Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3102984	3102984	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3102984C>T	uc001akf.2	+	2	413	c.333C>T	c.(331-333)GGC>GGT	p.G111G	PRDM16_uc001akc.2_Silent_p.G111G|PRDM16_uc001akd.2_Silent_p.G111G|PRDM16_uc001ake.2_Silent_p.G111G|PRDM16_uc009vlh.2_5'UTR	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	111	SET.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		AGAGGCTGGGCCCCTGCGTGG	0.637			T	EVI1	MDS|AML								4	41	---	---	---	---	PASS
KIAA0562	9731	broad.mit.edu	37	1	3761503	3761503	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3761503G>A	uc001aky.2	-	6	893	c.534C>T	c.(532-534)AGC>AGT	p.S178S	KIAA0562_uc010nzm.1_RNA|KIAA0562_uc001akz.2_Silent_p.S178S	NM_014704	NP_055519	O60308	CE104_HUMAN	glycine-, glutamate-,	178						centriole	binding				0	all_cancers(77;0.0395)|Ovarian(185;0.0634)|all_lung(157;0.222)|Lung NSC(156;0.227)	all_epithelial(116;3.96e-21)|all_lung(118;2.74e-08)|Lung NSC(185;6.4e-06)|Breast(487;0.00066)|Renal(390;0.00121)|Hepatocellular(190;0.00335)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.031)|Lung SC(97;0.0548)|Medulloblastoma(700;0.212)		Epithelial(90;6.85e-39)|OV - Ovarian serous cystadenocarcinoma(86;1.59e-22)|GBM - Glioblastoma multiforme(42;3.16e-16)|Colorectal(212;2.01e-05)|COAD - Colon adenocarcinoma(227;7.99e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000389)|Kidney(185;0.000513)|STAD - Stomach adenocarcinoma(132;0.00709)|KIRC - Kidney renal clear cell carcinoma(229;0.00714)|Lung(427;0.137)		CAGGGTCCTCGCTGTTGTGCC	0.478													4	98	---	---	---	---	PASS
PADI1	29943	broad.mit.edu	37	1	17557070	17557070	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17557070G>A	uc001bah.1	+	10	1149	c.1057G>A	c.(1057-1059)GAG>AAG	p.E353K	PADI1_uc010oco.1_5'Flank|PADI1_uc010ocp.1_5'Flank|PADI1_uc010ocq.1_5'Flank	NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I	353					peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CTCCCAGGACGAGATGGAGTT	0.577													4	39	---	---	---	---	PASS
SLC30A2	7780	broad.mit.edu	37	1	26369919	26369919	+	Missense_Mutation	SNP	G	A	A	rs148861822		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26369919G>A	uc001blh.1	-	3	612	c.395C>T	c.(394-396)ACG>ATG	p.T132M	SLC30A2_uc001blg.1_Missense_Mutation_p.T181M	NM_032513	NP_115902	Q9BRI3	ZNT2_HUMAN	solute carrier family 30, member 2 isoform 2	132	Helical; (Potential).				positive regulation of sequestering of zinc ion|zinc ion transport	integral to membrane|late endosome|lysosomal membrane	cation transmembrane transporter activity				0		Colorectal(325;3.46e-05)|Lung NSC(340;6.18e-05)|all_lung(284;9.43e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.09e-26)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000728)|BRCA - Breast invasive adenocarcinoma(304;0.000969)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00614)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGCCCGACGTGATCAGCAT	0.607													5	36	---	---	---	---	PASS
EYA3	2140	broad.mit.edu	37	1	28337512	28337512	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28337512C>A	uc001bpi.1	-	10	1020	c.855G>T	c.(853-855)AAG>AAT	p.K285N	EYA3_uc010ofs.1_Missense_Mutation_p.K232N|EYA3_uc010oft.1_Missense_Mutation_p.K239N|EYA3_uc001bpj.2_Missense_Mutation_p.K239N|EYA3_uc001bpk.1_RNA|EYA3_uc010ofu.1_RNA	NM_001990	NP_001981	Q99504	EYA3_HUMAN	eyes absent 3	285					anatomical structure morphogenesis|double-strand break repair|histone dephosphorylation|multicellular organismal development|positive regulation of DNA repair|regulation of transcription, DNA-dependent|response to ionizing radiation|transcription, DNA-dependent|visual perception	cytoplasm	metal ion binding|protein binding|protein tyrosine phosphatase activity			ovary(2)|skin(1)	3		Colorectal(325;3.46e-05)|all_lung(284;0.000414)|Lung NSC(340;0.000432)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.00503)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0484)|OV - Ovarian serous cystadenocarcinoma(117;1.25e-24)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;2.8e-06)|STAD - Stomach adenocarcinoma(196;0.00364)|KIRC - Kidney renal clear cell carcinoma(1967;0.00378)|BRCA - Breast invasive adenocarcinoma(304;0.00718)|READ - Rectum adenocarcinoma(331;0.0642)		TGCCCCGGTTCTTGCTAGTCA	0.413													11	130	---	---	---	---	PASS
PTAFR	5724	broad.mit.edu	37	1	28477434	28477434	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28477434A>T	uc001bpl.2	-	2	226	c.99T>A	c.(97-99)AAT>AAA	p.N33K	PTAFR_uc001bpm.3_Missense_Mutation_p.N33K|PTAFR_uc009vte.2_Missense_Mutation_p.N33K	NM_000952	NP_000943	P25105	PTAFR_HUMAN	platelet-activating factor receptor	33	Helical; Name=1; (Potential).				chemotaxis|inflammatory response|interferon-gamma-mediated signaling pathway|phosphatidylinositol-mediated signaling	integral to plasma membrane|nucleus	phospholipid binding|platelet activating factor receptor activity				0		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00715)|all_lung(284;0.00732)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.215)|OV - Ovarian serous cystadenocarcinoma(117;6e-22)|Colorectal(126;3.04e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00279)|BRCA - Breast invasive adenocarcinoma(304;0.00595)|STAD - Stomach adenocarcinoma(196;0.00678)|READ - Rectum adenocarcinoma(331;0.0649)		GCACGTAGCCATTAGCAATGA	0.493													7	41	---	---	---	---	PASS
COL8A2	1296	broad.mit.edu	37	1	36564093	36564093	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36564093C>T	uc001bzv.1	-	2	1196	c.1189G>A	c.(1189-1191)GGG>AGG	p.G397R	COL8A2_uc001bzw.1_Missense_Mutation_p.G332R	NM_005202	NP_005193	P25067	CO8A2_HUMAN	collagen, type VIII, alpha 2 precursor	397	Triple-helical region.				angiogenesis|cell-cell adhesion|extracellular matrix organization	basement membrane|collagen	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				CCACTAGGCCCCTGGTCACCT	0.697													3	16	---	---	---	---	PASS
INPP5B	3633	broad.mit.edu	37	1	38411462	38411462	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38411462G>A	uc001ccg.1	-	3	212	c.118C>T	c.(118-120)CGC>TGC	p.R40C	INPP5B_uc009vvk.1_5'UTR|INPP5B_uc001cch.2_5'UTR	NM_005540	NP_005531	P32019	I5P2_HUMAN	inositol polyphosphate-5-phosphatase, 75kDa	40					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to membrane|microtubule cytoskeleton	GTPase activator activity|inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			urinary_tract(1)	1	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				AGGCGGTAGCGCACGAGTCCC	0.667													5	112	---	---	---	---	PASS
EDN2	1907	broad.mit.edu	37	1	41949800	41949800	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41949800G>A	uc001cgx.2	-	2	211	c.139C>T	c.(139-141)CGC>TGC	p.R47C	EDN2_uc001cgu.2_RNA|EDN2_uc001cgv.2_RNA|EDN2_uc009vwh.2_5'UTR|EDN2_uc001cgw.2_RNA|EDN2_uc009vwi.2_RNA|EDN2_uc009vwj.2_RNA	NM_001956	NP_001947	P20800	EDN2_HUMAN	endothelin 2 preproprotein	47					artery smooth muscle contraction|calcium-mediated signaling|cytokine-mediated signaling pathway|elevation of cytosolic calcium ion concentration|hormonal regulation of the force of heart contraction|inositol phosphate-mediated signaling|macrophage activation|macrophage chemotaxis|neutrophil chemotaxis|positive regulation of cell proliferation|positive regulation of heart rate|positive regulation of leukocyte chemotaxis|positive regulation of prostaglandin-endoperoxide synthase activity|positive regulation of the force of heart contraction by chemical signal|prostaglandin biosynthetic process|regulation of systemic arterial blood pressure by endothelin|regulation of vasoconstriction|vein smooth muscle contraction	extracellular space	endothelin B receptor binding|hormone activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GAGCAACGGCGAAGCCGAAGG	0.612													4	46	---	---	---	---	PASS
MUTYH	4595	broad.mit.edu	37	1	45798117	45798117	+	Missense_Mutation	SNP	C	T	T	rs140342925		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45798117C>T	uc001cnm.2	-	9	941	c.725G>A	c.(724-726)CGT>CAT	p.R242H	MUTYH_uc009vxn.2_Missense_Mutation_p.R67H|MUTYH_uc001cnf.2_Missense_Mutation_p.R217H|MUTYH_uc009vxo.2_Missense_Mutation_p.R217H|MUTYH_uc001cng.2_Missense_Mutation_p.R228H|MUTYH_uc001cnj.2_Missense_Mutation_p.R125H|MUTYH_uc001cni.2_Missense_Mutation_p.R217H|MUTYH_uc001cnh.2_Missense_Mutation_p.R218H|MUTYH_uc001cno.2_Missense_Mutation_p.R125H|MUTYH_uc001cnk.2_Missense_Mutation_p.R102H|MUTYH_uc010oll.1_Intron|MUTYH_uc001cnl.2_Missense_Mutation_p.R231H|MUTYH_uc009vxp.2_Missense_Mutation_p.R245H|MUTYH_uc001cnn.2_Missense_Mutation_p.R232H	NM_012222	NP_036354	Q9UIF7	MUTYH_HUMAN	mutY homolog isoform 1	242					depurination|mismatch repair	nucleoplasm	4 iron, 4 sulfur cluster binding|DNA N-glycosylase activity|endonuclease activity|metal ion binding|MutSalpha complex binding				0	Acute lymphoblastic leukemia(166;0.155)					GGCTCGGACACGGCACAGCAC	0.617			Mis			colorectal		BER_DNA_glycosylases	MUTYH-associated_polyposis				5	70	---	---	---	---	PASS
CDKN2C	1031	broad.mit.edu	37	1	51439730	51439730	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51439730G>A	uc001csf.2	+	3	1511	c.295G>A	c.(295-297)GAG>AAG	p.E99K	CDKN2C_uc001csg.2_Missense_Mutation_p.E99K	NM_001262	NP_001253	P42773	CDN2C_HUMAN	cyclin-dependent kinase inhibitor 2C	99					cell cycle arrest|G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|induction of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|regulation of cyclin-dependent protein kinase activity	cytosol|nucleus	cyclin-dependent protein kinase inhibitor activity|protein kinase binding	p.0?(4)|p.?(1)		central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(5)|ovary(2)|thyroid(1)|lung(1)|kidney(1)	17				GBM - Glioblastoma multiforme(3;3.61e-13)|all cancers(3;0.00151)		TGTTAACATCGAGGATAATGA	0.532			D		glioma|MM				Multiple_Endocrine_Neoplasia_type_1				5	70	---	---	---	---	PASS
C1orf163	65260	broad.mit.edu	37	1	53153698	53153698	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53153698G>A	uc001cui.1	-	3	430	c.390C>T	c.(388-390)GAC>GAT	p.D130D		NM_023077	NP_075565	Q96BR5	SELR1_HUMAN	hypothetical protein LOC65260	130	Sel1-like 3.						binding				0						CCTTTCCCAAGTCAGGCTGGC	0.542													5	124	---	---	---	---	PASS
CDCP2	200008	broad.mit.edu	37	1	54607066	54607066	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:54607066G>A	uc001cwv.1	-	3	1316	c.468C>T	c.(466-468)CTC>CTT	p.L156L		NM_201546	NP_963840	Q5VXM1	CDCP2_HUMAN	CUB domain containing protein 2 precursor	156	CUB 2.					extracellular region				ovary(1)	1						CAGGACTGGTGAGGACCCCTG	0.607													5	61	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	57481000	57481000	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57481000G>A	uc001cys.1	-	14	1674	c.1000C>T	c.(1000-1002)CCG>TCG	p.P334S	DAB1_uc001cyt.1_Missense_Mutation_p.P332S|DAB1_uc001cyq.1_Missense_Mutation_p.P332S|DAB1_uc001cyr.1_Missense_Mutation_p.P248S|DAB1_uc009vzw.1_Missense_Mutation_p.P316S|DAB1_uc009vzx.1_Missense_Mutation_p.P334S	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	367					cell differentiation|nervous system development					skin(2)|ovary(1)	3						TGAGCCCCCGGCATCACCTGA	0.667													6	89	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92184997	92184997	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92184997C>T	uc001doh.2	-	10	1904	c.1438G>A	c.(1438-1440)GTC>ATC	p.V480I	TGFBR3_uc009wde.2_Missense_Mutation_p.V257I|TGFBR3_uc010osy.1_Missense_Mutation_p.V438I|TGFBR3_uc001doi.2_Missense_Mutation_p.V479I|TGFBR3_uc001doj.2_Missense_Mutation_p.V479I	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	480	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AACAGGGTGACGTCCATCCCC	0.517													7	90	---	---	---	---	PASS
SASS6	163786	broad.mit.edu	37	1	100551139	100551139	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100551139T>A	uc001dsu.2	-	16	1961	c.1820A>T	c.(1819-1821)GAT>GTT	p.D607V	SASS6_uc009wdz.2_Missense_Mutation_p.D440V	NM_194292	NP_919268	Q6UVJ0	SAS6_HUMAN	spindle assembly abnormal protein 6	607					centriole replication	centriole				upper_aerodigestive_tract(1)|ovary(1)	2		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		AGGAATGCTATCTTCCCTTTT	0.313													5	151	---	---	---	---	PASS
KCNC4	3749	broad.mit.edu	37	1	110765655	110765655	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:110765655G>A	uc001dzh.2	+	2	805	c.748G>A	c.(748-750)GCC>ACC	p.A250T	KCNC4_uc001dzf.2_Missense_Mutation_p.A250T|KCNC4_uc009wfr.2_Missense_Mutation_p.A250T|KCNC4_uc001dzg.2_Missense_Mutation_p.A250T|KCNC4_uc001dzi.2_RNA	NM_004978	NP_004969	Q03721	KCNC4_HUMAN	Shaw-related voltage-gated potassium channel	250					synaptic transmission	voltage-gated potassium channel complex	voltage-gated potassium channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		GACCCATGAGGCCTTTAATAT	0.582													8	145	---	---	---	---	PASS
C1orf88	128344	broad.mit.edu	37	1	111889268	111889268	+	5'UTR	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111889268G>A	uc001eaw.2	+	1					C1orf88_uc001eax.2_5'UTR|C1orf88_uc009wge.1_5'UTR|C1orf88_uc001eay.2_5'Flank	NM_181643	NP_857594	Q8TCI5	CA088_HUMAN	hypothetical protein LOC128344											ovary(1)|skin(1)	2		all_cancers(81;3.21e-05)|all_epithelial(167;1.19e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|Colorectal(144;0.0301)|all cancers(265;0.0677)|Epithelial(280;0.0897)|COAD - Colon adenocarcinoma(174;0.116)|LUSC - Lung squamous cell carcinoma(189;0.135)		AGCCCTAGCAGCTCGCGATGT	0.632													5	54	---	---	---	---	PASS
VANGL1	81839	broad.mit.edu	37	1	116206498	116206498	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116206498G>A	uc001efv.1	+	4	692	c.421G>A	c.(421-423)GAG>AAG	p.E141K	VANGL1_uc009wgy.1_Missense_Mutation_p.E139K|VANGL1_uc001efw.1_Missense_Mutation_p.E141K	NM_138959	NP_620409	Q8TAA9	VANG1_HUMAN	vang-like 1	141	Extracellular (Potential).				multicellular organismal development	integral to membrane	protein binding			central_nervous_system(1)	1	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		GTGGAGGGATGAGCTGGAGCC	0.507													12	146	---	---	---	---	PASS
BCL9	607	broad.mit.edu	37	1	147096108	147096108	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147096108G>T	uc001epq.2	+	10	4369	c.3629G>T	c.(3628-3630)AGC>ATC	p.S1210I	BCL9_uc010ozr.1_Missense_Mutation_p.S1124I	NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9	1210	Pro-rich.				Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					CTGGGGAACAGCATGCCTTCG	0.577			T	IGH@|IGL@	B-ALL								9	157	---	---	---	---	PASS
FAM63A	55793	broad.mit.edu	37	1	150974945	150974945	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150974945C>T	uc001ewf.2	-	3	1833	c.149G>A	c.(148-150)CGG>CAG	p.R50Q	FAM63A_uc001ewc.2_Intron|FAM63A_uc010pcm.1_Intron|FAM63A_uc001ewd.2_Intron|FAM63A_uc001ewe.2_Intron|FAM63A_uc010pcn.1_Missense_Mutation_p.R98Q|FAM63A_uc001ewg.2_Missense_Mutation_p.R50Q	NM_018379	NP_001156731	Q8N5J2	FA63A_HUMAN	hypothetical protein LOC55793 isoform 1	50							protein binding			ovary(1)	1	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGCTGGCTCCCGTTCTCTAGC	0.592													6	170	---	---	---	---	PASS
SLC39A1	27173	broad.mit.edu	37	1	153932959	153932959	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153932959G>A	uc001fdh.2	-	4	759	c.590C>T	c.(589-591)GCG>GTG	p.A197V	CRTC2_uc010ped.1_5'Flank|SLC39A1_uc001fdi.2_Missense_Mutation_p.A197V|SLC39A1_uc001fdj.2_Missense_Mutation_p.A197V|SLC39A1_uc001fdk.2_Missense_Mutation_p.A197V|SLC39A1_uc010pee.1_Missense_Mutation_p.A95V|SLC39A1_uc001fdl.2_Missense_Mutation_p.A197V	NM_014437	NP_055252	Q9NY26	S39A1_HUMAN	solute carrier family 39 (zinc transporter),	197	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane|membrane fraction|plasma membrane	zinc ion transmembrane transporter activity				0	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)	Colorectal(1306;0.019)		CAGCCCTACCGCCAGCCCCTC	0.677													6	61	---	---	---	---	PASS
FAM189B	10712	broad.mit.edu	37	1	155217906	155217906	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155217906G>A	uc001fjm.2	-	11	2374	c.1768C>T	c.(1768-1770)CGT>TGT	p.R590C	RAG1AP1_uc010pey.1_Intron|FAM189B_uc009wql.2_Missense_Mutation_p.R392C|FAM189B_uc001fjn.2_Missense_Mutation_p.R494C|FAM189B_uc001fjo.2_Missense_Mutation_p.R572C|FAM189B_uc001fjp.2_RNA	NM_006589	NP_006580	P81408	F189B_HUMAN	hypothetical protein LOC10712 isoform a	590						integral to membrane	WW domain binding			ovary(1)|breast(1)	2						TGGAGGAAACGAGTGACCAGG	0.607													3	48	---	---	---	---	PASS
PKLR	5313	broad.mit.edu	37	1	155263347	155263347	+	Missense_Mutation	SNP	G	A	A	rs74315362		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155263347G>A	uc001fkb.3	-	8	1190	c.1151C>T	c.(1150-1152)ACG>ATG	p.T384M	RAG1AP1_uc010pey.1_Intron|PKLR_uc001fka.3_Missense_Mutation_p.T353M	NM_000298	NP_000289	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC isoform 1	384			T -> M (in PKRD; Tokyo/Beirut; most common mutation in Japanese population; no conformational change).		endocrine pancreas development|energy reserve metabolic process|glycolysis|positive regulation of cellular metabolic process	cytosol	ATP binding|magnesium ion binding|potassium ion binding|pyruvate kinase activity			skin(4)|ovary(1)	5	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	CTCTGCCCTCGTTGGCCGGGG	0.587													15	55	---	---	---	---	PASS
SYT11	23208	broad.mit.edu	37	1	155838391	155838391	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155838391G>C	uc001fmg.2	+	2	933	c.670G>C	c.(670-672)GAC>CAC	p.D224H	SYT11_uc010pgq.1_Intron	NM_152280	NP_689493	Q9BT88	SYT11_HUMAN	synaptotagmin XI	224	Cytoplasmic (Potential).|C2 1.					cell junction|synaptic vesicle membrane	protein binding|transporter activity			ovary(1)|skin(1)	2	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CCCTGTGTTTGACGAGACCTT	0.557													7	96	---	---	---	---	PASS
RXFP4	339403	broad.mit.edu	37	1	155912482	155912482	+	Silent	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155912482C>A	uc010pgs.1	+	1	1003	c.982C>A	c.(982-984)CGG>AGG	p.R328R		NM_181885	NP_871001	Q8TDU9	RL3R2_HUMAN	relaxin 3 receptor 2	328	Cytoplasmic (Potential).					integral to membrane|plasma membrane	angiotensin type II receptor activity				0	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CAGGGATCTGCGGTTGAGGCT	0.662													15	115	---	---	---	---	PASS
UBQLN4	56893	broad.mit.edu	37	1	156020177	156020177	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156020177G>A	uc001fna.2	-	4	670	c.646C>T	c.(646-648)CGT>TGT	p.R216C	UBQLN4_uc010pgx.1_Missense_Mutation_p.R196C	NM_020131	NP_064516	Q9NRR5	UBQL4_HUMAN	ataxin-1 ubiquitin-like interacting protein	216						cytosol|endoplasmic reticulum membrane|nucleus	identical protein binding			pancreas(1)|skin(1)	2	Hepatocellular(266;0.133)|all_neural(408;0.195)					ATCATGTGACGCATCAGATCA	0.532													7	250	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158582760	158582760	+	Intron	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158582760G>C	uc001fst.1	-							NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1						actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					TCCTGTGGGAGAAATGGATCA	0.458													9	43	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158912017	158912017	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158912017G>A	uc001ftb.2	+	5	1075	c.830G>A	c.(829-831)CGT>CAT	p.R277H	PYHIN1_uc001ftc.2_Missense_Mutation_p.R268H|PYHIN1_uc001ftd.2_Missense_Mutation_p.R277H|PYHIN1_uc001fte.2_Missense_Mutation_p.R268H	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	277	HIN-200.				cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					TATTCCAAACGTAATAGTCTC	0.373													13	53	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160105790	160105790	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160105790G>A	uc001fvc.2	+						ATP1A2_uc001fvb.2_Intron|ATP1A2_uc001fvd.2_Intron	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein						ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			TATGGTGAGCGCAGGAGGTGG	0.602													7	86	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160260349	160260349	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160260349T>C	uc009wti.2	-	32	3942	c.3548A>G	c.(3547-3549)GAA>GGA	p.E1183G	COPA_uc001fvv.3_Missense_Mutation_p.E1192G	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	1183					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TGGACACTTTTCTACTGGCTT	0.463													23	137	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171755080	171755080	+	Silent	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171755080G>C	uc001ghz.2	+	3	1322	c.975G>C	c.(973-975)GCG>GCC	p.A325A	METTL13_uc001gia.2_Silent_p.A239A|METTL13_uc001gib.2_Silent_p.A169A|METTL13_uc010pml.1_Silent_p.A324A	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	325							methyltransferase activity|protein binding			kidney(1)	1						AACAGCTGGCGGCCAGTGCTG	0.557													6	33	---	---	---	---	PASS
RABGAP1L	9910	broad.mit.edu	37	1	174221626	174221626	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174221626C>G	uc001gjx.2	+	7	1079	c.884C>G	c.(883-885)CCT>CGT	p.P295R	RABGAP1L_uc009wwq.1_Missense_Mutation_p.P307R|RABGAP1L_uc001gjw.2_Missense_Mutation_p.P258R|RABGAP1L_uc001gjy.2_5'UTR	NM_014857	NP_055672	Q5R372	RBG1L_HUMAN	RAB GTPase activating protein 1-like isoform A	295					regulation of protein localization	early endosome|Golgi apparatus|nucleus	Rab GTPase activator activity			ovary(2)|lung(1)|kidney(1)	4						AGCCCTGTGCCTAAGGATAGA	0.289													15	102	---	---	---	---	PASS
CR1	1378	broad.mit.edu	37	1	207700114	207700114	+	Silent	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:207700114A>G	uc001hfy.2	+	6	1043	c.903A>G	c.(901-903)CCA>CCG	p.P301P	CR1_uc009xcl.1_Intron|CR1_uc001hfx.2_Silent_p.P301P|CR1_uc009xcj.1_Intron|CR1_uc009xck.1_Silent_p.P301P|CR1_uc010psh.1_5'Flank	NM_000573	NP_000564	P17927	CR1_HUMAN	complement receptor 1 isoform F precursor	301	Sushi 5.|Extracellular (Potential).				complement activation, classical pathway|innate immune response	integral to plasma membrane	complement receptor activity			ovary(3)	3						AGCCACCTCCAGATGTCCTGC	0.478													6	203	---	---	---	---	PASS
SMYD2	56950	broad.mit.edu	37	1	214478553	214478553	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214478553G>T	uc010ptx.1	+	2	230	c.197G>T	c.(196-198)GGA>GTA	p.G66V	SMYD2_uc009xdj.2_Intron|SMYD2_uc010ptw.1_Intron|SMYD2_uc009xdl.1_RNA	NM_020197	NP_064582	Q9NRG4	SMYD2_HUMAN	SET and MYND domain containing 2	66	MYND-type.				negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation|regulation of DNA damage response, signal transduction by p53 class mediator|transcription, DNA-dependent	cytosol|nucleus	histone methyltransferase activity (H3-K36 specific)|p53 binding|RNA polymerase II core binding|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(81;0.0122)|all cancers(67;0.0209)|GBM - Glioblastoma multiforme(131;0.106)|Epithelial(68;0.144)		TCCAAATGTGGAAGATGCAAG	0.458													15	179	---	---	---	---	PASS
