Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3322187	3322187	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3322187C>A	uc001akf.2	+	8	1241	c.1161C>A	c.(1159-1161)ATC>ATA	p.I387I	PRDM16_uc001akc.2_Silent_p.I387I|PRDM16_uc001akd.2_Silent_p.I387I|PRDM16_uc001ake.2_Silent_p.I387I|PRDM16_uc009vlh.2_Silent_p.I88I	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	387	C2H2-type 5.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		ACAAGCATATCCACAGCACGG	0.697			T	EVI1	MDS|AML								34	41	---	---	---	---	PASS
PRDM16	63976	broad.mit.edu	37	1	3342715	3342715	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3342715C>G	uc001akf.2	+	14	3290	c.3210C>G	c.(3208-3210)GAC>GAG	p.D1070E	PRDM16_uc001akc.2_Missense_Mutation_p.D1069E|PRDM16_uc001akd.2_Missense_Mutation_p.D1069E|PRDM16_uc001ake.2_Missense_Mutation_p.D1070E|PRDM16_uc009vlh.2_Missense_Mutation_p.D770E	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	1070	Mediates interaction with SKI and regulation of TGF-beta signaling.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGAAAGAAGACTCTTATTTCT	0.522			T	EVI1	MDS|AML								4	62	---	---	---	---	PASS
ESPN	83715	broad.mit.edu	37	1	6512037	6512037	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6512037G>T	uc001amy.2	+	10	2374	c.2206G>T	c.(2206-2208)GTG>TTG	p.V736L	ESPN_uc001amz.2_Missense_Mutation_p.V170L	NM_031475	NP_113663	B1AK53	ESPN_HUMAN	espin	736					sensory perception of sound	brush border|cytoplasm|filamentous actin|stereocilium	actin filament binding|SH3 domain binding				0	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GCAGCTGGACGTGGAGGCTCT	0.667													7	7	---	---	---	---	PASS
CELA2B	51032	broad.mit.edu	37	1	15813773	15813773	+	Intron	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15813773T>G	uc001awl.2	+							NM_015849	NP_056933	P08218	CEL2B_HUMAN	elastase 2B preproprotein						proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1						ACTCTGGCCTTCCTCAGGGAG	0.572													14	34	---	---	---	---	PASS
FUCA1	2517	broad.mit.edu	37	1	24189745	24189745	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24189745G>C	uc001bie.2	-	3	586	c.541C>G	c.(541-543)CTA>GTA	p.L181V	FUCA1_uc009vqt.1_RNA|FUCA1_uc010oed.1_RNA	NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor	181					fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GAGTGGTATAGTCCATAGCGG	0.343													5	26	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39801940	39801940	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39801940C>T	uc010oiu.1	+	1	5131	c.5000C>T	c.(4999-5001)TCT>TTT	p.S1667F	MACF1_uc010ois.1_Intron|MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc001cdb.1_Intron	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3232					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACTCTCAAATCTGAAATAGCA	0.398													18	21	---	---	---	---	PASS
RAB3B	5865	broad.mit.edu	37	1	52399038	52399038	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52399038C>A	uc001cth.2	-	4	549	c.424G>T	c.(424-426)GAG>TAG	p.E142*		NM_002867	NP_002858	P20337	RAB3B_HUMAN	RAB3B, member RAS oncogene family	142					protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding|GTPase activity			ovary(1)	1						ACAACCCTCTCTTCCTCCATG	0.463													26	35	---	---	---	---	PASS
ANKRD13C	81573	broad.mit.edu	37	1	70790558	70790558	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70790558G>C	uc001dex.3	-	3	881	c.555C>G	c.(553-555)ATC>ATG	p.I185M	ANKRD13C_uc009wbk.2_Intron	NM_030816	NP_110443	Q8N6S4	AN13C_HUMAN	ankyrin repeat domain 13C	185	ANK 3.				protein retention in ER lumen|regulation of anoikis|regulation of receptor biosynthetic process	endoplasmic reticulum membrane|perinuclear region of cytoplasm	receptor binding				0						CTCCATAGCTGATGGCTTCCG	0.378													5	85	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84348776	84348776	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84348776T>A	uc001djc.2	-	20	2809	c.2413A>T	c.(2413-2415)ACT>TCT	p.T805S	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_RNA|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	805					cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TGCAAAGGAGTCACCACCTCC	0.453													41	48	---	---	---	---	PASS
TTLL7	79739	broad.mit.edu	37	1	84417877	84417877	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84417877T>C	uc001djc.2	-	2	414	c.18A>G	c.(16-18)CAA>CAG	p.Q6Q	TTLL7_uc001djb.2_RNA|TTLL7_uc001djd.2_RNA|TTLL7_uc001dje.2_RNA|TTLL7_uc001djf.2_Intron|TTLL7_uc001djg.2_RNA	NM_024686	NP_078962	Q6ZT98	TTLL7_HUMAN	tubulin tyrosine ligase-like family, member 7	6					cell differentiation|nervous system development|protein modification process	cilium|dendrite|microtubule basal body|perikaryon	tubulin-tyrosine ligase activity			ovary(1)	1				all cancers(265;0.0126)|Epithelial(280;0.0372)|OV - Ovarian serous cystadenocarcinoma(397;0.16)		TACCTCCTTCTTGAGGCAGAG	0.358													27	25	---	---	---	---	PASS
CCBL2	56267	broad.mit.edu	37	1	89414823	89414823	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89414823G>A	uc001dmp.2	-	11	1469	c.1092C>T	c.(1090-1092)CCC>CCT	p.P364P	CCBL2_uc001dmq.2_Silent_p.P330P|CCBL2_uc001dmr.2_Silent_p.P200P	NM_001008661	NP_001008661	Q6YP21	KAT3_HUMAN	kynurenine aminotransferase III isoform 1	364					biosynthetic process|kynurenine metabolic process|tryptophan catabolic process		cysteine-S-conjugate beta-lyase activity|kynurenine-glyoxylate transaminase activity|kynurenine-oxoglutarate transaminase activity|pyridoxal phosphate binding			ovary(1)	1		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	CAGGAACTATGGGTTTTAGGC	0.368													29	16	---	---	---	---	PASS
MTF2	22823	broad.mit.edu	37	1	93599277	93599277	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93599277T>C	uc009wdj.2	+	12	1470	c.1178T>C	c.(1177-1179)ATA>ACA	p.I393T	MTF2_uc010oth.1_Missense_Mutation_p.I291T|MTF2_uc009wdk.2_Missense_Mutation_p.I336T|MTF2_uc001dpi.3_Missense_Mutation_p.I120T|MTF2_uc010oti.1_Missense_Mutation_p.I291T|MTF2_uc001dpj.3_Missense_Mutation_p.I291T|MTF2_uc001dpl.3_Missense_Mutation_p.I291T|MTF2_uc001dpm.3_Missense_Mutation_p.I62T	NM_007358	NP_031384	Q9Y483	MTF2_HUMAN	metal response element binding transcription	393						nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_lung(203;0.00196)|Lung NSC(277;0.00902)|Melanoma(281;0.099)|Ovarian(761;0.109)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00076)|GBM - Glioblastoma multiforme(16;0.00157)|Epithelial(280;0.0886)		AGCAATGGCATAGAAAAAAAA	0.343													17	26	---	---	---	---	PASS
SYT6	148281	broad.mit.edu	37	1	114641783	114641783	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114641783T>C	uc001eev.2	-	5	1292	c.1042A>G	c.(1042-1044)ATC>GTC	p.I348V	SYT6_uc001eeu.2_5'UTR	NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI	433	Cytoplasmic (Potential).|C2 2.				acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATGTCAAAGATGATGGCCTCA	0.463													64	110	---	---	---	---	PASS
ZNF687	57592	broad.mit.edu	37	1	151260589	151260589	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151260589G>T	uc001exq.2	+	2	1920	c.1822G>T	c.(1822-1824)GTG>TTG	p.V608L	ZNF687_uc001exp.1_Missense_Mutation_p.V617L|ZNF687_uc009wmo.2_Missense_Mutation_p.V608L|ZNF687_uc009wmp.2_Missense_Mutation_p.V608L	NM_020832	NP_065883	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	608					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus	DNA binding|zinc ion binding			central_nervous_system(3)|ovary(1)	4	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TGACCAGATGGTGGGGCAGCC	0.612													4	79	---	---	---	---	PASS
IL6R	3570	broad.mit.edu	37	1	154427045	154427045	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154427045C>T	uc001fez.1	+	9	1585	c.1148C>T	c.(1147-1149)GCC>GTC	p.A383V	IL6R_uc001ffa.1_Intron	NM_000565	NP_000556	P08887	IL6RA_HUMAN	interleukin 6 receptor isoform 1 precursor	383	Helical; (Potential).				acute-phase response|ciliary neurotrophic factor-mediated signaling pathway|defense response to Gram-negative bacterium|defense response to Gram-positive bacterium|endocrine pancreas development|hepatic immune response|negative regulation of collagen biosynthetic process|negative regulation of interleukin-8 production|positive regulation of activation of Janus kinase activity|positive regulation of anti-apoptosis|positive regulation of chemokine production|positive regulation of chemokine production|positive regulation of interleukin-6 production|positive regulation of leukocyte chemotaxis|positive regulation of MAPKKK cascade|positive regulation of osteoblast differentiation|positive regulation of smooth muscle cell proliferation|positive regulation of tyrosine phosphorylation of Stat3 protein|regulation of apoptosis	apical plasma membrane|basolateral plasma membrane|extracellular space|interleukin-6 receptor complex	ciliary neurotrophic factor binding|enzyme binding|protein homodimerization activity			ovary(3)|breast(1)	4	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CTCTGCATTGCCATTGTTCTG	0.463													6	43	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158609783	158609783	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158609783C>G	uc001fst.1	-	34	4951	c.4752G>C	c.(4750-4752)CAG>CAC	p.Q1584H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1584	Spectrin 15.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					GTTCCTTCAGCTGTTCCAGTT	0.483													42	96	---	---	---	---	PASS
OR6N2	81442	broad.mit.edu	37	1	158746513	158746513	+	Missense_Mutation	SNP	T	C	C	rs140258151		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158746513T>C	uc010pir.1	-	1	913	c.913A>G	c.(913-915)ATC>GTC	p.I305V		NM_001005278	NP_001005278	Q8NGY6	OR6N2_HUMAN	olfactory receptor, family 6, subfamily N,	305	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_hematologic(112;0.0378)					TTCTGGAAGATGGTCCTCTTG	0.383													5	134	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167097663	167097663	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167097663G>T	uc001geb.1	+	5	3295	c.3295G>T	c.(3295-3297)GGA>TGA	p.G1099*		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	1099					protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						TGAAGAAGAGGGAGAGAAAGA	0.498													18	42	---	---	---	---	PASS
ZNF648	127665	broad.mit.edu	37	1	182026397	182026397	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182026397T>C	uc001goz.2	-	2	957	c.749A>G	c.(748-750)TAC>TGC	p.Y250C		NM_001009992	NP_001009992	Q5T619	ZN648_HUMAN	zinc finger protein 648	250					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						CAGGCACCTGTAGGGACGCGC	0.731													4	7	---	---	---	---	PASS
GLT25D2	23127	broad.mit.edu	37	1	183933096	183933096	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183933096C>T	uc001gqr.2	-	6	1263	c.891G>A	c.(889-891)AAG>AAA	p.K297K	GLT25D2_uc010poj.1_Silent_p.K297K|GLT25D2_uc001gqq.2_Silent_p.K34K|GLT25D2_uc001gqs.2_Silent_p.K177K	NM_015101	NP_055916	Q8IYK4	GT252_HUMAN	glycosyltransferase 25 domain containing 2	297					lipopolysaccharide biosynthetic process	endoplasmic reticulum lumen	procollagen galactosyltransferase activity			ovary(1)|breast(1)	2						TCTGATGGGGCTTCAGGGGGA	0.527													6	90	---	---	---	---	PASS
CFHR4	10877	broad.mit.edu	37	1	196883696	196883696	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196883696A>T	uc001gto.2	+	4	580	c.511A>T	c.(511-513)ACA>TCA	p.T171S	CFHR4_uc009wyy.2_Missense_Mutation_p.T417S|CFHR4_uc001gtp.2_Missense_Mutation_p.T418S	NM_006684	NP_006675	Q92496	FHR4_HUMAN	complement factor H-related 4 precursor	171	Sushi 3.					extracellular region	lipid transporter activity			ovary(1)|pancreas(1)|skin(1)	3						GCTCCATGACACATTGGACTA	0.408													32	62	---	---	---	---	PASS
NR5A2	2494	broad.mit.edu	37	1	200143295	200143295	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200143295A>G	uc001gvb.2	+	8	1789	c.1583A>G	c.(1582-1584)TAT>TGT	p.Y528C	NR5A2_uc001gvc.2_Missense_Mutation_p.Y482C|NR5A2_uc009wzh.2_Missense_Mutation_p.Y488C|NR5A2_uc010pph.1_Missense_Mutation_p.Y456C	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	528					embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					GATGTGCCCTATAATAACCTT	0.458													25	44	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216373167	216373167	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216373167C>A	uc001hku.1	-	17	4000	c.3613G>T	c.(3613-3615)GCT>TCT	p.A1205S	USH2A_uc001hkv.2_Missense_Mutation_p.A1205S	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1205	Extracellular (Potential).|Fibronectin type-III 2.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGATGGTAGCTGAGGTTTCA	0.473										HNSCC(13;0.011)			39	87	---	---	---	---	PASS
TAF1A	9015	broad.mit.edu	37	1	222742979	222742979	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222742979G>T	uc009xdz.1	-	7	956	c.767C>A	c.(766-768)GCC>GAC	p.A256D	TAF1A_uc001hni.1_Missense_Mutation_p.A142D|TAF1A_uc001hnj.2_Missense_Mutation_p.A256D|TAF1A_uc001hnk.2_Missense_Mutation_p.A142D|TAF1A_uc010pur.1_Missense_Mutation_p.A256D	NM_139352	NP_647603	Q15573	TAF1A_HUMAN	TBP-associated factor 1A isoform 2	256					regulation of transcription, DNA-dependent|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter	RNA polymerase I transcription factor complex	DNA binding				0				GBM - Glioblastoma multiforme(131;0.0186)		TACCTCTTGGGCTCCATCTCG	0.353													27	43	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240990468	240990468	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240990468C>G	uc001hyv.2	-	10	944	c.614G>C	c.(613-615)GGA>GCA	p.G205A	RGS7_uc010pyh.1_Missense_Mutation_p.G179A|RGS7_uc010pyj.1_Missense_Mutation_p.G121A|RGS7_uc001hyu.2_Missense_Mutation_p.G205A|RGS7_uc009xgn.1_Missense_Mutation_p.G152A|RGS7_uc001hyw.2_Missense_Mutation_p.G205A|RGS7_uc001hyt.2_Missense_Mutation_p.G37A	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	205					G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ATTTACACATCCAGGCTGGGA	0.433													4	73	---	---	---	---	PASS
OPN3	23596	broad.mit.edu	37	1	241767615	241767615	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:241767615G>A	uc001hza.2	-	2	785	c.640C>T	c.(640-642)CCC>TCC	p.P214S	OPN3_uc001hzb.2_Intron|OPN3_uc001hzc.2_Intron	NM_014322	NP_055137	Q9H1Y3	OPN3_HUMAN	opsin 3	214	Helical; Name=5; (Potential).				phototransduction|protein-chromophore linkage|regulation of circadian rhythm|visual perception	integral to plasma membrane	G-protein coupled photoreceptor activity				0	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			ACACCCAGGGGCACCACCAGG	0.512													22	64	---	---	---	---	PASS
CEP170	9859	broad.mit.edu	37	1	243333015	243333015	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243333015C>A	uc001hzs.2	-	12	2166	c.1758G>T	c.(1756-1758)CAG>CAT	p.Q586H	CEP170_uc001hzt.2_Missense_Mutation_p.Q488H|CEP170_uc001hzu.2_Missense_Mutation_p.Q488H	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha	586						centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AACTAGCCCACTGTGAAACCC	0.388													26	34	---	---	---	---	PASS
C1orf100	200159	broad.mit.edu	37	1	244541905	244541905	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:244541905T>A	uc001iah.2	+	4	402	c.289T>A	c.(289-291)TAC>AAC	p.Y97N	C1orf100_uc001iai.2_Missense_Mutation_p.Y65N	NM_001012970	NP_001012988	Q5SVJ3	CA100_HUMAN	hypothetical protein LOC200159	97											0	all_cancers(71;3.94e-05)|all_epithelial(71;0.000138)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|all_lung(81;0.0736)|Ovarian(71;0.0761)|Lung NSC(105;0.103)		all cancers(7;8.19e-08)|GBM - Glioblastoma multiforme(7;2.05e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.000984)			AGAAACCACTTACCGACGAGA	0.423													27	72	---	---	---	---	PASS
OR2C3	81472	broad.mit.edu	37	1	247695001	247695001	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247695001C>T	uc009xgy.2	-	2	1175	c.813G>A	c.(811-813)CAG>CAA	p.Q271Q	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_Intron|C1orf150_uc001idb.3_Intron|C1orf150_uc009xgx.2_Intron|LOC148824_uc001idd.2_5'Flank	NM_198074	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C,	271	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TGAACTTGCCCTGCTCATGGG	0.537													17	64	---	---	---	---	PASS
OR2L13	284521	broad.mit.edu	37	1	248263011	248263011	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248263011T>A	uc001ids.2	+	3	671	c.334T>A	c.(334-336)TTA>ATA	p.L112I		NM_175911	NP_787107	Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTCTGAAGGCTTACTCCTGAC	0.498													114	241	---	---	---	---	PASS
OR2T2	401992	broad.mit.edu	37	1	248616170	248616170	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248616170C>A	uc001iek.1	+	1	72	c.72C>A	c.(70-72)TTC>TTA	p.F24L		NM_001004136	NP_001004136	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T,	24	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATCCTGCCTTCCCCGGGCTTC	0.527													113	273	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685254	248685254	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685254G>T	uc001ien.1	+	1	307	c.307G>T	c.(307-309)GTG>TTG	p.V103L		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAGCTCTATGTGGCCATGGG	0.532													83	104	---	---	---	---	PASS
SOX11	6664	broad.mit.edu	37	2	5832877	5832877	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:5832877G>T	uc002qyj.2	+	1	79	c.24G>T	c.(22-24)TTG>TTT	p.L8F		NM_003108	NP_003099	P35716	SOX11_HUMAN	SRY-box 11	8					cardiac ventricle formation|closure of optic fissure|cornea development in camera-type eye|embryonic digestive tract morphogenesis|embryonic skeletal system morphogenesis|eyelid development in camera-type eye|glial cell proliferation|hard palate development|lens morphogenesis in camera-type eye|limb bud formation|lung morphogenesis|negative regulation of cell death|negative regulation of glial cell proliferation|negative regulation of lymphocyte proliferation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription regulatory region DNA binding|neural crest cell development|neural tube formation|neuroepithelial cell differentiation|noradrenergic neuron differentiation|outflow tract morphogenesis|positive regulation of BMP signaling pathway|positive regulation of hippo signaling cascade|positive regulation of hormone secretion|positive regulation of neurogenesis|positive regulation of neuron differentiation|positive regulation of ossification|positive regulation of osteoblast differentiation|positive regulation of stem cell proliferation|regulation of transforming growth factor beta receptor signaling pathway|signal transduction involved in G1/S transition checkpoint|soft palate development|somite development|spinal cord development|sympathetic nervous system development|ventricular septum morphogenesis	cytoplasm|nucleolus	enhancer sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|RNA polymerase II transcription coactivator activity|translation factor activity, nucleic acid binding			central_nervous_system(3)	3	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			OV - Ovarian serous cystadenocarcinoma(76;0.132)		CGGAGAGCTTGGAAGCGGAGA	0.701													14	13	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15542399	15542399	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15542399C>A	uc002rcc.1	-	26	2990	c.2964G>T	c.(2962-2964)CAG>CAT	p.Q988H	NBAS_uc010exl.1_Missense_Mutation_p.Q60H|NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	988										ovary(2)|liver(1)|skin(1)	4						TCAGTTGGTCCTGATCAGGAA	0.368													14	53	---	---	---	---	PASS
NCOA1	8648	broad.mit.edu	37	2	24949570	24949570	+	Silent	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24949570A>T	uc002rfk.2	+	13	2970	c.2712A>T	c.(2710-2712)TCA>TCT	p.S904S	NCOA1_uc010eye.2_Silent_p.S904S|NCOA1_uc002rfi.2_Silent_p.S753S|NCOA1_uc002rfj.2_Silent_p.S904S|NCOA1_uc002rfl.2_Silent_p.S904S	NM_003743	NP_003734	Q15788	NCOA1_HUMAN	nuclear receptor coactivator 1 isoform 1	904	Interaction with CREBBP.								PAX3/NCOA1(8)	soft_tissue(8)|ovary(1)|lung(1)|skin(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGAGTAAATCAGAAGAGTAAG	0.333			T	PAX3	alveolar rhadomyosarcoma								18	22	---	---	---	---	PASS
CCDC121	79635	broad.mit.edu	37	2	27850564	27850564	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27850564C>G	uc002rle.2	-	2	284	c.103G>C	c.(103-105)GAA>CAA	p.E35Q	ZNF512_uc010yly.1_Intron|CCDC121_uc010eze.2_Missense_Mutation_p.E199Q|CCDC121_uc002rld.2_Missense_Mutation_p.E197Q|GPN1_uc010ezf.2_5'Flank|GPN1_uc010yma.1_5'Flank|GPN1_uc010ymb.1_5'Flank|GPN1_uc010ymc.1_5'Flank|GPN1_uc010ymd.1_5'Flank|GPN1_uc010yme.1_5'Flank|GPN1_uc010ezg.1_5'Flank	NM_024584	NP_078860	Q6ZUS5	CC121_HUMAN	coiled-coil domain containing 121 isoform 3	35											0	Acute lymphoblastic leukemia(172;0.155)					AATCTGTTTTCAGCCTGGACA	0.428													79	191	---	---	---	---	PASS
NRXN1	9378	broad.mit.edu	37	2	50758548	50758548	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:50758548C>A	uc010fbq.2	-	11	3761	c.2284G>T	c.(2284-2286)GAT>TAT	p.D762Y	NRXN1_uc002rxb.3_Missense_Mutation_p.D394Y|NRXN1_uc002rxe.3_Missense_Mutation_p.D722Y|NRXN1_uc002rxc.1_RNA	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor	Error:Variant_position_missing_in_P58400_after_alignment					angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			ATGCTCCCATCATAGCTCAAA	0.413													13	21	---	---	---	---	PASS
COMMD1	150684	broad.mit.edu	37	2	62227991	62227991	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62227991G>A	uc002sbp.2	+	2	347	c.336G>A	c.(334-336)CAG>CAA	p.Q112Q	COMMD1_uc002sbq.1_RNA	NM_152516	NP_689729	Q8N668	COMD1_HUMAN	MURR1	112					copper ion homeostasis|negative regulation of NF-kappaB transcription factor activity|positive regulation of protein ubiquitination|regulation of proteasomal ubiquitin-dependent protein catabolic process	cell junction|Cul2-RING ubiquitin ligase complex|cytoplasm|nucleolus	copper ion binding|protein homodimerization activity			ovary(1)	1	Lung NSC(7;0.035)|all_lung(7;0.0691)		LUSC - Lung squamous cell carcinoma(7;4.73e-07)|Epithelial(17;0.0216)|all cancers(80;0.0934)			TCATGAACCAGAGCCGCTGGA	0.498													8	73	---	---	---	---	PASS
PCYOX1	51449	broad.mit.edu	37	2	70486501	70486501	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70486501G>C	uc002sgn.3	+	2	188	c.122G>C	c.(121-123)GGA>GCA	p.G41A	PCYOX1_uc010fdo.2_5'UTR|PCYOX1_uc010yqu.1_Missense_Mutation_p.G41A	NM_016297	NP_057381	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1 precursor	41					prenylated protein catabolic process	lysosome|very-low-density lipoprotein particle	prenylcysteine oxidase activity			central_nervous_system(1)	1						GCGATTATTGGAGCCGGAATT	0.438													16	295	---	---	---	---	PASS
NAGK	55577	broad.mit.edu	37	2	71305575	71305575	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71305575G>A	uc002shp.3	+	10	1378	c.972G>A	c.(970-972)GGG>GGA	p.G324G	NAGK_uc010fea.2_RNA|NAGK_uc002shq.3_Silent_p.G175G|NAGK_uc002shr.2_Silent_p.G273G	NM_017567	NP_060037	Q9UJ70	NAGK_HUMAN	N-Acetylglucosamine kinase	324				G -> R (in Ref. 2; BAA91923).	N-acetylglucosamine metabolic process|N-acetylmannosamine metabolic process		ATP binding|N-acetylglucosamine kinase activity|protein binding				0					N-Acetyl-D-glucosamine(DB00141)	GGCACATCGGGCACCTCCTCC	0.607													10	14	---	---	---	---	PASS
LRRTM4	80059	broad.mit.edu	37	2	77745583	77745583	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77745583C>A	uc002snr.2	-	3	1827	c.1412G>T	c.(1411-1413)AGA>ATA	p.R471I	LRRTM4_uc002snq.2_Missense_Mutation_p.R471I|LRRTM4_uc002sns.2_Missense_Mutation_p.R471I|LRRTM4_uc002snt.2_Missense_Mutation_p.R472I	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4	471	Cytoplasmic (Potential).					integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		TTCAGACTCTCTGGCCTTTTT	0.453													34	62	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80874899	80874899	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80874899C>T	uc010ysh.1	+	18	2769	c.2764C>T	c.(2764-2766)CCT>TCT	p.P922S	CTNNA2_uc010yse.1_Missense_Mutation_p.P874S|CTNNA2_uc010ysf.1_Missense_Mutation_p.P874S|CTNNA2_uc010ysg.1_Missense_Mutation_p.P829S|CTNNA2_uc010ysi.1_Missense_Mutation_p.P506S|CTNNA2_uc010ysj.1_Missense_Mutation_p.P203S	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	922					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						GAGAGAAAAGCCTGAAGAATT	0.458													86	200	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309958	89309958	+	Intron	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309958G>T	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TGTCCATGCTGTGTCCTGACT	0.577													51	70	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90260015	90260015	+	RNA	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90260015A>T	uc010fhm.2	+	30		c.3998A>T								Parts of antibodies, mostly variable regions.																		TACAGGAGACAGAGTCACCAT	0.458													30	133	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98421889	98421889	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98421889C>A	uc002syh.3	-	21	2463	c.2234G>T	c.(2233-2235)GGA>GTA	p.G745V		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	745						integral to membrane				ovary(4)|central_nervous_system(2)	6						ACACTGTAGTCCAGGATCAAA	0.403													10	54	---	---	---	---	PASS
TMEM131	23505	broad.mit.edu	37	2	98421890	98421890	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98421890C>A	uc002syh.3	-	21	2462	c.2233G>T	c.(2233-2235)GGA>TGA	p.G745*		NM_015348	NP_056163	Q92545	TM131_HUMAN	RW1 protein	745						integral to membrane				ovary(4)|central_nervous_system(2)	6						CACTGTAGTCCAGGATCAAAA	0.403													10	52	---	---	---	---	PASS
RANBP2	5903	broad.mit.edu	37	2	109389037	109389037	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109389037G>T	uc002tem.3	+	22	8239	c.8113G>T	c.(8113-8115)GAT>TAT	p.D2705Y		NM_006267	NP_006258	P49792	RBP2_HUMAN	RAN binding protein 2	2705	Required for E3 SUMO-ligase activity.|Interaction with SUMO1.|2 X 50 AA approximate repeats.				carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA transport|protein folding|protein import into nucleus|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|nuclear pore	peptidyl-prolyl cis-trans isomerase activity|Ran GTPase binding|zinc ion binding		RANBP2/ALK(16)	soft_tissue(16)|lung(1)|pancreas(1)	18						AAATACAGCAGGTATGTTAAG	0.299													19	40	---	---	---	---	PASS
IL1F5	26525	broad.mit.edu	37	2	113818443	113818443	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113818443C>A	uc002tis.2	+	3	177	c.44C>A	c.(43-45)GCA>GAA	p.A15E	IL1F5_uc002tit.2_Missense_Mutation_p.A15E	NM_173170	NP_775262	Q9UBH0	I36RA_HUMAN	interleukin 1 family, member 5	15						extracellular space	cytokine activity|interleukin-1 receptor antagonist activity				0						AAGGACTCGGCATTGAAGGTG	0.502													3	58	---	---	---	---	PASS
SAP130	79595	broad.mit.edu	37	2	128712861	128712861	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128712861C>A	uc002tpp.2	-	15	2226	c.2094G>T	c.(2092-2094)ATG>ATT	p.M698I	SAP130_uc002tpn.2_Missense_Mutation_p.M458I|SAP130_uc002tpo.2_Missense_Mutation_p.M478I|SAP130_uc010fmd.2_Missense_Mutation_p.M733I|SAP130_uc002tpq.1_Missense_Mutation_p.M706I	NM_024545	NP_078821	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa isoform b	698					histone H3 acetylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	STAGA complex	transcription coactivator activity			ovary(2)|skin(2)	4	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		ATACAGTCTCCATGGACACAG	0.468													28	81	---	---	---	---	PASS
IMP4	92856	broad.mit.edu	37	2	131102229	131102229	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131102229G>T	uc002tra.1	+	3	157	c.140G>T	c.(139-141)CGC>CTC	p.R47L	CCDC115_uc002tqw.1_5'Flank|CCDC115_uc010zaf.1_5'Flank|CCDC115_uc002tqx.2_5'Flank|CCDC115_uc002tqy.1_5'Flank|CCDC115_uc002tqz.1_5'Flank	NM_033416	NP_219484	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein,	47	Arg-rich.				rRNA processing|translation	nucleolus|ribonucleoprotein complex	aminoacyl-tRNA ligase activity|ATP binding|protein binding			central_nervous_system(2)	2	Colorectal(110;0.1)					ACTGAGTTACGCCGAGAGGCT	0.552													21	87	---	---	---	---	PASS
KYNU	8942	broad.mit.edu	37	2	143685295	143685295	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143685295A>T	uc002tvl.2	+	4	488	c.358A>T	c.(358-360)ATG>TTG	p.M120L	KYNU_uc002tvk.2_Missense_Mutation_p.M120L|KYNU_uc010fnm.2_Missense_Mutation_p.M120L	NM_003937	NP_003928	Q16719	KYNU_HUMAN	kynureninase (L-kynurenine hydrolase) isoform a	120					anthranilate metabolic process|NAD biosynthetic process|quinolinate biosynthetic process|response to interferon-gamma|response to vitamin B6	cytosol|mitochondrion|soluble fraction	kynureninase activity|protein homodimerization activity			skin(2)	2				BRCA - Breast invasive adenocarcinoma(221;0.072)	L-Alanine(DB00160)|Pyridoxal Phosphate(DB00114)	TGTAGGCCTTATGAAGGACAT	0.358													15	93	---	---	---	---	PASS
G6PC2	57818	broad.mit.edu	37	2	169761069	169761069	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169761069C>T	uc002uem.2	+	3	475	c.383C>T	c.(382-384)ACC>ATC	p.T128I	G6PC2_uc002uen.2_Missense_Mutation_p.T128I|G6PC2_uc010fpv.2_Missense_Mutation_p.T12I	NM_021176	NP_066999	Q9NQR9	G6PC2_HUMAN	islet-specific glucose-6-phosphatase-related	128	Helical; (Potential).				gluconeogenesis|glucose homeostasis|glucose transport|regulation of insulin secretion|transmembrane transport	endoplasmic reticulum membrane|integral to membrane	glucose-6-phosphatase activity			pancreas(1)	1						GTCATGGTAACCGCTGCCCTG	0.483													45	186	---	---	---	---	PASS
MYO3B	140469	broad.mit.edu	37	2	171092574	171092574	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171092574C>G	uc002ufy.2	+	7	820	c.677C>G	c.(676-678)GCT>GGT	p.A226G	MYO3B_uc002ufv.2_Missense_Mutation_p.A213G|MYO3B_uc010fqb.1_Missense_Mutation_p.A213G|MYO3B_uc002ufz.2_Missense_Mutation_p.A226G|MYO3B_uc002ufw.2_RNA|MYO3B_uc002ufx.2_RNA|MYO3B_uc002uga.2_Missense_Mutation_p.A213G	NM_138995	NP_620482	Q8WXR4	MYO3B_HUMAN	myosin IIIB isoform 2	226	Protein kinase.				response to stimulus|visual perception	cytoplasm|myosin complex	actin binding|ATP binding|motor activity|protein serine/threonine kinase activity			lung(8)|ovary(6)|skin(4)|central_nervous_system(1)	19						GGGATCACAGCTATTGAACTG	0.498											OREG0014376	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	152	---	---	---	---	PASS
