Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
KIF1B	23095	broad.mit.edu	37	1	10386311	10386311	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10386311G>A	uc001aqx.3	+	27	3020	c.2818G>A	c.(2818-2820)GTG>ATG	p.V940M	KIF1B_uc001aqw.3_Missense_Mutation_p.V894M|KIF1B_uc001aqy.2_Missense_Mutation_p.V914M|KIF1B_uc001aqz.2_Missense_Mutation_p.V940M|KIF1B_uc001ara.2_Missense_Mutation_p.V900M|KIF1B_uc001arb.2_Missense_Mutation_p.V926M	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b	940					anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		TGAGGCATTCGTGGATGACGC	0.557													11	149	---	---	---	---	PASS
GLIS1	148979	broad.mit.edu	37	1	54060199	54060199	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54060199G>A	uc001cvr.1	-	3	944	c.377C>T	c.(376-378)TCG>TTG	p.S126L		NM_147193	NP_671726	Q8NBF1	GLIS1_HUMAN	GLIS family zinc finger 1	126					negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding			skin(1)	1						GCTGTCCGTCGATGCAGGGCC	0.632													8	93	---	---	---	---	PASS
DOCK7	85440	broad.mit.edu	37	1	62923246	62923246	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62923246G>C	uc001daq.2	-	48	6344	c.6310C>G	c.(6310-6312)CAG>GAG	p.Q2104E	DOCK7_uc001dan.2_Missense_Mutation_p.Q1967E|DOCK7_uc001dao.2_Missense_Mutation_p.Q1965E|DOCK7_uc001dap.2_Missense_Mutation_p.Q2084E|DOCK7_uc001dam.2_Missense_Mutation_p.Q1286E|DOCK7_uc010oov.1_Missense_Mutation_p.Q845E	NM_033407	NP_212132	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	2115					activation of Rac GTPase activity|axonogenesis|establishment of neuroblast polarity|microtubule cytoskeleton organization|positive regulation of peptidyl-serine phosphorylation	axon|basal part of cell|growth cone	GTP binding|guanyl-nucleotide exchange factor activity|Rac GTPase binding			ovary(2)	2						TTGTATAACTGAGGGATCTTT	0.413													15	143	---	---	---	---	PASS
ST6GALNAC3	256435	broad.mit.edu	37	1	76779364	76779364	+	Intron	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76779364T>C	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						CCAGGTAAAATATGCTGAATG	0.408													8	17	---	---	---	---	PASS
PKN2	5586	broad.mit.edu	37	1	89279257	89279257	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89279257G>C	uc001dmn.2	+	16	2462	c.2120G>C	c.(2119-2121)AGA>ACA	p.R707T	PKN2_uc010osp.1_Missense_Mutation_p.R691T|PKN2_uc010osq.1_Missense_Mutation_p.R550T|PKN2_uc009wcv.2_Missense_Mutation_p.R659T|PKN2_uc010osr.1_Missense_Mutation_p.R372T	NM_006256	NP_006247	Q16513	PKN2_HUMAN	protein kinase N2	707	Protein kinase.				signal transduction	cytoplasm	ATP binding|histone deacetylase binding|protein kinase C activity			large_intestine(1)|lung(1)|skin(1)	3		Lung NSC(277;0.123)		all cancers(265;0.0136)|Epithelial(280;0.0301)		TGTGAAAAAAGAATTTTTGAA	0.279													13	155	---	---	---	---	PASS
CTTNBP2NL	55917	broad.mit.edu	37	1	112998820	112998820	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:112998820G>C	uc001ebx.2	+	6	934	c.706G>C	c.(706-708)GAG>CAG	p.E236Q	CTTNBP2NL_uc001ebz.2_5'Flank	NM_018704	NP_061174	Q9P2B4	CT2NL_HUMAN	CTTNBP2 N-terminal like	236	Potential.					actin cytoskeleton	protein binding			central_nervous_system(2)|ovary(1)	3		all_cancers(81;0.00064)|all_epithelial(167;0.000415)|all_lung(203;0.00045)|Lung NSC(69;0.000705)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGCCCAGGTAGAGAAGCAGTT	0.483													9	81	---	---	---	---	PASS
LRIG2	9860	broad.mit.edu	37	1	113655227	113655227	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113655227A>C	uc001edf.1	+	14	2123	c.1925A>C	c.(1924-1926)GAC>GCC	p.D642A	LRIG2_uc009wgn.1_Missense_Mutation_p.D539A	NM_014813	NP_055628	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like	642	Ig-like C2-type 2.|Extracellular (Potential).					cytoplasm|integral to membrane|plasma membrane				ovary(3)	3	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		GGTGGTACTGACTTTCCTGCG	0.493													15	130	---	---	---	---	PASS
MCL1	4170	broad.mit.edu	37	1	150551640	150551640	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150551640C>T	uc001euz.2	-	1	497	c.367G>A	c.(367-369)GAA>AAA	p.E123K	MCL1_uc010pch.1_Missense_Mutation_p.E13K|MCL1_uc001eva.2_Missense_Mutation_p.E123K	NM_021960	NP_068779	Q07820	MCL1_HUMAN	myeloid cell leukemia sequence 1 isoform 1	123	PEST-like.				anti-apoptosis|apoptosis|cell fate determination|cellular homeostasis|multicellular organismal development|response to cytokine stimulus	integral to membrane|mitochondrial outer membrane|nucleoplasm	BH3 domain binding|protein binding|protein channel activity|protein heterodimerization activity				0	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AGCTCCTCTTCGGGCGACATG	0.687													7	52	---	---	---	---	PASS
THBS3	7059	broad.mit.edu	37	1	155172145	155172145	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155172145G>A	uc001fix.2	-	9	1028	c.1005C>T	c.(1003-1005)ACC>ACT	p.T335T	RAG1AP1_uc010pey.1_Intron|THBS3_uc009wqi.2_Silent_p.T326T|THBS3_uc001fiz.2_Silent_p.T335T|THBS3_uc001fiy.2_5'UTR|THBS3_uc010pfu.1_Silent_p.T215T|THBS3_uc010pfv.1_RNA|THBS3_uc001fja.2_RNA	NM_007112	NP_009043	P49746	TSP3_HUMAN	thrombospondin 3 precursor	335	EGF-like 2; calcium-binding (Potential).				cell-matrix adhesion	extracellular region|perinuclear region of cytoplasm	calcium ion binding|heparin binding|structural molecule activity			breast(3)|ovary(2)	5	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGCCGGGCATGGTGTTGATGC	0.617													19	117	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158604375	158604375	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158604375C>A	uc001fst.1	-	39	5722	c.5523G>T	c.(5521-5523)TTG>TTT	p.L1841F		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1841	Spectrin 18.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CTCGGACAGCCAAAGCATTCT	0.398													32	186	---	---	---	---	PASS
DUSP27	92235	broad.mit.edu	37	1	167088693	167088693	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167088693G>A	uc001geb.1	+	4	645	c.645G>A	c.(643-645)CTG>CTA	p.L215L		NM_001080426	NP_001073895	Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27	215	Tyrosine-protein phosphatase.				protein dephosphorylation		protein tyrosine/serine/threonine phosphatase activity			ovary(3)	3						AGGCGCTGCTGACTTACAGAG	0.527													10	45	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183515449	183515449	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183515449C>T	uc001gqg.2	+	17	2841	c.2719C>T	c.(2719-2721)CCT>TCT	p.P907S	SMG7_uc010pob.1_Missense_Mutation_p.P890S|SMG7_uc001gqf.2_Missense_Mutation_p.P861S|SMG7_uc001gqh.2_Missense_Mutation_p.P861S|SMG7_uc001gqi.2_Missense_Mutation_p.P819S|SMG7_uc010poc.1_Missense_Mutation_p.P865S	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1	907					mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AGAGCAGGATCCTGTACCCAG	0.473													11	72	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190129961	190129961	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190129961T>C	uc001gse.1	-	7	1253	c.1021A>G	c.(1021-1023)ATA>GTA	p.I341V	FAM5C_uc010pot.1_Missense_Mutation_p.I239V	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	341						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					AAATGCATTATAGTAGATGTG	0.318													46	166	---	---	---	---	PASS
KDM5B	10765	broad.mit.edu	37	1	202718206	202718206	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202718206G>A	uc001gyf.2	-	14	1999	c.1883C>T	c.(1882-1884)TCC>TTC	p.S628F	KDM5B_uc009xag.2_Missense_Mutation_p.S664F|KDM5B_uc001gyg.1_Missense_Mutation_p.S470F	NM_006618	NP_006609	Q9UGL1	KDM5B_HUMAN	jumonji, AT rich interactive domain 1B	628					negative regulation of transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-dimethyl-K4 specific)|histone demethylase activity (H3-trimethyl-K4 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(2)|breast(2)|urinary_tract(1)	5						CTCATCGTGGGAAAACACACA	0.413													8	99	---	---	---	---	PASS
IRF6	3664	broad.mit.edu	37	1	209965712	209965712	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209965712G>T	uc001hhq.1	-	6	832	c.569C>A	c.(568-570)GCA>GAA	p.A190E	IRF6_uc010psm.1_Missense_Mutation_p.A95E|IRF6_uc009xct.1_Missense_Mutation_p.A190E	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	190					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		GGGCCACACTGCCTCCGGGCT	0.552										HNSCC(57;0.16)			3	92	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213414815	213414815	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213414815G>T	uc010ptr.1	+	11	2155	c.1996G>T	c.(1996-1998)GAC>TAC	p.D666Y	RPS6KC1_uc001hkd.2_Missense_Mutation_p.D654Y|RPS6KC1_uc010pts.1_Missense_Mutation_p.D454Y|RPS6KC1_uc010ptt.1_Missense_Mutation_p.D454Y|RPS6KC1_uc010ptu.1_Missense_Mutation_p.D485Y|RPS6KC1_uc010ptv.1_Missense_Mutation_p.D201Y|RPS6KC1_uc001hke.2_Missense_Mutation_p.D485Y	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	666					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		GGGCTCAGATGACTCAGTGCC	0.403													25	116	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216040459	216040459	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216040459G>C	uc001hku.1	-	44	9122	c.8735C>G	c.(8734-8736)CCG>CGG	p.P2912R		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2912	Extracellular (Potential).|Fibronectin type-III 15.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTCTCGGCTCGGTGTAAAACC	0.423										HNSCC(13;0.011)			4	86	---	---	---	---	PASS
WNT3A	89780	broad.mit.edu	37	1	228210542	228210542	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228210542C>T	uc001hrq.1	+	2	324	c.246C>T	c.(244-246)CGC>CGT	p.R82R	WNT3A_uc001hrp.1_Silent_p.R82R	NM_033131	NP_149122	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family,	82					axis specification|cell proliferation in forebrain|cell-cell signaling|cellular response to retinoic acid|convergent extension|dermatome development|dorsal/ventral neural tube patterning|embryonic pattern specification|extracellular matrix organization|hemopoietic stem cell proliferation|hippocampus development|inner ear morphogenesis|mammary gland development|midbrain-hindbrain boundary development|negative regulation of fat cell differentiation|negative regulation of heart induction by canonical Wnt receptor signaling pathway|negative regulation of neuron projection development|notochord development|palate development|paraxial mesodermal cell fate commitment|positive regulation of catenin import into nucleus|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of receptor internalization|positive regulation of transcription from RNA polymerase II promoter|signalosome assembly|tail morphogenesis|Wnt receptor signaling pathway involved in forebrain neuroblast division|Wnt receptor signaling pathway, calcium modulating pathway	cell surface|early endosome|extracellular space|late endosome|membrane raft|plasma membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|frizzled-2 binding|receptor agonist activity|signal transducer activity|transcription coactivator activity			ovary(1)	1		Prostate(94;0.0405)				ACCAGTTCCGCGGCCGCCGGT	0.642													7	48	---	---	---	---	PASS
ZNF669	79862	broad.mit.edu	37	1	247264358	247264358	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247264358C>A	uc001ice.2	-	4	886	c.713G>T	c.(712-714)AGA>ATA	p.R238I	ZNF669_uc001icf.2_Missense_Mutation_p.R152I	NM_024804	NP_079080	Q96BR6	ZN669_HUMAN	zinc finger protein 669 isoform 1	238	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			CATGTGTCTTCTAACACCTGG	0.368													20	209	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	247902042	247902042	+	IGR	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247902042C>A								OR6F1 (25985 upstream) : OR1C1 (18724 downstream)																							TGAATTTAGTCATCATTCTCC	0.453													26	114	---	---	---	---	PASS
OR14C36	127066	broad.mit.edu	37	1	248512354	248512354	+	Missense_Mutation	SNP	C	A	A	rs145207343		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248512354C>A	uc010pzl.1	+	1	278	c.278C>A	c.(277-279)GCG>GAG	p.A93E		NM_001001918	NP_001001918	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C,	93	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ATTTCTAAGGCGGGATGTGTA	0.473													3	96	---	---	---	---	PASS
OR14I1	401994	broad.mit.edu	37	1	248845350	248845350	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248845350G>C	uc001ieu.1	-	1	256	c.256C>G	c.(256-258)CGC>GGC	p.R86G		NM_001004734	NP_001004734	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I,	86	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GAGCTTCTGCGAGTCAGGGAG	0.468													10	34	---	---	---	---	PASS
MYT1L	23040	broad.mit.edu	37	2	1906860	1906860	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1906860T>C	uc002qxe.2	-	14	2851	c.2024A>G	c.(2023-2025)TAT>TGT	p.Y675C	MYT1L_uc002qxd.2_Missense_Mutation_p.Y673C|MYT1L_uc010ewl.1_Intron	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	675					cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		ACCATCATCATATCCTTTGGG	0.438													8	119	---	---	---	---	PASS
KIDINS220	57498	broad.mit.edu	37	2	8871135	8871135	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8871135G>A	uc002qzc.2	-	30	5213	c.5031C>T	c.(5029-5031)AAC>AAT	p.N1677N	KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Silent_p.N1578N|KIDINS220_uc002qzb.2_Silent_p.N531N	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa	1677	Cytoplasmic (Potential).				activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TGGGAGTTCGGTTCAGGTTGT	0.488													8	102	---	---	---	---	PASS
PUM2	23369	broad.mit.edu	37	2	20462982	20462982	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20462982C>G	uc002rds.1	-	13	2220	c.2197G>C	c.(2197-2199)GAG>CAG	p.E733Q	PUM2_uc002rdq.1_Missense_Mutation_p.E110Q|PUM2_uc002rdt.1_Missense_Mutation_p.E733Q|PUM2_uc002rdr.2_Missense_Mutation_p.E593Q|PUM2_uc010yjy.1_Missense_Mutation_p.E654Q|PUM2_uc002rdu.1_Missense_Mutation_p.E733Q|PUM2_uc010yjz.1_Missense_Mutation_p.E672Q	NM_015317	NP_056132	Q8TB72	PUM2_HUMAN	pumilio homolog 2	733	Pumilio 1.|PUM-HD.				regulation of translation	perinuclear region of cytoplasm|stress granule	protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGAGAAAACTCAACTATATGT	0.368													8	73	---	---	---	---	PASS
ZNF513	130557	broad.mit.edu	37	2	27602971	27602971	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27602971C>G	uc002rkk.2	-	2	400	c.200G>C	c.(199-201)AGA>ACA	p.R67T	ZNF513_uc002rkj.2_Missense_Mutation_p.R5T	NM_144631	NP_653232	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	67	Gly-rich.				regulation of transcription, DNA-dependent|response to stimulus|retina development in camera-type eye|transcription, DNA-dependent|visual perception	nucleus	transcription regulatory region DNA binding|zinc ion binding			ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCGAGTCTCTCTCGAAGCC	0.552													21	429	---	---	---	---	PASS
LRPPRC	10128	broad.mit.edu	37	2	44153051	44153051	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44153051C>T	uc002rtr.2	-	26	2844	c.2786G>A	c.(2785-2787)AGA>AAA	p.R929K	LRPPRC_uc010yob.1_Missense_Mutation_p.R829K	NM_133259	NP_573566	P42704	LPPRC_HUMAN	leucine-rich PPR motif-containing protein	929					mitochondrion transport along microtubule|mRNA transport|regulation of transcription, DNA-dependent|transcription, DNA-dependent	condensed nuclear chromosome|cytoskeleton|mitochondrial nucleoid|nuclear inner membrane|nuclear outer membrane|nucleoplasm|perinuclear region of cytoplasm	beta-tubulin binding|microtubule binding|RNA binding			ovary(2)|skin(1)	3		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TGCAACACATCTGTCACAAAA	0.408													63	105	---	---	---	---	PASS
SLC3A1	6519	broad.mit.edu	37	2	44547771	44547771	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44547771C>T	uc002ruc.3	+	10	2129	c.2051C>T	c.(2050-2052)TCG>TTG	p.S684L	PREPL_uc002ruf.2_3'UTR|PREPL_uc002rug.2_3'UTR|PREPL_uc002ruh.2_3'UTR|PREPL_uc010fax.2_3'UTR|PREPL_uc002rui.3_3'UTR|PREPL_uc002ruj.1_3'UTR|PREPL_uc002ruk.1_3'UTR|SLC3A1_uc002rud.3_Missense_Mutation_p.S406L|SLC3A1_uc002rue.3_Missense_Mutation_p.S304L	NM_000341	NP_000332	Q07837	SLC31_HUMAN	solute carrier family 3, member 1	684	Extracellular (Potential).				carbohydrate metabolic process|cellular amino acid metabolic process|ion transport	integral to plasma membrane|membrane fraction	basic amino acid transmembrane transporter activity|catalytic activity|cation binding|L-cystine transmembrane transporter activity				0		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)			L-Cystine(DB00138)	CTGTATACCTCGTGTTAGGCA	0.413													7	112	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54147333	54147333	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54147333G>A	uc002rxp.2	-	19	2473	c.2417C>T	c.(2416-2418)TCT>TTT	p.S806F	PSME4_uc010yop.1_Missense_Mutation_p.S692F|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.S181F|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	806					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AACCAACCTAGACATTTCAAG	0.353													96	364	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54147371	54147371	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54147371G>C	uc002rxp.2	-	19	2435	c.2379C>G	c.(2377-2379)GTC>GTG	p.V793V	PSME4_uc010yop.1_Silent_p.V679V|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Silent_p.V168V|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	793					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			GCTGGAGTTTGACGAGCTCAG	0.403													91	357	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54147429	54147429	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54147429G>A	uc002rxp.2	-	19	2377	c.2321C>T	c.(2320-2322)TCA>TTA	p.S774L	PSME4_uc010yop.1_Missense_Mutation_p.S660L|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.S149L|PSME4_uc010fbv.1_Intron	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	774					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			CACTTCTTCTGAAGAAGGAAC	0.453													76	209	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61463362	61463362	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61463362C>A	uc002sbe.2	-	55	6874	c.6852G>T	c.(6850-6852)TGG>TGT	p.W2284C	USP34_uc002sbf.2_Missense_Mutation_p.W434C	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	2284					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TACACAATTGCCACATAAATC	0.269													18	118	---	---	---	---	PASS
C2orf78	388960	broad.mit.edu	37	2	74043451	74043451	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74043451G>C	uc002sjr.1	+	3	2222	c.2101G>C	c.(2101-2103)GAG>CAG	p.E701Q		NM_001080474	NP_001073943	A6NCI8	CB078_HUMAN	hypothetical protein LOC388960	701										ovary(2)	2						TGCTGAAAAAGAGTGTACATC	0.493													12	93	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309925	89309925	+	Intron	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309925C>A	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GCAGGAGCCCCAGGAGCTGAG	0.567													13	117	---	---	---	---	PASS
RNF149	284996	broad.mit.edu	37	2	101924926	101924926	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101924926A>G	uc002taz.1	-	1	227	c.125T>C	c.(124-126)GTA>GCA	p.V42A	RNF149_uc002tax.1_RNA	NM_173647	NP_775918	Q8NC42	RN149_HUMAN	ring finger protein 149 precursor	42						integral to membrane	ligase activity|zinc ion binding			ovary(1)|breast(1)	2						CTCGATGTTTACCACGGCCGA	0.607													12	69	---	---	---	---	PASS
IL1F7	27178	broad.mit.edu	37	2	113676149	113676149	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113676149G>A	uc002tij.2	+	5	462	c.420G>A	c.(418-420)CTG>CTA	p.L140L	IL1F7_uc002tik.2_Silent_p.L119L|IL1F7_uc002til.2_Silent_p.L100L|IL1F7_uc002tim.2_Silent_p.L79L|IL1F7_uc002tin.2_Silent_p.L114L	NM_014439	NP_055254	Q9NZH6	IL37_HUMAN	interleukin 1 family, member 7 isoform 1	140					immune response	cytosol|extracellular space|nucleus	cytokine activity|interleukin-1 receptor antagonist activity|interleukin-1 receptor binding				0						AGGAGAAACTGATGAAGCTGG	0.527													7	111	---	---	---	---	PASS
CLASP1	23332	broad.mit.edu	37	2	122106203	122106203	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122106203G>A	uc002tnc.2	-	37	4688	c.4298C>T	c.(4297-4299)ACG>ATG	p.T1433M	CLASP1_uc010yyv.1_Missense_Mutation_p.T479M|CLASP1_uc002tmz.2_Missense_Mutation_p.T518M|CLASP1_uc002tna.2_Missense_Mutation_p.T479M|CLASP1_uc010yyw.1_RNA|CLASP1_uc002tnb.2_RNA|CLASP1_uc010yyx.1_RNA|CLASP1_uc010yyy.1_RNA|CLASP1_uc010yyz.1_Missense_Mutation_p.T1374M|CLASP1_uc010yza.1_Missense_Mutation_p.T1366M|CLASP1_uc010yzb.1_RNA|CLASP1_uc010yzc.1_RNA|CLASP1_uc002tmy.2_Missense_Mutation_p.T269M	NM_015282	NP_056097	Q7Z460	CLAP1_HUMAN	CLIP-associating protein 1 isoform 1	1433	Localization to kinetochores.|Interaction with PHLDB2 and RSN.|Interaction with CLIP2 (By similarity).				axon guidance|cell division|establishment or maintenance of cell polarity|exit from mitosis|G2/M transition of mitotic cell cycle|microtubule anchoring|microtubule bundle formation|microtubule nucleation|microtubule organizing center organization|mitotic prometaphase|negative regulation of microtubule depolymerization	centrosomal corona|condensed chromosome kinetochore|cortical microtubule cytoskeleton|cytoplasmic microtubule|cytosol|Golgi apparatus|kinetochore microtubule	kinetochore binding|microtubule plus-end binding			ovary(1)|central_nervous_system(1)	2	Renal(3;0.0496)					GTAGTCGGCCGTCTGGATGAT	0.577													5	38	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	138414670	138414670	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138414670C>A	uc002tva.1	+	23	4228	c.4228C>A	c.(4228-4230)CTT>ATT	p.L1410I	THSD7B_uc010zbj.1_RNA	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GAAAGCAAGTCTTTGGAACAA	0.398													8	90	---	---	---	---	PASS