CDC42BPA	8476	broad.mit.edu	37	1	227300098	227300098	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:227300098G>T	uc001hqr.2	-	14	2859	c.1916C>A	c.(1915-1917)GCT>GAT	p.A639D	CDC42BPA_uc001hqs.2_Missense_Mutation_p.A558D|CDC42BPA_uc009xes.2_Missense_Mutation_p.A639D|CDC42BPA_uc010pvs.1_Missense_Mutation_p.A639D	NM_003607	NP_003598	Q5VT25	MRCKA_HUMAN	CDC42-binding protein kinase alpha isoform B	639	Potential.				actin cytoskeleton reorganization|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm	ATP binding|identical protein binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			lung(6)|breast(2)|stomach(1)|ovary(1)|pancreas(1)	11		all_cancers(173;0.156)|Prostate(94;0.0792)				TGCTTCAGCAGCTAGAGCTTC	0.368													11	230	---	---	---	---	PASS
C1orf69	200205	broad.mit.edu	37	1	228363082	228363082	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228363082C>T	uc001hsl.3	+	3	1028	c.939C>T	c.(937-939)GGC>GGT	p.G313G	C1orf69_uc010pvw.1_Silent_p.G120G	NM_001010867	NP_001010867	Q5T440	CAF17_HUMAN	hypothetical protein LOC200205 precursor	313					glycine catabolic process|heme biosynthetic process	mitochondrion	aminomethyltransferase activity				0		Prostate(94;0.0405)				TCAGGGCTGGCCAGGGCAACG	0.637													8	110	---	---	---	---	PASS
ARV1	64801	broad.mit.edu	37	1	231131696	231131696	+	Silent	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:231131696A>G	uc009xfl.1	+	4	668	c.639A>G	c.(637-639)GTA>GTG	p.V213V	ARV1_uc001huh.2_Silent_p.V213V	NM_022786	NP_073623	Q9H2C2	ARV1_HUMAN	ARV1 homolog	213					sphingolipid metabolic process	integral to membrane				breast(2)	2	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)		COAD - Colon adenocarcinoma(196;0.211)|Colorectal(1306;0.233)		TCATTAAAGTATTTGTTCTTA	0.348													7	156	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232650420	232650420	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232650420G>A	uc001hvg.2	-	1	824	c.666C>T	c.(664-666)CAC>CAT	p.H222H		NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	222					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				CCATTGCTTTGTGGTCATAAT	0.463													6	155	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237972262	237972262	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237972262A>T	uc001hyl.1	+	100	14480	c.14360A>T	c.(14359-14361)AAT>ATT	p.N4787I	RYR2_uc010pyb.1_Missense_Mutation_p.N220I	NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	4787					cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GTGGCATTCAATTTTTTCCGA	0.358													20	332	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243471407	243471407	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243471407G>C	uc001hzw.2	+	8	1013	c.857G>C	c.(856-858)TGT>TCT	p.C286S	SDCCAG8_uc010pyk.1_Missense_Mutation_p.C141S|SDCCAG8_uc010pyl.1_Missense_Mutation_p.C98S|SDCCAG8_uc001hzx.2_Missense_Mutation_p.C98S	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	286	Sufficient for homodimerization (By similarity).				establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		TGTTTGAAATGTGCTCAGCAT	0.403													28	174	---	---	---	---	PASS
OR2B11	127623	broad.mit.edu	37	1	247614912	247614912	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247614912C>G	uc010pyx.1	-	1	373	c.373G>C	c.(373-375)GAC>CAC	p.D125H		NM_001004492	NP_001004492	Q5JQS5	OR2BB_HUMAN	olfactory receptor, family 2, subfamily B,	125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.241)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			ACGTAGCGGTCCAGGGCCATG	0.612													14	92	---	---	---	---	PASS
ATP6V1C2	245973	broad.mit.edu	37	2	10922457	10922457	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10922457G>A	uc002ras.2	+	13	1259	c.1150G>A	c.(1150-1152)GTC>ATC	p.V384I	ATP6V1C2_uc002rat.2_Missense_Mutation_p.V338I	NM_001039362	NP_001034451	Q8NEY4	VATC2_HUMAN	vacuolar H+ ATPase C2 isoform a	384					ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	cytosol|proton-transporting V-type ATPase, V1 domain				ovary(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.191)			Epithelial(75;0.15)|OV - Ovarian serous cystadenocarcinoma(76;0.152)		TCTAAACTCTGTCTTCCGACA	0.443													8	53	---	---	---	---	PASS
SMC6	79677	broad.mit.edu	37	2	17907645	17907645	+	Intron	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:17907645G>T	uc002rco.2	-						SMC6_uc010exo.2_Intron|SMC6_uc002rcn.2_Intron|SMC6_uc002rcp.1_Intron|SMC6_uc002rcq.2_Intron|SMC6_uc002rcr.1_Intron	NM_001142286	NP_001135758	Q96SB8	SMC6_HUMAN	SMC6 protein						DNA recombination|DNA repair	chromosome|nucleus	ATP binding			breast(4)|upper_aerodigestive_tract(1)|kidney(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					ATTTACTTTGGTGCCACTTAC	0.313													22	102	---	---	---	---	PASS
MAP4K3	8491	broad.mit.edu	37	2	39552742	39552742	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39552742G>A	uc002rro.2	-	12	926	c.835C>T	c.(835-837)CGG>TGG	p.R279W	MAP4K3_uc002rrp.2_Missense_Mutation_p.R279W|MAP4K3_uc010yns.1_Translation_Start_Site	NM_003618	NP_003609	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase	279					JNK cascade		ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(3)|lung(3)|stomach(1)|pancreas(1)	8		all_hematologic(82;0.211)				GCCAAAGACCGTGTCAAATGT	0.313													5	81	---	---	---	---	PASS
SIX2	10736	broad.mit.edu	37	2	45233549	45233549	+	Silent	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:45233549C>A	uc002ruo.2	-	2	929	c.636G>T	c.(634-636)TCG>TCT	p.S212S	SIX2_uc002rup.2_Silent_p.S214S	NM_016932	NP_058628	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	212						nucleus	sequence-specific DNA binding transcription factor activity			pancreas(1)	1		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				TCTCATCCTCCGAGCTGCCTA	0.632													9	175	---	---	---	---	PASS
PTCD3	55037	broad.mit.edu	37	2	86346095	86346095	+	Missense_Mutation	SNP	G	A	A	rs140431055	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86346095G>A	uc002sqw.2	+	7	532	c.466G>A	c.(466-468)GCC>ACC	p.A156T	PTCD3_uc010ytc.1_Intron	NM_017952	NP_060422	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3 precursor	156	PPR 1.					mitochondrion	protein binding			ovary(1)	1						AAGTGAAGCCGCCCTGAAGGA	0.428													6	184	---	---	---	---	PASS
INPP4A	3631	broad.mit.edu	37	2	99155410	99155410	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99155410C>T	uc002syy.2	+	9	1029	c.636C>T	c.(634-636)TAC>TAT	p.Y212Y	INPP4A_uc010yvj.1_Silent_p.Y212Y|INPP4A_uc010yvk.1_Silent_p.Y212Y|INPP4A_uc002syx.2_Silent_p.Y212Y|INPP4A_uc010fik.2_Intron	NM_001134224	NP_001127696	Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type 1	212					signal transduction		phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity			kidney(1)	1						GATCCAAATACGCTTCATTGC	0.468													5	39	---	---	---	---	PASS
C2orf64	493753	broad.mit.edu	37	2	99220597	99220597	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99220597C>T	uc002syz.2	-	2	244	c.157G>A	c.(157-159)GCA>ACA	p.A53T	C2orf64_uc002sza.2_Intron	NM_001008215	NP_001008216	Q86WW8	COA5_HUMAN	hypothetical protein LOC493753	53			A -> P (in MT-C4D).								0						TCAAAAAATGCGTACTTCAAA	0.328													5	97	---	---	---	---	PASS
TGFBRAP1	9392	broad.mit.edu	37	2	105886000	105886000	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105886000C>T	uc002tcq.2	-	11	2219	c.2135G>A	c.(2134-2136)CGC>CAC	p.R712H	TGFBRAP1_uc010fjc.2_Missense_Mutation_p.R481H|TGFBRAP1_uc002tcr.3_Missense_Mutation_p.R712H	NM_004257	NP_004248	Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor	712					regulation of transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway	cytoplasm|membrane	SMAD binding|small GTPase regulator activity|transforming growth factor beta receptor binding			central_nervous_system(1)|skin(1)	2						GAGTTGCTGGCGGTGGGGTGG	0.662													4	29	---	---	---	---	PASS
ST6GAL2	84620	broad.mit.edu	37	2	107459969	107459969	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:107459969C>T	uc002tdq.2	-	2	584	c.465G>A	c.(463-465)GAG>GAA	p.E155E	ST6GAL2_uc002tdr.2_Silent_p.E155E|ST6GAL2_uc002tds.3_Silent_p.E155E	NM_001142351	NP_001135823	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide	155	Lumenal (Potential).				growth|multicellular organismal development|oligosaccharide metabolic process|protein glycosylation	Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,6-sialyltransferase activity			pancreas(6)|ovary(4)|skin(1)	11						GTGGGCCTGGCTCCCCGGGGG	0.632													42	228	---	---	---	---	PASS
TSN	7247	broad.mit.edu	37	2	122522919	122522919	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:122522919G>A	uc002tnl.2	+	6	898	c.663G>A	c.(661-663)ACG>ACA	p.T221T	TSN_uc002tnm.2_Silent_p.T174T|TSN_uc010yze.1_3'UTR|TSN_uc010flt.2_RNA	NM_004622	NP_004613	Q15631	TSN_HUMAN	translin	221					DNA recombination	cytoplasm|nucleus	sequence-specific DNA binding			breast(2)|large_intestine(1)	3		Ovarian(717;0.0563)|Prostate(154;0.116)				ATAAGGAGACGGCAGCAGCTT	0.522													4	97	---	---	---	---	PASS
HS6ST1	9394	broad.mit.edu	37	2	129026332	129026332	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:129026332G>A	uc002tpt.3	-	2	674	c.640C>T	c.(640-642)CGC>TGC	p.R214C		NM_004807	NP_004798	O60243	H6ST1_HUMAN	heparan sulfate 6-O-sulfotransferase 1	214	Lumenal (Potential).				heparan sulfate proteoglycan biosynthetic process, enzymatic modification	integral to plasma membrane	sulfotransferase activity			pancreas(1)	1	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.117)		GTGGGCGTGCGCCCATCACAC	0.647													5	130	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141108447	141108447	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141108447C>G	uc002tvj.1	-	77	12783	c.11811G>C	c.(11809-11811)TGG>TGC	p.W3937C		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	3937	Extracellular (Potential).|LDL-receptor class B 33.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACTGAGTACTCCAAATAATCA	0.343										TSP Lung(27;0.18)			5	119	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152410492	152410492	+	Silent	SNP	G	A	A	rs113068669		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152410492G>A	uc010fnx.2	-	98	14564	c.14373C>T	c.(14371-14373)ATC>ATT	p.I4791I	NEB_uc002txr.2_Silent_p.I1214I	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	4791	Nebulin 131.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGTCGGGCACGATGTGGATTT	0.458													17	216	---	---	---	---	PASS
PRPF40A	55660	broad.mit.edu	37	2	153530207	153530207	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:153530207T>C	uc002tyi.2	-	11	1139	c.1126A>G	c.(1126-1128)AAA>GAA	p.K376E	PRPF40A_uc002tyh.3_Missense_Mutation_p.K349E|PRPF40A_uc010zcd.1_Missense_Mutation_p.K296E|PRPF40A_uc002tyj.2_Missense_Mutation_p.K245E	NM_017892	NP_060362	O75400	PR40A_HUMAN	formin binding protein 3	376					mRNA processing|RNA splicing	nuclear matrix|nuclear speck	protein binding				0						TCCTCTTCTTTTTTGGGAGTA	0.284													4	46	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160287584	160287584	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160287584C>G	uc002uao.2	-	10	2336	c.1984G>C	c.(1984-1986)GAT>CAT	p.D662H	BAZ2B_uc002uap.2_Missense_Mutation_p.D660H|BAZ2B_uc002uaq.1_Intron|BAZ2B_uc002uar.1_Missense_Mutation_p.D235H	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	662	Asp/Glu-rich (acidic).				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						CCTTCAGTATCACTATCTGAT	0.378													12	130	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160295564	160295564	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160295564C>T	uc002uao.2	-	7	1208	c.856G>A	c.(856-858)GAT>AAT	p.D286N	BAZ2B_uc002uap.2_Missense_Mutation_p.D284N|BAZ2B_uc002uas.1_Missense_Mutation_p.D223N|BAZ2B_uc002uau.1_Missense_Mutation_p.D284N|BAZ2B_uc002uaq.1_Missense_Mutation_p.D214N|BAZ2B_uc002uat.3_Missense_Mutation_p.D223N|BAZ2B_uc010fop.1_Missense_Mutation_p.D284N	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	286					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						GAATCAGAATCATCATCTTCA	0.294													12	180	---	---	---	---	PASS
B3GALT1	8708	broad.mit.edu	37	2	168726029	168726029	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168726029G>A	uc002udz.1	+	2	831	c.480G>A	c.(478-480)ATG>ATA	p.M160I		NM_020981	NP_066191	Q9Y5Z6	B3GT1_HUMAN	UDP-Gal:betaGlcNAc beta	160	Lumenal (Potential).				lipid glycosylation|protein glycosylation	Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(2)|pancreas(1)|skin(1)	4						TAATGGGGATGAGATGGGTGG	0.383													8	83	---	---	---	---	PASS
CDCA7	83879	broad.mit.edu	37	2	174231026	174231026	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174231026C>G	uc002uid.1	+	7	945	c.814C>G	c.(814-816)CAA>GAA	p.Q272E	CDCA7_uc002uic.1_Missense_Mutation_p.Q351E|CDCA7_uc010zej.1_Missense_Mutation_p.Q307E|CDCA7_uc010zek.1_Missense_Mutation_p.Q230E	NM_145810	NP_665809	Q9BWT1	CDCA7_HUMAN	cell division cycle associated 7 isoform 2	272	Mediates transcriptional activity.				regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.116)			TACTTGTCATCAATGCCGTCA	0.428													5	169	---	---	---	---	PASS
CWC22	57703	broad.mit.edu	37	2	180830638	180830638	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180830638C>T	uc010frh.1	-	12	1582	c.1282G>A	c.(1282-1284)GAA>AAA	p.E428K	CWC22_uc002unp.2_Missense_Mutation_p.E428K	NM_020943	NP_065994	Q9HCG8	CWC22_HUMAN	CWC22 spliceosome-associated protein homolog	428	Poly-Glu.					catalytic step 2 spliceosome	protein binding|RNA binding				0						tcctcttcttcttcctcgtcc	0.234													6	42	---	---	---	---	PASS
TMEFF2	23671	broad.mit.edu	37	2	193059101	193059101	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193059101C>T	uc002utc.2	-	1	544	c.150G>A	c.(148-150)ACG>ACA	p.T50T	TMEFF2_uc002utd.1_Silent_p.T50T	NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two	50	Extracellular (Potential).					extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			AGCCGGTGGGCGTTTGGCAGT	0.592													10	134	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198482601	198482601	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198482601C>G	uc002uuo.3	-	6	1375	c.973G>C	c.(973-975)GAA>CAA	p.E325Q		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	325						plasma membrane					0						GAACCTTCTTCTTCATAGATA	0.388													7	94	---	---	---	---	PASS
AOX1	316	broad.mit.edu	37	2	201534294	201534294	+	Intron	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201534294C>T	uc002uvx.2	+						AOX1_uc010zhf.1_Intron|AOX1_uc010fsu.2_Intron	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1						inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	TGCTTCCTTTCAAGGGTCTGG	0.388													12	375	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207171375	207171375	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207171375C>G	uc002vbp.2	+	5	2373	c.2123C>G	c.(2122-2124)TCT>TGT	p.S708C		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	708							nucleic acid binding|zinc ion binding			ovary(3)	3						TCTCTGAGTTCTGATTCTCCG	0.408													11	68	---	---	---	---	PASS
ZDBF2	57683	broad.mit.edu	37	2	207173250	207173250	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207173250C>T	uc002vbp.2	+	5	4248	c.3998C>T	c.(3997-3999)TCA>TTA	p.S1333L		NM_020923	NP_065974	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1333							nucleic acid binding|zinc ion binding			ovary(3)	3						ATTTATGTTTCAAATATCCCT	0.383													4	69	---	---	---	---	PASS
C2orf67	151050	broad.mit.edu	37	2	211019309	211019309	+	5'UTR	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211019309C>T	uc002vds.2	-	2					C2orf67_uc002vdt.2_5'UTR|C2orf67_uc002vdw.2_5'UTR|C2orf67_uc002vdy.1_5'UTR|C2orf67_uc002vdv.2_5'UTR|C2orf67_uc002vdx.1_5'UTR	NM_152519	NP_689732	A0AUZ9	CB067_HUMAN	hypothetical protein LOC151050											ovary(3)	3		Renal(323;0.202)		Epithelial(149;0.00435)|Lung(261;0.0529)|LUSC - Lung squamous cell carcinoma(261;0.0551)|all cancers(144;0.0696)		GGGGTCATGGCGATTCCTGTA	0.383													4	83	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227663295	227663295	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227663295G>A	uc002voh.3	-	1	212	c.160C>T	c.(160-162)CGG>TGG	p.R54W		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	54	PH.|Mediates interaction with PHIP (By similarity).				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GACTTGTGCCGCCACTTCTTC	0.607													23	127	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227917019	227917019	+	Splice_Site	SNP	A	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227917019A>T	uc010zlt.1	-	32	3622	c.2968_splice	c.e32+1	p.G990_splice		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor						axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TTAAGTGTTTACCTCTTTCTC	0.408													9	45	---	---	---	---	PASS
PSMD1	5707	broad.mit.edu	37	2	231948391	231948391	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231948391C>T	uc002vrn.1	+	14	1767	c.1636C>T	c.(1636-1638)CGT>TGT	p.R546C	PSMD1_uc002vrm.1_Missense_Mutation_p.R546C|PSMD1_uc010fxu.1_Missense_Mutation_p.R410C	NM_002807	NP_002798	Q99460	PSMD1_HUMAN	proteasome 26S non-ATPase subunit 1	546					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|regulation of protein catabolic process|S phase of mitotic cell cycle|viral reproduction	proteasome regulatory particle	enzyme regulator activity|protein binding			ovary(1)|skin(1)	2		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	GAAGATTCTGCGTGGTCTTGC	0.458													5	99	---	---	---	---	PASS
ILKAP	80895	broad.mit.edu	37	2	239092332	239092332	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239092332C>A	uc002vxv.2	-	8	806	c.676G>T	c.(676-678)GAC>TAC	p.D226Y	ILKAP_uc010zns.1_Missense_Mutation_p.D158Y|ILKAP_uc002vxw.2_Missense_Mutation_p.D106Y|ILKAP_uc010znt.1_Missense_Mutation_p.D106Y	NM_030768	NP_110395	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated protein	226	PP2C-like.					cytoplasm|protein serine/threonine phosphatase complex	metal ion binding|protein binding			ovary(3)	3		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		AGAATGTTGTCTACAGCCAGA	0.493													6	91	---	---	---	---	PASS
STK25	10494	broad.mit.edu	37	2	242438156	242438156	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242438156C>T	uc002wbm.2	-	7	1086	c.815G>A	c.(814-816)CGC>CAC	p.R272H	STK25_uc002wbk.2_Missense_Mutation_p.R91H|STK25_uc002wbl.2_3'UTR|STK25_uc002wbn.2_Missense_Mutation_p.R272H|STK25_uc002wbo.2_Missense_Mutation_p.R195H|STK25_uc010zos.1_Missense_Mutation_p.R178H|STK25_uc010zot.1_Missense_Mutation_p.R198H|STK25_uc002wbp.2_Missense_Mutation_p.R272H|STK25_uc010fzo.2_Missense_Mutation_p.R195H|STK25_uc010zou.1_Missense_Mutation_p.R178H|STK25_uc010zov.1_Missense_Mutation_p.R178H	NM_006374	NP_006365	O00506	STK25_HUMAN	serine/threonine kinase 25	272					response to oxidative stress|signal transduction	Golgi apparatus	ATP binding|identical protein binding|metal ion binding|protein serine/threonine kinase activity				0		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;8.24e-34)|all cancers(36;3.46e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.6e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.1e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0839)		CTTGGTGTAGCGTGTGATGAA	0.602													12	157	---	---	---	---	PASS
D2HGDH	728294	broad.mit.edu	37	2	242681886	242681886	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242681886G>T	uc002wce.1	+	4	560	c.387G>T	c.(385-387)CAG>CAT	p.Q129H	D2HGDH_uc010zpc.1_RNA|D2HGDH_uc010fzq.1_Translation_Start_Site|D2HGDH_uc002wcg.1_RNA	NM_152783	NP_689996	Q8N465	D2HDH_HUMAN	D-2-hydroxyglutarate dehydrogenase precursor	129	FAD-binding PCMH-type.				2-oxoglutarate metabolic process|cellular protein metabolic process|response to cobalt ion|response to manganese ion|response to zinc ion	mitochondrial matrix	(R)-2-hydroxyglutarate dehydrogenase activity|flavin adenine dinucleotide binding|protein binding				0		all_cancers(19;1.09e-40)|all_epithelial(40;2.03e-18)|Breast(86;1.53e-05)|all_lung(227;0.00338)|Renal(207;0.00502)|Ovarian(221;0.00716)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|Melanoma(123;0.144)|all_hematologic(139;0.158)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;4.59e-33)|all cancers(36;9.89e-31)|OV - Ovarian serous cystadenocarcinoma(60;7.89e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.63e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0833)		TGAACCCACAGGGGGGCAACA	0.642													8	40	---	---	---	---	PASS
SRGAP3	9901	broad.mit.edu	37	3	9101998	9101998	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9101998G>A	uc003brf.1	-	6	1394	c.718C>T	c.(718-720)CGG>TGG	p.R240W	SRGAP3_uc003brg.1_Missense_Mutation_p.R240W|SRGAP3_uc003bri.1_RNA|SRGAP3_uc003brk.2_Missense_Mutation_p.R240W|SRGAP3_uc003brj.1_Missense_Mutation_p.R100W	NM_014850	NP_055665	O43295	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 3	240					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding		SRGAP3/RAF1(4)	central_nervous_system(4)|skin(3)|urinary_tract(1)|breast(1)	9				OV - Ovarian serous cystadenocarcinoma(96;0.0563)		TAGTCATTCCGGGCCTTTGTG	0.483			T	RAF1	pilocytic astrocytoma								5	126	---	---	---	---	PASS
BRPF1	7862	broad.mit.edu	37	3	9788039	9788039	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9788039C>A	uc003bse.2	+	13	3761	c.3362C>A	c.(3361-3363)CCT>CAT	p.P1121H	BRPF1_uc003bsf.2_Missense_Mutation_p.P1127H|BRPF1_uc003bsg.2_Missense_Mutation_p.P1120H|BRPF1_uc011ati.1_Missense_Mutation_p.P1026H	NM_004634	NP_004625	P55201	BRPF1_HUMAN	bromodomain and PHD finger-containing protein 1	1121	PWWP.				histone H3 acetylation|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|MOZ/MORF histone acetyltransferase complex|plasma membrane	DNA binding|zinc ion binding			ovary(2)|central_nervous_system(1)	3	Medulloblastoma(99;0.227)					GTTCCCATCCCTGTGCCCCCA	0.527													7	128	---	---	---	---	PASS
ATP2B2	491	broad.mit.edu	37	3	10413690	10413690	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10413690C>G	uc003bvt.2	-	12	1901	c.1462G>C	c.(1462-1464)GAG>CAG	p.E488Q	ATP2B2_uc003bvv.2_Missense_Mutation_p.E443Q|ATP2B2_uc003bvw.2_Missense_Mutation_p.E443Q|ATP2B2_uc010hdo.2_Missense_Mutation_p.E193Q	NM_001001331	NP_001001331	Q01814	AT2B2_HUMAN	plasma membrane calcium ATPase 2 isoform 1	488	Cytoplasmic (Potential).				ATP biosynthetic process|cytosolic calcium ion homeostasis|platelet activation	cytosol|integral to membrane|plasma membrane	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|calcium-transporting ATPase activity|calmodulin binding|calmodulin binding|metal ion binding|PDZ domain binding|protein C-terminus binding			ovary(3)|skin(2)|central_nervous_system(1)	6						CCCATGGTCTCACAGGCATCC	0.577													12	85	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37061819	37061819	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37061819G>A	uc003cgl.2	+	11	963	c.903G>A	c.(901-903)CAG>CAA	p.Q301Q	MLH1_uc011aye.1_Silent_p.Q60Q|MLH1_uc011ayb.1_Silent_p.Q60Q|MLH1_uc010hge.2_Silent_p.Q301Q|MLH1_uc003cgn.3_Silent_p.Q60Q|MLH1_uc011ayc.1_Silent_p.Q203Q|MLH1_uc011ayd.1_Silent_p.Q60Q|MLH1_uc003cgo.2_Silent_p.Q60Q|MLH1_uc010hgg.1_5'UTR|MLH1_uc010hgh.1_5'UTR|MLH1_uc010hgi.1_Intron|MLH1_uc010hgj.1_Intron|MLH1_uc010hgk.2_Intron|MLH1_uc010hgl.1_5'UTR	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	301					mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						TCAGTCCCCAGAATGTGGATG	0.493		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				12	103	---	---	---	---	PASS
