|positive regulation of transcription, DNA-dependent|protein oligomerization|regulation of cyclin-dependent protein kinase activity|replication fork processing|replication fork protection|response to X-ray	cytoplasm|lateral element|nuclear matrix|nucleolus|PML body	ATP binding|bubble DNA binding|DNA strand annealing activity|four-way junction helicase activity|G-quadruplex DNA binding|p53 binding			ovary(3)|skin(2)|breast(1)	6	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TTTATGTTTGGGACTTTTTTA	0.219			Mis|N|F			leukemia|lymphoma|skin squamous cell |other cancers		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Bloom_syndrome				11	15	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100339924	100339924	+	RNA	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100339924G>A	uc010urx.1	-	4		c.1003C>T			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|uc002bvq.2_5'Flank|uc002bvt.1_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						GCCTCTTTCAGCACGTGGTGC	0.632													17	27	---	---	---	---	PASS
PDXDC1	23042	broad.mit.edu	37	16	15100243	15100243	+	Intron	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15100243C>T	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ATATGTATCTCTTAACAGATA	0.338													5	95	---	---	---	---	PASS
ACSM1	116285	broad.mit.edu	37	16	20648489	20648489	+	Intron	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20648489C>A	uc002dhm.1	-						ACSM1_uc002dhn.1_Intron|ACSM1_uc010bwg.1_Intron	NM_052956	NP_443188	Q08AH1	ACSM1_HUMAN	acyl-CoA synthetase medium-chain family member						benzoate metabolic process|butyrate metabolic process|energy derivation by oxidation of organic compounds|fatty acid oxidation|xenobiotic metabolic process	mitochondrial matrix	acyl-CoA ligase activity|ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			central_nervous_system(1)|skin(1)	2						GTGTGATGCCCTGGCTGCCAG	0.308													31	123	---	---	---	---	PASS
EEF2K	29904	broad.mit.edu	37	16	22261999	22261999	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22261999G>T	uc002dki.2	+	5	918	c.433G>T	c.(433-435)GAG>TAG	p.E145*	EEF2K_uc002dkh.2_RNA	NM_013302	NP_037434	O00418	EF2K_HUMAN	elongation factor-2 kinase	145	Alpha-type protein kinase.				insulin receptor signaling pathway|translational elongation	cytosol	ATP binding|calcium ion binding|calmodulin binding|elongation factor-2 kinase activity|translation factor activity, nucleic acid binding			large_intestine(1)	1				GBM - Glioblastoma multiforme(48;0.0223)		AGCAATGAGGGAGTGCTTCCG	0.597													19	91	---	---	---	---	PASS
EIF3CL	728689	broad.mit.edu	37	16	28734622	28734622	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28734622G>T	uc010byj.2	+	10	1006	c.917G>T	c.(916-918)CGG>CTG	p.R306L	uc010vct.1_Intron|EIF3CL_uc010byi.2_Missense_Mutation_p.R305L|EIF3CL_uc002dqs.3_Missense_Mutation_p.R305L|EIF3C_uc002dqt.3_Missense_Mutation_p.R305L|EIF3CL_uc010vcy.1_Missense_Mutation_p.R295L|EIF3C_uc002dqu.3_Missense_Mutation_p.R305L|EIF3CL_uc002dqv.3_Missense_Mutation_p.R51L	NM_001099661	NP_001093131	B5ME19	B5ME19_HUMAN	eukaryotic translation initiation factor 3,	306						eukaryotic translation initiation factor 3 complex	translation initiation factor activity				0						GAAAGGGTCCGGGGCGGAGTG	0.537													102	481	---	---	---	---	PASS
MBTPS1	8720	broad.mit.edu	37	16	84129417	84129417	+	Intron	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84129417G>T	uc002fhi.2	-							NM_003791	NP_003782	Q14703	MBTP1_HUMAN	membrane-bound transcription factor site-1						cholesterol metabolic process|proteolysis	endoplasmic reticulum lumen|endoplasmic reticulum membrane|Golgi membrane|integral to membrane	serine-type endopeptidase activity			ovary(2)	2						TCAGCTACAGGCAAGGGAGAG	0.537													17	53	---	---	---	---	PASS
USP10	9100	broad.mit.edu	37	16	84778370	84778370	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:84778370A>G	uc002fii.2	+	4	425	c.283A>G	c.(283-285)ACA>GCA	p.T95A	USP10_uc010voe.1_Missense_Mutation_p.T99A|USP10_uc010vof.1_Intron|USP10_uc002fij.2_5'UTR	NM_005153	NP_005144	Q14694	UBP10_HUMAN	ubiquitin specific protease 10	95	Interaction with p53/TP53.				DNA damage response, signal transduction by p53 class mediator|DNA repair|protein deubiquitination|ubiquitin-dependent protein catabolic process	early endosome|intermediate filament cytoskeleton|nucleus	cystic fibrosis transmembrane conductance regulator binding|p53 binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity				0						TCTCGGTTGTACAGCTTCCAA	0.498													5	101	---	---	---	---	PASS
CA5A	763	broad.mit.edu	37	16	87960490	87960490	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87960490G>T	uc002fkn.1	-	2	260	c.204C>A	c.(202-204)AAC>AAA	p.N68K		NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor	68					one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		TCCACTGGATGTTAATAGGAG	0.607													6	18	---	---	---	---	PASS
FXR2	9513	broad.mit.edu	37	17	7504844	7504844	+	Splice_Site	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7504844C>T	uc002gia.1	-	7	771	c.544_splice	c.e7-1	p.S182_splice	FXR2_uc010vud.1_Splice_Site_p.S182_splice	NM_004860	NP_004851	P51116	FXR2_HUMAN	fragile X mental retardation syndrome related							cytosolic large ribosomal subunit	protein binding|RNA binding	p.?(1)			0				READ - Rectum adenocarcinoma(115;0.17)		CTGTGGTTGACTGGGAGGAAA	0.502													38	152	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577127	7577127	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577127C>A	uc002gim.2	-	8	1005	c.811G>T	c.(811-813)GAG>TAG	p.E271*	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Nonsense_Mutation_p.E271*|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Nonsense_Mutation_p.E139*|TP53_uc010cng.1_Nonsense_Mutation_p.E139*|TP53_uc002gii.1_Nonsense_Mutation_p.E139*|TP53_uc010cnh.1_Nonsense_Mutation_p.E271*|TP53_uc010cni.1_Nonsense_Mutation_p.E271*|TP53_uc002gij.2_Nonsense_Mutation_p.E271*	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	271	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> V (in an osteosarcoma with no family history; germline mutation and in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|E -> A (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> P (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.E271K(22)|p.E271*(14)|p.0?(7)|p.E271V(5)|p.E271Q(3)|p.E271G(3)|p.E271D(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.E271E(2)|p.E271fs*73(1)|p.E258fs*71(1)|p.E271_R273delEVR(1)|p.F270fs*72(1)|p.S269fs*21(1)|p.L265_K305del41(1)|p.F270_D281del12(1)|p.E271P(1)|p.E271del(1)|p.S269fs*34(1)|p.E271fs*34(1)|p.E271fs*35(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ACACGCACCTCAAAGCTGTTC	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			7	19	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10400460	10400460	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10400460G>T	uc002gmo.2	-	33	4676	c.4582C>A	c.(4582-4584)CAT>AAT	p.H1528N	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1528	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						TCCAGTTCATGGATGCGCTTT	0.373													17	37	---	---	---	---	PASS