ATF2	1386	broad.mit.edu	37	2	175978775	175978775	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175978775C>A	uc002ujl.2	-	9	950	c.688G>T	c.(688-690)GCT>TCT	p.A230S	ATF2_uc010fqv.2_Missense_Mutation_p.A181S|ATF2_uc002ujv.2_Intron|ATF2_uc002ujm.2_Missense_Mutation_p.A172S|ATF2_uc002ujn.2_RNA|ATF2_uc002ujo.2_Intron|ATF2_uc002ujp.2_RNA|ATF2_uc002ujq.2_Missense_Mutation_p.A230S|ATF2_uc002ujr.2_Intron|ATF2_uc010fqu.2_Missense_Mutation_p.A212S|ATF2_uc002ujs.2_Missense_Mutation_p.A172S|ATF2_uc002ujt.2_RNA|ATF2_uc002uju.2_RNA|ATF2_uc002ujw.1_Missense_Mutation_p.A172S|ATF2_uc002ujx.1_RNA	NM_001880	NP_001871	P15336	ATF2_HUMAN	activating transcription factor 2	230					innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|regulation of sequence-specific DNA binding transcription factor activity|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	nucleoplasm	protein dimerization activity|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(1)|breast(1)|pancreas(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.125)			GCAGGAATAGCAACAGGCATG	0.373													42	197	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179408165	179408165	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179408165C>A	uc010zfg.1	-	296	89055	c.88831G>T	c.(88831-88833)GTG>TTG	p.V29611L	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.V23306L|TTN_uc010zfi.1_Missense_Mutation_p.V23239L|TTN_uc010zfj.1_Missense_Mutation_p.V23114L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	30538							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCTGGCAGCACTCTGAAATAG	0.418													3	59	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179456221	179456221	+	Silent	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179456221G>C	uc010zfg.1	-	253	52751	c.52527C>G	c.(52525-52527)TCC>TCG	p.S17509S	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Silent_p.S11204S|TTN_uc010zfi.1_Silent_p.S11137S|TTN_uc010zfj.1_Silent_p.S11012S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	18436							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTAGCTCCACGGATGGAGGCA	0.353													53	198	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179470363	179470363	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179470363G>A	uc010zfg.1	-	228	46179	c.45955C>T	c.(45955-45957)CGC>TGC	p.R15319C	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.R9014C|TTN_uc010zfi.1_Missense_Mutation_p.R8947C|TTN_uc010zfj.1_Missense_Mutation_p.R8822C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16246							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCATTACTGCGGGGCTCTTTC	0.473													57	74	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179576040	179576040	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179576040C>G	uc010zfg.1	-	94	24415	c.24191G>C	c.(24190-24192)AGA>ACA	p.R8064T	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.R4725T	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8991							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TTGAACATCTCTCAATTGTCG	0.363													63	74	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179576683	179576683	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179576683G>T	uc010zfg.1	-	93	24366	c.24142C>A	c.(24142-24144)CTT>ATT	p.L8048I	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.L4709I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	8975							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAACGGTAAGGAAAGTTGAT	0.353													65	100	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803160	185803160	+	Missense_Mutation	SNP	A	G	G	rs142034505	byFrequency	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803160A>G	uc002uph.2	+	4	3631	c.3037A>G	c.(3037-3039)AGT>GGT	p.S1013G		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1013						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						AGCACATGTCAGTGGTCATAC	0.403													38	54	---	---	---	---	PASS
COL5A2	1290	broad.mit.edu	37	2	189923185	189923185	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189923185C>G	uc002uqk.2	-	33	2474	c.2199G>C	c.(2197-2199)ATG>ATC	p.M733I	COL5A2_uc010frx.2_Missense_Mutation_p.M309I	NM_000393	NP_000384	P05997	CO5A2_HUMAN	alpha 2 type V collagen preproprotein	733					axon guidance|collagen fibril organization|eye morphogenesis|skin development	collagen type V	extracellular matrix structural constituent			ovary(2)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GTCCTCCAGCCATTCCCTTCT	0.433													41	62	---	---	---	---	PASS
HECW2	57520	broad.mit.edu	37	2	197184491	197184491	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197184491C>A	uc002utm.1	-	9	1306	c.1123G>T	c.(1123-1125)GAC>TAC	p.D375Y	HECW2_uc002utl.1_Missense_Mutation_p.D19Y	NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin	375					protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						GCAGCACTGTCCTCAGAAACT	0.522													35	47	---	---	---	---	PASS
SF3B1	23451	broad.mit.edu	37	2	198267277	198267277	+	Intron	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198267277T>A	uc002uue.2	-							NM_012433	NP_036565	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1 isoform 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|nuclear speck|U12-type spliceosomal complex	protein binding			pancreas(3)|ovary(1)|breast(1)|skin(1)	6			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CATTACAACTTACCATGTTCA	0.209													9	43	---	---	---	---	PASS
CYP20A1	57404	broad.mit.edu	37	2	204116832	204116832	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204116832G>T	uc002uzv.3	+	4	1054	c.432G>T	c.(430-432)AAG>AAT	p.K144N	CYP20A1_uc002uzx.3_Missense_Mutation_p.K42N|CYP20A1_uc010zif.1_Missense_Mutation_p.K144N|CYP20A1_uc002uzy.3_Missense_Mutation_p.K42N|CYP20A1_uc002uzw.3_RNA	NM_177538	NP_803882	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A,	144						integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0						TCCTCCTAAAGGTAAGGTGAT	0.353													27	32	---	---	---	---	PASS
KIAA1486	57624	broad.mit.edu	37	2	226447576	226447576	+	Silent	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:226447576G>C	uc002voe.2	+	4	1618	c.1443G>C	c.(1441-1443)TCG>TCC	p.S481S	KIAA1486_uc010fxa.1_Intron|KIAA1486_uc002vof.1_Silent_p.S251S	NM_020864	NP_065915	Q9P242	K1486_HUMAN	hypothetical protein LOC57624	481										ovary(2)|central_nervous_system(1)	3		Renal(207;0.0112)|all_lung(227;0.0477)|Lung NSC(271;0.0644)|all_hematologic(139;0.101)|Esophageal squamous(248;0.129)		Epithelial(121;6.73e-10)|all cancers(144;4.32e-07)|Lung(261;0.0161)|LUSC - Lung squamous cell carcinoma(224;0.0223)		GACCCGTGTCGCAAGATGGGG	0.667													5	50	---	---	---	---	PASS
DIS3L2	129563	broad.mit.edu	37	2	233195494	233195494	+	Intron	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233195494G>A	uc010fxz.2	+						DIS3L2_uc002vsm.3_Intron|DIS3L2_uc002vso.2_Intron	NM_152383	NP_689596	Q8IYB7	DI3L2_HUMAN	DIS3 mitotic control homolog (S.								exonuclease activity|ribonuclease activity|RNA binding			ovary(1)|breast(1)|central_nervous_system(1)	3		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		CAGGTAAGGAGGGCCCAGCCC	0.617													58	76	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234343507	234343507	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234343507G>T	uc002vui.1	+	5	558	c.546G>T	c.(544-546)GAG>GAT	p.E182D	DGKD_uc002vuj.1_Missense_Mutation_p.E138D|DGKD_uc010fyh.1_Missense_Mutation_p.E49D|DGKD_uc002vuk.1_Missense_Mutation_p.E49D	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	182	Phorbol-ester/DAG-type 1.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TGTGCCGTGAGGCTCTGTCTG	0.562													38	158	---	---	---	---	PASS
DGKD	8527	broad.mit.edu	37	2	234357911	234357911	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234357911G>A	uc002vui.1	+	15	1789	c.1777G>A	c.(1777-1779)GCA>ACA	p.A593T	DGKD_uc002vuj.1_Missense_Mutation_p.A549T|DGKD_uc010fyh.1_Missense_Mutation_p.A460T|DGKD_uc010fyi.1_RNA	NM_152879	NP_690618	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa isoform 2	593					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|cell growth|diacylglycerol metabolic process|endocytosis|epidermal growth factor receptor signaling pathway|multicellular organismal development|platelet activation|protein homooligomerization|protein transport|response to organic substance|second-messenger-mediated signaling	cytoplasm|cytoplasmic membrane-bounded vesicle|plasma membrane|plasma membrane	ATP binding|diacylglycerol binding|diacylglycerol kinase activity|metal ion binding|protein heterodimerization activity|protein homodimerization activity			central_nervous_system(2)|pancreas(1)|lung(1)|skin(1)	5		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CCGCTTGGTGGCATCAGCTTG	0.607													18	54	---	---	---	---	PASS
ARPP21	10777	broad.mit.edu	37	3	35785334	35785334	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:35785334C>G	uc003cgb.2	+	18	2173	c.1909C>G	c.(1909-1911)CCT>GCT	p.P637A	ARPP21_uc003cga.2_Missense_Mutation_p.P618A|ARPP21_uc011axy.1_Missense_Mutation_p.P638A|ARPP21_uc003cgf.2_Missense_Mutation_p.P473A|ARPP21_uc003cgg.2_Missense_Mutation_p.P160A|uc011axz.1_5'Flank|MIR128-2_hsa-mir-128-2|MI0000727_5'Flank	NM_016300	NP_057384	Q9UBL0	ARP21_HUMAN	cyclic AMP-regulated phosphoprotein, 21 kD	637	Gln-rich.					cytoplasm	nucleic acid binding			ovary(2)|skin(1)	3						TCCACAGATGCCTGTATATTA	0.388													18	36	---	---	---	---	PASS
SLC25A38	54977	broad.mit.edu	37	3	39431939	39431939	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39431939G>T	uc003cjo.2	+	3	618	c.217G>T	c.(217-219)GTA>TTA	p.V73L		NM_017875	NP_060345	Q96DW6	S2538_HUMAN	solute carrier family 25, member 38	73	Solcar 1.				erythrocyte differentiation|heme biosynthetic process|transport	integral to membrane|mitochondrial inner membrane					0				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GATGTTGGCTGTACTCTTGAA	0.483													61	68	---	---	---	---	PASS
CDCP1	64866	broad.mit.edu	37	3	45132936	45132936	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45132936C>A	uc003com.2	-	7	1857	c.1722G>T	c.(1720-1722)GTG>GTT	p.V574V		NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	574	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGTTCCAGGACACAGAGGTGA	0.602													14	11	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52556921	52556921	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52556921C>T	uc003dej.2	+	62	6949	c.6875C>T	c.(6874-6876)TCA>TTA	p.S2292L	STAB1_uc003dek.1_Missense_Mutation_p.S307L|STAB1_uc003del.2_Missense_Mutation_p.S179L	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	2292	Extracellular (Potential).|Link.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		AAGAACCTCTCAGAACGCTGG	0.617													37	27	---	---	---	---	PASS
OR5AC2	81050	broad.mit.edu	37	3	97806366	97806366	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97806366T>C	uc011bgs.1	+	1	350	c.350T>C	c.(349-351)CTG>CCG	p.L117P		NM_054106	NP_473447	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC,	117	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGCTTCCTCCTGGTGATGATG	0.433													73	213	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97868387	97868387	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97868387C>T	uc003dsg.1	+	1	158	c.158C>T	c.(157-159)CCT>CTT	p.P53L		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	53	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TGGAAAGACCCTCATCTTCAT	0.418													91	371	---	---	---	---	PASS
DPPA4	55211	broad.mit.edu	37	3	109050762	109050762	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:109050762G>T	uc003dxq.3	-	3	350	c.295C>A	c.(295-297)CTG>ATG	p.L99M	DPPA4_uc011bho.1_Missense_Mutation_p.L99M|DPPA4_uc011bhp.1_Missense_Mutation_p.L99M	NM_018189	NP_060659	Q7L190	DPPA4_HUMAN	developmental pluripotency associated 4	99						nucleus	protein binding			upper_aerodigestive_tract(1)	1						CAGGCCCGCAGAATGTCCCGG	0.537													7	173	---	---	---	---	PASS
CCDC80	151887	broad.mit.edu	37	3	112358517	112358517	+	Missense_Mutation	SNP	C	A	A	rs139180030	byFrequency	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112358517C>A	uc003dzf.2	-	2	454	c.236G>T	c.(235-237)AGT>ATT	p.S79I	CCDC80_uc011bhv.1_Missense_Mutation_p.S79I|CCDC80_uc003dzg.2_Missense_Mutation_p.S79I|CCDC80_uc003dzh.1_Missense_Mutation_p.S79I	NM_199512	NP_955806	Q76M96	CCD80_HUMAN	steroid-sensitive protein 1 precursor	79										ovary(2)	2						CACGGGCACACTCCTCCTTCT	0.612													56	88	---	---	---	---	PASS
PLA1A	51365	broad.mit.edu	37	3	119331936	119331936	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119331936T>A	uc003ecu.2	+	5	674	c.635T>A	c.(634-636)TTC>TAC	p.F212Y	PLA1A_uc003ecv.2_Missense_Mutation_p.F196Y|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.F39Y	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	212					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						GATGCCCTCTTCGTGGAAGCC	0.582													9	18	---	---	---	---	PASS
PLA1A	51365	broad.mit.edu	37	3	119331937	119331937	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119331937C>A	uc003ecu.2	+	5	675	c.636C>A	c.(634-636)TTC>TTA	p.F212L	PLA1A_uc003ecv.2_Missense_Mutation_p.F196L|PLA1A_uc003ecw.2_RNA|PLA1A_uc011bjc.1_Missense_Mutation_p.F39L	NM_015900	NP_056984	Q53H76	PLA1A_HUMAN	phospholipase A1 member A precursor	212					lipid catabolic process|phosphatidylserine metabolic process	extracellular region	phospholipase A1 activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						ATGCCCTCTTCGTGGAAGCCA	0.577													9	17	---	---	---	---	PASS
FBXO40	51725	broad.mit.edu	37	3	121340661	121340661	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121340661C>T	uc003eeg.2	+	3	595	c.385C>T	c.(385-387)CTG>TTG	p.L129L		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	129					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)		GGACACAGCCCTGGCCCTGCA	0.502													12	39	---	---	---	---	PASS
SEMA5B	54437	broad.mit.edu	37	3	122645462	122645462	+	Missense_Mutation	SNP	C	A	A	rs139156063		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122645462C>A	uc003efz.1	-	9	1217	c.913G>T	c.(913-915)GCA>TCA	p.A305S	SEMA5B_uc011bju.1_Missense_Mutation_p.A247S|SEMA5B_uc003ega.1_RNA|SEMA5B_uc003egb.1_Missense_Mutation_p.A305S|SEMA5B_uc010hro.1_Missense_Mutation_p.A247S|SEMA5B_uc010hrp.1_RNA	NM_001031702	NP_001026872	Q9P283	SEM5B_HUMAN	semaphorin 5B isoform 1	305	Extracellular (Potential).|Sema.				cell differentiation|nervous system development	integral to membrane	receptor activity			ovary(2)|breast(2)|pancreas(2)|central_nervous_system(1)	7				GBM - Glioblastoma multiforme(114;0.0367)		TGCTCCACTGCGTTCTCCCGC	0.607													12	38	---	---	---	---	PASS
ROPN1B	152015	broad.mit.edu	37	3	125701208	125701208	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125701208C>T	uc003eih.2	+	5	720	c.492C>T	c.(490-492)CTC>CTT	p.L164L	ROPN1B_uc010hsb.2_Silent_p.L164L|ROPN1B_uc010hsc.2_Silent_p.L72L	NM_001012337	NP_001012337	Q9BZX4	ROP1B_HUMAN	ropporin, rhophilin associated protein 1B	164					acrosome reaction|cell-cell adhesion|cytokinesis|fusion of sperm to egg plasma membrane|Rho protein signal transduction|sperm motility|spermatogenesis	cytoplasm|flagellum	cAMP-dependent protein kinase regulator activity|protein heterodimerization activity|protein homodimerization activity|receptor signaling complex scaffold activity				0				GBM - Glioblastoma multiforme(114;0.151)		TCCAGTTTCTCTACACGTATA	0.428													26	106	---	---	---	---	PASS
GATA2	2624	broad.mit.edu	37	3	128199973	128199973	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128199973C>T	uc003ekm.3	-	7	1767	c.1332G>A	c.(1330-1332)CCG>CCA	p.P444P	GATA2_uc003ekn.3_Silent_p.P430P|GATA2_uc003eko.2_Silent_p.P444P	NM_001145661	NP_001139133	P23769	GATA2_HUMAN	GATA binding protein 2 isoform 1	444					blood coagulation|negative regulation of fat cell differentiation|negative regulation of fat cell proliferation|negative regulation of neural precursor cell proliferation|negative regulation of Notch signaling pathway|phagocytosis|positive regulation of angiogenesis|positive regulation of phagocytosis|positive regulation of transcription from RNA polymerase II promoter	nucleoplasm	C2H2 zinc finger domain binding|chromatin binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(13)|lung(1)|skin(1)	15				GBM - Glioblastoma multiforme(114;0.173)		GGCTGAAGGGCGGGAGGTGGC	0.657			Mis		AML(CML blast transformation)								17	88	---	---	---	---	PASS
IL20RB	53833	broad.mit.edu	37	3	136714254	136714254	+	Splice_Site	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136714254A>T	uc003eri.1	+	6	932	c.683_splice	c.e6-2	p.G228_splice	IL20RB_uc003erj.1_Splice_Site|IL20RB_uc010hud.1_Splice_Site_p.G86_splice	NM_144717	NP_653318	Q6UXL0	I20RB_HUMAN	interleukin 20 receptor beta precursor							integral to membrane	receptor activity			ovary(1)	1						TTTTGTTTCCAGGAGAGGCCA	0.507													58	170	---	---	---	---	PASS
RBP2	5948	broad.mit.edu	37	3	139195235	139195235	+	Missense_Mutation	SNP	C	A	A	rs147339826		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:139195235C>A	uc003eth.2	-	1	118	c.67G>T	c.(67-69)GCC>TCC	p.A23S		NM_004164	NP_004155	P50120	RET2_HUMAN	retinol binding protein 2, cellular	23					epidermis development|retinoid metabolic process|steroid metabolic process|vitamin A metabolic process	cytosol	retinal binding|retinol binding|transporter activity			skin(1)	1					Vitamin A(DB00162)	TTACCCAGGGCCTTCATGTAG	0.498													30	81	---	---	---	---	PASS
PLSCR5	389158	broad.mit.edu	37	3	146311771	146311771	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146311771T>A	uc003ewb.2	-	4	1393	c.389A>T	c.(388-390)GAG>GTG	p.E130V	PLSCR5_uc010hvb.2_Missense_Mutation_p.E118V|PLSCR5_uc010hvc.2_Missense_Mutation_p.E130V	NM_001085420	NP_001078889	A0PG75	PLS5_HUMAN	phospholipid scramblase family, member 5	130											0						TGTAATGACCTCTCGACCTGA	0.458													72	89	---	---	---	---	PASS
CP	1356	broad.mit.edu	37	3	148896347	148896347	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148896347T>C	uc003ewy.3	-	16	2986	c.2733A>G	c.(2731-2733)AGA>AGG	p.R911R	CP_uc011bnr.1_RNA|CP_uc003eww.3_Silent_p.R63R|CP_uc003ewx.3_Silent_p.R692R|CP_uc003ewz.2_Silent_p.R911R	NM_000096	NP_000087	P00450	CERU_HUMAN	ceruloplasmin precursor	911	F5/8 type A 3.|Plastocyanin-like 6.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	extracellular space	chaperone binding|ferroxidase activity			ovary(1)	1		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	CCAGTTTCCTTCTGGGATTGA	0.398													44	53	---	---	---	---	PASS
P2RY1	5028	broad.mit.edu	37	3	152553673	152553673	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:152553673C>T	uc003ezq.2	+	1	938	c.102C>T	c.(100-102)GCC>GCT	p.A34A		NM_002563	NP_002554	P47900	P2RY1_HUMAN	purinergic receptor P2Y1	34	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|platelet activation	integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0628)|Lung(72;0.11)			CCTCCACTGCCGCCGTCTCCT	0.627													23	116	---	---	---	---	PASS
SERPINI1	5274	broad.mit.edu	37	3	167510476	167510476	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167510476T>G	uc003ffa.3	+	4	778	c.580T>G	c.(580-582)TTT>GTT	p.F194V	SERPINI1_uc003ffb.3_Missense_Mutation_p.F194V	NM_001122752	NP_001116224	Q99574	NEUS_HUMAN	neuroserpin precursor	194					central nervous system development|peripheral nervous system development|regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			skin(1)	1						GAAGTCGCAGTTTAGGCCTGA	0.388													40	148	---	---	---	---	PASS
TERC	7012	broad.mit.edu	37	3	169482476	169482476	+	RNA	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169482476C>T	uc003ffr.1	-	1		c.373G>A				NR_001566				Homo sapiens cDNA clone IMAGE:40002477.												0						CTCCGTTCCTCTTCCTGCGGC	0.672									Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				9	21	---	---	---	---	PASS
MYNN	55892	broad.mit.edu	37	3	169501281	169501281	+	Silent	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169501281A>T	uc003fft.2	+	6	1845	c.1416A>T	c.(1414-1416)ATA>ATT	p.I472I	MYNN_uc011bpm.1_Silent_p.I358I|MYNN_uc003ffu.2_Silent_p.I472I|MYNN_uc003ffv.2_Silent_p.I199I|MYNN_uc010hwo.2_Silent_p.I472I|MYNN_uc003ffw.1_RNA	NM_018657	NP_061127	Q9NPC7	MYNN_HUMAN	myoneurin	472	C2H2-type 7.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(1)	1	all_cancers(22;9.55e-22)|all_epithelial(15;2.04e-26)|all_lung(20;5.05e-16)|Lung NSC(18;2.19e-15)|Ovarian(172;0.000223)|Breast(254;0.197)		Epithelial(2;4.03e-64)|all cancers(2;2.19e-58)|Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			AACCATACATATGTGGTATTT	0.323													119	216	---	---	---	---	PASS
SLC2A2	6514	broad.mit.edu	37	3	170720438	170720438	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170720438G>A	uc003fhe.1	-	8	1304	c.995C>T	c.(994-996)ACG>ATG	p.T332M	SLC2A2_uc003fhf.1_Missense_Mutation_p.T159M|SLC2A2_uc011bpu.1_Missense_Mutation_p.T205M	NM_000340	NP_000331	P11168	GTR2_HUMAN	solute carrier family 2 (facilitated glucose	332	Extracellular (Potential).				carbohydrate metabolic process|cellular lipid metabolic process|endocrine pancreas development|energy reserve metabolic process|regulation of insulin secretion	integral to plasma membrane|membrane fraction	D-glucose transmembrane transporter activity			ovary(1)|central_nervous_system(1)	2	all_cancers(22;1.41e-19)|all_lung(20;1.59e-15)|Lung NSC(18;7.08e-15)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;1.1e-14)|Lung(28;2.99e-14)			GATACCAGCCGTCTGAAAAAT	0.383													7	48	---	---	---	---	PASS
PLD1	5337	broad.mit.edu	37	3	171321028	171321028	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171321028T>A	uc003fhs.2	-	27	3181	c.3065A>T	c.(3064-3066)AAG>ATG	p.K1022M	PLD1_uc003fht.2_Missense_Mutation_p.K984M	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a	1022					cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TAATACGGGCTTGTTTATAAA	0.388													21	114	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173998631	173998631	+	Silent	SNP	G	A	A	rs115881871	byFrequency	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173998631G>A	uc003fio.1	+	7	2433	c.2010G>A	c.(2008-2010)AGG>AGA	p.R670R	NLGN1_uc003fip.1_Silent_p.R670R	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	687	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			TGGATCAAAGGGACTACTCAA	0.458													42	257	---	---	---	---	PASS
NDUFB5	4711	broad.mit.edu	37	3	179322659	179322659	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179322659C>G	uc003fkc.2	+	1	85	c.56C>G	c.(55-57)TCT>TGT	p.S19C	MRPL47_uc003fjz.2_5'Flank|MRPL47_uc003fka.2_5'Flank|MRPL47_uc003fkb.2_5'Flank|NDUFB5_uc003fkd.2_RNA|NDUFB5_uc003fke.2_Missense_Mutation_p.S19C	NM_002492	NP_002483	O43674	NDUB5_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	19					mitochondrial electron transport, NADH to ubiquinone|transport	integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			skin(1)	1	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)		NADH(DB00157)	GCAGCTCTGTCTGGCCGGCCC	0.642													12	63	---	---	---	---	PASS
HTR3C	170572	broad.mit.edu	37	3	183776353	183776353	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183776353T>A	uc003fmk.2	+	6	732	c.698T>A	c.(697-699)CTA>CAA	p.L233Q		NM_130770	NP_570126	Q8WXA8	5HT3C_HUMAN	5-hydroxytryptamine receptor 3 subunit C	233	Extracellular (Potential).					integral to membrane|plasma membrane|postsynaptic membrane	extracellular ligand-gated ion channel activity|receptor activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			GGCAACAACCTATATGACCAG	0.512													40	210	---	---	---	---	PASS
DGKG	1608	broad.mit.edu	37	3	185906145	185906145	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185906145C>A	uc003fqa.2	-	22	2478	c.1941G>T	c.(1939-1941)CTG>CTT	p.L647L	DGKG_uc003fqb.2_Silent_p.L608L|DGKG_uc003fqc.2_Silent_p.L622L|DGKG_uc011brx.1_Silent_p.L588L	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1	647					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	AGATGTTGCTCAGGTCCACCC	0.498													30	140	---	---	---	---	PASS
OTOP1	133060	broad.mit.edu	37	4	4228190	4228190	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:4228190G>T	uc003ghp.1	-	1	432	c.402C>A	c.(400-402)CGC>CGA	p.R134R		NM_177998	NP_819056	Q7RTM1	OTOP1_HUMAN	otopetrin 1	134					biomineral tissue development	extracellular space|integral to membrane				ovary(2)|central_nervous_system(1)	3				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGGACTCACCGCGCAGCCAGC	0.721													4	2	---	---	---	---	PASS
CENPC1	1060	broad.mit.edu	37	4	68380252	68380252	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68380252T>C	uc003hdd.1	-	8	1167	c.984A>G	c.(982-984)AAA>AAG	p.K328K	CENPC1_uc010ihj.1_RNA|CENPC1_uc010ihk.1_RNA|CENPC1_uc010ihm.1_Silent_p.K328K	NM_001812	NP_001803	Q03188	CENPC_HUMAN	centromere protein C 1	328					mitotic prometaphase	condensed chromosome kinetochore|condensed nuclear chromosome, centromeric region|cytosol	DNA binding			urinary_tract(1)|lung(1)	2						TTGTGCGTTGTTTCAGAGACC	0.393													16	13	---	---	---	---	PASS
BANK1	55024	broad.mit.edu	37	4	102993502	102993502	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:102993502G>T	uc003hvy.3	+	15	2517	c.2243G>T	c.(2242-2244)GGT>GTT	p.G748V	BANK1_uc003hvx.3_Missense_Mutation_p.G733V|BANK1_uc010ill.2_Missense_Mutation_p.G615V|BANK1_uc003hvz.3_Missense_Mutation_p.G718V	NM_017935	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	748					B cell activation					ovary(2)|skin(1)	3		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		GTATTTCTAGGTAAGGAAACT	0.259													41	50	---	---	---	---	PASS
LRIT3	345193	broad.mit.edu	37	4	110791868	110791868	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110791868C>A	uc003hzx.3	+	3	2021	c.1828C>A	c.(1828-1830)CTG>ATG	p.L610M	LRIT3_uc003hzw.3_Missense_Mutation_p.L472M	NM_198506	NP_940908	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and	610						integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		AGAGAAATTGCTGCTTTGTTC	0.458													16	25	---	---	---	---	PASS
LRIT3	345193	broad.mit.edu	37	4	110791869	110791869	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110791869T>A	uc003hzx.3	+	3	2022	c.1829T>A	c.(1828-1830)CTG>CAG	p.L610Q	LRIT3_uc003hzw.3_Missense_Mutation_p.L472Q	NM_198506	NP_940908	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and	610						integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		GAGAAATTGCTGCTTTGTTCT	0.458													17	25	---	---	---	---	PASS
AGA	175	broad.mit.edu	37	4	178358674	178358674	+	Splice_Site	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178358674C>T	uc003iuu.1	-	5	570	c.508_splice	c.e5-1	p.N170_splice	AGA_uc003iuv.1_Splice_Site_p.N74_splice|AGA_uc003iuw.2_Splice_Site_p.N74_splice	NM_000027	NP_000018	P20933	ASPG_HUMAN	aspartylglucosaminidase precursor						asparagine catabolic process via L-aspartate|protein deglycosylation|protein maturation	endoplasmic reticulum|intermediate filament cytoskeleton|lysosome|microtubule cytoskeleton	N4-(beta-N-acetylglucosaminyl)-L-asparaginase activity				0		all_lung(41;1.27e-09)|Lung NSC(41;1.1e-08)|Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Hepatocellular(41;0.148)|all_neural(102;0.164)|Colorectal(36;0.245)		all cancers(43;1.37e-22)|Epithelial(43;3.86e-20)|OV - Ovarian serous cystadenocarcinoma(60;3.8e-11)|Colorectal(24;6.98e-05)|GBM - Glioblastoma multiforme(59;0.000362)|COAD - Colon adenocarcinoma(29;0.000462)|STAD - Stomach adenocarcinoma(60;0.0029)|LUSC - Lung squamous cell carcinoma(193;0.0328)|READ - Rectum adenocarcinoma(43;0.163)		GTATAACATTCTGTAAACAAG	0.338													19	17	---	---	---	---	PASS
HELT	391723	broad.mit.edu	37	4	185941641	185941641	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185941641G>T	uc011ckq.1	+	4	699	c.699G>T	c.(697-699)CAG>CAT	p.Q233H	HELT_uc011cko.1_Missense_Mutation_p.Q148H|HELT_uc003ixa.3_Missense_Mutation_p.Q147H|HELT_uc011ckp.1_Missense_Mutation_p.Q91H	NM_001029887	NP_001025058	A6NFD8	HELT_HUMAN	HES/HEY-like transcription factor	233	Pro-rich.						DNA binding				0		all_lung(41;9.65e-12)|Lung NSC(41;1.64e-11)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;8.92e-26)|Epithelial(43;3.02e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.59e-11)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)		TCTCCTATCAGCTGCACCCTG	0.721													18	13	---	---	---	---	PASS
TRIML2	205860	broad.mit.edu	37	4	189012671	189012671	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189012671G>T	uc003izl.2	-	7	1056	c.1020C>A	c.(1018-1020)TCC>TCA	p.S340S	TRIML2_uc003izj.1_Silent_p.S168S|TRIML2_uc003izk.1_Silent_p.S148S|TRIML2_uc011cle.1_Silent_p.S415S	NM_173553	NP_775824	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	340	B30.2/SPRY.						ligase activity			central_nervous_system(2)	2		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TGTAAATGAGGGACATCTCGG	0.488													76	65	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13762899	13762899	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13762899C>G	uc003jfd.2	-	60	10255	c.10213G>C	c.(10213-10215)GGT>CGT	p.G3405R	DNAH5_uc003jfc.2_5'UTR	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	3405	Stalk (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					GAACAAAGACCAGCTACATTT	0.423									Kartagener_syndrome				36	67	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19838880	19838880	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19838880C>A	uc003jgc.2	-	2	593	c.216G>T	c.(214-216)CAG>CAT	p.Q72H	CDH18_uc003jgd.2_Missense_Mutation_p.Q72H|CDH18_uc011cnm.1_Missense_Mutation_p.Q72H	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	72	Extracellular (Potential).|Cadherin 1.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					TTCCAACATACTGAGGATCTG	0.378													14	38	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26881656	26881656	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26881656C>A	uc003jgs.1	-	12	2128	c.1959G>T	c.(1957-1959)CGG>CGT	p.R653R	CDH9_uc011cnv.1_Silent_p.R246R	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	653	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CAATGTTGTCCCGGACATCGT	0.408													64	141	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26885930	26885930	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26885930T>A	uc003jgs.1	-	11	1844	c.1675A>T	c.(1675-1677)AAC>TAC	p.N559Y	CDH9_uc011cnv.1_Missense_Mutation_p.N152Y	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	559	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CTCATTTTGTTGCGACTGTAG	0.388													29	39	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26902713	26902713	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26902713T>C	uc003jgs.1	-	7	1294	c.1125A>G	c.(1123-1125)GAA>GAG	p.E375E		NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	375	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						CATCTATATCTTCCACAGATA	0.413													29	67	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38451484	38451484	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38451484T>A	uc003jlc.1	+	20	2959	c.2635T>A	c.(2635-2637)TGG>AGG	p.W879R	EGFLAM_uc003jlb.1_Missense_Mutation_p.W871R|EGFLAM_uc003jle.1_Missense_Mutation_p.W637R|EGFLAM_uc003jlf.1_Missense_Mutation_p.W237R|EGFLAM_uc003jlg.1_Missense_Mutation_p.W14R	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	879	Laminin G-like 3.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CCTTTTGCTGTGGAGGGGAGA	0.507													59	108	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102487021	102487021	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102487021G>C	uc003kod.3	+	9	1490	c.971G>C	c.(970-972)GGC>GCC	p.G324A	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Missense_Mutation_p.G324A|PPIP5K2_uc010jbo.1_Missense_Mutation_p.G246A	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	324					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						GATGTCAATGGCTTCAGTTTT	0.299													30	37	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140588761	140588761	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140588761G>C	uc003liz.2	+	1	471	c.282G>C	c.(280-282)GAG>GAC	p.E94D	PCDHB12_uc011dak.1_Intron	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	94	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			ACAGGGAGGAGCTCTGTGGCT	0.478													56	38	---	---	---	---	PASS