MLH1	4292	broad.mit.edu	37	3	37061853	37061853	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:37061853G>T	uc003cgl.2	+	11	997	c.937G>T	c.(937-939)GAA>TAA	p.E313*	MLH1_uc011aye.1_Nonsense_Mutation_p.E72*|MLH1_uc011ayb.1_Nonsense_Mutation_p.E72*|MLH1_uc010hge.2_Nonsense_Mutation_p.E313*|MLH1_uc003cgn.3_Nonsense_Mutation_p.E72*|MLH1_uc011ayc.1_Nonsense_Mutation_p.E215*|MLH1_uc011ayd.1_Nonsense_Mutation_p.E72*|MLH1_uc003cgo.2_Nonsense_Mutation_p.E72*|MLH1_uc010hgg.1_5'UTR|MLH1_uc010hgh.1_5'UTR|MLH1_uc010hgi.1_Intron|MLH1_uc010hgj.1_Intron|MLH1_uc010hgk.2_Intron|MLH1_uc010hgl.1_Missense_Mutation_p.M11I	NM_000249	NP_000240	P40692	MLH1_HUMAN	MutL protein homolog 1	313					mismatch repair|somatic hypermutation of immunoglobulin genes	chiasma|MutLalpha complex|MutLbeta complex|synaptonemal complex	ATP binding|ATPase activity|protein binding	p.0?(1)		large_intestine(40)|haematopoietic_and_lymphoid_tissue(8)|ovary(6)|pancreas(5)|stomach(3)|central_nervous_system(3)|endometrium(3)|breast(3)|prostate(3)|skin(2)|NS(1)	77						CACAAAGCATGAAGTTCACTT	0.502		1	D|Mis|N|F|S		colorectal|endometrial|ovarian|CNS	colorectal|endometrial|ovarian|CNS		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				13	91	---	---	---	---	PASS
EIF1B	10289	broad.mit.edu	37	3	40352450	40352450	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40352450T>C	uc003ckc.2	+	2	358	c.98T>C	c.(97-99)ATA>ACA	p.I33T	uc003ckb.2_5'Flank	NM_005875	NP_005866	O60739	EIF1B_HUMAN	translation factor sui1 homolog	33					regulation of translational initiation		protein binding|translation initiation factor activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		TACATTCATATAAGAATCCAG	0.403													13	59	---	---	---	---	PASS
CDCP1	64866	broad.mit.edu	37	3	45132780	45132780	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45132780G>A	uc003com.2	-	7	2013	c.1878C>T	c.(1876-1878)CTC>CTT	p.L626L		NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	626	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TTGGCTTGGGGAGCACATCCT	0.602													11	115	---	---	---	---	PASS
CDCP1	64866	broad.mit.edu	37	3	45153706	45153706	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:45153706C>T	uc003com.2	-	3	659	c.524G>A	c.(523-525)GGA>GAA	p.G175E	CDCP1_uc003con.2_Missense_Mutation_p.G175E	NM_022842	NP_073753	Q9H5V8	CDCP1_HUMAN	CUB domain-containing protein 1 isoform 1	175	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		GCAGAAGGTTCCGATCCTGAC	0.587													31	121	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66431074	66431074	+	Silent	SNP	C	T	T	rs148872922		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66431074C>T	uc003dmx.2	-	18	2996	c.2982G>A	c.(2980-2982)TCG>TCA	p.S994S	SLC25A26_uc011bft.1_RNA|LRIG1_uc011bfu.1_Silent_p.S614S|LRIG1_uc003dmw.2_Silent_p.S660S|LRIG1_uc010hnz.2_Silent_p.S710S|LRIG1_uc010hoa.2_Silent_p.S971S	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	994	Cytoplasmic (Potential).					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		TGGGGTAGAGCGACCCTTGGC	0.557													7	227	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100949881	100949881	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100949881G>T	uc003duq.1	-	16	3545	c.3342C>A	c.(3340-3342)GTC>GTA	p.V1114V	IMPG2_uc011bhe.1_Silent_p.V977V|IMPG2_uc010hpj.1_Intron	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	1114	Helical; (Potential).				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						CAGAAAAGATGACAAGAAGTC	0.478													20	220	---	---	---	---	PASS
QTRTD1	79691	broad.mit.edu	37	3	113804605	113804605	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113804605C>T	uc003eay.2	+	10	1332	c.1102C>T	c.(1102-1104)CTG>TTG	p.L368L	QTRTD1_uc003eaz.2_Silent_p.L380L|QTRTD1_uc011biq.1_Silent_p.L245L|QTRTD1_uc011bir.1_Silent_p.L262L	NM_024638	NP_078914	Q9H974	QTRD1_HUMAN	queuine tRNA-ribosyltransferase domain	368					queuosine biosynthetic process	mitochondrion	metal ion binding|queuine tRNA-ribosyltransferase activity			central_nervous_system(1)|skin(1)	2						CCACCATCTGCTGGTGACCAA	0.473													12	267	---	---	---	---	PASS
TMEM39A	55254	broad.mit.edu	37	3	119153616	119153616	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119153616C>T	uc003eck.1	-	8	1589	c.1226G>A	c.(1225-1227)CGC>CAC	p.R409H	TMEM39A_uc003ecl.1_Missense_Mutation_p.R257H	NM_018266	NP_060736	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	409						integral to membrane				ovary(1)|breast(1)	2				GBM - Glioblastoma multiforme(114;0.244)		TGCATAAAAGCGGGCATGAGA	0.468													11	193	---	---	---	---	PASS
PLXND1	23129	broad.mit.edu	37	3	129303326	129303326	+	Missense_Mutation	SNP	C	T	T	rs139388919	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129303326C>T	uc003emx.2	-	6	2031	c.1931G>A	c.(1930-1932)CGC>CAC	p.R644H		NM_015103	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1 precursor	644	Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane				large_intestine(1)	1						AGCCACAGTGCGGATGTTGTT	0.637													6	120	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130282153	130282153	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130282153C>T	uc010htl.2	+	2	337	c.306C>T	c.(304-306)GGC>GGT	p.G102G		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	102	Nonhelical region.|VWFA 1.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						GATTCATTGGCGGGTCCCTGC	0.498													10	43	---	---	---	---	PASS
KY	339855	broad.mit.edu	37	3	134322712	134322712	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134322712C>T	uc010hty.2	-	11	1757	c.1695G>A	c.(1693-1695)TGG>TGA	p.W565*	KY_uc011blw.1_3'UTR|KY_uc011blx.1_Nonsense_Mutation_p.W544*	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	Error:Variant_position_missing_in_Q8NBH2_after_alignment						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						GGAACATGGGCCAGTTCACCT	0.493													4	73	---	---	---	---	PASS
CHST2	9435	broad.mit.edu	37	3	142841021	142841021	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142841021G>T	uc003evm.2	+	2	2252	c.1363G>T	c.(1363-1365)GCC>TCC	p.A455S		NM_004267	NP_004258	Q9Y4C5	CHST2_HUMAN	carbohydrate (N-acetylglucosamine-6-O)	455	Lumenal (Potential).				inflammatory response|multicellular organismal development|N-acetylglucosamine metabolic process|sulfur compound metabolic process	integral to membrane|intrinsic to Golgi membrane|trans-Golgi network	N-acetylglucosamine 6-O-sulfotransferase activity			ovary(3)	3						GGAGCAGTTTGCCCTGAACAT	0.612													7	61	---	---	---	---	PASS
IQCJ	654502	broad.mit.edu	37	3	158983100	158983100	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158983100C>G	uc003fcp.1	+	5	493	c.388C>G	c.(388-390)CTC>GTC	p.L130V	SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Missense_Mutation_p.L103V	NM_001042705	NP_001036170	Q1A5X6	IQCJ_HUMAN	IQ motif containing J isoform CaMBPv1	130											0			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			GGTGATTCTTCTCTACCTTGA	0.512													17	205	---	---	---	---	PASS
EIF2B5	8893	broad.mit.edu	37	3	183858308	183858308	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183858308C>T	uc003fmp.2	+	7	1310	c.946C>T	c.(946-948)CGA>TGA	p.R316*	EIF2B5_uc003fmq.2_Nonsense_Mutation_p.R37*|EIF2B5_uc003fmr.2_5'Flank	NM_003907	NP_003898	Q13144	EI2BE_HUMAN	eukaryotic translation initiation factor 2B,	316					astrocyte development|myelination|negative regulation of translational initiation in response to stress|oligodendrocyte development|ovarian follicle development|positive regulation of translational initiation|response to glucose stimulus|response to heat|response to peptide hormone stimulus|RNA metabolic process	cytosol|eukaryotic translation initiation factor 2B complex|nucleus	guanyl-nucleotide exchange factor activity|transferase activity|translation initiation factor activity|translation initiation factor binding			ovary(5)	5	all_cancers(143;7.59e-11)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)			CGTCATCCGCCGATGGGTCTA	0.567													11	272	---	---	---	---	PASS
AHSG	197	broad.mit.edu	37	3	186338694	186338694	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186338694G>A	uc003fqk.3	+	7	1160	c.1079G>A	c.(1078-1080)GGG>GAG	p.G360E	AHSG_uc003fql.3_Missense_Mutation_p.G361E|AHSG_uc003fqm.3_Missense_Mutation_p.G359E|AHSG_uc010hyp.2_Missense_Mutation_p.G323E	NM_001622	NP_001613	P02765	FETUA_HUMAN	alpha-2-HS-glycoprotein	360					acute-phase response|negative regulation of bone mineralization|negative regulation of insulin receptor signaling pathway|pinocytosis|positive regulation of phagocytosis|regulation of inflammatory response|skeletal system development	extracellular space	cysteine-type endopeptidase inhibitor activity|protein binding				0	all_cancers(143;3.64e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.27e-20)	GBM - Glioblastoma multiforme(93;0.0463)		CCATGTCCGGGGAGGATCAGA	0.572													5	82	---	---	---	---	PASS
CPN2	1370	broad.mit.edu	37	3	194062396	194062396	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194062396T>C	uc003fts.2	-	2	1126	c.1036A>G	c.(1036-1038)AGC>GGC	p.S346G		NM_001080513	NP_001073982	P22792	CPN2_HUMAN	carboxypeptidase N, polypeptide 2	346	LRR 11.				protein stabilization	extracellular region	enzyme regulator activity			ovary(5)	5	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.65e-05)		AGGTTGTTGCTGCCCAGGTAG	0.577													4	105	---	---	---	---	PASS
FAM43A	131583	broad.mit.edu	37	3	194407900	194407900	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194407900G>A	uc003fuj.2	+	1	1279	c.345G>A	c.(343-345)GCG>GCA	p.A115A		NM_153690	NP_710157	Q8N2R8	FA43A_HUMAN	hypothetical protein LOC131583	115										central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		CGGTGAGTGCGCAGGGTATCC	0.711													7	54	---	---	---	---	PASS
JAKMIP1	152789	broad.mit.edu	37	4	6114505	6114505	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6114505C>G	uc003giu.3	-	2	349	c.73G>C	c.(73-75)GAG>CAG	p.E25Q	JAKMIP1_uc010idb.1_Missense_Mutation_p.E25Q|JAKMIP1_uc010idc.1_Missense_Mutation_p.E25Q|JAKMIP1_uc010idd.1_Missense_Mutation_p.E25Q|JAKMIP1_uc011bwc.1_Missense_Mutation_p.E25Q|JAKMIP1_uc003giv.3_Missense_Mutation_p.E25Q|JAKMIP1_uc010ide.2_Missense_Mutation_p.E25Q	NM_144720	NP_653321	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein	25	Potential.|Mediates association with microtubules.				protein transport	cytoplasm|membrane|microtubule|peripheral to membrane of membrane fraction|ribonucleoprotein complex	GABA receptor binding|RNA binding			large_intestine(1)|pancreas(1)|ovary(1)|skin(1)	4						GCCCGCAGCTCCTCGTTGGCC	0.602													5	100	---	---	---	---	PASS
PSAPL1	768239	broad.mit.edu	37	4	7435593	7435593	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7435593G>A	uc011bwj.1	-	1	1108	c.1014C>T	c.(1012-1014)ATC>ATT	p.I338I	SORCS2_uc003gkb.3_Intron|SORCS2_uc011bwi.1_Intron	NM_001085382	NP_001078851	Q6NUJ1	SAPL1_HUMAN	prosaposin-like protein 1	338	Saposin B-type 3.				sphingolipid metabolic process	extracellular region|lysosome					0						TGTCCACCAAGATGATGCACT	0.577													20	167	---	---	---	---	PASS
PI4K2B	55300	broad.mit.edu	37	4	25260783	25260783	+	Missense_Mutation	SNP	T	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25260783T>A	uc003grk.2	+	5	1014	c.881T>A	c.(880-882)GTT>GAT	p.V294D	PI4K2B_uc011bxs.1_Missense_Mutation_p.V198D	NM_018323	NP_060793	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	294	PI3K/PI4K.					cytoplasm|membrane	1-phosphatidylinositol 4-kinase activity|ATP binding			ovary(2)|skin(2)	4		Breast(46;0.173)				GAAAGATTAGTTATTTTGGAT	0.318													13	121	---	---	---	---	PASS
CORIN	10699	broad.mit.edu	37	4	47605540	47605540	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47605540C>T	uc003gxm.2	-	20	2779	c.2686G>A	c.(2686-2688)GTT>ATT	p.V896I	CORIN_uc011bzf.1_Missense_Mutation_p.V757I|CORIN_uc011bzg.1_Missense_Mutation_p.V829I	NM_006587	NP_006578	Q9Y5Q5	CORIN_HUMAN	corin	896	Extracellular (Potential).|Peptidase S1.				peptide hormone processing|regulation of systemic arterial blood pressure by atrial natriuretic peptide	integral to membrane|plasma membrane	scavenger receptor activity|serine-type endopeptidase activity|serine-type exopeptidase activity			ovary(1)|central_nervous_system(1)	2						CTCAGCTCAACGATGCTGATG	0.537													6	92	---	---	---	---	PASS
CEP135	9662	broad.mit.edu	37	4	56831849	56831849	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56831849C>T	uc003hbi.2	+	8	1102	c.868C>T	c.(868-870)CGT>TGT	p.R290C	CEP135_uc003hbj.2_5'UTR|CEP135_uc010igz.1_Missense_Mutation_p.R120C	NM_025009	NP_079285	Q66GS9	CP135_HUMAN	centrosome protein 4	290	Potential.				centriole replication|centriole-centriole cohesion|G2/M transition of mitotic cell cycle	centriole|cytosol	protein C-terminus binding			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	Glioma(25;0.08)|all_neural(26;0.101)					CCTGGAGAAGCGTATACGAGA	0.333													8	45	---	---	---	---	PASS
AASDH	132949	broad.mit.edu	37	4	57215996	57215996	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57215996T>C	uc003hbn.2	-	11	2074	c.1921A>G	c.(1921-1923)AGT>GGT	p.S641G	AASDH_uc010ihb.2_Missense_Mutation_p.S156G|AASDH_uc011caa.1_Missense_Mutation_p.S488G|AASDH_uc003hbo.2_Missense_Mutation_p.S541G|AASDH_uc011cab.1_Missense_Mutation_p.S156G|AASDH_uc010ihc.2_Missense_Mutation_p.S641G|AASDH_uc003hbp.2_Missense_Mutation_p.S641G	NM_181806	NP_861522	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	641					fatty acid metabolic process		acid-thiol ligase activity|acyl carrier activity|ATP binding|cofactor binding	p.S641I(1)		ovary(4)	4	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				GTGGCACAACTCTTCCTGAAT	0.403													5	261	---	---	---	---	PASS
LPHN3	23284	broad.mit.edu	37	4	62849149	62849149	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62849149G>T	uc010ihh.2	+	16	3033	c.2860G>T	c.(2860-2862)GCC>TCC	p.A954S	LPHN3_uc003hcq.3_Missense_Mutation_p.A954S|LPHN3_uc003hct.2_Missense_Mutation_p.A347S	NM_015236	NP_056051	Q9HAR2	LPHN3_HUMAN	latrophilin 3 precursor	941	Helical; Name=3; (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity|sugar binding			lung(15)|ovary(1)|central_nervous_system(1)|pancreas(1)	18						CTTCTTGGCTGCCTTCACCTG	0.443													17	74	---	---	---	---	PASS
CXCL6	6372	broad.mit.edu	37	4	74702938	74702938	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:74702938G>A	uc003hhf.2	+	3	456	c.261G>A	c.(259-261)GGG>GGA	p.G87G	IL8_uc011cbh.1_Intron	NM_002993	NP_002984	P80162	CXCL6_HUMAN	chemokine (C-X-C motif) ligand 6 (granulocyte	87					cell-cell signaling|chemotaxis|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity|heparin binding				0	Breast(15;0.00102)		all cancers(17;0.00176)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)			TGAAGAACGGGAAGCAAGTTT	0.463													4	105	---	---	---	---	PASS
MTTP	4547	broad.mit.edu	37	4	100530115	100530115	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100530115C>T	uc003hvc.3	+	13	2006	c.1750C>T	c.(1750-1752)CGT>TGT	p.R584C	MTTP_uc011cej.1_Missense_Mutation_p.R611C	NM_000253	NP_000244	P55157	MTP_HUMAN	microsomal triglyceride transfer protein large	584	Vitellogenin.				lipid metabolic process|lipoprotein metabolic process	endoplasmic reticulum lumen	lipid binding|lipid transporter activity			ovary(3)|central_nervous_system(1)	4				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)	AGACATCCTACGTTTTGAAAT	0.408													7	146	---	---	---	---	PASS
SGMS2	166929	broad.mit.edu	37	4	108816946	108816946	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:108816946G>A	uc003hyl.3	+	3	792	c.237G>A	c.(235-237)ACG>ACA	p.T79T	uc003hym.1_Intron|SGMS2_uc003hyn.2_Silent_p.T79T|SGMS2_uc003hyo.2_Silent_p.T79T	NM_001136258	NP_001129730	Q8NHU3	SMS2_HUMAN	sphingomyelin synthase 2	79					sphingomyelin biosynthetic process	integral to Golgi membrane|integral to plasma membrane	ceramide cholinephosphotransferase activity|kinase activity|sphingomyelin synthase activity			lung(1)	1				OV - Ovarian serous cystadenocarcinoma(123;2.95e-05)	Choline(DB00122)	GGTGGAAAACGGGCATTGCCT	0.483													7	105	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114275200	114275200	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114275200C>T	uc003ibe.3	+	38	5526	c.5426C>T	c.(5425-5427)GCG>GTG	p.A1809V	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Missense_Mutation_p.A1824V	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	1776	Repeat A.|Repeat-rich region.				axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CATCCAGCTGCGTCACCCTCT	0.522													9	138	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126328171	126328171	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126328171G>T	uc003ifj.3	+	3	5444	c.5444G>T	c.(5443-5445)CGT>CTT	p.R1815L	FAT4_uc011cgp.1_Missense_Mutation_p.R113L	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	1815	Cadherin 17.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						CTGCTAGTTCGTGCTGATGAT	0.468													23	211	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126373015	126373015	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126373015G>T	uc003ifj.3	+	9	10844	c.10844G>T	c.(10843-10845)CGG>CTG	p.R3615L	FAT4_uc011cgp.1_Missense_Mutation_p.R1913L|FAT4_uc003ifi.1_Missense_Mutation_p.R1093L	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	3615	Cadherin 34.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						TCACAGTCTCGGACGGTGGAG	0.438													6	172	---	---	---	---	PASS
MFSD8	256471	broad.mit.edu	37	4	128851936	128851936	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128851936C>T	uc003ifp.2	-	10	1063	c.900G>A	c.(898-900)TGG>TGA	p.W300*	MFSD8_uc011cgu.1_Nonsense_Mutation_p.W255*|MFSD8_uc011cgv.1_Nonsense_Mutation_p.W262*|MFSD8_uc011cgw.1_RNA|MFSD8_uc011cgx.1_3'UTR	NM_152778	NP_689991	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing	300	Extracellular (Potential).				cell death|transmembrane transport	integral to membrane|lysosomal membrane				ovary(1)|liver(1)	2						GTTCTTGAGTCCAGGCATACA	0.308													10	174	---	---	---	---	PASS
PALLD	23022	broad.mit.edu	37	4	169606677	169606677	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169606677C>T	uc011cjx.1	+	6	1513	c.1302C>T	c.(1300-1302)ACC>ACT	p.T434T	PALLD_uc003iru.2_Silent_p.T434T|PALLD_uc003irv.2_Silent_p.T52T	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2	434					cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		CTGATGGAACCACTACTGCCT	0.393									Pancreatic_Cancer_Familial_Clustering_of				6	184	---	---	---	---	PASS
LRP2BP	55805	broad.mit.edu	37	4	186291928	186291928	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186291928C>T	uc003ixj.1	-	7	1656	c.844G>A	c.(844-846)GCC>ACC	p.A282T	LRP2BP_uc003ixk.1_Missense_Mutation_p.A256T|LRP2BP_uc011ckr.1_Missense_Mutation_p.A282T	NM_018409	NP_060879	Q9P2M1	LR2BP_HUMAN	LRP2 binding protein	282						cytoplasm	protein binding				0		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		GTGACCTGGGCGATCATGGGG	0.498													8	131	---	---	---	---	PASS
CYP4V2	285440	broad.mit.edu	37	4	187120144	187120144	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187120144G>A	uc003iyw.3	+	6	1012	c.708G>A	c.(706-708)ATG>ATA	p.M236I		NM_207352	NP_997235	Q6ZWL3	CP4V2_HUMAN	cytochrome P450, family 4, subfamily v,	236					response to stimulus|visual perception	endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen				0		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.33e-10)|BRCA - Breast invasive adenocarcinoma(30;3.84e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000293)|LUSC - Lung squamous cell carcinoma(40;0.00242)|READ - Rectum adenocarcinoma(43;0.17)		GAATAAAGATGCCCTGGCTTT	0.363													28	129	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13845026	13845026	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13845026G>A	uc003jfd.2	-	32	5233	c.5191C>T	c.(5191-5193)CAG>TAG	p.Q1731*		NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1731	Stem (By similarity).				microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TCCGACGCCTGCCCCAGAATC	0.448									Kartagener_syndrome				34	153	---	---	---	---	PASS
WDR70	55100	broad.mit.edu	37	5	37392194	37392194	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37392194G>A	uc003jkv.2	+	4	326	c.268G>A	c.(268-270)GTC>ATC	p.V90I	WDR70_uc010iva.1_Missense_Mutation_p.V90I	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70	90	Ser-rich.									ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			ATCAAATGTGGTCAGAGATTG	0.328													17	190	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38352359	38352359	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38352359G>T	uc003jlc.1	+	5	795	c.471G>T	c.(469-471)GAG>GAT	p.E157D	EGFLAM_uc003jlb.1_Missense_Mutation_p.E157D	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G	157	Fibronectin type-III 2.					cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					CGGATTCTGAGGTGGCCCTGT	0.507													7	255	---	---	---	---	PASS
RICTOR	253260	broad.mit.edu	37	5	38944564	38944564	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38944564C>G	uc003jlp.2	-	36	4921	c.4897G>C	c.(4897-4899)GAG>CAG	p.E1633Q	RICTOR_uc003jlo.2_Missense_Mutation_p.E1657Q|RICTOR_uc010ivf.2_Missense_Mutation_p.E1310Q	NM_152756	NP_689969	Q6R327	RICTR_HUMAN	rapamycin-insensitive companion of mTOR	1633					actin cytoskeleton reorganization|embryo development|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|positive regulation of TOR signaling cascade|regulation of protein kinase B signaling cascade|T cell costimulation	cytosol|TORC2 complex	protein binding			ovary(3)|lung(3)|skin(2)|kidney(1)|central_nervous_system(1)	10	all_lung(31;0.000396)					AGCCCAGTCTCATGACATTTA	0.323													5	238	---	---	---	---	PASS
FBXO4	26272	broad.mit.edu	37	5	41927220	41927220	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41927220T>C	uc003jmq.2	+	2	351	c.295T>C	c.(295-297)TGG>CGG	p.W99R	FBXO4_uc003jmp.2_Missense_Mutation_p.W99R|FBXO4_uc003jmr.2_Missense_Mutation_p.W99R	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1	99	F-box.				positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				TCCAATTCTGTGGAGATACTT	0.373													15	263	---	---	---	---	PASS
GZMA	3001	broad.mit.edu	37	5	54404118	54404118	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:54404118G>T	uc003jpm.2	+	4	560	c.523G>T	c.(523-525)GAC>TAC	p.D175Y		NM_006144	NP_006135	P12544	GRAA_HUMAN	granzyme A precursor	175	Peptidase S1.				cleavage of lamin|cytolysis|immune response|negative regulation of DNA binding|negative regulation of endodeoxyribonuclease activity|negative regulation of oxidoreductase activity|positive regulation of apoptosis	extracellular region|immunological synapse|nucleus	protein homodimerization activity|serine-type endopeptidase activity			ovary(2)|pancreas(1)|skin(1)	4		Lung NSC(810;4.08e-05)|Breast(144;0.0433)|Prostate(74;0.183)				CACCATCATAGACAGAAAAGT	0.453													5	48	---	---	---	---	PASS