NCRNA00188	125144	broad.mit.edu	37	17	16342876	16342876	+	Intron	SNP	A	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:16342876A>C	uc002gqc.2	+						NCRNA00188_uc010vwf.1_Intron|NCRNA00188_uc010vwg.1_RNA|NCRNA00188_uc010vwh.1_Intron|NCRNA00188_uc010cpd.2_Intron|NCRNA00188_uc002gqb.3_Intron|NCRNA00188_uc010vwi.1_Intron|NCRNA00188_uc010vwj.1_RNA|NCRNA00188_uc002gqa.3_Intron|NCRNA00188_uc010vwk.1_Intron|NCRNA00188_uc010vwl.1_Intron|NCRNA00188_uc010vwm.1_Intron|NCRNA00188_uc010vwn.1_Intron|NCRNA00188_uc010cpe.2_Intron|NCRNA00188_uc010vwo.1_Intron|NCRNA00188_uc010vwp.1_Intron|SNORD49A_uc010cpg.1_5'Flank|SNORD65_uc002gqf.1_5'Flank	NR_027667				RecName: Full=Putative uncharacterized protein C17orf45, mitochondrial; Flags: Precursor;												0						GACGACGTCTAATGTCTATCT	0.453													41	167	---	---	---	---	PASS
WSB1	26118	broad.mit.edu	37	17	25637137	25637137	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25637137G>C	uc002gzd.1	+	7	1251	c.935G>C	c.(934-936)CGG>CCG	p.R312P	WSB1_uc002gze.1_Missense_Mutation_p.R166P|WSB1_uc002gzf.1_RNA	NM_015626	NP_056441	Q9Y6I7	WSB1_HUMAN	WD repeat and SOCS box-containing 1 isoform 1	312	WD 6.				intracellular signal transduction	intracellular	protein binding				0	all_cancers(1;2e-13)|all_epithelial(1;4.8e-15)|Lung NSC(42;0.00152)		BRCA - Breast invasive adenocarcinoma(3;0.0152)	UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		GCAAATGACCGGTGGGTACGA	0.418													5	107	---	---	---	---	PASS
EFCAB5	374786	broad.mit.edu	37	17	28419089	28419089	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28419089C>T	uc002het.2	+	21	4330	c.4138C>T	c.(4138-4140)CGT>TGT	p.R1380C	EFCAB5_uc010cse.2_Missense_Mutation_p.R1135C|EFCAB5_uc010csf.2_Intron	NM_198529	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5 isoform a	1380							calcium ion binding			ovary(1)|skin(1)	2						GAAACTAGTGCGTGACATCCT	0.388													24	48	---	---	---	---	PASS
NSF	4905	broad.mit.edu	37	17	44806225	44806225	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44806225C>T	uc002iku.2	+	17	1937	c.1833C>T	c.(1831-1833)TAC>TAT	p.Y611Y	NSF_uc010wke.1_Silent_p.Y517Y|NSF_uc010wkf.1_Silent_p.Y517Y|NSF_uc010wkg.1_Silent_p.Y606Y	NM_006178	NP_006169	P46459	NSF_HUMAN	vesicle-fusing ATPase	611					protein transport|synaptic transmission	cytosol	ATP binding|metal ion binding			ovary(1)	1		Melanoma(429;0.203)	BRCA - Breast invasive adenocarcinoma(9;0.0257)	BRCA - Breast invasive adenocarcinoma(366;0.241)		TTCCAGATTACGTCCCTATTG	0.318													8	27	---	---	---	---	PASS
PSMD12	5718	broad.mit.edu	37	17	65353488	65353488	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65353488C>T	uc002jfy.2	-	3	314	c.228G>A	c.(226-228)GAG>GAA	p.E76E	PSMD12_uc002jga.2_Silent_p.E56E|PSMD12_uc002jfz.2_Silent_p.E17E|PSMD12_uc010det.1_Silent_p.E76E	NM_002816	NP_002807	O00232	PSD12_HUMAN	proteasome 26S non-ATPase subunit 12 isoform 1	76					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	protein binding				0	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					ATTCTTTAGCCTCATAGCACA	0.368													7	79	---	---	---	---	PASS
ABCA10	10349	broad.mit.edu	37	17	67170799	67170799	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67170799G>A	uc010dfa.1	-	25	3876	c.2997C>T	c.(2995-2997)TAC>TAT	p.Y999Y	ABCA10_uc010wqs.1_Intron|ABCA10_uc010wqt.1_RNA	NM_080282	NP_525021	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A, member 10	999	Helical; (Potential).				transport	integral to membrane	ATP binding|ATPase activity			ovary(2)|central_nervous_system(1)|skin(1)	4	Breast(10;6.95e-12)					ATATGAAGTAGTAAATTAAAT	0.363													15	63	---	---	---	---	PASS
PGS1	9489	broad.mit.edu	37	17	76400029	76400029	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76400029G>T	uc002jvm.2	+	7	1273	c.1261G>T	c.(1261-1263)GCC>TCC	p.A421S	PGS1_uc010wtt.1_RNA|PGS1_uc010dho.2_RNA|PGS1_uc002jvn.2_Missense_Mutation_p.A134S|PGS1_uc002jvo.2_RNA|PGS1_uc002jvp.1_Missense_Mutation_p.A134S	NM_024419	NP_077733	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	421					phospholipid biosynthetic process	endoplasmic reticulum|mitochondrion	ATP binding|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity				0			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			CTTCTTTGGGGCCAAGGGGGT	0.617													11	159	---	---	---	---	PASS
DNAH17	8632	broad.mit.edu	37	17	76446779	76446779	+	Silent	SNP	G	A	A	rs138142447		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76446779G>A	uc010dhp.1	-	12	2106	c.1884C>T	c.(1882-1884)AGC>AGT	p.S628S	DNAH17_uc002jvq.2_5'Flank|DNAH17_uc002jvs.2_RNA					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCTCGATCTCGCTGGCTGTGT	0.642													21	17	---	---	---	---	PASS
DLGAP1	9229	broad.mit.edu	37	18	3879555	3879555	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3879555C>T	uc002kmf.2	-	1	581	c.514G>A	c.(514-516)GAG>AAG	p.E172K	DLGAP1_uc010wyz.1_Missense_Mutation_p.E172K|DLGAP1_uc002kmk.2_Missense_Mutation_p.E172K|uc002kml.1_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform	172					synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				GCCTGCGCCTCGTCAGGGCTG	0.711													36	188	---	---	---	---	PASS
TMEM200C	645369	broad.mit.edu	37	18	5891759	5891759	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5891759C>T	uc002kmx.1	-	1	345	c.304G>A	c.(304-306)GCC>ACC	p.A102T		NM_001080209	NP_001073678	A6NKL6	T200C_HUMAN	transmembrane protein 200C	102						integral to membrane					0						CTGCTGTTGGCCGTGGTTGGG	0.697													4	104	---	---	---	---	PASS
PIAS2	9063	broad.mit.edu	37	18	44416462	44416462	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44416462T>A	uc002lck.2	-	9	1218	c.1060A>T	c.(1060-1062)ACA>TCA	p.T354S	PIAS2_uc010dnp.2_Missense_Mutation_p.T52S|PIAS2_uc002lcl.2_Missense_Mutation_p.T354S|PIAS2_uc010xda.1_Missense_Mutation_p.T52S|PIAS2_uc002lcm.2_Missense_Mutation_p.T354S|PIAS2_uc002lcn.1_Missense_Mutation_p.T358S	NM_004671	NP_004662	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT X isoform	354	SP-RING-type.				androgen receptor signaling pathway|negative regulation of androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck|PML body	androgen receptor binding|DNA binding|protein binding|SUMO ligase activity|transcription coactivator activity|zinc ion binding			ovary(2)|breast(1)|skin(1)	4						CATGGGATTGTCAGCCTCATT	0.438													19	34	---	---	---	---	PASS