RBM43	375287	broad.mit.edu	37	2	152107863	152107863	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152107863G>A	uc002txh.2	-	4	779	c.631C>T	c.(631-633)CCT>TCT	p.P211S		NM_198557	NP_940959	Q6ZSC3	RBM43_HUMAN	RNA binding motif protein 43	211							nucleotide binding|RNA binding				0				BRCA - Breast invasive adenocarcinoma(221;0.131)		GCAGTCTCAGGTACTAAGGTC	0.393													13	156	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179425453	179425453	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179425453G>C	uc010zfg.1	-	275	77926	c.77702C>G	c.(77701-77703)TCT>TGT	p.S25901C	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S19596C|TTN_uc010zfi.1_Missense_Mutation_p.S19529C|TTN_uc010zfj.1_Missense_Mutation_p.S19404C	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	26828							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGGAAAGAGAGCATTTCTC	0.483													17	57	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	213291085	213291085	+	Intron	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:213291085G>C	uc002veg.1	-						ERBB4_uc002veh.1_Intron|ERBB4_uc010zji.1_Intron|ERBB4_uc010zjj.1_Intron|ERBB4_uc010fut.1_Intron|MIR548F-2_hsa-mir-548f-2|MI0006375_5'Flank	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene						cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		aTAGTTATTAGAAAGATGGTG	0.169										TSP Lung(8;0.080)			8	105	---	---	---	---	PASS
GMPPA	29926	broad.mit.edu	37	2	220371039	220371039	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220371039G>T	uc002vlr.2	+	12	1125	c.1057G>T	c.(1057-1059)GTG>TTG	p.V353L	GMPPA_uc002vls.2_Missense_Mutation_p.V353L|GMPPA_uc002vlt.2_Missense_Mutation_p.V406L|GMPPA_uc002vlu.2_Missense_Mutation_p.V406L|GMPPA_uc002vlv.2_Missense_Mutation_p.V353L|GMPPA_uc002vlw.2_RNA|GMPPA_uc002vlx.2_Missense_Mutation_p.V353L	NM_013335	NP_037467	Q96IJ6	GMPPA_HUMAN	GDP-mannose pyrophosphorylase A	353					dolichol-linked oligosaccharide biosynthetic process|GDP-mannose biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine		GTP binding|mannose-1-phosphate guanylyltransferase activity				0		Renal(207;0.0183)		Epithelial(149;3.82e-10)|all cancers(144;6.25e-08)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00807)|READ - Rectum adenocarcinoma(5;0.148)		CTGGGCCCGCGTGGAGGGTAC	0.622													35	108	---	---	---	---	PASS
CHPF	79586	broad.mit.edu	37	2	220404238	220404238	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220404238C>T	uc002vmc.3	-	4	2422	c.2195G>A	c.(2194-2196)CGG>CAG	p.R732Q	CHPF_uc010zlh.1_Missense_Mutation_p.R570Q	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	732	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CGTCTGGGCCCGGTAGCGCTG	0.667													4	58	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241468504	241468504	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241468504G>A	uc002vyz.1	-	4	865	c.636C>T	c.(634-636)ATC>ATT	p.I212I	ANKMY1_uc002vza.1_Intron|ANKMY1_uc010fzd.1_Silent_p.I301I|ANKMY1_uc002vzb.1_Intron|ANKMY1_uc002vzc.1_Intron|ANKMY1_uc002vzd.1_Intron|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	212							zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		GGGTCTCATTGATTATGAACC	0.507													18	189	---	---	---	---	PASS
KIF1A	547	broad.mit.edu	37	2	241722531	241722531	+	Intron	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241722531G>T	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		CCCCTCCTGCGGGCAGAAAAG	0.652													19	52	---	---	---	---	PASS
PDCD6IP	10015	broad.mit.edu	37	3	33906918	33906918	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33906918C>T	uc003cfx.2	+	17	2583	c.2428C>T	c.(2428-2430)CCT>TCT	p.P810S	PDCD6IP_uc003cfy.2_Missense_Mutation_p.P815S|PDCD6IP_uc011axw.1_Missense_Mutation_p.P591S	NM_013374	NP_037506	Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	810	Pro-rich.|Interaction with EIAV p9.|Self-association.				apoptosis|cell cycle|cell division|interspecies interaction between organisms|protein transport	cytosol|melanosome|microtubule organizing center	calcium-dependent protein binding			ovary(1)|skin(1)	2						TCCAGGATATCCTGGGTAAGG	0.547													14	57	---	---	---	---	PASS
PLXNB1	5364	broad.mit.edu	37	3	48453313	48453313	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48453313C>T	uc003csw.2	-	28	5476	c.5206G>A	c.(5206-5208)GAC>AAC	p.D1736N	PLXNB1_uc003cst.2_Missense_Mutation_p.D186N|PLXNB1_uc003csu.2_Missense_Mutation_p.D1553N|PLXNB1_uc003csx.2_Missense_Mutation_p.D1736N	NM_002673	NP_002664	O43157	PLXB1_HUMAN	plexin B1 precursor	1736	Cytoplasmic (Potential).				axon guidance|cell migration|intracellular signal transduction|regulation of cell shape|regulation of cytoskeleton organization|regulation of small GTPase mediated signal transduction|semaphorin-plexin signaling pathway	extracellular region|integral to plasma membrane|intracellular|semaphorin receptor complex	GTPase activator activity|semaphorin receptor activity|semaphorin receptor binding			ovary(2)|pancreas(1)|breast(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGGCGGTTGTCGTTCAAGGTG	0.582													16	135	---	---	---	---	PASS
C3orf62	375341	broad.mit.edu	37	3	49314135	49314135	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49314135C>T	uc003cwn.2	-	1	374	c.171G>A	c.(169-171)TCG>TCA	p.S57S	C3orf62_uc003cwm.2_5'Flank	NM_198562	NP_940964	Q6ZUJ4	CC062_HUMAN	hypothetical protein LOC375341	57											0				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GCACGGGCAGCGAGAAGGAGA	0.592													7	84	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96945212	96945212	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96945212G>A	uc010how.1	+	4	1262	c.1219G>A	c.(1219-1221)GAA>AAA	p.E407K	EPHA6_uc003drp.1_Missense_Mutation_p.E407K	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	312	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						CTGTCAGTGTGAAAAGGGTTA	0.398													19	259	---	---	---	---	PASS
OR5K3	403277	broad.mit.edu	37	3	98110363	98110363	+	Missense_Mutation	SNP	C	G	G	rs140041184	byFrequency	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98110363C>G	uc011bgw.1	+	1	854	c.854C>G	c.(853-855)CCT>CGT	p.P285R		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	285	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTATTAAATCCTTTTATTTAT	0.294													18	80	---	---	---	---	PASS
CPOX	1371	broad.mit.edu	37	3	98311835	98311835	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98311835C>T	uc003dsx.2	-	1	607	c.514G>A	c.(514-516)GGG>AGG	p.G172R	CPOX_uc011bgz.1_Missense_Mutation_p.G172R	NM_000097	NP_000088	P36551	HEM6_HUMAN	coproporphyrinogen oxidase precursor	172						mitochondrial intermembrane space	coproporphyrinogen oxidase activity|protein homodimerization activity				0						TTGGCGCCCCCGTCTACCTGT	0.637													3	34	---	---	---	---	PASS
ALCAM	214	broad.mit.edu	37	3	105260527	105260527	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:105260527G>A	uc003dvx.2	+	8	1449	c.909G>A	c.(907-909)GTG>GTA	p.V303V	ALCAM_uc003dvw.1_Silent_p.V303V|ALCAM_uc003dvy.2_Silent_p.V303V|ALCAM_uc011bhh.1_Silent_p.V252V|ALCAM_uc010hpp.2_Intron|ALCAM_uc003dvz.2_5'Flank	NM_001627	NP_001618	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	303	Extracellular (Potential).|Ig-like C2-type 1.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(2)|breast(1)	3						TGACGGATGTGAGGCGCAATG	0.418													22	77	---	---	---	---	PASS
RETNLB	84666	broad.mit.edu	37	3	108475982	108475982	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108475982C>T	uc003dxh.2	-	1	149	c.51G>A	c.(49-51)CTG>CTA	p.L17L		NM_032579	NP_115968	Q9BQ08	RETNB_HUMAN	resistin like beta precursor	17					cell proliferation	extracellular region	hormone activity			skin(1)	1						CCGGGTTGATCAGCTGGAGAA	0.522													19	63	---	---	---	---	PASS
PHLDB2	90102	broad.mit.edu	37	3	111632271	111632271	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111632271A>G	uc010hqa.2	+	3	1852	c.1441A>G	c.(1441-1443)AAG>GAG	p.K481E	PHLDB2_uc003dyc.2_Missense_Mutation_p.K508E|PHLDB2_uc003dyd.2_Missense_Mutation_p.K481E|PHLDB2_uc003dyg.2_Missense_Mutation_p.K481E|PHLDB2_uc003dyh.2_Missense_Mutation_p.K481E|PHLDB2_uc003dyi.2_Missense_Mutation_p.K67E|PHLDB2_uc003dyf.3_Missense_Mutation_p.K481E	NM_001134438	NP_001127910	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,	481						cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						GAAAATCAACAAGGAGCTTGA	0.517													32	159	---	---	---	---	PASS
ABHD10	55347	broad.mit.edu	37	3	111710348	111710348	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111710348C>G	uc003dyk.3	+	5	782	c.701C>G	c.(700-702)CCA>CGA	p.P234R	ABHD10_uc011bhq.1_Missense_Mutation_p.P77R	NM_018394	NP_060864	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10 precursor	234						mitochondrion	serine-type peptidase activity				0						TTACATAGCCCAATTCCTGTG	0.438													52	218	---	---	---	---	PASS
GCET2	257144	broad.mit.edu	37	3	111849292	111849292	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111849292C>T	uc003dys.1	-	2	248	c.98G>A	c.(97-99)AGA>AAA	p.R33K	C3orf52_uc011bht.1_3'UTR|C3orf52_uc003dyr.1_RNA|GCET2_uc003dyt.1_5'UTR	NM_152785	NP_689998	Q8N6F7	GCET2_HUMAN	germinal center expressed transcript 2 isoform	33						mitochondrion					0						TTGCTCTCACCTGGATGTTCT	0.498													24	311	---	---	---	---	PASS
MGLL	11343	broad.mit.edu	37	3	127454641	127454641	+	Intron	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127454641C>A	uc003ejx.2	-						MGLL_uc003ejw.2_Intron|MGLL_uc011bko.1_Intron|MGLL_uc010hsp.1_Intron|MGLL_uc003ejv.2_Nonsense_Mutation_p.E21*	NM_001003794	NP_001003794	Q99685	MGLL_HUMAN	monoglyceride lipase isoform 2						arachidonic acid metabolic process|fatty acid biosynthetic process|inflammatory response|platelet activation|regulation of endocannabinoid signaling pathway|regulation of inflammatory response|regulation of sensory perception of pain|triglyceride catabolic process	plasma membrane	acylglycerol lipase activity|carboxylesterase activity|lysophospholipase activity|protein homodimerization activity				0						TGTATAAATTCTGGCATTCTC	0.333													4	121	---	---	---	---	PASS
ESYT3	83850	broad.mit.edu	37	3	138174129	138174129	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138174129C>T	uc003esk.2	+	3	689	c.463C>T	c.(463-465)CTG>TTG	p.L155L	ESYT3_uc010hug.2_RNA	NM_031913	NP_114119	A0FGR9	ESYT3_HUMAN	family with sequence similarity 62 (C2 domain	155						integral to membrane|plasma membrane					0						GAGCATCCACCTGAGGACCTT	0.522													20	105	---	---	---	---	PASS
RNF7	9616	broad.mit.edu	37	3	141464056	141464056	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141464056G>A	uc003eud.2	+	3	412	c.279G>A	c.(277-279)GTG>GTA	p.V93V	RNF7_uc003euc.2_Silent_p.*91*|RNF7_uc003eue.2_RNA	NM_014245	NP_055060	Q9UBF6	RBX2_HUMAN	ring finger protein 7 isoform 1	93	RING-type.				anti-apoptosis|induction of apoptosis by oxidative stress|protein neddylation|response to redox state	cytoplasm|nucleus	copper ion binding|NEDD8 ligase activity|protein binding|zinc ion binding				0						CCCTGTGGGTGAAACAGAACA	0.453													11	115	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180378361	180378361	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180378361G>C	uc010hxe.2	-	4	628	c.513C>G	c.(511-513)ATC>ATG	p.I171M	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	171	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TTCTCACCCTGATTTTATTAT	0.358													5	21	---	---	---	---	PASS
LEPREL1	55214	broad.mit.edu	37	3	189692409	189692409	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189692409G>A	uc011bsk.1	-	9	1778	c.1390C>T	c.(1390-1392)CGG>TGG	p.R464W	LEPREL1_uc003fsg.2_Missense_Mutation_p.R283W	NM_018192	NP_060662	Q8IVL5	P3H2_HUMAN	leprecan-like 1 isoform a	464					collagen metabolic process|negative regulation of cell proliferation|peptidyl-proline hydroxylation	basement membrane|endoplasmic reticulum|Golgi apparatus	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-proline 3-dioxygenase activity			breast(3)|ovary(1)	4	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AGGAGAACCCGCTGAGTCCCG	0.567													8	76	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8583059	8583059	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8583059G>A	uc003glk.2	+	1	769	c.350G>A	c.(349-351)CGC>CAC	p.R117H	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	117	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						TACGCCGGACGCCTGCGACCG	0.697													6	16	---	---	---	---	PASS
GPR78	27201	broad.mit.edu	37	4	8584304	8584304	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8584304G>C	uc003glk.2	+	2	1134	c.715G>C	c.(715-717)GCC>CCC	p.A239P	CPZ_uc003gll.2_RNA	NM_080819	NP_543009	Q96P69	GPR78_HUMAN	G protein-coupled receptor 78	239	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			central_nervous_system(4)|ovary(2)	6						CCGCCACCGCGCCACCAGGAA	0.622													18	92	---	---	---	---	PASS
UGT2A3	79799	broad.mit.edu	37	4	69811154	69811154	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:69811154C>A	uc003hef.2	-	2	765	c.734G>T	c.(733-735)TGT>TTT	p.C245F	UGT2A3_uc010ihp.1_RNA	NM_024743	NP_079019	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family,	245	Extracellular (Potential).					integral to membrane	glucuronosyltransferase activity			ovary(1)|skin(1)	2						CACAGTCTCACATAATGTAGT	0.328													17	94	---	---	---	---	PASS
GRSF1	2926	broad.mit.edu	37	4	71698953	71698953	+	Silent	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71698953A>G	uc010iia.1	-	3	635	c.552T>C	c.(550-552)TTT>TTC	p.F184F	GRSF1_uc011caz.1_Silent_p.F66F|GRSF1_uc003hfs.2_Silent_p.F22F	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1 isoform 1	184	RRM 1.				mRNA polyadenylation		mRNA binding|nucleotide binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			TGTTTAGGAGAAAATGTATTC	0.403													7	91	---	---	---	---	PASS
HERC3	8916	broad.mit.edu	37	4	89571022	89571022	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89571022C>G	uc003hrw.1	+	4	424	c.258C>G	c.(256-258)ATC>ATG	p.I86M	HERC3_uc003hrv.2_Missense_Mutation_p.I86M|HERC3_uc011cdn.1_Translation_Start_Site	NM_014606	NP_055421	Q15034	HERC3_HUMAN	hect domain and RLD 3	86	RCC1 2.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasmic membrane-bounded vesicle	ubiquitin-protein ligase activity			lung(2)|prostate(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000319)		ATCAGCATATCATTCATGTGG	0.498													5	112	---	---	---	---	PASS
ADH5	128	broad.mit.edu	37	4	99993574	99993574	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99993574C>G	uc003hui.2	-	9	1199	c.1119G>C	c.(1117-1119)AAG>AAC	p.K373N	ADH5_uc003huj.2_3'UTR	NM_000671	NP_000662	P11766	ADHX_HUMAN	class III alcohol dehydrogenase, chi subunit	373					ethanol oxidation|response to redox state		alcohol dehydrogenase (NAD) activity|electron carrier activity|fatty acid binding|formaldehyde dehydrogenase activity|S-(hydroxymethyl)glutathione dehydrogenase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)	NADH(DB00157)	TGAATTAAATCTTTACAACAG	0.398													5	74	---	---	---	---	PASS
UGT8	7368	broad.mit.edu	37	4	115589240	115589240	+	Splice_Site	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115589240G>A	uc003ibs.2	+	5	1565	c.1043_splice	c.e5-1	p.G348_splice	UGT8_uc003ibt.2_Splice_Site_p.G348_splice|UGT8_uc011cge.1_Splice_Site	NM_001128174	NP_001121646	Q16880	CGT_HUMAN	UDP-galactose-ceramide galactosyltransferase 8						central nervous system development|peripheral nervous system development	integral to membrane	2-hydroxyacylsphingosine 1-beta-galactosyltransferase activity|UDP-galactose:glucosylceramide beta-1,4-galactosyltransferase activity			ovary(1)|skin(1)	2		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000632)		TCTTTCTTCAGGGCATTCAAA	0.358													21	122	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125599867	125599867	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125599867G>A	uc003ifg.3	-	2	972	c.706C>T	c.(706-708)CGA>TGA	p.R236*	ANKRD50_uc011cgo.1_Nonsense_Mutation_p.R57*|ANKRD50_uc010inw.2_Nonsense_Mutation_p.R236*	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	236										central_nervous_system(1)	1						CTCTGCTTTCGGGCAGAACAG	0.408													6	227	---	---	---	---	PASS
KIAA0922	23240	broad.mit.edu	37	4	154507539	154507539	+	Intron	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154507539C>G	uc003inm.3	+						KIAA0922_uc010ipp.2_Intron|KIAA0922_uc010ipq.2_Intron|KIAA0922_uc010ips.1_Intron	NM_015196	NP_056011	A2VDJ0	T131L_HUMAN	hypothetical protein LOC23240 isoform 2							integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2	all_hematologic(180;0.093)	Renal(120;0.118)				AAGGTATTTTCTACAATACTA	0.313													11	88	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	37001175	37001175	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37001175C>T	uc003jkl.3	+	14	4158	c.3659C>T	c.(3658-3660)GCG>GTG	p.A1220V	NIPBL_uc003jkk.3_Missense_Mutation_p.A1220V	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	1220					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GATTTTACTGCGTTTGGTAAA	0.333													9	180	---	---	---	---	PASS
SLC38A9	153129	broad.mit.edu	37	5	54968400	54968400	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54968400G>T	uc003jqf.2	-	4	438	c.237C>A	c.(235-237)GAC>GAA	p.D79E	SLC38A9_uc003jqd.2_Missense_Mutation_p.D16E|SLC38A9_uc010ivx.2_Missense_Mutation_p.D52E|SLC38A9_uc003jqe.2_RNA|SLC38A9_uc010ivy.2_Intron	NM_173514	NP_775785	Q8NBW4	S38A9_HUMAN	solute carrier family 38, member 9	79					amino acid transport|sodium ion transport	integral to membrane					0		Lung NSC(810;0.00122)|Prostate(74;0.0376)|Breast(144;0.181)				CCAGTGCCTTGTCTGCAGGAG	0.428													4	192	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120022385	120022385	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120022385C>A	uc003ksq.2	+	2	1059	c.896C>A	c.(895-897)TCA>TAA	p.S299*	PRR16_uc003ksp.2_Nonsense_Mutation_p.S276*|PRR16_uc003ksr.2_Nonsense_Mutation_p.S229*	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	299										pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		TTGAGGAAGTCAACCACTACA	0.378													4	59	---	---	---	---	PASS
PRRC1	133619	broad.mit.edu	37	5	126883605	126883605	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126883605G>C	uc003kuk.2	+	8	1300	c.1120G>C	c.(1120-1122)GTA>CTA	p.V374L	PRRC1_uc003kuj.3_Missense_Mutation_p.V374L	NM_130809	NP_570721	Q96M27	PRRC1_HUMAN	proline-rich coiled-coil 1	374						Golgi apparatus					0		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0851)|Epithelial(69;0.113)		TTTGGAATTTGTACAGCAGGT	0.368													10	74	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139216784	139216784	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139216784C>G	uc003leu.1	+	11	1831	c.1626C>G	c.(1624-1626)TTC>TTG	p.F542L		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	542	PH.				regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGAAGAAATTCTACGCAGTGC	0.622													8	133	---	---	---	---	PASS
C5orf32	84418	broad.mit.edu	37	5	139622978	139622978	+	Silent	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139622978C>G	uc003lfd.2	+	3	514	c.276C>G	c.(274-276)CTC>CTG	p.L92L	C5orf32_uc010jfi.2_RNA	NM_032412	NP_115788	Q9H1C7	CE032_HUMAN	hypothetical protein LOC84418	92											0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGCTGTCTCTGGGACATGC	0.582													4	46	---	---	---	---	PASS
CD14	929	broad.mit.edu	37	5	140012007	140012007	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140012007C>A	uc003lgi.1	-	2	916	c.562G>T	c.(562-564)GAA>TAA	p.E188*	CD14_uc003lgj.1_Nonsense_Mutation_p.E188*	NM_000591	NP_000582	P08571	CD14_HUMAN	CD14 antigen precursor	188	LRR 5.				apoptosis|cellular response to lipopolysaccharide|cellular response to lipoteichoic acid|inflammatory response|innate immune response|phagocytosis|positive regulation of tumor necrosis factor production|Toll signaling pathway	anchored to membrane|plasma membrane	lipopolysaccharide binding|lipoteichoic acid binding|opsonin receptor activity|peptidoglycan receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGAACCTGTTCGCAGGAAAAG	0.622													4	83	---	---	---	---	PASS