TMEM161B	153396	broad.mit.edu	37	5	87502852	87502852	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:87502852C>G	uc003kjc.2	-	6	717	c.592G>C	c.(592-594)GAA>CAA	p.E198Q	TMEM161B_uc011cty.1_Missense_Mutation_p.E187Q|TMEM161B_uc010jax.2_RNA|TMEM161B_uc011ctz.1_Missense_Mutation_p.E65Q|TMEM161B_uc011ctx.1_Missense_Mutation_p.E16Q	NM_153354	NP_699185	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	198						integral to membrane				skin(2)	2		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		TTACCTGTTTCAAGTCCAAAT	0.289													3	39	---	---	---	---	PASS
APC	324	broad.mit.edu	37	5	112175432	112175432	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112175432C>T	uc010jby.2	+	16	4521	c.4141C>T	c.(4141-4143)CCA>TCA	p.P1381S	APC_uc011cvt.1_Missense_Mutation_p.P1363S|APC_uc003kpz.3_Missense_Mutation_p.P1381S|APC_uc003kpy.3_Missense_Mutation_p.P1381S|APC_uc010jbz.2_Missense_Mutation_p.P1098S|APC_uc010jca.2_Missense_Mutation_p.P681S	NM_001127511	NP_001120983	P25054	APC_HUMAN	adenomatous polyposis coli	1381	Ser-rich.				canonical Wnt receptor signaling pathway|cell adhesion|cell cycle arrest|cell migration|cellular component disassembly involved in apoptosis|cytokinesis after mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|negative regulation of microtubule depolymerization|positive regulation of apoptosis|positive regulation of cell migration|positive regulation of pseudopodium assembly|protein complex assembly|regulation of attachment of spindle microtubules to kinetochore|response to DNA damage stimulus|tight junction assembly	adherens junction|APC-Axin-1-beta-catenin complex|Axin-APC-beta-catenin-GSK3B complex|beta-catenin destruction complex|centrosome|cytosol|kinetochore|lamellipodium|lateral plasma membrane|nucleus|ruffle membrane|tight junction	beta-catenin binding|gamma-catenin binding|microtubule plus-end binding|protein kinase binding|protein kinase regulator activity	p.P1381fs*4(1)|p.Y1376fs*41(1)|p.K1192fs*3(1)|p.?(1)		large_intestine(2123)|stomach(123)|soft_tissue(55)|small_intestine(34)|breast(26)|pancreas(25)|urinary_tract(20)|lung(19)|thyroid(18)|liver(13)|central_nervous_system(10)|ovary(9)|skin(7)|upper_aerodigestive_tract(6)|adrenal_gland(6)|bone(6)|NS(5)|prostate(4)|endometrium(3)|kidney(1)|oesophagus(1)|biliary_tract(1)	2515		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		TCAGGAGACCCCACTCATGTT	0.468		12	D|Mis|N|F|S		colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS	colorectal|pancreatic|desmoid|hepatoblastoma|glioma|other CNS			Hereditary_Desmoid_Disease|Familial_Adenomatous_Polyposis|Turcot_syndrome	TSP Lung(16;0.13)			7	97	---	---	---	---	PASS
ETF1	2107	broad.mit.edu	37	5	137878559	137878559	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137878559T>C	uc003ldc.3	-	2	214	c.49A>G	c.(49-51)ATC>GTC	p.I17V	ETF1_uc011cyv.1_5'Flank|ETF1_uc010jex.2_RNA|ETF1_uc003ldd.3_5'UTR	NM_004730	NP_004721	P62495	ERF1_HUMAN	eukaryotic translation termination factor 1	17					nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|protein methylation|regulation of translational termination	cytoplasm	protein binding|ribosome binding|translation release factor activity, codon specific			ovary(2)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			AGCTTCTTGATCTTCCAGATC	0.677													5	42	---	---	---	---	PASS
CTNNA1	1495	broad.mit.edu	37	5	138268318	138268318	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138268318G>A	uc003ldh.2	+	17	2445	c.2350G>A	c.(2350-2352)GCC>ACC	p.A784T	CTNNA1_uc011cyx.1_Missense_Mutation_p.A681T|CTNNA1_uc011cyy.1_Missense_Mutation_p.A661T|CTNNA1_uc003ldi.2_Missense_Mutation_p.A482T|CTNNA1_uc003ldj.2_Missense_Mutation_p.A784T|CTNNA1_uc003ldl.2_Missense_Mutation_p.A414T	NM_001903	NP_001894	P35221	CTNA1_HUMAN	catenin, alpha 1	784					adherens junction organization|apical junction assembly|cell adhesion|cellular response to indole-3-methanol|muscle cell differentiation|positive regulation of muscle cell differentiation	actin cytoskeleton|catenin complex|cytosol	beta-catenin binding|cadherin binding|gamma-catenin binding|structural molecule activity|vinculin binding			breast(6)|ovary(2)|large_intestine(2)|kidney(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCAACGCATCGCCCTCTACTG	0.587													9	45	---	---	---	---	PASS
PCDHB2	56133	broad.mit.edu	37	5	140475054	140475054	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140475054C>T	uc003lil.2	+	1	818	c.680C>T	c.(679-681)ACG>ATG	p.T227M	PCDHB2_uc003lim.1_Translation_Start_Site	NM_018936	NP_061759	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2 precursor	227	Extracellular (Potential).|Cadherin 2.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to plasma membrane	calcium ion binding			ovary(3)|upper_aerodigestive_tract(2)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGTCCGGCACGGCCCTGGTA	0.592													9	48	---	---	---	---	PASS
FCHSD1	89848	broad.mit.edu	37	5	141029088	141029088	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141029088G>A	uc003llk.2	-	5	300	c.249C>T	c.(247-249)TTC>TTT	p.F83F	FCHSD1_uc010jgg.2_5'Flank|FCHSD1_uc003llj.2_RNA	NM_033449	NP_258260	Q86WN1	FCSD1_HUMAN	FCH and double SH3 domains 1	83									FCHSD1/BRAF(2)	skin(2)|ovary(1)|central_nervous_system(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAGGCACCGAACACTGTCC	0.657													10	60	---	---	---	---	PASS
MED7	9443	broad.mit.edu	37	5	156565862	156565862	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156565862C>A	uc010jik.2	-	2	973	c.581G>T	c.(580-582)AGC>ATC	p.S194I	MED7_uc003lwm.3_Missense_Mutation_p.S194I	NM_001100816	NP_001094286	O43513	MED7_HUMAN	mediator complex subunit 7	194					regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex|transcription factor complex	protein binding|transcription coactivator activity				0	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			ACAATTGTTGCTATCATCAGC	0.378													16	147	---	---	---	---	PASS
WWC1	23286	broad.mit.edu	37	5	167858385	167858385	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:167858385T>G	uc003lzu.2	+	15	2309	c.2216T>G	c.(2215-2217)CTT>CGT	p.L739R	WWC1_uc003lzv.2_Missense_Mutation_p.L739R|WWC1_uc011den.1_Missense_Mutation_p.L739R|WWC1_uc003lzw.2_Missense_Mutation_p.L538R|WWC1_uc010jjf.1_Missense_Mutation_p.L6R	NM_015238	NP_056053	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1 isoform 3	739	C2.				cell migration|positive regulation of MAPKKK cascade|regulation of hippo signaling cascade|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|ruffle membrane	protein binding|transcription coactivator activity			ovary(2)|skin(2)|breast(1)	5	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		TATCCAGCCCTTCACCAGAAG	0.488													6	73	---	---	---	---	PASS
DSP	1832	broad.mit.edu	37	6	7585249	7585249	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7585249C>G	uc003mxp.1	+	24	8033	c.7754C>G	c.(7753-7755)TCC>TGC	p.S2585C	DSP_uc003mxq.1_Missense_Mutation_p.S1986C	NM_004415	NP_004406	P15924	DESP_HUMAN	desmoplakin isoform I	2585	Globular 2.				cellular component disassembly involved in apoptosis|keratinocyte differentiation|peptide cross-linking	cornified envelope|cytoplasm|desmosome	protein binding, bridging|structural constituent of cytoskeleton			central_nervous_system(6)|ovary(2)|skin(1)	9	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TTTAGCAGCTCCCGACATGAA	0.483													13	117	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25770291	25770291	+	Intron	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25770291C>A	uc003nfe.2	+						SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Intron	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),						phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						TCTTTGTCATCTAGGCCCCTG	0.438													13	184	---	---	---	---	PASS
SLC44A4	80736	broad.mit.edu	37	6	31833154	31833154	+	Silent	SNP	G	A	A	rs145759335		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31833154G>A	uc010jti.2	-	17	1764	c.1698C>T	c.(1696-1698)TAC>TAT	p.Y566Y	NEU1_uc003nxq.3_5'Flank|NEU1_uc010jtg.2_5'Flank|NEU1_uc003nxr.3_5'Flank|NEU1_uc010jth.2_5'Flank|NEU1_uc003nxs.3_5'Flank	NM_025257	NP_079533	Q53GD3	CTL4_HUMAN	choline transporter-like protein 4	566	Helical; (Potential).					integral to membrane|plasma membrane	choline transmembrane transporter activity			large_intestine(2)|ovary(1)|central_nervous_system(1)	4					Choline(DB00122)	AATTCTTCCCGTAGATGGCGA	0.552													13	180	---	---	---	---	PASS
BRPF3	27154	broad.mit.edu	37	6	36178207	36178207	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36178207G>A	uc003olv.3	+	6	2305	c.2081G>A	c.(2080-2082)CGG>CAG	p.R694Q	BRPF3_uc010jwb.2_Missense_Mutation_p.R694Q|BRPF3_uc011dtj.1_RNA|BRPF3_uc010jwc.2_RNA|BRPF3_uc011dtk.1_Missense_Mutation_p.R694Q	NM_015695	NP_056510	Q9ULD4	BRPF3_HUMAN	bromodomain and PHD finger containing, 3	694					histone H3 acetylation|platelet activation|platelet degranulation	cytosol|extracellular region|MOZ/MORF histone acetyltransferase complex	protein binding|zinc ion binding			ovary(1)|skin(1)	2						CGGCACGCCCGGCGGCAGGCA	0.532													5	115	---	---	---	---	PASS
MTCH1	23787	broad.mit.edu	37	6	36945884	36945884	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:36945884C>T	uc003ond.1	-	4	561	c.561G>A	c.(559-561)ATG>ATA	p.M187I	MTCH1_uc003onc.1_Missense_Mutation_p.M187I|MTCH1_uc010jwo.1_RNA|MTCH1_uc003one.3_Missense_Mutation_p.M187I|MTCH1_uc011dtt.1_Missense_Mutation_p.M19I	NM_014341	NP_055156	Q9NZJ7	MTCH1_HUMAN	mitochondrial carrier homolog 1	187					activation of caspase activity|neuronal ion channel clustering|positive regulation of apoptosis|regulation of signal transduction|transport	integral to membrane|mitochondrial inner membrane	protein binding				0						GGGAAGTCTTCATATCATCCT	0.498													5	107	---	---	---	---	PASS
RNF8	9025	broad.mit.edu	37	6	37344705	37344705	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:37344705G>T	uc003onq.3	+	6	1325	c.1132G>T	c.(1132-1134)GAG>TAG	p.E378*	RNF8_uc003onr.3_Nonsense_Mutation_p.E378*|RNF8_uc011dtx.1_Nonsense_Mutation_p.E310*	NM_003958	NP_003949	O76064	RNF8_HUMAN	ring finger protein 8 isoform 1	378					cell division|double-strand break repair|histone H2A ubiquitination|histone H2B ubiquitination|mitosis|positive regulation of DNA repair|response to ionizing radiation	midbody|nucleus|ubiquitin ligase complex	chromatin binding|histone binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1						CTTGCAGGAAGAGAAGGAGAA	0.403													4	67	---	---	---	---	PASS
TSPO2	222642	broad.mit.edu	37	6	41011317	41011317	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41011317G>T	uc003opj.2	+	3	496	c.195G>T	c.(193-195)TGG>TGT	p.W65C	UNC5CL_uc010jxe.1_Intron|TSPO2_uc003opk.2_Intron|TSPO2_uc011dub.1_Missense_Mutation_p.W65C	NM_001010873	NP_001010873	Q5TGU0	TSPO2_HUMAN	benzodiazapine receptor (peripheral)-like 1	65	Helical; (Potential).				transport	endoplasmic reticulum membrane|integral to membrane	cholesterol binding|receptor activity				0						ACCTGGTGTGGAAGGACCTGG	0.572													10	170	---	---	---	---	PASS
CUL9	23113	broad.mit.edu	37	6	43190375	43190375	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43190375G>A	uc003ouk.2	+	37	7103	c.7028G>A	c.(7027-7029)CGG>CAG	p.R2343Q	CUL9_uc003oul.2_Missense_Mutation_p.R2315Q|CUL9_uc010jyk.2_Missense_Mutation_p.R1495Q|CUL9_uc003oun.2_Missense_Mutation_p.R138Q	NM_015089	NP_055904	Q8IWT3	CUL9_HUMAN	p53-associated parkin-like cytoplasmic protein	2343					ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex|cytoplasm	ATP binding|ubiquitin protein ligase binding|zinc ion binding			ovary(5)|lung(3)|skin(2)|breast(1)|central_nervous_system(1)	12						GAGCAGGCTCGGAAGGTGGTA	0.617													8	32	---	---	---	---	PASS
GSTA5	221357	broad.mit.edu	37	6	52699019	52699019	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52699019A>G	uc003pba.1	-	5	404	c.334T>C	c.(334-336)TGT>CGT	p.C112R		NM_153699	NP_714543	Q7RTV2	GSTA5_HUMAN	glutathione S-transferase alpha 5	112	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.0912)				Glutathione(DB00143)	TCTGGTTGACATATGAGCAGA	0.378													6	239	---	---	---	---	PASS
KIAA1586	57691	broad.mit.edu	37	6	56918751	56918751	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56918751C>T	uc003pdj.2	+	4	1624	c.1454C>T	c.(1453-1455)GCG>GTG	p.A485V	KIAA1586_uc011dxm.1_Missense_Mutation_p.A458V	NM_020931	NP_065982	Q9HCI6	K1586_HUMAN	hypothetical protein LOC57691	485							nucleic acid binding				0	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			CCAAGATGGGCGGCATGTAGT	0.368													9	107	---	---	---	---	PASS
LGSN	51557	broad.mit.edu	37	6	64004921	64004921	+	Silent	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:64004921A>G	uc003peh.2	-	2	94	c.60T>C	c.(58-60)ACT>ACC	p.T20T	LGSN_uc003pei.2_Silent_p.T20T|LGSN_uc003pej.1_Silent_p.T20T	NM_016571	NP_057655	Q5TDP6	LGSN_HUMAN	lengsin, lens protein with glutamine synthetase	20					glutamine biosynthetic process		glutamate-ammonia ligase activity			skin(2)	2					L-Glutamic Acid(DB00142)	TGTTGGCTTCAGTCTCATTGC	0.353													9	149	---	---	---	---	PASS
SMAP1	60682	broad.mit.edu	37	6	71567858	71567858	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:71567858G>A	uc003pfr.2	+	10	1443	c.1195G>A	c.(1195-1197)GTG>ATG	p.V399M	SMAP1_uc003pfs.2_Missense_Mutation_p.V372M|SMAP1_uc010kao.2_Missense_Mutation_p.V372M|SMAP1_uc010kap.2_Missense_Mutation_p.V389M	NM_001044305	NP_001037770	Q8IYB5	SMAP1_HUMAN	stromal membrane-associated GTPase-activating	399					regulation of ARF GTPase activity	plasma membrane	ARF GTPase activator activity|zinc ion binding				0						AGGAGGAATGGTGGGACAAAT	0.547													9	83	---	---	---	---	PASS
SYNCRIP	10492	broad.mit.edu	37	6	86329009	86329009	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:86329009C>G	uc003pla.2	-	9	1676	c.1135G>C	c.(1135-1137)GAT>CAT	p.D379H	SYNCRIP_uc003pku.2_Missense_Mutation_p.D379H|SYNCRIP_uc003pkw.2_Missense_Mutation_p.D344H|SYNCRIP_uc003pky.2_Missense_Mutation_p.D281H|SYNCRIP_uc003pkv.2_Missense_Mutation_p.D379H|SYNCRIP_uc003pkx.2_Missense_Mutation_p.D227H|SYNCRIP_uc003pkz.2_Missense_Mutation_p.D344H	NM_006372	NP_006363	O60506	HNRPQ_HUMAN	synaptotagmin binding, cytoplasmic RNA	379	RRM 3.				CRD-mediated mRNA stabilization|interspecies interaction between organisms	catalytic step 2 spliceosome|CRD-mediated mRNA stability complex|endoplasmic reticulum|histone pre-mRNA 3'end processing complex|microsome|nucleoplasm	nucleotide binding|protein binding			ovary(2)	2		all_cancers(76;0.000137)|Acute lymphoblastic leukemia(125;3.66e-08)|Prostate(29;8.2e-07)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0297)		BRCA - Breast invasive adenocarcinoma(108;0.0389)		TCTCGCTCATCAAAATGAATG	0.338													18	155	---	---	---	---	PASS
ASCC3	10973	broad.mit.edu	37	6	101296201	101296201	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:101296201G>A	uc003pqk.2	-	4	953	c.624C>T	c.(622-624)TGC>TGT	p.C208C	ASCC3_uc011eai.1_Silent_p.C110C|ASCC3_uc003pql.2_Silent_p.C208C|ASCC3_uc010kcv.2_Silent_p.C208C	NM_006828	NP_006819	Q8N3C0	HELC1_HUMAN	activating signal cointegrator 1 complex subunit	208					regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton	ATP binding|ATP-dependent helicase activity|nucleic acid binding			ovary(5)|skin(1)	6		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		GTTCTGGGGTGCAAGCCTCCT	0.393													9	103	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106987389	106987389	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106987389G>A	uc003prh.2	+	7	4093	c.3606G>A	c.(3604-3606)ATG>ATA	p.M1202I	AIM1_uc003pri.2_5'Flank	NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1202	Beta/gamma crystallin 'Greek key' 4.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		TTGGATCCATGCGGCCTCTGA	0.433													9	124	---	---	---	---	PASS
PDSS2	57107	broad.mit.edu	37	6	107780271	107780271	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:107780271C>T	uc003prt.2	-	1	509	c.219G>A	c.(217-219)CTG>CTA	p.L73L	PDSS2_uc011eak.1_Intron|PDSS2_uc011eal.1_Silent_p.L73L|PDSS2_uc003pru.2_Silent_p.L73L|PDSS2_uc003prv.2_Silent_p.L73L	NM_020381	NP_065114	Q86YH6	DLP1_HUMAN	prenyl diphosphate synthase, subunit 2	73					isoprenoid biosynthetic process|ubiquinone biosynthetic process	mitochondrion	protein heterodimerization activity			ovary(2)	2	Breast(9;0.0127)	all_cancers(87;3.63e-05)|Acute lymphoblastic leukemia(125;2.86e-08)|all_hematologic(75;1.14e-06)|all_epithelial(87;0.0108)|Colorectal(196;0.156)|Lung NSC(302;0.211)	BRCA - Breast invasive adenocarcinoma(8;0.0101)|all cancers(7;0.243)	BRCA - Breast invasive adenocarcinoma(108;0.112)|OV - Ovarian serous cystadenocarcinoma(136;0.173)|all cancers(137;0.191)		GCTCGTCGCTCAGCAGGCAGC	0.622											OREG0017595	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	8	86	---	---	---	---	PASS
GJA1	2697	broad.mit.edu	37	6	121768435	121768435	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:121768435C>T	uc003pyr.2	+	2	692	c.442C>T	c.(442-444)CGA>TGA	p.R148*	GJA1_uc011ebo.1_Nonsense_Mutation_p.R49*|GJA1_uc011ebp.1_Intron	NM_000165	NP_000156	P17302	CXA1_HUMAN	connexin 43	148	Cytoplasmic (Potential).				cell-cell signaling|cellular membrane organization|gap junction assembly|heart development|muscle contraction|positive regulation of I-kappaB kinase/NF-kappaB cascade	connexon complex|Golgi-associated vesicle membrane|integral to plasma membrane|membrane raft	ion transmembrane transporter activity|signal transducer activity			ovary(2)	2				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	GGTGAAAATGCGAGGGGGGTT	0.453													7	114	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129591883	129591883	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129591883A>G	uc003qbn.2	+	17	2542	c.2437A>G	c.(2437-2439)ATC>GTC	p.I813V	LAMA2_uc003qbo.2_Missense_Mutation_p.I813V	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	813	Laminin EGF-like 7.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TCCACTCAATATCCCATCCAA	0.418													5	109	---	---	---	---	PASS
SLC35D3	340146	broad.mit.edu	37	6	137245683	137245683	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:137245683C>G	uc003qhe.2	+	2	1265	c.1100C>G	c.(1099-1101)CCC>CGC	p.P367R		NM_001008783	NP_001008783	Q5M8T2	S35D3_HUMAN	solute carrier family 35, member D3	367					carbohydrate transport	integral to membrane				ovary(1)|central_nervous_system(1)	2	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000136)|OV - Ovarian serous cystadenocarcinoma(155;0.00365)		AGGGGCAGCCCCCGAGGAGTC	0.637													4	47	---	---	---	---	PASS
TNFAIP3	7128	broad.mit.edu	37	6	138196093	138196093	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:138196093G>A	uc003qhr.2	+	3	473	c.407G>A	c.(406-408)CGC>CAC	p.R136H	TNFAIP3_uc003qhs.2_Missense_Mutation_p.R136H	NM_006290	NP_006281	P21580	TNAP3_HUMAN	tumor necrosis factor, alpha-induced protein 3	136	TRAF-binding.|OTU.				anti-apoptosis|apoptosis|B-1 B cell homeostasis|negative regulation of B cell activation|negative regulation of bone resorption|negative regulation of CD40 signaling pathway|negative regulation of endothelial cell apoptosis|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of inflammatory response|negative regulation of interleukin-2 production|negative regulation of interleukin-6 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of osteoclast proliferation|negative regulation of protein ubiquitination|negative regulation of smooth muscle cell proliferation|negative regulation of toll-like receptor 2 signaling pathway|negative regulation of toll-like receptor 3 signaling pathway|negative regulation of tumor necrosis factor production|negative regulation of type I interferon production|positive regulation of protein catabolic process|protein K48-linked ubiquitination|protein K63-linked deubiquitination|protein oligomerization|regulation of defense response to virus by host|regulation of germinal center formation|regulation of vascular wound healing|tolerance induction to lipopolysaccharide	centrosome|cytosol|nucleus	caspase inhibitor activity|DNA binding|protease binding|protein self-association|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-protein ligase activity|ubiquitin-specific protease activity|zinc ion binding	p.0?(22)|p.R136fs*3(1)		haematopoietic_and_lymphoid_tissue(133)|lung(3)|ovary(1)	137	Breast(32;0.135)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.000849)|OV - Ovarian serous cystadenocarcinoma(155;0.00468)		ACAGACACACGCAACTTTAAA	0.488			D|N|F		marginal zone B-cell lymphomas|Hodgkin's lymphoma|primary mediastinal B cell lymphoma								6	109	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146747715	146747715	+	Intron	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146747715C>G	uc010khw.1	+						GRM1_uc010khv.1_Missense_Mutation_p.S894W|GRM1_uc003qll.2_Missense_Mutation_p.S894W|GRM1_uc011edz.1_Missense_Mutation_p.S894W|GRM1_uc011eea.1_Intron	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha						synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CCAGAATTCTCGCCCACCAGC	0.493													3	22	---	---	---	---	PASS
LATS1	9113	broad.mit.edu	37	6	150004302	150004302	+	Silent	SNP	G	A	A	rs35163691		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150004302G>A	uc003qmu.1	-	4	2471	c.1923C>T	c.(1921-1923)TTC>TTT	p.F641F	LATS1_uc010kif.1_Silent_p.F536F|LATS1_uc003qmv.1_Silent_p.F641F|LATS1_uc003qmw.2_Silent_p.F641F|LATS1_uc010kig.1_Silent_p.F536F	NM_004690	NP_004681	O95835	LATS1_HUMAN	LATS homolog 1	641	Interaction with YAP1.				cell division|cytoplasmic sequestering of protein|G2/M transition of mitotic cell cycle|hippo signaling cascade|hormone-mediated signaling pathway|mitosis|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of cyclin-dependent protein kinase activity|positive regulation of peptidyl-serine phosphorylation|regulation of actin filament polymerization|sister chromatid segregation	microtubule organizing center|spindle pole	ATP binding|magnesium ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(5)|central_nervous_system(1)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GCTCCATAAAGAATTTAAATG	0.338													10	103	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151869452	151869452	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151869452G>A	uc003qol.2	+	5	691	c.602G>A	c.(601-603)CGC>CAC	p.R201H		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	201	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		AGAGACCTGCGCAAAGAAAAT	0.353													5	47	---	---	---	---	PASS