TCEB3B	51224	broad.mit.edu	37	18	44561068	44561068	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44561068C>A	uc002lcr.1	-	1	921	c.568G>T	c.(568-570)GGG>TGG	p.G190W	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_016427	NP_057511	Q8IYF1	ELOA2_HUMAN	elongin A2	190					regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter	integral to membrane|nucleus	DNA binding			ovary(2)|large_intestine(1)|pancreas(1)	4						GGTTGCTTCCCGGGCGCAGCG	0.701													4	59	---	---	---	---	PASS
LIPG	9388	broad.mit.edu	37	18	47108800	47108800	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47108800T>C	uc002ldv.2	+	7	1357	c.1105T>C	c.(1105-1107)TAC>CAC	p.Y369H	LIPG_uc010xdh.1_Missense_Mutation_p.Y295H	NM_006033	NP_006024	Q9Y5X9	LIPE_HUMAN	endothelial lipase precursor	369	PLAT.				cholesterol homeostasis|high-density lipoprotein particle remodeling|phospholipid catabolic process|phospholipid homeostasis|positive regulation of cholesterol transport|positive regulation of high-density lipoprotein particle clearance|reverse cholesterol transport	extracellular space	heparin binding|lipoprotein lipase activity|phospholipase A1 activity|protein binding|triglyceride lipase activity			ovary(1)|skin(1)	2						GCCCACCTTTTACGTCACCCT	0.448													16	100	---	---	---	---	PASS
DCAF15	90379	broad.mit.edu	37	19	14070631	14070631	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14070631A>G	uc002mxt.2	+	9	1370	c.1364A>G	c.(1363-1365)AAT>AGT	p.N455S	DCAF15_uc002mxu.2_RNA	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	455										central_nervous_system(1)	1						TATGTTATCAATGAGGTCATC	0.607											OREG0025301	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	27	76	---	---	---	---	PASS
CYP4F8	11283	broad.mit.edu	37	19	15739567	15739567	+	Intron	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15739567C>A	uc002nbi.2	+						CYP4F8_uc010xoj.1_Intron	NM_007253	NP_009184	P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F,						prostaglandin metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	alkane 1-monooxygenase activity|aromatase activity|electron carrier activity|heme binding|oxygen binding|protein binding			large_intestine(1)	1						TGCCTCCACCCCAGGTCTATG	0.577													36	83	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16034683	16034683	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16034683A>G	uc002nbu.2	-	7	893	c.857T>C	c.(856-858)TTC>TCC	p.F286S	CYP4F11_uc010eab.1_Missense_Mutation_p.F286S|CYP4F11_uc002nbt.2_Missense_Mutation_p.F286S	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	286					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GTTCTTGAGGAAATCATCAAT	0.537													80	151	---	---	---	---	PASS
ANO8	57719	broad.mit.edu	37	19	17435528	17435528	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17435528G>T	uc002ngf.2	-	17	3488	c.3329C>A	c.(3328-3330)TCA>TAA	p.S1110*	ANO8_uc010eap.2_RNA	NM_020959	NP_066010	Q9HCE9	ANO8_HUMAN	anoctamin 8	1110	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(3)	3						CTTGTGACCTGAGCCTTCCTC	0.697													12	188	---	---	---	---	PASS
ELL	8178	broad.mit.edu	37	19	18561418	18561418	+	Missense_Mutation	SNP	C	T	T	rs138181189		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18561418C>T	uc002njh.2	-	8	1406	c.1334G>A	c.(1333-1335)CGC>CAC	p.R445H	ELL_uc010ebq.2_Missense_Mutation_p.R388H|ELL_uc002njg.2_Missense_Mutation_p.R312H	NM_006532	NP_006523	P55199	ELL_HUMAN	elongation factor RNA polymerase II	445	Nuclear localization signal (Potential).				positive regulation of transcription elongation, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	Cajal body|nuclear speck|transcription elongation factor complex	protein binding			lung(1)	1				GBM - Glioblastoma multiforme(1328;7.81e-07)		GGGCTTGCTGCGCGAGGGGCT	0.682			T	MLL	AL								4	45	---	---	---	---	PASS
HNRNPL	3191	broad.mit.edu	37	19	39330862	39330862	+	Silent	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39330862A>G	uc010xul.1	-	8	1118	c.1107T>C	c.(1105-1107)CCT>CCC	p.P369P	HNRNPL_uc010ege.1_Silent_p.P25P|HNRNPL_uc002ojj.1_Silent_p.P25P|HNRNPL_uc002ojo.1_5'Flank|HNRNPL_uc002ojk.2_Silent_p.P25P|HNRNPL_uc002ojl.2_Silent_p.P25P|HNRNPL_uc010xum.1_Silent_p.P236P|HNRNPL_uc002ojp.1_Silent_p.P25P|HNRNPL_uc010xun.1_Missense_Mutation_p.L77P	NM_001533	NP_001524	P14866	HNRPL_HUMAN	heterogeneous nuclear ribonucleoprotein L	369	Pro-rich.				nuclear mRNA splicing, via spliceosome	cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding|transcription regulatory region DNA binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00342)|LUSC - Lung squamous cell carcinoma(53;0.00575)			GTGGTGGGGGAGGGGGTGGGG	0.622													4	18	---	---	---	---	PASS
LGALS13	29124	broad.mit.edu	37	19	40097910	40097910	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40097910G>A	uc002omb.2	+	4	391	c.351G>A	c.(349-351)CCG>CCA	p.P117P		NM_013268	NP_037400	Q9UHV8	PP13_HUMAN	galectin-13	117	Galectin.				lipid catabolic process|phospholipid metabolic process		carboxylesterase activity|lysophospholipase activity|sugar binding			ovary(1)	1	all_cancers(60;1.77e-05)|all_lung(34;5.38e-08)|Lung NSC(34;6.37e-08)|Ovarian(47;0.116)		Epithelial(26;3.28e-26)|OV - Ovarian serous cystadenocarcinoma(5;7.31e-25)|all cancers(26;1.15e-23)|LUSC - Lung squamous cell carcinoma(53;0.00281)			ATCGAATCCCGCCATCATTTG	0.448													30	77	---	---	---	---	PASS
ERF	2077	broad.mit.edu	37	19	42754489	42754489	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42754489G>A	uc002ote.3	-	2	409	c.251C>T	c.(250-252)GCC>GTC	p.A84V	ERF_uc002otd.3_5'UTR	NM_006494	NP_006485	P50548	ERF_HUMAN	Ets2 repressor factor	84	ETS.				cell proliferation|regulation of transcription from RNA polymerase II promoter	nucleus	ligand-regulated transcription factor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			lung(1)|kidney(1)|central_nervous_system(1)|skin(1)	4		Prostate(69;0.00682)				TCACCGCAGGGCCCGGCTCAG	0.557													32	58	---	---	---	---	PASS
EML2	24139	broad.mit.edu	37	19	46124521	46124521	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46124521T>G	uc002pcn.2	-	11	1101	c.1066A>C	c.(1066-1068)ACC>CCC	p.T356P	EML2_uc002pco.2_RNA|EML2_uc002pcp.2_Missense_Mutation_p.T240P|EML2_uc010xxl.1_Missense_Mutation_p.T503P|EML2_uc010xxm.1_Missense_Mutation_p.T557P|EML2_uc010xxn.1_RNA|EML2_uc010xxo.1_Missense_Mutation_p.T356P|EML2_uc010ekj.2_Silent_p.P322P	NM_012155	NP_036287	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like	356					sensory perception of sound|visual perception	cytoplasm|intracellular membrane-bounded organelle|microtubule|microtubule associated complex	catalytic activity|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GAATTGCGGGTGGTCCCCACG	0.498													13	72	---	---	---	---	PASS