CD14	929	broad.mit.edu	37	5	140012199	140012199	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140012199C>G	uc003lgi.1	-	2	724	c.370G>C	c.(370-372)GAG>CAG	p.E124Q	CD14_uc003lgj.1_Missense_Mutation_p.E124Q	NM_000591	NP_000582	P08571	CD14_HUMAN	CD14 antigen precursor	124	LRR 3.				apoptosis|cellular response to lipopolysaccharide|cellular response to lipoteichoic acid|inflammatory response|innate immune response|phagocytosis|positive regulation of tumor necrosis factor production|Toll signaling pathway	anchored to membrane|plasma membrane	lipopolysaccharide binding|lipoteichoic acid binding|opsonin receptor activity|peptidoglycan receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTAGGTCCTCGAGCGTCAGT	0.632													8	90	---	---	---	---	PASS
PCDHA6	56142	broad.mit.edu	37	5	140208509	140208509	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140208509C>T	uc003lho.2	+	1	860	c.833C>T	c.(832-834)TCA>TTA	p.S278L	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Missense_Mutation_p.S278L|PCDHA6_uc011dab.1_Missense_Mutation_p.S278L	NM_018909	NP_061732	Q9UN73	PCDA6_HUMAN	protocadherin alpha 6 isoform 1 precursor	278	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	extracellular region|integral to plasma membrane	calcium ion binding|protein binding			haematopoietic_and_lymphoid_tissue(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGGCAATTTCATATTCTTTT	0.388													29	186	---	---	---	---	PASS
PCDHGC3	5098	broad.mit.edu	37	5	140856583	140856583	+	Silent	SNP	A	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140856583A>T	uc003lkv.1	+	1	1015	c.900A>T	c.(898-900)GTA>GTT	p.V300V	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lkp.1_Intron|PCDHGA11_uc003lkq.1_Intron|PCDHGA12_uc003lkt.1_Intron|PCDHGC3_uc003lku.1_Silent_p.V300V|PCDHGC3_uc003lkw.1_Intron	NM_002588	NP_002579	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3 isoform 1	300	Cadherin 3.|Extracellular (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGACCTTGTAACCGGGATGC	0.547													20	164	---	---	---	---	PASS
GLRA1	2741	broad.mit.edu	37	5	151230968	151230968	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:151230968G>C	uc003lut.2	-	7	1182	c.895C>G	c.(895-897)CGA>GGA	p.R299G	GLRA1_uc003lur.2_Missense_Mutation_p.R299G|GLRA1_uc003lus.2_Missense_Mutation_p.R216G	NM_001146040	NP_001139512	P23415	GLRA1_HUMAN	glycine receptor, alpha 1 isoform 1 precursor	299			R -> L (in STHE; decreased potency of glycine to activate the channel).|R -> Q (in STHE; decreased potency of glycine to activate the channel).		muscle contraction|negative regulation of transmission of nerve impulse|neuropeptide signaling pathway|positive regulation of acrosome reaction|regulation of membrane potential|startle response	cell junction|chloride channel complex|integral to plasma membrane|intracellular membrane-bounded organelle|postsynaptic membrane	extracellular-glycine-gated chloride channel activity|glycine binding|protein binding|receptor activity|taurine binding|transmitter-gated ion channel activity			ovary(1)|central_nervous_system(1)	2		all_hematologic(541;0.0341)|Medulloblastoma(196;0.0912)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Ethanol(DB00898)|Glycine(DB00145)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGAGATGCTCGAGAGCCGGAG	0.547													6	59	---	---	---	---	PASS
GRIA1	2890	broad.mit.edu	37	5	153149833	153149833	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153149833T>A	uc003lva.3	+	13	2493	c.2128T>A	c.(2128-2130)TCC>ACC	p.S710T	GRIA1_uc003luy.3_Missense_Mutation_p.S710T|GRIA1_uc003luz.3_Missense_Mutation_p.S615T|GRIA1_uc011dcv.1_RNA|GRIA1_uc011dcw.1_Missense_Mutation_p.S630T|GRIA1_uc011dcx.1_Missense_Mutation_p.S641T|GRIA1_uc011dcy.1_Missense_Mutation_p.S720T|GRIA1_uc011dcz.1_Missense_Mutation_p.S720T	NM_001114183	NP_001107655	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1 isoform	710	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic spine|endocytic vesicle membrane|endoplasmic reticulum membrane|neuronal cell body|postsynaptic density|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity|PDZ domain binding			ovary(4)|skin(2)	6		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|L-Glutamic Acid(DB00142)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	AGTGAGGAAATCCAAAGGCAA	0.473													15	79	---	---	---	---	PASS
SOX30	11063	broad.mit.edu	37	5	157065554	157065554	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157065554G>A	uc003lxb.1	-	4	1906	c.1564C>T	c.(1564-1566)CAT>TAT	p.H522Y	SOX30_uc003lxc.1_Intron|SOX30_uc011dds.1_Missense_Mutation_p.H217Y	NM_178424	NP_848511	O94993	SOX30_HUMAN	SRY (sex determining region Y)-box 30 isoform a	522					regulation of transcription from RNA polymerase II promoter|regulation of transcription, DNA-dependent|response to corticosteroid stimulus|transcription, DNA-dependent	nucleus|nucleus	sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)|central_nervous_system(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TGCAGCTGATGAGTGTCTGTT	0.542													7	86	---	---	---	---	PASS
GABRA6	2559	broad.mit.edu	37	5	161128560	161128560	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161128560A>G	uc003lyu.2	+	9	1481	c.1143A>G	c.(1141-1143)ATA>ATG	p.I381M	GABRA6_uc003lyv.2_Missense_Mutation_p.I152M	NM_000811	NP_000802	Q16445	GBRA6_HUMAN	gamma-aminobutyric acid A receptor, alpha 6	381	Cytoplasmic (Probable).				gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	benzodiazepine receptor activity|chloride channel activity			ovary(7)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Alprazolam(DB00404)|Ethchlorvynol(DB00189)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Lorazepam(DB00186)|Meprobamate(DB00371)|Midazolam(DB00683)	CTTTGCCAATAGTTTCATCTT	0.448										TCGA Ovarian(5;0.080)			39	163	---	---	---	---	PASS
ADAMTS2	9509	broad.mit.edu	37	5	178541089	178541089	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178541089G>C	uc003mjw.2	-	22	3415	c.3415C>G	c.(3415-3417)CCC>GCC	p.P1139A	uc003mjv.3_5'Flank	NM_014244	NP_055059	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1139					collagen catabolic process	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		ACCTCCAGGGGGGTGCTTGGT	0.572													31	153	---	---	---	---	PASS
SERPINB6	5269	broad.mit.edu	37	6	2954823	2954823	+	Intron	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2954823C>T	uc003muk.2	-						SERPINB6_uc003mui.2_Intron|SERPINB6_uc003muj.2_Intron|SERPINB6_uc003mul.2_Intron|SERPINB6_uc003mum.2_Intron|SERPINB6_uc003mun.2_Intron|SERPINB6_uc003muo.2_Intron	NM_004568	NP_004559	P35237	SPB6_HUMAN	serine (or cysteine) proteinase inhibitor, clade						regulation of proteolysis	centrosome|cytosol|protein complex	protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Drotrecogin alfa(DB00055)	AATACATTTTCACCTTCTGTC	0.353													13	161	---	---	---	---	PASS
TRIM15	89870	broad.mit.edu	37	6	30131596	30131596	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30131596G>C	uc010jrx.2	+	1	614	c.135G>C	c.(133-135)CAG>CAC	p.Q45H	TRIM10_uc003npn.2_5'Flank|TRIM10_uc003npo.3_5'Flank	NM_033229	NP_150232	Q9C019	TRI15_HUMAN	tripartite motif protein 15	45	RING-type.				mesodermal cell fate determination	intracellular	zinc ion binding				0						CGCTCTCCCAGATGGGGGCCC	0.687													7	64	---	---	---	---	PASS
HLA-DMB	3109	broad.mit.edu	37	6	32905234	32905234	+	Splice_Site	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32905234C>A	uc003ocl.1	-	3	571	c.338_splice	c.e3-1	p.R113_splice	HLA-DMB_uc003ocj.1_3'UTR|HLA-DMB_uc003ock.1_5'Flank|HLA-DMB_uc010jud.1_Splice_Site|HLA-DMB_uc010jue.1_Splice_Site|HLA-DMB_uc010juf.1_Splice_Site|HLA-DMB_uc011dql.1_Intron	NM_002118	NP_002109	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						GATGGTGGCCCTGCATAGGAG	0.493													25	143	---	---	---	---	PASS
MAPK13	5603	broad.mit.edu	37	6	36103596	36103596	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36103596G>C	uc003ols.2	+	4	473	c.375G>C	c.(373-375)GAG>GAC	p.E125D	MAPK13_uc003olt.2_RNA	NM_002754	NP_002745	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	125	Protein kinase.				cell cycle|intracellular protein kinase cascade|nerve growth factor receptor signaling pathway|positive regulation of interleukin-6 production|Ras protein signal transduction|response to stress		ATP binding|MAP kinase activity|protein binding			breast(2)|central_nervous_system(1)	3						TCAGTGAGGAGAAGATCCAGT	0.552													23	109	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38793996	38793996	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38793996G>C	uc003ooe.1	+	27	3861	c.3261G>C	c.(3259-3261)CTG>CTC	p.L1087L		NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						GTCGATATCTGAATGAAGAAT	0.323													18	77	---	---	---	---	PASS
BEND6	221336	broad.mit.edu	37	6	56857268	56857268	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56857268C>T	uc010kab.2	+	3	799	c.213C>T	c.(211-213)TGC>TGT	p.C71C	BEND6_uc003pdg.2_RNA	NM_152731	NP_689944	Q5SZJ8	BEND6_HUMAN	BEN domain containing 6	71	Potential.										0						AAGAATTGTGCGCCAAAATAA	0.413													11	211	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	70037782	70037782	+	Splice_Site	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:70037782G>T	uc003pev.3	+	22	3483	c.3035_splice	c.e22+1	p.Y1012_splice	BAI3_uc010kak.2_Splice_Site_p.Y1012_splice|BAI3_uc011dxx.1_Splice_Site_p.Y218_splice|BAI3_uc003pex.1_Splice_Site_p.Y142_splice	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				CTGATCACTAGTAAGTCCATC	0.393													19	82	---	---	---	---	PASS
FAM135A	57579	broad.mit.edu	37	6	71235668	71235668	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71235668A>G	uc003pfj.2	+	13	3014	c.2881A>G	c.(2881-2883)ACA>GCA	p.T961A	FAM135A_uc003pfi.2_Missense_Mutation_p.T765A|FAM135A_uc003pfh.2_Missense_Mutation_p.T748A|FAM135A_uc003pfl.2_Missense_Mutation_p.T628A|FAM135A_uc003pfn.2_Missense_Mutation_p.T167A|FAM135A_uc003pfo.1_Missense_Mutation_p.T332A|FAM135A_uc010kan.1_5'Flank	NM_001162529	NP_001156001	Q9P2D6	F135A_HUMAN	hypothetical protein LOC57579 isoform c	961										central_nervous_system(1)	1						TAATAACTCTACAGGGACAGC	0.368													21	74	---	---	---	---	PASS
GABRR2	2570	broad.mit.edu	37	6	89967576	89967576	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89967576T>C	uc003pnb.2	-	9	1294	c.1286A>G	c.(1285-1287)CAA>CGA	p.Q429R	GABRR2_uc011dzx.1_Missense_Mutation_p.Q305R	NM_002043	NP_002034	P28476	GBRR2_HUMAN	gamma-aminobutyric acid (GABA) receptor, rho 2	429	Cytoplasmic (Probable).				synaptic transmission	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity				0		all_cancers(76;1.67e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.49e-10)|all_hematologic(105;7.77e-07)|all_epithelial(107;2.51e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0158)		TATTTTGTCTTGCCTTTCTTC	0.517													7	73	---	---	---	---	PASS
PRDM13	59336	broad.mit.edu	37	6	100061058	100061058	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100061058C>A	uc003pqg.1	+	4	808	c.547C>A	c.(547-549)CCA>ACA	p.P183T		NM_021620	NP_067633	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	183					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		AGGCGCCGTCCCAGCGGCTGA	0.697													15	33	---	---	---	---	PASS
VGLL2	245806	broad.mit.edu	37	6	117586987	117586987	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117586987G>T	uc003pxn.2	+	1	251	c.61G>T	c.(61-63)GCC>TCC	p.A21S	VGLL2_uc003pxo.2_Missense_Mutation_p.A21S	NM_182645	NP_872586	Q8N8G2	VGLL2_HUMAN	vestigial-like 2 isoform 1	21					transcription, DNA-dependent	nucleus				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(226;0.0254)|all cancers(137;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.0757)		CTTCGCAGCCGCCTACACCCC	0.582													4	74	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129826502	129826502	+	Splice_Site	SNP	T	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129826502T>A	uc003qbn.2	+	60	8808	c.8703_splice	c.e60+2	p.P2901_splice	LAMA2_uc003qbo.2_Splice_Site_p.P2897_splice|uc003qbq.2_Intron	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor						cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ATTGGTCCAGTAAATATCTGA	0.383													28	97	---	---	---	---	PASS
OPRM1	4988	broad.mit.edu	37	6	154412236	154412236	+	Missense_Mutation	SNP	C	T	T	rs17174822	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154412236C>T	uc003qpr.2	+	3	1030	c.793C>T	c.(793-795)CGC>TGC	p.R265C	OPRM1_uc011efc.1_Missense_Mutation_p.R184C|OPRM1_uc011efd.1_Missense_Mutation_p.R165C|OPRM1_uc011efe.1_Missense_Mutation_p.R358C|OPRM1_uc003qpn.2_Missense_Mutation_p.R265C|OPRM1_uc003qpo.1_Missense_Mutation_p.R265C|OPRM1_uc011eff.1_Missense_Mutation_p.R265C|OPRM1_uc011efg.1_Missense_Mutation_p.R265C|OPRM1_uc011efh.1_Missense_Mutation_p.R265C|OPRM1_uc003qpq.1_Missense_Mutation_p.R265C|OPRM1_uc003qpt.1_Missense_Mutation_p.R265C|OPRM1_uc011efi.1_Missense_Mutation_p.R265C|OPRM1_uc003qpp.2_RNA|OPRM1_uc003qps.2_RNA|OPRM1_uc010kjg.2_Missense_Mutation_p.R165C|OPRM1_uc003qpu.2_Missense_Mutation_p.R165C	NM_000914	NP_000905	P35372	OPRM_HUMAN	opioid receptor, mu 1 isoform MOR-1	265	Cytoplasmic (Potential).				behavior|negative regulation of cell proliferation|sensory perception	endoplasmic reticulum|Golgi apparatus|integral to plasma membrane	mu-opioid receptor activity|protein binding			ovary(1)	1		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;9.26e-11)|BRCA - Breast invasive adenocarcinoma(81;0.0154)	Alfentanil(DB00802)|Anileridine(DB00913)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dezocine(DB01209)|Diphenoxylate(DB01081)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Levallorphan(DB00504)|Levomethadyl Acetate(DB01227)|Levorphanol(DB00854)|Loperamide(DB00836)|Methadone(DB00333)|Methadyl Acetate(DB01433)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Oxymorphone(DB01192)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tramadol(DB00193)	CAAGAGTGTCCGCATGCTCTC	0.502													8	100	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160525834	160525834	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160525834C>T	uc003qta.2	+	48	7342	c.7194C>T	c.(7192-7194)GCC>GCT	p.A2398A		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	2398	Cytoplasmic (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		CAGTGAAAGCCCTCAGCTCCC	0.572													3	72	---	---	---	---	PASS
PMS2	5395	broad.mit.edu	37	7	6026709	6026709	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6026709G>A	uc003spl.2	-	11	1774	c.1687C>T	c.(1687-1689)CGA>TGA	p.R563*	PMS2_uc003spj.2_Nonsense_Mutation_p.R457*|PMS2_uc003spk.2_Nonsense_Mutation_p.R428*|PMS2_uc011jwl.1_Nonsense_Mutation_p.R428*|PMS2_uc010ktg.2_Nonsense_Mutation_p.R252*|PMS2_uc010kte.2_Intron|PMS2_uc010ktf.1_Intron	NM_000535	NP_000526	P54278	PMS2_HUMAN	PMS2 postmeiotic segregation increased 2 isoform	563					mismatch repair|reciprocal meiotic recombination|somatic hypermutation of immunoglobulin genes	MutLalpha complex	ATP binding|ATPase activity|endonuclease activity|protein binding|single base insertion or deletion binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0694)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)|OV - Ovarian serous cystadenocarcinoma(56;4.39e-15)		GGCAAAACTCGAAATTTACAT	0.408			Mis|N|F			colorectal|endometrial|ovarian|medulloblastoma|glioma		Direct_reversal_of_damage|MMR	Lynch_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				47	336	---	---	---	---	PASS
RSBN1L	222194	broad.mit.edu	37	7	77325886	77325886	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77325886C>T	uc010ldt.1	+	1	144	c.100C>T	c.(100-102)CGG>TGG	p.R34W	RSBN1L_uc003ugm.2_5'Flank|uc003ugj.1_RNA	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	34						nucleus				ovary(1)	1						ACTCTCCTCCCGGGACCCTCC	0.667													19	68	---	---	---	---	PASS
RSBN1L	222194	broad.mit.edu	37	7	77407731	77407731	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77407731C>T	uc010ldt.1	+	7	1914	c.1870C>T	c.(1870-1872)CAG>TAG	p.Q624*	RSBN1L_uc003ugm.2_Nonsense_Mutation_p.Q406*	NM_198467	NP_940869	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	624						nucleus				ovary(1)	1						TCAACGAATGCAGTTAGATTT	0.323													12	154	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82584106	82584106	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82584106C>T	uc003uhx.2	-	5	6452	c.6163G>A	c.(6163-6165)GAA>AAA	p.E2055K	PCLO_uc003uhv.2_Missense_Mutation_p.E2055K	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1986					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						AGTTTCCTTTCTTCTTCTGTA	0.443													18	77	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82784553	82784553	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82784553C>A	uc003uhx.2	-	2	1693	c.1404G>T	c.(1402-1404)AAG>AAT	p.K468N	PCLO_uc003uhv.2_Missense_Mutation_p.K468N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	419	Gln-rich.|Pro-rich.|10 X 10 AA tandem approximate repeats of P-A-K-P-Q-P-Q-Q-P-X.				cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GTGAAGGAGGCTTTGTTGGGC	0.607													10	124	---	---	---	---	PASS
CCDC132	55610	broad.mit.edu	37	7	92938172	92938172	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92938172G>C	uc003umo.2	+	19	1794	c.1666G>C	c.(1666-1668)GAG>CAG	p.E556Q	CCDC132_uc003umq.2_RNA|CCDC132_uc003ump.2_Missense_Mutation_p.E526Q|CCDC132_uc003umr.2_RNA|CCDC132_uc011khz.1_Missense_Mutation_p.E276Q	NM_017667	NP_060137	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132 isoform a	556											0	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			TGCCTATCAAGAGTATGACAG	0.403													6	101	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100676942	100676942	+	Silent	SNP	T	C	C	rs71557224		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100676942T>C	uc003uxp.1	+	3	2298	c.2245T>C	c.(2245-2247)TTA>CTA	p.L749L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	749	Extracellular (Potential).|Ser-rich.|10.|59 X approximate tandem repeats.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					AAGCACTCCATTAACAAGTAT	0.488													13	394	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678647	100678647	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678647C>T	uc003uxp.1	+	3	4003	c.3950C>T	c.(3949-3951)TCA>TTA	p.S1317L	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1317	Extracellular (Potential).|20.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GAAGTCAGTTCATCTCCTACA	0.488													53	305	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100678759	100678759	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100678759C>T	uc003uxp.1	+	3	4115	c.4062C>T	c.(4060-4062)ATC>ATT	p.I1354I	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	1354	Extracellular (Potential).|20.|59 X approximate tandem repeats.|Ser-rich.					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GTTCTGCAATCAGCATCCTTT	0.468													58	336	---	---	---	---	PASS
ATXN7L1	222255	broad.mit.edu	37	7	105516986	105516986	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105516986G>C	uc003vde.2	-	1	46	c.19C>G	c.(19-21)CGA>GGA	p.R7G	ATXN7L1_uc003vdi.2_Missense_Mutation_p.R7G|CDHR3_uc003vdk.2_5'Flank|uc003vdj.1_5'Flank	NM_020725	NP_065776	Q9ULK2	AT7L1_HUMAN	ataxin 7-like 1 isoform 1	7											0						CACGGGATTCGAGAACGCTCC	0.418													3	42	---	---	---	---	PASS
PTN	5764	broad.mit.edu	37	7	136938275	136938275	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136938275C>T	uc003vtq.2	-	3	588	c.225G>A	c.(223-225)GAG>GAA	p.E75E	PTN_uc010lmx.2_Silent_p.E75E|PTN_uc003vtr.1_Silent_p.E75E	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin	75				E -> G (in Ref. 9; AAV38498).	nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity	p.E75Q(1)		upper_aerodigestive_tract(1)|pancreas(1)	2						TTTGCTTGCACTCAGCTCCAG	0.537													13	90	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147259273	147259273	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147259273G>C	uc003weu.1	+	12	2337	c.1821G>C	c.(1819-1821)CAG>CAC	p.Q607H		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	607	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			ACCTAGGACAGACATCAAATT	0.428										HNSCC(39;0.1)			13	110	---	---	---	---	PASS
EZH2	2146	broad.mit.edu	37	7	148515180	148515180	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148515180G>C	uc003wfd.1	-	10	1180	c.1014C>G	c.(1012-1014)CTC>CTG	p.L338L	EZH2_uc011kug.1_Silent_p.L329L|EZH2_uc003wfb.1_Silent_p.L343L|EZH2_uc003wfc.1_Silent_p.L299L|EZH2_uc011kuh.1_Silent_p.L329L|EZH2_uc011kui.1_Silent_p.L338L|EZH2_uc011kuj.1_RNA	NM_004456	NP_004447	Q15910	EZH2_HUMAN	enhancer of zeste 2 isoform a	338	Interaction with DNMT1, DNMT3A and DNMT3B.				negative regulation of retinoic acid receptor signaling pathway|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	ESC/E(Z) complex	DNA binding|histone-lysine N-methyltransferase activity|protein binding			haematopoietic_and_lymphoid_tissue(180)|skin(2)|large_intestine(1)	183	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			GCTCAGCGGTGAGAGCAGCAG	0.478			Mis		DLBCL								17	224	---	---	---	---	PASS