SYNJ2	8871	broad.mit.edu	37	6	158509790	158509790	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158509790G>A	uc003qqx.1	+	24	3517	c.3442G>A	c.(3442-3444)GCA>ACA	p.A1148T	SYNJ2_uc003qqw.1_Missense_Mutation_p.A1148T|SYNJ2_uc003qqy.1_Missense_Mutation_p.A861T|SYNJ2_uc003qqz.1_Missense_Mutation_p.A765T|SYNJ2_uc003qra.1_Missense_Mutation_p.A491T|SYNJ2_uc010kjp.1_Missense_Mutation_p.A31T	NM_003898	NP_003889	O15056	SYNJ2_HUMAN	synaptojanin 2	1148	Catalytic (By similarity).						nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(65;4.42e-18)|BRCA - Breast invasive adenocarcinoma(81;4.23e-05)		TCTACCAGGAGCACCTCAGCA	0.478													6	98	---	---	---	---	PASS
C7orf27	221927	broad.mit.edu	37	7	2578022	2578022	+	Missense_Mutation	SNP	G	A	A	rs140802292	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2578022G>A	uc003smi.2	-	14	2189	c.2147C>T	c.(2146-2148)GCG>GTG	p.A716V	C7orf27_uc003smh.3_Missense_Mutation_p.A148V	NM_152743	NP_689956	Q6PJG6	BRAT1_HUMAN	hypothetical protein LOC221927 precursor	716					response to ionizing radiation	nucleus	protein binding				0		Ovarian(82;0.0779)		OV - Ovarian serous cystadenocarcinoma(56;2.91e-14)		AGACTTCTGCGCCACAGGGCG	0.627													9	107	---	---	---	---	PASS
USP42	84132	broad.mit.edu	37	7	6189851	6189851	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:6189851C>T	uc011jwo.1	+	13	2147	c.2024C>T	c.(2023-2025)GCG>GTG	p.A675V	USP42_uc010kth.1_Missense_Mutation_p.A608V|USP42_uc011jwp.1_Missense_Mutation_p.A675V|USP42_uc011jwq.1_Missense_Mutation_p.A482V|USP42_uc011jwr.1_Missense_Mutation_p.A520V	NM_032172	NP_115548	Q9H9J4	UBP42_HUMAN	ubiquitin specific peptidase 42	675					cell differentiation|protein deubiquitination|spermatogenesis|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(2)|ovary(1)|pancreas(1)|breast(1)	5		Ovarian(82;0.0423)		UCEC - Uterine corpus endometrioid carcinoma (126;0.108)|OV - Ovarian serous cystadenocarcinoma(56;5.77e-14)		AACGGCCTAGCGCCTGATGGT	0.562													5	30	---	---	---	---	PASS
BLVRA	644	broad.mit.edu	37	7	43843318	43843318	+	Silent	SNP	C	T	T	rs146563888		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43843318C>T	uc003tir.2	+	7	587	c.504C>T	c.(502-504)AGC>AGT	p.S168S	BLVRA_uc010kxv.2_Silent_p.S168S	NM_000712	NP_000703	P53004	BIEA_HUMAN	biliverdin reductase A precursor	168					heme catabolic process	cytosol	biliverdin reductase activity|zinc ion binding			ovary(1)	1					NADH(DB00157)	CTGCATTCAGCGGCATCTCTC	0.522													9	286	---	---	---	---	PASS
MYO1G	64005	broad.mit.edu	37	7	45009408	45009408	+	Missense_Mutation	SNP	C	T	T	rs150434835	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:45009408C>T	uc003tmh.2	-	11	1543	c.1399G>A	c.(1399-1401)GTG>ATG	p.V467M	MYO1G_uc003tmf.2_5'Flank|MYO1G_uc003tmg.2_Missense_Mutation_p.V229M|MYO1G_uc010kym.2_Missense_Mutation_p.V352M|MYO1G_uc003tmi.1_Missense_Mutation_p.V379M|MYO1G_uc003tmj.2_Missense_Mutation_p.V229M	NM_033054	NP_149043	B0I1T2	MYO1G_HUMAN	myosin IG	467	Myosin head-like.					myosin complex|plasma membrane	actin binding|ATP binding|calmodulin binding|motor activity			breast(2)|ovary(1)|pancreas(1)	4						TCGTCCAGCACGGCCAGGATG	0.607													24	176	---	---	---	---	PASS
CLDN3	1365	broad.mit.edu	37	7	73184230	73184230	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73184230C>A	uc003tzg.3	-	1	371	c.150G>T	c.(148-150)TGG>TGT	p.W50C	RFC2_uc011kfa.1_Intron	NM_001306	NP_001297	O15551	CLD3_HUMAN	claudin 3	50	Extracellular (Potential).				response to hypoxia	integral to plasma membrane|tight junction	structural molecule activity|transmembrane receptor activity				0		Lung NSC(55;0.159)				CGCAGTTCATCCACAGGCCCT	0.647													5	59	---	---	---	---	PASS
HSPB1	3315	broad.mit.edu	37	7	75933484	75933484	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75933484C>T	uc003uew.2	+	3	767	c.612C>T	c.(610-612)GCC>GCT	p.A204A	HSPB1_uc010ldj.1_RNA|uc003uey.1_5'Flank	NM_001540	NP_001531	P04792	HSPB1_HUMAN	heat shock protein beta-1	204	Interaction with TGFB1I1 (By similarity).				anti-apoptosis|cell death|cellular component movement|mRNA metabolic process|positive regulation of interleukin-1 beta production|positive regulation of tumor necrosis factor biosynthetic process|regulation of I-kappaB kinase/NF-kappaB cascade|regulation of translational initiation|response to heat|response to unfolded protein|response to virus	cell surface|cytosol|nucleus|proteasome complex|spindle	identical protein binding|protein kinase C delta binding|protein kinase C inhibitor activity|ubiquitin binding				0						AGACTGCCGCCAAGTAAAGCC	0.582													3	12	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88964767	88964767	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88964767G>T	uc011khi.1	+	4	3009	c.2471G>T	c.(2470-2472)AGA>ATA	p.R824I		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	824						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			AAATCTACGAGAATCATCTAT	0.363										HNSCC(36;0.09)			6	86	---	---	---	---	PASS
KRIT1	889	broad.mit.edu	37	7	91855866	91855866	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91855866G>C	uc003ulq.1	-	9	1291	c.1120C>G	c.(1120-1122)CTC>GTC	p.L374V	KRIT1_uc010lev.1_Missense_Mutation_p.L167V|KRIT1_uc003ulr.1_Missense_Mutation_p.L374V|KRIT1_uc003uls.1_Missense_Mutation_p.L374V|KRIT1_uc003ult.1_Missense_Mutation_p.L326V|KRIT1_uc003ulu.1_Missense_Mutation_p.L374V|KRIT1_uc003ulv.1_Missense_Mutation_p.L374V	NM_194456	NP_919438	O00522	KRIT1_HUMAN	krev interaction trapped 1 isoform 1	374	ANK 3.				angiogenesis|cell redox homeostasis|negative regulation of angiogenesis|negative regulation of endothelial cell apoptosis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|regulation of establishment of cell polarity|small GTPase mediated signal transduction	cell-cell junction|cytoskeleton	protein binding|small GTPase regulator activity			ovary(2)|lung(1)	3	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGGTTTAGGAGAATCTGTACT	0.343									Familial_Cerebral_Cavernous_Angioma				14	108	---	---	---	---	PASS
ANKIB1	54467	broad.mit.edu	37	7	91980322	91980322	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91980322G>C	uc003ulw.2	+	8	1520	c.1144G>C	c.(1144-1146)GAT>CAT	p.D382H		NM_019004	NP_061877	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	382	RING-type 1; atypical.						protein binding|zinc ion binding			lung(1)	1	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCCTGCATATGATTGCTTCCA	0.358													3	24	---	---	---	---	PASS
ARPC1A	10552	broad.mit.edu	37	7	98955978	98955978	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98955978G>C	uc003upx.1	+	7	876	c.729G>C	c.(727-729)AAG>AAC	p.K243N	ARPC1A_uc010lfu.1_RNA|ARPC1A_uc003upy.1_Missense_Mutation_p.K229N|ARPC1A_uc011kit.1_RNA	NM_006409	NP_006400	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex subunit 1A	243					actin cytoskeleton organization|regulation of actin filament polymerization	actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			CGACTCTGAAGACAGAGTTCC	0.463													9	76	---	---	---	---	PASS
ACHE	43	broad.mit.edu	37	7	100490391	100490391	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100490391C>T	uc003uxd.2	-	2	1273	c.1117G>A	c.(1117-1119)GGG>AGG	p.G373R	ACHE_uc003uxe.2_Missense_Mutation_p.G373R|ACHE_uc003uxf.2_Missense_Mutation_p.G373R|ACHE_uc003uxg.2_Missense_Mutation_p.G373R|ACHE_uc003uxh.2_Intron|ACHE_uc003uxi.2_Missense_Mutation_p.G373R	NM_000665	NP_000656	P22303	ACES_HUMAN	acetylcholinesterase isoform E4-E6 precursor	373					acetylcholine catabolic process in synaptic cleft|amyloid precursor protein metabolic process|cell adhesion|cell proliferation|choline metabolic process|DNA replication|muscle organ development|neurotransmitter biosynthetic process|osteoblast development|positive regulation of protein secretion|regulation of axonogenesis|regulation of dendrite morphogenesis|response to wounding|synapse assembly	anchored to membrane|axon|basal lamina|cell junction|cell surface|dendrite|endoplasmic reticulum lumen|extracellular space|Golgi apparatus|neuromuscular junction|nucleus|perinuclear region of cytoplasm|postsynaptic membrane|presynaptic membrane|synaptic cleft	acetylcholine binding|acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|collagen binding|laminin-1 binding|protein homodimerization activity|serine hydrolase activity			skin(2)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Atropine(DB00572)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium bromide(DB00944)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tacrine(DB00382)|Tubocurarine(DB01199)	CCTGGGGCCCCGTAAACCAGA	0.582													4	26	---	---	---	---	PASS
MUC17	140453	broad.mit.edu	37	7	100686564	100686564	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100686564C>A	uc003uxp.1	+	3	11920	c.11867C>A	c.(11866-11868)GCA>GAA	p.A3956E	MUC17_uc010lho.1_RNA	NM_001040105	NP_001035194	Q685J3	MUC17_HUMAN	mucin 17 precursor	3956	Extracellular (Potential).					extracellular region|integral to membrane|plasma membrane	extracellular matrix constituent, lubricant activity			ovary(14)|skin(8)|breast(3)|lung(2)	27	Lung NSC(181;0.136)|all_lung(186;0.182)					GTCTTTCCTGCAACAACTGGT	0.443													28	147	---	---	---	---	PASS
TRIM56	81844	broad.mit.edu	37	7	100731660	100731660	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100731660C>A	uc003uxq.2	+	3	1298	c.1067C>A	c.(1066-1068)CCT>CAT	p.P356H	TRIM56_uc003uxr.2_Intron	NM_030961	NP_112223	Q9BRZ2	TRI56_HUMAN	tripartite motif-containing 56	356					defense response to virus|interferon-beta production|protein K63-linked ubiquitination|response to type I interferon	cytoplasm	ubiquitin-protein ligase activity|zinc ion binding	p.P356S(1)		kidney(1)|central_nervous_system(1)|skin(1)	3	Lung NSC(181;0.136)|all_lung(186;0.182)					GAGCTCCATCCTGGGCTCCTG	0.667													6	28	---	---	---	---	PASS
SLC26A5	375611	broad.mit.edu	37	7	103048320	103048320	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:103048320G>A	uc003vbz.2	-	8	1102	c.866C>T	c.(865-867)CCT>CTT	p.P289L	SLC26A5_uc003vbt.1_Missense_Mutation_p.P289L|SLC26A5_uc003vbu.1_Missense_Mutation_p.P289L|SLC26A5_uc003vbv.1_Missense_Mutation_p.P289L|SLC26A5_uc003vbw.2_RNA|SLC26A5_uc003vbx.2_Missense_Mutation_p.P289L|SLC26A5_uc003vby.2_RNA|SLC26A5_uc010liy.2_RNA	NM_198999	NP_945350	P58743	S26A5_HUMAN	prestin isoform a	289	Helical; Name=7; (Potential).				regulation of cell shape|sensory perception of sound	integral to membrane	secondary active sulfate transmembrane transporter activity			ovary(1)	1						TAAAGGAATAGGCGCCGGCAA	0.458													4	126	---	---	---	---	PASS
LAMB4	22798	broad.mit.edu	37	7	107743572	107743572	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107743572G>C	uc010ljo.1	-	10	1181	c.1097C>G	c.(1096-1098)ACT>AGT	p.T366S	LAMB4_uc003vey.2_Missense_Mutation_p.T366S	NM_007356	NP_031382	A4D0S4	LAMB4_HUMAN	laminin, beta 4 precursor	366	Laminin EGF-like 2.				cell adhesion	basement membrane				ovary(4)|breast(2)|large_intestine(1)|skin(1)	8						CTGCCCCTCAGTGTTGTGCTG	0.607													3	45	---	---	---	---	PASS
WDR91	29062	broad.mit.edu	37	7	134890753	134890753	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134890753C>G	uc003vsp.2	-	5	714	c.652G>C	c.(652-654)GAG>CAG	p.E218Q	WDR91_uc010lmq.2_5'UTR|WDR91_uc010lmr.2_RNA	NM_014149	NP_054868	A4D1P6	WDR91_HUMAN	WD repeat domain 91	218										breast(2)|ovary(1)|skin(1)	4						GCCTCTTCCTCTTCTGGCTGT	0.512													18	238	---	---	---	---	PASS
STRA8	346673	broad.mit.edu	37	7	134925438	134925438	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:134925438G>A	uc011kpx.1	+	2	228	c.228G>A	c.(226-228)GTG>GTA	p.V76V		NM_182489	NP_872295	Q7Z7C7	STRA8_HUMAN	STRA8	76					DNA replication|regulation of transcription, DNA-dependent	cytoplasm|nucleus					0						GGAAGACAGTGTACTCTCAGT	0.607													9	143	---	---	---	---	PASS
ZNF282	8427	broad.mit.edu	37	7	148895705	148895705	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148895705G>A	uc003wfm.2	+	2	551	c.446G>A	c.(445-447)AGC>AAC	p.S149N	ZNF282_uc011kun.1_Missense_Mutation_p.S149N|ZNF282_uc003wfn.2_Missense_Mutation_p.S89N|ZNF282_uc003wfo.2_Missense_Mutation_p.S89N	NM_003575	NP_003566	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	149					negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CACATGGAGAGCAAGTGGGCC	0.627													6	121	---	---	---	---	PASS
AGAP3	116988	broad.mit.edu	37	7	150784082	150784082	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150784082C>A	uc003wjg.1	+	1	257	c.254C>A	c.(253-255)GCC>GAC	p.A85D	AGAP3_uc003wje.1_Intron|AGAP3_uc003wjf.1_Missense_Mutation_p.A85D|AGAP3_uc010lpy.1_Missense_Mutation_p.A85D	NM_031946	NP_114152	Q96P47	AGAP3_HUMAN	centaurin, gamma 3 isoform a	49					regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm|membrane	ARF GTPase activator activity|GTP binding|GTPase activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3						AATATCTACGCCATCTACGAC	0.667													3	43	---	---	---	---	PASS
DLGAP2	9228	broad.mit.edu	37	8	1626520	1626520	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1626520G>A	uc003wpl.2	+	9	2286	c.2189G>A	c.(2188-2190)AGC>AAC	p.S730N	DLGAP2_uc003wpm.2_Missense_Mutation_p.S716N	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	809					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		TCCGAGCCCAGCACCCCCACC	0.622													16	72	---	---	---	---	PASS
CTSB	1508	broad.mit.edu	37	8	11702626	11702626	+	3'UTR	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11702626A>G	uc003wum.2	-	12					CTSB_uc003wul.2_3'UTR|CTSB_uc011kxl.1_3'UTR|CTSB_uc003wun.2_3'UTR|CTSB_uc003wuo.2_3'UTR|CTSB_uc003wup.2_3'UTR|CTSB_uc003wuq.2_3'UTR|CTSB_uc010lsc.2_3'UTR|CTSB_uc003wur.2_3'UTR|CTSB_uc003wus.1_3'UTR|CTSB_uc003wut.1_3'UTR|CTSB_uc003wuu.2_3'UTR	NM_147780	NP_680090	P07858	CATB_HUMAN	cathepsin B preproprotein						proteolysis|regulation of apoptosis|regulation of catalytic activity	lysosome|melanosome	cysteine-type endopeptidase activity				0	all_epithelial(15;0.205)		STAD - Stomach adenocarcinoma(15;0.00546)	COAD - Colon adenocarcinoma(149;0.184)		CGACAGGCCCACGGCAGATTA	0.473													8	58	---	---	---	---	PASS
PEBP4	157310	broad.mit.edu	37	8	22785204	22785204	+	Silent	SNP	G	T	T	rs11547477		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22785204G>T	uc003xcn.1	-	2	116	c.24C>A	c.(22-24)GTC>GTA	p.V8V		NM_144962	NP_659399	Q96S96	PEBP4_HUMAN	phosphatidylethanolamine-binding protein 4	8						lysosome				ovary(1)|large_intestine(1)|breast(1)|skin(1)	4		Prostate(55;0.0453)|Breast(100;0.103)		Colorectal(74;0.0434)|COAD - Colon adenocarcinoma(73;0.124)		GTGCTGCTGTGACCAGCCTCA	0.597													14	97	---	---	---	---	PASS
WHSC1L1	54904	broad.mit.edu	37	8	38187141	38187141	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38187141C>G	uc003xli.2	-	6	1854	c.1336G>C	c.(1336-1338)GAA>CAA	p.E446Q	WHSC1L1_uc011lbm.1_Missense_Mutation_p.E446Q|WHSC1L1_uc010lwe.2_Missense_Mutation_p.E446Q|WHSC1L1_uc003xlj.2_Missense_Mutation_p.E446Q	NM_023034	NP_075447	Q9BZ95	NSD3_HUMAN	WHSC1L1 protein isoform long	446					cell differentiation|cell growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome	histone-lysine N-methyltransferase activity|zinc ion binding			breast(1)	1	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			CTCCGAATTTCAGTACTTGAG	0.507			T	NUP98	AML								17	138	---	---	---	---	PASS
CHRNA6	8973	broad.mit.edu	37	8	42611901	42611901	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42611901G>T	uc003xpj.2	-	5	487	c.441C>A	c.(439-441)ACC>ACA	p.T147T	CHRNA6_uc011lcw.1_Silent_p.T132T	NM_004198	NP_004189	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6	147	Extracellular.					cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	acetylcholine receptor activity|nicotinic acetylcholine-activated cation-selective channel activity				0	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)			GTGGAGTCCAGGTTATCATGC	0.408													8	207	---	---	---	---	PASS
FNTA	2339	broad.mit.edu	37	8	42927429	42927429	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42927429G>T	uc003xps.2	+	5	660	c.612G>T	c.(610-612)CAG>CAT	p.Q204H	FNTA_uc003xpt.2_Missense_Mutation_p.Q113H|FNTA_uc003xpu.2_Missense_Mutation_p.Q137H|FNTA_uc003xpv.2_RNA	NM_002027	NP_002018	P49354	FNTA_HUMAN	farnesyltransferase, CAAX box, alpha isoform a	204	PFTA 3.				cellular component disassembly involved in apoptosis|positive regulation of deacetylase activity|positive regulation of tubulin deacetylation|protein farnesylation|protein geranylgeranylation|transforming growth factor beta receptor signaling pathway	cytosol|microtubule associated complex	alpha-tubulin binding|CAAX-protein geranylgeranyltransferase activity|microtubule binding|protein farnesyltransferase activity			ovary(1)	1	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			ATGCCTGGCAGCATCGACAAT	0.343													5	131	---	---	---	---	PASS
PRKDC	5591	broad.mit.edu	37	8	48761740	48761740	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:48761740C>A	uc003xqi.2	-	55	7312	c.7255G>T	c.(7255-7257)GAC>TAC	p.D2419Y	PRKDC_uc003xqj.2_Missense_Mutation_p.D2419Y|PRKDC_uc011ldh.1_Intron	NM_006904	NP_008835	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic	2419					cellular response to insulin stimulus|double-strand break repair via nonhomologous end joining|peptidyl-serine phosphorylation|positive regulation of transcription from RNA polymerase II promoter	DNA-dependent protein kinase-DNA ligase 4 complex|transcription factor complex	ATP binding|DNA binding|DNA-dependent protein kinase activity|transcription factor binding			lung(12)|central_nervous_system(9)|ovary(6)|skin(4)|large_intestine(3)	34		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)				TGAACGAAGTCCTTGCTCTTT	0.458								NHEJ					10	140	---	---	---	---	PASS
OPRK1	4986	broad.mit.edu	37	8	54142388	54142388	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54142388G>A	uc003xrh.1	-	3	987	c.612C>T	c.(610-612)GAC>GAT	p.D204D	OPRK1_uc003xri.1_Silent_p.D204D|OPRK1_uc010lyc.1_Silent_p.D115D	NM_000912	NP_000903	P41145	OPRK_HUMAN	opioid receptor, kappa 1	204	Extracellular (Potential).				behavior|immune response|inhibition of adenylate cyclase activity by G-protein signaling pathway|sensory perception|synaptic transmission|viral genome replication	integral to plasma membrane	kappa-opioid receptor activity|protein binding			ovary(1)|skin(1)	2		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Buprenorphine(DB00921)|Butorphanol(DB00611)|Cocaine(DB00907)|Codeine(DB00318)|Dezocine(DB01209)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Meperidine(DB00454)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Propoxyphene(DB00647)|Tramadol(DB00193)	TGACATCGACGTCTGGAGGAG	0.423													11	51	---	---	---	---	PASS
NCOA2	10499	broad.mit.edu	37	8	71068967	71068967	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:71068967C>T	uc003xyn.1	-	11	1795	c.1633G>A	c.(1633-1635)GGG>AGG	p.G545R		NM_006540	NP_006531	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	545					cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	histone acetyltransferase activity|ligand-dependent nuclear receptor binding|nuclear hormone receptor binding|signal transducer activity		PAX3/NCOA2(4)	lung(6)|soft_tissue(4)|breast(2)|skin(2)|ovary(1)|pancreas(1)	16	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			AATGAGACCCCGTGCCCCTCG	0.512			T	RUNXBP2	AML								9	165	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618552	77618552	+	Silent	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618552C>A	uc003yav.2	+	2	2616	c.2229C>A	c.(2227-2229)GCC>GCA	p.A743A	ZFHX4_uc003yat.1_Silent_p.A743A|ZFHX4_uc003yau.1_Silent_p.A743A|ZFHX4_uc003yaw.1_Silent_p.A743A	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	743						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCCACTCTGCCCCAGCCCCCA	0.522										HNSCC(33;0.089)			6	42	---	---	---	---	PASS
UBR5	51366	broad.mit.edu	37	8	103274250	103274250	+	Silent	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:103274250A>G	uc003ykr.1	-	55	7768	c.7735T>C	c.(7735-7737)TTG>CTG	p.L2579L	UBR5_uc003yks.1_Silent_p.L2578L|UBR5_uc003ykq.2_Silent_p.L90L	NM_015902	NP_056986	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin	2579	HECT.				cell proliferation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of protein import into nucleus, translocation|progesterone receptor signaling pathway|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to DNA damage stimulus	nucleus|soluble fraction	protein binding|RNA binding|ubiquitin-ubiquitin ligase activity|zinc ion binding			lung(16)|ovary(4)|large_intestine(3)|breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|kidney(1)	28	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			AGTTGCCGCAAACTCTCATAC	0.378													10	124	---	---	---	---	PASS
C8orf85	441376	broad.mit.edu	37	8	117954881	117954881	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117954881G>C	uc003yof.2	+	2	428	c.409G>C	c.(409-411)GAA>CAA	p.E137Q		NM_001025357	NP_001020528	Q4LEZ3	AARD_HUMAN	alanine and arginine-rich domain-containing	137											0						AAAGGAGTATGAACTGGAAAT	0.353													13	80	---	---	---	---	PASS
MTSS1	9788	broad.mit.edu	37	8	125565386	125565386	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125565386G>T	uc003yrk.2	-	14	2649	c.2115C>A	c.(2113-2115)GCC>GCA	p.A705A	NDUFB9_uc011lim.1_Intron|MTSS1_uc003yrh.2_Silent_p.A354A|MTSS1_uc011lin.1_Silent_p.A479A|MTSS1_uc011lio.1_Silent_p.A595A|MTSS1_uc003yri.2_Silent_p.A423A|MTSS1_uc003yrj.2_Silent_p.A680A|MTSS1_uc003yrl.2_Silent_p.A709A	NM_014751	NP_055566	O43312	MTSS1_HUMAN	metastasis suppressor 1	705	Pro-rich.				actin cytoskeleton organization|cell adhesion|cellular component movement|filopodium assembly|transmembrane receptor protein tyrosine kinase signaling pathway	actin cytoskeleton|endocytic vesicle|ruffle	actin monomer binding|cytoskeletal adaptor activity|receptor binding|SH3 domain binding			ovary(1)	1	Ovarian(258;0.00438)|all_neural(195;0.00459)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			GGGAGACAGTGGCACTTGGGG	0.587													33	456	---	---	---	---	PASS
PUF60	22827	broad.mit.edu	37	8	144898903	144898903	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144898903C>G	uc003yzs.2	-	12	1531	c.1467G>C	c.(1465-1467)AAG>AAC	p.K489N	SCRIB_uc003yzo.1_5'Flank|SCRIB_uc003yzp.1_5'Flank|PUF60_uc003yzr.2_Missense_Mutation_p.K429N|PUF60_uc003yzt.2_Missense_Mutation_p.K472N|PUF60_uc003yzq.2_Missense_Mutation_p.K446N	NM_078480	NP_510965	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa isoform a	489	RRM 3; atypical.|Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptosis|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|transcription, DNA-dependent	nucleus|ribonucleoprotein complex	DNA binding|nucleotide binding|protein binding|RNA binding				0	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			CGGCCCCGAACTTGCCACACT	0.537													19	184	---	---	---	---	PASS
ZNF16	7564	broad.mit.edu	37	8	146156294	146156294	+	Missense_Mutation	SNP	G	A	A	rs145120548		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:146156294G>A	uc003zet.2	-	4	2066	c.1879C>T	c.(1879-1881)CGC>TGC	p.R627C	ZNF16_uc003zeu.2_Missense_Mutation_p.R627C	NM_001029976	NP_001025147	P17020	ZNF16_HUMAN	zinc finger protein 16	627					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(5)	5	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		TTGTAGGGGCGCTCGCCCGTG	0.532													13	115	---	---	---	---	PASS