PCDHGA1	56114	broad.mit.edu	37	5	140712343	140712343	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140712343G>T	uc003lji.1	+	1	2092	c.2092G>T	c.(2092-2094)GCC>TCC	p.A698S	PCDHGA1_uc011dan.1_Missense_Mutation_p.A698S	NM_018912	NP_061735	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1 isoform 1	698	Helical; (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|breast(1)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGCGGCGGCCGCGGTCTC	0.677													45	52	---	---	---	---	PASS
NIPAL4	348938	broad.mit.edu	37	5	156899620	156899620	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156899620C>G	uc003lwx.3	+	6	1169	c.1053C>G	c.(1051-1053)TTC>TTG	p.F351L	ADAM19_uc003lww.1_Intron|NIPAL4_uc011ddq.1_Missense_Mutation_p.F332L	NM_001099287	NP_001092757	Q0D2K0	NIPA4_HUMAN	ichthyin protein	351	Cytoplasmic (Potential).					integral to membrane	receptor activity				0						TGGACATTTTCAACACTTCCC	0.547											OREG0016979	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	38	40	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169144478	169144478	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169144478T>C	uc003maf.2	+	21	2202	c.2122T>C	c.(2122-2124)TTG>CTG	p.L708L	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Silent_p.L200L	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	708					actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGTGCGACCTTGGCTTACAA	0.448													48	41	---	---	---	---	PASS
SCGB3A1	92304	broad.mit.edu	37	5	180017806	180017806	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180017806C>A	uc003mly.2	-	2	110	c.85G>T	c.(85-87)GTG>TTG	p.V29L		NM_052863	NP_443095	Q96QR1	SG3A1_HUMAN	secretoglobin, family 3A, member 1 precursor	29					negative regulation of cell growth|regulation of cell proliferation	extracellular space	cytokine activity				0	all_cancers(89;7.5e-05)|all_epithelial(37;7.38e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00658)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCTGGGCCACAGGCTTGGCC	0.721													3	2	---	---	---	---	PASS
TMEM170B	100113407	broad.mit.edu	37	6	11566052	11566052	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:11566052C>A	uc010jpa.2	+	2	251	c.251C>A	c.(250-252)ACT>AAT	p.T84N		NM_001100829	NP_001094299	Q5T4T1	T170B_HUMAN	transmembrane protein 170B	84	Helical; (Potential).					integral to membrane					0						GCTTCTGTAACTGGAGCGATG	0.418													12	126	---	---	---	---	PASS
SCGN	10590	broad.mit.edu	37	6	25661812	25661812	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25661812G>T	uc003nfb.2	+	3	389	c.186G>T	c.(184-186)GTG>GTT	p.V62V	SCGN_uc010jpz.2_5'UTR	NM_006998	NP_008929	O76038	SEGN_HUMAN	secretagogin precursor	62	EF-hand 2.					extracellular region|transport vesicle membrane	calcium ion binding			ovary(2)|pancreas(1)	3						TGCACAAGGTGAAACAGCAGT	0.408													7	36	---	---	---	---	PASS
OR2B6	26212	broad.mit.edu	37	6	27925240	27925240	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:27925240C>G	uc011dkx.1	+	1	222	c.222C>G	c.(220-222)ACC>ACG	p.T74T		NM_012367	NP_036499	P58173	OR2B6_HUMAN	olfactory receptor, family 2, subfamily B,	74	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						TTTGTTACACCACATGTACAG	0.418													11	81	---	---	---	---	PASS
HLA-DQA2	3118	broad.mit.edu	37	6	32714033	32714033	+	Silent	SNP	C	T	T	rs139553288	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32714033C>T	uc003obx.2	+	4	688	c.630C>T	c.(628-630)GCC>GCT	p.A210A		NM_020056	NP_064440	P01906	DQA2_HUMAN	major histocompatibility complex, class II, DQ	210	Extracellular (Potential).|Connecting peptide.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	endoplasmic reticulum membrane|endosome membrane|Golgi apparatus|integral to plasma membrane|lysosomal membrane|MHC class II protein complex	MHC class II receptor activity				0					Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AGATTCCAGCCCCTATGTCAG	0.572													8	110	---	---	---	---	PASS
SYNGAP1	8831	broad.mit.edu	37	6	33405482	33405482	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33405482G>T	uc011dri.1	+	8	995	c.800G>T	c.(799-801)TGG>TTG	p.W267L	SYNGAP1_uc003oeo.1_Missense_Mutation_p.W252L|SYNGAP1_uc010juy.2_Missense_Mutation_p.W252L|SYNGAP1_uc010juz.2_5'UTR	NM_006772	NP_006763	Q96PV0	SYGP1_HUMAN	synaptic Ras GTPase activating protein 1	267	C2.				negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity|SH3 domain binding			ovary(4)	4						CTAAAGCTGTGGATCATAGAG	0.582													84	105	---	---	---	---	PASS
TFEB	7942	broad.mit.edu	37	6	41658460	41658460	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41658460T>G	uc003oqs.1	-	4	711	c.409A>C	c.(409-411)AAC>CAC	p.N137H	TFEB_uc003oqt.1_Missense_Mutation_p.N137H|TFEB_uc003oqu.1_Missense_Mutation_p.N151H|TFEB_uc003oqv.1_Missense_Mutation_p.N137H|TFEB_uc010jxo.1_Missense_Mutation_p.N137H|TFEB_uc003oqx.1_Missense_Mutation_p.N137H|TFEB_uc003oqr.1_Intron|TFEB_uc003oqw.1_Missense_Mutation_p.N137H	NM_007162	NP_009093	P19484	TFEB_HUMAN	transcription factor EB	137				GSPKPPPAASPGVRAGHVLSSSAGNSAPN -> ALRNPHQP PPQGCELDTCCPPPLATVLPI (in Ref. 1; AAA36730).	embryonic placenta development|humoral immune response|positive regulation of transcription from RNA polymerase II promoter	cytoplasm	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			ovary(1)	1	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			GGAGCACTGTTGCCAGCGGAG	0.652			T	ALPHA	renal (childhood epithelioid)								9	33	---	---	---	---	PASS
NFKBIE	4794	broad.mit.edu	37	6	44230285	44230285	+	Intron	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:44230285C>T	uc003oxe.1	-							NM_004556	NP_004547	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene						cytoplasmic sequestering of transcription factor		protein binding			breast(2)	2	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			ATAACATTCTCTCGCCACCAA	0.537													7	54	---	---	---	---	PASS
RHAG	6005	broad.mit.edu	37	6	49582509	49582509	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49582509C>T	uc003ozk.3	-	5	760	c.698G>A	c.(697-699)GGA>GAA	p.G233E	RHAG_uc010jzl.2_Missense_Mutation_p.G233E|RHAG_uc010jzm.2_Missense_Mutation_p.G233E	NM_000324	NP_000315	Q02094	RHAG_HUMAN	Rh-associated glycoprotein	233	Extracellular (Potential).				carbon dioxide transport|cellular ion homeostasis	integral to plasma membrane	ammonia transmembrane transporter activity|ammonium transmembrane transporter activity|ankyrin binding			breast(1)|skin(1)	2	Lung NSC(77;0.0255)					CTGTTTGTCTCCAGGTTCAGC	0.502													46	61	---	---	---	---	PASS
GCLC	2729	broad.mit.edu	37	6	53379229	53379229	+	Intron	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53379229A>G	uc003pbw.1	-						GCLC_uc003pbx.2_Intron	NM_001498	NP_001489	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit						anti-apoptosis|cell redox homeostasis|cysteine metabolic process|glutamate metabolic process|glutathione biosynthetic process|negative regulation of transcription, DNA-dependent|regulation of blood vessel size|response to heat|response to hormone stimulus|response to oxidative stress|xenobiotic metabolic process	cytosol	ADP binding|ATP binding|coenzyme binding|glutamate binding|glutamate-cysteine ligase activity|magnesium ion binding			ovary(1)|central_nervous_system(1)	2	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|L-Glutamic Acid(DB00142)	ACCTCTCAGTAGACTTACTTG	0.343													27	46	---	---	---	---	PASS
COL21A1	81578	broad.mit.edu	37	6	56044682	56044682	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56044682C>T	uc003pcs.2	-	3	566	c.334G>A	c.(334-336)GGA>AGA	p.G112R	COL21A1_uc003pct.1_RNA|COL21A1_uc011dxi.1_Missense_Mutation_p.G112R|COL21A1_uc003pcu.1_Missense_Mutation_p.G112R	NM_030820	NP_110447	Q96P44	COLA1_HUMAN	collagen, type XXI, alpha 1 precursor	112	VWFA.				cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(2)	2	Lung NSC(77;0.0483)		LUSC - Lung squamous cell carcinoma(124;0.181)			TTTGTGTTTCCTCCTAAGTAG	0.468													17	25	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	63990918	63990918	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63990918G>C	uc003peh.2	-	4	572	c.538C>G	c.(538-540)CTT>GTT	p.L180V	LGSN_uc003pei.2_Intron	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	180					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	GAAGTCAAAAGAGGCTCACCA	0.453													10	46	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71162203	71162203	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71162203A>G	uc003pfj.2	+	3	219	c.86A>G	c.(85-87)CAG>CGG	p.Q29R	FAM135A_uc003pfi.2_Missense_Mutation_p.Q29R|FAM135A_uc003pfh.2_Intron|FAM135A_uc003pfk.2_Missense_Mutation_p.Q29R|FAM135A_uc003pfl.2_5'UTR	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	29										central_nervous_system(1)	1						AGTTTTTACCAGATTCGTGCT	0.308													19	30	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76713620	76713620	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76713620G>T	uc003pik.1	-	11	1313	c.1183C>A	c.(1183-1185)CTG>ATG	p.L395M		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	395					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				GATGTGGGCAGCTCTGATTGG	0.388													5	28	---	---	---	---	PASS
DOPEY1	23033	broad.mit.edu	37	6	83838904	83838904	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83838904C>T	uc003pjs.1	+	16	2278	c.2018C>T	c.(2017-2019)GCA>GTA	p.A673V	DOPEY1_uc011dyy.1_Missense_Mutation_p.A664V|DOPEY1_uc010kbl.1_Missense_Mutation_p.A664V	NM_015018	NP_055833	Q5JWR5	DOP1_HUMAN	dopey family member 1	673					protein transport					ovary(2)|breast(1)|central_nervous_system(1)	4		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAAAAGACTGCAATGCAGTGC	0.463													4	70	---	---	---	---	PASS
CNR1	1268	broad.mit.edu	37	6	88854060	88854060	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:88854060C>T	uc011dzq.1	-	2	4497	c.934G>A	c.(934-936)GGC>AGC	p.G312S	CNR1_uc010kbz.2_Missense_Mutation_p.G312S|CNR1_uc011dzr.1_Missense_Mutation_p.G312S|CNR1_uc011dzs.1_Missense_Mutation_p.G312S|CNR1_uc003pmq.3_Missense_Mutation_p.G312S|CNR1_uc011dzt.1_Missense_Mutation_p.G312S|CNR1_uc010kca.2_Missense_Mutation_p.G279S	NM_001160260	NP_001153732	P21554	CNR1_HUMAN	cannabinoid receptor 1 isoform a	312	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	cannabinoid receptor activity|protein binding			skin(2)	2		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Marinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TTCTGGGTGCCACGCTGAATC	0.557													38	45	---	---	---	---	PASS
FHL5	9457	broad.mit.edu	37	6	97063490	97063490	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97063490A>T	uc003pos.1	+	7	1102	c.697A>T	c.(697-699)ACA>TCA	p.T233S	FHL5_uc003pot.1_Missense_Mutation_p.T233S	NM_020482	NP_065228	Q5TD97	FHL5_HUMAN	activator of cAMP-responsive element modulator	233	LIM zinc-binding 4.					nucleus	zinc ion binding			ovary(2)	2		all_cancers(76;1.57e-07)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00266)|Colorectal(196;0.0341)|Lung NSC(302;0.204)		BRCA - Breast invasive adenocarcinoma(108;0.0948)		TACAGGTCTCACAGGTGCCAA	0.303													13	58	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100868810	100868810	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100868810C>G	uc003pqj.3	-	9	1230	c.1023G>C	c.(1021-1023)CAG>CAC	p.Q341H	SIM1_uc010kcu.2_Missense_Mutation_p.Q341H	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1	341	Single-minded C-terminal.				cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CCAGGGAGAGCTGCAGCCCTT	0.527													6	26	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112440359	112440359	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112440359C>A	uc003pvu.2	-	34	5130	c.4821G>T	c.(4819-4821)CAG>CAT	p.Q1607H	LAMA4_uc003pvv.2_Missense_Mutation_p.Q1600H|LAMA4_uc003pvt.2_Missense_Mutation_p.Q1600H	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor	1607	Laminin G-like 4.				cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		CCTGGCTTACCTGAACATTTT	0.299													7	52	---	---	---	---	PASS
LAMA4	3910	broad.mit.edu	37	6	112528355	112528355	+	Intron	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112528355C>T	uc003pvu.2	-						LAMA4_uc003pvv.2_Intron|LAMA4_uc003pvt.2_Intron	NM_001105206	NP_001098676	Q16363	LAMA4_HUMAN	laminin, alpha 4 isoform 1 precursor						cell adhesion|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	extracellular matrix structural constituent|receptor binding			ovary(4)|breast(2)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	9		all_cancers(87;0.000196)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0335)|OV - Ovarian serous cystadenocarcinoma(136;0.0578)|Epithelial(106;0.0748)|BRCA - Breast invasive adenocarcinoma(108;0.242)		TGCTATGAGACAAAAGACAAG	0.438													18	22	---	---	---	---	PASS
DSE	29940	broad.mit.edu	37	6	116720781	116720781	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116720781G>A	uc003pws.2	+	2	562	c.368G>A	c.(367-369)CGA>CAA	p.R123Q	DSE_uc011ebf.1_Missense_Mutation_p.R123Q|DSE_uc003pwq.1_Missense_Mutation_p.R123Q|DSE_uc011ebg.1_Missense_Mutation_p.R142Q|DSE_uc003pwt.2_Missense_Mutation_p.R123Q	NM_001080976	NP_001074445	Q9UL01	DSE_HUMAN	dermatan sulfate epimerase precursor	123					dermatan sulfate biosynthetic process	endoplasmic reticulum|Golgi apparatus|integral to membrane	chondroitin-glucuronate 5-epimerase activity			ovary(1)	1		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		ATTGAAGCCCGAGACATGGCC	0.458													6	77	---	---	---	---	PASS
RSPO3	84870	broad.mit.edu	37	6	127476428	127476428	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127476428C>A	uc003qar.2	+	4	769	c.479C>A	c.(478-480)ACG>AAG	p.T160K	RSPO3_uc003qas.1_Missense_Mutation_p.T160K	NM_032784	NP_116173	Q9BXY4	RSPO3_HUMAN	R-spondin 3 precursor	160	TSP type-1.					extracellular region	heparin binding				0				GBM - Glioblastoma multiforme(226;0.0555)		AGTCCATGCACGAAGAAGGGA	0.463													22	151	---	---	---	---	PASS
IFNGR1	3459	broad.mit.edu	37	6	137519616	137519616	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137519616C>A	uc003qho.2	-	7	1125	c.1022G>T	c.(1021-1023)GGA>GTA	p.G341V	IFNGR1_uc011edm.1_Missense_Mutation_p.G313V	NM_000416	NP_000407	P15260	INGR1_HUMAN	interferon gamma receptor 1 precursor	341	Cytoplasmic (Potential).				regulation of interferon-gamma-mediated signaling pathway|response to virus	integral to plasma membrane	interferon-gamma receptor activity			upper_aerodigestive_tract(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000829)|OV - Ovarian serous cystadenocarcinoma(155;0.00389)	Interferon gamma-1b(DB00033)	TTCCACTTTTCCTGGATTGTC	0.458													9	44	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152650870	152650870	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152650870T>C	uc010kiw.2	-	78	15552	c.14950A>G	c.(14950-14952)AGA>GGA	p.R4984G	SYNE1_uc003qot.3_Missense_Mutation_p.R4913G|SYNE1_uc003qou.3_Missense_Mutation_p.R4984G|SYNE1_uc010kiz.2_Missense_Mutation_p.R739G	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4984	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCCACCTGTCTGGTGCGTAAG	0.438										HNSCC(10;0.0054)			7	98	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152651898	152651898	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152651898A>T	uc010kiw.2	-	78	14524	c.13922T>A	c.(13921-13923)CTC>CAC	p.L4641H	SYNE1_uc003qot.3_Missense_Mutation_p.L4570H|SYNE1_uc003qou.3_Missense_Mutation_p.L4641H|SYNE1_uc010kiz.2_Missense_Mutation_p.L396H	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4641	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTTTCACTGAGGTAGGAATG	0.398										HNSCC(10;0.0054)			40	59	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152762327	152762327	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152762327G>T	uc010kiw.2	-	32	4689	c.4087C>A	c.(4087-4089)CAT>AAT	p.H1363N	SYNE1_uc003qot.3_Missense_Mutation_p.H1370N|SYNE1_uc003qou.3_Missense_Mutation_p.H1363N|SYNE1_uc010kjb.1_Missense_Mutation_p.H1346N|SYNE1_uc003qow.2_Missense_Mutation_p.H658N|SYNE1_uc003qox.1_Missense_Mutation_p.H879N	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	1363	Potential.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AAGCGTTCATGACTGGAACCT	0.328										HNSCC(10;0.0054)			13	17	---	---	---	---	PASS
FBXO5	26271	broad.mit.edu	37	6	153296183	153296183	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153296183C>G	uc003qpg.2	-	2	786	c.677G>C	c.(676-678)AGA>ACA	p.R226T	FBXO5_uc003qph.2_Missense_Mutation_p.R180T	NM_012177	NP_036309	Q9UKT4	FBX5_HUMAN	F-box only protein 5 isoform a	226	Interaction with EVI5.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitotic metaphase/anaphase transition|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of mitotic cell cycle|regulation of transcription involved in G1/S phase of mitotic cell cycle	cytosol|nucleoplasm|spindle	metal ion binding|protein binding				0		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.38e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0893)		AAAATTTCCTCTGGCTATAAT	0.368													7	73	---	---	---	---	PASS
PDE10A	10846	broad.mit.edu	37	6	165848854	165848854	+	Silent	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:165848854T>A	uc003qun.2	-	7	619	c.378A>T	c.(376-378)ATA>ATT	p.I126I	PDE10A_uc011egj.1_RNA|PDE10A_uc011egk.1_Silent_p.I56I|PDE10A_uc003quo.2_Silent_p.I136I	NM_006661	NP_006652	Q9Y233	PDE10_HUMAN	phosphodiesterase 10A isoform 2	126	GAF 1.				platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cAMP binding|cGMP binding|metal ion binding			ovary(3)|skin(2)	5		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Dipyridamole(DB00975)	GTGGCGTGAATATACACAGGC	0.473													16	18	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2255829	2255829	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2255829C>A	uc003slh.1	-	8	1038	c.772G>T	c.(772-774)GAG>TAG	p.E258*	MAD1L1_uc003sle.1_5'Flank|MAD1L1_uc003slf.1_Nonsense_Mutation_p.E258*|MAD1L1_uc003slg.1_Nonsense_Mutation_p.E258*|MAD1L1_uc010ksh.1_Nonsense_Mutation_p.E258*|MAD1L1_uc003sli.1_Nonsense_Mutation_p.E166*|MAD1L1_uc010ksi.1_Nonsense_Mutation_p.E211*|MAD1L1_uc010ksj.2_Nonsense_Mutation_p.E258*	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein	258	Potential.				cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		TGCTTCAGCTCCCGTTCCAGC	0.622													37	50	---	---	---	---	PASS
GNA12	2768	broad.mit.edu	37	7	2802280	2802280	+	Intron	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2802280C>A	uc003smu.2	-						GNA12_uc011jwb.1_Intron|GNA12_uc003smt.2_Intron	NM_007353	NP_031379	Q03113	GNA12_HUMAN	guanine nucleotide binding protein (G protein)						G-protein signaling, coupled to cAMP nucleotide second messenger|platelet activation|Rho protein signal transduction	brush border membrane|heterotrimeric G-protein complex	D5 dopamine receptor binding|G-protein beta/gamma-subunit complex binding|GTP binding|GTPase activity|signal transducer activity			ovary(1)	1		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;1.02e-13)		AAGCACAGAGCGGCAGGACGA	0.517													9	15	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6194338	6194338	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6194338C>T	uc011jwo.1	+	15	3276	c.3153C>T	c.(3151-3153)CCC>CCT	p.P1051P	USP42_uc011jwp.1_Silent_p.P1051P|USP42_uc011jwq.1_Silent_p.P858P|USP42_uc011jwr.1_Silent_p.P896P	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	1051	Arg-rich.				cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AGTTCTACCCCGACAGGCCGC	0.692													6	7	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11468755	11468755	+	Intron	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11468755G>T	uc003ssf.3	-							NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AATGTAACCTGAGTAGAGGAA	0.517										HNSCC(18;0.044)			33	71	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20682940	20682940	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20682940C>A	uc010kuh.2	+	6	685	c.448C>A	c.(448-450)CAG>AAG	p.Q150K		NM_001163941	NP_001157413	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	334	Extracellular (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						AGTTTTGGCACAGGACATCGG	0.398													16	40	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21640753	21640753	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21640753G>A	uc003svc.2	+	17	3412	c.3381G>A	c.(3379-3381)TGG>TGA	p.W1127*		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1127	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTAAGAAATGGAGCTGGATGT	0.348									Kartagener_syndrome				8	94	---	---	---	---	PASS
CHN2	1124	broad.mit.edu	37	7	29234547	29234547	+	5'UTR	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:29234547G>T	uc003szz.2	+	1					CHN2_uc011jzs.1_Intron|CHN2_uc010kva.2_5'UTR|CHN2_uc010kvb.2_RNA|CHN2_uc010kvc.2_5'UTR|CHN2_uc011jzt.1_5'UTR|CHN2_uc010kvd.2_5'UTR|CHN2_uc011jzu.1_5'Flank|CPVL_uc003szx.2_Intron	NM_004067	NP_004058	P52757	CHIO_HUMAN	beta chimerin isoform 2						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|membrane	GTPase activator activity|metal ion binding|SH3/SH2 adaptor activity			ovary(2)	2						cgacgcgaggggcgcgcggag	0.333													6	12	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31855535	31855535	+	Intron	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31855535C>G	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron|PDE1C_uc003tcr.2_Intron|PDE1C_uc003tcs.2_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			TAAGTCTACTCACCATTCTGT	0.443													26	144	---	---	---	---	PASS
BBS9	27241	broad.mit.edu	37	7	33303909	33303909	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33303909G>T	uc003tdn.1	+	7	1138	c.625G>T	c.(625-627)GTA>TTA	p.V209L	BBS9_uc003tdo.1_Missense_Mutation_p.V209L|BBS9_uc003tdp.1_Missense_Mutation_p.V209L|BBS9_uc003tdq.1_Missense_Mutation_p.V209L|BBS9_uc010kwn.1_RNA|BBS9_uc011kan.1_Missense_Mutation_p.V209L|BBS9_uc011kao.1_Missense_Mutation_p.V87L	NM_198428	NP_940820	Q3SYG4	PTHB1_HUMAN	parathyroid hormone-responsive B1 isoform 2	209					fat cell differentiation|response to stimulus|visual perception	BBSome|cilium membrane|microtubule organizing center|nucleus	protein binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			GBM - Glioblastoma multiforme(11;0.0894)			CAGGTACCAGGTACTTGCTTT	0.244									Bardet-Biedl_syndrome				27	55	---	---	---	---	PASS
AMPH	273	broad.mit.edu	37	7	38471793	38471793	+	Missense_Mutation	SNP	C	A	A	rs145380938		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:38471793C>A	uc003tgu.2	-	13	1223	c.1154G>T	c.(1153-1155)TGG>TTG	p.W385L	AMPH_uc003tgv.2_Missense_Mutation_p.W385L|AMPH_uc003tgt.2_Missense_Mutation_p.W138L|AMPH_uc003tgw.1_5'Flank|AMPH_uc010kxl.1_5'Flank	NM_001635	NP_001626	P49418	AMPH_HUMAN	amphiphysin isoform 1	385					endocytosis|synaptic transmission	actin cytoskeleton|cell junction|synaptic vesicle membrane				ovary(3)|liver(1)|skin(1)	5						GCTTACCGTCCATAGGTCCCA	0.323													46	66	---	---	---	---	PASS
YKT6	10652	broad.mit.edu	37	7	44247777	44247777	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44247777G>T	uc003tkm.2	+	5	596	c.439G>T	c.(439-441)GAT>TAT	p.D147Y	YKT6_uc011kbv.1_Missense_Mutation_p.D147Y	NM_006555	NP_006546	O15498	YKT6_HUMAN	YKT6 v-SNARE protein	147	v-SNARE coiled-coil homology.				ER to Golgi vesicle-mediated transport|protein transport|retrograde transport, endosome to Golgi|vesicle docking involved in exocytosis|vesicle targeting	cytoplasmic vesicle membrane|cytosol|endoplasmic reticulum|endosome|Golgi membrane|integral to plasma membrane|mitochondrion|SNARE complex	protein-cysteine S-palmitoleyltransferase activity|SNAP receptor activity				0						GGCCGAACTAGATGAGACCAA	0.493													11	25	---	---	---	---	PASS
TNS3	64759	broad.mit.edu	37	7	47384613	47384613	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47384613C>A	uc003tnv.2	-	19	2842	c.2475G>T	c.(2473-2475)CAG>CAT	p.Q825H	TNS3_uc003tnw.2_Missense_Mutation_p.Q825H	NM_022748	NP_073585	Q68CZ2	TENS3_HUMAN	tensin 3	825						focal adhesion	protein binding			ovary(4)	4						TATCGAGGTCCTGGGGATAGC	0.488													19	53	---	---	---	---	PASS
DMTF1	9988	broad.mit.edu	37	7	86813864	86813864	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86813864A>G	uc003uih.2	+	11	1298	c.972A>G	c.(970-972)AAA>AAG	p.K324K	DMTF1_uc003uii.2_Silent_p.K58K|DMTF1_uc003uij.2_Silent_p.K58K|DMTF1_uc011khb.1_Silent_p.K236K|DMTF1_uc003uik.2_RNA|DMTF1_uc003uil.2_Silent_p.K324K|DMTF1_uc003uin.2_Silent_p.K58K	NM_001142327	NP_001135799	Q9Y222	DMTF1_HUMAN	cyclin D binding myb-like transcription factor 1	324	H-T-H motif (By similarity).|Interaction with CCND1, CCND2 and CCND3 (By similarity).|HTH myb-type.|Required for DNA-binding (By similarity).				cell cycle	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2	Esophageal squamous(14;0.0058)					GTCGTTCTAAATGGCTCAACT	0.478													42	52	---	---	---	---	PASS
ABCB1	5243	broad.mit.edu	37	7	87150160	87150160	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:87150160G>T	uc003uiz.1	-	23	3136	c.2718C>A	c.(2716-2718)ACC>ACA	p.T906T	ABCB1_uc011khc.1_Silent_p.T842T	NM_000927	NP_000918	P08183	MDR1_HUMAN	ATP-binding cassette, subfamily B, member 1	906	ABC transmembrane type-1 2.				G2/M transition of mitotic cell cycle|stem cell proliferation	apical plasma membrane|cell surface|Golgi membrane|integral to membrane|intercellular canaliculus|membrane fraction	ATP binding|protein binding|xenobiotic-transporting ATPase activity			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	7	Esophageal squamous(14;0.00164)				Adenosine triphosphate(DB00171)|Alfentanil(DB00802)|Arsenic trioxide(DB01169)|Atazanavir(DB01072)|Carvedilol(DB01136)|Colchicine(DB01394)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dipyridamole(DB00975)|Estramustine(DB01196)|Flupenthixol(DB00875)|Imatinib(DB00619)|Itraconazole(DB01167)|Nicardipine(DB00622)|Propafenone(DB01182)|Quinacrine(DB01103)|Quinidine(DB00908)|Ranolazine(DB00243)|Rifampin(DB01045)|Roxithromycin(DB00778)|Saquinavir(DB01232)|Tamoxifen(DB00675)|Vinblastine(DB00570)	AAGAAACAACGGTTCGGAAGT	0.418													24	93	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100675756	100675756	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100675756A>G	uc003uxp.1	+	3	1112	c.1059A>G	c.(1057-1059)ACA>ACG	p.T353T	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	353	Extracellular (Potential).|Ser-rich.|3.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AAATGAGCACACTTTCAATAA	0.478													113	347	---	---	---	---	PASS
DUS4L	11062	broad.mit.edu	37	7	107215764	107215764	+	Intron	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107215764A>T	uc003veh.2	+						DUS4L_uc003veg.2_Intron|DUS4L_uc011klw.1_Intron|DUS4L_uc011klx.1_Intron|DUS4L_uc010ljl.2_Intron	NM_181581	NP_853559	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like						tRNA processing		flavin adenine dinucleotide binding|tRNA dihydrouridine synthase activity				0						AGGTAAAGACAATATTTCAAT	0.313													40	53	---	---	---	---	PASS
PPP1R3A	5506	broad.mit.edu	37	7	113518576	113518576	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:113518576T>A	uc010ljy.1	-	4	2602	c.2571A>T	c.(2569-2571)AAA>AAT	p.K857N		NM_002711	NP_002702	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory (inhibitor)	857					glycogen metabolic process	integral to membrane				lung(9)|ovary(9)|pancreas(7)|skin(6)|breast(2)|prostate(1)	34						TTGAAGTTGCTTTTTGATATT	0.368													46	149	---	---	---	---	PASS
SLC13A1	6561	broad.mit.edu	37	7	122757565	122757565	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122757565G>T	uc003vkm.2	-	14	1635	c.1610C>A	c.(1609-1611)GCT>GAT	p.A537D	SLC13A1_uc010lks.2_Missense_Mutation_p.A413D	NM_022444	NP_071889	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate	537						integral to membrane|plasma membrane	sodium:sulfate symporter activity			ovary(2)	2					Succinic acid(DB00139)	AAAGACAATAGCATTGGGTGG	0.398													18	68	---	---	---	---	PASS
MIR592	693177	broad.mit.edu	37	7	126698233	126698233	+	RNA	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126698233A>G	hsa-mir-592|MI0003604	-			c.6A>G			GRM8_uc003vls.2_Intron|GRM8_uc003vlr.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron|GRM8_uc003vlu.1_Intron																	0						ATGTCATGGCATAATATCATC	0.453													15	22	---	---	---	---	PASS
ARF5	381	broad.mit.edu	37	7	127229539	127229539	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127229539G>T	uc003vmb.1	+	3	185	c.149G>T	c.(148-150)GGC>GTC	p.G50V	ARF5_uc010llb.1_Missense_Mutation_p.G50V|FSCN3_uc003vmc.1_5'Flank	NM_001662	NP_001653	P84085	ARF5_HUMAN	ADP-ribosylation factor 5	50					protein transport|small GTPase mediated signal transduction|vesicle-mediated transport	Golgi apparatus|perinuclear region of cytoplasm	GTP binding|GTPase activity|protein binding			ovary(1)	1						TTATCTGCAGGCTTCAATGTA	0.438													19	99	---	---	---	---	PASS
FAM40B	57464	broad.mit.edu	37	7	129083936	129083936	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:129083936C>G	uc011koy.1	+	3	311	c.271C>G	c.(271-273)CAA>GAA	p.Q91E	FAM40B_uc003vow.2_Missense_Mutation_p.Q91E	NM_020704	NP_065755	Q9ULQ0	FA40B_HUMAN	hypothetical protein LOC57464 isoform a	91											0						TTTCAAGACTCAAGGTAATTC	0.383													3	42	---	---	---	---	PASS