UBXN8	7993	broad.mit.edu	37	8	30623805	30623805	+	Silent	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:30623805C>A	uc003xii.2	+	10	725	c.708C>A	c.(706-708)TCC>TCA	p.S236S	UBXN8_uc010lvi.2_3'UTR|UBXN8_uc011lbb.1_RNA|UBXN8_uc003xij.2_RNA	NM_005671	NP_005662	O00124	UBXN8_HUMAN	reproduction 8	236	UBX.				single fertilization						0						TTTCTACTTCCTTTCCCAGAC	0.473													4	66	---	---	---	---	PASS
HTRA4	203100	broad.mit.edu	37	8	38832597	38832597	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38832597G>A	uc003xmj.2	+	2	629	c.514G>A	c.(514-516)GCG>ACG	p.A172T		NM_153692	NP_710159	P83105	HTRA4_HUMAN	HtrA serine peptidase 4 precursor	172					proteolysis|regulation of cell growth	extracellular region	insulin-like growth factor binding|serine-type endopeptidase activity				0		all_lung(54;0.0344)|Hepatocellular(245;0.0512)|Lung NSC(58;0.0955)	LUSC - Lung squamous cell carcinoma(45;1.5e-07)			CTTCATCGCCGCGGTGGTGGA	0.567													13	869	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38880712	38880712	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38880712G>C	uc003xmr.2	+	9	860	c.782G>C	c.(781-783)GGA>GCA	p.G261A	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	261	Extracellular (Potential).|Peptidase M12B.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			GTGCTAGTTGGACTGGAGATT	0.373													81	735	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38880725	38880725	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38880725G>C	uc003xmr.2	+	9	873	c.795G>C	c.(793-795)TGG>TGC	p.W265C	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	265	Extracellular (Potential).|Peptidase M12B.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TGGAGATTTGGACCAATGGAA	0.398													197	651	---	---	---	---	PASS
ADAM9	8754	broad.mit.edu	37	8	38880818	38880818	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38880818G>C	uc003xmr.2	+	9	966	c.888G>C	c.(886-888)CGG>CGC	p.R296R	ADAM9_uc011lcf.1_RNA|ADAM9_uc011lcg.1_RNA|ADAM9_uc010lwr.2_RNA	NM_003816	NP_003807	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9 isoform 1	296	Extracellular (Potential).|Peptidase M12B.				activation of MAPKK activity|cell-cell adhesion mediated by integrin|cell-matrix adhesion|keratinocyte differentiation|monocyte activation|PMA-inducible membrane protein ectodomain proteolysis|PMA-inducible membrane protein ectodomain proteolysis|positive regulation of cell adhesion mediated by integrin|positive regulation of keratinocyte migration|positive regulation of macrophage fusion|positive regulation of membrane protein ectodomain proteolysis|positive regulation of protein secretion|response to calcium ion|response to glucocorticoid stimulus|response to hydrogen peroxide|response to manganese ion|response to tumor necrosis factor|transforming growth factor beta receptor signaling pathway	extracellular space|extracellular space|integral to membrane|intrinsic to external side of plasma membrane	collagen binding|integrin binding|laminin binding|metalloendopeptidase activity|protein kinase C binding|SH3 domain binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			TCACACGTCGGAGACATGACA	0.348													82	525	---	---	---	---	PASS
IKBKB	3551	broad.mit.edu	37	8	42176941	42176941	+	Splice_Site	SNP	T	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42176941T>G	uc003xow.1	+	14	1693	c.1516_splice	c.e14+2	p.T506_splice	IKBKB_uc010lxh.1_Missense_Mutation_p.S401R|IKBKB_uc011lco.1_Splice_Site|IKBKB_uc010lxj.1_Splice_Site_p.T283_splice|IKBKB_uc003xox.1_Splice_Site_p.T227_splice|IKBKB_uc011lcp.1_Splice_Site|IKBKB_uc011lcq.1_Splice_Site_p.T504_splice|IKBKB_uc010lxi.1_Splice_Site|IKBKB_uc011lcr.1_Splice_Site_p.T447_splice	NM_001556	NP_001547	O14920	IKKB_HUMAN	inhibitor of nuclear factor kappa B kinase beta						anti-apoptosis|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane|membrane raft	ATP binding|identical protein binding|IkappaB kinase activity			breast(3)|ovary(2)|lung(1)|skin(1)	7	all_cancers(6;1.42e-24)|all_epithelial(6;1.02e-25)|all_lung(13;6.21e-12)|Lung NSC(13;1.04e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000434)|Lung NSC(58;0.00161)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;1.37e-10)|Colorectal(10;0.00102)|OV - Ovarian serous cystadenocarcinoma(14;0.00168)|Lung(22;0.00467)|LUSC - Lung squamous cell carcinoma(45;0.024)|COAD - Colon adenocarcinoma(11;0.0264)		Arsenic trioxide(DB01169)|Auranofin(DB00995)	TTGGGATCAGTGAGTGTGCAC	0.393											OREG0018747	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	168	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55541754	55541754	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55541754C>T	uc003xsd.1	+	4	5460	c.5312C>T	c.(5311-5313)TCA>TTA	p.S1771L	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	1771					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GACACCACATCAGTGGACACC	0.438													5	75	---	---	---	---	PASS
TRHR	7201	broad.mit.edu	37	8	110131549	110131549	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110131549C>G	uc003ymz.3	+	2	1078	c.1062C>G	c.(1060-1062)TAC>TAG	p.Y354*		NM_003301	NP_003292	P34981	TRFR_HUMAN	thyrotropin-releasing hormone receptor	354	Cytoplasmic (Potential).					integral to plasma membrane	thyrotropin-releasing hormone receptor activity			skin(2)|lung(1)	3			OV - Ovarian serous cystadenocarcinoma(57;2.3e-11)			CCCTAAATTACAGCGTCATCA	0.463													65	173	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113420573	113420573	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113420573G>C	uc003ynu.2	-	34	5738	c.5579C>G	c.(5578-5580)GCT>GGT	p.A1860G	CSMD3_uc003yns.2_Intron|CSMD3_uc003ynt.2_Missense_Mutation_p.A1820G|CSMD3_uc011lhx.1_Missense_Mutation_p.A1756G	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1860	Extracellular (Potential).|CUB 10.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AAATCCCTTAGCTGTTATTGG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			70	224	---	---	---	---	PASS
COL14A1	7373	broad.mit.edu	37	8	121259908	121259908	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121259908C>A	uc003yox.2	+	21	2801	c.2536C>A	c.(2536-2538)CGC>AGC	p.R846S	COL14A1_uc003yoy.2_Missense_Mutation_p.R524S	NM_021110	NP_066933	Q05707	COEA1_HUMAN	collagen, type XIV, alpha 1 precursor	846	Fibronectin type-III 7.				cell-cell adhesion|collagen fibril organization	collagen type XIV|extracellular space	collagen binding|extracellular matrix structural constituent|protein binding, bridging			ovary(4)|kidney(4)|skin(2)|pancreas(1)|central_nervous_system(1)	12	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			TAACCGGTTGCGCATTACGTG	0.458													25	177	---	---	---	---	PASS
C8orf73	642475	broad.mit.edu	37	8	144652017	144652017	+	Intron	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144652017G>C	uc010mff.2	-						C8orf73_uc010mfg.1_Intron	NM_001100878	NP_001094348	A6NGR9	CH073_HUMAN	hypothetical protein LOC642475								binding			ovary(1)	1	all_cancers(97;6.49e-11)|all_epithelial(106;4.73e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.014)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.134)|BRCA - Breast invasive adenocarcinoma(115;0.146)			ACAGCTAGGCGAGGCACATGG	0.682													3	22	---	---	---	---	PASS
ZNF623	9831	broad.mit.edu	37	8	144732358	144732358	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144732358C>G	uc003yzd.2	+	1	405	c.316C>G	c.(316-318)CTG>GTG	p.L106V	ZNF623_uc011lkp.1_Missense_Mutation_p.L66V|ZNF623_uc003yzc.2_Missense_Mutation_p.L66V	NM_014789	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623 isoform 1	106					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AAACCATATTCTGAATTCAGA	0.488													10	194	---	---	---	---	PASS
RECQL4	9401	broad.mit.edu	37	8	145736871	145736871	+	Silent	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145736871C>G	uc003zdj.2	-	22	3602	c.3570G>C	c.(3568-3570)CTG>CTC	p.L1190L		NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4	1190					DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CATGGAAGCTCAGGTGCAGGT	0.647			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				3	124	---	---	---	---	PASS
DOCK8	81704	broad.mit.edu	37	9	340232	340232	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:340232G>C	uc003zgf.2	+	14	1702	c.1590G>C	c.(1588-1590)GTG>GTC	p.V530V	DOCK8_uc011lls.1_Silent_p.V530V|DOCK8_uc010mgu.2_5'UTR|DOCK8_uc010mgv.2_Silent_p.V462V|DOCK8_uc003zgg.2_Silent_p.V462V|DOCK8_uc003zgh.2_RNA	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	530	DHR-1.				blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		TGCTGCCCGTGAAACCCTTTC	0.443													10	141	---	---	---	---	PASS
PSIP1	11168	broad.mit.edu	37	9	15466839	15466839	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:15466839C>A	uc003zlv.3	-	15	1769	c.1439G>T	c.(1438-1440)GGA>GTA	p.G480V	PSIP1_uc003zlw.3_Missense_Mutation_p.G480V	NM_033222	NP_150091	O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1 isoform 2	480					initiation of viral infection|interspecies interaction between organisms|nuclear mRNA 5'-splice site recognition|provirus integration|regulation of transcription, DNA-dependent|response to heat|response to oxidative stress|transcription, DNA-dependent	cytosol|nuclear heterochromatin|nuclear periphery|nucleoplasm|nucleoplasm|transcriptionally active chromatin	activating transcription factor binding|chromatin binding|DNA secondary structure binding|RNA polymerase II transcription coactivator activity			breast(1)	1				GBM - Glioblastoma multiforme(50;2.38e-06)		ATCAGATCCTCCATTTAGAGT	0.408													4	125	---	---	---	---	PASS
CDKN2A	1029	broad.mit.edu	37	9	21971036	21971036	+	Missense_Mutation	SNP	C	T	T	rs121913381		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21971036C>T	uc003zpk.2	-	2	534	c.322G>A	c.(322-324)GAT>AAT	p.D108N	MTAP_uc003zpi.1_Intron|CDKN2A_uc003zpj.2_3'UTR|CDKN2A_uc010miu.2_RNA|CDKN2A_uc003zpl.2_Missense_Mutation_p.R163Q	NM_000077	NP_000068	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A isoform 1	108			D -> Y (in a head and neck tumor).|D -> H (in a bladder tumor).		cell cycle arrest|cell cycle checkpoint|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of cell-matrix adhesion|negative regulation of cyclin-dependent protein kinase activity|negative regulation of NF-kappaB transcription factor activity|positive regulation of macrophage apoptosis|positive regulation of smooth muscle cell apoptosis|Ras protein signal transduction|replicative senescence	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|NF-kappaB binding|protein binding|protein binding|protein kinase binding	p.0?(1112)|p.D108Y(14)|p.?(13)|p.D108H(9)|p.D108N(5)|p.H83fs*2(2)|p.D105fs*8(1)|p.A68fs*3(1)|p.R107fs*33(1)		haematopoietic_and_lymphoid_tissue(647)|skin(419)|upper_aerodigestive_tract(414)|central_nervous_system(381)|lung(325)|pancreas(244)|oesophagus(230)|urinary_tract(225)|pleura(94)|liver(91)|soft_tissue(79)|bone(77)|ovary(76)|biliary_tract(71)|stomach(46)|breast(46)|kidney(39)|NS(28)|thyroid(24)|cervix(23)|meninges(18)|genital_tract(15)|endometrium(13)|prostate(11)|autonomic_ganglia(10)|salivary_gland(10)|large_intestine(9)|adrenal_gland(6)|eye(4)|vulva(2)|small_intestine(1)	3678		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CCCCAGGCATCGCGCACGTCC	0.741		17							Uveal_Melanoma_Familial|Familial_Malignant_Melanoma_and_Tumors_of_the_Nervous_System|Hereditary_Melanoma	HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)			10	19	---	---	---	---	PASS
CDC14B	8555	broad.mit.edu	37	9	99296825	99296825	+	Splice_Site	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99296825C>T	uc004awj.2	-	8	1080	c.628_splice	c.e8-1	p.K210_splice	CDC14B_uc004awk.2_Splice_Site_p.K210_splice|CDC14B_uc004awl.2_Splice_Site|CDC14B_uc004awi.2_Splice_Site_p.K173_splice	NM_033331	NP_201588	O60729	CC14B_HUMAN	CDC14 homolog B isoform 2						activation of anaphase-promoting complex activity|DNA repair|G2/M transition DNA damage checkpoint	nucleolus|nucleoplasm	protein binding|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(1)	1		Acute lymphoblastic leukemia(62;0.0559)				TTTCTGCTTTCTGCAAGGGGA	0.398													12	61	---	---	---	---	PASS
DDX31	64794	broad.mit.edu	37	9	135470306	135470306	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135470306T>A	uc004cbq.1	-	20	2655	c.2503A>T	c.(2503-2505)AGA>TGA	p.R835*	DDX31_uc010mzu.1_Nonsense_Mutation_p.R762*	NM_022779	NP_073616	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	835						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		TGGGTTTTTCTCCATTTTAAT	0.542													8	289	---	---	---	---	PASS
C9orf167	54863	broad.mit.edu	37	9	140174066	140174066	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140174066C>T	uc004cmn.2	+	2	1042	c.925C>T	c.(925-927)CGC>TGC	p.R309C	C9orf167_uc011mew.1_5'Flank	NM_017723	NP_060193	Q9NXH8	CI167_HUMAN	hypothetical protein LOC54863	309					chaperone mediated protein folding requiring cofactor	integral to membrane	ATP binding|nucleoside-triphosphatase activity			pancreas(1)	1	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.07e-05)|Epithelial(140;0.000728)		CGAGGTCACGCGCTTCGTGCT	0.726													4	8	---	---	---	---	PASS
LARP4B	23185	broad.mit.edu	37	10	860896	860896	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:860896G>A	uc001ifs.1	-	15	1851	c.1810C>T	c.(1810-1812)CAT>TAT	p.H604Y		NM_015155	NP_055970	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	604							nucleotide binding|RNA binding			ovary(2)|central_nervous_system(1)	3						TCGGGTAAATGAGCTGGGGAG	0.532													11	121	---	---	---	---	PASS
ITGA8	8516	broad.mit.edu	37	10	15686210	15686210	+	Silent	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15686210G>T	uc001ioc.1	-	13	1218	c.1218C>A	c.(1216-1218)ATC>ATA	p.I406I	ITGA8_uc010qcb.1_Silent_p.I391I	NM_003638	NP_003629	P53708	ITA8_HUMAN	integrin, alpha 8 precursor	406	Extracellular (Potential).|FG-GAP 6.				cell differentiation|cell-cell adhesion|cell-matrix adhesion|integrin-mediated signaling pathway|nervous system development	integrin complex	receptor activity			ovary(3)|lung(3)	6						AAGGCACTCCGATGGCAATGT	0.318													4	71	---	---	---	---	PASS
ANUBL1	93550	broad.mit.edu	37	10	46121646	46121646	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:46121646G>A	uc001jcp.3	-	7	1867	c.1625C>T	c.(1624-1626)TCC>TTC	p.S542F	ANUBL1_uc001jcl.3_Missense_Mutation_p.S62F|ANUBL1_uc001jcm.3_Missense_Mutation_p.S542F|ANUBL1_uc009xmu.2_Missense_Mutation_p.S468F|ANUBL1_uc001jcn.3_Missense_Mutation_p.S468F|ANUBL1_uc001jco.3_Intron	NM_001128324	NP_001121796	Q86XD8	ANUB1_HUMAN	AN1, ubiquitin-like, homolog	542							zinc ion binding				0						CTCAACTTTGGAAATAACATC	0.398													32	197	---	---	---	---	PASS
RTKN2	219790	broad.mit.edu	37	10	63959610	63959610	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:63959610C>A	uc001jlw.2	-	11	1294	c.1197G>T	c.(1195-1197)AAG>AAT	p.K399N	RTKN2_uc009xpf.1_Missense_Mutation_p.K201N|RTKN2_uc001jlv.2_Missense_Mutation_p.K53N	NM_145307	NP_660350	Q8IZC4	RTKN2_HUMAN	rhotekin 2	399					signal transduction	intracellular					0	Prostate(12;0.0297)|all_hematologic(501;0.215)					CACAACAGTGCTTCCATTGGC	0.333													21	118	---	---	---	---	PASS
TECTB	6975	broad.mit.edu	37	10	114044304	114044304	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:114044304G>C	uc001kzr.1	+	2	88	c.88G>C	c.(88-90)GTG>CTG	p.V30L		NM_058222	NP_478129	Q96PL2	TECTB_HUMAN	tectorin beta precursor	30	ZP.					anchored to membrane|plasma membrane|proteinaceous extracellular matrix					0		Colorectal(252;0.198)		Epithelial(162;0.0143)|all cancers(201;0.0242)		TGTCATTCTTGTGTTTTGCTA	0.458													7	75	---	---	---	---	PASS
ANO9	338440	broad.mit.edu	37	11	429656	429656	+	Intron	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:429656C>T	uc001lpi.2	-						ANO9_uc001lph.2_Intron|ANO9_uc010qvv.1_Intron	NM_001012302	NP_001012302	A1A5B4	ANO9_HUMAN	tumor protein p53 inducible protein 5							chloride channel complex	chloride channel activity			central_nervous_system(2)|ovary(1)|skin(1)	4						ACCGTGGCTGCGGCGGGGGCA	0.682													3	46	---	---	---	---	PASS
ZNF195	7748	broad.mit.edu	37	11	3381028	3381028	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3381028C>G	uc001lxt.2	-	6	1388	c.1210G>C	c.(1210-1212)GAG>CAG	p.E404Q	uc001lxr.2_5'Flank|ZNF195_uc001lxv.2_Missense_Mutation_p.E381Q|ZNF195_uc001lxs.2_Missense_Mutation_p.E332Q|ZNF195_uc010qxr.1_Missense_Mutation_p.E385Q|ZNF195_uc009ydz.2_Missense_Mutation_p.E359Q|ZNF195_uc001lxu.2_Missense_Mutation_p.E336Q	NM_001130520	NP_001123992	O14628	ZN195_HUMAN	zinc finger protein 195 isoform 1	404				Missing (in Ref. 2; BAD18466).	regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CCTCCAATCTCATTTCTCTGG	0.408													14	325	---	---	---	---	PASS
OR51E2	81285	broad.mit.edu	37	11	4703778	4703778	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4703778T>C	uc001lzk.2	-	2	408	c.164A>G	c.(163-165)CAC>CGC	p.H55R		NM_030774	NP_110401	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E,	55	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(3)|ovary(2)	5		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		CATCGGAGCGTGCAGGCTGCG	0.517													30	98	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5462646	5462646	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5462646G>C	uc010qze.1	-	1	99	c.99C>G	c.(97-99)TTC>TTG	p.F33L	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	33	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGAGGATGCAGAAAATCAGGG	0.527													13	132	---	---	---	---	PASS
OVCH2	341277	broad.mit.edu	37	11	7720330	7720330	+	Intron	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7720330G>A	uc010rbf.1	-							NM_198185	NP_937828			ovochymase 2 precursor												0				Epithelial(150;7.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.197)		CCTGGGAAAGGAAAAGAAGGA	0.433													6	38	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10517157	10517157	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10517157C>T	uc001mio.1	+	9	1642	c.1307C>T	c.(1306-1308)TCA>TTA	p.S436L	AMPD3_uc010rbz.1_Missense_Mutation_p.S277L|AMPD3_uc001min.1_Missense_Mutation_p.S445L|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Missense_Mutation_p.S443L|AMPD3_uc009yfy.2_Missense_Mutation_p.S436L	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	436					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		TACCAGTACTCAGAGCCACGG	0.602													11	60	---	---	---	---	PASS
ELP4	26610	broad.mit.edu	37	11	31648666	31648666	+	Silent	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31648666C>A	uc001mtb.2	+	6	698	c.663C>A	c.(661-663)ACC>ACA	p.T221T	ELP4_uc001mta.1_RNA|ELP4_uc001mtc.2_Silent_p.T221T|ELP4_uc010rdz.1_Silent_p.T222T	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog	221					histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					GTTCTTTGACCCCTGGCTACA	0.318													17	116	---	---	---	---	PASS
DEPDC7	91614	broad.mit.edu	37	11	33053045	33053045	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33053045C>T	uc001mub.2	+	5	996	c.904C>T	c.(904-906)CTG>TTG	p.L302L	DEPDC7_uc001muc.2_Silent_p.L293L	NM_001077242	NP_001070710	Q96QD5	DEPD7_HUMAN	novel 58.3 KDA protein isoform 1	302					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|skin(1)	2						GAAAGAACTTCTGTTTGATGC	0.398													19	114	---	---	---	---	PASS
ZFP91	80829	broad.mit.edu	37	11	58385039	58385039	+	Silent	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58385039C>A	uc001nmx.3	+	11	1741	c.1573C>A	c.(1573-1575)CGG>AGG	p.R525R	ZFP91_uc001nmy.3_Silent_p.R524R|ZFP91-CNTF_uc010rkm.1_RNA	NM_053023	NP_444251	Q96JP5	ZFP91_HUMAN	zinc finger protein 91	525					activation of NF-kappaB-inducing kinase activity|protein K63-linked ubiquitination	nucleus	nucleic acid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				TGGGACGGAACGGGTGAGCCT	0.423													3	100	---	---	---	---	PASS
ORAOV1	220064	broad.mit.edu	37	11	69482722	69482722	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69482722C>T	uc001opc.2	-	4	444	c.286G>A	c.(286-288)GAC>AAC	p.D96N	ORAOV1_uc010rqi.1_Missense_Mutation_p.D96N|ORAOV1_uc009ysm.2_RNA|ORAOV1_uc001opd.2_Missense_Mutation_p.D37N	NM_153451	NP_703152	Q8WV07	ORAV1_HUMAN	oral cancer overexpressed 1	96											0	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;5.64e-57)|all cancers(3;5.98e-51)|BRCA - Breast invasive adenocarcinoma(2;5.49e-48)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			TAAGTAGGGTCATCATAAGGG	0.413													20	100	---	---	---	---	PASS
ODZ4	26011	broad.mit.edu	37	11	78369355	78369355	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78369355C>G	uc001ozl.3	-	34	8521	c.8058G>C	c.(8056-8058)GAG>GAC	p.E2686D	ODZ4_uc001ozk.3_Missense_Mutation_p.E911D|ODZ4_uc009yvb.1_Intron	NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4	2686	Extracellular (Potential).				signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						CCCGTGCCTTCTCCTCATCCA	0.632													6	21	---	---	---	---	PASS