TOPORS	10210	broad.mit.edu	37	9	32542684	32542684	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:32542684C>A	uc003zrb.2	-	3	2006	c.1839G>T	c.(1837-1839)AAG>AAT	p.K613N	TOPORS_uc003zrc.2_Missense_Mutation_p.K546N	NM_005802	NP_005793	Q9NS56	TOPRS_HUMAN	topoisomerase I binding, arginine/serine-rich	613	Arg-rich.|Interaction with TOP1.|Interaction with SUMO1.|Interaction with p53/TP53.				DNA damage response, signal transduction resulting in induction of apoptosis|maintenance of protein location in nucleus|proteasomal ubiquitin-dependent protein catabolic process|protein sumoylation|transcription, DNA-dependent	nuclear speck|PML body	antigen binding|DNA binding|DNA topoisomerase I binding|SUMO ligase activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(3)|upper_aerodigestive_tract(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.0018)		TTCTATGATTCTTCTGATCAT	0.403													8	367	---	---	---	---	PASS
GBA2	57704	broad.mit.edu	37	9	35739307	35739307	+	Intron	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35739307C>A	uc003zxw.2	-						GBA2_uc003zxx.1_5'Flank|GBA2_uc011lpb.1_Intron|GBA2_uc011lpc.1_Intron|GBA2_uc011lpd.1_Intron|GBA2_uc003zxy.1_Intron	NM_020944	NP_065995	Q9HCG7	GBA2_HUMAN	bile acid beta-glucosidase						bile acid metabolic process|glucosylceramide catabolic process|O-glycoside catabolic process	integral to membrane|microsome|plasma membrane|smooth endoplasmic reticulum	beta-glucosidase activity|glucosylceramidase activity			ovary(3)|skin(1)	4	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AAAAGGGATCCTCACCCATGT	0.502													4	32	---	---	---	---	PASS
PIP5K1B	8395	broad.mit.edu	37	9	71538235	71538235	+	Silent	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71538235T>C	uc004agu.2	+	12	1439	c.1134T>C	c.(1132-1134)CAT>CAC	p.H378H	PIP5K1B_uc011lrq.1_Silent_p.H378H|PIP5K1B_uc004agv.2_RNA	NM_003558	NP_003549	O14986	PI51B_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type	378	PIPK.					endomembrane system|membrane|uropod	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|protein binding			stomach(1)	1				Lung(182;0.133)		TTTCTGTTCATAGACCAAGCT	0.338													13	171	---	---	---	---	PASS
TJP2	9414	broad.mit.edu	37	9	71849460	71849460	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:71849460G>A	uc004ahe.2	+	12	1977	c.1777G>A	c.(1777-1779)GAT>AAT	p.D593N	TJP2_uc011lrs.1_Missense_Mutation_p.D570N|TJP2_uc011lrt.1_Missense_Mutation_p.D570N|TJP2_uc004ahd.2_Missense_Mutation_p.D593N|TJP2_uc004ahf.2_Missense_Mutation_p.D593N|TJP2_uc011lru.1_Missense_Mutation_p.D597N|TJP2_uc011lrv.1_Missense_Mutation_p.D615N	NM_004817	NP_004808	Q9UDY2	ZO2_HUMAN	tight junction protein 2 (zona occludens 2)	593					cellular component disassembly involved in apoptosis	adherens junction|cytoplasm|nucleus|tight junction	guanylate kinase activity|protein binding				0						GAGCCGAGCCGATGGTGAGCA	0.488													5	56	---	---	---	---	PASS
TRPM3	80036	broad.mit.edu	37	9	73206004	73206004	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:73206004T>C	uc004aid.2	-	21	3374	c.3130A>G	c.(3130-3132)ATC>GTC	p.I1044V	TRPM3_uc004ahu.2_Missense_Mutation_p.I874V|TRPM3_uc004ahv.2_Missense_Mutation_p.I846V|TRPM3_uc004ahw.2_Missense_Mutation_p.I916V|TRPM3_uc004ahx.2_Missense_Mutation_p.I903V|TRPM3_uc004ahy.2_Missense_Mutation_p.I906V|TRPM3_uc004ahz.2_Missense_Mutation_p.I893V|TRPM3_uc004aia.2_Missense_Mutation_p.I891V|TRPM3_uc004aib.2_Missense_Mutation_p.I881V|TRPM3_uc004aic.2_Missense_Mutation_p.I1044V	NM_001007471	NP_001007472	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel,	1069	Extracellular (Potential).					integral to membrane	calcium channel activity			ovary(3)|pancreas(2)|central_nervous_system(2)|skin(2)	9						ATGTAGAAGATGTTCTTGGCC	0.448													7	201	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	9	78953262	78953262	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:78953262G>A	uc004akc.1	+	7	1260	c.1040G>A	c.(1039-1041)CGC>CAC	p.R347H						Homo sapiens cDNA FLJ16215 fis, clone CTONG2025610, moderately similar to PC6B.																		TTTCTGCTCCGCTCCAAAGGA	0.547													5	32	---	---	---	---	PASS
MURC	347273	broad.mit.edu	37	9	103348485	103348485	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:103348485G>A	uc004bba.2	+	2	937	c.847G>A	c.(847-849)GCT>ACT	p.A283T		NM_001018116	NP_001018126	Q5BKX8	MURC_HUMAN	muscle-related coiled-coil protein	283					cell differentiation|muscle organ development|transcription, DNA-dependent					ovary(1)	1		Acute lymphoblastic leukemia(62;0.0461)				CCGAACAGTGGCTGAAGGTGA	0.512													5	172	---	---	---	---	PASS
ZNF189	7743	broad.mit.edu	37	9	104170627	104170627	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104170627G>C	uc004bbh.1	+	3	853	c.577G>C	c.(577-579)GAA>CAA	p.E193Q	ZNF189_uc004bbg.1_Missense_Mutation_p.E151Q|ZNF189_uc004bbi.1_Missense_Mutation_p.E179Q|ZNF189_uc011lvk.1_Missense_Mutation_p.E178Q	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	193	C2H2-type 2.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				ATTTGTTATTGAACATCAGAG	0.403													6	114	---	---	---	---	PASS
ZNF189	7743	broad.mit.edu	37	9	104171282	104171282	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104171282G>C	uc004bbh.1	+	3	1508	c.1232G>C	c.(1231-1233)AGA>ACA	p.R411T	ZNF189_uc004bbg.1_Missense_Mutation_p.R369T|ZNF189_uc004bbi.1_Missense_Mutation_p.R397T|ZNF189_uc011lvk.1_Missense_Mutation_p.R396T	NM_003452	NP_003443	O75820	ZN189_HUMAN	zinc finger protein 189 isoform 1	411	C2H2-type 10.				negative regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)|skin(2)|kidney(1)|central_nervous_system(1)	6		Acute lymphoblastic leukemia(62;0.0559)				GCCTTTAGTAGAAGCTCAGGT	0.408													8	94	---	---	---	---	PASS
OR13C4	138804	broad.mit.edu	37	9	107288712	107288712	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107288712G>T	uc011lvn.1	-	1	779	c.779C>A	c.(778-780)GCA>GAA	p.A260E		NM_001001919	NP_001001919	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C,	260	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CTTAGGTTTTGCATACATAAA	0.468													15	147	---	---	---	---	PASS
ACTL7B	10880	broad.mit.edu	37	9	111617236	111617236	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111617236G>A	uc004bdi.2	-	1	1040	c.975C>T	c.(973-975)CGC>CGT	p.R325R		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	325						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1						TGTCCTGGCAGCGGCCCAGGC	0.677													6	132	---	---	---	---	PASS
WDR31	114987	broad.mit.edu	37	9	116082628	116082628	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116082628G>A	uc004bhe.2	-						WDR31_uc004bhc.2_Intron|WDR31_uc004bhd.2_Intron|WDR31_uc004bhf.2_Intron	NM_001012361	NP_001012361	Q8NA23	WDR31_HUMAN	WD repeat domain 31 isoform 1												0						ACCTCACACAGTCTCCTACCG	0.522													5	121	---	---	---	---	PASS
CDK5RAP2	55755	broad.mit.edu	37	9	123169494	123169494	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123169494G>C	uc004bkf.2	-	32	4940	c.4759C>G	c.(4759-4761)CCT>GCT	p.P1587A	CDK5RAP2_uc010mvi.2_Missense_Mutation_p.P596A|CDK5RAP2_uc004bke.2_Missense_Mutation_p.P872A|CDK5RAP2_uc004bkg.2_Intron|CDK5RAP2_uc011lxw.1_Missense_Mutation_p.P852A|CDK5RAP2_uc011lxx.1_RNA|CDK5RAP2_uc011lxy.1_RNA|CDK5RAP2_uc011lxz.1_Missense_Mutation_p.P852A|CDK5RAP2_uc011lya.1_Missense_Mutation_p.P852A|CDK5RAP2_uc004bkh.1_Missense_Mutation_p.P1357A|CDK5RAP2_uc004bki.2_3'UTR	NM_018249	NP_060719	Q96SN8	CK5P2_HUMAN	CDK5 regulatory subunit associated protein 2	1587					brain development|centrosome organization|chromosome segregation|G2/M transition of mitotic cell cycle|microtubule bundle formation|negative regulation of centriole replication|positive regulation of transcription, DNA-dependent|regulation of neuron differentiation|regulation of spindle checkpoint	cytosol|Golgi apparatus|microtubule|pericentriolar material|perinuclear region of cytoplasm|spindle pole	calmodulin binding|microtubule binding|neuronal Cdc2-like kinase binding|transcription regulatory region DNA binding			ovary(2)|lung(1)|skin(1)	4						TCCCTGAAAGGATCCTGCCCC	0.562													11	113	---	---	---	---	PASS
DDX31	64794	broad.mit.edu	37	9	135538025	135538025	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135538025G>T	uc004cbq.1	-	2	600	c.448C>A	c.(448-450)CGG>AGG	p.R150R	DDX31_uc010mzu.1_Silent_p.R150R|DDX31_uc004cbr.1_Silent_p.R150R|DDX31_uc004cbs.1_Silent_p.R150R	NM_022779	NP_073616	Q9H8H2	DDX31_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 31	150						nucleolus	ATP binding|ATP-dependent helicase activity|RNA binding			central_nervous_system(1)	1				OV - Ovarian serous cystadenocarcinoma(145;2.67e-06)|Epithelial(140;7.61e-05)		TCGTTCCTCCGTTTCGCTGGG	0.438													4	158	---	---	---	---	PASS
SURF6	6838	broad.mit.edu	37	9	136198994	136198994	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136198994G>A	uc004cdb.3	-	5	875	c.797C>T	c.(796-798)GCG>GTG	p.A266V		NM_006753	NP_006744	O75683	SURF6_HUMAN	surfeit 6	266						granular component	DNA binding|RNA binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		CTTCATCTTCGCCTCCAGCTC	0.667													6	187	---	---	---	---	PASS
C9orf7	11094	broad.mit.edu	37	9	136333154	136333154	+	Intron	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136333154C>T	uc011mdg.1	+						C9orf7_uc004cec.2_Intron|C9orf7_uc011mdh.1_Intron|C9orf7_uc011mdi.1_Intron|C9orf7_uc010nan.2_Intron	NM_017586	NP_060056	Q9UGQ2	FLOWR_HUMAN	hypothetical protein LOC11094 isoform a							integral to membrane					0				GBM - Glioblastoma multiforme(294;5.7e-39)|all cancers(34;1.83e-23)|OV - Ovarian serous cystadenocarcinoma(145;8.94e-08)|Epithelial(140;1.01e-06)		GCAAAAAGTGCGTCTGCCAGG	0.627													4	50	---	---	---	---	PASS
VAV2	7410	broad.mit.edu	37	9	136635533	136635533	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136635533G>A	uc004ces.2	-	27	2360	c.2314C>T	c.(2314-2316)CGT>TGT	p.R772C	VAV2_uc004cer.2_Missense_Mutation_p.R762C|VAV2_uc004cet.1_Missense_Mutation_p.R311C	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform	772					angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		GAGGCCGAACGTTCCCGGGAC	0.657													7	97	---	---	---	---	PASS
INPP5E	56623	broad.mit.edu	37	9	139329253	139329253	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139329253C>T	uc004cho.2	-	2	1260	c.875G>A	c.(874-876)CGC>CAC	p.R292H	INPP5E_uc010nbm.2_Missense_Mutation_p.R292H	NM_019892	NP_063945	Q9NRR6	INP5E_HUMAN	inositol polyphosphate-5-phosphatase E	292						cilium axoneme|cytoskeleton|Golgi cisterna membrane	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity			skin(1)	1		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.36e-06)|Epithelial(140;1.4e-05)		TGGGAAGTAGCGGGCCAGCTC	0.577													3	32	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140708873	140708873	+	Intron	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140708873C>G	uc011mfc.1	+						EHMT1_uc004coe.2_5'Flank	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		CCCGGCGCCTCTCTTCTCAGT	0.592													9	154	---	---	---	---	PASS
PRKCQ	5588	broad.mit.edu	37	10	6504316	6504316	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6504316G>A	uc001ijj.1	-	14	1532	c.1457C>T	c.(1456-1458)GCT>GTT	p.A486V	PRKCQ_uc009xim.1_Missense_Mutation_p.A486V|PRKCQ_uc001iji.1_Missense_Mutation_p.A519V|PRKCQ_uc009xin.1_Missense_Mutation_p.A450V|PRKCQ_uc010qax.1_Missense_Mutation_p.A361V	NM_006257	NP_006248	Q04759	KPCT_HUMAN	protein kinase C, theta	486	Protein kinase.				axon guidance|cellular component disassembly involved in apoptosis|intracellular signal transduction|membrane protein ectodomain proteolysis|platelet activation|regulation of cell growth|T cell receptor signaling pathway	cytosol	ATP binding|metal ion binding|protein binding|protein kinase C activity			ovary(3)|lung(2)|large_intestine(1)	6						AATGATTTCAGCAGCATAAAA	0.413													9	87	---	---	---	---	PASS
SUV39H2	79723	broad.mit.edu	37	10	14939354	14939354	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14939354C>A	uc001inh.2	+	2	563	c.507C>A	c.(505-507)TGC>TGA	p.C169*	SUV39H2_uc001ing.2_Intron|SUV39H2_uc001ini.2_Nonsense_Mutation_p.C169*|SUV39H2_uc001inj.2_Nonsense_Mutation_p.C169*	NM_024670	NP_078946	Q9H5I1	SUV92_HUMAN	suppressor of variegation 3-9 homolog 2	229	Pre-SET.				cell cycle|cell differentiation|chromatin assembly or disassembly|chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromatin|chromosome, centromeric region|nucleus	histone methyltransferase activity (H3-K9 specific)|protein binding|zinc ion binding			breast(2)|ovary(1)	3						TCTATGAATGCAACTCAAGGT	0.413													13	125	---	---	---	---	PASS
MKI67	4288	broad.mit.edu	37	10	129910038	129910038	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129910038C>T	uc001lke.2	-	11	2326	c.2131G>A	c.(2131-2133)GCA>ACA	p.A711T	MKI67_uc001lkf.2_Missense_Mutation_p.A351T|MKI67_uc009yav.1_Missense_Mutation_p.A286T|MKI67_uc009yaw.1_Intron	NM_002417	NP_002408	P46013	KI67_HUMAN	antigen identified by monoclonal antibody Ki-67	711					cell proliferation	nucleolus	ATP binding|protein C-terminus binding			ovary(4)|central_nervous_system(2)|skin(1)	7		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGAGAGTTTGCGTGGCCTGTA	0.433													10	121	---	---	---	---	PASS
TUBGCP2	10844	broad.mit.edu	37	10	135106715	135106715	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135106715C>T	uc001lmg.1	-	7	1209	c.852G>A	c.(850-852)GAG>GAA	p.E284E	TUBGCP2_uc001lmf.1_5'Flank|TUBGCP2_uc010qvc.1_Silent_p.E312E|TUBGCP2_uc009ybk.1_Silent_p.E284E|TUBGCP2_uc010qvd.1_Silent_p.E154E|TUBGCP2_uc001lmh.1_RNA	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	284					G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		CCTGCCCGTACTCGAAGGAAG	0.557													8	96	---	---	---	---	PASS
OR52I2	143502	broad.mit.edu	37	11	4608686	4608686	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4608686C>T	uc010qyh.1	+	1	644	c.644C>T	c.(643-645)GCC>GTC	p.A215V		NM_001005170	NP_001005170	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I,	215	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		ATAGCTTTGGCCAGGTTAGCA	0.512													23	291	---	---	---	---	PASS
OR51V1	283111	broad.mit.edu	37	11	5221786	5221786	+	Silent	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5221786A>G	uc010qyz.1	-	1	145	c.145T>C	c.(145-147)TTG>CTG	p.L49L		NM_001004760	NP_001004760	Q9H2C8	O51V1_HUMAN	olfactory receptor, family 51, subfamily V,	49	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.83e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAATTGCCCAAAAGCACCATG	0.502													6	133	---	---	---	---	PASS
EIF3F	8665	broad.mit.edu	37	11	8016879	8016879	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8016879G>C	uc001mfw.2	+	7	994	c.961G>C	c.(961-963)GAT>CAT	p.D321H	EIF3F_uc010rbj.1_Missense_Mutation_p.D172H	NM_003754	NP_003745	O00303	EIF3F_HUMAN	eukaryotic translation initiation factor 3,	321						cytosol|eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			lung(1)	1				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AATAGTTCCCGATGACTTTGA	0.493													23	263	---	---	---	---	PASS
PIK3C2A	5286	broad.mit.edu	37	11	17153558	17153558	+	Silent	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17153558T>C	uc001mmq.3	-	11	2202	c.2136A>G	c.(2134-2136)TCA>TCG	p.S712S	PIK3C2A_uc009ygu.1_Intron|PIK3C2A_uc010rcw.1_Silent_p.S332S|PIK3C2A_uc001mmr.3_Intron	NM_002645	NP_002636	O00443	P3C2A_HUMAN	phosphoinositide-3-kinase, class 2 alpha	712					cell communication|phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling	clathrin-coated vesicle|Golgi apparatus|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity			lung(4)|central_nervous_system(4)|stomach(1)|ovary(1)	10					Phosphatidylserine(DB00144)	TGTGAGACAGTGAACATATCA	0.279													7	140	---	---	---	---	PASS
RCN1	5954	broad.mit.edu	37	11	32118747	32118747	+	Silent	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32118747G>C	uc010reb.1	+	2	578	c.312G>C	c.(310-312)CTG>CTC	p.L104L	RCN1_uc010rea.1_Silent_p.L53L|RCN1_uc001mtk.2_5'UTR	NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor	104	EF-hand 1.					endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					CTGAGGAGCTGAAAACCTGGA	0.413													4	33	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32956815	32956815	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32956815C>T	uc001mty.2	+	4	3891	c.3624C>T	c.(3622-3624)GGC>GGT	p.G1208G	QSER1_uc001mtz.1_Silent_p.G969G|QSER1_uc001mua.2_Silent_p.G713G	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1208										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					CTGAAACTGGCGGTAACAGTC	0.428													6	168	---	---	---	---	PASS
GYLTL1B	120071	broad.mit.edu	37	11	45950326	45950326	+	Missense_Mutation	SNP	G	A	A	rs140560270		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:45950326G>A	uc001nbv.1	+	14	2207	c.2096G>A	c.(2095-2097)CGC>CAC	p.R699H	GYLTL1B_uc001nbw.1_Missense_Mutation_p.R668H|GYLTL1B_uc001nbx.1_Missense_Mutation_p.R699H|GYLTL1B_uc001nby.1_Missense_Mutation_p.R382H|GYLTL1B_uc001nbz.1_Missense_Mutation_p.A48T	NM_152312	NP_689525	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	699	Lumenal (Potential).				muscle cell homeostasis	Golgi membrane|integral to membrane	transferase activity, transferring glycosyl groups			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.226)		GACTTGTCCCGCCACCATGGG	0.672													5	127	---	---	---	---	PASS
LRP4	4038	broad.mit.edu	37	11	46920945	46920945	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46920945C>A	uc001ndn.3	-	5	686	c.540G>T	c.(538-540)GAG>GAT	p.E180D	LRP4_uc009ylh.1_Missense_Mutation_p.E131D	NM_002334	NP_002325	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein	180	Extracellular (Potential).|LDL-receptor class A 4.				endocytosis|negative regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane	calcium ion binding|receptor activity			skin(2)|upper_aerodigestive_tract(1)|ovary(1)	4				Lung(87;0.159)		CACGACAGTTCTCCTCATCGG	0.572													11	209	---	---	---	---	PASS
FAM111B	374393	broad.mit.edu	37	11	58893237	58893237	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58893237C>T	uc001nnl.2	+	4	1910	c.1667C>T	c.(1666-1668)GCG>GTG	p.A556V	FAM111B_uc001nnm.2_Missense_Mutation_p.A526V|FAM111B_uc010rko.1_Missense_Mutation_p.A526V	NM_198947	NP_945185	Q6SJ93	F111B_HUMAN	hypothetical protein LOC374393 isoform a	556							catalytic activity			ovary(2)	2						AATGGAAATGCGTTTCCTCCA	0.383													13	148	---	---	---	---	PASS
DDB1	1642	broad.mit.edu	37	11	61067618	61067618	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61067618C>T	uc001nrc.3	-	27	3639	c.3413G>A	c.(3412-3414)CGG>CAG	p.R1138Q		NM_001923	NP_001914	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1	1138	Interaction with CDT1 and CUL4A.				cell cycle checkpoint|interspecies interaction between organisms|nucleotide-excision repair, DNA damage removal|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	Cul4A-RING ubiquitin ligase complex|Cul4B-RING ubiquitin ligase complex|cytoplasm|nucleoplasm	damaged DNA binding|protein binding			ovary(2)|lung(1)|central_nervous_system(1)	4						CTAATGGATCCGAGTTAGCTC	0.597								NER					11	51	---	---	---	---	PASS
SDHAF2	54949	broad.mit.edu	37	11	61205522	61205522	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61205522A>G	uc001nrt.2	+	3	329	c.307A>G	c.(307-309)AAC>GAC	p.N103D		NM_017841	NP_060311	Q9NX18	SDHF2_HUMAN	succinate dehydrogenase complex assembly factor	103					mitochondrial electron transport, succinate to ubiquinone|protein-FAD linkage	mitochondrion	protein binding			ovary(2)	2						AAAGCAGCTGAACCTCTATGA	0.393									Familial_Paragangliomas				8	145	---	---	---	---	PASS
INCENP	3619	broad.mit.edu	37	11	61897526	61897526	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61897526G>C	uc001nsw.1	+	4	729	c.527G>C	c.(526-528)CGC>CCC	p.R176P	INCENP_uc009ynv.2_Missense_Mutation_p.R176P|INCENP_uc009ynw.1_Missense_Mutation_p.R176P|INCENP_uc001nsx.1_Missense_Mutation_p.R176P	NM_001040694	NP_001035784	Q9NQS7	INCE_HUMAN	inner centromere protein antigens 135/155kDa	176					chromosome segregation|cytokinesis|mitotic prometaphase	centromeric heterochromatin|condensed chromosome kinetochore|cytosol|microtubule|spindle	protein binding			lung(1)	1						ATCAGTGAGCGCCAGAATGCT	0.617													13	74	---	---	---	---	PASS
EFEMP2	30008	broad.mit.edu	37	11	65635415	65635415	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65635415T>C	uc001ofy.3	-	10	1281	c.1087A>G	c.(1087-1089)ATC>GTC	p.I363V	EFEMP2_uc001ofz.2_RNA|EFEMP2_uc001oga.2_Missense_Mutation_p.I363V	NM_016938	NP_058634	O95967	FBLN4_HUMAN	EGF-containing fibulin-like extracellular matrix	363					blood coagulation	basement membrane|membrane	calcium ion binding|extracellular matrix structural constituent|protein binding|transmembrane receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(159;0.169)		GTCGCCTGGATCTGGAACACG	0.582													22	161	---	---	---	---	PASS
KDM4D	55693	broad.mit.edu	37	11	94731334	94731334	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:94731334G>A	uc001pfe.2	+	3	1630	c.798G>A	c.(796-798)CAG>CAA	p.Q266Q		NM_018039	NP_060509	Q6B0I6	KDM4D_HUMAN	jumonji domain containing 2D	266	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						GCATAACTCAGGAGGCTGGAG	0.547													5	82	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107923528	107923528	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107923528G>A	uc001pjv.2	+	5	1220	c.553G>A	c.(553-555)GTT>ATT	p.V185I	CUL5_uc001pju.2_RNA	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing	185					cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		AGAATCCTATGGTATGTTCTG	0.343													6	51	---	---	---	---	PASS
KCNJ5	3762	broad.mit.edu	37	11	128781427	128781427	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128781427C>T	uc001qet.2	+	2	573	c.259C>T	c.(259-261)CGC>TGC	p.R87C	KCNJ5_uc009zck.2_Missense_Mutation_p.R87C|KCNJ5_uc001qew.2_Missense_Mutation_p.R87C	NM_000890	NP_000881	P48544	IRK5_HUMAN	potassium inwardly-rectifying channel J5	87	Helical; Name=M1; (By similarity).				synaptic transmission	voltage-gated potassium channel complex	G-protein activated inward rectifier potassium channel activity|protein binding			skin(1)	1	all_hematologic(175;0.0641)	Lung NSC(97;0.00038)|all_lung(97;0.000817)|Breast(109;0.00123)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0059)|LUSC - Lung squamous cell carcinoma(976;0.021)|Lung(977;0.0215)	Glibenclamide(DB01016)	CCTCAAGTGGCGCTTCAACTT	0.552													10	149	---	---	---	---	PASS
WNK1	65125	broad.mit.edu	37	12	1005492	1005492	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1005492C>T	uc001qio.3	+	24	6346	c.5839C>T	c.(5839-5841)CAG>TAG	p.Q1947*	WNK1_uc001qip.3_Nonsense_Mutation_p.Q1699*|WNK1_uc001qir.3_Nonsense_Mutation_p.Q1120*	NM_018979	NP_061852	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1947					intracellular protein kinase cascade|ion transport|neuron development	cytoplasm	ATP binding|protein binding|protein kinase inhibitor activity|protein serine/threonine kinase activity			stomach(6)|breast(6)|ovary(5)|lung(4)|large_intestine(1)|central_nervous_system(1)	23	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			TGGACGTTTTCAGGTGACAAC	0.488													5	114	---	---	---	---	PASS