CD37	951	broad.mit.edu	37	19	49842048	49842048	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49842048C>A	uc002pnd.2	+	6	660	c.539C>A	c.(538-540)TCC>TAC	p.S180Y	uc002pnb.1_Intron|CD37_uc002pnc.2_RNA|CD37_uc010yam.1_Missense_Mutation_p.S180Y|CD37_uc010yan.1_Missense_Mutation_p.S112Y|CD37_uc002pnf.3_Missense_Mutation_p.S152Y|CD37_uc002pne.2_Missense_Mutation_p.S112Y	NM_001774	NP_001765	P11049	CD37_HUMAN	CD37 antigen isoform A	180	Extracellular (Potential).					integral to membrane					0		all_lung(116;2.81e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00088)|GBM - Glioblastoma multiforme(486;0.0443)		GTGCCCTGCTCCTGCTACAAC	0.622													40	91	---	---	---	---	PASS
MYH14	79784	broad.mit.edu	37	19	50812387	50812387	+	Silent	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50812387G>T	uc002prr.1	+	40	5837	c.5790G>T	c.(5788-5790)TCG>TCT	p.S1930S	MYH14_uc010enu.1_Silent_p.S1971S|MYH14_uc002prq.1_Silent_p.S1938S|MYH14_uc010ycb.1_Silent_p.S281S|MYH14_uc002prs.1_Silent_p.S281S	NM_024729	NP_079005	Q7Z406	MYH14_HUMAN	myosin, heavy chain 14 isoform 2	1930	Potential.				axon guidance|regulation of cell shape	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			central_nervous_system(1)	1		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TCACAGAGTCGGCCGAGTCCA	0.642													20	103	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56419275	56419275	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56419275G>T	uc010ygg.1	-	7	2355	c.2330C>A	c.(2329-2331)GCC>GAC	p.A777D		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	777							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ACCCTGAAGGGCAATAATGAG	0.502													40	156	---	---	---	---	PASS
VN1R1	57191	broad.mit.edu	37	19	57967296	57967296	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57967296G>A	uc002qos.1	-	1	559	c.559C>T	c.(559-561)CTT>TTT	p.L187F	ZNF547_uc002qpm.3_Intron	NM_020633	NP_065684	Q9GZP7	VN1R1_HUMAN	vomeronasal 1 receptor 1	187	Helical; Name=4; (Potential).				response to pheromone	integral to membrane|plasma membrane	pheromone receptor activity			ovary(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)|Breast(46;0.222)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)|Lung(386;0.171)		ACTAATAGAAGAACAGATGCA	0.398													6	72	---	---	---	---	PASS
TRIM28	10155	broad.mit.edu	37	19	59061390	59061390	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:59061390C>T	uc002qtg.1	+	15	2470	c.2181C>T	c.(2179-2181)TCC>TCT	p.S727S	TRIM28_uc010eut.1_Silent_p.S645S|TRIM28_uc002qth.1_Silent_p.S342S	NM_005762	NP_005753	Q13263	TIF1B_HUMAN	tripartite motif-containing 28 protein	727	Bromo.				epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent	nucleoplasm	chromo shadow domain binding|ligase activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(17;4.4e-22)|all_epithelial(17;2.15e-16)|Lung NSC(17;1.24e-06)|all_lung(17;5.41e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Ovarian(87;0.0443)|Breast(46;0.0928)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0434)|all cancers(4;1.39e-13)|Epithelial(4;1.01e-10)|OV - Ovarian serous cystadenocarcinoma(4;2.34e-09)|GBM - Glioblastoma multiforme(193;0.0102)|Lung(386;0.179)		CTACCGACTCCACCTTCTCCC	0.498													12	52	---	---	---	---	PASS
MCM8	84515	broad.mit.edu	37	20	5953813	5953813	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5953813C>G	uc002wmi.2	+	12	1743	c.1366C>G	c.(1366-1368)CCA>GCA	p.P456A	MCM8_uc002wmj.2_Missense_Mutation_p.P440A|MCM8_uc002wmk.2_Missense_Mutation_p.P496A|MCM8_uc002wml.2_Missense_Mutation_p.P456A|MCM8_uc010gbp.2_Intron|MCM8_uc002wmm.2_Translation_Start_Site	NM_032485	NP_115874	Q9UJA3	MCM8_HUMAN	minichromosome maintenance complex component 8	456	ATP (Potential).|MCM.				cell cycle checkpoint|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|regulation of transcription, DNA-dependent|S phase of mitotic cell cycle|transcription, DNA-dependent	nucleoplasm	ATP binding|DNA binding|nucleoside-triphosphatase activity			skin(1)	1						TGTTGGAGATCCAGGCCTAGG	0.403													28	69	---	---	---	---	PASS
PLCB4	5332	broad.mit.edu	37	20	9417754	9417754	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9417754C>T	uc002wnf.2	+	28	2819	c.2683C>T	c.(2683-2685)CCA>TCA	p.P895S	PLCB4_uc010gbw.1_Missense_Mutation_p.P895S|PLCB4_uc010gbx.2_Missense_Mutation_p.P907S|PLCB4_uc002wne.2_Missense_Mutation_p.P895S|PLCB4_uc002wnh.2_Missense_Mutation_p.P742S	NM_182797	NP_877949	Q15147	PLCB4_HUMAN	phospholipase C beta 4 isoform b	895					intracellular signal transduction|lipid catabolic process	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|protein binding|signal transducer activity			skin(11)|ovary(3)|pancreas(1)	15						TGAGCTCAGACCAACCACCAC	0.532													10	31	---	---	---	---	PASS
KIF16B	55614	broad.mit.edu	37	20	16359697	16359697	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16359697C>T	uc002wpg.1	-	19	3108	c.2950G>A	c.(2950-2952)GAA>AAA	p.E984K	KIF16B_uc002wpe.1_Missense_Mutation_p.E366K|KIF16B_uc002wpf.1_Missense_Mutation_p.E366K|KIF16B_uc010gch.1_Missense_Mutation_p.E984K|KIF16B_uc010gci.1_Missense_Mutation_p.E984K|KIF16B_uc010gcj.1_Missense_Mutation_p.E995K	NM_024704	NP_078980	Q96L93	KI16B_HUMAN	kinesin-like motor protein C20orf23	984	Glu-rich.|Potential.				cell communication|early endosome to late endosome transport|endoderm development|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|formation of primary germ layer|Golgi to endosome transport|microtubule-based movement|receptor catabolic process|regulation of receptor recycling	early endosome membrane|microtubule	ATP binding|phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|phosphatidylinositol-3,5-bisphosphate binding|phosphatidylinositol-3-phosphate binding|plus-end-directed microtubule motor activity			skin(2)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|ovary(1)|kidney(1)	8						CTCACTTTTTCCTCCTGACGT	0.512													20	234	---	---	---	---	PASS
C20orf26	26074	broad.mit.edu	37	20	20177230	20177230	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20177230G>T	uc002wru.2	+	16	1683	c.1607G>T	c.(1606-1608)CGG>CTG	p.R536L	C20orf26_uc010zse.1_Missense_Mutation_p.R516L	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074	536										ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		GAGTACATACGGTCCCATTAC	0.413													9	62	---	---	---	---	PASS
DEFB118	117285	broad.mit.edu	37	20	29960893	29960893	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29960893A>C	uc002wvr.2	+	2	318	c.292A>C	c.(292-294)AGC>CGC	p.S98R		NM_054112	NP_473453	Q96PH6	DB118_HUMAN	beta-defensin 118 precursor	98					cell-matrix adhesion|defense response to bacterium|innate immune response|spermatogenesis	extracellular region				ovary(3)|pancreas(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TGAAGTAAGCAGCAAGAAAGA	0.453													13	98	---	---	---	---	PASS