TMEM135	65084	broad.mit.edu	37	11	87025542	87025542	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87025542T>C	uc001pch.2	+	12	1053	c.1030T>C	c.(1030-1032)TAT>CAT	p.Y344H	TMEM135_uc010rtt.1_Missense_Mutation_p.Y205H|TMEM135_uc001pci.2_Missense_Mutation_p.Y322H	NM_022918	NP_075069	Q86UB9	TM135_HUMAN	transmembrane protein 135	344	Helical; (Potential).					integral to membrane					0		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AATGATGTTTTATAAAAGCAC	0.303													17	80	---	---	---	---	PASS
BUD13	84811	broad.mit.edu	37	11	116633646	116633646	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116633646T>C	uc001ppn.2	-	4	693	c.659A>G	c.(658-660)CAT>CGT	p.H220R	BUD13_uc001ppo.2_Intron|BUD13_uc009yzc.2_Missense_Mutation_p.H220R	NM_032725	NP_116114	Q9BRD0	BUD13_HUMAN	BUD13 homolog isoform 1	220	Arg-rich.									large_intestine(1)|pancreas(1)	2	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		TGGTGAATCATGACGGACTCT	0.547													55	171	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117244507	117244507	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117244507C>G	uc001prc.2	+	10	1340	c.1193C>G	c.(1192-1194)TCA>TGA	p.S398*	CEP164_uc001prb.2_Nonsense_Mutation_p.S398*|CEP164_uc010rxk.1_Nonsense_Mutation_p.S372*|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	398					cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CCACAGCTCTCAGACTCCATA	0.383													10	123	---	---	---	---	PASS
CEP164	22897	broad.mit.edu	37	11	117244538	117244538	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:117244538C>T	uc001prc.2	+	10	1371	c.1224C>T	c.(1222-1224)TTC>TTT	p.F408F	CEP164_uc001prb.2_Silent_p.F408F|CEP164_uc010rxk.1_Silent_p.F382F|CEP164_uc001prf.2_RNA|CEP164_uc009yzp.1_RNA	NM_014956	NP_055771	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	408					cell division|DNA repair|G2/M transition of mitotic cell cycle|mitosis	centriole|cytosol|nucleus				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		CCAAGTCCTTCCATGGCCTGG	0.303													7	87	---	---	---	---	PASS
PVRL1	5818	broad.mit.edu	37	11	119545974	119545974	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119545974G>A	uc001pwv.2	-	5	1070	c.898C>T	c.(898-900)CTC>TTC	p.L300F	PVRL1_uc001pwu.1_Missense_Mutation_p.L300F|PVRL1_uc001pww.2_Missense_Mutation_p.L300F	NM_002855	NP_002846	Q15223	PVRL1_HUMAN	poliovirus receptor-related 1 isoform 1	300	Extracellular (Potential).|Ig-like C2-type 2.				adherens junction organization|cell junction assembly|entry of virus into host cell|heterophilic cell-cell adhesion|homophilic cell adhesion|immune response	cell-cell adherens junction|extracellular region|integral to membrane	cell adhesion molecule binding|coreceptor activity|protein homodimerization activity				0		Breast(348;0.037)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.29e-05)		TTGAAGAAGAGGGTTCTGTTC	0.567													15	86	---	---	---	---	PASS
OR8A1	390275	broad.mit.edu	37	11	124440462	124440462	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124440462C>T	uc010san.1	+	1	498	c.498C>T	c.(496-498)TAC>TAT	p.Y166Y		NM_001005194	NP_001005194	Q8NGG7	OR8A1_HUMAN	olfactory receptor, family 8, subfamily A,	166	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0214)		CTGTGGTCTACGCCATCGGAC	0.507													15	64	---	---	---	---	PASS
C3AR1	719	broad.mit.edu	37	12	8211896	8211896	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8211896G>A	uc001qtv.1	-	2	978	c.886C>T	c.(886-888)CTG>TTG	p.L296L		NM_004054	NP_004045	Q16581	C3AR_HUMAN	complement component 3a receptor 1	296	Extracellular (Potential).				blood circulation|chemotaxis|elevation of cytosolic calcium ion concentration|inflammatory response	integral to plasma membrane	C3a anaphylatoxin receptor activity|complement component C3a receptor activity|phosphatidylinositol phospholipase C activity			ovary(1)	1				Kidney(36;0.0893)		CTAGGGAACAGCTTTAAATGA	0.433													4	128	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9221440	9221440	+	Splice_Site	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9221440T>C	uc001qvk.1	-	34	4377	c.4264_splice	c.e34-1	p.V1422_splice	A2M_uc001qvj.1_Splice_Site_p.V464_splice|A2M_uc009zgk.1_Splice_Site_p.V1272_splice	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor						blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	ATTTGACACCTGGAAAGCAAA	0.383													10	17	---	---	---	---	PASS
CLEC12B	387837	broad.mit.edu	37	12	10167165	10167165	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10167165G>A	uc001qwz.2	+	3	362	c.234G>A	c.(232-234)TTG>TTA	p.L78L	CLEC12B_uc001qwx.1_Silent_p.L78L|CLEC12B_uc001qwy.1_5'UTR|CLEC12B_uc009zhe.2_RNA	NM_001129998	NP_001123470	Q2HXU8	CL12B_HUMAN	C-type lectin domain family 12, member B isoform	78	Extracellular (Potential).					integral to membrane|plasma membrane	receptor activity|sugar binding				0						CAGAGAAATTGAGTCAACTTC	0.388													5	80	---	---	---	---	PASS
PRB3	5544	broad.mit.edu	37	12	11420897	11420897	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11420897G>A	uc001qzs.2	-	3	324	c.286C>T	c.(286-288)CCG>TCG	p.P96S	PRB4_uc001qzf.1_Intron	NM_006249	NP_006240	Q04118	PRB3_HUMAN	proline-rich protein BstNI subfamily 3	96	10 X 21 AA tandem repeats of [RH]-P-G-K- P-[EQ]-G-[PQS]-P-[PS]-Q-[GE]-G-N-[QK]- [SP]-[QR]-[GR]-P-P-P.|Pro-rich.|3.					extracellular region	Gram-negative bacterial cell surface binding			skin(1)	1			OV - Ovarian serous cystadenocarcinoma(49;0.201)			GGCTTTCCCGGACGAGGTGGG	0.617													47	706	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53877249	53877249	+	Silent	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53877249C>G	uc001sdm.1	-	11	1496	c.1398G>C	c.(1396-1398)CGG>CGC	p.R466R	MAP3K12_uc001sdn.1_Silent_p.R499R	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	466					histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						CTGGGCACCTCCGCTCTAAAG	0.567													10	119	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53877268	53877268	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53877268C>T	uc001sdm.1	-	11	1477	c.1379G>A	c.(1378-1380)CGA>CAA	p.R460Q	MAP3K12_uc001sdn.1_Missense_Mutation_p.R493Q	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase	460	Leucine-zipper 2.				histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						AGCTTGCTCTCGCCTAAAGAT	0.582													6	122	---	---	---	---	PASS
MAP3K12	7786	broad.mit.edu	37	12	53877279	53877279	+	Intron	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53877279C>T	uc001sdm.1	-						MAP3K12_uc001sdn.1_Intron	NM_006301	NP_006292	Q12852	M3K12_HUMAN	mitogen-activated protein kinase kinase kinase						histone phosphorylation|JNK cascade|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|protein autophosphorylation	cytosol|membrane fraction|plasma membrane	ATP binding|magnesium ion binding|MAP kinase kinase kinase activity|protein homodimerization activity|protein kinase binding			lung(2)|ovary(1)|breast(1)|skin(1)	5						GCCTAAAGATCCAGGCACCTT	0.582													6	127	---	---	---	---	PASS
RDH16	8608	broad.mit.edu	37	12	57348692	57348692	+	Silent	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57348692G>C	uc001smi.3	-	2	742	c.570C>G	c.(568-570)CTC>CTG	p.L190L	RDH16_uc009zpa.2_Intron	NM_003708	NP_003699	O75452	RDH16_HUMAN	retinol dehydrogenase 16	190	Cytoplasmic (Potential).				lipid metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	binding|electron carrier activity|retinol dehydrogenase activity				0						ACCCATACCTGAGGGAGTCAG	0.567													3	58	---	---	---	---	PASS
LTA4H	4048	broad.mit.edu	37	12	96415995	96415995	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96415995C>A	uc001ten.1	-	5	583	c.515G>T	c.(514-516)AGT>ATT	p.S172I	LTA4H_uc010suy.1_Missense_Mutation_p.S134I|LTA4H_uc010suz.1_Missense_Mutation_p.S134I|LTA4H_uc010sva.1_RNA	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase	172					hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						ACGAATAGCACTCATAAGTGC	0.363													3	97	---	---	---	---	PASS
HPD	3242	broad.mit.edu	37	12	122285128	122285128	+	Intron	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122285128G>T	uc001ubj.2	-						HPD_uc001ubk.2_Intron	NM_002150	NP_002141	P32754	HPPD_HUMAN	4-hydroxyphenylpyruvate dioxygenase						L-phenylalanine catabolic process|tyrosine catabolic process	cytosol	4-hydroxyphenylpyruvate dioxygenase activity|metal ion binding				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000105)|Epithelial(86;0.000352)|BRCA - Breast invasive adenocarcinoma(302;0.225)	Nitisinone(DB00348)	TACCTGTAGGGTGGGCGGTGG	0.572													22	75	---	---	---	---	PASS
KNTC1	9735	broad.mit.edu	37	12	123042029	123042029	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123042029C>T	uc001ucv.2	+	17	1534	c.1371C>T	c.(1369-1371)GAC>GAT	p.D457D	KNTC1_uc010taf.1_Silent_p.D420D	NM_014708	NP_055523	P50748	KNTC1_HUMAN	Rough Deal homolog, centromere/kinetochore	457					cell division|mitotic cell cycle checkpoint|mitotic prometaphase|protein complex assembly|regulation of exit from mitosis	condensed chromosome kinetochore|cytosol|kinetochore microtubule|nucleus|spindle pole	protein binding			ovary(5)|kidney(3)|lung(1)|central_nervous_system(1)	10	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TTGTAGACGACGCTAAGGAAA	0.393													6	69	---	---	---	---	PASS
TNFRSF19	55504	broad.mit.edu	37	13	24190102	24190102	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24190102C>G	uc001uov.1	+	4	341	c.277C>G	c.(277-279)CTG>GTG	p.L93V	TNFRSF19_uc001uot.2_Missense_Mutation_p.L93V|TNFRSF19_uc010tcu.1_5'UTR|TNFRSF19_uc001uow.2_Missense_Mutation_p.L93V	NM_018647	NP_061117	Q9NS68	TNR19_HUMAN	tumor necrosis factor receptor superfamily,	93	TNFR-Cys 2.|Extracellular (Potential).				apoptosis|induction of apoptosis|JNK cascade	integral to membrane|mitochondrion	tumor necrosis factor receptor activity			kidney(1)|skin(1)	2		all_cancers(29;3.4e-22)|all_epithelial(30;8.75e-19)|all_lung(29;5.09e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00193)|Epithelial(112;0.0137)|OV - Ovarian serous cystadenocarcinoma(117;0.0465)|GBM - Glioblastoma multiforme(144;0.184)|Lung(94;0.19)		CAAGCCCTGTCTGGACTGCGC	0.572													9	123	---	---	---	---	PASS
SUCLA2	8803	broad.mit.edu	37	13	48542720	48542720	+	Intron	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48542720G>C	uc001vbs.2	-						SUCLA2_uc010tgb.1_Intron|SUCLA2_uc010tgc.1_Intron|SUCLA2_uc010tgd.1_Intron|SUCLA2_uc001vbt.1_Intron	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit						succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	GACAAAAGAAGATACTTTACC	0.328													18	97	---	---	---	---	PASS
DIAPH3	81624	broad.mit.edu	37	13	60667807	60667807	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:60667807G>C	uc001vht.2	-	4	669	c.450C>G	c.(448-450)ATC>ATG	p.I150M	DIAPH3_uc001vhw.1_Missense_Mutation_p.I139M|DIAPH3_uc010aed.1_Intron|DIAPH3_uc010aee.1_Missense_Mutation_p.I80M	NM_001042517	NP_001035982	Q9NSV4	DIAP3_HUMAN	diaphanous homolog 3 isoform a	150	GBD/FH3.				actin cytoskeleton organization		actin binding|Rho GTPase binding			ovary(2)	2		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		TTTCTTTTTTGATACTGAAGT	0.318													3	86	---	---	---	---	PASS
TMTC4	84899	broad.mit.edu	37	13	101316528	101316528	+	Silent	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:101316528C>A	uc001vou.2	-	3	385	c.225G>T	c.(223-225)CTG>CTT	p.L75L	TMTC4_uc001vot.2_Silent_p.L94L|TMTC4_uc010tja.1_Intron	NM_001079669	NP_001073137	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat	75						integral to membrane	binding			ovary(2)|breast(1)	3	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TGTTGCTGCTCAGTCTACTGC	0.582													4	31	---	---	---	---	PASS
POTEG	404785	broad.mit.edu	37	14	19566062	19566062	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19566062C>A	uc001vuz.1	+	6	1158	c.1106C>A	c.(1105-1107)TCT>TAT	p.S369Y	POTEG_uc001vva.1_RNA|POTEG_uc010ahc.1_RNA|uc001vvb.2_Intron	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G	369										ovary(1)	1						CTAAAAGTCTCTTCTGAAAAC	0.214													11	537	---	---	---	---	PASS
OR6S1	341799	broad.mit.edu	37	14	21109188	21109188	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21109188G>T	uc001vxv.1	-	1	663	c.663C>A	c.(661-663)TAC>TAA	p.Y221*		NM_001001968	NP_001001968	Q8NH40	OR6S1_HUMAN	olfactory receptor, family 6, subfamily S,	221	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(95;0.00304)		Epithelial(56;1.23e-06)|all cancers(55;1.01e-05)	GBM - Glioblastoma multiforme(265;0.0135)		CAATGAGGCCGTAGGACACAG	0.557													9	129	---	---	---	---	PASS
OR10G2	26534	broad.mit.edu	37	14	22102926	22102926	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22102926G>T	uc010tmc.1	-	1	73	c.73C>A	c.(73-75)CCA>ACA	p.P25T		NM_001005466	NP_001005466	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G,	25	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		CTTAGATTTGGGGGGTGAGAC	0.478													23	134	---	---	---	---	PASS
PSMB11	122706	broad.mit.edu	37	14	23512009	23512009	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23512009A>T	uc010ake.1	+	1	634	c.575A>T	c.(574-576)TAT>TTT	p.Y192F		NM_001099780	NP_001093250	A5LHX3	PSB11_HUMAN	proteasome beta 11 subunit precursor	192					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	threonine-type endopeptidase activity				0	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00643)		GACCGTGGCTATCGCTACGAC	0.627													19	61	---	---	---	---	PASS
C14orf104	55172	broad.mit.edu	37	14	50092567	50092567	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50092567G>A	uc001wws.3	-	3	2288	c.2207C>T	c.(2206-2208)TCT>TTT	p.S736F	SDCCAG1_uc010anj.1_Intron|C14orf104_uc001wwt.3_Missense_Mutation_p.S688F	NM_018139	NP_060609	Q9NVR5	KTU_HUMAN	kintoun isoform 1	736					axonemal dynein complex assembly|ciliary cell motility|flagellar cell motility	cytoplasm					0	all_epithelial(31;0.0021)|Breast(41;0.0124)					TATCATTTGAGAAACATCAAG	0.328									Kartagener_syndrome				11	95	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55618609	55618609	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55618609C>A	uc001xbs.2	-	17	2389	c.2172G>T	c.(2170-2172)ATG>ATT	p.M724I	DLGAP5_uc001xbt.2_Missense_Mutation_p.M724I	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	724					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						GAGGCAAACTCATTCTCTCAC	0.328													27	100	---	---	---	---	PASS
GALNTL1	57452	broad.mit.edu	37	14	69799873	69799873	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69799873A>G	uc010aqu.1	+	8	943	c.850A>G	c.(850-852)ACC>GCC	p.T284A	GALNTL1_uc001xla.1_Missense_Mutation_p.T284A|GALNTL1_uc001xlb.1_Missense_Mutation_p.T284A	NM_020692	NP_065743	Q8N428	GLTL1_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	284	Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(1)|central_nervous_system(1)	2				all cancers(60;0.00793)|BRCA - Breast invasive adenocarcinoma(234;0.0174)|OV - Ovarian serous cystadenocarcinoma(108;0.0656)		GACAGACCCCACCAGGCCCAT	0.617													18	76	---	---	---	---	PASS
PSEN1	5663	broad.mit.edu	37	14	73685865	73685865	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73685865C>T	uc001xnr.2	+	12	1556	c.1272C>T	c.(1270-1272)CTC>CTT	p.L424L	PSEN1_uc001xnv.2_Silent_p.L420L|PSEN1_uc010ark.2_Silent_p.L420L|PSEN1_uc001xnu.2_RNA	NM_000021	NP_000012	P49768	PSN1_HUMAN	presenilin 1 isoform I-467	424	Required for interaction with CTNNB1.|Poly-Leu.|Helical; (Potential).				amyloid precursor protein catabolic process|anti-apoptosis|beta-amyloid metabolic process|cell-cell adhesion|induction of apoptosis by extracellular signals|membrane protein ectodomain proteolysis|membrane protein intracellular domain proteolysis|nerve growth factor receptor signaling pathway|Notch receptor processing|Notch signaling pathway|smooth endoplasmic reticulum calcium ion homeostasis	apical plasma membrane|axon|cell cortex|cell surface|centrosome|ciliary rootlet|dendritic shaft|endoplasmic reticulum membrane|gamma-secretase complex|Golgi membrane|growth cone|integral to plasma membrane|kinetochore|lysosomal membrane|membrane raft|mitochondrial inner membrane|neuromuscular junction|neuronal cell body|nuclear outer membrane|perinuclear region of cytoplasm|rough endoplasmic reticulum|smooth endoplasmic reticulum|Z disc	aspartic-type endopeptidase activity|beta-catenin binding|cadherin binding|calcium channel activity|PDZ domain binding			breast(1)|kidney(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		CATTATTACTCCTTGCCATTT	0.398													30	377	---	---	---	---	PASS
C14orf118	55668	broad.mit.edu	37	14	76633045	76633045	+	Silent	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76633045C>G	uc001xsh.2	+	3	788	c.702C>G	c.(700-702)CTC>CTG	p.L234L	C14orf118_uc001xsi.2_Silent_p.L234L|C14orf118_uc001xsj.1_Silent_p.L234L|C14orf118_uc001xsk.1_Silent_p.L234L|C14orf118_uc001xsl.2_RNA	NM_017926	NP_060396	Q9NWQ4	CN118_HUMAN	hypothetical protein LOC55668 isoform 1	234										ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(234;0.0172)		ACACTGGGCTCTTTACCAATG	0.428													9	48	---	---	---	---	PASS
DICER1	23405	broad.mit.edu	37	14	95590807	95590807	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:95590807G>C	uc001ydw.2	-	9	1284	c.1102C>G	c.(1102-1104)CTT>GTT	p.L368V	DICER1_uc001ydv.2_Missense_Mutation_p.L358V|DICER1_uc001ydx.2_Missense_Mutation_p.L368V	NM_030621	NP_085124	Q9UPY3	DICER_HUMAN	dicer1	368	Required for interaction with PRKRA and TARBP2.				negative regulation of Schwann cell proliferation|negative regulation of transcription from RNA polymerase II promoter|nerve development|neuron projection morphogenesis|peripheral nervous system myelin formation|positive regulation of myelination|positive regulation of Schwann cell differentiation|pre-miRNA processing|production of siRNA involved in RNA interference|targeting of mRNA for destruction involved in RNA interference	cytosol|RNA-induced silencing complex	ATP binding|ATP-dependent helicase activity|double-stranded RNA binding|metal ion binding|protein binding|ribonuclease III activity			skin(2)|ovary(1)|pancreas(1)|lung(1)	5		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		TTCAGGTCAAGTGAGGCAGGT	0.393			Mis F|N			pleuropulmonary blastoma			DICER_1_syndrome_|Familial_Multinodular_Goiter_				30	229	---	---	---	---	PASS
VPS39	23339	broad.mit.edu	37	15	42453899	42453899	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42453899T>C	uc001zpd.2	-	25	2717	c.2566A>G	c.(2566-2568)AAG>GAG	p.K856E	VPS39_uc001zpc.2_Missense_Mutation_p.K845E|VPS39_uc001zpb.2_Missense_Mutation_p.K191E	NM_015289	NP_056104	Q96JC1	VPS39_HUMAN	vacuolar protein sorting 39	856					protein transport	HOPS complex|late endosome membrane|lysosomal membrane	small GTPase regulator activity			ovary(1)|pancreas(1)|skin(1)	3		all_cancers(109;6.78e-16)|all_epithelial(112;1.81e-14)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.0574)|Colorectal(260;0.152)		GBM - Glioblastoma multiforme(94;3.05e-06)		ATCTTCTTCTTACACACCATG	0.527													13	324	---	---	---	---	PASS
MAP1A	4130	broad.mit.edu	37	15	43817909	43817909	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43817909G>A	uc001zrt.2	+	4	4705	c.4238G>A	c.(4237-4239)AGA>AAA	p.R1413K		NM_002373	NP_002364	P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1413						cytoplasm|microtubule|microtubule associated complex	protein binding|structural molecule activity			ovary(3)|breast(3)|pancreas(2)|skin(1)	9		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CAAAAGGGCAGAGACTTAGAG	0.453													4	102	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52510865	52510865	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52510865C>G	uc010bff.2	-	32	3942	c.3805G>C	c.(3805-3807)GAA>CAA	p.E1269Q	MYO5C_uc010uga.1_RNA	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC	1269	Potential.					myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		GTATGTATTTCATTTTGGGCT	0.433													18	56	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54793157	54793157	+	Nonsense_Mutation	SNP	T	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54793157T>A	uc002ack.2	+	20	5282	c.5282T>A	c.(5281-5283)TTA>TAA	p.L1761*		NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1761	MHD1.				exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TTATCTCACTTAATGAGAAGA	0.368													37	159	---	---	---	---	PASS
MYO9A	4649	broad.mit.edu	37	15	72338400	72338400	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72338400G>A	uc002atl.3	-	2	978	c.505C>T	c.(505-507)CGC>TGC	p.R169C	MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Missense_Mutation_p.R169C|MYO9A_uc002atn.1_Missense_Mutation_p.R169C	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA	169	Myosin head-like 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						TGCTTAAAGCGATTTCGTAGG	0.328													10	99	---	---	---	---	PASS
C15orf27	123591	broad.mit.edu	37	15	76452464	76452464	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:76452464G>A	uc002bbq.2	+	5	566	c.411G>A	c.(409-411)GTG>GTA	p.V137V	C15orf27_uc010bkp.2_5'UTR|C15orf27_uc002bbr.2_5'UTR	NM_152335	NP_689548	Q2M3C6	CO027_HUMAN	hypothetical protein LOC123591	137	Helical; (Potential).					integral to membrane					0						TTGCTGGCGTGATTCACTGGA	0.537													22	281	---	---	---	---	PASS