ADIPOR2	79602	broad.mit.edu	37	12	1889659	1889659	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1889659G>T	uc001qjm.2	+	5	703	c.506G>T	c.(505-507)CGC>CTC	p.R169L	ADIPOR2_uc001qjn.2_Missense_Mutation_p.R169L	NM_024551	NP_078827	Q86V24	ADR2_HUMAN	adiponectin receptor 2	169	Extracellular (Potential).				fatty acid oxidation|hormone-mediated signaling pathway	integral to membrane	hormone binding|receptor activity				0	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.000382)			TATATGTTTCGCCCAAATATC	0.403													32	275	---	---	---	---	PASS
LTBR	4055	broad.mit.edu	37	12	6498000	6498000	+	Intron	SNP	G	T	T	rs116609490	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6498000G>T	uc001qny.1	+						LTBR_uc010sfc.1_Intron|LTBR_uc001qnz.1_Intron	NM_002342	NP_002333	P36941	TNR3_HUMAN	lymphotoxin beta receptor precursor						apoptosis|cellular response to mechanical stimulus|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	protein binding|receptor activity			lung(2)	2						AGGTAATGGCGGGGGCTGAGA	0.552													18	95	---	---	---	---	PASS
CD163L1	283316	broad.mit.edu	37	12	7510085	7510085	+	Intron	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7510085G>C	uc001qsy.2	-						CD163L1_uc010sge.1_Intron	NM_174941	NP_777601	Q9NR16	C163B_HUMAN	scavenger receptor cysteine-rich type 1							extracellular region|integral to membrane|plasma membrane	scavenger receptor activity			ovary(8)|skin(2)|central_nervous_system(1)	11						GGTGTCATCTGAAAGAAAGGC	0.438													9	68	---	---	---	---	PASS
A2M	2	broad.mit.edu	37	12	9265040	9265040	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9265040C>A	uc001qvk.1	-	3	476	c.363G>T	c.(361-363)ATG>ATT	p.M121I	A2M_uc009zgk.1_Intron	NM_000014	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin precursor	121					blood coagulation, intrinsic pathway|negative regulation of complement activation, lectin pathway|platelet activation|platelet degranulation|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|extracellular space|platelet alpha granule lumen	enzyme binding|GTPase activator activity|interleukin-1 binding|interleukin-8 binding|serine-type endopeptidase inhibitor activity|tumor necrosis factor binding			central_nervous_system(4)|skin(1)	5					Bacitracin(DB00626)|Becaplermin(DB00102)	CGTTCTTAACCATCACTGTGG	0.448													7	60	---	---	---	---	PASS
GSG1	83445	broad.mit.edu	37	12	13243687	13243687	+	Silent	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13243687T>C	uc001rbn.2	-	2	287	c.114A>G	c.(112-114)TCA>TCG	p.S38S	GSG1_uc001rbj.2_Silent_p.S25S|GSG1_uc001rbk.2_Silent_p.S25S|GSG1_uc001rbl.2_Silent_p.S25S|GSG1_uc001rbm.2_Silent_p.S25S|GSG1_uc001rbo.2_Silent_p.S38S|GSG1_uc001rbp.2_Silent_p.S38S|GSG1_uc001rbq.1_Silent_p.S38S	NM_001080555	NP_001074024	Q2KHT4	GSG1_HUMAN	germ cell associated 1 isoform 4	25	Helical; (Potential).					endoplasmic reticulum membrane|integral to membrane					0		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		AGAAGCTGAGTGATAGCATGC	0.552													6	113	---	---	---	---	PASS
ADCY6	112	broad.mit.edu	37	12	49170131	49170131	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49170131C>T	uc001rsh.3	-	7	2198	c.1538G>A	c.(1537-1539)CGC>CAC	p.R513H	ADCY6_uc001rsj.3_Missense_Mutation_p.R513H|ADCY6_uc001rsi.3_Missense_Mutation_p.R513H|ADCY6_uc010slw.1_5'Flank	NM_015270	NP_056085	O43306	ADCY6_HUMAN	adenylate cyclase 6 isoform a	513	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	integral to membrane	ATP binding|metal ion binding				0						GATGTGGATGCGGCTGTATGT	0.667													4	81	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49421039	49421039	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49421039G>A	uc001rta.3	-	48	14710	c.14710C>T	c.(14710-14712)CGA>TGA	p.R4904*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	4904					chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						GAGAGCTGTCGCACATCCAGA	0.612			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			6	152	---	---	---	---	PASS
ITGA7	3679	broad.mit.edu	37	12	56078904	56078904	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56078904G>T	uc001shh.2	-	25	3584	c.3364C>A	c.(3364-3366)CTG>ATG	p.L1122M	ITGA7_uc001shg.2_Missense_Mutation_p.L1118M|ITGA7_uc010sps.1_Missense_Mutation_p.L1025M|ITGA7_uc001shf.2_3'UTR|ITGA7_uc009znw.2_Missense_Mutation_p.L365M|ITGA7_uc009znx.2_Missense_Mutation_p.L999M	NM_001144996	NP_001138468	Q13683	ITA7_HUMAN	integrin alpha 7 isoform 1 precursor	1162	3 X 4 AA repeats of D-X-H-P.|Cytoplasmic (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development|regulation of cell shape	integrin complex	receptor activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5						TCAGCAGCCAGGATGGGGTGT	0.682													6	40	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57593149	57593149	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57593149C>T	uc001snd.2	+	61	10297	c.9831C>T	c.(9829-9831)GAC>GAT	p.D3277D		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3277	LDL-receptor class B 30.|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GGCCCATGGACCTGCATGTCT	0.627													6	154	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57594475	57594475	+	Intron	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57594475C>G	uc001snd.2	+							NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1						aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GCCTCCCTCTCTGGCAGCTGA	0.617													6	69	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94965417	94965417	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94965417G>C	uc001tdj.2	-	4	1346	c.1228C>G	c.(1228-1230)CTC>GTC	p.L410V	TMCC3_uc001tdi.2_Missense_Mutation_p.L379V	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	410						integral to membrane				ovary(1)|skin(1)	2						CTCCCCAGGAGAACTTTAGCA	0.527													8	114	---	---	---	---	PASS
TMCC3	57458	broad.mit.edu	37	12	94965482	94965482	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94965482G>A	uc001tdj.2	-	4	1281	c.1163C>T	c.(1162-1164)TCT>TTT	p.S388F	TMCC3_uc001tdi.2_Missense_Mutation_p.S357F	NM_020698	NP_065749	Q9ULS5	TMCC3_HUMAN	transmembrane and coiled-coil domain family 3	388	Potential.					integral to membrane				ovary(1)|skin(1)	2						CTCCAGCTTAGAAATGCGAGT	0.552													9	75	---	---	---	---	PASS
TDG	6996	broad.mit.edu	37	12	104378655	104378655	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104378655C>T	uc001tkg.2	+	8	1144	c.921C>T	c.(919-921)GAC>GAT	p.D307D	TDG_uc009zuk.2_Silent_p.D303D|TDG_uc010swi.1_Silent_p.D164D|TDG_uc010swj.1_Silent_p.D95D	NM_003211	NP_003202	Q13569	TDG_HUMAN	thymine-DNA glycosylase	307					depyrimidination|mismatch repair	nucleoplasm	damaged DNA binding|mismatched DNA binding|protein binding|pyrimidine-specific mismatch base pair DNA N-glycosylase activity			ovary(3)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(302;0.00114)		GAAATATGGACGTTCAAGAGG	0.363								BER_DNA_glycosylases					6	119	---	---	---	---	PASS
KIAA1033	23325	broad.mit.edu	37	12	105536924	105536924	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105536924G>A	uc001tld.2	+	20	2000	c.1913G>A	c.(1912-1914)CGC>CAC	p.R638H	KIAA1033_uc010swr.1_Missense_Mutation_p.R639H|KIAA1033_uc010sws.1_Missense_Mutation_p.R450H	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325	638					endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						AGTGCTTTGCGCGACTGTGTA	0.333													3	45	---	---	---	---	PASS
ANAPC5	51433	broad.mit.edu	37	12	121746350	121746350	+	Missense_Mutation	SNP	G	A	A	rs115934510	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121746350G>A	uc001uag.2	-	17	2323	c.2201C>T	c.(2200-2202)GCG>GTG	p.A734V	ANAPC5_uc010szu.1_Missense_Mutation_p.A400V|ANAPC5_uc001uae.2_Missense_Mutation_p.A298V|ANAPC5_uc010szv.1_Missense_Mutation_p.A336V|ANAPC5_uc001uaf.2_RNA|ANAPC5_uc001uah.2_Missense_Mutation_p.A622V	NM_016237	NP_057321	Q9UJX4	APC5_HUMAN	anaphase-promoting complex subunit 5 isoform a	734					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			skin(3)|breast(2)|kidney(1)	6	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GAAGAGCATCGCACACCGGTT	0.562													18	159	---	---	---	---	PASS
KDM2B	84678	broad.mit.edu	37	12	122016728	122016728	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122016728C>T	uc001uat.2	-	2	354	c.250G>A	c.(250-252)GTG>ATG	p.V84M	KDM2B_uc001uas.2_Missense_Mutation_p.V53M|KDM2B_uc001uau.2_Translation_Start_Site|KDM2B_uc001uav.3_Missense_Mutation_p.V84M	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform	84					embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						ATGGCGTGCACGAAGTCCCCC	0.697													6	62	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124915343	124915343	+	Intron	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124915343C>T	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron|NCOR2_uc001ugk.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CCTGGGAGAGCGCAGGGGGCA	0.537													14	105	---	---	---	---	PASS
ANKLE2	23141	broad.mit.edu	37	12	133331494	133331494	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133331494C>A	uc001ukx.2	-	2	474	c.407G>T	c.(406-408)AGG>ATG	p.R136M	ANKLE2_uc001uky.3_Missense_Mutation_p.R74M	NM_015114	NP_055929	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	136						cytoplasm|integral to membrane|nuclear envelope					0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		CTTCAAAATCCTTTGTGGGTC	0.498													7	89	---	---	---	---	PASS
SIAH3	283514	broad.mit.edu	37	13	46425674	46425674	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46425674C>A	uc001vap.2	-	1	173	c.91G>T	c.(91-93)GCC>TCC	p.A31S		NM_198849	NP_942146	Q8IW03	SIAH3_HUMAN	seven in absentia homolog 3	31					multicellular organismal development|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding			ovary(1)|skin(1)	2						AGTTGCCCGGCAGCGGAGAAA	0.483													4	120	---	---	---	---	PASS
KPNA3	3839	broad.mit.edu	37	13	50280449	50280449	+	Silent	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:50280449T>C	uc001vdj.2	-	13	1507	c.1092A>G	c.(1090-1092)GTA>GTG	p.V364V		NM_002267	NP_002258	O00505	IMA3_HUMAN	karyopherin alpha 3	364	ARM 8.|NLS binding site (minor) (By similarity).				interspecies interaction between organisms|NLS-bearing substrate import into nucleus|protein complex assembly	cytoplasm|nuclear pore	nuclear localization sequence binding|protein transporter activity				0		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		CAGCATCTATTACAGCTTGAA	0.358													4	75	---	---	---	---	PASS
SLC15A1	6564	broad.mit.edu	37	13	99364785	99364785	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:99364785C>A	uc001vno.2	-	10	854	c.777G>T	c.(775-777)GAG>GAT	p.E259D		NM_005073	NP_005064	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide	259	Cytoplasmic (Potential).				digestion|protein transport	integral to plasma membrane|membrane fraction	peptide:hydrogen symporter activity			ovary(1)	1	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Cefadroxil(DB01140)|Ceftibuten(DB01415)|Cyclacillin(DB01000)	CCAGCCAGTGCTCCCTCTTGG	0.418													15	109	---	---	---	---	PASS
C14orf183	196913	broad.mit.edu	37	14	50550460	50550460	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50550460C>G	uc010tqk.1	-	5	884	c.884G>C	c.(883-885)TGG>TCG	p.W295S		NM_001014830	NP_001014830	Q8WXQ3	CN183_HUMAN	hypothetical protein LOC196913	295											0						GACTGGCATCCATTCGCTGCT	0.552													13	112	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53619565	53619565	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53619565G>A	uc001xai.2	-	1	482	c.252C>T	c.(250-252)CTC>CTT	p.L84L	DDHD1_uc001xaj.2_Silent_p.L84L|DDHD1_uc001xah.2_Silent_p.L84L	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	84					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					TCTCGTCACTGAGGCAGGGGT	0.701													5	31	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64898281	64898281	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64898281C>T	uc001xhb.2	+	14	1730	c.1343C>T	c.(1342-1344)GCC>GTC	p.A448V	MTHFD1_uc010aqe.2_Missense_Mutation_p.A484V|MTHFD1_uc010aqf.2_Missense_Mutation_p.A504V	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	448	Formyltetrahydrofolate synthetase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GACATCCATGCCATCACTGCA	0.463													4	74	---	---	---	---	PASS
PAPOLA	10914	broad.mit.edu	37	14	97018866	97018866	+	Missense_Mutation	SNP	A	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:97018866A>C	uc001yfq.2	+	17	1781	c.1571A>C	c.(1570-1572)GAC>GCC	p.D524A	PAPOLA_uc001yfr.2_Missense_Mutation_p.D524A|PAPOLA_uc010twv.1_Missense_Mutation_p.D524A|PAPOLA_uc010avp.2_Missense_Mutation_p.D274A	NM_032632	NP_116021	P51003	PAPOA_HUMAN	poly(A) polymerase alpha	524	Ser/Thr-rich.	Interaction with RNA (By similarity).			mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	cytoplasm|nucleoplasm	ATP binding|magnesium ion binding|manganese ion binding|polynucleotide adenylyltransferase activity|RNA binding				0		all_cancers(154;0.0555)|all_epithelial(191;0.149)|Melanoma(154;0.155)		COAD - Colon adenocarcinoma(157;0.213)		AGCAGCCTCGACTTGTCTATG	0.413													6	101	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28493709	28493709	+	Nonsense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28493709G>C	uc001zbj.2	-	21	3330	c.3224C>G	c.(3223-3225)TCA>TGA	p.S1075*		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	1075					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		AGAAATATCTGAGGTCTGACC	0.393													3	51	---	---	---	---	PASS
ZFP106	64397	broad.mit.edu	37	15	42710039	42710039	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:42710039G>A	uc001zpw.2	-	18	5894	c.5559C>T	c.(5557-5559)TGC>TGT	p.C1853C	ZFP106_uc001zpu.2_Silent_p.C951C|ZFP106_uc001zpv.2_Silent_p.C1038C|ZFP106_uc001zpx.2_Silent_p.C1081C	NM_022473	NP_071918	Q9H2Y7	ZF106_HUMAN	zinc finger protein 106 homolog	1853						nucleolus	zinc ion binding			central_nervous_system(2)|ovary(1)	3		all_cancers(109;1.63e-12)|all_epithelial(112;3.97e-11)|Lung NSC(122;2.04e-07)|all_lung(180;8.31e-07)|Melanoma(134;0.091)		GBM - Glioblastoma multiforme(94;8.6e-07)		AAAAAGCATCGCAGTTCTTCC	0.463													8	90	---	---	---	---	PASS
SPG11	80208	broad.mit.edu	37	15	44920876	44920876	+	Silent	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44920876G>C	uc001ztx.2	-	10	2089	c.2058C>G	c.(2056-2058)CTC>CTG	p.L686L	SPG11_uc010ueh.1_Silent_p.L686L|SPG11_uc010uei.1_Silent_p.L686L|SPG11_uc001zua.1_Silent_p.L686L	NM_025137	NP_079413	Q96JI7	SPTCS_HUMAN	spatacsin isoform 1	686	Extracellular (Potential).				cell death	cytosol|integral to membrane|nucleus	protein binding			ovary(4)|skin(1)	5		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		CCTCAAAGCTGAGTTTCTTCC	0.338													11	157	---	---	---	---	PASS
C15orf33	196951	broad.mit.edu	37	15	49882125	49882125	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49882125G>A	uc001zxl.2	-	4	479	c.185C>T	c.(184-186)TCA>TTA	p.S62L	C15orf33_uc001zxm.2_Missense_Mutation_p.S62L	NM_152647	NP_689860	Q96M60	CO033_HUMAN	hypothetical protein LOC196951	62										ovary(1)	1		all_lung(180;0.00187)		all cancers(107;3.45e-08)|GBM - Glioblastoma multiforme(94;0.000124)		TGAAACAAATGAACTATCTTC	0.308													10	102	---	---	---	---	PASS
IGDCC4	57722	broad.mit.edu	37	15	65682603	65682603	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65682603G>A	uc002aou.1	-	13	2508	c.2298C>T	c.(2296-2298)ATC>ATT	p.I766I	IGDCC4_uc002aot.1_Silent_p.I354I	NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member	766	Fibronectin type-III 4.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3						ACCGAAGCCAGATGGATGTGG	0.552													7	89	---	---	---	---	PASS
SMAD3	4088	broad.mit.edu	37	15	67358513	67358513	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:67358513C>T	uc002aqj.2	+	1	319	c.21C>T	c.(19-21)TTC>TTT	p.F7F		NM_005902	NP_005893	P84022	SMAD3_HUMAN	mothers against decapentaplegic homolog 3	7					activation of caspase activity|cell cycle arrest|cell-cell junction organization|evasion of host defenses by virus|immune response|induction of apoptosis|negative regulation of cell growth|negative regulation of mitotic cell cycle|negative regulation of protein catabolic process|negative regulation of protein phosphorylation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of catenin import into nucleus|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription factor import into nucleus|positive regulation of transcription from RNA polymerase II promoter|primary miRNA processing|protein stabilization|regulation of transforming growth factor beta receptor signaling pathway|regulation of transforming growth factor-beta2 production|response to hypoxia|SMAD protein complex assembly|transforming growth factor beta receptor signaling pathway|transport|wound healing	cytosol|nuclear inner membrane|receptor complex	beta-catenin binding|co-SMAD binding|metal ion binding|protein homodimerization activity|protein kinase binding|R-SMAD binding|RNA polymerase II activating transcription factor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transforming growth factor beta receptor binding|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity|ubiquitin protein ligase binding			large_intestine(2)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)	5				Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(7;0.125)		TCCTGCCTTTCACTCCCCCGA	0.537													3	13	---	---	---	---	PASS
RASGRF1	5923	broad.mit.edu	37	15	79339219	79339219	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79339219C>T	uc002beq.2	-	5	1122	c.747G>A	c.(745-747)CTG>CTA	p.L249L	RASGRF1_uc002bep.2_Silent_p.L249L|RASGRF1_uc010blm.1_Silent_p.L171L|RASGRF1_uc002ber.3_Silent_p.L249L	NM_002891	NP_002882	Q13972	RGRF1_HUMAN	Ras protein-specific guanine	249	DH.				activation of Rac GTPase activity|apoptosis|induction of apoptosis by extracellular signals|long-term memory|nerve growth factor receptor signaling pathway|neuron projection development|regulation of Rac protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol|growth cone|plasma membrane|synaptosome	Rho guanyl-nucleotide exchange factor activity			skin(4)|ovary(1)|central_nervous_system(1)	6						CCTCAGCCTCCAGCATGCTGA	0.602													11	104	---	---	---	---	PASS
ZNF592	9640	broad.mit.edu	37	15	85327190	85327190	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85327190G>T	uc002bld.2	+	4	1620	c.1284G>T	c.(1282-1284)GTG>GTT	p.V428V	ZNF592_uc010upb.1_RNA	NM_014630	NP_055445	Q92610	ZN592_HUMAN	zinc finger protein 592	428					cell death|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(4)|skin(2)	6			BRCA - Breast invasive adenocarcinoma(143;0.0587)			AGGTGCCTGTGGAAGAGCACT	0.597													6	84	---	---	---	---	PASS
TTC23	64927	broad.mit.edu	37	15	99758814	99758814	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:99758814C>T	uc002bur.2	-	7	1091	c.560G>A	c.(559-561)CGG>CAG	p.R187Q	TTC23_uc002bus.2_Missense_Mutation_p.R187Q|TTC23_uc002but.2_Missense_Mutation_p.R187Q|TTC23_uc002buu.2_Missense_Mutation_p.R187Q|TTC23_uc002buv.2_Missense_Mutation_p.R187Q|TTC23_uc002bux.2_Missense_Mutation_p.R187Q|TTC23_uc002buw.2_Missense_Mutation_p.R187Q|TTC23_uc010boq.2_RNA|TTC23_uc002buy.2_Missense_Mutation_p.R187Q|TTC23_uc010bor.2_Missense_Mutation_p.R187Q|TTC23_uc002buz.2_Missense_Mutation_p.R187Q	NM_022905	NP_075056	Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	187	TPR 3.						binding				0	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TAATCTGATCCGTGCTTCAAT	0.408													4	175	---	---	---	---	PASS
NOMO1	23420	broad.mit.edu	37	16	14989511	14989511	+	3'UTR	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14989511G>T	uc002dcv.2	+	31						NM_014287	NP_055102	Q15155	NOMO1_HUMAN	nodal modulator 1 precursor							integral to membrane	carbohydrate binding|carboxypeptidase activity|protein binding			ovary(1)	1						GAGGAGGAAGGGGACAGTTGC	0.592													15	441	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15814831	15814831	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15814831C>A	uc002ddy.2	-	33	4763	c.4656G>T	c.(4654-4656)GAG>GAT	p.E1552D	MYH11_uc002ddv.2_Missense_Mutation_p.E1559D|MYH11_uc002ddw.2_Missense_Mutation_p.E1552D|MYH11_uc002ddx.2_Missense_Mutation_p.E1559D|MYH11_uc010bvg.2_Missense_Mutation_p.E1384D|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.E258D|NDE1_uc002ddz.1_5'Flank	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1552	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						GCAGCTCGTCCTCCAGCTCTT	0.642			T	CBFB	AML								10	109	---	---	---	---	PASS
GDE1	51573	broad.mit.edu	37	16	19516332	19516332	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19516332C>T	uc002dgh.2	-	5	883	c.719G>A	c.(718-720)CGC>CAC	p.R240H	GDE1_uc002dgi.2_Missense_Mutation_p.R130H	NM_016641	NP_057725	Q9NZC3	GDE1_HUMAN	glycerophosphodiester phosphodiesterase 1	240	Lumenal (Potential).|GDPD.				glycerol metabolic process|lipid metabolic process	cytoplasm|integral to membrane	glycerophosphodiester phosphodiesterase activity|glycerophosphoinositol glycerophosphodiesterase activity|metal ion binding			ovary(2)|central_nervous_system(1)	3						AGTATCATAGCGTGGTTTCCC	0.408													6	223	---	---	---	---	PASS
ARHGAP17	55114	broad.mit.edu	37	16	24980023	24980023	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24980023C>T	uc002dnb.2	-	5	436	c.343G>A	c.(343-345)GTT>ATT	p.V115I	ARHGAP17_uc002dnc.2_Missense_Mutation_p.V115I|ARHGAP17_uc010vcf.1_5'UTR|ARHGAP17_uc002dnf.2_Missense_Mutation_p.V23I|ARHGAP17_uc002dng.1_Missense_Mutation_p.V115I	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1	115	BAR.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		TCCTTCTCAACAAAGACTTCG	0.552													12	189	---	---	---	---	PASS
APOB48R	55911	broad.mit.edu	37	16	28509320	28509320	+	Intron	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28509320G>C	uc002dqb.1	+						uc010vct.1_Intron|APOB48R_uc010byg.1_Intron	NM_018690	NP_061160	Q0VD83	APOBR_HUMAN	apolipoprotein B48 receptor						cholesterol metabolic process|lipid transport	chylomicron|low-density lipoprotein particle|plasma membrane|very-low-density lipoprotein particle					0						GGAGCGAGGTGAGGGCTCTTG	0.697													4	66	---	---	---	---	PASS
KCTD13	253980	broad.mit.edu	37	16	29922394	29922394	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29922394C>T	uc002duv.2	-	5	849	c.658G>A	c.(658-660)GAG>AAG	p.E220K	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|ASPHD1_uc002duu.3_Intron|ASPHD1_uc010bzi.2_Intron|KCTD13_uc010vee.1_RNA	NM_178863	NP_849194	Q8WZ19	BACD1_HUMAN	potassium channel tetramerisation domain	220					cell migration|DNA replication|negative regulation of Rho protein signal transduction|proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|stress fiber assembly	Cul3-RING ubiquitin ligase complex|nucleus|voltage-gated potassium channel complex	GTP-Rho binding|voltage-gated potassium channel activity				0						CAGCAGATCTCGTCCCCCAGG	0.562													10	79	---	---	---	---	PASS