DEFB118	117285	broad.mit.edu	37	20	29960894	29960894	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29960894G>T	uc002wvr.2	+	2	319	c.293G>T	c.(292-294)AGC>ATC	p.S98I		NM_054112	NP_473453	Q96PH6	DB118_HUMAN	beta-defensin 118 precursor	98					cell-matrix adhesion|defense response to bacterium|innate immune response|spermatogenesis	extracellular region				ovary(3)|pancreas(1)	4	all_hematologic(12;0.158)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			GAAGTAAGCAGCAAGAAAGAT	0.453													13	98	---	---	---	---	PASS
SAMHD1	25939	broad.mit.edu	37	20	35533876	35533876	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35533876G>A	uc002xgh.1	-	12	1431	c.1301C>T	c.(1300-1302)ACT>ATT	p.T434I	SAMHD1_uc010gft.1_RNA	NM_015474	NP_056289	Q9Y3Z3	SAMH1_HUMAN	SAM domain- and HD domain-containing protein 1	434					defense response to virus|innate immune response|regulation of innate immune response	nucleus	metal ion binding|phosphoric diester hydrolase activity				0		Myeloproliferative disorder(115;0.00878)				TTTGGGATCAGTAGAGTATAA	0.308													12	109	---	---	---	---	PASS
R3HDML	140902	broad.mit.edu	37	20	42969953	42969953	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42969953C>A	uc002xls.1	+	2	551	c.379C>A	c.(379-381)CAG>AAG	p.Q127K		NM_178491	NP_848586	Q9H3Y0	CRSPL_HUMAN	R3H domain containing-like precursor	127						extracellular region	peptidase inhibitor activity				0		Myeloproliferative disorder(115;0.028)	COAD - Colon adenocarcinoma(18;0.00189)			CCATTCTGGCCAGTGAGTGAC	0.393													33	44	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57769077	57769077	+	Silent	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57769077G>A	uc002yan.2	+	1	3003	c.3003G>A	c.(3001-3003)GCG>GCA	p.A1001A		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	1001						intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					CAGGTGAGGCGGACAGCATCC	0.647													28	36	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	21	10862961	10862961	+	IGR	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10862961G>A								None (None upstream) : TPTE (43782 downstream)																							TTCCAGGCCAGAGTCACCATA	0.532													81	313	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33371224	33371224	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33371224C>T	uc002yph.2	+	11	2232	c.1872C>T	c.(1870-1872)CAC>CAT	p.H624H		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	624					multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						CTTTTGCTCACGAAGATAAGA	0.582													16	32	---	---	---	---	PASS
ZDHHC8	29801	broad.mit.edu	37	22	20128226	20128226	+	Silent	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20128226G>T	uc002zrq.2	+	6	853	c.747G>T	c.(745-747)GCG>GCT	p.A249A	ZDHHC8_uc002zrr.1_Silent_p.A249A|ZDHHC8_uc010gsa.2_Silent_p.A55A	NM_013373	NP_037505	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC domain containing 8	249	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Colorectal(54;0.0993)					GCCCCCTGGCGCCCCGGTGAG	0.672													12	22	---	---	---	---	PASS
LZTR1	8216	broad.mit.edu	37	22	21348291	21348291	+	Silent	SNP	C	A	A	rs150365548		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21348291C>A	uc002zto.2	+	13	1535	c.1432C>A	c.(1432-1434)CGG>AGG	p.R478R	LZTR1_uc002ztn.2_Silent_p.R437R|LZTR1_uc011ahy.1_Silent_p.R459R|LZTR1_uc010gsr.1_Silent_p.R349R|LZTR1_uc002ztp.2_5'Flank	NM_006767	NP_006758	Q8N653	LZTR1_HUMAN	leucine-zipper-like transcription regulator 1	478	BTB 1.				anatomical structure morphogenesis		sequence-specific DNA binding transcription factor activity			ovary(2)|lung(2)	4	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CACGCAGGCGCGGGAGAGGCT	0.642													3	63	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22937401	22937401	+	Intron	SNP	A	G	G	rs148991236	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22937401A>G	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						ACCGGCCCTCAAGGATCCCTG	0.562											OREG0026367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	81	---	---	---	---	PASS
NIPSNAP1	8508	broad.mit.edu	37	22	29956798	29956798	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29956798G>A	uc003afx.3	-	8	704	c.631C>T	c.(631-633)CGG>TGG	p.R211W	NIPSNAP1_uc011akp.1_Missense_Mutation_p.R191W	NM_003634	NP_003625	Q9BPW8	NIPS1_HUMAN	nipsnap homolog 1	211								p.?(1)		skin(1)	1						TTCTCCTGCCGGTACTTGATG	0.587													19	162	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11308596	11308596	+	Intron	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11308596C>A	uc004cup.1	-						ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Intron|ARHGAP6_uc004cun.1_Intron|ARHGAP6_uc010neb.1_5'UTR|ARHGAP6_uc011mif.1_Intron|AMELX_uc004cus.2_5'Flank|AMELX_uc004cut.2_5'Flank|AMELX_uc004cuu.2_5'Flank	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1						actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						CATACAACTCCAACTCTACCC	0.338													11	22	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63445290	63445290	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63445290C>A	uc011mou.1	-	10	1434	c.1366G>T	c.(1366-1368)GCT>TCT	p.A456S	ASB12_uc004dvp.1_Missense_Mutation_p.A72S|ASB12_uc004dvq.1_Missense_Mutation_p.A81S|ASB12_uc004dvr.1_Missense_Mutation_p.A81S	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	Error:Variant_position_missing_in_Q96EF0_after_alignment						nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						CCATAAGAAGCAGCCAAGCGC	0.527													5	13	---	---	---	---	PASS
MSN	4478	broad.mit.edu	37	X	64956699	64956699	+	Silent	SNP	G	A	A	rs113359990		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64956699G>A	uc004dwf.2	+	9	1200	c.1002G>A	c.(1000-1002)GAG>GAA	p.E334E		NM_002444	NP_002435	P26038	MOES_HUMAN	moesin	334					leukocyte cell-cell adhesion|leukocyte migration|membrane to membrane docking	apical plasma membrane|cytoskeleton|extrinsic to membrane|microvillus membrane|nucleolus	cell adhesion molecule binding|receptor binding|structural constituent of cytoskeleton		MSN/ALK(6)	haematopoietic_and_lymphoid_tissue(6)|ovary(3)|lung(1)	10						aaatggcagagaaggagaaag	0.214			T	ALK	ALCL								2	2	---	---	---	---	PASS
CENPI	2491	broad.mit.edu	37	X	100364557	100364557	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100364557G>A	uc004egx.2	+	4	730	c.460G>A	c.(460-462)GGC>AGC	p.G154S	CENPI_uc011mrg.1_Missense_Mutation_p.G154S|CENPI_uc004egy.2_Missense_Mutation_p.G154S	NM_006733	NP_006724	Q92674	CENPI_HUMAN	centromere protein I	154					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	cytosol|kinetochore|nucleoplasm	protein binding			skin(1)	1						GCTTTGTGTTGGCAAGTGTTC	0.428													10	266	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123514710	123514710	+	Silent	SNP	C	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123514710C>T	uc004euj.2	-	31	7918	c.7854G>A	c.(7852-7854)CGG>CGA	p.R2618R	ODZ1_uc011muj.1_Silent_p.R2624R|ODZ1_uc010nqy.2_Silent_p.R2625R	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2618	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TATCTGCAAACCGTCTAGTCC	0.512													27	50	---	---	---	---	PASS