SLC28A1	9154	broad.mit.edu	37	15	85487987	85487987	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85487987G>T	uc002blg.2	+	18	1965	c.1763G>T	c.(1762-1764)GGG>GTG	p.G588V	SLC28A1_uc010bnb.2_Missense_Mutation_p.G588V|SLC28A1_uc010upe.1_Missense_Mutation_p.G422V|SLC28A1_uc010upf.1_Missense_Mutation_p.G588V|SLC28A1_uc010upg.1_Intron	NM_004213	NP_004204	O00337	S28A1_HUMAN	solute carrier family 28, member 1 isoform 1	588	Helical; (Potential).				nucleobase, nucleoside and nucleotide metabolic process	integral to plasma membrane|membrane fraction	nucleoside binding			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CCCTCTACAGGGATCCTCTAC	0.597													18	104	---	---	---	---	PASS
PALB2	79728	broad.mit.edu	37	16	23614875	23614875	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23614875C>G	uc002dlx.1	-	13	3666	c.3466G>C	c.(3466-3468)GAC>CAC	p.D1156H		NM_024675	NP_078951	Q86YC2	PALB2_HUMAN	partner and localizer of BRCA2	1156	Interaction with RAD51 and BRCA2.|WD 7.				double-strand break repair via homologous recombination	nucleoplasm	DNA binding|protein binding			lung(3)|breast(3)|ovary(2)|skin(1)|kidney(1)|pancreas(1)	11				GBM - Glioblastoma multiforme(48;0.0167)		CAATGTTGGTCAGAGACAGGT	0.438			F|N|Mis			Wilms tumor|medulloblastoma|AML ,breast		Direct_reversal_of_damage|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia_type_N|Fanconi_Anemia|PALB2-associated_Familial_Breast_and_Pancreatic_Cancer|Pancreatic_Cancer_Familial_Clustering_of				14	147	---	---	---	---	PASS
ITGAD	3681	broad.mit.edu	37	16	31422207	31422207	+	Intron	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31422207G>A	uc002ebv.1	+						ITGAD_uc010cap.1_Intron	NM_005353	NP_005344	Q13349	ITAD_HUMAN	integrin, alpha D precursor						cell-cell adhesion|cell-matrix adhesion|immune response|integrin-mediated signaling pathway	integrin complex	receptor activity			skin(1)	1						CAGGTTGGGCGTGACAGGAGC	0.657													6	73	---	---	---	---	PASS
ARL2BP	23568	broad.mit.edu	37	16	57282555	57282555	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57282555C>A	uc002elf.1	+	3	449	c.207C>A	c.(205-207)TAC>TAA	p.Y69*	ARL2BP_uc010ccy.1_RNA|ARL2BP_uc010vhl.1_Nonsense_Mutation_p.Y69*	NM_012106	NP_036238	Q9Y2Y0	AR2BP_HUMAN	binder of Arl Two	69					maintenance of protein location in nucleus|positive regulation of tyrosine phosphorylation of Stat3 protein|signal transduction	centrosome|midbody|mitochondrial intermembrane space|nucleus|spindle	protein binding|small GTPase regulator activity|transcription coactivator activity				0						TTAATGAATACGTAAGTAGAT	0.318													4	127	---	---	---	---	PASS
KATNB1	10300	broad.mit.edu	37	16	57778365	57778365	+	Silent	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57778365C>G	uc002eml.1	+	4	605	c.231C>G	c.(229-231)CTC>CTG	p.L77L		NM_005886	NP_005877	Q9BVA0	KTNB1_HUMAN	katanin p80 subunit B 1	77	WD 2.|Interaction with centrosomes.|Interaction with dynein (By similarity).				cell division|mitosis|negative regulation of microtubule depolymerization|positive regulation of microtubule depolymerization|protein targeting	katanin complex|microtubule|spindle pole	microtubule binding|protein heterodimerization activity				0		all_neural(199;0.223)				CCGAGGAGCTCATCGTGGCCG	0.642													10	115	---	---	---	---	PASS
CA5A	763	broad.mit.edu	37	16	87960375	87960375	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87960375C>T	uc002fkn.1	-	2	375	c.319G>A	c.(319-321)GAC>AAC	p.D107N		NM_001739	NP_001730	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial precursor	107					one-carbon metabolic process	mitochondrial matrix	carbonate dehydratase activity|zinc ion binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0513)		GTGGCATCGTCAAATTCCACC	0.592													16	67	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577105	7577105	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577105G>A	uc002gim.2	-	8	1027	c.833C>T	c.(832-834)CCT>CTT	p.P278L	TP53_uc002gig.1_Intron|TP53_uc002gih.2_Missense_Mutation_p.P278L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.P146L|TP53_uc010cng.1_Missense_Mutation_p.P146L|TP53_uc002gii.1_Missense_Mutation_p.P146L|TP53_uc010cnh.1_Missense_Mutation_p.P278L|TP53_uc010cni.1_Missense_Mutation_p.P278L|TP53_uc002gij.2_Missense_Mutation_p.P278L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	278	Interaction with DNA.||Interaction with E4F1.|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		P -> F (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|P -> S (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|P -> H (in sporadic cancers; somatic mutation).|P -> R (in sporadic cancers; somatic mutation).|P -> T (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.P278L(52)|p.P278S(48)|p.P278R(26)|p.P278T(21)|p.P278A(17)|p.P278H(11)|p.0?(7)|p.P278fs*67(5)|p.P278F(3)|p.P278fs*28(2)|p.?(2)|p.A276_R283delACPGRDRR(1)|p.A276fs*64(1)|p.V274_P278del(1)|p.P278P(1)|p.C277_P278insXXXXXXX(1)|p.F270_D281del12(1)|p.P278_G279insXXXXX(1)|p.C275_R283delCACPGRDRR(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275fs*20(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTCTCTCCCAGGACAGGCACA	0.552		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			5	46	---	---	---	---	PASS
DNAH2	146754	broad.mit.edu	37	17	7678290	7678290	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7678290A>T	uc002giu.1	+	28	4729	c.4715A>T	c.(4714-4716)CAG>CTG	p.Q1572L		NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3	1572	Stem (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CTGAGAATCCAGAAGGTCAGT	0.537													12	66	---	---	---	---	PASS
GLP2R	9340	broad.mit.edu	37	17	9792918	9792918	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9792918G>T	uc002gmd.1	+	13	1558	c.1558G>T	c.(1558-1560)GAC>TAC	p.D520Y		NM_004246	NP_004237	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor precursor	520	Cytoplasmic (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger|positive regulation of cell proliferation	integral to membrane|plasma membrane				lung(2)|ovary(1)	3					Glucagon recombinant(DB00040)	GCCCCAACAGGACCATGCACG	0.622													4	37	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10216513	10216513	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10216513C>T	uc002gmk.1	-	30	4233	c.4143G>A	c.(4141-4143)ACG>ACA	p.T1381T		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	1381	Potential.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GAATGGCGTCCGTCTCGTATT	0.627													7	211	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17701460	17701460	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17701460C>T	uc002grm.2	+	3	5667	c.5198C>T	c.(5197-5199)TCG>TTG	p.S1733L	RAI1_uc002grn.1_Missense_Mutation_p.S1733L	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1733						cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		GAGGAGGCCTCGCTGCCGCTT	0.642													6	55	---	---	---	---	PASS
KIAA0100	9703	broad.mit.edu	37	17	26942236	26942236	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26942236G>C	uc002hbu.2	-	39	6653	c.6554C>G	c.(6553-6555)TCT>TGT	p.S2185C	SGK494_uc010waq.1_5'Flank|SGK494_uc010war.1_5'Flank|SGK494_uc002hbr.1_5'Flank|uc002hbs.1_Intron|KIAA0100_uc002hbt.2_Missense_Mutation_p.S514C	NM_014680	NP_055495	Q14667	K0100_HUMAN	hypothetical protein LOC9703 precursor	2185				S -> P (in Ref. 8; AAQ93061).		extracellular region				ovary(2)|breast(1)|skin(1)	4	Lung NSC(42;0.00431)					GCCTGTTGCAGACTTCAGCCT	0.448													5	113	---	---	---	---	PASS
CCL14	6358	broad.mit.edu	37	17	34311404	34311404	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34311404G>C	uc010wcr.1	-	2	243	c.164C>G	c.(163-165)ACC>AGC	p.T55S	CCL16_uc002hkl.2_5'Flank|CCL16_uc002hkm.2_5'Flank|CCL14_uc010wcq.1_Missense_Mutation_p.T71S|CCL14_uc002hkn.2_RNA|CCL14-CCL15_uc010wcs.1_RNA|CCL14-CCL15_uc010wct.1_RNA|uc002hkq.2_5'Flank	NM_032963	NP_116739	Q16627	CCL14_HUMAN	chemokine (C-C motif) ligand 14 isoform 1	55					cellular calcium ion homeostasis|immune response|positive regulation of cell proliferation	extracellular space	chemokine activity|signal transducer activity				0		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTGGCTGTTGGTCTCATAGTA	0.577													13	65	---	---	---	---	PASS
CDC6	990	broad.mit.edu	37	17	38447541	38447541	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38447541G>C	uc002huj.1	+	3	620	c.410G>C	c.(409-411)AGA>ACA	p.R137T		NM_001254	NP_001245	Q99741	CDC6_HUMAN	cell division cycle 6 protein	137					cell division|DNA replication|DNA replication checkpoint|M/G1 transition of mitotic cell cycle|mitosis|negative regulation of cell proliferation|negative regulation of DNA replication|positive regulation of cell cycle cytokinesis|positive regulation of chromosome segregation|regulation of cyclin-dependent protein kinase activity|regulation of mitotic anaphase|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|traversing start control point of mitotic cell cycle	cytosol|nucleoplasm|spindle midzone|spindle pole	ATP binding|kinase binding|nucleoside-triphosphatase activity			ovary(2)|breast(1)	3						TCTGAGCAGAGATGTCCACTG	0.383													10	101	---	---	---	---	PASS
COASY	80347	broad.mit.edu	37	17	40714959	40714959	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40714959C>T	uc002hzz.2	+	2	476	c.319C>T	c.(319-321)CTC>TTC	p.L107F	COASY_uc010cyj.2_Missense_Mutation_p.L136F|COASY_uc002iab.2_5'UTR|COASY_uc002iad.2_Missense_Mutation_p.L107F|COASY_uc002iac.2_Missense_Mutation_p.L107F|COASY_uc002iae.2_5'Flank	NM_001042529	NP_001035994	Q13057	COASY_HUMAN	coenzyme A synthase isoform a	107					coenzyme A biosynthetic process|pantothenate metabolic process	mitochondrial outer membrane	ATP binding|dephospho-CoA kinase activity|pantetheine-phosphate adenylyltransferase activity				0		all_cancers(22;1.06e-05)|Breast(137;0.000153)|all_epithelial(22;0.000344)		BRCA - Breast invasive adenocarcinoma(366;0.13)		AGTCCAGAATCTCGCCCACCC	0.577													59	240	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40843901	40843901	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40843901G>A	uc002iay.2	+	16	2638	c.2422G>A	c.(2422-2424)GAT>AAT	p.D808N	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	808	Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CCACAGCCTGGATGTCTCCTT	0.577													78	380	---	---	---	---	PASS
BRCA1	672	broad.mit.edu	37	17	41246585	41246585	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41246585C>A	uc002icq.2	-	10	1195	c.963G>T	c.(961-963)TGG>TGT	p.W321C	BRCA1_uc010whp.1_Intron|BRCA1_uc010whl.1_Intron|BRCA1_uc010whm.1_Intron|BRCA1_uc002icp.3_Missense_Mutation_p.W250C|BRCA1_uc002icu.2_Intron|BRCA1_uc010cyx.2_Missense_Mutation_p.W274C|BRCA1_uc002ict.2_Missense_Mutation_p.W321C|BRCA1_uc010whn.1_Intron|BRCA1_uc010who.1_Intron|BRCA1_uc010whq.1_Intron|BRCA1_uc002idc.1_Intron|BRCA1_uc010whr.1_Intron|BRCA1_uc002idd.2_Missense_Mutation_p.W321C|BRCA1_uc002ide.1_Missense_Mutation_p.W152C|BRCA1_uc010cyy.1_Missense_Mutation_p.W321C|BRCA1_uc010whs.1_Missense_Mutation_p.W321C|BRCA1_uc010cyz.2_Missense_Mutation_p.W274C|BRCA1_uc010cza.2_Missense_Mutation_p.W295C|BRCA1_uc010wht.1_Missense_Mutation_p.W25C	NM_007294	NP_009225	P38398	BRCA1_HUMAN	breast cancer 1, early onset isoform 1	321					androgen receptor signaling pathway|apoptosis|cellular response to indole-3-methanol|chromosome segregation|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|DNA damage response, signal transduction resulting in induction of apoptosis|double-strand break repair via homologous recombination|fatty acid biosynthetic process|G2/M transition DNA damage checkpoint|negative regulation of centriole replication|negative regulation of fatty acid biosynthetic process|negative regulation of histone H3-K9 methylation|negative regulation of transcription, DNA-dependent|positive regulation of cell cycle arrest|positive regulation of DNA repair|positive regulation of histone acetylation|positive regulation of histone H3-K4 methylation|positive regulation of histone H4-K20 methylation|positive regulation of protein ubiquitination|positive regulation of transcription from RNA polymerase II promoter|postreplication repair|protein autoubiquitination|protein K6-linked ubiquitination|regulation of cell motility|regulation of cell proliferation|regulation of transcription from RNA polymerase III promoter|response to estrogen stimulus|response to ionizing radiation|substrate adhesion-dependent cell spreading	BRCA1-A complex|BRCA1-BARD1 complex|gamma-tubulin ring complex|nucleoplasm|plasma membrane|ribonucleoprotein complex|ruffle	androgen receptor binding|identical protein binding|protein binding|RNA binding|transcription coactivator activity|transcription regulatory region DNA binding|tubulin binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(24)|breast(21)|lung(4)|central_nervous_system(1)|endometrium(1)|urinary_tract(1)	52		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TACTTCCAGCCCATCTGTTAT	0.408			D|Mis|N|F|S		ovarian	breast|ovarian		Homologous_recombination	Hereditary_Breast-Ovarian_Cancer_BRCA1_type	TCGA Ovarian(2;0.000030)			20	231	---	---	---	---	PASS
PLEKHM1	9842	broad.mit.edu	37	17	43515290	43515290	+	Silent	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:43515290C>A	uc002ija.2	-	12	3275	c.3105G>T	c.(3103-3105)GTG>GTT	p.V1035V	PLEKHM1_uc010wjm.1_Silent_p.V1007V|PLEKHM1_uc002ijb.2_Silent_p.V510V	NM_014798	NP_055613	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M	1035	Phorbol-ester/DAG-type.				intracellular signal transduction	cytoplasm	metal ion binding				0	Renal(3;0.0405)					CCTTCTTCACCACAGCCTGGC	0.652													15	78	---	---	---	---	PASS
NPEPPS	9520	broad.mit.edu	37	17	45682807	45682807	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45682807C>T	uc002ilr.3	+	17	2207	c.1984C>T	c.(1984-1986)CTC>TTC	p.L662F	NPEPPS_uc010wkt.1_Missense_Mutation_p.L658F|NPEPPS_uc010wku.1_Missense_Mutation_p.L626F|NPEPPS_uc010wkv.1_Missense_Mutation_p.L216F|NPEPPS_uc002ils.1_Missense_Mutation_p.L95F	NM_006310	NP_006301	P55786	PSA_HUMAN	aminopeptidase puromycin sensitive	662					proteolysis	cytosol|nucleus	aminopeptidase activity|metallopeptidase activity|protein binding|zinc ion binding				0						CCTGGGGATTCTCTCAACTCT	0.463													3	23	---	---	---	---	PASS
NXPH3	11248	broad.mit.edu	37	17	47656017	47656017	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47656017C>T	uc002ipa.2	+	2	398	c.114C>T	c.(112-114)CAC>CAT	p.H38H	NXPH3_uc010wlw.1_Silent_p.H38H	NM_007225	NP_009156	O95157	NXPH3_HUMAN	neurexophilin 3 precursor	38	II.				neuropeptide signaling pathway	extracellular region				pancreas(1)|skin(1)	2	all_cancers(4;7.45e-14)|Breast(4;1.08e-27)|all_epithelial(4;2.27e-17)					GTGATGACCACGAGGGCCAGC	0.657													4	108	---	---	---	---	PASS
EME1	146956	broad.mit.edu	37	17	48458295	48458295	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48458295G>C	uc002iqs.1	+	9	1781	c.1708G>C	c.(1708-1710)GAC>CAC	p.D570H	EME1_uc010dbp.1_Missense_Mutation_p.D583H|EME1_uc010dbq.1_RNA|uc010wmk.1_5'Flank	NM_152463	NP_689676	Q96AY2	EME1_HUMAN	essential meiotic endonuclease 1 homolog 1	570					DNA recombination|DNA repair	nucleolus	DNA binding|endonuclease activity|metal ion binding|protein binding				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			AGATAGTGCTGACTGATTCTA	0.502								Direct_reversal_of_damage|Homologous_recombination					3	73	---	---	---	---	PASS
MTMR4	9110	broad.mit.edu	37	17	56569101	56569101	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56569101C>A	uc002iwj.2	-	19	3621	c.3511G>T	c.(3511-3513)GAA>TAA	p.E1171*		NM_004687	NP_004678	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	1171	FYVE-type.					cytoplasm|membrane	metal ion binding|protein tyrosine phosphatase activity			skin(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TGAATGTGTTCGTAACATGAG	0.483													20	103	---	---	---	---	PASS
ITGB4	3691	broad.mit.edu	37	17	73732131	73732131	+	Splice_Site	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73732131G>A	uc002jpg.2	+	14	1845	c.1658_splice	c.e14-1	p.D553_splice	ITGB4_uc002jph.2_Splice_Site_p.D553_splice|ITGB4_uc010dgo.2_Splice_Site_p.D553_splice|ITGB4_uc002jpi.3_Splice_Site_p.D553_splice|ITGB4_uc010dgp.1_Splice_Site_p.D553_splice|ITGB4_uc002jpj.2_Splice_Site_p.D553_splice|ITGB4_uc010wsh.1_Splice_Site_p.D108_splice	NM_000213	NP_000204	P16144	ITB4_HUMAN	integrin beta 4 isoform 1 precursor						cell communication|cell motility|cell-matrix adhesion|hemidesmosome assembly|integrin-mediated signaling pathway|multicellular organismal development|response to wounding	cell leading edge|cell surface|hemidesmosome|integrin complex	protein binding|receptor activity			lung(4)	4	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			CCTCTCTGCAGACCGAGGACG	0.612													15	266	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74163754	74163754	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74163754C>T	uc002jqz.2	-	4	490	c.421G>A	c.(421-423)GAG>AAG	p.E141K	RNF157_uc002jra.2_Missense_Mutation_p.E141K	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	141							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			TTCTGGAACTCTTCCGTGGCC	0.483													10	157	---	---	---	---	PASS
CARD14	79092	broad.mit.edu	37	17	78165148	78165148	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78165148G>C	uc002jxw.1	+	8	1311	c.1116G>C	c.(1114-1116)CAG>CAC	p.Q372H	CARD14_uc002jxt.1_RNA|CARD14_uc002jxv.2_Missense_Mutation_p.Q372H|CARD14_uc010wud.1_RNA|CARD14_uc002jxx.2_Missense_Mutation_p.Q135H|CARD14_uc010dhu.1_Missense_Mutation_p.Q170H	NM_024110	NP_077015	Q9BXL6	CAR14_HUMAN	caspase recruitment domain protein 14 isoform 1	372	Potential.				activation of NF-kappaB-inducing kinase activity|positive regulation of protein phosphorylation|regulation of apoptosis	aggresome|cytoplasm|plasma membrane	CARD domain binding			ovary(4)|skin(1)	5	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			ACAGTGCTCAGAGGGAGATTT	0.657													8	109	---	---	---	---	PASS
ZNF521	25925	broad.mit.edu	37	18	22932086	22932086	+	5'UTR	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22932086C>T	uc002kvk.2	-	1					ZNF521_uc010xbe.1_RNA|ZNF521_uc010dly.2_5'UTR|ZNF521_uc002kvl.2_5'UTR	NM_015461	NP_056276	Q96K83	ZN521_HUMAN	zinc finger protein 521						cell differentiation|multicellular organismal development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein domain specific binding|zinc ion binding			ovary(4)|large_intestine(2)|lung(1)	7	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CGCAGGGACTCGCTCTGTACG	0.577			T	PAX5	ALL								5	77	---	---	---	---	PASS
TJP3	27134	broad.mit.edu	37	19	3740705	3740705	+	Nonsense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3740705C>G	uc010xhv.1	+	13	1886	c.1886C>G	c.(1885-1887)TCA>TGA	p.S629*	TJP3_uc010xhs.1_Nonsense_Mutation_p.S596*|TJP3_uc010xht.1_Nonsense_Mutation_p.S560*|TJP3_uc010xhu.1_Nonsense_Mutation_p.S605*|TJP3_uc010xhw.1_Nonsense_Mutation_p.S615*	NM_014428	NP_055243	O95049	ZO3_HUMAN	tight junction protein 3	610	Guanylate kinase-like.					tight junction	protein binding			ovary(1)|central_nervous_system(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGACCTCTCAGCTCTGACC	0.687													5	48	---	---	---	---	PASS
TMEM146	257062	broad.mit.edu	37	19	5776281	5776281	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5776281A>G	uc002mda.2	+	21	2112	c.2051A>G	c.(2050-2052)AAT>AGT	p.N684S		NM_152784	NP_689997	Q86XM0	TM146_HUMAN	transmembrane protein 146 precursor	684	Extracellular (Potential).					integral to membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						TTCGGCCACAATGGCTTTTAT	0.577													12	82	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8154983	8154983	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8154983C>T	uc002mjf.2	-	48	6205	c.6184G>A	c.(6184-6186)GCT>ACT	p.A2062T	FBN3_uc002mje.2_5'Flank	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2062	TB 8.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GGGCACTCACCGCTGCCCTCC	0.632													3	67	---	---	---	---	PASS
MYO1F	4542	broad.mit.edu	37	19	8601411	8601411	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8601411G>T	uc002mkg.2	-	18	1984	c.1870C>A	c.(1870-1872)CGC>AGC	p.R624S		NM_012335	NP_036467	O00160	MYO1F_HUMAN	myosin IF	624	Myosin head-like.					unconventional myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(1)	3						AACTGGCGGCGGTAGGCGAAG	0.642													13	100	---	---	---	---	PASS
MAST1	22983	broad.mit.edu	37	19	12962980	12962980	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12962980G>T	uc002mvm.2	+	9	1056	c.928G>T	c.(928-930)GCC>TCC	p.A310S	MAST1_uc002mvk.2_Missense_Mutation_p.A306S	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase	310					cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						CGAAGGACACGCCAAGGAGGG	0.652													12	98	---	---	---	---	PASS
C19orf57	79173	broad.mit.edu	37	19	14000131	14000131	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14000131C>T	uc002mxl.1	-	6	1597	c.1538G>A	c.(1537-1539)CGA>CAA	p.R513Q	C19orf57_uc002mxk.1_Missense_Mutation_p.R395Q|C19orf57_uc002mxm.1_Intron	NM_024323	NP_077299	Q0VDD7	CS057_HUMAN	hypothetical protein LOC79173	513					multicellular organismal development		protein binding			ovary(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			CAGGTGGTCTCGCTGCCCTGC	0.597													7	86	---	---	---	---	PASS