KCNH2	3757	broad.mit.edu	37	7	150649746	150649746	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150649746C>A	uc003wic.2	-	6	1337	c.1324G>T	c.(1324-1326)GCT>TCT	p.A442S	KCNH2_uc003wib.2_Missense_Mutation_p.A102S|KCNH2_uc011kux.1_Missense_Mutation_p.A346S|KCNH2_uc003wid.2_Missense_Mutation_p.A102S|KCNH2_uc003wie.2_Missense_Mutation_p.A442S	NM_000238	NP_000229	Q12809	KCNH2_HUMAN	voltage-gated potassium channel, subfamily H,	442	Extracellular (Potential).				blood circulation|muscle contraction|regulation of heart contraction|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|two-component sensor activity			skin(3)|ovary(1)	4	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Cisapride(DB00604)|Dofetilide(DB00204)|Halofantrine(DB01218)|Ibutilide(DB00308)|Pimozide(DB01100)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terfenadine(DB00342)|Verapamil(DB00661)	CACTCGGTAGCAGGCGGGCCT	0.592													37	117	---	---	---	---	PASS
PRKAG2	51422	broad.mit.edu	37	7	151573625	151573625	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151573625G>T	uc003wkk.2	-	1	692	c.81C>A	c.(79-81)AGC>AGA	p.S27R	PRKAG2_uc010lqe.1_RNA|PRKAG2_uc003wkm.1_Missense_Mutation_p.S27R|uc003wko.1_5'Flank	NM_016203	NP_057287	Q9UGJ0	AAKG2_HUMAN	AMP-activated protein kinase gamma2 subunit	27					ATP biosynthetic process|carnitine shuttle|cell cycle arrest|fatty acid biosynthetic process|glycogen metabolic process|insulin receptor signaling pathway|intracellular protein kinase cascade|positive regulation of peptidyl-threonine phosphorylation|positive regulation of protein kinase activity|regulation of fatty acid biosynthetic process|regulation of fatty acid oxidation|regulation of glucose import|regulation of glycolysis|sterol biosynthetic process	AMP-activated protein kinase complex|cytosol|nucleoplasm	ADP binding|ATP binding|cAMP-dependent protein kinase inhibitor activity|cAMP-dependent protein kinase regulator activity|phosphorylase kinase regulator activity|protein kinase activator activity|protein kinase binding			breast(1)|kidney(1)	2	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)		GCCTCTTCTGGCTGGCATTTT	0.612													5	117	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154561257	154561257	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154561257C>T	uc003wlk.2	+	9	1143	c.1014C>T	c.(1012-1014)ACC>ACT	p.T338T	DPP6_uc003wli.2_Silent_p.T274T|DPP6_uc003wlm.2_Silent_p.T276T|DPP6_uc011kvq.1_Silent_p.T231T	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1	338	Extracellular (Potential).				cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			TCTACCCCACCGTGAAGCCCT	0.552													10	27	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154684200	154684200	+	3'UTR	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154684200G>T	uc003wlk.2	+	26					DPP6_uc003wli.2_3'UTR|DPP6_uc003wlm.2_3'UTR|DPP6_uc011kvq.1_3'UTR	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			AGCTCAGGTCGCTCTAAGCAC	0.473													63	51	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16026296	16026296	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16026296C>T	uc003wwz.2	-	4	499	c.301G>A	c.(301-303)GGA>AGA	p.G101R	MSR1_uc010lsu.2_Missense_Mutation_p.G119R|MSR1_uc003wxa.2_Missense_Mutation_p.G101R|MSR1_uc003wxb.2_Missense_Mutation_p.G101R|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	101	Spacer (Probable).|Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		CTGTCATTTCCTTTTCCCGTG	0.373													27	75	---	---	---	---	PASS
LPL	4023	broad.mit.edu	37	8	19809327	19809327	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:19809327G>A	uc003wzk.3	+	3	667	c.297G>A	c.(295-297)CTG>CTA	p.L99L		NM_000237	NP_000228	P06858	LIPL_HUMAN	lipoprotein lipase precursor	99					fatty acid biosynthetic process|lipoprotein metabolic process|phospholipid metabolic process|positive regulation of cholesterol storage|positive regulation of sequestering of triglyceride|triglyceride catabolic process|triglyceride homeostasis|very-low-density lipoprotein particle remodeling	anchored to membrane|chylomicron|plasma membrane|very-low-density lipoprotein particle	heparin binding|lipoprotein lipase activity|phospholipase activity|receptor binding|triglyceride lipase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3				Colorectal(111;0.0577)|COAD - Colon adenocarcinoma(73;0.216)	Clofibrate(DB00636)|Gemfibrozil(DB01241)|Orlistat(DB01083)	TGGCCGCCCTGTACAAGAGAG	0.507													86	82	---	---	---	---	PASS
GOT1L1	137362	broad.mit.edu	37	8	37793357	37793357	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37793357G>T	uc011lbj.1	-	7	894	c.794C>A	c.(793-795)GCA>GAA	p.A265E		NM_152413	NP_689626	Q8NHS2	AATC2_HUMAN	glutamic-oxaloacetic transaminase 1-like 1	265					biosynthetic process|cellular amino acid metabolic process	cytoplasm	pyridoxal phosphate binding|transaminase activity			ovary(1)	1	Colorectal(12;0.00627)	Lung NSC(58;0.118)|all_lung(54;0.195)	LUSC - Lung squamous cell carcinoma(8;1.37e-11)			GTTGTTGACTGCCACCACCAC	0.592													29	33	---	---	---	---	PASS
MCM4	4173	broad.mit.edu	37	8	48874618	48874618	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48874618C>A	uc003xqk.1	+	4	336	c.241C>A	c.(241-243)CCT>ACT	p.P81T	PRKDC_uc003xqi.2_5'Flank|PRKDC_uc003xqj.2_5'Flank|PRKDC_uc011ldh.1_5'Flank|MCM4_uc003xql.1_Missense_Mutation_p.P81T|MCM4_uc011ldi.1_Missense_Mutation_p.P81T|MCM4_uc010lxw.1_Intron	NM_182746	NP_877423	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	81					cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	MCM complex	ATP binding|DNA binding|helicase activity|protein binding			ovary(2)|skin(2)	4		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				TATAGCTATCCCTCTTGACTT	0.438													22	39	---	---	---	---	PASS
SULF1	23213	broad.mit.edu	37	8	70541858	70541858	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70541858G>C	uc010lza.1	+	19	2945	c.2228G>C	c.(2227-2229)GGC>GCC	p.G743A	SULF1_uc003xyd.2_Missense_Mutation_p.G743A|SULF1_uc003xye.2_Missense_Mutation_p.G743A|SULF1_uc003xyf.2_Missense_Mutation_p.G743A|SULF1_uc003xyg.2_Missense_Mutation_p.G743A|SULF1_uc003xyh.1_RNA|SULF1_uc003xyi.1_5'UTR	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor	743					apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGCCTGCCTGGCCTCACTTGC	0.542													60	91	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77766606	77766606	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77766606G>T	uc003yav.2	+	10	7701	c.7314G>T	c.(7312-7314)CAG>CAT	p.Q2438H	ZFHX4_uc003yau.1_Missense_Mutation_p.Q2483H|ZFHX4_uc003yaw.1_Missense_Mutation_p.Q2438H	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	2438						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			CGTCTCTCCAGAACAGTCTAC	0.483										HNSCC(33;0.089)			33	78	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77768344	77768344	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77768344G>A	uc003yav.2	+	10	9439	c.9052G>A	c.(9052-9054)GAA>AAA	p.E3018K	ZFHX4_uc003yau.1_Missense_Mutation_p.E3063K|ZFHX4_uc003yaw.1_Missense_Mutation_p.E3018K	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	3018						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGCACAGCAAGAACTTGATCG	0.537										HNSCC(33;0.089)			13	128	---	---	---	---	PASS
VPS13B	157680	broad.mit.edu	37	8	100732644	100732644	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100732644G>A	uc003yiv.2	+	38	6915	c.6804G>A	c.(6802-6804)GAG>GAA	p.E2268E	VPS13B_uc003yiw.2_Silent_p.E2243E	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5	2268					protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACCTTAATGAGGAGGGAAATT	0.343													19	36	---	---	---	---	PASS
ZFPM2	23414	broad.mit.edu	37	8	106814257	106814257	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:106814257A>T	uc003ymd.2	+	8	1970	c.1947A>T	c.(1945-1947)CAA>CAT	p.Q649H	ZFPM2_uc011lhs.1_Missense_Mutation_p.Q380H	NM_012082	NP_036214	Q8WW38	FOG2_HUMAN	zinc finger protein, multitype 2	649					blood coagulation|negative regulation of fat cell differentiation|outflow tract septum morphogenesis|right ventricular cardiac muscle tissue morphogenesis|ventricular septum morphogenesis	nucleoplasm	DNA binding|RNA polymerase II transcription coactivator activity|transcription corepressor activity|transcription factor binding|zinc ion binding			ovary(4)|large_intestine(1)	5			OV - Ovarian serous cystadenocarcinoma(57;8.28e-08)			TTTCCACTCAAACTAAGAAGC	0.418													17	32	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113276024	113276024	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113276024G>T	uc003ynu.2	-	61	9865	c.9706C>A	c.(9706-9708)CCT>ACT	p.P3236T	CSMD3_uc003yns.2_Missense_Mutation_p.P2438T|CSMD3_uc003ynt.2_Missense_Mutation_p.P3196T|CSMD3_uc011lhx.1_Missense_Mutation_p.P3067T	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3236	Sushi 25.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATCTGGGGAGGAGTTGGGCAG	0.408										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			15	48	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113353855	113353855	+	Missense_Mutation	SNP	C	T	T	rs139554725	byFrequency	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113353855C>T	uc003ynu.2	-	42	6662	c.6503G>A	c.(6502-6504)CGA>CAA	p.R2168Q	CSMD3_uc003yns.2_Missense_Mutation_p.R1370Q|CSMD3_uc003ynt.2_Missense_Mutation_p.R2128Q|CSMD3_uc011lhx.1_Missense_Mutation_p.R2064Q	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	2168	Extracellular (Potential).|CUB 12.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGATCCACTTCGTACTTCCAA	0.368										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			3	45	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113966966	113966966	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113966966G>T	uc003ynu.2	-	8	1526	c.1367C>A	c.(1366-1368)TCT>TAT	p.S456Y	CSMD3_uc003ynt.2_Missense_Mutation_p.S416Y|CSMD3_uc011lhx.1_Missense_Mutation_p.S352Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	456	Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAATCCTCTAGATTTAAAATC	0.289										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			7	22	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125076656	125076656	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125076656G>A	uc003yqw.2	+	26	3603	c.3397G>A	c.(3397-3399)GAT>AAT	p.D1133N	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1133	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCCCCCAGCAGATCACATTTA	0.572													67	122	---	---	---	---	PASS
ADCY8	114	broad.mit.edu	37	8	131793095	131793095	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:131793095G>T	uc003ytd.3	-	18	3553	c.3297C>A	c.(3295-3297)GGC>GGA	p.G1099G	ADCY8_uc010mds.2_Silent_p.G968G	NM_001115	NP_001106	P40145	ADCY8_HUMAN	adenylate cyclase 8	1099	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane|membrane fraction|plasma membrane	ATP binding|calcium- and calmodulin-responsive adenylate cyclase activity|metal ion binding			skin(4)|large_intestine(1)|central_nervous_system(1)	6	Esophageal squamous(12;0.00693)|Ovarian(258;0.00707)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000538)			CGCCGATAACGCCAGCTACCA	0.577										HNSCC(32;0.087)			46	112	---	---	---	---	PASS
C8orf31	286122	broad.mit.edu	37	8	144126182	144126182	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144126182A>T	uc003yxp.1	+	4	655	c.303A>T	c.(301-303)CAA>CAT	p.Q101H	C8orf31_uc003yxq.1_RNA|C8orf31_uc003yxr.1_RNA	NM_173687	NP_775958	Q8N9H6	CH031_HUMAN	hypothetical protein LOC286122	101										ovary(1)	1	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GCCCCTTCCAAGACCGCCAAG	0.617													19	27	---	---	---	---	PASS
DENND4C	55667	broad.mit.edu	37	9	19341087	19341087	+	Silent	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19341087A>T	uc003znq.2	+	16	2157	c.2124A>T	c.(2122-2124)ATA>ATT	p.I708I	DENND4C_uc011lnc.1_Silent_p.I38I|DENND4C_uc011lnd.1_5'UTR|DENND4C_uc003znr.2_5'UTR|DENND4C_uc003zns.2_5'Flank	NM_017925	NP_060395	Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	708						integral to membrane				ovary(1)|skin(1)	2						GAGAATTGATAACTAAAACAA	0.333													25	28	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971028	21971028	+	Nonsense_Mutation	SNP	C	T	T	rs121913389		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971028C>T	uc003zpk.2	-	2	542	c.330G>A	c.(328-330)TGG>TGA	p.W110*	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.G166R	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	110	ANK 4.				cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.W110*(38)|p.?(13)|p.H83fs*2(2)|p.W110fs*9(1)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)|p.W110fs*36(1)|p.W110C(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCAGACGGCCCCAGGCATCGC	0.736		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			13	8	---	---	---	---	PASS
KIF24	347240	broad.mit.edu	37	9	34256481	34256481	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34256481C>T	uc003zua.3	-	11	3244	c.3124G>A	c.(3124-3126)GCT>ACT	p.A1042T	KIF24_uc010mkb.2_Intron	NM_194313	NP_919289	Q5T7B8	KIF24_HUMAN	kinesin family member 24	1042					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1			LUSC - Lung squamous cell carcinoma(29;0.0107)			GCATATTCAGCATGCGTGCCT	0.577													40	41	---	---	---	---	PASS
PGM5	5239	broad.mit.edu	37	9	71114186	71114186	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71114186G>A	uc004agr.2	+	10	1752	c.1523G>A	c.(1522-1524)CGG>CAG	p.R508Q		NM_021965	NP_068800	Q15124	PGM5_HUMAN	phosphoglucomutase 5	508					cell adhesion|cellular calcium ion homeostasis|glucose metabolic process	costamere|dystrophin-associated glycoprotein complex|focal adhesion|intercalated disc|internal side of plasma membrane|sarcolemma|spot adherens junction|stress fiber|Z disc	intramolecular transferase activity, phosphotransferases|magnesium ion binding|structural molecule activity			ovary(1)|pancreas(1)	2						CTCATCTTCCGGCTCAGTTCC	0.527													47	111	---	---	---	---	PASS
C9orf71	169693	broad.mit.edu	37	9	71152321	71152321	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71152321G>C	uc004agt.2	-	2	420	c.367C>G	c.(367-369)CCA>GCA	p.P123A	uc004ags.1_RNA	NM_153237	NP_694969	Q8N6L7	CI071_HUMAN	hypothetical protein LOC169693	123						integral to membrane					0						TATAGAGGTGGAGGAATGCCA	0.542													22	53	---	---	---	---	PASS
TJP2	9414	broad.mit.edu	37	9	71863052	71863052	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71863052C>T	uc004ahe.2	+	19	2992	c.2792C>T	c.(2791-2793)GCC>GTC	p.A931V	TJP2_uc011lrs.1_Missense_Mutation_p.A908V|TJP2_uc004ahd.2_Missense_Mutation_p.A931V|TJP2_uc004ahf.2_Missense_Mutation_p.A931V|TJP2_uc011lru.1_Missense_Mutation_p.A935V|TJP2_uc011lrv.1_Missense_Mutation_p.A953V|TJP2_uc010mom.1_Missense_Mutation_p.A91V	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	931					cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						GAAGGAGGCGCCTACACTGAC	0.622													20	35	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90262220	90262220	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90262220G>T	uc004apc.2	+	14	1369	c.1231G>T	c.(1231-1233)GGC>TGC	p.G411C	DAPK1_uc004ape.2_Missense_Mutation_p.G411C|DAPK1_uc004apd.2_Missense_Mutation_p.G411C|DAPK1_uc011ltg.1_Missense_Mutation_p.G411C|DAPK1_uc011lth.1_Missense_Mutation_p.G148C|DAPK1_uc004apf.1_5'UTR	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1	411	ANK 2.				apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						TTTCCTGCAGGGCGGGTCCAA	0.507									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				44	89	---	---	---	---	PASS
S1PR3	1903	broad.mit.edu	37	9	91616485	91616485	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91616485G>T	uc004aqe.2	+	2	766	c.370G>T	c.(370-372)GCG>TCG	p.A124S		NM_005226	NP_005217	Q99500	S1PR3_HUMAN	sphingosine-1-phosphate receptor 3	124	Helical; Name=3; (By similarity).				anatomical structure morphogenesis|elevation of cytosolic calcium ion concentration|inflammatory response|positive regulation of cell proliferation	integral to plasma membrane	lipid binding|lysosphingolipid and lysophosphatidic acid receptor activity			ovary(2)|lung(1)|central_nervous_system(1)|skin(1)	5						GGCCCTTGGGGCGTCCACCTG	0.567											OREG0019291	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	21	55	---	---	---	---	PASS
ROR2	4920	broad.mit.edu	37	9	94486886	94486886	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94486886C>A	uc004arj.1	-	9	2089	c.1890G>T	c.(1888-1890)AAG>AAT	p.K630N	ROR2_uc004ari.1_Missense_Mutation_p.K490N	NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	630	Cytoplasmic (Potential).|Protein kinase.				negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						AGTCTGAGATCTTCACGTTCA	0.592													36	92	---	---	---	---	PASS
PTPDC1	138639	broad.mit.edu	37	9	96847026	96847026	+	Intron	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:96847026A>T	uc004auf.1	+						PTPDC1_uc004aug.1_Intron|PTPDC1_uc004auh.1_Missense_Mutation_p.N72Y|PTPDC1_uc010mrj.1_Missense_Mutation_p.N72Y|PTPDC1_uc010mri.1_Missense_Mutation_p.N72Y	NM_177995	NP_818931	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1								protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1						TGCAGAGGGAAACCCAACTTT	0.507													29	72	---	---	---	---	PASS
KIAA1529	57653	broad.mit.edu	37	9	100079491	100079491	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:100079491G>T	uc011lut.1	+	21	2262	c.1489G>T	c.(1489-1491)GCC>TCC	p.A497S	KIAA1529_uc004axe.1_Missense_Mutation_p.A497S|KIAA1529_uc004axg.1_Missense_Mutation_p.A358S|KIAA1529_uc011lus.1_Missense_Mutation_p.A315S|KIAA1529_uc010msm.1_RNA|KIAA1529_uc004axf.2_Missense_Mutation_p.A358S|KIAA1529_uc011luv.1_Missense_Mutation_p.A355S	NM_020893	NP_065944			hypothetical protein LOC57653											ovary(4)|large_intestine(2)|skin(1)	7		Acute lymphoblastic leukemia(62;0.154)				CAAGAAGGAGGCCCTGCTGCA	0.622													9	10	---	---	---	---	PASS
TEX10	54881	broad.mit.edu	37	9	103082603	103082603	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103082603C>A	uc004bas.2	-	11	2361	c.2146G>T	c.(2146-2148)GTG>TTG	p.V716L	TEX10_uc011lvf.1_Missense_Mutation_p.V555L|TEX10_uc011lvg.1_Missense_Mutation_p.V719L	NM_017746	NP_060216	Q9NXF1	TEX10_HUMAN	testis expressed 10 isoform 1	716						integral to membrane|MLL1 complex|nuclear membrane|nucleolus	binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(62;0.0527)		OV - Ovarian serous cystadenocarcinoma(323;0.157)		TAGAGAAGCACAGGGGAAAGC	0.383													9	19	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112151514	112151514	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112151514C>T	uc004bed.2	-	22	2364	c.2252G>A	c.(2251-2253)CGG>CAG	p.R751Q	PTPN3_uc004beb.2_Missense_Mutation_p.R620Q|PTPN3_uc004bec.2_Missense_Mutation_p.R575Q|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Missense_Mutation_p.R706Q|PTPN3_uc011lwh.1_Missense_Mutation_p.R597Q|PTPN3_uc011lwd.1_Missense_Mutation_p.R219Q|PTPN3_uc011lwe.1_Missense_Mutation_p.R464Q|PTPN3_uc011lwf.1_Missense_Mutation_p.R419Q	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	751	Tyrosine-protein phosphatase.				negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						GCTACTTACCCGCCCTCGTTC	0.512													5	56	---	---	---	---	PASS
PTPN3	5774	broad.mit.edu	37	9	112182805	112182805	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112182805G>A	uc004bed.2	-	14	1324	c.1212C>T	c.(1210-1212)ACC>ACT	p.T404T	PTPN3_uc004beb.2_Silent_p.T273T|PTPN3_uc004bec.2_Silent_p.T228T|PTPN3_uc010mtu.2_RNA|PTPN3_uc011lwg.1_Silent_p.T359T|PTPN3_uc011lwh.1_Silent_p.T250T|PTPN3_uc011lwd.1_5'Flank|PTPN3_uc011lwe.1_Silent_p.T117T|PTPN3_uc011lwf.1_Silent_p.T72T	NM_002829	NP_002820	P26045	PTN3_HUMAN	protein tyrosine phosphatase, non-receptor type	404					negative regulation of membrane protein ectodomain proteolysis|negative regulation of mitotic cell cycle	cytoplasm|cytoskeleton|internal side of plasma membrane	ATPase binding|cytoskeletal protein binding|phosphotyrosine binding|protein tyrosine phosphatase activity			ovary(3)	3						CCGTGATGTAGGTCATTTCAT	0.517													6	70	---	---	---	---	PASS
SLC46A2	57864	broad.mit.edu	37	9	115652054	115652054	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:115652054A>G	uc004bgk.2	-	1	1140	c.908T>C	c.(907-909)GTG>GCG	p.V303A		NM_033051	NP_149040	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	303	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	symporter activity			central_nervous_system(1)	1						AAGAGGGATCACGTCCACTGT	0.532													22	36	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119903667	119903667	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119903667T>G	uc004bjs.1	-	4	1207	c.1106A>C	c.(1105-1107)CAG>CCG	p.Q369P	ASTN2_uc004bjr.1_Missense_Mutation_p.Q369P|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	369	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TGGTTGCAGCTGACCGATCTC	0.587													19	56	---	---	---	---	PASS
PIP5KL1	138429	broad.mit.edu	37	9	130689478	130689478	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130689478T>C	uc011mao.1	-	7	649	c.604A>G	c.(604-606)ATC>GTC	p.I202V	PIP5KL1_uc004bsu.2_5'UTR	NM_001135219	NP_001128691	Q5T9C9	PI5L1_HUMAN	phosphatidylinositol-4-phosphate 5-kinase-like 1	202	PIPK.					cytoplasm|membrane	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding			lung(1)|kidney(1)	2						TGCATGACGATGAAGTACGTC	0.692													13	37	---	---	---	---	PASS
OBP2A	29991	broad.mit.edu	37	9	138439085	138439085	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138439085T>C	uc004cgb.2	+	3	310	c.268T>C	c.(268-270)TTC>CTC	p.F90L	OBP2A_uc004cgc.2_Missense_Mutation_p.F90L|OBP2A_uc010nau.2_RNA|OBP2A_uc010nav.2_Missense_Mutation_p.I45T	NM_014582	NP_055397	Q9NY56	OBP2A_HUMAN	odorant binding protein 2A precursor	90				F -> Y (in Ref. 1; CAB71326).	response to stimulus|sensory perception of smell	extracellular region	odorant binding|transporter activity				0				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		GCCTGGCAAATTCAGCGCCTG	0.642													26	45	---	---	---	---	PASS
LCN9	392399	broad.mit.edu	37	9	138556117	138556117	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138556117G>T	uc004cgk.1	+	2	206	c.206G>T	c.(205-207)GGC>GTC	p.G69V		NM_001001676	NP_001001676	Q8WX39	LCN9_HUMAN	lipocalin 9	69						extracellular region	pheromone binding|transporter activity			large_intestine(2)	2		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;3.43e-07)|Epithelial(140;1.97e-06)|all cancers(34;6.1e-05)		TTGAAGAACGGCAGCCTAATA	0.473													37	119	---	---	---	---	PASS
AKR1C3	8644	broad.mit.edu	37	10	5141522	5141522	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5141522A>G	uc001ihr.2	+	5	634	c.451A>G	c.(451-453)ATG>GTG	p.M151V	AKR1C3_uc010qap.1_Missense_Mutation_p.M128V|AKR1C3_uc001ihu.2_Missense_Mutation_p.M151V	NM_003739	NP_003730	P42330	AK1C3_HUMAN	aldo-keto reductase family 1, member C3	151					prostaglandin metabolic process	cytoplasm	aldo-keto reductase (NADP) activity|androsterone dehydrogenase (A-specific) activity|indanol dehydrogenase activity|prostaglandin-F synthase activity|testosterone 17-beta-dehydrogenase (NAD+) activity|testosterone 17-beta-dehydrogenase (NADP+) activity|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity			skin(1)	1					Dimethyl sulfoxide(DB01093)|NADH(DB00157)	TCCACAGGCCATGGAGAAGTG	0.473													27	35	---	---	---	---	PASS
ANKRD26	22852	broad.mit.edu	37	10	27355424	27355424	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27355424C>A	uc001ith.2	-	11	1433	c.1261G>T	c.(1261-1263)GAT>TAT	p.D421Y	ANKRD26_uc001itg.2_Missense_Mutation_p.D140Y|ANKRD26_uc009xku.1_Missense_Mutation_p.D421Y	NM_014915	NP_055730	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26	421						centrosome				large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|skin(1)	4						ACCTCAGAATCCCAAGGTGAT	0.313													40	73	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37508455	37508455	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37508455A>G	uc001iza.1	+	34	3746	c.3647A>G	c.(3646-3648)GAT>GGT	p.D1216G		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1272						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						TATGCAGGAGATGCTCTAAGA	0.373													15	24	---	---	---	---	PASS
ARHGAP22	58504	broad.mit.edu	37	10	49667886	49667886	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49667886T>C	uc001jgt.2	-	5	797	c.500A>G	c.(499-501)TAT>TGT	p.Y167C	ARHGAP22_uc001jgs.2_Missense_Mutation_p.Y77C|ARHGAP22_uc001jgu.2_Missense_Mutation_p.Y183C|ARHGAP22_uc010qgl.1_Missense_Mutation_p.Y124C|ARHGAP22_uc010qgm.1_Missense_Mutation_p.Y173C|ARHGAP22_uc001jgv.2_5'UTR	NM_021226	NP_067049	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 2	167	Rho-GAP.				angiogenesis|cell differentiation|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol|nucleus	GTPase activator activity			ovary(1)	1						GCGGGGGCCATACTTCCGCTC	0.652													25	25	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55849791	55849791	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55849791A>T	uc001jju.1	-	16	2345	c.1950T>A	c.(1948-1950)TAT>TAA	p.Y650*	PCDH15_uc010qhq.1_Nonsense_Mutation_p.Y655*|PCDH15_uc010qhr.1_Nonsense_Mutation_p.Y650*|PCDH15_uc010qhs.1_Nonsense_Mutation_p.Y662*|PCDH15_uc010qht.1_Nonsense_Mutation_p.Y657*|PCDH15_uc010qhu.1_Nonsense_Mutation_p.Y650*|PCDH15_uc001jjv.1_Nonsense_Mutation_p.Y628*|PCDH15_uc010qhv.1_Nonsense_Mutation_p.Y650*|PCDH15_uc010qhw.1_Nonsense_Mutation_p.Y613*|PCDH15_uc010qhx.1_Intron|PCDH15_uc010qhy.1_Nonsense_Mutation_p.Y655*|PCDH15_uc010qhz.1_Nonsense_Mutation_p.Y650*|PCDH15_uc010qia.1_Nonsense_Mutation_p.Y628*|PCDH15_uc010qib.1_Nonsense_Mutation_p.Y628*|PCDH15_uc001jjw.2_Nonsense_Mutation_p.Y650*	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	650	Cadherin 6.|Extracellular (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				TCTCAATGGCATATGTTATTG	0.338										HNSCC(58;0.16)			23	43	---	---	---	---	PASS
CDHR1	92211	broad.mit.edu	37	10	85973843	85973843	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85973843C>G	uc001kcv.2	+	17	2046	c.2046C>G	c.(2044-2046)CTC>CTG	p.L682L	CDHR1_uc001kcw.2_Intron|CDHR1_uc009xst.2_Silent_p.L386L|CDHR1_uc001kcx.2_5'UTR	NM_033100	NP_149091	Q96JP9	CDHR1_HUMAN	protocadherin 21 precursor	682	Cadherin 6.|Extracellular (Potential).				homophilic cell adhesion		calcium ion binding|receptor activity			ovary(1)	1						TTCAGACCCTCTCCCGGAGCC	0.562													45	39	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89692790	89692790	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89692790G>C	uc001kfb.2	+	6	1305	c.274G>C	c.(274-276)GAC>CAC	p.D92H		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	92	Phosphatase tensin-type.			D->A: 700-fold reduction in phosphatase activity towards PtdIns(3,4,5)P3. Loss of protein phosphatase activity. Unable to inhibit focal adhesion formation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R55fs*1(4)|p.D92H(3)|p.D92V(2)|p.?(2)|p.Y27fs*1(2)|p.D92G(2)|p.D92N(2)|p.Y27_N212>Y(2)|p.D92fs*7(1)|p.D92Y(1)|p.D92E(1)|p.Q87_P96del(1)|p.D92A(1)|p.F90_P95>L(1)|p.N82_P95del(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TCCTTTTGAAGACCATAACCC	0.333		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			3	53	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89692905	89692905	+	Missense_Mutation	SNP	G	A	A	rs121913292		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89692905G>A	uc001kfb.2	+	6	1420	c.389G>A	c.(388-390)CGA>CAA	p.R130Q		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	130	Phosphatase tensin-type.		R -> L (in CD and endometrial hyperplasia; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> Q (in CD; loss of phosphatase activity towards Ins(1,3,4,5)P4; retains ability to bind phospholipid membranes).|R -> G (loss of phosphatase activity towards Ins(1,3,4,5)P4 and PtdIns(3,4,5)P3).	R->M: Does not affect the ability to inhibit AKT/PKB activation.	activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.R130G(65)|p.R130*(61)|p.R130Q(43)|p.R130fs*4(12)|p.R130L(7)|p.R55fs*1(4)|p.R130P(4)|p.K128_R130del(3)|p.Y27_N212>Y(2)|p.?(2)|p.Y27fs*1(2)|p.R130R(1)|p.K128fs*47(1)|p.A121_F145del(1)|p.R130fs*2(1)|p.T131fs*50(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGAAAGGGACGAACTGGTGTA	0.403	R130Q(MDAPCA2B_PROSTATE)|R130Q(MFE296_ENDOMETRIUM)|R130fs*4(AN3CA_ENDOMETRIUM)|R130Q(JHUEM1_ENDOMETRIUM)	31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			17	56	---	---	---	---	PASS
TM9SF3	56889	broad.mit.edu	37	10	98336540	98336540	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:98336540G>A	uc001kmm.3	-	2	366	c.149C>T	c.(148-150)CCC>CTC	p.P50L	TM9SF3_uc010qot.1_Missense_Mutation_p.P50L	NM_020123	NP_064508	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3 precursor	50						integral to membrane	binding				0		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		ATTATGGTAGGGCCCAACAGT	0.333													17	73	---	---	---	---	PASS
NDUFB8	4714	broad.mit.edu	37	10	102286181	102286181	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102286181T>A	uc001kri.1	-	4	471	c.443A>T	c.(442-444)GAC>GTC	p.D148V	SEC31B_uc009xwo.1_5'UTR|SEC31B_uc010qpq.1_Intron|SEC31B_uc010qpr.1_RNA	NM_005004	NP_004995	O95169	NDUB8_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	148	Helical; (Potential).				mitochondrial electron transport, NADH to ubiquinone|transport	endoplasmic reticulum|integral to membrane|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity				0		Colorectal(252;0.234)		Epithelial(162;5.68e-10)|all cancers(201;4.05e-08)	NADH(DB00157)	AGGGTACACGTCCCCCACCCA	0.532													22	21	---	---	---	---	PASS
LDB1	8861	broad.mit.edu	37	10	103871063	103871063	+	Intron	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103871063T>C	uc009xwz.2	-						LDB1_uc001kuk.3_Intron|LDB1_uc001kul.3_Intron	NM_001113407	NP_001106878	Q86U70	LDB1_HUMAN	LIM domain binding 1 isoform 1						histone H3-K4 acetylation|negative regulation of erythrocyte differentiation|negative regulation of transcription, DNA-dependent|positive regulation of hemoglobin biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription elongation, DNA-dependent|transcription, DNA-dependent|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery	nuclear chromatin|protein complex	LIM domain binding|protein homodimerization activity|transcription corepressor activity			large_intestine(1)	1		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		TTGGGCTGTGTAAAGGAAGAG	0.562													47	24	---	---	---	---	PASS