BCORL1	63035	broad.mit.edu	37	X	129148208	129148208	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:129148208A>C	uc004evb.1	+	4	1574	c.1460A>C	c.(1459-1461)GAC>GCC	p.D487A	BCORL1_uc010nrd.1_Missense_Mutation_p.D389A	NM_021946	NP_068765	Q5H9F3	BCORL_HUMAN	BCL6 co-repressor-like 1	487	Pro-rich.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus				ovary(4)|breast(2)|lung(1)	7						TACCTGCAGGACAGGTGTCTC	0.602													7	103	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151821421	151821421	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151821421G>T	uc004ffp.1	+	9	1596	c.1576G>T	c.(1576-1578)GGT>TGT	p.G526C		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	526						cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					TGGCGAGAAGGGTGTGCAAGA	0.527													18	16	---	---	---	---	PASS
PNCK	139728	broad.mit.edu	37	X	152936845	152936845	+	Intron	SNP	A	G	G			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152936845A>G	uc011myu.1	-						PNCK_uc011myt.1_Intron|PNCK_uc004fia.2_Missense_Mutation_p.V205A|PNCK_uc004fhz.3_Intron|PNCK_uc010nuh.2_3'UTR|PNCK_uc011myv.1_3'UTR|PNCK_uc011myw.1_3'UTR	NM_001039582	NP_001034671	Q6P2M8	KCC1B_HUMAN	pregnancy upregulated non-ubiquitously expressed							cytoplasm|nucleus	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			breast(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGACGCACGCACAGGCACACA	0.637													16	22	---	---	---	---	PASS
AVPR2	554	broad.mit.edu	37	X	153171312	153171312	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153171312C>A	uc004fjh.3	+	2	423	c.352C>A	c.(352-354)CTG>ATG	p.L118M	AVPR2_uc004fjg.3_Intron|AVPR2_uc004fji.2_Missense_Mutation_p.L118M	NM_000054	NP_000045	P30518	V2R_HUMAN	arginine vasopressin receptor 2 isoform 1	118	Helical; Name=3; (Potential).				activation of adenylate cyclase activity|excretion|G-protein signaling, coupled to cAMP nucleotide second messenger|hemostasis|positive regulation of gene expression|transmembrane transport|water transport	endoplasmic reticulum|endosome|Golgi apparatus|integral to plasma membrane	vasopressin receptor activity			breast(1)	1	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Terlipressin(DB02638)|Vasopressin(DB00067)	CGTGAAGTATCTGCAGATGGT	0.652													25	26	---	---	---	---	PASS
WDR8	49856	broad.mit.edu	37	1	3566626	3566633	+	5'UTR	DEL	GCAGGCTG	-	-	rs3831025		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3566626_3566633delGCAGGCTG	uc001ako.2	-	1					WDR8_uc001akn.3_5'UTR|WDR8_uc010nzi.1_5'UTR|TP73_uc001akq.2_5'Flank|TP73_uc001akp.2_5'Flank	NM_017818	NP_060288	Q9P2S5	WRP73_HUMAN	WD repeat domain 8							centrosome	protein binding				0	all_cancers(77;0.0128)|all_epithelial(69;0.00526)|Ovarian(185;0.0634)|Lung NSC(156;0.162)|all_lung(157;0.172)	all_epithelial(116;7.37e-22)|all_lung(118;8.23e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;4.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;4.16e-22)|GBM - Glioblastoma multiforme(42;1.05e-14)|Colorectal(212;1.19e-05)|BRCA - Breast invasive adenocarcinoma(365;2.67e-05)|COAD - Colon adenocarcinoma(227;5.82e-05)|Kidney(185;0.000364)|KIRC - Kidney renal clear cell carcinoma(229;0.00223)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		TGGGCGCGCAGCAGGCTGCAACAGCCGA	0.683													6	5	---	---	---	---	
KCNN3	3782	broad.mit.edu	37	1	154680513	154680513	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154680513delC	uc001ffp.2	-	8	2449	c.2135delG	c.(2134-2136)AGCfs	p.S712fs	KCNN3_uc001ffo.2_Frame_Shift_Del_p.S407fs	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium	717						integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			CCCAATGGGGCTATCGGAGAT	0.592													157	89	---	---	---	---	
SELP	6403	broad.mit.edu	37	1	169565276	169565276	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169565276delC	uc001ggi.3	-	12	2053	c.1988delG	c.(1987-1989)GGTfs	p.G663fs	SELP_uc001ggh.2_Frame_Shift_Del_p.G498fs|SELP_uc009wvr.2_Frame_Shift_Del_p.G663fs	NM_003005	NP_002996	P16109	LYAM3_HUMAN	selectin P precursor	663	Extracellular (Potential).|Sushi 8.				platelet activation|platelet degranulation|positive regulation of platelet activation	external side of plasma membrane|extracellular space|integral to plasma membrane|membrane fraction|platelet alpha granule membrane|platelet dense granule membrane|soluble fraction	fucose binding|glycosphingolipid binding|heparin binding|lipopolysaccharide binding|oligosaccharide binding|sialic acid binding			ovary(2)|skin(2)	4	all_hematologic(923;0.208)				Clopidogrel(DB00758)|Heparin(DB01109)|Tirofiban(DB00775)	GGTATTAAAACCAAAGGTTCC	0.512													184	106	---	---	---	---	
CMPK2	129607	broad.mit.edu	37	2	7001225	7001236	+	Intron	DEL	ACACACACACGC	-	-	rs149134084		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7001225_7001236delACACACACACGC	uc002qyo.2	-						CMPK2_uc010yis.1_Intron|CMPK2_uc010ewv.2_Intron	NM_207315	NP_997198	Q5EBM0	CMPK2_HUMAN	UMP-CMP kinase 2 precursor						dTDP biosynthetic process	mitochondrion	ATP binding|cytidylate kinase activity|thymidylate kinase activity|UMP kinase activity				0	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGTACGTATacacacacacgcacacacacac	0.189													6	4	---	---	---	---	
HPCAL1	3241	broad.mit.edu	37	2	10539523	10539524	+	Intron	INS	-	CAC	CAC			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10539523_10539524insCAC	uc002raj.2	+						HPCAL1_uc002rak.2_Intron|HPCAL1_uc002ral.2_Intron|HPCAL1_uc010exe.2_Intron|HPCAL1_uc010exf.2_Intron	NM_002149	NP_002140	P37235	HPCL1_HUMAN	hippocalcin-like 1								calcium ion binding			pancreas(1)	1	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.214)		accaccaccatcaccaccacca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	38710019	38710019	+	3'UTR	DEL	T	-	-	rs57303101		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38710019delT	uc002rqu.1	+	2										SubName: Full=RPLP0 protein;																		CTTtaaaaaataaataaataa	0.239													4	3	---	---	---	---	
ITPRIPL1	150771	broad.mit.edu	37	2	96993095	96993095	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96993095delC	uc002svx.2	+	3	1061	c.726delC	c.(724-726)GTCfs	p.V242fs	ITPRIPL1_uc010yuk.1_Frame_Shift_Del_p.V234fs|ITPRIPL1_uc002svy.2_Frame_Shift_Del_p.V250fs|ITPRIPL1_uc010yul.1_Frame_Shift_Del_p.V234fs	NM_001008949	NP_001008949	Q6GPH6	IPIL1_HUMAN	inositol 1,4,5-triphosphate receptor interacting	242	Cytoplasmic (Potential).					integral to membrane				central_nervous_system(2)|ovary(1)	3						TGCCCATTGTCCCCCCACAGG	0.587													41	20	---	---	---	---	