JAK3	3718	broad.mit.edu	37	19	17950440	17950440	+	Silent	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17950440G>A	uc002nhn.3	-	10	1387	c.1287C>T	c.(1285-1287)CTC>CTT	p.L429L	JAK3_uc010ebh.2_RNA|JAK3_uc002nho.2_Silent_p.L429L|JAK3_uc010xpx.1_Silent_p.L429L	NM_000215	NP_000206	P52333	JAK3_HUMAN	Janus kinase 3	429	SH2; atypical.				B cell differentiation|cytokine-mediated signaling pathway|enzyme linked receptor protein signaling pathway|intracellular protein kinase cascade|negative regulation of dendritic cell cytokine production|negative regulation of FasL biosynthetic process|negative regulation of interleukin-10 production|negative regulation of interleukin-12 production|negative regulation of T-helper 1 cell differentiation|negative regulation of thymocyte apoptosis|peptidyl-tyrosine phosphorylation|positive regulation of anti-apoptosis|response to interleukin-15|response to interleukin-2|response to interleukin-4|response to interleukin-9|T cell homeostasis	cytoskeleton|cytosol|endomembrane system|membrane	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			haematopoietic_and_lymphoid_tissue(40)|lung(5)|breast(5)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	56						TGCGCCGGATGAGGCAGCCCT	0.602		2	Mis		acute megakaryocytic leukemia|								4	23	---	---	---	---	PASS
PSMC4	5704	broad.mit.edu	37	19	40477127	40477127	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40477127C>G	uc002omq.2	+	1	55	c.18C>G	c.(16-18)ATC>ATG	p.I6M	PSMC4_uc002omr.2_Missense_Mutation_p.I6M	NM_006503	NP_006494	P43686	PRS6B_HUMAN	proteasome 26S ATPase subunit 4 isoform 1	6					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	mitochondrion|nucleus|proteasome complex	ATP binding|ATPase activity|protein binding			ovary(1)	1	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGATAGGCATCTTGGTGGAGA	0.617													11	177	---	---	---	---	PASS
GSK3A	2931	broad.mit.edu	37	19	42738713	42738713	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42738713A>G	uc002otb.1	-	5	903	c.784T>C	c.(784-786)TGC>CGC	p.C262R	GSK3A_uc002ota.1_Missense_Mutation_p.C180R|GSK3A_uc002otc.2_RNA	NM_019884	NP_063937	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	262	Protein kinase.				insulin receptor signaling pathway|negative regulation of glucose import|negative regulation of insulin receptor signaling pathway|negative regulation of transferase activity|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of protein catabolic process	beta-catenin destruction complex|cytosol	ATP binding|protein kinase A catalytic subunit binding|protein serine/threonine kinase activity|tau-protein kinase activity			ovary(2)|lung(2)	4		Prostate(69;0.00682)				CCAAAATCGCAGAGCTTGAGG	0.627													12	93	---	---	---	---	PASS
SLC17A7	57030	broad.mit.edu	37	19	49933907	49933907	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49933907C>A	uc002pnp.2	-	12	1724	c.1552G>T	c.(1552-1554)GGC>TGC	p.G518C	SLC17A7_uc002pno.2_Missense_Mutation_p.G180C	NM_020309	NP_064705	Q9P2U7	VGLU1_HUMAN	solute carrier family 17, member 7	518	Cytoplasmic (Potential).				glutamate secretion|neurotransmitter secretion	cell junction|clathrin sculpted glutamate transport vesicle membrane|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|sodium-dependent phosphate transmembrane transporter activity|sodium:inorganic phosphate symporter activity			ovary(1)|pancreas(1)|skin(1)	3		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		TCGTCACTGCCAGCCAGCTGG	0.637													15	85	---	---	---	---	PASS
CPT1C	126129	broad.mit.edu	37	19	50213726	50213726	+	Silent	SNP	A	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50213726A>G	uc002ppj.2	+	14	1921	c.1716A>G	c.(1714-1716)CAA>CAG	p.Q572Q	CPT1C_uc002ppl.3_Silent_p.Q538Q|CPT1C_uc002ppi.2_Silent_p.Q489Q|CPT1C_uc002ppk.2_Silent_p.Q561Q|CPT1C_uc010eng.2_Silent_p.Q572Q|CPT1C_uc010enh.2_Silent_p.Q572Q|CPT1C_uc010ybc.1_Silent_p.Q443Q|CPT1C_uc010eni.1_Silent_p.Q229Q	NM_152359	NP_689572	Q8TCG5	CPT1C_HUMAN	carnitine palmitoyltransferase 1C isoform 2	572	Cytoplasmic (Potential).				fatty acid metabolic process	integral to membrane|mitochondrial outer membrane	carnitine O-palmitoyltransferase activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0011)|GBM - Glioblastoma multiforme(134;0.00786)		TCGCCTTGCAACTGGCCCACT	0.587													9	62	---	---	---	---	PASS
SIGLEC9	27180	broad.mit.edu	37	19	51629380	51629380	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51629380G>A	uc002pvu.2	+	3	810	c.743G>A	c.(742-744)GGC>GAC	p.G248D	SIGLEC9_uc010yct.1_Missense_Mutation_p.G248D	NM_014441	NP_055256	Q9Y336	SIGL9_HUMAN	sialic acid binding Ig-like lectin 9 precursor	248	Extracellular (Potential).|Ig-like C2-type 2.				cell adhesion|cell surface receptor linked signaling pathway	integral to plasma membrane	sugar binding			skin(1)	1		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.000826)|OV - Ovarian serous cystadenocarcinoma(262;0.00295)		CAAGGAGACGGCACAGGTAGG	0.597													5	116	---	---	---	---	PASS
ZNF614	80110	broad.mit.edu	37	19	52521336	52521336	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52521336C>G	uc002pyj.2	-	4	565	c.163G>C	c.(163-165)GAT>CAT	p.D55H	ZNF614_uc002pyi.3_Missense_Mutation_p.D55H|ZNF614_uc010epj.2_5'UTR	NM_025040	NP_079316	Q8N883	ZN614_HUMAN	zinc finger protein 614	55	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		GAGAGTACATCTGGTTTGCTA	0.393													11	125	---	---	---	---	PASS
ZNF616	90317	broad.mit.edu	37	19	52619900	52619900	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52619900C>A	uc002pym.2	-	4	800	c.517G>T	c.(517-519)GGT>TGT	p.G173C	ZNF616_uc002pyn.2_RNA	NM_178523	NP_848618	Q08AN1	ZN616_HUMAN	zinc finger protein 616	173					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0				GBM - Glioblastoma multiforme(134;0.00392)|OV - Ovarian serous cystadenocarcinoma(262;0.0189)		ACTAAACAACCATTATTACCT	0.383													21	190	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58963053	58963053	+	5'UTR	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58963053G>A	uc002qsv.1	+	1					ZNF324B_uc002qsu.1_5'UTR|ZNF324B_uc010euq.1_5'UTR	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GTCGGGGCCCGAGGCGGGCGG	0.632													5	16	---	---	---	---	PASS
TGM6	343641	broad.mit.edu	37	20	2398026	2398026	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2398026C>T	uc002wfy.1	+	10	1546	c.1485C>T	c.(1483-1485)ATC>ATT	p.I495I	TGM6_uc010gal.1_Silent_p.I495I	NM_198994	NP_945345	O95932	TGM3L_HUMAN	transglutaminase 6	495					cell death|peptide cross-linking		acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			ovary(3)|skin(1)	4					L-Glutamine(DB00130)	AGCCCAGCATCGCTGGCAAGT	0.662													5	60	---	---	---	---	PASS
ADRA1D	146	broad.mit.edu	37	20	4229246	4229246	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4229246G>C	uc002wkr.2	-	1	414	c.359C>G	c.(358-360)TCA>TGA	p.S120*		NM_000678	NP_000669	P25100	ADA1D_HUMAN	alpha-1D-adrenergic receptor	120	Helical; Name=1; (By similarity).				cell proliferation|cell-cell signaling|DNA metabolic process|G-protein signaling, coupled to cAMP nucleotide second messenger|multicellular organismal development|positive regulation of cell proliferation	integral to plasma membrane	alpha1-adrenergic receptor activity				0					Alfuzosin(DB00346)|Bethanidine(DB00217)|Dapiprazole(DB00298)|Debrisoquin(DB04840)|Doxazosin(DB00590)|Guanadrel Sulfate(DB00226)|Guanethidine(DB01170)|Methotrimeprazine(DB01403)|Norepinephrine(DB00368)|Promazine(DB00420)|Propericiazine(DB01608)|Propiomazine(DB00777)|Sertindole(DB06144)|Tamsulosin(DB00706)|Terazosin(DB01162)	GCAGGCCACTGAGAGGATGAC	0.473													3	26	---	---	---	---	PASS
TPX2	22974	broad.mit.edu	37	20	30385200	30385200	+	Intron	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30385200C>G	uc002wwp.1	+						TPX2_uc010gdv.1_Intron	NM_012112	NP_036244	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated protein homolog						activation of protein kinase activity|apoptosis|cell division|cell proliferation|mitosis|regulation of mitotic spindle organization	cytoplasm|microtubule|nucleus|spindle pole	ATP binding|GTP binding|protein kinase binding			large_intestine(1)|ovary(1)	2			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			GACTTTCTCTCTAATAGCTGG	0.418													51	253	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34535534	34535534	+	Silent	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34535534C>T	uc002xek.1	+	18	3135	c.3024C>T	c.(3022-3024)CTC>CTT	p.L1008L		NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	1008					regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					AGATCGCCCTCTGCTGCTCAA	0.557													13	67	---	---	---	---	PASS
PREX1	57580	broad.mit.edu	37	20	47258974	47258974	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47258974G>A	uc002xtw.1	-	28	3678	c.3655C>T	c.(3655-3657)CAT>TAT	p.H1219Y	PREX1_uc002xtv.1_Missense_Mutation_p.H516Y	NM_020820	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,	1219					actin filament polymerization|apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|neutrophil activation|small GTPase mediated signal transduction|superoxide metabolic process	cytosol|plasma membrane	enzyme binding|phospholipid binding|Rho GTPase activator activity|Rho guanyl-nucleotide exchange factor activity			lung(3)|ovary(2)|pancreas(1)	6			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGGCAGCCATGAAGCTTGTCC	0.592													13	45	---	---	---	---	PASS
CBLN4	140689	broad.mit.edu	37	20	54573773	54573773	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54573773G>A	uc002xxa.2	-	3	1231	c.446C>T	c.(445-447)GCC>GTC	p.A149V		NM_080617	NP_542184	Q9NTU7	CBLN4_HUMAN	cerebellin 4 precursor	149	C1q.					cell junction|extracellular region|synapse				ovary(3)|pancreas(1)	4			Colorectal(105;0.202)			CCCCGCAAAGGCAGATATTAC	0.373													13	93	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60574149	60574149	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60574149C>G	uc002ybs.2	-	12	2803	c.2803G>C	c.(2803-2805)GAG>CAG	p.E935Q		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	935					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CTCGCCTGCTCATATCTGTCG	0.483													41	597	---	---	---	---	PASS
MORC3	23515	broad.mit.edu	37	21	37711192	37711192	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37711192C>T	uc002yvi.2	+	5	657	c.581C>T	c.(580-582)ACG>ATG	p.T194M		NM_015358	NP_056173	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	194					cell aging|maintenance of protein location in nucleus|negative regulation of fibroblast proliferation|peptidyl-serine phosphorylation|protein stabilization	aggresome|intermediate filament cytoskeleton|PML body	ATP binding|zinc ion binding			ovary(2)	2						AAGAAGGGGACGAGGATCATC	0.438													5	273	---	---	---	---	PASS
KRTAP10-7	386675	broad.mit.edu	37	21	46021273	46021273	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46021273A>T	uc002zfn.3	+	2	762	c.737A>T	c.(736-738)GAT>GTT	p.D246V	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198689	NP_941962	P60409	KR107_HUMAN	keratin associated protein 10-7	251	30 X 5 AA repeats of C-C-X(3).					keratin filament					0						TGCTCTGATGATTCCGGTTCA	0.647													14	233	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47754334	47754334	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47754334G>C	uc002zji.3	+	3	398	c.291G>C	c.(289-291)AAG>AAC	p.K97N	PCNT_uc002zjj.2_5'UTR|PCNT_uc010gqk.1_RNA	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin	97					cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					ATGGAGAGAAGAGAGAGGACT	0.542													7	143	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	23101419	23101419	+	RNA	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23101419C>T	uc011aim.1	+	210		c.10848C>T								Parts of antibodies, mostly variable regions.												0						TGCCCTGACTCAGCCTGCCTC	0.592													19	209	---	---	---	---	PASS
PATZ1	23598	broad.mit.edu	37	22	31740795	31740795	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31740795C>T	uc003akq.2	-	1	1455	c.794G>A	c.(793-795)CGA>CAA	p.R265Q	PATZ1_uc003akp.2_Missense_Mutation_p.R265Q|PATZ1_uc003akr.2_Missense_Mutation_p.R265Q|PATZ1_uc003aks.2_Missense_Mutation_p.R265Q|uc003akt.2_5'Flank	NM_014323	NP_055138	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	265	A.T hook.				negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding		EWSR1/PATZ1(2)	soft_tissue(2)	2						GCCCCGGCCTCGCTTGCCAGT	0.652													7	31	---	---	---	---	PASS
ARHGAP6	395	broad.mit.edu	37	X	11204422	11204422	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:11204422G>C	uc004cup.1	-	5	2080	c.1207C>G	c.(1207-1209)CTG>GTG	p.L403V	ARHGAP6_uc004cuo.1_RNA|ARHGAP6_uc004cur.1_Missense_Mutation_p.L403V|ARHGAP6_uc004cum.1_Missense_Mutation_p.L200V|ARHGAP6_uc004cun.1_Missense_Mutation_p.L223V|ARHGAP6_uc010neb.1_Missense_Mutation_p.L225V|ARHGAP6_uc011mif.1_Missense_Mutation_p.L200V	NM_013427	NP_038286	O43182	RHG06_HUMAN	Rho GTPase activating protein 6 isoform 1	403	Rho-GAP.				actin filament polymerization|activation of phospholipase C activity|negative regulation of focal adhesion assembly|negative regulation of stress fiber assembly|Rho protein signal transduction	actin filament|cytosol	phospholipase activator activity|phospholipase binding|Rho GTPase activator activity|SH3 domain binding|SH3/SH2 adaptor activity			urinary_tract(1)|lung(1)	2						ATAGGATTCAGACTGAGTTTC	0.428													32	154	---	---	---	---	PASS
TLR8	51311	broad.mit.edu	37	X	12939453	12939453	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:12939453C>A	uc004cve.2	+	2	2362	c.2294C>A	c.(2293-2295)TCT>TAT	p.S765Y	TLR8_uc004cvd.2_Missense_Mutation_p.S783Y	NM_138636	NP_619542	Q9NR97	TLR8_HUMAN	toll-like receptor 8 precursor	765	Extracellular (Potential).				cellular response to mechanical stimulus|defense response to virus|I-kappaB kinase/NF-kappaB cascade|immunoglobulin mediated immune response|inflammatory response|innate immune response|positive regulation of innate immune response|positive regulation of interferon-alpha biosynthetic process|positive regulation of interferon-beta biosynthetic process|positive regulation of interferon-gamma biosynthetic process|positive regulation of interleukin-8 biosynthetic process	endosome membrane	DNA binding|double-stranded RNA binding|single-stranded RNA binding|transmembrane receptor activity			ovary(4)|lung(2)|large_intestine(1)	7						ACCAAATTATCTATGTTGGAA	0.408													9	78	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998327	27998327	+	Silent	SNP	T	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998327T>A	uc004dbx.1	-	1	1240	c.1125A>T	c.(1123-1125)GTA>GTT	p.V375V		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	375										ovary(3)|skin(1)	4						ATTTCTTGAGTACTCCATTGT	0.423													15	46	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998340	27998340	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998340T>C	uc004dbx.1	-	1	1227	c.1112A>G	c.(1111-1113)GAA>GGA	p.E371G		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	371	WD 4.									ovary(3)|skin(1)	4						TCCATTGTTTTCTTTCTTATC	0.393													10	47	---	---	---	---	PASS
ZMAT1	84460	broad.mit.edu	37	X	101139090	101139090	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101139090G>T	uc004eim.2	-	2	4294	c.796C>A	c.(796-798)CAT>AAT	p.H266N	ZMAT1_uc011mrl.1_Missense_Mutation_p.H437N|ZMAT1_uc004ein.2_Missense_Mutation_p.H266N|ZMAT1_uc011mrm.1_Missense_Mutation_p.H266N	NM_032441	NP_115817	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin type 1 isoform 3	266						nucleus	zinc ion binding			ovary(1)	1						AACATTCTATGTCTGGGTCTG	0.418													123	201	---	---	---	---	PASS
GPRASP1	9737	broad.mit.edu	37	X	101911775	101911775	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101911775G>T	uc004ejj.3	+	5	3735	c.2934G>T	c.(2932-2934)GAG>GAT	p.E978D	GPRASP1_uc004eji.3_Missense_Mutation_p.E978D|GPRASP1_uc010nod.2_Missense_Mutation_p.E978D	NM_014710	NP_055525	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting	978	Glu-rich.|OPRD1-binding.					cytoplasm	protein binding			ovary(1)|lung(1)	2						CTGAAGATGAGGTAGATAACA	0.507													42	71	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123224762	123224762	+	Intron	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123224762G>T	uc004etz.3	+						STAG2_uc004eua.2_Nonsense_Mutation_p.E1176*|STAG2_uc004eub.2_Intron|STAG2_uc004euc.2_Nonsense_Mutation_p.E1176*|STAG2_uc004eud.2_Intron|STAG2_uc004eue.2_Intron	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						GCAACAGCAGGAGAGAGCAGC	0.403													6	29	---	---	---	---	PASS
USP26	83844	broad.mit.edu	37	X	132161299	132161299	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:132161299G>T	uc010nrm.1	-	6	1420	c.950C>A	c.(949-951)CCA>CAA	p.P317Q	USP26_uc011mvf.1_Missense_Mutation_p.P317Q	NM_031907	NP_114113	Q9BXU7	UBP26_HUMAN	ubiquitin-specific protease 26	317					protein deubiquitination|ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(3)|central_nervous_system(3)|kidney(1)|liver(1)	8	Acute lymphoblastic leukemia(192;0.000127)					AGCAAACGATGGGATTGAAAG	0.383													19	61	---	---	---	---	PASS
GABRQ	55879	broad.mit.edu	37	X	151815469	151815469	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151815469G>A	uc004ffp.1	+	4	387	c.367G>A	c.(367-369)GAG>AAG	p.E123K		NM_018558	NP_061028	Q9UN88	GBRT_HUMAN	gamma-aminobutyric acid (GABA) receptor, theta	123	Extracellular (Potential).					cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity|neurotransmitter transporter activity			ovary(2)|pancreas(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					AGCATACTATGAGACCACCCT	0.448													23	118	---	---	---	---	PASS
NLGN4Y	22829	broad.mit.edu	37	Y	16952691	16952691	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:16952691C>A	uc004ftg.2	+	6	2252	c.2000C>A	c.(1999-2001)ACC>AAC	p.T667N	NLGN4Y_uc004fte.2_Missense_Mutation_p.T499N|NLGN4Y_uc011nas.1_Missense_Mutation_p.T687N|NLGN4Y_uc004ftf.2_Missense_Mutation_p.T360N|NLGN4Y_uc004fth.2_Missense_Mutation_p.T667N	NM_014893	NP_055708	Q8NFZ3	NLGNY_HUMAN	neuroligin 4, Y-linked isoform 1	667	Extracellular (Potential).				brainstem development|cell adhesion|cerebellum development|male courtship behavior|positive regulation of organ growth|social behavior|synapse assembly|territorial aggressive behavior|vocalization behavior	cell surface|integral to plasma membrane|synapse	neurexin binding|receptor activity				0						CTCATTGAAACCAAACGAGAT	0.512													4	108	---	---	---	---	PASS
MEGF6	1953	broad.mit.edu	37	1	3418615	3418615	+	Intron	DEL	G	-	-	rs111656273		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3418615delG	uc001akl.2	-						MEGF6_uc001akk.2_Intron	NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GTGCCCCCCCGGCGCCTCCTC	0.711													5	4	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21488462	21488462	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21488462delA	uc001bef.2	-						EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bee.2_Intron|EIF4G3_uc001beh.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		actctgtctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39545373	39545374	+	5'Flank	INS	-	TTCC	TTCC	rs139109290	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39545373_39545374insTTCC	uc010ois.1	+						MACF1_uc010oir.1_5'Flank	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TCAAATTTCTTttccttccttc	0.188													7	7	---	---	---	---	
NFIA	4774	broad.mit.edu	37	1	61921199	61921199	+	3'UTR	DEL	A	-	-	rs74089375		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:61921199delA	uc001czw.2	+	11					NFIA_uc001czy.2_3'UTR|NFIA_uc010oos.1_3'UTR|NFIA_uc001czv.2_3'UTR|NFIA_uc001czx.2_3'UTR|NFIA_uc009wae.2_RNA	NM_001134673	NP_001128145	Q12857	NFIA_HUMAN	nuclear factor I/A isoform 1						DNA replication|viral genome replication	cell junction|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			pancreas(1)|skin(1)	2						TTTTTTTTTTAAAATACTTTA	0.378													6	3	---	---	---	---	
INADL	10207	broad.mit.edu	37	1	62483402	62483402	+	Intron	DEL	A	-	-	rs138754411		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:62483402delA	uc001dab.2	+						INADL_uc009waf.1_Intron|INADL_uc001daa.2_Intron|INADL_uc001dad.3_Intron|INADL_uc001dac.2_Intron|INADL_uc010oot.1_Intron|INADL_uc009wag.2_Intron|INADL_uc010oou.1_Intron	NM_176877	NP_795352	Q8NI35	INADL_HUMAN	InaD-like						intracellular signal transduction|tight junction assembly	apical plasma membrane|perinuclear region of cytoplasm|tight junction	protein binding			ovary(3)|skin(1)	4						agactgtctcaaaaaaaaaaa	0.075													4	2	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247076400	247076400	+	Intron	DEL	T	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076400delT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTAAAATACCTTTTTTTTTTT	0.299													3	3	---	---	---	---	