XPNPEP1	7511	broad.mit.edu	37	10	111631611	111631611	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:111631611G>T	uc001kyp.1	-	17	1472	c.1332C>A	c.(1330-1332)TTC>TTA	p.F444L	XPNPEP1_uc009xxt.1_Missense_Mutation_p.F463L|XPNPEP1_uc001kyq.1_Missense_Mutation_p.F373L	NM_020383	NP_065116	Q9NQW7	XPP1_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 1,	444					bradykinin catabolic process|proteolysis		manganese ion binding|metalloaminopeptidase activity|protein homodimerization activity			ovary(3)|pancreas(1)	4		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		GGACATATGTGAAGCATTCCT	0.483													44	49	---	---	---	---	PASS
DUSP5	1847	broad.mit.edu	37	10	112258257	112258257	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112258257A>T	uc001kzd.2	+	1	633	c.378A>T	c.(376-378)AAA>AAT	p.K126N		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	126	Rhodanese.				endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		ACTTCCTCAAAGGTGAGCGCT	0.736													2	1	---	---	---	---	PASS
HABP2	3026	broad.mit.edu	37	10	115345564	115345564	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115345564G>A	uc001lai.3	+	12	1488	c.1385G>A	c.(1384-1386)CGC>CAC	p.R462H		NM_004132	NP_004123	Q14520	HABP2_HUMAN	hyaluronan binding protein 2 preproprotein	462	Peptidase S1.				cell adhesion|proteolysis	extracellular space	glycosaminoglycan binding|serine-type endopeptidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)		AAAGGGTCCCGCCAGCTCCTG	0.532													22	15	---	---	---	---	PASS
ATRNL1	26033	broad.mit.edu	37	10	117486838	117486838	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:117486838A>C	uc001lcg.2	+	27	4262	c.3876A>C	c.(3874-3876)CAA>CAC	p.Q1292H	ATRNL1_uc010qsm.1_Missense_Mutation_p.Q421H|ATRNL1_uc010qsn.1_RNA	NM_207303	NP_997186	Q5VV63	ATRN1_HUMAN	attractin-like 1 precursor	1292	Cytoplasmic (Potential).					integral to membrane	sugar binding			ovary(5)|lung(1)|central_nervous_system(1)	7		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		GAGCTGAACAAACAGAGTTTC	0.473													3	31	---	---	---	---	PASS
ADAM12	8038	broad.mit.edu	37	10	127753428	127753428	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127753428T>C	uc001ljk.2	-	14	1978	c.1565A>G	c.(1564-1566)TAC>TGC	p.Y522C	ADAM12_uc010qul.1_Missense_Mutation_p.Y473C|ADAM12_uc001ljm.2_Missense_Mutation_p.Y522C|ADAM12_uc001ljn.2_Missense_Mutation_p.Y519C|ADAM12_uc001ljl.3_Missense_Mutation_p.Y519C	NM_003474	NP_003465	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12 isoform 1	522	Extracellular (Potential).|Cys-rich.				cell adhesion|epidermal growth factor receptor signaling pathway|myoblast fusion|proteolysis	extracellular region|integral to membrane|plasma membrane	metalloendopeptidase activity|protein binding|SH3 domain binding|zinc ion binding			breast(4)|ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)	9		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		GATGCCATTGTAGCAGTAGCC	0.617													9	5	---	---	---	---	PASS
DOCK1	1793	broad.mit.edu	37	10	129046349	129046349	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129046349T>C	uc001ljt.2	+	28	2926	c.2862T>C	c.(2860-2862)TTT>TTC	p.F954F	DOCK1_uc010qun.1_Silent_p.F975F	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	954					apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		TCAAGACTTTTGGGAAAATGA	0.393													24	21	---	---	---	---	PASS
CD151	977	broad.mit.edu	37	11	837554	837554	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:837554G>A	uc001lry.2	+	7	695	c.551G>A	c.(550-552)TGC>TAC	p.C184Y	CD151_uc001lrx.2_RNA|CD151_uc001lrz.2_Missense_Mutation_p.C184Y|CD151_uc001lsa.2_Missense_Mutation_p.C184Y|CD151_uc001lsb.2_Missense_Mutation_p.C184Y	NM_004357	NP_004348	P48509	CD151_HUMAN	CD151 antigen	184	Extracellular (Potential).				cell adhesion|hemidesmosome assembly	cytosol|integral to plasma membrane|membrane fraction	protein binding				0		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCAGACAGCTGCTGCAAGACG	0.602													21	21	---	---	---	---	PASS
MUC5B	727897	broad.mit.edu	37	11	1258386	1258386	+	Missense_Mutation	SNP	C	G	G	rs35573593		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1258386C>G	uc009ycr.1	+	41	5494	c.5368C>G	c.(5368-5370)CGC>GGC	p.R1790G	MUC5B_uc009yct.1_Missense_Mutation_p.R1097G|MUC5B_uc001ltb.2_Missense_Mutation_p.R1100G|MUC5B_uc001lta.2_Missense_Mutation_p.R765G	NM_017511	NP_059981	Q9HC84	MUC5B_HUMAN	SubName: Full=Mucin 5AC, oligomeric mucus/gel-forming;	1097	VWFD 3.				cell adhesion	extracellular region	extracellular matrix structural constituent|protein binding				0		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CGCCGCCTGCCGCTCCCAGGT	0.687													7	7	---	---	---	---	PASS
OR51A7	119687	broad.mit.edu	37	11	4928880	4928880	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4928880C>A	uc010qyq.1	+	1	281	c.281C>A	c.(280-282)CCT>CAT	p.P94H		NM_001004749	NP_001004749	Q8NH64	O51A7_HUMAN	olfactory receptor, family 51, subfamily A,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GGAATTTCACCTAATGCCTGC	0.453													38	37	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	5172649	5172649	+	IGR	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5172649T>A								OR52A5 (18777 upstream) : OR52A1 (14 downstream)																							TAGGCATTAATTAAGGTGGAT	0.368													63	58	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17482100	17482100	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17482100C>T	uc001mnc.2	-	6	1072	c.946G>A	c.(946-948)GGG>AGG	p.G316R	ABCC8_uc010rcy.1_Missense_Mutation_p.G315R	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	316	Helical; Name=6; (By similarity).|ABC transmembrane type-1 1.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	CACAGTGGCCCGGCGAAGCCC	0.647													49	184	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195011	18195011	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195011G>T	uc001mnv.1	+	1	628	c.208G>T	c.(208-210)GCA>TCA	p.A70S		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	70	Helical; Name=2; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						CAACCTGGCCGCAGCAGACTT	0.527													82	53	---	---	---	---	PASS
MRGPRX4	117196	broad.mit.edu	37	11	18195313	18195313	+	Silent	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18195313T>C	uc001mnv.1	+	1	930	c.510T>C	c.(508-510)TCT>TCC	p.S170S		NM_054032	NP_473373	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	170	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1						GTGCTGATTCTAGTTGGTGTG	0.517													258	196	---	---	---	---	PASS
NAV2	89797	broad.mit.edu	37	11	19735336	19735336	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19735336C>A	uc010rdm.1	+	1	456	c.95C>A	c.(94-96)GCG>GAG	p.A32E	NAV2_uc001mpp.2_Intron|NAV2_uc001mpr.3_Missense_Mutation_p.A32E|LOC100126784_uc010rdl.1_3'UTR	NM_145117	NP_660093	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 2	32						nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						ccggcccgggcgggcccccAG	0.542													29	27	---	---	---	---	PASS
CKAP5	9793	broad.mit.edu	37	11	46782308	46782308	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46782308G>A	uc001ndi.1	-	33	4358	c.4248C>T	c.(4246-4248)CTC>CTT	p.L1416L	CKAP5_uc009ylg.1_Silent_p.L1302L|CKAP5_uc001ndj.1_Silent_p.L1416L|CKAP5_uc001ndh.1_Silent_p.L345L	NM_001008938	NP_001008938	Q14008	CKAP5_HUMAN	colonic and hepatic tumor over-expressed protein	1416					cell division|centrosome organization|establishment or maintenance of microtubule cytoskeleton polarity|G2/M transition of mitotic cell cycle|mitotic prometaphase|RNA transport|spindle organization	centrosome|cytosol	protein binding|protein binding			ovary(1)|skin(1)	2						TCCTCTCCTCGAGCATGCTCA	0.403													8	90	---	---	---	---	PASS
OR4C12	283093	broad.mit.edu	37	11	50003685	50003685	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50003685C>G	uc010ria.1	-	1	353	c.353G>C	c.(352-354)TGT>TCT	p.C118S		NM_001005270	NP_001005270	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C,	118	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3						ATAGCAGTCACAGGCCATCAC	0.488													79	115	---	---	---	---	PASS
OR4C46	119749	broad.mit.edu	37	11	51516092	51516092	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:51516092A>T	uc010ric.1	+	1	811	c.811A>T	c.(811-813)ATA>TTA	p.I271L		NM_001004703	NP_001004703	A6NHA9	O4C46_HUMAN	olfactory receptor, family 4, subfamily C,	271	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1						AGCAGTTGCTATATTCTACAC	0.388													21	48	---	---	---	---	PASS
OR4A16	81327	broad.mit.edu	37	11	55110791	55110791	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55110791G>A	uc010rie.1	+	1	115	c.115G>A	c.(115-117)GGA>AGA	p.G39R		NM_001005274	NP_001005274	Q8NH70	O4A16_HUMAN	olfactory receptor, family 4, subfamily A,	39	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(2)|pancreas(1)	3						GACAATGGTGGGAAACCTCCT	0.418													24	73	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322712	55322712	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322712A>G	uc010rig.1	+	1	930	c.930A>G	c.(928-930)GTA>GTG	p.V310V		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	256	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						GCATATTTGTATATACACGAC	0.413										HNSCC(20;0.049)			80	122	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735395	55735395	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735395T>A	uc010rit.1	-	1	545	c.545A>T	c.(544-546)AAC>ATC	p.N182I		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					CACAAATATGTTTCCACAAGC	0.398													4	36	---	---	---	---	PASS
OR8J3	81168	broad.mit.edu	37	11	55904407	55904407	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55904407T>A	uc010riz.1	-	1	788	c.788A>T	c.(787-789)CAA>CTA	p.Q263L		NM_001004064	NP_001004064	Q8NGG0	OR8J3_HUMAN	olfactory receptor, family 8, subfamily J,	263	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.00693)					GTGGTTGGTTTGGGGCTGCAA	0.428													31	86	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468108	56468108	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468108T>A	uc010rjn.1	+	1	245	c.245T>A	c.(244-246)GTG>GAG	p.V82E		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	82	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						AAGATCCTAGTGACCTGCATC	0.483													14	138	---	---	---	---	PASS
MS4A13	503497	broad.mit.edu	37	11	60296849	60296849	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60296849G>T	uc001nps.2	+	6	641	c.318G>T	c.(316-318)AGG>AGT	p.R106S	MS4A13_uc009ync.2_Missense_Mutation_p.R66S|MS4A13_uc009ynd.2_Missense_Mutation_p.R47S	NM_001012417	NP_001012417	Q5J8X5	M4A13_HUMAN	membrane-spanning 4-domains, subfamily A, member	106						integral to membrane					0						AACTTGGGAGGGAAGTATCAC	0.373													11	60	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62289139	62289139	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62289139C>A	uc001ntl.2	-	5	13050	c.12750G>T	c.(12748-12750)ATG>ATT	p.M4250I	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4250					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				CTTTGATGTTCATCTCAGGCA	0.468													96	291	---	---	---	---	PASS
SYVN1	84447	broad.mit.edu	37	11	64895953	64895953	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64895953C>T	uc001odb.2	-	16	1849	c.1755G>A	c.(1753-1755)GAG>GAA	p.E585E	SYVN1_uc001odc.2_Silent_p.E584E|SYVN1_uc009yqc.2_Silent_p.E533E	NM_172230	NP_757385	Q86TM6	SYVN1_HUMAN	synoviolin 1 isoform b	585	Cytoplasmic (Potential).				ER-associated protein catabolic process|response to stress	endoplasmic reticulum membrane|integral to membrane|nucleus	acid-amino acid ligase activity|protein binding|zinc ion binding			ovary(1)	1						TGCCCACTGACTCAGGAGCTG	0.617													5	57	---	---	---	---	PASS
DPF2	5977	broad.mit.edu	37	11	65113767	65113767	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65113767G>T	uc001odm.2	+	9	966	c.954G>T	c.(952-954)AAG>AAT	p.K318N	DPF2_uc001odn.2_Missense_Mutation_p.K332N|DPF2_uc010roe.1_Intron	NM_006268	NP_006259	Q92785	REQU_HUMAN	D4, zinc and double PHD fingers family 2	318	PHD-type 1.				apoptosis|induction of apoptosis by extracellular signals|regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1						CGGCAGTGAAGACATACCGCT	0.567													4	53	---	---	---	---	PASS
SART1	9092	broad.mit.edu	37	11	65733956	65733956	+	Missense_Mutation	SNP	C	G	G	rs144548769		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65733956C>G	uc001ogl.2	+	9	1209	c.1117C>G	c.(1117-1119)CGG>GGG	p.R373G	SART1_uc010rot.1_Missense_Mutation_p.C258W	NM_005146	NP_005137	O43290	SNUT1_HUMAN	squamous cell carcinoma antigen recognized by T	373					cell cycle arrest|induction of apoptosis by intracellular signals|positive regulation of cytotoxic T cell differentiation|spliceosomal snRNP assembly	Cajal body|catalytic step 2 spliceosome|cytosol				ovary(1)	1						GGCCAAGCTGCGGCTGCAGGC	0.677													5	22	---	---	---	---	PASS
PDE2A	5138	broad.mit.edu	37	11	72294509	72294509	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:72294509G>T	uc010rrc.1	-	20	1944	c.1701C>A	c.(1699-1701)GCC>GCA	p.A567A	PDE2A_uc001oso.2_Silent_p.A546A|PDE2A_uc010rra.1_Silent_p.A560A|PDE2A_uc001osn.2_Silent_p.A311A|PDE2A_uc010rrb.1_Silent_p.A558A|PDE2A_uc010rrd.1_Silent_p.A452A	NM_002599	NP_002590	O00408	PDE2A_HUMAN	phosphodiesterase 2A isoform 1	567					platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(2)|breast(1)|skin(1)	4			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Sildenafil(DB00203)|Sulindac(DB00605)	TCATCTCATTGGCCAGGTGGC	0.537													39	90	---	---	---	---	PASS
DLG2	1740	broad.mit.edu	37	11	83183809	83183809	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83183809C>T	uc001paj.2	-	18	2293	c.1990G>A	c.(1990-1992)GAC>AAC	p.D664N	DLG2_uc001pai.2_Missense_Mutation_p.D543N|DLG2_uc010rsy.1_Missense_Mutation_p.D613N|DLG2_uc010rsz.1_Missense_Mutation_p.D660N|DLG2_uc010rta.1_Missense_Mutation_p.D646N|DLG2_uc001pak.2_Missense_Mutation_p.D769N|DLG2_uc010rtb.1_Missense_Mutation_p.D631N|DLG2_uc010rsw.1_Missense_Mutation_p.D128N|DLG2_uc010rsx.1_Missense_Mutation_p.D141N	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2	664						cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				AGAATGAGGTCTTCTTGTCCT	0.428													30	70	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92534277	92534277	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92534277C>A	uc001pdj.3	+	9	8115	c.8098C>A	c.(8098-8100)CCC>ACC	p.P2700T		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	2700	Cadherin 24.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CCACGTCTTGCCCCCTGAAAC	0.463										TCGA Ovarian(4;0.039)			19	42	---	---	---	---	PASS
MED17	9440	broad.mit.edu	37	11	93529576	93529576	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93529576G>T	uc001pem.3	+	7	1288	c.1013G>T	c.(1012-1014)AGC>ATC	p.S338I		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	338					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTATAAATAGGCTTGCAGTTA	0.328													15	66	---	---	---	---	PASS
MED17	9440	broad.mit.edu	37	11	93542995	93542995	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93542995C>T	uc001pem.3	+	11	1972	c.1697C>T	c.(1696-1698)GCA>GTA	p.A566V		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	566					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATTGGTAATGCATCTGCCATC	0.483													50	161	---	---	---	---	PASS
MED17	9440	broad.mit.edu	37	11	93542996	93542996	+	Silent	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93542996A>T	uc001pem.3	+	11	1973	c.1698A>T	c.(1696-1698)GCA>GCT	p.A566A		NM_004268	NP_004259	Q9NVC6	MED17_HUMAN	mediator complex subunit 17	566					androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TTGGTAATGCATCTGCCATCA	0.478													50	163	---	---	---	---	PASS
MMP8	4317	broad.mit.edu	37	11	102586033	102586033	+	Splice_Site	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102586033A>T	uc001phe.2	-	7	1135	c.1036_splice	c.e7+1	p.G346_splice	MMP8_uc010rut.1_Splice_Site_p.D281_splice|MMP8_uc010ruu.1_Splice_Site_p.G323_splice	NM_002424	NP_002415	P22894	MMP8_HUMAN	matrix metalloproteinase 8 preproprotein						collagen catabolic process|proteolysis	extracellular space|proteinaceous extracellular matrix	metalloendopeptidase activity|serine-type endopeptidase activity|zinc ion binding			ovary(3)|breast(1)	4	all_cancers(8;0.00092)|all_epithelial(12;0.00389)|Lung NSC(15;0.227)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0555)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.189)	BRCA - Breast invasive adenocarcinoma(274;0.0141)		TTAGGAAGTTACCTTTAAATA	0.408													18	20	---	---	---	---	PASS
SORL1	6653	broad.mit.edu	37	11	121420786	121420786	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121420786G>T	uc001pxx.2	+	15	2249	c.2169G>T	c.(2167-2169)AGG>AGT	p.R723S		NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class	723	Extracellular (Potential).				cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		CTACTTACAGGAGAACGAGAG	0.507													19	54	---	---	---	---	PASS
TMEM225	338661	broad.mit.edu	37	11	123756055	123756055	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123756055C>T	uc001pzi.2	-	1	286	c.78G>A	c.(76-78)ATG>ATA	p.M26I		NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225	26	Helical; (Potential).					integral to membrane				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						AGGTGATTCCCATCACCATTA	0.428													34	56	---	---	---	---	PASS
OR8D4	338662	broad.mit.edu	37	11	123777298	123777298	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123777298C>A	uc010saa.1	+	1	160	c.160C>A	c.(160-162)CAA>AAA	p.Q54K		NM_001005197	NP_001005197	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D,	54	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		GCTGAATCGTCAACTTCATAC	0.408													37	107	---	---	---	---	PASS
PUS3	83480	broad.mit.edu	37	11	125765462	125765462	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125765462G>A	uc001qcy.2	-	3	699	c.601C>T	c.(601-603)CGT>TGT	p.R201C	HYLS1_uc009zbv.2_Intron|HYLS1_uc001qcx.3_Intron	NM_031307	NP_112597	Q9BZE2	PUS3_HUMAN	pseudouridylate synthase 3	201						nucleus	RNA binding			ovary(1)	1	all_hematologic(175;0.177)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.131)|all_lung(97;0.139)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.043)		AAATCAGCACGAGGGAAAAAA	0.473													8	56	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	131781445	131781445	+	Missense_Mutation	SNP	C	T	T	rs143802759		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131781445C>T	uc001qgp.2	+	1	734	c.70C>T	c.(70-72)CTT>TTT	p.L24F	NTM_uc001qgm.2_Intron|NTM_uc010sch.1_Intron|NTM_uc010sci.1_Intron|NTM_uc010scj.1_Intron|NTM_uc001qgo.2_Missense_Mutation_p.L24F|NTM_uc001qgq.2_Missense_Mutation_p.L24F	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1	24					cell adhesion|neuron recognition	anchored to membrane|plasma membrane		p.L24F(1)		ovary(4)|central_nervous_system(1)|skin(1)	6						GCTGCTGTTCCTTGTACCCAC	0.627											OREG0021537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	49	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2694567	2694567	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2694567G>T	uc009zdu.1	+	17	2678	c.2365G>T	c.(2365-2367)GAG>TAG	p.E789*	CACNA1C_uc009zdv.1_Nonsense_Mutation_p.E786*|CACNA1C_uc001qkb.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkc.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qke.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkf.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qjz.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkd.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkg.2_Nonsense_Mutation_p.E789*|CACNA1C_uc009zdw.1_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkh.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkl.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkn.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qko.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkp.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkr.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qku.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkq.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qks.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qkt.2_Nonsense_Mutation_p.E789*|CACNA1C_uc001qka.1_Nonsense_Mutation_p.E324*|CACNA1C_uc001qki.1_Nonsense_Mutation_p.E525*|CACNA1C_uc001qkj.1_Nonsense_Mutation_p.E525*|CACNA1C_uc001qkk.1_Nonsense_Mutation_p.E525*|CACNA1C_uc001qkm.1_Nonsense_Mutation_p.E525*|CACNA1C_uc001qkw.2_Nonsense_Mutation_p.E78*	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	789	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	GAAGAAACAAGAGTTGGTGGA	0.542													7	28	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4920672	4920672	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4920672C>A	uc001qng.2	+	1	2331	c.1465C>A	c.(1465-1467)CTG>ATG	p.L489M		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	489						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						TGCGCCGGACCTGAGGGCAAC	0.597										HNSCC(72;0.22)			20	69	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9229536	9229536	+	Intron	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9229536T>A	uc001qvk.1	-						A2M_uc001qvj.1_Intron|A2M_uc009zgk.1_Intron	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CAGGGTGCTGTGAAGGCAGAA	0.478													7	111	---	---	---	---	PASS
CLEC1B	51266	broad.mit.edu	37	12	10149546	10149546	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10149546A>T	uc001qwu.2	-	4	537	c.337T>A	c.(337-339)TGC>AGC	p.C113S	CLEC1B_uc009zhd.2_Missense_Mutation_p.C80S	NM_016509	NP_057593	Q9P126	CLC1B_HUMAN	C-type lectin domain family 1, member B isoform	113	C-type lectin.|Extracellular (Potential).				cell surface receptor linked signaling pathway|defense response	integral to plasma membrane	protein binding|sugar binding|transmembrane receptor activity				0						AACCCATAGCAGCTATCTCCA	0.433													39	76	---	---	---	---	PASS
CAPZA3	93661	broad.mit.edu	37	12	18891505	18891505	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:18891505G>A	uc001rdy.2	+	1	461	c.303G>A	c.(301-303)CTG>CTA	p.L101L	PLCZ1_uc001rdv.3_5'Flank|PLCZ1_uc001rdw.3_5'Flank|PLCZ1_uc010sid.1_5'Flank	NM_033328	NP_201585	Q96KX2	CAZA3_HUMAN	capping protein alpha 3	101					actin cytoskeleton organization|actin filament capping	F-actin capping protein complex	actin binding			ovary(1)|central_nervous_system(1)	2	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)	Hepatocellular(102;0.194)				AAAATCAGCTGAAAGACATCC	0.398													8	62	---	---	---	---	PASS
ST8SIA1	6489	broad.mit.edu	37	12	22354742	22354742	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22354742C>A	uc001rfo.3	-	5	1297	c.815G>T	c.(814-816)CGC>CTC	p.R272L	ST8SIA1_uc009zix.2_Missense_Mutation_p.R129L	NM_003034	NP_003025	Q92185	SIA8A_HUMAN	alpha-2,8-sialyltransferase 1	272	Lumenal (Potential).				glycosphingolipid biosynthetic process|protein glycosylation	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(3)	3						TGTGGACAGGCGCTTGGCATG	0.507													30	60	---	---	---	---	PASS
SOX5	6660	broad.mit.edu	37	12	23728734	23728734	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:23728734G>A	uc001rfw.2	-	10	1305	c.1203C>T	c.(1201-1203)CCC>CCT	p.P401P	SOX5_uc001rfx.2_Silent_p.P388P|SOX5_uc001rfy.2_Intron|SOX5_uc001rfv.2_Silent_p.P15P|SOX5_uc010siv.1_Silent_p.P388P|SOX5_uc010siw.1_RNA|SOX5_uc001rfz.1_Silent_p.P353P	NM_006940	NP_008871	P35711	SOX5_HUMAN	SRY (sex determining region Y)-box 5 isoform a	401					transcription from RNA polymerase II promoter	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(5)|lung(1)	6						CAGAGGTCTTGGGTTTAGCTG	0.488													34	85	---	---	---	---	PASS
KLHDC5	57542	broad.mit.edu	37	12	27950784	27950784	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27950784C>T	uc001rij.2	+	3	1280	c.1203C>T	c.(1201-1203)CAC>CAT	p.H401H	KLHDC5_uc009zjj.2_RNA	NM_020782	NP_065833	Q9P2K6	KLDC5_HUMAN	kelch domain containing 5	401	Kelch 5.									ovary(1)|central_nervous_system(1)	2	Lung SC(9;0.0873)					GGTGTCTCCACGAGCTGGGGC	0.587													48	87	---	---	---	---	PASS
IPO8	10526	broad.mit.edu	37	12	30826935	30826935	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30826935C>A	uc001rjd.2	-	8	1068	c.898G>T	c.(898-900)GGC>TGC	p.G300C	IPO8_uc010sjt.1_Missense_Mutation_p.G95C	NM_006390	NP_006381	O15397	IPO8_HUMAN	importin 8	300					intracellular protein transport|signal transduction	cytoplasm|nucleus	protein transporter activity|Ran GTPase binding			skin(2)|central_nervous_system(1)	3	all_lung(12;6.66e-10)|Lung NSC(12;4.84e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					TGCTGAATGCCCACTGCATAG	0.313													16	59	---	---	---	---	PASS
C12orf40	283461	broad.mit.edu	37	12	40020150	40020150	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40020150C>G	uc001rmc.2	+	1	179	c.12C>G	c.(10-12)GTC>GTG	p.V4V	C12orf40_uc009zjv.1_RNA	NM_001031748	NP_001026918	Q86WS4	CL040_HUMAN	hypothetical protein LOC283461	4										ovary(6)	6						TGAATTGGGTCGGGGGGTCCC	0.542													14	44	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49420645	49420645	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49420645C>A	uc001rta.3	-	48	15104	c.15104G>T	c.(15103-15105)TGT>TTT	p.C5035F		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	5035					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						CTCCTCATGACAGAAACAGCA	0.617			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			8	101	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49435057	49435057	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49435057G>A	uc001rta.3	-	31	6496	c.6496C>T	c.(6496-6498)CAG>TAG	p.Q2166*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	2166	Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GCGGGCACCTGGGGTGGGAGC	0.701			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			10	17	---	---	---	---	PASS
CELA1	1990	broad.mit.edu	37	12	51733741	51733741	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51733741A>G	uc001ryi.1	-	6	553	c.512T>C	c.(511-513)GTG>GCG	p.V171A		NM_001971	NP_001962	Q9UNI1	CELA1_HUMAN	chymotrypsin-like elastase family, member 1	171	Peptidase S1.				proteolysis	extracellular region	metal ion binding|serine-type endopeptidase activity			breast(1)	1						GGCGTAGTCCACAGAGGGCAG	0.597													15	23	---	---	---	---	PASS
KRT86	3892	broad.mit.edu	37	12	52699180	52699180	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52699180C>G	uc010snq.1	+	6	1025	c.892C>G	c.(892-894)CGC>GGC	p.R298G	KRT86_uc009zmg.2_Missense_Mutation_p.R298G|KRT81_uc001sac.2_Intron|KRT86_uc001sad.2_Missense_Mutation_p.R298G	NM_002284	NP_002275	O43790	KRT86_HUMAN	keratin 86	298	Rod.|Coil 2.				cytoskeleton organization	keratin filament	structural molecule activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(357;0.189)		GTCCTGGTACCGCAGCAAGGT	0.542													28	48	---	---	---	---	PASS
KRT73	319101	broad.mit.edu	37	12	53008428	53008428	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53008428C>A	uc001sas.2	-	4	789	c.754G>T	c.(754-756)GAG>TAG	p.E252*		NM_175068	NP_778238	Q86Y46	K2C73_HUMAN	keratin 73	252	Coil 1B.|Rod.					keratin filament	structural molecule activity			large_intestine(2)|ovary(2)|skin(2)	6				BRCA - Breast invasive adenocarcinoma(357;0.189)		GCCTGCAGCTCCACTTTGCTC	0.567													22	42	---	---	---	---	PASS
KIF5A	3798	broad.mit.edu	37	12	57969442	57969442	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57969442C>T	uc001sor.1	+	17	2133	c.1925C>T	c.(1924-1926)TCG>TTG	p.S642L	KIF5A_uc010srr.1_Missense_Mutation_p.S553L	NM_004984	NP_004975	Q12840	KIF5A_HUMAN	kinesin family member 5A	642					blood coagulation|cell death|microtubule-based movement|synaptic transmission	cytosol|kinesin complex|membrane fraction|microtubule|perinuclear region of cytoplasm	ATP binding|microtubule motor activity			ovary(2)|skin(1)	3						AAGATCCGCTCGCTTACGGAA	0.557													71	139	---	---	---	---	PASS
GEFT	115557	broad.mit.edu	37	12	58007895	58007895	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58007895C>T	uc001spb.2	+	6	1109	c.649C>T	c.(649-651)CAC>TAC	p.H217Y	GEFT_uc009zpy.2_Missense_Mutation_p.H256Y|GEFT_uc001soz.1_Missense_Mutation_p.H91Y|GEFT_uc001spa.2_Missense_Mutation_p.H111Y|uc001spc.2_Intron|GEFT_uc001spd.2_5'UTR	NM_182947	NP_891992	Q86VW2	ARHGP_HUMAN	RhoA/RAC/CDC42 exchange factor isoform 1	217	DH.				regulation of Rho protein signal transduction	cytosol|plasma membrane|sarcomere	Rho guanyl-nucleotide exchange factor activity				0	Melanoma(17;0.122)					CTATGAGTGGCACCGAGAGTG	0.537													26	70	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78542700	78542700	+	Splice_Site	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78542700G>T	uc001syp.2	+	22	4958	c.4785_splice	c.e22+1	p.N1595_splice	NAV3_uc001syo.2_Splice_Site_p.N1595_splice|NAV3_uc010sub.1_Splice_Site_p.N1081_splice|NAV3_uc009zsf.2_Splice_Site_p.N426_splice	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						TTCAGCAAATGTAAGTCACTT	0.313										HNSCC(70;0.22)			5	20	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80613652	80613652	+	IGR	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80613652C>A								PPP1R12A (284417 upstream) : PTPRQ (224474 downstream)																							GAACATGTGACTGTCAAATAT	0.383													13	29	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81839366	81839366	+	Nonsense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81839366A>T	uc001szo.1	-	6	700	c.539T>A	c.(538-540)TTG>TAG	p.L180*	PPFIA2_uc010sue.1_Nonsense_Mutation_p.L80*|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	106										ovary(3)|lung(2)|pancreas(1)	6						GTGCTCAAACAAAGATTTCAG	0.428													42	59	---	---	---	---	PASS
TMPO	7112	broad.mit.edu	37	12	98921700	98921700	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:98921700G>A	uc001tfj.2	+	2	553	c.316G>A	c.(316-318)GAT>AAT	p.D106N	TMPO_uc001tfi.1_Missense_Mutation_p.D106N|TMPO_uc001tfk.2_Missense_Mutation_p.D106N|TMPO_uc001tfl.2_RNA|TMPO_uc001tfh.1_Missense_Mutation_p.D106N	NM_001032283	NP_001027454	P42167	LAP2B_HUMAN	thymopoietin isoform beta	106	Linker.|Nucleoplasmic (Potential).					integral to membrane|nuclear inner membrane	DNA binding|lamin binding			ovary(2)	2						CAGACAAGAAGATAAAGATGA	0.348													41	88	---	---	---	---	PASS