ERCC3	2071	broad.mit.edu	37	2	128044122	128044122	+	Intron	DEL	A	-	-	rs111463049		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128044122delA	uc002toh.1	-						ERCC3_uc002toe.1_Intron|ERCC3_uc002tof.1_Intron|ERCC3_uc002tog.1_Intron	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		actccctctcaaaaaaaaaaa	0.204			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217475010	217475010	+	IGR	DEL	G	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217475010delG								RPL37A (108824 upstream) : IGFBP2 (23117 downstream)																							ttttttttttGAAAGAAAGGC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	111197863	111197870	+	IGR	DEL	CACACACA	-	-	rs7650195		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111197863_111197870delCACACACA								PVRL3 (285490 upstream) : CD96 (63056 downstream)																							CGAACAGCCTcacacacacacacacaca	0.442													3	3	---	---	---	---	
HACE1	57531	broad.mit.edu	37	6	105280774	105280774	+	Intron	DEL	A	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105280774delA	uc003pqu.1	-						HACE1_uc010kcy.1_Intron|HACE1_uc010kcz.1_Intron	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		gccctgtctcaaaaaaaaaaG	0.124													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	158195299	158195300	+	IGR	INS	-	A	A	rs145143619		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158195299_158195300insA								ZDHHC14 (100323 upstream) : SNX9 (48994 downstream)																							ggaggaggtggggtagtggagg	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23531030	23531030	+	IGR	DEL	A	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23531030delA								RPS2P32 (1 upstream) : TRA2A (13372 downstream)																							TATTACTGTCAAAAAAAAAAA	0.378													4	2	---	---	---	---	
CAMK2B	816	broad.mit.edu	37	7	44294372	44294375	+	Intron	DEL	AACT	-	-	rs111901158		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44294372_44294375delAACT	uc003tkq.2	-						CAMK2B_uc003tkp.2_Intron|CAMK2B_uc003tkx.2_Intron|CAMK2B_uc010kyd.2_Intron|CAMK2B_uc003tkr.2_Intron|CAMK2B_uc003tks.2_Intron|CAMK2B_uc003tku.2_Intron|CAMK2B_uc003tkv.2_Intron|CAMK2B_uc003tkt.2_Intron|CAMK2B_uc003tkw.2_Intron|CAMK2B_uc010kyc.2_Intron	NM_001220	NP_001211	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|synaptic transmission	cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			large_intestine(1)|ovary(1)	2						caccaccaccaactaccaccatca	0.029													4	2	---	---	---	---	
POM121C	100101267	broad.mit.edu	37	7	75054247	75054248	+	Intron	INS	-	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75054247_75054248insA	uc003udk.3	-							NM_001099415	NP_001092885	A8CG34	P121C_HUMAN	POM121 membrane glycoprotein (rat)-like						mRNA transport|protein transport|transmembrane transport	endoplasmic reticulum membrane|nuclear membrane|nuclear pore	protein binding				0						tctcaaaaaacaaaaacaaaaa	0.188													27	16	---	---	---	---	
TAS2R5	54429	broad.mit.edu	37	7	141491042	141491042	+	Frame_Shift_Del	DEL	G	-	-	rs2234016	byFrequency	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141491042delG	uc003vwr.1	+	1	1026	c.881delG	c.(880-882)CGGfs	p.R294fs		NM_018980	NP_061853	Q9NYW4	TA2R5_HUMAN	taste receptor T2R5	294	Cytoplasmic (Potential).				chemosensory behavior|sensory perception of taste		taste receptor activity				0	Melanoma(164;0.0171)					GTGTGTGCTCGGAGATGCTGG	0.488													219	98	---	---	---	---	
LRP12	29967	broad.mit.edu	37	8	105601193	105601195	+	5'UTR	DEL	CGC	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105601193_105601195delCGC	uc003yma.2	-	1					LRP12_uc003ymb.2_5'UTR|LRP12_uc003ymc.3_5'UTR	NM_013437	NP_038465	Q9Y561	LRP12_HUMAN	low density lipoprotein-related protein 12						endocytosis|regulation of growth	coated pit|integral to plasma membrane	low-density lipoprotein receptor activity|protein binding				0			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			aggTAGACGAcgccgacgccgcc	0.335													5	4	---	---	---	---	
TAF2	6873	broad.mit.edu	37	8	120793175	120793175	+	Intron	DEL	A	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120793175delA	uc003you.2	-							NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2						G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			actctgtctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	52467360	52467361	+	IGR	DEL	CA	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:52467360_52467361delCA								SGMS1 (82437 upstream) : ASAH2B (32335 downstream)																							AGCTGATATCcacacacacaca	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	130698834	130698834	+	IGR	DEL	G	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:130698834delG								MKI67 (774366 upstream) : MGMT (566620 downstream)																							GGAGAGTTTAGGGAGGTGCTC	0.527													8	11	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74980343	74980343	+	Intron	DEL	C	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74980343delC	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TGCCCTGGGACCCCCCCCCAC	0.682													4	4	---	---	---	---	
CNOT2	4848	broad.mit.edu	37	12	70739865	70739865	+	Intron	DEL	T	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70739865delT	uc001svv.2	+						CNOT2_uc009zro.2_Intron|CNOT2_uc009zrp.2_Intron|CNOT2_uc009zrq.2_Intron	NM_014515	NP_055330	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2						nuclear-transcribed mRNA poly(A) tail shortening|regulation of transcription from RNA polymerase II promoter	cytosol|nucleus	protein binding|RNA polymerase II transcription cofactor activity				0	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			TTATGTGTAATTTTTTTTTTC	0.224													4	2	---	---	---	---	
TPTE2P1	646405	broad.mit.edu	37	13	25527490	25527491	+	Intron	INS	-	AAAAAG	AAAAAG			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25527490_25527491insAAAAAG	uc010tdh.1	-						TPTE2P1_uc001upx.3_Intron	NR_026730				RecName: Full=C2 tensin-type domain-containing protein ENSP00000371290;												0						AGGAAGGTTCTAAAAAAAATTT	0.252													4	2	---	---	---	---	
CPSF2	53981	broad.mit.edu	37	14	92623098	92623099	+	Intron	INS	-	AATTT	AATTT	rs148978587	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92623098_92623099insAATTT	uc001yah.1	+							NM_017437	NP_059133	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2						histone mRNA 3'-end processing|mRNA export from nucleus|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	hydrolase activity|protein binding|RNA binding			ovary(2)	2		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		TGTGCTTTTAAAATTTATTTTT	0.262													4	3	---	---	---	---	
CCNF	899	broad.mit.edu	37	16	2495727	2495728	+	Intron	INS	-	T	T	rs141290345	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2495727_2495728insT	uc002cqd.1	+						CCNF_uc002cqe.1_Intron	NM_001761	NP_001752	P41002	CCNF_HUMAN	cyclin F						cell division|mitosis|negative regulation of centrosome duplication|protein ubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	centriole|nucleus|SCF ubiquitin ligase complex	protein binding			central_nervous_system(1)|kidney(1)	2		Ovarian(90;0.17)				tttgttttgtgttgtttttttt	0.282													6	3	---	---	---	---	