WDR43	23160	broad.mit.edu	37	2	29129301	29129301	+	Intron	DEL	T	-	-	rs113220687		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:29129301delT	uc002rmo.2	+							NM_015131	NP_055946	Q15061	WDR43_HUMAN	WD repeat domain 43							nucleolus				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)					cagccttaaattttttttttt	0.194													3	3	---	---	---	---	
THSD7B	80731	broad.mit.edu	37	2	138000234	138000234	+	Intron	DEL	T	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:138000234delT	uc002tva.1	+						THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Intron	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGTGAGCACCTTTTTTTTTTT	0.393													5	3	---	---	---	---	
CDCA7	83879	broad.mit.edu	37	2	174229327	174229328	+	Intron	INS	-	TAT	TAT	rs143428036	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174229327_174229328insTAT	uc002uid.1	+						CDCA7_uc002uic.1_Intron|CDCA7_uc010zej.1_Intron|CDCA7_uc010zek.1_Intron	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2						regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			ACTGGGCTTGGTATTACAAAAG	0.302													4	2	---	---	---	---	
SERPINE2	5270	broad.mit.edu	37	2	224866712	224866716	+	Intron	DEL	CAGAT	-	-	rs145573218	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224866712_224866716delCAGAT	uc002vnu.2	-						SERPINE2_uc002vnt.2_Intron|SERPINE2_uc010zlr.1_Intron|SERPINE2_uc002vnv.2_Intron	NM_006216	NP_006207	P07093	GDN_HUMAN	plasminogen activator inhibitor type 1, member 2						negative regulation of blood coagulation|negative regulation of plasminogen activation|negative regulation of platelet aggregation|positive regulation of astrocyte differentiation|regulation of cell migration	cytosol|extracellular matrix|extracellular space|extrinsic to external side of plasma membrane|neuromuscular junction|platelet alpha granule	heparin binding|receptor binding|serine-type endopeptidase inhibitor activity			breast(2)|ovary(1)|central_nervous_system(1)	4		Renal(207;0.025)|all_lung(227;0.0586)|Lung NSC(271;0.0682)|all_hematologic(139;0.0797)		Epithelial(121;5.68e-10)|all cancers(144;1.9e-07)|Lung(261;0.0088)|LUSC - Lung squamous cell carcinoma(224;0.00902)		ttttttcccccagatagagactcgt	0.132													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	228642467	228642468	+	IGR	INS	-	TTCC	TTCC			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228642467_228642468insTTCC								SLC19A3 (59722 upstream) : CCL20 (36090 downstream)																							accttctttctttccttccttc	0.198													4	3	---	---	---	---	
NCL	4691	broad.mit.edu	37	2	232325998	232325998	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325998delA	uc002vru.2	-						SNORD82_uc010fxw.1_5'Flank	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		aaaaaaatttaaaaaaaaaaa	0.119													5	4	---	---	---	---	
SHQ1	55164	broad.mit.edu	37	3	72841935	72841936	+	Intron	INS	-	A	A			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72841935_72841936insA	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		acctccatctcaaaaaaaaaaa	0.139													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152000965	152000972	+	IGR	DEL	TCCTTCCT	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152000965_152000972delTCCTTCCT								LRBA (64086 upstream) : RPS3A (19782 downstream)																							cttccttccgtccttccttccttccttc	0.000													4	2	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154142937	154142940	+	Intron	DEL	AAGG	-	-	rs35003062		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154142937_154142940delAAGG	uc003ing.2	+						TRIM2_uc003inh.2_Intron	NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		gaaagaagaaaaggaaggaaagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	28780220	28780221	+	IGR	INS	-	TTCC	TTCC			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:28780220_28780221insTTCC								None (None upstream) : None (None downstream)																							ttctctgtcttttccttccttc	0.084													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													13	6	---	---	---	---	
RNF145	153830	broad.mit.edu	37	5	158608809	158608809	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:158608809delA	uc003lxp.2	-						RNF145_uc011ddy.1_Intron|RNF145_uc003lxo.1_Intron|RNF145_uc011ddz.1_Intron|RNF145_uc010jiq.1_Intron|RNF145_uc011dea.1_Intron	NM_144726	NP_653327	Q96MT1	RN145_HUMAN	ring finger protein 145							integral to membrane	zinc ion binding			ovary(3)|lung(1)|skin(1)	5	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGAAGACTTAAAAAAAAAAA	0.294													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	161266841	161266848	+	IGR	DEL	TTCTTTCC	-	-	rs10535909	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:161266841_161266848delTTCTTTCC								GABRA6 (137243 upstream) : GABRA1 (7349 downstream)																							ctttctttctttctttccttccttcctt	0.000													4	2	---	---	---	---	
ZKSCAN3	80317	broad.mit.edu	37	6	28327932	28327932	+	Intron	DEL	T	-	-	rs113424723		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28327932delT	uc003nle.3	+						ZKSCAN3_uc010jrc.2_Intron|ZKSCAN3_uc003nlf.3_Intron	NM_024493	NP_077819	Q9BRR0	ZKSC3_HUMAN	zinc finger with KRAB and SCAN domains 3						positive regulation of transcription, DNA-dependent|viral reproduction	nucleus	chromatin binding|DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						ctcagaataatttttttttta	0.050													2	4	---	---	---	---	
KIAA0240	23506	broad.mit.edu	37	6	42789978	42789978	+	Intron	DEL	T	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42789978delT	uc003osn.1	+						KIAA0240_uc003osm.1_Intron|KIAA0240_uc011duw.1_Intron|KIAA0240_uc003oso.1_Intron|KIAA0240_uc003osp.1_Intron	NM_015349	NP_056164	Q6AI39	K0240_HUMAN	hypothetical protein LOC23506											ovary(1)	1	Colorectal(47;0.196)		Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00524)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.104)			TCAGTAAttcttttttttttt	0.124													6	3	---	---	---	---	
SFT2D1	113402	broad.mit.edu	37	6	166739420	166739421	+	Intron	INS	-	C	C			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166739420_166739421insC	uc003qux.2	-							NM_145169	NP_660152	Q8WV19	SFT2A_HUMAN	SFT2 domain containing 1						protein transport|vesicle-mediated transport	integral to membrane				central_nervous_system(1)	1		Breast(66;0.000148)|Prostate(117;0.109)|Ovarian(120;0.199)		OV - Ovarian serous cystadenocarcinoma(33;2.63e-19)|BRCA - Breast invasive adenocarcinoma(81;4.92e-06)|GBM - Glioblastoma multiforme(31;4.58e-05)		TTCACTGACTACCTCTATGCTG	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93578218	93578221	+	IGR	DEL	GAAG	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93578218_93578221delGAAG								GNG11 (22394 upstream) : BET1 (13864 downstream)																							GAAAaaggaagaaggaaggaagga	0.142													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	99178594	99178594	+	IGR	DEL	T	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99178594delT								ZNF655 (4520 upstream) : ZNF498 (35977 downstream)																							ACCCCCCACCttttttttttg	0.080													4	2	---	---	---	---	
FAM3C	10447	broad.mit.edu	37	7	121023197	121023197	+	Intron	DEL	A	-	-	rs35702337		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121023197delA	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					CATTGGCATTAAAAAAAAAAA	0.209													6	4	---	---	---	---	
GALT	2592	broad.mit.edu	37	9	34646573	34646576	+	5'Flank	DEL	CAGT	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34646573_34646576delCAGT	uc003zve.2	+						GALT_uc003zvf.2_5'Flank|GALT_uc003zvg.2_5'Flank|GALT_uc003zvh.2_5'Flank|GALT_uc011lop.1_5'Flank	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase						galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		CAGGGCAGCCCAGTCAGTCAGTCA	0.642									Galactosemia		OREG0019158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	110004557	110004557	+	IGR	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:110004557delA								ZNF462 (230768 upstream) : RAD23B (40987 downstream)																							aaagaaaaggaaggaaggaag	0.000													2	4	---	---	---	---	
C5	727	broad.mit.edu	37	9	123725782	123725783	+	Intron	INS	-	A	A	rs111500884		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123725782_123725783insA	uc004bkv.2	-							NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	aatccacctccaaaaaaaaaaa	0.104													4	2	---	---	---	---	
EXD3	54932	broad.mit.edu	37	9	140218010	140218010	+	Intron	DEL	C	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140218010delC	uc004cmp.2	-						C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Intron	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3						nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						TCACCCCGGACCCACGAGGGA	0.677													6	5	---	---	---	---	
ANO3	63982	broad.mit.edu	37	11	26584943	26584950	+	Intron	DEL	TGTGTGTG	-	-	rs61877025		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584943_26584950delTGTGTGTG	uc001mqt.3	+						ANO3_uc010rdr.1_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Intron|MUC15_uc001mqx.2_Intron|MUC15_uc001mqy.2_Intron	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C							chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						TTTCTCTCTCtgtgtgtgtgtgtgtgtg	0.226													6	3	---	---	---	---	
LGR4	55366	broad.mit.edu	37	11	27393399	27393400	+	Intron	INS	-	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:27393399_27393400insT	uc001mrj.3	-						LGR4_uc001mrk.3_Intron	NM_018490	NP_060960	Q9BXB1	LGR4_HUMAN	leucine-rich repeat-containing G protein-coupled							integral to membrane|plasma membrane	protein-hormone receptor activity			ovary(1)	1						GAATGCCATTGttttttttggt	0.168													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	57390664	57390691	+	IGR	DEL	AGGAAGGAAGGAAGGAAGGAAGGAAGGG	-	-	rs71470280	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57390664_57390691delAGGAAGGAAGGAAGGAAGGAAGGAAGGG								SERPING1 (8338 upstream) : MIR130A (17980 downstream)																							gaaggaaggaaggaaggaaggaaggaaggaaggaagggagggagggag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	68412067	68412068	+	IGR	INS	-	G	G	rs74620594		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68412067_68412068insG								SAPS3 (29268 upstream) : GAL (39915 downstream)																							aaggaaggaaagaaggaaggaa	0.000													4	2	---	---	---	---	
TMBIM6	7009	broad.mit.edu	37	12	50151817	50151817	+	Intron	DEL	A	-	-	rs80171037		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50151817delA	uc001rux.2	+						TMBIM6_uc010sml.1_Intron|TMBIM6_uc001ruy.2_Intron|TMBIM6_uc001ruz.2_Intron	NM_003217	NP_003208	P55061	BI1_HUMAN	testis enhanced gene transcript (BAX inhibitor						apoptosis|negative regulation of apoptosis	endoplasmic reticulum|insoluble fraction|integral to plasma membrane|nucleus					0						CTATTTCTATAAAAAAAAAAA	0.353													4	2	---	---	---	---	
NAV3	89795	broad.mit.edu	37	12	78224970	78224975	+	5'Flank	DEL	AGAGAC	-	-	rs72186592	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78224970_78224975delAGAGAC	uc001syp.2	+						NAV3_uc001syo.2_5'Flank	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3							nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						agagagagagagagacagagagagag	0.204										HNSCC(70;0.22)			4	2	---	---	---	---	
C12orf29	91298	broad.mit.edu	37	12	88441883	88441883	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88441883delA	uc001tao.2	+						C12orf29_uc001tap.2_Intron|C12orf29_uc009zsk.2_Intron	NM_001009894	NP_001009894	Q8N999	CL029_HUMAN	hypothetical protein LOC91298												0						gaccagctataaaaaaaaaaa	0.040													4	2	---	---	---	---	
UBAC2	337867	broad.mit.edu	37	13	99896625	99896626	+	Intron	INS	-	TATATACACACATATGCATGTGTG	TATATACACACATATGCATGTGTG	rs146409182	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99896625_99896626insTATATACACACATATGCATGTGTG	uc001voa.3	+						UBAC2_uc010tiu.1_Intron|UBAC2_uc001vob.3_Intron|UBAC2_uc010tiv.1_Intron|UBAC2_uc001vod.2_Intron|UBAC2_uc001voc.2_Intron|UBAC2_uc010tiw.1_Intron	NM_001144072	NP_001137544	Q8NBM4	UBAC2_HUMAN	UBA domain containing 2 isoform 1							integral to membrane				ovary(1)	1	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AATTTCAAatatatatacacac	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	82284362	82284363	+	IGR	INS	-	CTTC	CTTC	rs150527150	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:82284362_82284363insCTTC								SEL1L (284157 upstream) : None (None downstream)																							cttccttccttcttcctttctt	0.129													9	4	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106919168	106919168	+	RNA	DEL	C	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106919168delC	uc010tyt.1	-	245		c.10611delG			uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						ACGTTAACCTCCCCCTCACTG	0.557													3	3	---	---	---	---	
LPCAT4	254531	broad.mit.edu	37	15	34656626	34656627	+	Intron	DEL	TC	-	-	rs60508631	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34656626_34656627delTC	uc001zig.2	-						LPCAT4_uc010bav.1_Intron	NM_153613	NP_705841	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity|calcium ion binding				0						tttttttttttctgttgttgtt	0.203													9	4	---	---	---	---	
NARFL	64428	broad.mit.edu	37	16	781741	781744	+	Intron	DEL	CTGC	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:781741_781744delCTGC	uc002cjr.2	-						NARFL_uc002cjp.2_Intron|NARFL_uc002cjq.2_Intron|NARFL_uc002cjs.2_Intron|NARFL_uc010uuq.1_Intron	NM_022493	NP_071938	Q9H6Q4	NARFL_HUMAN	nuclear prelamin A recognition factor-like						iron-sulfur cluster assembly|oxygen homeostasis|regulation of transcription, DNA-dependent|response to hypoxia		4 iron, 4 sulfur cluster binding|metal ion binding				0		Hepatocellular(780;0.0218)				GCTGGGGCTGCTGCCTGCCAACCT	0.652													4	2	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15083569	15083570	+	Intron	INS	-	GCA	GCA	rs66497434		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15083569_15083570insGCA	uc010uzl.1	+						PDXDC1_uc010uzm.1_Intron|PDXDC1_uc010bvc.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002dda.3_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron|uc010bvd.1_5'UTR	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	ACGCACGCGGCGCAGCAGCCCC	0.634													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33939019	33939019	+	IGR	DEL	C	-	-	rs113683091		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33939019delC								None (None upstream) : MIR1826 (26489 downstream)																							GTTGCACAGGCCGCCTGCGTG	0.667													6	3	---	---	---	---	
MYH3	4621	broad.mit.edu	37	17	10544822	10544833	+	Intron	DEL	TGTCTTTTTTTT	-	-	rs72032178		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10544822_10544833delTGTCTTTTTTTT	uc002gmq.1	-							NM_002470	NP_002461	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle,						muscle filament sliding|muscle organ development	cytosol|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|central_nervous_system(2)|pancreas(1)	7						GATTTAACTCTGTCtttttttttttttttttt	0.127													5	5	---	---	---	---	
PSMD3	5709	broad.mit.edu	37	17	38140452	38140453	+	Intron	INS	-	A	A	rs34306234		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38140452_38140453insA	uc002htn.1	+						PSMD3_uc010wen.1_Intron|PSMD3_uc010weo.1_Intron	NM_002809	NP_002800	O43242	PSMD3_HUMAN	proteasome 26S non-ATPase subunit 3						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome complex	enzyme regulator activity|protein binding			ovary(1)|pancreas(1)	2	Colorectal(19;0.000442)					gactccgtctcaaaaaaaaaaa	0.178													12	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	39130721	39130724	+	IGR	DEL	TCTT	-	-	rs12941907	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39130721_39130724delTCTT								KRT39 (7577 upstream) : KRT40 (3244 downstream)																							tttctttctctctttctttctttc	0.000													6	3	---	---	---	---	
DHX8	1659	broad.mit.edu	37	17	41591078	41591079	+	Intron	DEL	TT	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41591078_41591079delTT	uc002idu.1	+						DHX8_uc010wif.1_Intron|DHX8_uc010wig.1_Intron	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8							catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		Gtttttaatctttttttttttt	0.144													4	2	---	---	---	---	
CCDC46	201134	broad.mit.edu	37	17	64025820	64025821	+	Intron	INS	-	TAAA	TAAA	rs144628903	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:64025820_64025821insTAAA	uc002jfl.2	-						CCDC46_uc010deo.2_Intron|CCDC46_uc002jfm.2_Intron|CCDC46_uc010dep.2_Intron	NM_145036	NP_659473	Q8N8E3	CE112_HUMAN	coiled-coil domain containing 46 isoform a							centrosome					0			BRCA - Breast invasive adenocarcinoma(6;1.53e-06)			gaccctgtctctaaataaacaa	0.114													6	4	---	---	---	---	
SNRPD1	6632	broad.mit.edu	37	18	19202891	19202891	+	Intron	DEL	T	-	-	rs111943199		TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19202891delT	uc002ktj.1	+							NM_006938	NP_008869	P62314	SMD1_HUMAN	small nuclear ribonucleoprotein D1 polypeptide						ncRNA metabolic process|spliceosomal snRNP assembly|spliceosome assembly	catalytic step 2 spliceosome|cytosol|nucleoplasm|small nuclear ribonucleoprotein complex|U12-type spliceosomal complex	protein binding|RNA binding				0						AATTATGTAAttttttttttt	0.114													6	3	---	---	---	---	
HAUS1	115106	broad.mit.edu	37	18	43702272	43702272	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43702272delA	uc002lbu.2	+						HAUS1_uc002lbv.2_Intron	NM_138443	NP_612452	Q96CS2	HAUS1_HUMAN	coiled-coil domain containing 5						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole				ovary(1)	1						ctcatctcttaaaaaaaaaaa	0.204													6	3	---	---	---	---	
UNC13A	23025	broad.mit.edu	37	19	17757078	17757079	+	Intron	INS	-	TGTT	TGTT	rs142508123	by1000genomes	TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17757078_17757079insTGTT	uc002nhd.2	-							NM_001080421	NP_001073890	Q9UPW8	UN13A_HUMAN	unc-13 homolog A						exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(3)	3						Ggttttttgtgtgtttgtttgt	0.272													6	4	---	---	---	---	
HAPLN4	404037	broad.mit.edu	37	19	19379017	19379018	+	Intron	INS	-	T	T			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19379017_19379018insT	uc002nmc.2	-						TM6SF2_uc002nmd.1_Intron	NM_023002	NP_075378	Q86UW8	HPLN4_HUMAN	hyaluronan and proteoglycan link protein 4						cell adhesion	proteinaceous extracellular matrix	hyaluronic acid binding			pancreas(1)	1			Epithelial(12;0.00575)			tttcttttttcttttttttttt	0.158													6	3	---	---	---	---	
NLRP7	199713	broad.mit.edu	37	19	55446085	55446085	+	Intron	DEL	T	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55446085delT	uc002qih.3	-						NLRP7_uc002qig.3_Intron|NLRP7_uc002qii.3_Intron|NLRP7_uc010esk.2_Intron|NLRP7_uc010esl.2_Intron	NM_206828	NP_996611	Q8WX94	NALP7_HUMAN	NACHT, leucine rich repeat and PYD containing 7								ATP binding			large_intestine(1)|breast(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(193;0.0325)		CCCTATCAGCttttttttttt	0.264													6	3	---	---	---	---	
PIGU	128869	broad.mit.edu	37	20	33232992	33232992	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33232992delA	uc002xas.2	-						PIGU_uc010zul.1_Intron|PIGU_uc002xat.2_Intron|PIGU_uc010gev.1_Intron	NM_080476	NP_536724	Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						attachment of GPI anchor to protein|C-terminal protein lipidation|regulation of JAK-STAT cascade	GPI-anchor transamidase complex|plasma membrane					0						accccatctcaaaaaaaaaaa	0.095													3	3	---	---	---	---	
C20orf117	140710	broad.mit.edu	37	20	35445891	35445891	+	Intron	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35445891delA	uc002xgd.1	-						C20orf117_uc002xge.1_5'Flank	NM_199181	NP_954650	O94964	K0889_HUMAN	hypothetical protein LOC140710 isoform 2												0		Myeloproliferative disorder(115;0.00874)				AGatttaattaaaaaaaaaaa	0.507													4	2	---	---	---	---	
GCFC1	94104	broad.mit.edu	37	21	34133202	34133205	+	Intron	DEL	GTGC	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34133202_34133205delGTGC	uc002yqn.2	-						GCFC1_uc002yqo.2_Intron|GCFC1_uc002yqp.2_Intron|GCFC1_uc002yqr.2_Intron	NM_016631	NP_057715	Q9Y5B6	GCFC1_HUMAN	GC-rich sequence DNA-binding factor candidate							cytosol|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2						GTGTCTCtgtgtgcgtgcgtgcgt	0.270													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	113736014	113736015	+	IGR	DEL	AC	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:113736014_113736015delAC								None (None upstream) : HTR2C (82536 downstream)																							aatgtcctaaacacacacacac	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	M	6692	6692	+	5'UTR	DEL	A	-	-			TCGA-39-5028-01	TCGA-39-5028-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrM:6692delA	uc011mfh.1	+	1					uc004cou.3_5'Flank|uc011mfi.1_5'Flank					Homo sapiens cDNA: FLJ22894 fis, clone KAT04907.																		TACTACTCCGGAAAAAAAGAA	0.383													22	34	---	---	---	---	