NR1H4	9971	broad.mit.edu	37	12	100928738	100928738	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100928738C>G	uc001tht.1	+	4	727	c.699C>G	c.(697-699)ACC>ACG	p.T233T	NR1H4_uc001thp.1_Silent_p.T219T|NR1H4_uc001thq.1_Silent_p.T223T|NR1H4_uc010svj.1_RNA|NR1H4_uc001thr.1_Silent_p.T223T|NR1H4_uc010svk.1_Silent_p.T172T|NR1H4_uc001ths.1_Silent_p.T229T	NM_005123	NP_005114	Q96RI1	NR1H4_HUMAN	nuclear receptor subfamily 1, group H, member 4	233					bile acid metabolic process|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|thyroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						CAGATCAGACCGTGAATGAAG	0.428													20	37	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101551154	101551154	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101551154G>A	uc001thz.3	-	15	2126	c.1736C>T	c.(1735-1737)TCA>TTA	p.S579L		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	579	Cytoplasmic (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						CACTGGATGTGATTTATAGCT	0.373													5	16	---	---	---	---	PASS
SLC5A8	160728	broad.mit.edu	37	12	101603342	101603342	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101603342C>T	uc001thz.3	-	1	675	c.285G>A	c.(283-285)GTG>GTA	p.V95V		NM_145913	NP_666018	Q8N695	SC5A8_HUMAN	solute carrier family 5 (iodide transporter),	95	Helical; (Potential).				apoptosis|sodium ion transport	apical plasma membrane|integral to membrane	monocarboxylic acid transmembrane transporter activity|passive transmembrane transporter activity|symporter activity				0						TGATGACCACCACAAAGAAGT	0.577													9	26	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101731884	101731884	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101731884A>T	uc001tia.1	+	30	3853	c.3697A>T	c.(3697-3699)ACC>TCC	p.T1233S		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1233					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TGATATCCTGACCAATGTTTT	0.388													30	74	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104379432	104379432	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104379432A>G	uc001tkg.2	+	9	1239	c.1016A>G	c.(1015-1017)GAG>GGG	p.E339G	TDG_uc009zuk.2_Missense_Mutation_p.E335G|TDG_uc010swi.1_Missense_Mutation_p.E196G|TDG_uc010swj.1_Missense_Mutation_p.E127G	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	339					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		CCAGGTTATGAGGCAGCATAT	0.403								BER_DNA_glycosylases					17	115	---	---	---	---	PASS
CORO1C	23603	broad.mit.edu	37	12	109051103	109051103	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109051103G>A	uc001tnj.2	-	6	823	c.727C>T	c.(727-729)CGG>TGG	p.R243W	CORO1C_uc009zva.2_Missense_Mutation_p.R296W|CORO1C_uc010sxf.1_Missense_Mutation_p.R206W	NM_014325	NP_055140	Q9ULV4	COR1C_HUMAN	coronin, actin binding protein, 1C isoform 1	243					actin cytoskeleton organization|phagocytosis|signal transduction	actin cytoskeleton	actin filament binding			skin(3)	3						GCCAGCTGCCGCTCGCTCATG	0.557													41	81	---	---	---	---	PASS
FOXN4	121643	broad.mit.edu	37	12	109719363	109719363	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:109719363G>T	uc001toe.3	-	9	1248	c.1143C>A	c.(1141-1143)ACC>ACA	p.T381T	FOXN4_uc009zvg.2_Silent_p.T178T|FOXN4_uc001tof.3_Silent_p.T201T	NM_213596	NP_998761	Q96NZ1	FOXN4_HUMAN	forkhead box N4	381					axon extension|embryo development|organ development|pattern specification process|regulation of heart contraction|regulation of sequence-specific DNA binding transcription factor activity|tissue development	transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			ovary(1)|lung(1)	2						GCAGTGGCGGGGTCTGGGCTG	0.662													6	8	---	---	---	---	PASS
COQ5	84274	broad.mit.edu	37	12	120966933	120966933	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120966933G>A	uc001tyn.2	-	1	32	c.12C>T	c.(10-12)CCC>CCT	p.P4P	COQ5_uc001tyo.2_5'UTR|COQ5_uc010szj.1_Silent_p.P4P	NM_032314	NP_115690	Q5HYK3	COQ5_HUMAN	coenzyme Q5 homolog, methyltransferase	4					ubiquinone biosynthetic process	mitochondrion	methyltransferase activity			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					CACAGCTCCCGGGGGCCGCCA	0.652													12	19	---	---	---	---	PASS
ACADS	35	broad.mit.edu	37	12	121174802	121174802	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121174802G>T	uc001tza.3	+	3	342	c.224G>T	c.(223-225)GGC>GTC	p.G75V	ACADS_uc010szl.1_Missense_Mutation_p.G75V|ACADS_uc001tzb.3_Missense_Mutation_p.G2V	NM_000017	NP_000008	P16219	ACADS_HUMAN	short-chain acyl-CoA dehydrogenase precursor	75						mitochondrial matrix	butyryl-CoA dehydrogenase activity			central_nervous_system(2)	2	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)	Lung NSC(355;0.163)			NADH(DB00157)	AAGAAGATGGGCGGGCTTGGG	0.692													7	14	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20048124	20048124	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20048124A>T	uc001umd.2	-	7	533	c.322T>A	c.(322-324)TAT>AAT	p.Y108N	TPTE2_uc009zzk.2_Intron|TPTE2_uc009zzl.2_Intron|TPTE2_uc001ume.2_Missense_Mutation_p.Y71N|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	108						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		ATAGAACGATACTCCAAAGGA	0.333													34	94	---	---	---	---	PASS
SGCG	6445	broad.mit.edu	37	13	23777964	23777964	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:23777964T>A	uc001uom.2	+	2	286	c.131T>A	c.(130-132)CTC>CAC	p.L44H	SGCG_uc009zzv.2_Missense_Mutation_p.L44H|SGCG_uc009zzw.2_Missense_Mutation_p.L44H	NM_000231	NP_000222	Q13326	SGCG_HUMAN	gamma sarcoglycan	44	Helical; Signal-anchor for type II membrane protein; (Potential).				cytoskeleton organization|muscle organ development	cytoplasm|cytoskeleton|integral to membrane|sarcoglycan complex|sarcolemma					0		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		CTTCTTTTACTCATCATCCTC	0.378													32	52	---	---	---	---	PASS
USPL1	10208	broad.mit.edu	37	13	31227421	31227421	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:31227421A>T	uc001utc.2	+	8	1807	c.1375A>T	c.(1375-1377)ACA>TCA	p.T459S	USPL1_uc001utd.2_Missense_Mutation_p.T130S|USPL1_uc001ute.1_Missense_Mutation_p.T130S	NM_005800	NP_005791	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	459					ubiquitin-dependent protein catabolic process		ubiquitin thiolesterase activity			pancreas(2)|skin(1)	3		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TCATTTTATAACATGGATTTT	0.328													31	71	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	35644848	35644848	+	Intron	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:35644848G>T	uc001uvb.2	+							NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin							cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		TTTTGTTTTTGGACATAGGAT	0.299													15	65	---	---	---	---	PASS
FREM2	341640	broad.mit.edu	37	13	39452269	39452269	+	Splice_Site	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39452269A>T	uc001uwv.2	+	22	8981	c.8672_splice	c.e22-2	p.G2891_splice		NM_207361	NP_997244	Q5SZK8	FREM2_HUMAN	FRAS1-related extracellular matrix protein 2						cell communication|homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(7)|pancreas(1)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	11		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCTCTATTTCAGGTGATATAA	0.393													48	85	---	---	---	---	PASS
EPSTI1	94240	broad.mit.edu	37	13	43500491	43500491	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:43500491C>T	uc001uyw.1	-	7	714	c.638G>A	c.(637-639)GGC>GAC	p.G213D	EPSTI1_uc001uyx.1_Missense_Mutation_p.G213D	NM_001002264	NP_001002264	Q96J88	ESIP1_HUMAN	epithelial stromal interaction 1 isoform 1	213										ovary(1)	1		Lung NSC(96;3.6e-06)|Breast(139;0.00869)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		GBM - Glioblastoma multiforme(144;0.000528)|BRCA - Breast invasive adenocarcinoma(63;0.0858)		GGATTGTGGGCCACAAACAGC	0.448													91	201	---	---	---	---	PASS
SLC25A30	253512	broad.mit.edu	37	13	45980021	45980021	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45980021C>A	uc001vag.2	-	4	441	c.304G>T	c.(304-306)GAA>TAA	p.E102*	SLC25A30_uc010tfs.1_Nonsense_Mutation_p.E27*|SLC25A30_uc001vah.2_Nonsense_Mutation_p.E27*|SLC25A30_uc010tft.1_Nonsense_Mutation_p.E51*|SLC25A30_uc001vaf.2_5'Flank	NM_001010875	NP_001010875	Q5SVS4	KMCP1_HUMAN	solute carrier family 25, member 30	102					mitochondrial transport	integral to membrane|mitochondrial inner membrane	binding			breast(1)	1		Lung NSC(96;0.00227)|Prostate(109;0.00578)|Breast(56;0.0192)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.95e-05)		CACTCACCTTCTGGGCGTTCA	0.473													24	61	---	---	---	---	PASS
RNF219	79596	broad.mit.edu	37	13	79213075	79213075	+	Silent	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79213075T>A	uc001vkw.1	-	4	491	c.432A>T	c.(430-432)CTA>CTT	p.L144L	RNF219_uc010afb.1_5'UTR|RNF219_uc010afc.2_Silent_p.L144L	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219	144							zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TATCTGTGACTAGATGTTTGT	0.363													35	88	---	---	---	---	PASS
RNF219	79596	broad.mit.edu	37	13	79213097	79213097	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:79213097T>A	uc001vkw.1	-	4	469	c.410A>T	c.(409-411)AAC>ATC	p.N137I	RNF219_uc010afb.1_5'UTR|RNF219_uc010afc.2_Missense_Mutation_p.N137I	NM_024546	NP_078822	Q5W0B1	RN219_HUMAN	ring finger protein 219	137							zinc ion binding			large_intestine(2)	2		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TTCATTTTGGTTGCCCTGCAC	0.368													34	89	---	---	---	---	PASS
GPC6	10082	broad.mit.edu	37	13	95050862	95050862	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:95050862T>G	uc001vlt.2	+	8	2064	c.1432T>G	c.(1432-1434)TAC>GAC	p.Y478D		NM_005708	NP_005699	Q9Y625	GPC6_HUMAN	glypican 6 precursor	478						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding				0	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				AAAAAACGCCTACAATGGCAA	0.428													16	50	---	---	---	---	PASS
UGGT2	55757	broad.mit.edu	37	13	96589190	96589190	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96589190T>A	uc001vmt.2	-	17	2135	c.1965A>T	c.(1963-1965)AGA>AGT	p.R655S		NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2	655					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						AAAAAACTTCTCTTTGTAAAT	0.244													26	40	---	---	---	---	PASS
ZIC2	7546	broad.mit.edu	37	13	100637327	100637327	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100637327C>A	uc001von.2	+	2	1203	c.1203C>A	c.(1201-1203)TCC>TCA	p.S401S		NM_007129	NP_009060	O95409	ZIC2_HUMAN	zinc finger protein of the cerebellum 2	401	C2H2-type 5.				brain development|negative regulation of transcription, DNA-dependent|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|visual perception	cytoplasm|nucleus	chromatin DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCGACAAGTCCTACACGCACC	0.667													26	64	---	---	---	---	PASS
ARGLU1	55082	broad.mit.edu	37	13	107196490	107196490	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:107196490T>C	uc001vqk.3	-	4	923	c.676A>G	c.(676-678)ATT>GTT	p.I226V		NM_018011	NP_060481	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	226	Glu-rich.										0	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TCTTCAACAATTCTCAACTGT	0.174													22	32	---	---	---	---	PASS
OR4M1	441670	broad.mit.edu	37	14	20249278	20249278	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20249278C>A	uc010tku.1	+	1	797	c.797C>A	c.(796-798)TCA>TAA	p.S266*		NM_001005500	NP_001005500	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M,	266	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCATTTGACTCATTTTCCCTA	0.413													39	192	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23886701	23886701	+	Intron	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23886701C>A	uc001wjx.2	-							NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGGCCCCCACCCAGGGCCCAC	0.632													34	68	---	---	---	---	PASS
C14orf37	145407	broad.mit.edu	37	14	58605787	58605787	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:58605787T>A	uc001xdc.2	-	2	401	c.290A>T	c.(289-291)CAG>CTG	p.Q97L	C14orf37_uc010tro.1_Missense_Mutation_p.Q135L|C14orf37_uc001xdd.2_Missense_Mutation_p.Q97L|C14orf37_uc001xde.2_Missense_Mutation_p.Q97L	NM_001001872	NP_001001872	Q86TY3	CN037_HUMAN	hypothetical protein LOC145407 precursor	97	Extracellular (Potential).					integral to membrane	binding				0						TTGTCCAGGCTGGGTTTCTTT	0.488													38	64	---	---	---	---	PASS
C14orf115	55237	broad.mit.edu	37	14	74825314	74825314	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74825314C>A	uc001xpw.3	+	2	2019	c.1828C>A	c.(1828-1830)CAG>AAG	p.Q610K		NM_018228	NP_060698	Q9H8Y1	VRTN_HUMAN	hypothetical protein LOC55237	610					transposition, DNA-mediated		DNA binding|transposase activity				0				BRCA - Breast invasive adenocarcinoma(234;0.00147)		GGGGGCCCTGCAGGAGGGGGC	0.667													7	54	---	---	---	---	PASS
YLPM1	56252	broad.mit.edu	37	14	75265623	75265623	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75265623G>C	uc001xqj.3	+	5	3747	c.3623G>C	c.(3622-3624)GGT>GCT	p.G1208A	YLPM1_uc001xql.3_RNA	NM_019589	NP_062535	P49750	YLPM1_HUMAN	YLP motif containing 1	1013	Arg-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nuclear speck				ovary(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		CCATTAGATGGTAGAAATGCT	0.468													15	24	---	---	---	---	PASS
NRXN3	9369	broad.mit.edu	37	14	79276669	79276669	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79276669A>T	uc001xun.2	+	7	1629	c.1138A>T	c.(1138-1140)AGG>TGG	p.R380W	NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor	753	Laminin G-like 4.|Extracellular (Potential).				axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		AGACTGTATCAGGATAAACTG	0.343													9	22	---	---	---	---	PASS
TRIP11	9321	broad.mit.edu	37	14	92488131	92488131	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92488131A>G	uc001xzy.2	-	4	1145	c.357T>C	c.(355-357)GAT>GAC	p.D119D		NM_004239	NP_004230	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	119	Potential.				transcription from RNA polymerase II promoter	cytoskeleton|Golgi apparatus|membrane|nucleus	protein binding|transcription coactivator activity			ovary(6)|skin(2)|kidney(2)|central_nervous_system(1)|lung(1)|breast(1)	13				COAD - Colon adenocarcinoma(157;0.223)		TCAGCAACTGATCCTGGAGTG	0.408			T	PDGFRB	AML								30	55	---	---	---	---	PASS
KIAA1409	57578	broad.mit.edu	37	14	94088791	94088791	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94088791G>A	uc001ybv.1	+	28	4830	c.4747G>A	c.(4747-4749)GGT>AGT	p.G1583S	KIAA1409_uc001ybs.1_Missense_Mutation_p.G1561S	NM_020818	NP_065869	Q9P2D8	UNC79_HUMAN	hypothetical protein LOC57578	1738						integral to membrane				ovary(10)|skin(4)|large_intestine(3)	17		all_cancers(154;0.0354)|all_epithelial(191;0.216)		Epithelial(152;0.188)		GTTCTCCTGCGGTAGCCCACT	0.577													33	90	---	---	---	---	PASS
MARK3	4140	broad.mit.edu	37	14	103932708	103932708	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103932708C>A	uc001ymz.3	+	10	1592	c.926C>A	c.(925-927)GCA>GAA	p.A309E	MARK3_uc001ymx.3_Missense_Mutation_p.A309E|MARK3_uc001ymw.3_Missense_Mutation_p.A309E|MARK3_uc001yna.3_Missense_Mutation_p.A309E|MARK3_uc001ymy.3_Missense_Mutation_p.A230E|MARK3_uc010awp.2_Missense_Mutation_p.A332E|MARK3_uc010tyb.1_Missense_Mutation_p.A120E	NM_001128918	NP_001122390	P27448	MARK3_HUMAN	MAP/microtubule affinity-regulating kinase 3	309							ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|stomach(1)	4		Melanoma(154;0.155)	Epithelial(46;0.241)			TGGATCAATGCAGGGCATGAA	0.353													16	22	---	---	---	---	PASS
PPP1R13B	23368	broad.mit.edu	37	14	104206650	104206650	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104206650C>A	uc001yof.1	-	12	2386	c.2103G>T	c.(2101-2103)GCG>GCT	p.A701A	PPP1R13B_uc010awv.1_RNA|PPP1R13B_uc001yog.1_Silent_p.A568A	NM_015316	NP_056131	Q96KQ4	ASPP1_HUMAN	apoptosis-stimulating protein of p53, 1	701	Pro-rich.				apoptosis|induction of apoptosis|negative regulation of cell cycle	cytoplasm|nucleus|plasma membrane	protein binding			ovary(1)	1		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				GGGGCCGGGGCGCGTTGGCCA	0.672													43	92	---	---	---	---	PASS
ADSSL1	122622	broad.mit.edu	37	14	105204723	105204723	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105204723G>T	uc001ypd.2	+	3	380	c.306G>T	c.(304-306)GTG>GTT	p.V102V	INF2_uc010tyi.1_Intron|ADSSL1_uc001ype.2_Silent_p.V145V|ADSSL1_uc001ypf.2_RNA	NM_152328	NP_689541	Q8N142	PURA1_HUMAN	adenylosuccinate synthase like 1 isoform 2	102					AMP biosynthetic process|immune system process|purine base metabolic process	cytosol	adenylosuccinate synthase activity|GTP binding|magnesium ion binding|phosphate binding			ovary(1)|central_nervous_system(1)	2		all_cancers(154;0.0896)|Melanoma(154;0.155)|all_epithelial(191;0.172)	all cancers(16;0.00153)|OV - Ovarian serous cystadenocarcinoma(23;0.0148)|Epithelial(46;0.0396)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.18)	L-Aspartic Acid(DB00128)	GCAACGGGGTGGTCATCCACT	0.493													27	52	---	---	---	---	PASS
C15orf2	23742	broad.mit.edu	37	15	24922057	24922057	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:24922057G>T	uc001ywo.2	+	1	1517	c.1043G>T	c.(1042-1044)CGA>CTA	p.R348L		NM_018958	NP_061831	Q9NZP6	CO002_HUMAN	hypothetical protein LOC23742	348	Pro-rich.				cell differentiation|multicellular organismal development|spermatogenesis					ovary(2)|large_intestine(2)|skin(2)|kidney(1)|central_nervous_system(1)	8		all_cancers(20;2.14e-21)|all_epithelial(15;4.77e-19)|Lung NSC(15;1.43e-14)|all_lung(15;9.57e-14)|Breast(32;0.00086)		all cancers(64;3.19e-24)|Epithelial(43;2.67e-17)|GBM - Glioblastoma multiforme(186;7.36e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000273)|Lung(196;0.229)		CTGTGGGATCGAGGTGAGCTT	0.567													14	42	---	---	---	---	PASS
UBE3A	7337	broad.mit.edu	37	15	25616072	25616072	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25616072T>A	uc001zaq.2	-	4	1258	c.1258A>T	c.(1258-1260)AAG>TAG	p.K420*	uc001zae.2_Intron|UBE3A_uc001zar.2_Nonsense_Mutation_p.K397*|UBE3A_uc001zas.2_Nonsense_Mutation_p.K417*|UBE3A_uc001zat.2_Nonsense_Mutation_p.K397*	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2	420	Interaction with HCV core protein.				brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		GGACCTTTCTTGTTTCTTCTT	0.443													13	28	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28408228	28408228	+	Intron	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28408228C>G	uc001zbj.2	-							NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2						DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CCCCGCCCTCCCTGAGACTCA	0.632													34	74	---	---	---	---	PASS
AQR	9716	broad.mit.edu	37	15	35210502	35210502	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:35210502T>C	uc001ziv.2	-	15	1480	c.1299A>G	c.(1297-1299)ATA>ATG	p.I433M		NM_014691	NP_055506	O60306	AQR_HUMAN	aquarius	433						catalytic step 2 spliceosome	RNA binding			large_intestine(1)	1		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TTTCATCCCATATAATTTTCT	0.348													28	56	---	---	---	---	PASS
LTK	4058	broad.mit.edu	37	15	41804959	41804959	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41804959G>T	uc001zoa.3	-	3	483	c.305C>A	c.(304-306)GCC>GAC	p.A102D	LTK_uc001zob.3_Missense_Mutation_p.A102D|LTK_uc010ucx.1_Missense_Mutation_p.A102D|LTK_uc010bcg.2_Intron	NM_002344	NP_002335	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase isoform 1	102	Extracellular (Potential).				apoptosis|cell proliferation|phosphatidylinositol 3-kinase cascade|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|central_nervous_system(1)	7		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CAGCTGCCCGGCGGCCCCCAC	0.682										TSP Lung(18;0.14)			11	12	---	---	---	---	PASS
CASC4	113201	broad.mit.edu	37	15	44705541	44705541	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44705541A>T	uc001ztp.2	+	10	1547	c.1248A>T	c.(1246-1248)GAA>GAT	p.E416D	CASC4_uc001ztq.2_Missense_Mutation_p.E360D	NM_138423	NP_612432	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment						integral to membrane				ovary(1)	1		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		CAGATGATGAAGAACGAGAGC	0.328													20	42	---	---	---	---	PASS
SLC28A2	9153	broad.mit.edu	37	15	45556903	45556903	+	Silent	SNP	G	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45556903G>C	uc001zva.2	+	7	704	c.639G>C	c.(637-639)GGG>GGC	p.G213G		NM_004212	NP_004203	O43868	S28A2_HUMAN	solute carrier family 28 (sodium-coupled	213	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding|nucleoside:sodium symporter activity|purine nucleoside transmembrane transporter activity			ovary(4)	4		all_cancers(109;8.53e-07)|all_epithelial(112;1.39e-05)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.77e-16)|GBM - Glioblastoma multiforme(94;2.71e-06)		TTGTCTTTGGGATCTTGGTCA	0.418													6	137	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50534531	50534531	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50534531C>A	uc001zxz.2	-	12	2021	c.1915G>T	c.(1915-1917)GTC>TTC	p.V639F	HDC_uc001zxy.2_Missense_Mutation_p.V382F|HDC_uc010uff.1_Missense_Mutation_p.V606F	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	639					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	AAGCTGGGGACGCTGTAGAAT	0.438													31	77	---	---	---	---	PASS
TLN2	83660	broad.mit.edu	37	15	63042694	63042694	+	Intron	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63042694A>T	uc002alb.3	+						TLN2_uc002alc.3_Intron	NM_015059	NP_055874	Q9Y4G6	TLN2_HUMAN	talin 2						cell adhesion|cell-cell junction assembly|cytoskeletal anchoring at plasma membrane	actin cytoskeleton|cytoplasm|focal adhesion|ruffle|synapse	actin binding|insulin receptor binding|structural constituent of cytoskeleton			ovary(5)|upper_aerodigestive_tract(2)|lung(2)|breast(2)	11						CTCCAAGGTAAGACTGCCTAT	0.478													25	53	---	---	---	---	PASS
ALDH1A3	220	broad.mit.edu	37	15	101436239	101436239	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101436239C>T	uc002bwn.3	+	7	872	c.768C>T	c.(766-768)ACC>ACT	p.T256T	ALDH1A3_uc010bpb.2_Silent_p.T149T|uc002bwo.1_RNA	NM_000693	NP_000684	P47895	AL1A3_HUMAN	aldehyde dehydrogenase 1A3	256					retinal metabolic process	cytoplasm	aldehyde dehydrogenase|protein homodimerization activity			central_nervous_system(2)|lung(1)|pancreas(1)	4	Lung NSC(78;0.00144)|all_lung(78;0.0018)|Melanoma(26;0.00852)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.0766)|Lung(145;0.103)		NADH(DB00157)|Vitamin A(DB00162)	TCGCCTTCACCGGCTCCACAG	0.537													4	18	---	---	---	---	PASS
RGS11	8786	broad.mit.edu	37	16	321280	321280	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:321280C>A	uc002cgj.1	-	12	787	c.784G>T	c.(784-786)GAT>TAT	p.D262Y	RGS11_uc002cgi.1_Missense_Mutation_p.D241Y|RGS11_uc010bqs.1_Missense_Mutation_p.D251Y|RGS11_uc002cgk.1_Missense_Mutation_p.D78Y	NM_183337	NP_899180	O94810	RGS11_HUMAN	regulator of G-protein signalling 11 isoform 1	262	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|signal transducer activity			lung(1)|pancreas(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ACGAGGGGATCGTGGGGTCCA	0.662													9	30	---	---	---	---	PASS
WDR90	197335	broad.mit.edu	37	16	716485	716485	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:716485C>G	uc002cii.1	+	38	4825	c.4771C>G	c.(4771-4773)CTA>GTA	p.L1591V	WDR90_uc002cij.1_Intron|WDR90_uc002cil.1_RNA|WDR90_uc002cin.1_Missense_Mutation_p.L206V|WDR90_uc010uul.1_Intron|WDR90_uc002cio.1_Missense_Mutation_p.L190V|WDR90_uc010bqx.1_Intron|RHOT2_uc010uum.1_5'Flank|RHOT2_uc002cip.2_5'Flank|RHOT2_uc002ciq.2_5'Flank	NM_145294	NP_660337	Q96KV7	WDR90_HUMAN	WD repeat domain 90	1591	WD 20.									ovary(1)	1		Hepatocellular(780;0.0218)				GGGCACAGACCTATGGCTGGC	0.632													8	56	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2159681	2159681	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2159681C>T	uc002cos.1	-	15	5696	c.5487G>A	c.(5485-5487)CTG>CTA	p.L1829L	PKD1_uc002cot.1_Silent_p.L1829L	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	1829	PKD 14.|Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						TGCCCGTGGCCAGCTGCCCCC	0.672													3	9	---	---	---	---	PASS
C16orf68	79091	broad.mit.edu	37	16	8729173	8729173	+	Intron	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:8729173A>G	uc002cyz.2	+						C16orf68_uc002cza.2_Intron	NM_024109	NP_077014	Q9BUU2	MET22_HUMAN	hypothetical protein LOC79091								methyltransferase activity				0						TGTACAGGTAATGAGGTGACA	0.537											OREG0023592	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	41	---	---	---	---	PASS
PDILT	204474	broad.mit.edu	37	16	20370813	20370813	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20370813T>A	uc002dhc.1	-	12	1806	c.1583A>T	c.(1582-1584)AAA>ATA	p.K528I		NM_174924	NP_777584	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis	528					cell differentiation|cell redox homeostasis|multicellular organismal development|spermatogenesis	endoplasmic reticulum	isomerase activity			large_intestine(1)	1						AGGTAACCCTTTCCTCATCAT	0.463													39	144	---	---	---	---	PASS
PRRT2	112476	broad.mit.edu	37	16	29824976	29824976	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29824976C>A	uc002due.3	+	2	902	c.601C>A	c.(601-603)CAC>AAC	p.H201N	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|uc002duc.1_5'Flank|PRRT2_uc002dud.2_Missense_Mutation_p.H201N|PRRT2_uc002duf.1_Missense_Mutation_p.H201N|C16orf53_uc002dug.3_5'Flank	NM_145239	NP_660282	Q7Z6L0	PRRT2_HUMAN	proline-rich transmembrane protein 2	201	Extracellular (Potential).|Pro-rich.				response to biotic stimulus	integral to membrane					0						CCCTGAGCCTCACTCACCACC	0.612													3	27	---	---	---	---	PASS
ZNF768	79724	broad.mit.edu	37	16	30536224	30536224	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30536224G>A	uc002dyk.3	-	2	1413	c.1237C>T	c.(1237-1239)CGG>TGG	p.R413W	ZNF768_uc010vex.1_Missense_Mutation_p.R382W|uc002dyl.1_5'Flank|ZNF768_uc010vew.1_Missense_Mutation_p.R382W	NM_024671	NP_078947	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	413	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	DNA-directed RNA polymerase II, core complex	DNA binding|zinc ion binding				0						AGGGCCGACCGCTGGGAGAAG	0.647													15	36	---	---	---	---	PASS
ITGAM	3684	broad.mit.edu	37	16	31287020	31287020	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31287020G>T	uc002ebq.2	+	9	1107	c.1009G>T	c.(1009-1011)GGT>TGT	p.G337C	ITGAM_uc002ebr.2_Missense_Mutation_p.G337C|ITGAM_uc010cam.1_5'UTR	NM_000632	NP_000623	P11215	ITAM_HUMAN	integrin alpha M isoform 2 precursor	337	Extracellular (Potential).				blood coagulation|cell adhesion|integrin-mediated signaling pathway|leukocyte migration	integrin complex	glycoprotein binding|receptor activity			kidney(1)	1						TGCGATCGAGGGTGAGTCAGG	0.547													16	28	---	---	---	---	PASS
PHKB	5257	broad.mit.edu	37	16	47695708	47695708	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:47695708G>T	uc002eev.3	+	23	2327	c.2275G>T	c.(2275-2277)GAA>TAA	p.E759*	PHKB_uc002eeu.3_Nonsense_Mutation_p.E752*	NM_000293	NP_000284	Q93100	KPBB_HUMAN	phosphorylase kinase, beta isoform a	759					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity			ovary(1)|large_intestine(1)|breast(1)	3		all_cancers(37;0.00447)|all_lung(18;0.00616)|Lung NSC(13;0.0418)|Breast(268;0.203)				CATCACAAAGGAAGGTAAGCA	0.408													30	46	---	---	---	---	PASS
CYLD	1540	broad.mit.edu	37	16	50816277	50816277	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50816277C>T	uc002egp.1	+	11	2141	c.1726C>T	c.(1726-1728)CCA>TCA	p.P576S	CYLD_uc002ego.2_Missense_Mutation_p.P573S|CYLD_uc010cbs.1_Missense_Mutation_p.P573S|CYLD_uc002egq.1_Missense_Mutation_p.P573S|CYLD_uc002egr.1_Missense_Mutation_p.P573S|CYLD_uc002egs.1_Missense_Mutation_p.P573S	NM_015247	NP_056062	Q9NQC7	CYLD_HUMAN	ubiquitin carboxyl-terminal hydrolase CYLD	576	Interaction with TRIP.				cell cycle|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|protein K63-linked deubiquitination|regulation of microtubule cytoskeleton organization|regulation of mitotic cell cycle|translation|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway	cytosol|extrinsic to internal side of plasma membrane|microtubule|perinuclear region of cytoplasm|ribosome	proline-rich region binding|protein kinase binding|structural constituent of ribosome|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			skin(19)|large_intestine(3)|haematopoietic_and_lymphoid_tissue(3)|central_nervous_system(3)	28		all_cancers(37;0.0156)				AGAAAATACTCCACCAAAAAT	0.308			Mis|N|F|S		cylindroma	cylindroma			Familial_Cylindromatosis|Multiple_Trichoepithelioma_Familial				8	31	---	---	---	---	PASS
AMFR	267	broad.mit.edu	37	16	56396318	56396318	+	3'UTR	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56396318T>A	uc002eiy.2	-	14					AMFR_uc002eiw.2_RNA|AMFR_uc002eix.2_3'UTR	NM_001144	NP_001135	Q9UKV5	AMFR2_HUMAN	autocrine motility factor receptor						endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|protein oligomerization|protein polyubiquitination	integral to endoplasmic reticulum membrane|integral to membrane of membrane fraction	protein binding|protein binding|receptor activity|ubiquitin-protein ligase activity|zinc ion binding			breast(2)	2						CAGGGGTGCATGAGCCCGTGG	0.562													29	119	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66434918	66434918	+	Silent	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66434918A>T	uc002eom.3	+	11	1992	c.1836A>T	c.(1834-1836)ACA>ACT	p.T612T		NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein	612	Helical; (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		TCACCATCACAGGTCAGTGCT	0.607													18	29	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70935069	70935069	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70935069C>A	uc002ezr.2	-	53	9011	c.8883G>T	c.(8881-8883)ACG>ACT	p.T2961T		NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	2962										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				CAGGCAGGAGCGTGACATTGC	0.488													7	46	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76501305	76501305	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76501305G>T	uc002feu.1	+	12	1925	c.1540G>T	c.(1540-1542)GGA>TGA	p.G514*	CNTNAP4_uc002fev.1_Nonsense_Mutation_p.G378*|CNTNAP4_uc010chb.1_Nonsense_Mutation_p.G441*|CNTNAP4_uc002fex.1_Nonsense_Mutation_p.G517*|CNTNAP4_uc002few.2_Nonsense_Mutation_p.G489*	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	514	Extracellular (Potential).|Laminin G-like 2.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TGGATTTCAGGGATGTATGAG	0.428													30	40	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76532454	76532454	+	Intron	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76532454T>A	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TTGTTGCTATTGTTTTTTAGG	0.358													7	51	---	---	---	---	PASS