OTOA	146183	broad.mit.edu	37	16	21712045	21712046	+	Intron	INS	-	AA	AA	rs3054189		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21712045_21712046insAA	uc002djh.2	+						uc002diq.3_Intron|OTOA_uc010vbj.1_Intron	NM_144672	NP_653273	Q7RTW8	OTOAN_HUMAN	otoancorin isoform 1						sensory perception of sound	anchored to membrane|apical plasma membrane|proteinaceous extracellular matrix				ovary(1)|central_nervous_system(1)|skin(1)	3				GBM - Glioblastoma multiforme(48;0.0414)		gactccatctcaaaaaaaaaaa	0.188													4	5	---	---	---	---	
TRIM16	10626	broad.mit.edu	37	17	15508388	15508389	+	Intron	INS	-	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15508388_15508389insA	uc002gor.1	-						CDRT1_uc002gov.3_Intron|CDRT1_uc002gou.2_Intron			O95361	TRI16_HUMAN	SubName: Full=Putative uncharacterized protein; Flags: Fragment;						histone H3 acetylation|histone H4 acetylation|positive regulation of interleukin-1 beta secretion|positive regulation of keratinocyte differentiation|positive regulation of retinoic acid receptor signaling pathway|positive regulation of transcription, DNA-dependent|response to growth hormone stimulus|response to organophosphorus|response to retinoic acid	cytoplasm|plasma membrane|PML body	DNA binding|interleukin-1 binding|NACHT domain binding|zinc ion binding			ovary(2)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (92;0.0839)|Epithelial(1;8.4e-29)|all cancers(1;3.06e-28)|Colorectal(1;1.57e-19)|OV - Ovarian serous cystadenocarcinoma(1;6.1e-17)|COAD - Colon adenocarcinoma(1;3.38e-12)|READ - Rectum adenocarcinoma(2;1.46e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0559)		TTTTCCTTGCCAAAAAAAAAAT	0.317													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	48313504	48313513	+	IGR	DEL	TGCTTTTTTT	-	-	rs141571873	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48313504_48313513delTGCTTTTTTT								COL1A1 (34504 upstream) : TMEM92 (38324 downstream)																							GAAGGGAAACTGCttttttttttttttttt	0.233													4	2	---	---	---	---	
TLK2	11011	broad.mit.edu	37	17	60593626	60593626	+	Intron	DEL	T	-	-	rs144318990		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60593626delT	uc010ddp.2	+						TLK2_uc002izx.3_Intron|TLK2_uc002izz.3_Intron|TLK2_uc002jaa.3_Intron|TLK2_uc010wpd.1_Intron	NM_006852	NP_006843	Q86UE8	TLK2_HUMAN	tousled-like kinase 2 isoform A						cell cycle|chromatin modification|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			stomach(1)|kidney(1)	2						gttttagttcttTTTTTTTTT	0.184													5	5	---	---	---	---	
TNRC6C	57690	broad.mit.edu	37	17	76087407	76087408	+	Intron	INS	-	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76087407_76087408insA	uc002jud.2	+						TNRC6C_uc002juf.2_Intron	NM_018996	NP_061869	Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C isoform 2						gene silencing by RNA|regulation of translation		nucleotide binding|RNA binding			ovary(1)|central_nervous_system(1)	2			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			gactccgtctcaaaaaaaaaaa	0.178													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	214519	214520	+	IGR	INS	-	TTG	TTG	rs142588910		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:214519_214520insTTG								USP14 (780 upstream) : THOC1 (2 downstream)																							CTGTACAACAATTGTTATAAAA	0.351													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12303770	12303771	+	IGR	INS	-	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12303770_12303771insA								CIDEA (26178 upstream) : TUBB6 (4469 downstream)																							AAATGCATCTCaaaaaaaaaaa	0.208													4	2	---	---	---	---	
SLC5A5	6528	broad.mit.edu	37	19	17994332	17994333	+	Intron	INS	-	C	C	rs112211542		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17994332_17994333insC	uc002nhr.3	+							NM_000453	NP_000444	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium iodide						cellular nitrogen compound metabolic process|cellular response to cAMP|cellular response to gonadotropin stimulus|hormone biosynthetic process	integral to membrane|nucleus|plasma membrane	iodide transmembrane transporter activity|sodium:iodide symporter activity			skin(2)|ovary(1)|central_nervous_system(1)	4						GCAGGAACAAGGGGGGGGGGTC	0.540													15	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27736362	27736362	+	IGR	DEL	T	-	-	rs4395191		TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27736362delT								None (None upstream) : LOC148189 (545040 downstream)																							agagtttaacttttcttttca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43807802	43807809	+	IGR	DEL	ATGTGTGT	-	-	rs66685229	by1000genomes	TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43807802_43807809delATGTGTGT								PSG9 (34120 upstream) : PRG1 (45399 downstream)																							GAGAGAGAGAAtgtgtgtgtgtgtgtgt	0.332													9	4	---	---	---	---	
PRRG2	5639	broad.mit.edu	37	19	50093431	50093432	+	Intron	INS	-	GCGGGG	GCGGGG			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50093431_50093432insGCGGGG	uc002pon.3	+						PRRG2_uc010yaz.1_Intron|PRR12_uc002poo.3_5'Flank	NM_000951	NP_000942	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2							extracellular region|integral to plasma membrane	calcium ion binding			skin(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		GGGCTTGGAGTGCGGGGGCGGG	0.683													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	34341657	34341658	+	IGR	INS	-	A	A			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34341657_34341658insA								RBM39 (11464 upstream) : PHF20 (18265 downstream)																							AGAAATTAtggaaaaaaaaaaa	0.168													5	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60275109	60275109	+	Intron	DEL	C	-	-			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60275109delC	uc002ybn.1	+						CDH4_uc002ybo.1_Intron|CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GAACACCCCACCCCCGGGGAC	0.627													4	2	---	---	---	---	
SH3KBP1	30011	broad.mit.edu	37	X	19688957	19688958	+	Intron	INS	-	AAAA	AAAA			TCGA-39-5019-01	TCGA-39-5019-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19688957_19688958insAAAA	uc004czm.2	-						SH3KBP1_uc011mje.1_5'Flank|SH3KBP1_uc011mjf.1_Intron|SH3KBP1_uc004czl.2_Intron	NM_031892	NP_114098	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1 isoform a						apoptosis|cell-cell signaling|endocytosis|epidermal growth factor receptor signaling pathway|negative regulation of epidermal growth factor receptor signaling pathway	cytoplasmic vesicle membrane|cytoskeleton|cytosol|focal adhesion|nucleus|synapse|synaptosome	SH3 domain binding				0						ACTCTAAAAGCAAAAAAAAAAA	0.391													3	4	---	---	---	---	