ACSF3	197322	broad.mit.edu	37	16	89169054	89169054	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89169054G>A	uc002fmp.2	+	4	1049	c.709G>A	c.(709-711)GTG>ATG	p.V237M	ACSF3_uc010cig.1_Missense_Mutation_p.V237M|ACSF3_uc010cih.1_Translation_Start_Site|ACSF3_uc002fmq.1_RNA|ACSF3_uc010cii.1_RNA|ACSF3_uc002fmr.1_Translation_Start_Site	NM_174917	NP_777577	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3 precursor	237					fatty acid metabolic process	mitochondrion	acid-thiol ligase activity|ATP binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0281)		CAAAGACGACGTGATCCTCCA	0.617													4	55	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577130	7577130	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577130A>T	uc002gim.2	-	8	1002	c.808T>A	c.(808-810)TTT>ATT	p.F270I	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.F270I|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.F138I|TP53_uc010cng.1_Missense_Mutation_p.F138I|TP53_uc002gii.1_Missense_Mutation_p.F138I|TP53_uc010cnh.1_Missense_Mutation_p.F270I|TP53_uc010cni.1_Missense_Mutation_p.F270I|TP53_uc002gij.2_Missense_Mutation_p.F270I	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	270	|Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		F -> L (in sporadic cancers; somatic mutation).|F -> Y (in sporadic cancers; somatic mutation).|F -> C (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> I (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.F270L(22)|p.F270C(15)|p.F270V(8)|p.0?(7)|p.F270S(7)|p.F270Y(5)|p.F270I(3)|p.?(2)|p.G266_E271delGRNSFE(2)|p.G262_F270delGNLLGRNSF(2)|p.F270fs*72(1)|p.S269fs*75(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.S269fs*34(1)|p.F270_D281del12(1)|p.S269_F270insX(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CGCACCTCAAAGCTGTTCCGT	0.537		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			15	13	---	---	---	---	PASS
PIK3R5	23533	broad.mit.edu	37	17	8784089	8784089	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8784089G>A	uc002glt.2	-	19	2577	c.2510C>T	c.(2509-2511)CCG>CTG	p.P837L	PIK3R5_uc010vuz.1_Missense_Mutation_p.P837L|PIK3R5_uc002glu.3_Missense_Mutation_p.P451L	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5	837					platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						CTTGTAGCACGGTGAGACCTC	0.642													5	28	---	---	---	---	PASS
CYTSB	92521	broad.mit.edu	37	17	20217384	20217384	+	3'UTR	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20217384G>T	uc002gwq.2	+	15					CYTSB_uc002gws.2_3'UTR|CYTSB_uc002gwv.2_3'UTR|CYTSB_uc010vzf.1_3'UTR|CYTSB_uc002gww.2_3'UTR	NM_001033553	NP_001028725	Q5M775	CYTSB_HUMAN	spectrin domain with coiled-coils 1 NSP5b3b							nucleus					0						CGTAACCCTGGAGGGCCTGGG	0.582													12	43	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26966931	26966931	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26966931G>T	uc002hbu.2	-	9	1102	c.1003C>A	c.(1003-1005)CTG>ATG	p.L335M	KIAA0100_uc002hbv.2_Missense_Mutation_p.L335M|KIAA0100_uc010crr.1_Missense_Mutation_p.L192M	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	335						extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					TCCAGCAGCAGTTCAGTGCTC	0.512													83	174	---	---	---	---	PASS
RHOT1	55288	broad.mit.edu	37	17	30521103	30521103	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30521103G>A	uc002hgz.2	+	11	1085	c.846G>A	c.(844-846)TTG>TTA	p.L282L	RHOT1_uc002hgw.2_Silent_p.L282L|RHOT1_uc002hgy.2_Silent_p.L282L|RHOT1_uc002hha.2_Silent_p.L155L|RHOT1_uc010csv.2_RNA|RHOT1_uc002hgx.2_Silent_p.L155L|RHOT1_uc010wby.1_Silent_p.L282L|RHOT1_uc002hhb.2_Silent_p.L261L|RHOT1_uc002hgv.2_Silent_p.L282L	NM_018307	NP_060777	Q8IXI2	MIRO1_HUMAN	ras homolog gene family, member T1 isoform 3	282	Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			ovary(3)|central_nervous_system(1)	4		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				ACCTGGATTTGACACCTGAAT	0.308													174	427	---	---	---	---	PASS
KRTAP1-1	81851	broad.mit.edu	37	17	39197393	39197393	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39197393T>C	uc002hvw.1	-	1	321	c.257A>G	c.(256-258)TAC>TGC	p.Y86C		NM_030967	NP_112229	Q07627	KRA11_HUMAN	keratin associated protein 1-1	86			Missing (in allele KAP1.7).			extracellular region|keratin filament					0		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			GCTGGTCTGGTAGCAGCTTGG	0.587													4	105	---	---	---	---	PASS
WNT9B	7484	broad.mit.edu	37	17	44950021	44950021	+	Silent	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44950021C>T	uc002ikw.1	+	2	253	c.216C>T	c.(214-216)CCC>CCT	p.P72P	WNT9B_uc002ikx.1_Silent_p.P72P	NM_003396	NP_003387	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family,	72					anterior/posterior pattern formation|axis specification|branching involved in ureteric bud morphogenesis|canonical Wnt receptor signaling pathway|cell-cell signaling|cellular response to retinoic acid|collecting duct development|cornea development in camera-type eye|endoderm development|establishment of planar polarity involved in nephron morphogenesis|kidney rudiment formation|male genitalia development|mesonephric duct formation|metanephric tubule development|neuron differentiation|palate development|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|uterus morphogenesis|Wnt receptor signaling pathway, calcium modulating pathway|Wnt receptor signaling pathway, planar cell polarity pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|G-protein-coupled receptor binding			lung(2)	2			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GGAGGGAGCCCGGCCTGGCTG	0.682													25	35	---	---	---	---	PASS
SP2	6668	broad.mit.edu	37	17	46000649	46000649	+	Intron	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46000649G>A	uc002imk.2	+						SP2_uc002iml.2_Intron	NM_003110	NP_003101	Q02086	SP2_HUMAN	Sp2 transcription factor						immune response|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|histone deacetylase binding|zinc ion binding				0						CGGTGAGGATGGCCCCTGTGG	0.597													6	11	---	---	---	---	PASS
CDK5RAP3	80279	broad.mit.edu	37	17	46058079	46058079	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46058079A>T	uc002imr.2	+	12	1282	c.1198A>T	c.(1198-1200)ACC>TCC	p.T400S	CDK5RAP3_uc010wlc.1_Missense_Mutation_p.T420S|CDK5RAP3_uc002imq.1_Missense_Mutation_p.T175S|CDK5RAP3_uc002imu.2_Missense_Mutation_p.T244S|CDK5RAP3_uc002ims.2_Missense_Mutation_p.T313S|CDK5RAP3_uc002imv.2_Missense_Mutation_p.T244S|CDK5RAP3_uc002imw.2_Missense_Mutation_p.T242S|CDK5RAP3_uc002imx.2_Missense_Mutation_p.T175S	NM_176096	NP_788276	Q96JB5	CK5P3_HUMAN	CDK5 regulatory subunit associated protein 3	400					brain development|regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation		neuronal Cdc2-like kinase binding				0						GAAGATGGTTACCATGGTGTC	0.547													57	101	---	---	---	---	PASS
YPEL2	388403	broad.mit.edu	37	17	57474474	57474474	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57474474G>T	uc002ixm.1	+	5	611	c.283G>T	c.(283-285)GAA>TAA	p.E95*		NM_001005404	NP_001005404	Q96QA6	YPEL2_HUMAN	yippee-like 2	95						nucleolus					0	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					ACATGCTTTTGAAAGCAGCCA	0.343													16	38	---	---	---	---	PASS
PDE6G	5148	broad.mit.edu	37	17	79623529	79623529	+	5'UTR	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79623529C>T	uc002kay.3	-	1					PDE6G_uc002kaz.3_RNA	NM_002602	NP_002593	P18545	CNRG_HUMAN	phosphodiesterase 6G						platelet activation|visual perception	cytosol	3',5'-cyclic-GMP phosphodiesterase activity|cGMP binding|enzyme inhibitor activity				0	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TCACCAAGTGCAGGGCGGGTC	0.642													8	18	---	---	---	---	PASS
L3MBTL4	91133	broad.mit.edu	37	18	6237958	6237958	+	Intron	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6237958C>A	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				AGGCAGTCCACTCACCTTGGG	0.413													88	78	---	---	---	---	PASS
FAM38B	63895	broad.mit.edu	37	18	10675263	10675263	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:10675263A>C	uc002kor.3	-	12	1776	c.1636T>G	c.(1636-1638)TAT>GAT	p.Y546D	FAM38B_uc002koq.2_Missense_Mutation_p.Y381D	NM_022068	NP_071351	Q9H5I5	PIEZ2_HUMAN	family with sequence similarity 38, member B	2589						integral to membrane	ion channel activity			ovary(1)	1						TTCACATAATATGGATAAATC	0.274													57	67	---	---	---	---	PASS
DSG3	1830	broad.mit.edu	37	18	29055928	29055928	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:29055928C>T	uc002kws.2	+	16	2814	c.2705C>T	c.(2704-2706)TCA>TTA	p.S902L	DSG3_uc002kwt.2_Missense_Mutation_p.S184L	NM_001944	NP_001935	P32926	DSG3_HUMAN	desmoglein 3 preproprotein	902	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|homophilic cell adhesion	cytosol|desmosome|integral to membrane	calcium ion binding			skin(4)|ovary(3)|lung(1)|central_nervous_system(1)	9			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			CAGACTTTGTCAGGAAGTCAA	0.502													88	89	---	---	---	---	PASS
TCEB3C	162699	broad.mit.edu	37	18	44555161	44555161	+	Silent	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:44555161G>T	uc010xdb.1	-	1	1289	c.1053C>A	c.(1051-1053)GCC>GCA	p.A351A	KATNAL2_uc010dnq.1_Intron|KATNAL2_uc002lco.2_Intron|KATNAL2_uc002lcp.3_Intron	NM_145653	NP_663628	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide	351	Activation domain (By similarity).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane|nucleus	DNA binding				0						CGTCGCCGAGGGCGTCCGGAT	0.647													33	384	---	---	---	---	PASS
ST8SIA3	51046	broad.mit.edu	37	18	55027478	55027478	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55027478C>G	uc002lgn.2	+	4	1470	c.1113C>G	c.(1111-1113)CTC>CTG	p.L371L		NM_015879	NP_056963	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide	371	Lumenal (Potential).				glycosphingolipid biosynthetic process|N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			breast(1)|skin(1)	2				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GGGAAGGGCTCACCAAGCTGA	0.478													20	11	---	---	---	---	PASS
CDH7	1005	broad.mit.edu	37	18	63492067	63492067	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63492067G>T	uc002ljz.2	+	6	1306	c.981G>T	c.(979-981)AAG>AAT	p.K327N	CDH7_uc002lka.2_Missense_Mutation_p.K327N|CDH7_uc002lkb.2_Missense_Mutation_p.K327N	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein	327	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				CTATACAGAAGGTAATGTTTT	0.368													5	49	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74563747	74563747	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74563747A>T	uc002lmi.2	+	3	407	c.209A>T	c.(208-210)CAG>CTG	p.Q70L	ZNF236_uc002lmj.2_RNA|ZNF236_uc002lmk.1_Missense_Mutation_p.Q70L	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236	70	C2H2-type 2.				cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		CGATGTGACCAGTGCCCCCAA	0.398													29	13	---	---	---	---	PASS
MAP2K2	5605	broad.mit.edu	37	19	4099222	4099222	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4099222C>A	uc002lzk.2	-	7	1150	c.896G>T	c.(895-897)AGG>ATG	p.R299M	MAP2K2_uc002lzj.2_Missense_Mutation_p.R109M	NM_030662	NP_109587	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	299	Protein kinase.|Pro-rich.				activation of MAPK activity|activation of MAPKK activity|axon guidance|epidermal growth factor receptor signaling pathway|ERK1 and ERK2 cascade|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|extracellular region	ATP binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGGGGGGCCTCGGCCGAGG	0.711									Cardiofaciocutaneous_syndrome				4	14	---	---	---	---	PASS
FUT5	2527	broad.mit.edu	37	19	5867384	5867384	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5867384G>T	uc002mdo.3	-	2	441	c.353C>A	c.(352-354)GCG>GAG	p.A118E	FUT5_uc010duo.2_Missense_Mutation_p.A118E	NM_002034	NP_002025	Q11128	FUT5_HUMAN	fucosyltransferase 5	118	Lumenal (Potential).				L-fucose catabolic process|protein glycosylation	Golgi cisterna membrane|integral to membrane	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity|alpha(1,3)-fucosyltransferase activity				0						CACGATGACCGCGTCTGCCTG	0.642													21	49	---	---	---	---	PASS
OR7G2	390882	broad.mit.edu	37	19	9213062	9213062	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9213062G>T	uc010xkk.1	-	1	921	c.921C>A	c.(919-921)AAC>AAA	p.N307K		NM_001005193	NP_001005193	Q8NG99	OR7G2_HUMAN	olfactory receptor, family 7, subfamily G,	286	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						AGATAAAGGGGTTCACCATTT	0.458													35	63	---	---	---	---	PASS
ZNF440	126070	broad.mit.edu	37	19	11943166	11943166	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11943166G>T	uc002msp.1	+	4	1331	c.1175G>T	c.(1174-1176)GGA>GTA	p.G392V		NM_152357	NP_689570	Q8IYI8	ZN440_HUMAN	zinc finger protein 440	392					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						ACTCACACTGGAGAGAAACCC	0.453													26	61	---	---	---	---	PASS
JUNB	3726	broad.mit.edu	37	19	12903533	12903533	+	Silent	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12903533C>G	uc002mvc.2	+	1	1224	c.948C>G	c.(946-948)CTC>CTG	p.L316L	JUNB_uc002mvb.2_RNA	NM_002229	NP_002220	P17275	JUNB_HUMAN	jun B proto-oncogene	316	Leucine-zipper.					chromatin|nucleus	protein dimerization activity|transcription coactivator activity|transcription corepressor activity			lung(2)|central_nervous_system(1)	3						CCGCCGGCCTCCTCCGGGAGC	0.647													6	8	---	---	---	---	PASS
FAM129C	199786	broad.mit.edu	37	19	17651385	17651385	+	Silent	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17651385C>A	uc010xpr.1	+	10	1395	c.1257C>A	c.(1255-1257)CGC>CGA	p.R419R	FAM129C_uc010xpq.1_Silent_p.R419R|FAM129C_uc002ngy.3_Silent_p.R145R|FAM129C_uc010xpu.1_Silent_p.R145R|FAM129C_uc002ngz.3_RNA|FAM129C_uc010eaw.2_Silent_p.R145R|FAM129C_uc002nhb.2_Silent_p.R18R	NM_173544	NP_775815	Q86XR2	NIBL2_HUMAN	B-cell novel protein 1 isoform a	419											0						CGCGGCTGCGCAGGGAGGTGA	0.622													3	10	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22155386	22155386	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22155386A>G	uc002nqp.2	-	5	2299	c.2150T>C	c.(2149-2151)GTC>GCC	p.V717A	ZNF208_uc002nqo.1_Intron	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				AAGGGTTGAGACCTTACTAAA	0.358													25	41	---	---	---	---	PASS
ZNF257	113835	broad.mit.edu	37	19	22256279	22256279	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22256279G>T	uc010ecx.2	+	3	308	c.139G>T	c.(139-141)GTC>TTC	p.V47F	ZNF257_uc010ecy.2_Missense_Mutation_p.V15F	NM_033468	NP_258429	Q9Y2Q1	ZN257_HUMAN	zinc finger protein 257	47	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGGTATTGCTGTCTCTAAGCC	0.393													45	112	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	31039660	31039660	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31039660C>T	uc002nsu.1	+	4	3272	c.3134C>T	c.(3133-3135)GCC>GTC	p.A1045V	ZNF536_uc010edd.1_Missense_Mutation_p.A1045V	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	1045					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					AAAGACCAAGCCCGGGAGGCG	0.537													17	62	---	---	---	---	PASS
GAPDHS	26330	broad.mit.edu	37	19	36024423	36024423	+	5'UTR	SNP	A	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36024423A>C	uc002oaf.1	+	1						NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,						gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)	TAACCTTATAAGAGGCCATGT	0.622													28	59	---	---	---	---	PASS
GAPDHS	26330	broad.mit.edu	37	19	36035845	36035845	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36035845C>A	uc002oaf.1	+	10	1207	c.1091C>A	c.(1090-1092)TCG>TAG	p.S364*	uc010eec.1_RNA|uc002oag.2_Intron|TMEM147_uc002oai.1_5'Flank|TMEM147_uc002oaj.1_5'Flank|TMEM147_uc002oak.1_5'Flank	NM_014364	NP_055179	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase,	364					gluconeogenesis|glycolysis|positive regulation of glycolysis|sperm motility	cytosol	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity|NAD binding|protein binding				0	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)		NADH(DB00157)	GATACCCACTCGTCCATCTTC	0.537													60	95	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37975140	37975140	+	Missense_Mutation	SNP	A	T	T	rs139260465	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37975140A>T	uc002ogk.1	+	5	1145	c.616A>T	c.(616-618)ATT>TTT	p.I206F	ZNF570_uc010efl.1_Missense_Mutation_p.I262F|ZNF570_uc010xtr.1_Missense_Mutation_p.I3F	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570	206					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTAATGGCTATTAAGCCCAA	0.358													76	174	---	---	---	---	PASS
TGFB1	7040	broad.mit.edu	37	19	41858693	41858693	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41858693T>C	uc002oqh.1	-	1	1124	c.257A>G	c.(256-258)GAC>GGC	p.D86G	CYP2F1_uc010xvw.1_Intron|TMEM91_uc002oqi.2_Intron	NM_000660	NP_000651	P01137	TGFB1_HUMAN	transforming growth factor, beta 1 precursor	86					active induction of host immune response by virus|ATP biosynthetic process|cell cycle arrest|cell growth|cell-cell junction organization|chondrocyte differentiation|connective tissue replacement involved in inflammatory response wound healing|epidermal growth factor receptor signaling pathway|evasion of host defenses by virus|hemopoietic progenitor cell differentiation|induction of apoptosis|lymph node development|mitotic cell cycle G1/S transition checkpoint|negative regulation of blood vessel endothelial cell migration|negative regulation of cell growth|negative regulation of cell-cell adhesion|negative regulation of DNA replication|negative regulation of epithelial cell proliferation|negative regulation of fat cell differentiation|negative regulation of macrophage cytokine production|negative regulation of mitotic cell cycle|negative regulation of protein phosphorylation|ossification involved in bone remodeling|pathway-restricted SMAD protein phosphorylation|platelet activation|platelet degranulation|positive regulation of blood vessel endothelial cell migration|positive regulation of bone mineralization|positive regulation of cell division|positive regulation of chemotaxis|positive regulation of collagen biosynthetic process|positive regulation of epithelial to mesenchymal transition|positive regulation of fibroblast migration|positive regulation of interleukin-17 production|positive regulation of isotype switching to IgA isotypes|positive regulation of MAP kinase activity|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of peptidyl-serine phosphorylation|positive regulation of peptidyl-threonine phosphorylation|positive regulation of phosphatidylinositol 3-kinase activity|positive regulation of protein dephosphorylation|positive regulation of protein kinase B signaling cascade|positive regulation of protein secretion|positive regulation of SMAD protein import into nucleus|protein export from nucleus|protein import into nucleus, translocation|receptor catabolic process|regulation of DNA binding|regulation of striated muscle tissue development|regulation of transforming growth factor beta receptor signaling pathway|response to cholesterol|response to estradiol stimulus|response to progesterone stimulus|salivary gland morphogenesis|SMAD protein complex assembly|SMAD protein import into nucleus|transforming growth factor beta receptor signaling pathway|viral infectious cycle	extracellular space|Golgi lumen|nucleus|platelet alpha granule lumen|proteinaceous extracellular matrix	growth factor activity|type II transforming growth factor beta receptor binding				0					Hyaluronidase(DB00070)	GGCCACCCGGTCGCGGGTGCT	0.706													9	16	---	---	---	---	PASS
ZNF526	116115	broad.mit.edu	37	19	42729069	42729069	+	Missense_Mutation	SNP	C	T	T	rs143231579		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42729069C>T	uc002osz.1	+	3	670	c.514C>T	c.(514-516)CCA>TCA	p.P172S		NM_133444	NP_597701	Q8TF50	ZN526_HUMAN	zinc finger protein 526	172					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Prostate(69;0.0704)				AGCTGAGCCACCAGTGCCACC	0.607													44	73	---	---	---	---	PASS
C19orf61	56006	broad.mit.edu	37	19	44254859	44254859	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44254859T>C	uc002oxj.2	-	2	378	c.35A>G	c.(34-36)TAT>TGT	p.Y12C	C19orf61_uc002oxk.2_Missense_Mutation_p.Y12C|C19orf61_uc010eiy.1_Missense_Mutation_p.Y12C	NM_019108	NP_061981	Q9H0W8	SMG9_HUMAN	SMG9 protein	12					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	intracellular	protein binding				0		Prostate(69;0.0352)				CTCTATCCCATAGAGTCCAGG	0.567													43	103	---	---	---	---	PASS
PPP1R13L	10848	broad.mit.edu	37	19	45889145	45889145	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45889145T>A	uc002pbn.2	-	10	2095	c.2018A>T	c.(2017-2019)TAC>TTC	p.Y673F	PPP1R13L_uc002pbm.2_Missense_Mutation_p.Y252F|PPP1R13L_uc002pbo.2_Missense_Mutation_p.Y673F	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13	673	ANK 1.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		CACGATAGAGTAGTTGGCGCC	0.657													8	17	---	---	---	---	PASS
PRR12	57479	broad.mit.edu	37	19	50103085	50103085	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50103085G>T	uc002poo.3	+	5	4235	c.4235G>T	c.(4234-4236)GGG>GTG	p.G1412V		NM_020719	NP_065770	Q9ULL5	PRR12_HUMAN	proline rich 12	591	Pro-rich.						DNA binding			central_nervous_system(1)|pancreas(1)	2		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		CCCCTTGCTGGGCCAAAAGAC	0.642													44	89	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52723050	52723050	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52723050C>A	uc002pyp.2	+	10	1394	c.1235C>A	c.(1234-1236)GCT>GAT	p.A412D	PPP2R1A_uc010ydk.1_Missense_Mutation_p.A357D|PPP2R1A_uc002pyq.2_Missense_Mutation_p.A233D	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	412	HEAT 11.|PP2A subunit C binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GTGGAGCTGGCTGAGGACGCC	0.622			Mis		clear cell ovarian carcinoma								7	71	---	---	---	---	PASS
KIR3DL2	3812	broad.mit.edu	37	19	55363737	55363737	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55363737G>T	uc002qho.3	+	3	388	c.355G>T	c.(355-357)GGA>TGA	p.G119*	KIR3DL1_uc002qhl.3_Intron|KIR2DS4_uc002qhn.1_Intron|KIR3DL2_uc010esh.2_Nonsense_Mutation_p.G119*	NM_006737	NP_006728	P43630	KI3L2_HUMAN	killer cell immunoglobulin-like receptor, three	119	Extracellular (Potential).				cellular defense response|regulation of immune response	integral to plasma membrane	receptor activity			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(193;0.0192)		CATGGTCACAGGTCAGAGGCT	0.617													24	63	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56410158	56410158	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56410158G>A	uc010ygg.1	-	10	2960	c.2935C>T	c.(2935-2937)CAT>TAT	p.H979Y		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	979							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AATGCACGATGTGGTTTCAGA	0.468													14	106	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640074	57640074	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640074C>T	uc002qny.2	+	4	387	c.31C>T	c.(31-33)CAA>TAA	p.Q11*		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	11					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TGGATTCATCCAAATTTGGAG	0.343													15	34	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640084	57640084	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640084G>A	uc002qny.2	+	4	397	c.41G>A	c.(40-42)AGC>AAC	p.S14N		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	14					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		CAAATTTGGAGCCAGAAGACT	0.343													15	35	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58965615	58965615	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58965615C>T	uc002qsv.1	+	3	249	c.142C>T	c.(142-144)CGT>TGT	p.R48C	ZNF324B_uc002qsu.1_5'UTR|ZNF324B_uc010euq.1_Missense_Mutation_p.R48C	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	48	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		CTCCCGACCTCGTGTGGTCAT	0.602													4	57	---	---	---	---	PASS
PLK1S1	55857	broad.mit.edu	37	20	21224905	21224905	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21224905G>T	uc002wsb.2	+	13	2036	c.1903G>T	c.(1903-1905)GTG>TTG	p.V635L	PLK1S1_uc010zsh.1_Missense_Mutation_p.V532L|PLK1S1_uc010zsi.1_Missense_Mutation_p.V502L|PLK1S1_uc010zsj.1_RNA|PLK1S1_uc002wsd.2_RNA	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1	635					spindle organization	centrosome	protein kinase binding				0						AAAGAAACCCGTGATCAATTT	0.308													20	61	---	---	---	---	PASS
MIR1825	100302183	broad.mit.edu	37	20	30825602	30825602	+	RNA	SNP	A	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30825602A>C	hsa-mir-1825|MI0008193	+			c.5A>C			POFUT1_uc002wxp.2_3'UTR|POFUT1_uc010ztt.1_3'UTR|POFUT1_uc010ztu.1_3'UTR																	0						caggcgagagactggggtgct	0.000													12	36	---	---	---	---	PASS
RBM12	10137	broad.mit.edu	37	20	34242587	34242587	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34242587C>A	uc002xdq.2	-	3	890	c.658G>T	c.(658-660)GTG>TTG	p.V220L	CPNE1_uc010zvj.1_5'Flank|CPNE1_uc002xde.2_Intron|CPNE1_uc002xdf.2_Intron|CPNE1_uc002xdg.2_Intron|CPNE1_uc010gfi.2_Intron|CPNE1_uc010gfj.2_Intron|CPNE1_uc002xdh.2_Intron|CPNE1_uc002xdi.2_Intron|CPNE1_uc002xdj.2_Intron|CPNE1_uc002xdk.2_Intron|CPNE1_uc002xdl.2_Intron|CPNE1_uc002xdm.2_Intron|CPNE1_uc010gfk.1_Intron|CPNE1_uc002xdn.1_Intron|CPNE1_uc002xdo.1_Intron|CPNE1_uc002xdp.1_Intron|RBM12_uc002xdr.2_Missense_Mutation_p.V220L|RBM12_uc002xds.2_Missense_Mutation_p.V220L	NM_152838	NP_690051	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	220	Pro-rich.					nucleus	nucleotide binding|protein binding|RNA binding			ovary(3)	3	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			ACAGGAGGCACAGGAGGCAAT	0.607													28	68	---	---	---	---	PASS
C20orf152	140894	broad.mit.edu	37	20	34575396	34575396	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34575396T>A	uc002xes.1	+	7	952	c.796T>A	c.(796-798)TAT>AAT	p.Y266N	C20orf152_uc002xer.1_Missense_Mutation_p.Y266N|C20orf152_uc010gfp.1_Intron			Q96M20	CT152_HUMAN	SubName: Full=C20orf152 protein;	266											0	Breast(12;0.00631)					GAGGTTCTCGTATGGGCAGCT	0.498													26	44	---	---	---	---	PASS
RALGAPB	57148	broad.mit.edu	37	20	37145013	37145013	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37145013G>A	uc002xiw.2	+	7	1308	c.1051G>A	c.(1051-1053)GGT>AGT	p.G351S	RALGAPB_uc010zvz.1_Missense_Mutation_p.G351S|RALGAPB_uc002xix.2_Missense_Mutation_p.G351S|RALGAPB_uc002xiy.1_Missense_Mutation_p.G351S|RALGAPB_uc002xiz.2_Missense_Mutation_p.G129S|RALGAPB_uc002xja.1_Missense_Mutation_p.G78S	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit	351					activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TGCATTCTTAGGTGAATTTTG	0.398													65	124	---	---	---	---	PASS
PABPC1L	80336	broad.mit.edu	37	20	43547656	43547656	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43547656C>G	uc010ggv.1	+	4	695	c.613C>G	c.(613-615)CAA>GAA	p.Q205E	PABPC1L_uc010zwq.1_RNA	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	205	RRM 3.						nucleotide binding|RNA binding			ovary(1)	1						TGTGGACGAGCAAGGCCTGCA	0.612													51	120	---	---	---	---	PASS
CBLN4	140689	broad.mit.edu	37	20	54573762	54573762	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54573762C>T	uc002xxa.2	-	3	1242	c.457G>A	c.(457-459)GAC>AAC	p.D153N		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	153	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)			ACATCTTTGTCCCCCGCAAAG	0.363													16	40	---	---	---	---	PASS
CBLN4	140689	broad.mit.edu	37	20	54573764	54573764	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54573764C>T	uc002xxa.2	-	3	1240	c.455G>A	c.(454-456)GGG>GAG	p.G152E		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	152	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)			ATCTTTGTCCCCCGCAAAGGC	0.358													16	41	---	---	---	---	PASS
COL20A1	57642	broad.mit.edu	37	20	61948004	61948004	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61948004T>C	uc011aau.1	+	21	2724	c.2624T>C	c.(2623-2625)TTC>TCC	p.F875S	COL20A1_uc011aav.1_Missense_Mutation_p.F696S	NM_020882	NP_065933	Q9P218	COKA1_HUMAN	collagen, type XX, alpha 1	875	TSP N-terminal.				cell adhesion	collagen|extracellular space	structural molecule activity			central_nervous_system(1)	1	all_cancers(38;1.39e-10)					ACCCCGACCTTCACGCTCTTC	0.637													3	9	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33371496	33371496	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33371496A>G	uc002yph.2	+	11	2504	c.2144A>G	c.(2143-2145)TAA>TGA	p.*715*		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	715					multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						ACCCAGTGCTAACTTGGGCCA	0.602													30	40	---	---	---	---	PASS
GAB4	128954	broad.mit.edu	37	22	17472932	17472932	+	Silent	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17472932A>G	uc002zlw.2	-	2	417	c.309T>C	c.(307-309)GAT>GAC	p.D103D	GAB4_uc010gqs.1_Silent_p.D103D	NM_001037814	NP_001032903	Q2WGN9	GAB4_HUMAN	GRB2-associated binding protein family, member	103	PH.									large_intestine(1)|ovary(1)	2		all_epithelial(15;0.112)|Lung NSC(13;0.248)				TCACATCAACATCCAGCTGCT	0.488													21	338	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41723376	41723376	+	Intron	SNP	T	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41723376T>C	uc003azw.2	+						ZC3H7B_uc003azv.1_Intron|ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B						interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						CACGTGAGTGTGGCTCTGCAG	0.647													14	93	---	---	---	---	PASS
TCF20	6942	broad.mit.edu	37	22	42575682	42575682	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42575682G>A	uc003bcj.1	-	2	5816	c.5682C>T	c.(5680-5682)GGC>GGT	p.G1894G	TCF20_uc003bck.1_Silent_p.G1894G|TCF20_uc003bnt.2_Silent_p.G1894G	NM_005650	NP_005641	Q9UGU0	TCF20_HUMAN	transcription factor 20 isoform 1	1894	PHD-type; atypical.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(4)|skin(1)	5						CCAAGGTGGCGCCTGCCTCCT	0.562													17	158	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	44127589	44127589	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:44127589C>T	uc003bdy.1	-	8	962	c.747G>A	c.(745-747)ATG>ATA	p.M249I	EFCAB6_uc003bdz.1_Missense_Mutation_p.M97I|EFCAB6_uc010gzi.1_Missense_Mutation_p.M97I|EFCAB6_uc010gzk.1_RNA|EFCAB6_uc011aqa.1_Missense_Mutation_p.M143I|EFCAB6_uc003bea.1_Missense_Mutation_p.M246I|EFCAB6_uc003beb.3_Missense_Mutation_p.M143I	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	249					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				CTTGATTTCCCATACAATATC	0.219													14	32	---	---	---	---	PASS
DMD	1756	broad.mit.edu	37	X	32404524	32404524	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:32404524C>T	uc004dda.1	-	33	4821	c.4577G>A	c.(4576-4578)GGA>GAA	p.G1526E	DMD_uc004dcw.2_Missense_Mutation_p.G182E|DMD_uc004dcx.2_Missense_Mutation_p.G185E|DMD_uc004dcz.2_Missense_Mutation_p.G1403E|DMD_uc004dcy.1_Missense_Mutation_p.G1522E|DMD_uc004ddb.1_Missense_Mutation_p.G1518E|DMD_uc010ngo.1_Intron	NM_004006	NP_003997	P11532	DMD_HUMAN	dystrophin Dp427m isoform	1526	Spectrin 10.|Interaction with SYNM (By similarity).				muscle filament sliding|peptide biosynthetic process	cell surface|costamere|cytoskeleton|cytosol|dystrophin-associated glycoprotein complex|sarcolemma	actin binding|dystroglycan binding|nitric-oxide synthase binding|protein binding|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(3)|pancreas(2)|large_intestine(1)	6		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				AATCTGACGTCCAGTCTTTAT	0.353													28	15	---	---	---	---	PASS
CXorf22	170063	broad.mit.edu	37	X	35971701	35971701	+	Intron	SNP	T	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:35971701T>A	uc004ddj.2	+						CXorf22_uc010ngv.2_Intron	NM_152632	NP_689845	Q6ZTR5	CX022_HUMAN	hypothetical protein LOC170063											large_intestine(1)|lung(1)|ovary(1)	3						ATTGTGATTTTTTTACAGGCT	0.333													6	42	---	---	---	---	PASS
AR	367	broad.mit.edu	37	X	66863174	66863174	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:66863174G>T	uc004dwu.1	+	2	2808	c.1693G>T	c.(1693-1695)GAT>TAT	p.D565Y	AR_uc011mpd.1_Missense_Mutation_p.D565Y|AR_uc011mpe.1_RNA|AR_uc011mpf.1_Missense_Mutation_p.D565Y|AR_uc004dwv.1_Missense_Mutation_p.D33Y	NM_000044	NP_000035	P10275	ANDR_HUMAN	androgen receptor isoform 1	564	NR C4-type.|Nuclear receptor.				cell death|cell growth|cell proliferation|cell-cell signaling|negative regulation of apoptosis|negative regulation of integrin biosynthetic process|positive regulation of cell proliferation|positive regulation of integrin biosynthetic process|positive regulation of NF-kappaB transcription factor activity|positive regulation of phosphorylation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|regulation of establishment of protein localization in plasma membrane|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transport	cytoplasm|nuclear chromatin|nucleoplasm	androgen binding|androgen receptor activity|beta-catenin binding|enzyme binding|ligand-regulated transcription factor activity|protein dimerization activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|transcription regulatory region DNA binding|zinc ion binding			ovary(3)|lung(2)|breast(2)|central_nervous_system(1)	8	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone(DB04839)|Dromostanolone(DB00858)|Finasteride(DB01216)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Nandrolone(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Testosterone(DB00624)	GATCTGTGGAGATGAAGCTTC	0.483									Androgen_Insensitivity_Syndrome				47	21	---	---	---	---	PASS
LPAR4	2846	broad.mit.edu	37	X	78010451	78010451	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78010451A>T	uc010nme.2	+	2	490	c.85A>T	c.(85-87)AAT>TAT	p.N29Y		NM_005296	NP_005287	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	29	Extracellular (Potential).					integral to plasma membrane	lipid binding|purinergic nucleotide receptor activity, G-protein coupled			ovary(3)	3						TACTGCCAATAATACTTGCAT	0.403													63	36	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133858	91133858	+	Silent	SNP	G	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133858G>A	uc004efk.1	+	2	3464	c.2619G>A	c.(2617-2619)AAG>AAA	p.K873K	PCDH11X_uc004efl.1_Silent_p.K873K|PCDH11X_uc004efo.1_Silent_p.K873K|PCDH11X_uc010nmv.1_Silent_p.K873K|PCDH11X_uc004efm.1_Silent_p.K873K|PCDH11X_uc004efn.1_Silent_p.K873K|PCDH11X_uc004efh.1_Silent_p.K873K|PCDH11X_uc004efj.1_Silent_p.K873K	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	873	Cytoplasmic (Potential).|Poly-Lys.				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						agaaaaagaagaagaagCATT	0.368													27	23	---	---	---	---	PASS
ESX1	80712	broad.mit.edu	37	X	103495292	103495292	+	Missense_Mutation	SNP	A	T	T	rs144173947	byFrequency	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103495292A>T	uc004ely.2	-	4	896	c.838T>A	c.(838-840)TCA>ACA	p.S280T		NM_153448	NP_703149	Q8N693	ESX1_HUMAN	extraembryonic, spermatogenesis, homeobox	280	5.|15 X 9 AA tandem repeats of P-P-x-x-P-x- P-P-x.				negative regulation of transcription, DNA-dependent|regulation of cell cycle	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1						GCCATGCGTGAGCCGGGTGGC	0.488													5	29	---	---	---	---	PASS
COL4A6	1288	broad.mit.edu	37	X	107404948	107404948	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107404948C>A	uc004enw.3	-	42	4340	c.4237G>T	c.(4237-4239)GGC>TGC	p.G1413C	COL4A6_uc004env.3_Missense_Mutation_p.G1412C|COL4A6_uc011msn.1_Missense_Mutation_p.G1388C|COL4A6_uc010npk.2_Missense_Mutation_p.G1355C|COL4A6_uc011msm.1_5'Flank|COL4A6_uc010npj.2_Intron	NM_001847	NP_001838	Q14031	CO4A6_HUMAN	type IV alpha 6 collagen isoform A precursor	1413	Triple-helical region.				cell adhesion|extracellular matrix organization	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(6)|urinary_tract(1)|large_intestine(1)	8						CCGGGGATGCCAGGTAAACCT	0.592									Alport_syndrome_with_Diffuse_Leiomyomatosis				13	7	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118223293	118223293	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118223293C>A	uc004era.3	-	11	1900	c.1900G>T	c.(1900-1902)GCA>TCA	p.A634S		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	634										ovary(4)|skin(1)	5						ATGGGCTGTGCTGCTGATGCT	0.473													26	11	---	---	---	---	PASS
KIAA1210	57481	broad.mit.edu	37	X	118223294	118223294	+	Silent	SNP	T	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118223294T>G	uc004era.3	-	11	1899	c.1899A>C	c.(1897-1899)GCA>GCC	p.A633A		NM_020721	NP_065772	Q9ULL0	K1210_HUMAN	hypothetical protein LOC57481	633										ovary(4)|skin(1)	5						TGGGCTGTGCTGCTGATGCTT	0.473													27	12	---	---	---	---	PASS
GPC3	2719	broad.mit.edu	37	X	132887885	132887885	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132887885A>G	uc004exe.1	-	3	846	c.656T>C	c.(655-657)GTT>GCT	p.V219A	GPC3_uc004exd.1_Missense_Mutation_p.V91A|GPC3_uc010nrn.1_Missense_Mutation_p.V219A|GPC3_uc011mvh.1_Missense_Mutation_p.V203A|GPC3_uc010nro.1_Missense_Mutation_p.V165A|GPC3_uc010nrp.1_Missense_Mutation_p.V91A	NM_004484	NP_004475	P51654	GPC3_HUMAN	glypican 3 isoform 2 precursor	219						extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding|peptidyl-dipeptidase inhibitor activity			lung(2)|prostate(1)|breast(1)|skin(1)	5	Acute lymphoblastic leukemia(192;0.000127)					TGACTTGGAAACCTGGGTCAT	0.468			T|D|Mis|N|F|S			Wilms tumour			Simpson-Golabi-Behmel_syndrome				66	38	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4967136	4967136	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4967136C>A	uc004fqo.2	+	2	2251	c.1517C>A	c.(1516-1518)TCT>TAT	p.S506Y	PCDH11Y_uc010nwg.1_Missense_Mutation_p.S495Y|PCDH11Y_uc004fql.1_Missense_Mutation_p.S495Y|PCDH11Y_uc004fqm.1_Missense_Mutation_p.S495Y|PCDH11Y_uc004fqn.1_Missense_Mutation_p.S506Y|PCDH11Y_uc004fqp.1_Missense_Mutation_p.S277Y	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	506	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						GTAACTGTTTCTATTCCTGAG	0.443													7	16	---	---	---	---	PASS
COL11A1	1301	broad.mit.edu	37	1	103573532	103573532	+	Intron	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103573532delC	uc001dul.2	-						COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		TTTTTTTTTTCTTGAAGAGCG	0.473													3	3	---	---	---	---	
LOC647121	647121	broad.mit.edu	37	1	121309321	121309322	+	Intron	INS	-	G	G			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121309321_121309322insG	uc009wht.1	+						LOC647121_uc001eiu.1_Intron					Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						AAAAGAAAAAAGCACTCAGGTG	0.351													4	2	---	---	---	---	
CHD1L	9557	broad.mit.edu	37	1	146731281	146731281	+	Intron	DEL	A	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146731281delA	uc001epm.3	+						uc001epp.2_RNA|CHD1L_uc001epn.3_Intron|CHD1L_uc010ozo.1_Intron|CHD1L_uc009wjg.2_Intron|CHD1L_uc009wjh.2_Intron|CHD1L_uc010ozp.1_Intron|CHD1L_uc001epo.3_Intron	NM_004284	NP_004275	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein						chromatin remodeling|DNA repair	cytoplasm|nucleus|plasma membrane	ATP binding|ATP-dependent DNA helicase activity|DNA binding|protein binding			ovary(3)|lung(2)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.0487)					CCATTTTGTTAAAAAAAAAAA	0.299													4	2	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													4	3	---	---	---	---	
NMNAT2	23057	broad.mit.edu	37	1	183229954	183229955	+	Intron	INS	-	AA	AA	rs71906824		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183229954_183229955insAA	uc001gqc.1	-						NMNAT2_uc009wye.1_Intron|NMNAT2_uc001gqb.1_Intron	NM_015039	NP_055854	Q9BZQ4	NMNA2_HUMAN	nicotinamide mononucleotide adenylyltransferase						water-soluble vitamin metabolic process	Golgi membrane|nucleus	ATP binding|nicotinamide-nucleotide adenylyltransferase activity|nicotinate-nucleotide adenylyltransferase activity			skin(1)	1						gacgctgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
C1orf124	83932	broad.mit.edu	37	1	231475793	231475794	+	Intron	INS	-	AAA	AAA	rs3071954		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231475793_231475794insAAA	uc001hur.2	+						EXOC8_uc001huq.2_5'Flank|C1orf124_uc001hus.2_Intron|C1orf124_uc001hut.2_Intron	NM_032018	NP_114407	Q9H040	CA124_HUMAN	hypothetical protein LOC83932 isoform a						DNA repair	nuclear speck	DNA binding|metal ion binding				0	Breast(184;0.0871)	all_cancers(173;0.151)|Prostate(94;0.183)				TGCTTCATAGTAAAAAAAAAAA	0.203													4	2	---	---	---	---	
PAPOLG	64895	broad.mit.edu	37	2	60997770	60997771	+	Intron	INS	-	A	A	rs10187671	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60997770_60997771insA	uc002sai.2	+						PAPOLG_uc002saj.2_Intron|PAPOLG_uc002sak.2_Intron	NM_022894	NP_075045	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma						mRNA processing|RNA polyadenylation|transcription, DNA-dependent	nucleus	ATP binding|metal ion binding|polynucleotide adenylyltransferase activity|RNA binding			ovary(1)|central_nervous_system(1)	2	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			tttttttttttaatgaagagat	0.109													4	3	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75900438	75900439	+	Intron	INS	-	A	A	rs75112825		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75900438_75900439insA	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						agtctcaaaagaaaaaaaaaaa	0.084													4	2	---	---	---	---	
MFSD9	84804	broad.mit.edu	37	2	103343084	103343085	+	Intron	DEL	CA	-	-	rs112803412		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103343084_103343085delCA	uc002tcb.2	-						MFSD9_uc010fja.2_Intron	NM_032718	NP_116107	Q8NBP5	MFSD9_HUMAN	major facilitator superfamily domain containing						transmembrane transport	integral to membrane|plasma membrane	transporter activity			ovary(2)|breast(2)	4						ctcgcgcacgcacacacacaca	0.361													5	3	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	137988525	137988525	+	Intron	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137988525delG	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TATCATTTTTGGGGGGGTACT	0.363													9	8	---	---	---	---	
PSMD14	10213	broad.mit.edu	37	2	162251500	162251500	+	Intron	DEL	T	-	-	rs112832377		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:162251500delT	uc002ubu.2	+							NM_005805	NP_005796	O00487	PSDE_HUMAN	proteasome 26S subunit, non-ATPase 14						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K63-linked deubiquitination|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of proteasomal protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	endopeptidase activator activity|metal ion binding|metallopeptidase activity|proteasome binding|ubiquitin thiolesterase activity			breast(1)	1						AGTCGAAATGTTTTTTTTTTT	0.224													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	5124704	5124705	+	IGR	INS	-	TTTTTTTTTTT	TTTTTTTTTTT	rs72175262		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5124704_5124705insTTTTTTTTTTT								BHLHE40 (97841 upstream) : ARL8B (39225 downstream)																							CCATTTCAGCCttttttttttt	0.460													4	4	---	---	---	---	
TMEM111	55831	broad.mit.edu	37	3	10016252	10016252	+	Intron	DEL	T	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10016252delT	uc003bun.2	-						CIDEC_uc003bto.2_Intron|TMEM111_uc003buo.2_Intron	NM_018447	NP_060917	Q9P0I2	TM111_HUMAN	transmembrane protein 111							integral to membrane					0						CTGTAAACTGtttttttttga	0.194													4	2	---	---	---	---	
CACNA2D3	55799	broad.mit.edu	37	3	54420721	54420722	+	Intron	INS	-	TTT	TTT	rs79160483		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:54420721_54420722insTTT	uc003dhf.2	+						CACNA2D3_uc011beu.1_Intron|CACNA2D3_uc003dhg.1_Intron|CACNA2D3_uc003dhh.1_Intron|CACNA2D3_uc010hmv.1_Intron	NM_018398	NP_060868	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			large_intestine(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)		GCTGTCTTCTGTTTTTTTTTTT	0.381													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110401054	110401054	+	IGR	DEL	T	-	-	rs113398685		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110401054delT								None (None upstream) : PVRL3 (389811 downstream)																							CTTTGACTTCTTTTTTTTTTT	0.408													4	2	---	---	---	---	
GNB4	59345	broad.mit.edu	37	3	179119234	179119236	+	Intron	DEL	AAT	-	-	rs74384746		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179119234_179119236delAAT	uc003fjv.3	-						GNB4_uc003fju.3_Intron	NM_021629	NP_067642	Q9HAV0	GBB4_HUMAN	guanine nucleotide-binding protein, beta-4						cellular response to glucagon stimulus|energy reserve metabolic process	plasma membrane	signal transducer activity			skin(2)	2	all_cancers(143;2.01e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.237)			TCAGttaaaaaataataataatt	0.271													3	3	---	---	---	---	
SLC6A19	340024	broad.mit.edu	37	5	1210804	1210805	+	Intron	INS	-	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1210804_1210805insC	uc003jbw.3	+							NM_001003841	NP_001003841	Q695T7	S6A19_HUMAN	solute carrier family 6, member 19						cellular nitrogen compound metabolic process	integral to plasma membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity				0	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			AGAAACCAGAGCCCCAAGGCAA	0.554													8	4	---	---	---	---	
SLC30A5	64924	broad.mit.edu	37	5	68399959	68399960	+	Intron	INS	-	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68399959_68399960insT	uc003jvh.2	+						SLC30A5_uc003jvg.2_3'UTR|SLC30A5_uc011crc.1_RNA|SLC30A5_uc003jvi.2_Intron	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),						cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		GAATACTGTCCttttttttttt	0.158													4	2	---	---	---	---	
PCDHB2	56133	broad.mit.edu	37	5	140475430	140475430	+	Frame_Shift_Del	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475430delG	uc003lil.2	+	1	1194	c.1056delG	c.(1054-1056)TCGfs	p.S352fs	PCDHB2_uc003lim.1_Frame_Shift_Del_p.S13fs	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	352	Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAACTATGTCGACACTTATCA	0.463													20	16	---	---	---	---	
MICALL2	79778	broad.mit.edu	37	7	1474622	1474622	+	Intron	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1474622delC	uc003skj.3	-						MICALL2_uc003skh.3_Intron|MICALL2_uc003ski.3_Intron	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1							cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		CCGATACCCGCCCCCCCCCCA	0.721													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65976419	65976420	+	IGR	INS	-	A	A			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65976419_65976420insA								NCRNA00174 (111024 upstream) : LOC493754 (17026 downstream)																							ccatctcgaacaaaaaaaaaaa	0.243													5	3	---	---	---	---	
DPY19L2P2	349152	broad.mit.edu	37	7	102815704	102815705	+	3'UTR	DEL	TG	-	-	rs7796853		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:102815704_102815705delTG	uc003vbh.3	-	21					DPY19L2P2_uc003vbg.3_RNA|DPY19L2P2_uc010lit.2_RNA	NR_003561				RecName: Full=Protein dpy-19 homolog 2-like 2; AltName: Full=Dpy-19-like protein 2 pseudogene 2;												0						AATCAAGttttgtttttttttt	0.198													4	2	---	---	---	---	
RELN	5649	broad.mit.edu	37	7	103236848	103236848	+	Intron	DEL	T	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103236848delT	uc003vca.2	-						RELN_uc010liz.2_Intron	NM_005045	NP_005036	P78509	RELN_HUMAN	reelin isoform a						axon guidance|cell adhesion|cerebral cortex tangential migration|glial cell differentiation|neuron migration|peptidyl-tyrosine phosphorylation|positive regulation of protein kinase activity|positive regulation of small GTPase mediated signal transduction|response to pain|spinal cord patterning	cytoplasm|dendrite|extracellular space|proteinaceous extracellular matrix	metal ion binding|protein serine/threonine/tyrosine kinase activity|serine-type peptidase activity			ovary(8)|upper_aerodigestive_tract(5)|large_intestine(2)|central_nervous_system(2)|skin(1)|pancreas(1)	19				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCAACAATGATTTAACCTTTA	0.363													84	62	---	---	---	---	
METTL2B	55798	broad.mit.edu	37	7	128120574	128120574	+	Intron	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128120574delC	uc003vnf.2	+						METTL2B_uc003vng.2_Intron|METTL2B_uc011kop.1_Intron	NM_018396	NP_060866	Q6P1Q9	MTL2B_HUMAN	methyltransferase like 2B								methyltransferase activity			skin(1)	1						CTGTTTAGCTCTGGTCACTAC	0.378													13	11	---	---	---	---	
SSPO	23145	broad.mit.edu	37	7	149503214	149503214	+	Intron	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149503214delC	uc010lpk.2	+							NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor						cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			TTGACCTTTTCCCCACCCTCA	0.602													12	8	---	---	---	---	
DEFA5	1670	broad.mit.edu	37	8	6913933	6913933	+	Intron	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6913933delG	uc003wra.1	-							NM_021010	NP_066290	Q01523	DEF5_HUMAN	defensin, alpha 5 preproprotein						defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space					0				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		tcaaggtccaggaagattaag	0.154													5	5	---	---	---	---	
MED30	90390	broad.mit.edu	37	8	118535449	118535450	+	Intron	INS	-	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118535449_118535450insT	uc003yoj.2	+						MED30_uc011lib.1_Intron	NM_080651	NP_542382	Q96HR3	MED30_HUMAN	TRAP/Mediator complex component TRAP25						androgen receptor signaling pathway|positive regulation of transcription, DNA-dependent|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding				0	all_cancers(13;3.41e-25)|Lung NSC(37;3.02e-05)|Ovarian(258;0.00163)		STAD - Stomach adenocarcinoma(47;0.0266)			TTTTTTTTAAGTTTTTTTTTTT	0.327													8	4	---	---	---	---	
SLC24A2	25769	broad.mit.edu	37	9	19516395	19516395	+	Frame_Shift_Del	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19516395delG	uc003zoa.1	-	10	1804	c.1742delC	c.(1741-1743)CCAfs	p.P581fs	SLC24A2_uc003zob.1_Frame_Shift_Del_p.P564fs	NM_020344	NP_065077	Q9UI40	NCKX2_HUMAN	solute carrier family 24	581	Helical; (Potential).				visual perception	integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(3)	3				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		CCAGGGCAGTGGGAGCCTGTG	0.517													18	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383711	42383712	+	IGR	INS	-	C	C			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383711_42383712insC								None (None upstream) : LOC441666 (443603 downstream)																							tcaaatggaatcaaaataacca	0.000													9	5	---	---	---	---	
PARG	8505	broad.mit.edu	37	10	51532041	51532041	+	Intron	DEL	T	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51532041delT	uc001jih.2	-						uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron	NM_003631	NP_003622	Q86W56	PARG_HUMAN	poly (ADP-ribose) glycohydrolase						carbohydrate metabolic process	nucleus	poly(ADP-ribose) glycohydrolase activity			ovary(2)	2				Epithelial(53;0.213)		GAAAGTTTCCTTTTTTTTTTT	0.189													11	5	---	---	---	---	
DNM1L	10059	broad.mit.edu	37	12	32895822	32895822	+	Intron	DEL	C	-	-	rs74934269		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32895822delC	uc001rld.2	+						DNM1L_uc001rle.2_Intron|DNM1L_uc001rlf.2_Intron|DNM1L_uc010skh.1_Intron|DNM1L_uc001rlg.2_Intron|DNM1L_uc001rlh.2_Intron|DNM1L_uc010ski.1_Intron	NM_012062	NP_036192	O00429	DNM1L_HUMAN	dynamin 1-like isoform 1						cellular component disassembly involved in apoptosis|mitochondrial fragmentation involved in apoptosis|mitochondrial membrane organization|positive regulation of mitochondrial fission	cis-Golgi network|cytosol|endomembrane system|endoplasmic reticulum|mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)|pancreas(1)	2	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					TGATAAGAATCtttttttttt	0.149													4	2	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													4	2	---	---	---	---	
FNDC3A	22862	broad.mit.edu	37	13	49618818	49618818	+	Intron	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49618818delG	uc001vcm.2	+						FNDC3A_uc001vcl.1_Intron|FNDC3A_uc001vcn.2_Intron|FNDC3A_uc001vco.2_Intron	NM_001079673	NP_001073141	Q9Y2H6	FND3A_HUMAN	fibronectin type III domain containing 3A							Golgi membrane|integral to membrane				lung(2)	2		all_lung(13;7.44e-08)|Lung NSC(96;4.08e-06)|Breast(56;0.000111)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.94e-09)		aaaaaaaaaagaaagaaaaaT	0.174													4	2	---	---	---	---	
ARHGAP11B	89839	broad.mit.edu	37	15	30919319	30919320	+	Intron	INS	-	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:30919319_30919320insT	uc001zet.1	+						ARHGAP11B_uc010azv.1_Intron|ARHGAP11B_uc001zeu.2_Intron	NM_001039841	NP_001034930	Q3KRB8	RHGBB_HUMAN	Rho GTPase activating protein 11B						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0		all_lung(180;2.71e-09)|Breast(32;0.00116)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		TGACATTCTTGTTTTTTTTTTC	0.233													4	2	---	---	---	---	
OIP5	11339	broad.mit.edu	37	15	41624158	41624158	+	Frame_Shift_Del	DEL	A	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41624158delA	uc001znp.2	-	2	404	c.344delT	c.(343-345)TTGfs	p.L115fs	NUSAP1_uc001znq.3_5'Flank|NUSAP1_uc001znr.3_5'Flank|NUSAP1_uc001zns.3_5'Flank|NUSAP1_uc010bce.2_5'Flank|NUSAP1_uc001znt.3_5'Flank|NUSAP1_uc001znv.3_5'Flank|NUSAP1_uc001znu.3_5'Flank|NUSAP1_uc010ucw.1_5'Flank	NM_007280	NP_009211	O43482	MS18B_HUMAN	Opa interacting protein 5	115					cell communication|cell division|CenH3-containing nucleosome assembly at centromere|mitosis	Cajal body|chromatin|chromosome, centromeric region	protein binding				0		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GGGCGCTTCCAAAACGACGTT	0.453											OREG0023073	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	102	47	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10725215	10725216	+	Intron	INS	-	G	G	rs113859011		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10725215_10725216insG	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						ggggtgggggcgggggagggtt	0.069													4	2	---	---	---	---	
FBXW10	10517	broad.mit.edu	37	17	18673619	18673620	+	Intron	INS	-	T	T	rs111256666		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18673619_18673620insT	uc002guk.2	+						FBXW10_uc002guj.2_Intron|FBXW10_uc002gul.2_Intron|FBXW10_uc010cqh.1_Intron	NM_031456	NP_113644	Q5XX13	FBW10_HUMAN	F-box and WD-40 domain protein 10											ovary(1)	1						TTCATTTTGACttttttttttt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	41026420	41026420	+	IGR	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41026420delC								LOC90586 (5057 upstream) : LOC388387 (271 downstream)																							GCCAAGGGCTCCAGGGCCAGG	0.687													19	10	---	---	---	---	
MUM1	84939	broad.mit.edu	37	19	1376306	1376310	+	Intron	DEL	GTTTG	-	-	rs7508308		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1376306_1376310delGTTTG	uc010xgm.1	+						MUM1_uc002lrz.2_Intron|MUM1_uc002lsb.2_Intron|MUM1_uc002lsd.2_Intron			Q2TAK8	MUM1_HUMAN	SubName: Full=MUM1 protein;						chromatin organization|DNA repair	nucleus	nucleosome binding|protein binding				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ttttttttttgtttgtttttttttt	0.000													5	4	---	---	---	---	
FBN3	84467	broad.mit.edu	37	19	8188250	8188250	+	Intron	DEL	G	-	-	rs10419582	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8188250delG	uc002mjf.2	-							NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						aaaaaaaaaagaagaagaaaa	0.239													5	3	---	---	---	---	
WDR83	84292	broad.mit.edu	37	19	12783811	12783812	+	Intron	INS	-	T	T			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12783811_12783812insT	uc002mue.3	+						WDR83_uc002muc.2_Intron|WDR83_uc010dyw.2_Intron	NM_001099737	NP_001093207	Q9BRX9	WDR83_HUMAN	mitogen-activated protein kinase organizer 1						nuclear mRNA splicing, via spliceosome	catalytic step 2 spliceosome|cytoplasm				lung(1)|breast(1)	2						CCTACCCACCCTTCCCCCAAGG	0.644													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	16090707	16090707	+	IGR	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16090707delG								OR10H4 (29940 upstream) : LOC126536 (35737 downstream)																							GGCTCCATGTGGTCTGGACAG	0.612													10	6	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													4	3	---	---	---	---	
CHST8	64377	broad.mit.edu	37	19	34180129	34180129	+	5'UTR	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34180129delC	uc002nus.3	+	3					CHST8_uc002nut.3_5'UTR|CHST8_uc002nuu.2_5'UTR	NM_001127895	NP_001121367	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0)						carbohydrate biosynthetic process|central nervous system development|hormone biosynthetic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi membrane|integral to membrane	N-acetylgalactosamine 4-O-sulfotransferase activity			skin(2)|large_intestine(1)|ovary(1)	4	Esophageal squamous(110;0.162)					GAAGAACGTGCCCCCCACACC	0.647													53	24	---	---	---	---	
PNKP	11284	broad.mit.edu	37	19	50364837	50364837	+	Intron	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50364837delG	uc002pqh.2	-						PNKP_uc002pqg.2_Intron|PNKP_uc002pqi.2_Intron|PNKP_uc002pqj.2_Intron|PNKP_uc010enm.2_Intron|PNKP_uc002pqk.2_Intron	NM_007254	NP_009185	Q96T60	PNKP_HUMAN	polynucleotide kinase 3' phosphatase						DNA damage response, detection of DNA damage|DNA-dependent DNA replication|nucleotide-excision repair, DNA damage removal|response to oxidative stress|response to radiation	nucleolus	ATP binding|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity|damaged DNA binding|double-stranded DNA binding|endonuclease activity|nucleotide kinase activity|polynucleotide 3'-phosphatase activity|protein binding			ovary(1)|kidney(1)	2		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		GGTGCAGCCCGGGGGGTGTCC	0.701								Other_BER_factors					4	3	---	---	---	---	
SYT3	84258	broad.mit.edu	37	19	51132916	51132917	+	Intron	DEL	CC	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132916_51132917delCC	uc002pst.2	-						SYT3_uc002psv.2_Intron|SYT3_uc010ycd.1_Intron	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III							cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		ggagtccaggcccccagcccct	0.000													4	2	---	---	---	---	
ZNF320	162967	broad.mit.edu	37	19	53368688	53368689	+	Intron	DEL	TA	-	-	rs12972693		TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53368688_53368689delTA	uc010eqh.1	-						ZNF320_uc010eqi.1_Intron			A2RRD8	ZN320_HUMAN	Homo sapiens full length insert cDNA clone ZD42C02.						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.0534)		GTCCAGGCTTtatatatatata	0.262													4	2	---	---	---	---	
LIME1	54923	broad.mit.edu	37	20	62369426	62369427	+	Intron	INS	-	GGGGCG	GGGGCG	rs150938918	by1000genomes	TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62369426_62369427insGGGGCG	uc002ygp.3	+						ZGPAT_uc002ygn.3_Intron|LIME1_uc011abi.1_Intron|SLC2A4RG_uc002ygq.2_5'Flank|SLC2A4RG_uc002ygr.2_5'Flank	NM_017806	NP_060276	Q9H400	LIME1_HUMAN	Lck interacting transmembrane adaptor 1							integral to membrane|plasma membrane					0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					GAGCAGAgggcggggcgggggc	0.594													4	3	---	---	---	---	
TRMU	55687	broad.mit.edu	37	22	46751235	46751236	+	Intron	DEL	TG	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46751235_46751236delTG	uc003bhp.2	+						TRMU_uc003bhq.2_Intron|TRMU_uc003bhs.2_Intron|TRMU_uc003bhr.2_Intron|TRMU_uc003bht.2_Intron|TRMU_uc003bhu.2_Intron|TRMU_uc003bhv.2_Intron	NM_018006	NP_060476	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate							mitochondrion	ATP binding|sulfurtransferase activity|tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase activity|tRNA binding			ovary(1)	1		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		cacCGTTACCTGTGTGTGTGTG	0.332											OREG0026654	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
NRK	203447	broad.mit.edu	37	X	105153518	105153518	+	Frame_Shift_Del	DEL	C	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105153518delC	uc004emd.2	+	13	2188	c.1885delC	c.(1885-1887)CCCfs	p.P629fs	NRK_uc010npc.1_Frame_Shift_Del_p.P297fs	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	629							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						GACACTAGAACCCCCACAGGC	0.498										HNSCC(51;0.14)			10	8	---	---	---	---	
SERPINA7	6906	broad.mit.edu	37	X	105280841	105280841	+	Frame_Shift_Del	DEL	G	-	-			TCGA-39-5027-01	TCGA-39-5027-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105280841delG	uc004eme.1	-	1	225	c.209delC	c.(208-210)CCTfs	p.P70fs	SERPINA7_uc010npd.2_Frame_Shift_Del_p.P70fs|SERPINA7_uc010npe.1_Frame_Shift_Del_p.P70fs	NM_000354	NP_000345	P05543	THBG_HUMAN	serine (or cysteine) proteinase inhibitor, clade	70					regulation of proteolysis	extracellular space	serine-type endopeptidase inhibitor activity				0					Levothyroxine(DB00451)|Liothyronine(DB00279)	AATGCTCACAGGGGAAAAGAA	0.483													31	50	---	---	---	---	