FTO	79068	broad.mit.edu	37	16	53844090	53844090	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:53844090C>T	uc002ehr.2	+	2	306	c.84C>T	c.(82-84)CTC>CTT	p.L28L	FTO_uc010vha.1_5'UTR	NM_001080432	NP_001073901	Q9C0B1	FTO_HUMAN	fat mass and obesity associated	28					DNA dealkylation involved in DNA repair|oxidative single-stranded DNA demethylation|oxidative single-stranded RNA demethylation|RNA repair	nucleus	DNA-N1-methyladenine dioxygenase activity|ferrous iron binding|oxidative DNA demethylase activity|oxidative RNA demethylase activity|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen				0						ACACTTGGCTCCCTTATCTGA	0.264													8	81	---	---	---	---	PASS
PRSS54	221191	broad.mit.edu	37	16	58325047	58325047	+	Intron	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58325047A>G	uc002enf.2	-						PRSS54_uc002eng.2_Intron|PRSS54_uc010vie.1_Intron	NM_001080492	NP_001073961	Q6PEW0	PRS54_HUMAN	plasma kallikrein-like protein 4 precursor						proteolysis	extracellular region	serine-type endopeptidase activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3						CAACCTGCGGAGCAGGTGCGG	0.612													11	44	---	---	---	---	PASS
PSKH1	5681	broad.mit.edu	37	16	67943531	67943531	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67943531C>T	uc002euv.2	+	2	1049	c.879C>T	c.(877-879)GGC>GGT	p.G293G	PSKH1_uc010cet.2_Silent_p.G293G	NM_006742	NP_006733	P11801	KPSH1_HUMAN	protein serine kinase H1	293	Protein kinase.					endoplasmic reticulum membrane|Golgi apparatus|microtubule organizing center|nuclear speck|plasma membrane	ATP binding|protein serine/threonine kinase activity				0		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		TACTCAGTGGCACCATGCCGT	0.587													5	74	---	---	---	---	PASS
FOXC2	2303	broad.mit.edu	37	16	86601394	86601394	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86601394C>A	uc002fjq.2	+	1	538	c.453C>A	c.(451-453)GAC>GAA	p.D151E		NM_005251	NP_005242	Q99958	FOXC2_HUMAN	forkhead box C2	151	Fork-head.				anti-apoptosis|artery morphogenesis|blood vessel remodeling|camera-type eye development|cardiac muscle cell proliferation|collagen fibril organization|embryonic heart tube development|embryonic viscerocranium morphogenesis|insulin receptor signaling pathway|lymphangiogenesis|metanephros development|negative regulation of transcription from RNA polymerase II promoter|neural crest cell fate commitment|Notch signaling pathway|ossification|paraxial mesodermal cell fate commitment|patterning of blood vessels|positive regulation of cell adhesion mediated by integrin|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of vascular wound healing|regulation of blood vessel size|regulation of organ growth|regulation of sequence-specific DNA binding transcription factor activity|somitogenesis|ureteric bud development|vascular endothelial growth factor receptor signaling pathway|vasculogenesis|ventricular cardiac muscle tissue morphogenesis	transcription factor complex	chromatin DNA binding|DNA bending activity|double-stranded DNA binding|promoter binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription factor binding|transcription regulatory region DNA binding				0						TGGACCCGGACTCCTACAACA	0.622									Late-onset_Hereditary_Lymphedema				10	99	---	---	---	---	PASS
ZCCHC14	23174	broad.mit.edu	37	16	87443942	87443942	+	Intron	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87443942C>A	uc002fjz.1	-						ZCCHC14_uc002fka.1_Splice_Site	NM_015144	NP_055959	Q8WYQ9	ZCH14_HUMAN	zinc finger, CCHC domain containing 14						cell communication		nucleic acid binding|phosphatidylinositol binding|zinc ion binding			upper_aerodigestive_tract(1)|breast(1)	2				BRCA - Breast invasive adenocarcinoma(80;0.0285)		CTAAAAGTACCTAGAGAGAGG	0.443													10	130	---	---	---	---	PASS
ZZEF1	23140	broad.mit.edu	37	17	3990837	3990837	+	Intron	SNP	T	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3990837T>A	uc002fxe.2	-						ZZEF1_uc002fxk.1_Intron	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						ACCTAAAAAATTATAAAGATC	0.224													4	52	---	---	---	---	PASS
KIF1C	10749	broad.mit.edu	37	17	4908161	4908161	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4908161G>A	uc002gan.1	+	13	1357	c.1031G>A	c.(1030-1032)CGC>CAC	p.R344H		NM_006612	NP_006603	O43896	KIF1C_HUMAN	kinesin family member 1C	344					microtubule-based movement|retrograde vesicle-mediated transport, Golgi to ER	endoplasmic reticulum|Golgi apparatus|microtubule	ATP binding|microtubule motor activity			breast(2)	2						TATGCTGACCGCACCAAGCAA	0.612													5	129	---	---	---	---	PASS
TEKT1	83659	broad.mit.edu	37	17	6704111	6704111	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6704111T>C	uc002gdt.2	-	7	1114	c.1004A>G	c.(1003-1005)TAT>TGT	p.Y335C	TEKT1_uc010vth.1_Missense_Mutation_p.Y189C	NM_053285	NP_444515	Q969V4	TEKT1_HUMAN	tektin 1	335	Potential.				microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|skin(1)	2		Myeloproliferative disorder(207;0.0255)				CATTAGCCTATATTGTGCGAC	0.507											OREG0024124	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	202	---	---	---	---	PASS
PER1	5187	broad.mit.edu	37	17	8049287	8049287	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8049287G>T	uc002gkd.2	-	17	2445	c.2207C>A	c.(2206-2208)CCC>CAC	p.P736H	PER1_uc010vuq.1_RNA|PER1_uc010vur.1_Missense_Mutation_p.P720H	NM_002616	NP_002607	O15534	PER1_HUMAN	period 1	736	CSNK1E binding domain (By similarity).				circadian rhythm|entrainment of circadian clock|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	signal transducer activity			lung(2)|breast(2)|skin(2)|large_intestine(1)|ovary(1)|kidney(1)	9						CGACTCCGGGGGCTTCTTGTC	0.637			T	ETV6	AML|CMML			Other_conserved_DNA_damage_response_genes					13	108	---	---	---	---	PASS
RICH2	9912	broad.mit.edu	37	17	12883479	12883479	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:12883479G>C	uc002gnr.3	+	19	2195	c.1868G>C	c.(1867-1869)GGA>GCA	p.G623A	RICH2_uc010vvk.1_Missense_Mutation_p.G623A|RICH2_uc010vvl.1_Missense_Mutation_p.G617A|RICH2_uc002gns.3_Missense_Mutation_p.G417A|RICH2_uc010vvm.1_Missense_Mutation_p.G617A|RICH2_uc010vvn.1_Intron	NM_014859	NP_055674	Q17R89	RHG44_HUMAN	Rho GTPase-activating protein RICH2	623					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity				0						GCTCAACCTGGAGCTCAGCCG	0.627													9	30	---	---	---	---	PASS
TTC19	54902	broad.mit.edu	37	17	15907564	15907564	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:15907564C>G	uc002gph.1	+	6	950	c.932C>G	c.(931-933)GCT>GGT	p.A311G	TTC19_uc010cox.1_RNA	NM_017775	NP_060245	Q6DKK2	TTC19_HUMAN	tetratricopeptide repeat domain 19	190	TPR 2.				cell cycle|cytokinesis|mitochondrial respiratory chain complex III assembly	centrosome|midbody|mitochondrial inner membrane	protein binding			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		AGTATCTATGCTGCGCAGAAC	0.418													11	128	---	---	---	---	PASS
NLK	51701	broad.mit.edu	37	17	26518101	26518101	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:26518101C>T	uc010crj.2	+	9	1503	c.1291C>T	c.(1291-1293)CGA>TGA	p.R431*	NLK_uc010cri.1_RNA	NM_016231	NP_057315	Q9UBE8	NLK_HUMAN	nemo like kinase	431					intracellular protein kinase cascade|negative regulation of Wnt receptor signaling pathway|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|serine phosphorylation of STAT3 protein|transcription, DNA-dependent|transforming growth factor beta receptor signaling pathway|Wnt receptor signaling pathway	cytoplasm|nucleus	ATP binding|magnesium ion binding|MAP kinase activity|SH2 domain binding|transcription factor binding|ubiquitin protein ligase binding			ovary(1)|lung(1)|central_nervous_system(1)	3	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AGATGAAGGGCGACTACGATA	0.423													9	122	---	---	---	---	PASS
NEK8	284086	broad.mit.edu	37	17	27066122	27066122	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27066122G>A	uc002hcp.2	+	10	1320	c.1320G>A	c.(1318-1320)TTG>TTA	p.L440L		NM_178170	NP_835464	Q86SG6	NEK8_HUMAN	NIMA-related kinase 8	440	RCC1 2.					cytoplasm|primary cilium	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|ovary(1)|pancreas(1)|liver(1)|skin(1)	6	Lung NSC(42;0.0158)					TGGAGGCTTTGCTGGGCTATG	0.587													7	147	---	---	---	---	PASS
KRT12	3859	broad.mit.edu	37	17	39017927	39017927	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39017927C>G	uc002hvk.2	-	8	1495	c.1471G>C	c.(1471-1473)GAA>CAA	p.E491Q		NM_000223	NP_000214	Q99456	K1C12_HUMAN	keratin 12	491	Tail.				visual perception	intermediate filament	structural molecule activity			ovary(1)	1		Breast(137;0.000301)				ATTAGTTCTTCAATTTCCTGA	0.373													10	121	---	---	---	---	PASS
CNTNAP1	8506	broad.mit.edu	37	17	40837258	40837258	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40837258G>A	uc002iay.2	+	5	751	c.535G>A	c.(535-537)GGC>AGC	p.G179S	CNTNAP1_uc010wgs.1_RNA	NM_003632	NP_003623	P78357	CNTP1_HUMAN	contactin associated protein 1 precursor	179	Extracellular (Potential).				axon guidance|cell adhesion	paranode region of axon	receptor activity|receptor binding|SH3 domain binding|SH3/SH2 adaptor activity			ovary(3)|breast(3)|upper_aerodigestive_tract(1)|lung(1)	8		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTATTTCGACGGCGACGATGC	0.627													4	127	---	---	---	---	PASS
DHX8	1659	broad.mit.edu	37	17	41570888	41570888	+	Silent	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41570888G>C	uc002idu.1	+	7	1012	c.939G>C	c.(937-939)GTG>GTC	p.V313V	DHX8_uc010wif.1_Silent_p.V222V|DHX8_uc010wig.1_Silent_p.V313V	NM_004941	NP_004932	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	313	S1 motif.					catalytic step 2 spliceosome	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|pancreas(1)	4		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CTGATGTCGTGAGCAAAGGCC	0.572													11	137	---	---	---	---	PASS
TTLL6	284076	broad.mit.edu	37	17	46863659	46863659	+	Missense_Mutation	SNP	T	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46863659T>G	uc010wlo.1	-	13	1663	c.1628A>C	c.(1627-1629)AAG>ACG	p.K543T	TTLL6_uc002iob.2_Missense_Mutation_p.K236T|TTLL6_uc010dbi.2_RNA|TTLL6_uc002ioc.2_Missense_Mutation_p.K296T|TTLL6_uc002iod.2_Missense_Mutation_p.K390T	NM_001130918	NP_001124390	Q8N841	TTLL6_HUMAN	tubulin tyrosine ligase-like family, member 6	495						cilium|microtubule basal body	ATP binding|tubulin binding|tubulin-tyrosine ligase activity				0						TTGGAAGGGCTTTTTCTCCCG	0.522													10	462	---	---	---	---	PASS
PHOSPHO1	162466	broad.mit.edu	37	17	47304062	47304062	+	5'UTR	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47304062C>T	uc010wlv.1	-	2					PHOSPHO1_uc002ios.2_5'UTR	NM_178500	NP_848595	Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1 isoform 2						regulation of bone mineralization		metal ion binding|phosphoethanolamine/phosphocholine phosphatase activity				0			Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	ATTGTCGGTGCATTACCGTGA	0.577													8	62	---	---	---	---	PASS
PHB	5245	broad.mit.edu	37	17	47482457	47482457	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:47482457C>T	uc002iox.1	-	7	789	c.716G>A	c.(715-717)CGC>CAC	p.R239H		NM_002634	NP_002625	P35232	PHB_HUMAN	prohibitin	239					cellular response to interleukin-6|DNA replication|glucocorticoid receptor signaling pathway|histone deacetylation|negative regulation of androgen receptor signaling pathway|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of transcription by competitive promoter binding|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|progesterone receptor signaling pathway|regulation of apoptosis	integral to plasma membrane|mitochondrial inner membrane|nucleoplasm	histone deacetylase binding|transcription regulatory region DNA binding				0	all_cancers(4;2.62e-14)|Breast(4;4.21e-29)|all_epithelial(4;6.9e-18)		Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)			TTCCAGCTTGCGCAGCTCGAT	0.622													3	18	---	---	---	---	PASS
EME1	146956	broad.mit.edu	37	17	48458295	48458295	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48458295G>C	uc002iqs.1	+	9	1781	c.1708G>C	c.(1708-1710)GAC>CAC	p.D570H	EME1_uc010dbp.1_Missense_Mutation_p.D583H|EME1_uc010dbq.1_RNA|uc010wmk.1_5'Flank	NM_152463	NP_689676	Q96AY2	EME1_HUMAN	essential meiotic endonuclease 1 homolog 1	570					DNA recombination|DNA repair	nucleolus	DNA binding|endonuclease activity|metal ion binding|protein binding				0	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			AGATAGTGCTGACTGATTCTA	0.502								Direct_reversal_of_damage|Homologous_recombination					4	77	---	---	---	---	PASS
WFIKKN2	124857	broad.mit.edu	37	17	48917580	48917580	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48917580G>T	uc002isv.3	+	2	1625	c.931G>T	c.(931-933)GCA>TCA	p.A311S	WFIKKN2_uc010dbu.2_Missense_Mutation_p.A218S	NM_175575	NP_783165	Q8TEU8	WFKN2_HUMAN	WFIKKN2 protein	311						extracellular region	metalloendopeptidase inhibitor activity|protein binding|serine-type endopeptidase inhibitor activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TCATCAGGCTGCAGCCACCTC	0.662													7	62	---	---	---	---	PASS
SCPEP1	59342	broad.mit.edu	37	17	55073004	55073004	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55073004G>A	uc002iuv.3	+						SCPEP1_uc010dcl.2_Intron|SCPEP1_uc010wnk.1_Intron	NM_021626	NP_067639	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1 precursor						proteolysis	extracellular region	serine-type carboxypeptidase activity			skin(1)	1	Breast(9;2.86e-08)					CAGGTAAAAAGGGGAAACACT	0.413													20	99	---	---	---	---	PASS
RNFT1	51136	broad.mit.edu	37	17	58040334	58040334	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:58040334G>A	uc002iya.2	-	2	461	c.368C>T	c.(367-369)GCA>GTA	p.A123V	uc002iye.1_5'Flank|RNFT1_uc002iyb.2_RNA|RNFT1_uc002iyc.2_5'UTR|RNFT1_uc010wop.1_Missense_Mutation_p.A123V|RNFT1_uc002iyd.3_Missense_Mutation_p.A123V	NM_016125	NP_057209	Q5M7Z0	RNFT1_HUMAN	PTD016 protein	123						integral to membrane	zinc ion binding				0	all_cancers(5;1.58e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;7.95e-12)|all cancers(12;1.34e-10)			AGTCAGCCTTGCTTCACTGTG	0.483													5	122	---	---	---	---	PASS
AXIN2	8313	broad.mit.edu	37	17	63554607	63554607	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:63554607C>T	uc002jfi.2	-	2	421	c.132G>A	c.(130-132)CAG>CAA	p.Q44Q	AXIN2_uc010den.1_Silent_p.Q44Q|AXIN2_uc002jfh.2_Silent_p.Q44Q|AXIN2_uc002jfj.1_Silent_p.Q44Q	NM_004655	NP_004646	Q9Y2T1	AXIN2_HUMAN	axin 2	44				QPGVGKGQVTKPMSVSSNTRRNEDGL -> HHGGQGPGHQT HVCLFQHQAERRWV (in Ref. 2; AAF22799).	cellular protein localization|cellular response to organic cyclic compound|dorsal/ventral axis specification|intramembranous ossification|maintenance of DNA repeat elements|mRNA stabilization|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of cell proliferation|negative regulation of osteoblast differentiation|odontogenesis|positive regulation of cell death|positive regulation of epithelial to mesenchymal transition|positive regulation of protein phosphorylation|regulation of centromeric sister chromatid cohesion|regulation of mismatch repair|Wnt receptor signaling pathway involved in somitogenesis	Axin-APC-beta-catenin-GSK3B complex|cell cortex|centrosome|cytoplasmic membrane-bounded vesicle|cytoplasmic microtubule|nucleus|plasma membrane|postsynaptic density	armadillo repeat domain binding|beta-catenin binding|GTPase activator activity|protein kinase binding|signal transducer activity|ubiquitin protein ligase binding			central_nervous_system(1)|skin(1)	2						GTTTGGTGACCTGGCCCTTGC	0.682									Oligodontia_Ectodermal_Dysplasia_and_Colorectal_Polyp_syndrome				5	100	---	---	---	---	PASS
PRPSAP1	5635	broad.mit.edu	37	17	74308994	74308994	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74308994G>C	uc010wta.1	-	9	1402	c.956C>G	c.(955-957)TCT>TGT	p.S319C	PRPSAP1_uc010wtb.1_Missense_Mutation_p.S216C	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate	290					nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						GGCCTCTGCAGACAGGATGCC	0.502													15	108	---	---	---	---	PASS
TXNDC2	84203	broad.mit.edu	37	18	9886977	9886977	+	Silent	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:9886977C>A	uc002koi.3	+	2	950	c.501C>A	c.(499-501)GCC>GCA	p.A167A	TXNDC2_uc010wzq.1_Intron|TXNDC2_uc002koh.3_Silent_p.A100A	NM_001098529	NP_001091999	Q86VQ3	TXND2_HUMAN	thioredoxin domain-containing 2 isoform 2	167	22 X 15 AA approximate tandem repeat of Q-P-K-X-G-D-I-P-K-S-[PS]-E-[KE]-X-I.|4.				cell differentiation|cell redox homeostasis|glycerol ether metabolic process|multicellular organismal development|spermatogenesis	cytoplasm	electron carrier activity|nutrient reservoir activity|protein disulfide oxidoreductase activity|thioredoxin-disulfide reductase activity			ovary(1)|pancreas(1)	2						TTCCCAAGGCCTCAGTGAAGC	0.552													7	229	---	---	---	---	PASS
CABLES1	91768	broad.mit.edu	37	18	20768804	20768804	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20768804G>A	uc002kuc.2	+	2	848	c.848G>A	c.(847-849)CGG>CAG	p.R283Q	CABLES1_uc002kub.2_5'UTR|CABLES1_uc002kud.2_Missense_Mutation_p.R18Q	NM_001100619	NP_001094089	Q8TDN4	CABL1_HUMAN	Cdk5 and Abl enzyme substrate 1 isoform 2	283	Interacts with CDK3 (By similarity).				blood coagulation|cell cycle|cell division|regulation of cell cycle|regulation of cell division	cytosol|nucleus	cyclin-dependent protein kinase regulator activity|protein binding			breast(1)	1	all_cancers(21;0.000102)|all_epithelial(16;2.48e-06)|Lung NSC(20;0.00696)|all_lung(20;0.0197)|Colorectal(14;0.0202)|Ovarian(20;0.127)					TTCTGCAGACGGCGCCTCATC	0.408													4	61	---	---	---	---	PASS
LAMA3	3909	broad.mit.edu	37	18	21399973	21399973	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:21399973G>A	uc002kuq.2	+						LAMA3_uc002kur.2_Intron	NM_198129	NP_937762	Q16787	LAMA3_HUMAN	laminin alpha 3 subunit isoform 1						cell adhesion|epidermis development|hemidesmosome assembly|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|skin(2)|central_nervous_system(1)	11	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)				Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	TACGCAACCCGAAGAGAGCAG	0.517													9	60	---	---	---	---	PASS
RNF152	220441	broad.mit.edu	37	18	59483590	59483590	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59483590G>A	uc002lih.1	-	2	519	c.107C>T	c.(106-108)TCA>TTA	p.S36L		NM_173557	NP_775828	Q8N8N0	RN152_HUMAN	ring finger protein 152	36	RING-type.				apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)				CAGGCACACTGAACAGCAGGT	0.612													13	106	---	---	---	---	PASS
GALR1	2587	broad.mit.edu	37	18	74962959	74962959	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74962959C>T	uc002lms.3	+	1	952	c.455C>T	c.(454-456)GCG>GTG	p.A152V		NM_001480	NP_001471	P47211	GALR1_HUMAN	galanin receptor 1	152	Helical; Name=4; (Potential).				digestion|negative regulation of adenylate cyclase activity	integral to membrane|plasma membrane	galanin receptor activity			lung(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.03e-06)|BRCA - Breast invasive adenocarcinoma(31;0.104)		TCCCGCAACGCGCTGCTGGGC	0.692													8	70	---	---	---	---	PASS
POLR2E	5434	broad.mit.edu	37	19	1090909	1090909	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1090909C>T	uc002lre.3	-	4	504	c.427G>A	c.(427-429)GAG>AAG	p.E143K	POLR2E_uc010xgf.1_RNA	NM_002695	NP_002686	P19388	RPAB1_HUMAN	DNA directed RNA polymerase II polypeptide E	143					interspecies interaction between organisms|mRNA capping|nuclear mRNA splicing, via spliceosome|positive regulation of viral transcription|protein phosphorylation|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase II promoter|transcription elongation from RNA polymerase III promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	DNA-directed RNA polymerase II, core complex	DNA binding|DNA-directed RNA polymerase activity				0		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGCCCACCTCGTGCTCCGTG	0.647													6	52	---	---	---	---	PASS
AES	166	broad.mit.edu	37	19	3061229	3061229	+	Silent	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3061229G>C	uc002lwy.1	-	2	227	c.54C>G	c.(52-54)CTC>CTG	p.L18L	AES_uc002lwz.1_Silent_p.L18L|AES_uc002lxa.1_5'UTR|AES_uc002lxb.1_Silent_p.L85L|AES_uc002lxc.2_Silent_p.L85L	NM_001130	NP_001121	Q08117	AES_HUMAN	amino-terminal enhancer of split isoform b	18	Gln-rich (Q domain).				negative regulation of canonical Wnt receptor signaling pathway|negative regulation of protein binding|negative regulation of response to cytokine stimulus|negative regulation of transcription from RNA polymerase II promoter|organ morphogenesis|response to interleukin-1|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGAATTTGAGTTGCTGGG	0.652													17	205	---	---	---	---	PASS
LONP1	9361	broad.mit.edu	37	19	5711826	5711826	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5711826C>G	uc002mcx.2	-	4	859	c.826G>C	c.(826-828)GAG>CAG	p.E276Q	LONP1_uc002mcy.2_Missense_Mutation_p.E212Q|LONP1_uc010duh.2_Missense_Mutation_p.E17Q|LONP1_uc010dui.2_Intron|LONP1_uc002mcz.2_Missense_Mutation_p.E80Q	NM_004793	NP_004784	P36776	LONM_HUMAN	mitochondrial lon peptidase 1 precursor	276	Lon.				cellular chaperone-mediated protein complex assembly|cellular response to oxidative stress|misfolded or incompletely synthesized protein catabolic process|mitochondrial DNA metabolic process|oxidation-dependent protein catabolic process|protein homooligomerization|response to hypoxia	mitochondrial nucleoid	ADP binding|ATP binding|ATP-dependent peptidase activity|DNA polymerase binding|G-quadruplex DNA binding|mitochondrial heavy strand promoter anti-sense binding|mitochondrial light strand promoter anti-sense binding|sequence-specific DNA binding|serine-type endopeptidase activity|single-stranded DNA binding|single-stranded RNA binding				0						ACAACGTTCTCTACCTCCACC	0.672													9	136	---	---	---	---	PASS
VAV1	7409	broad.mit.edu	37	19	6828713	6828713	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6828713G>C	uc002mfu.1	+	12	1270	c.1173G>C	c.(1171-1173)GAG>GAC	p.E391D	VAV1_uc010xjh.1_Missense_Mutation_p.E359D|VAV1_uc010dva.1_Missense_Mutation_p.E391D|VAV1_uc002mfv.1_Missense_Mutation_p.E336D	NM_005428	NP_005419	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	391					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|T cell costimulation	cytosol|plasma membrane	metal ion binding|protein binding|sequence-specific DNA binding transcription factor activity			lung(4)|ovary(4)|breast(3)|central_nervous_system(2)|kidney(2)|skin(1)	16						TGTCCATTGAGAACCTGGTGA	0.627													19	229	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9065822	9065822	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9065822G>T	uc002mkp.2	-	3	21828	c.21624C>A	c.(21622-21624)GCC>GCA	p.A7208A		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	7210	Ser-rich.|Thr-rich.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						TTGGTGATGTGGCTTTGGATG	0.473													20	179	---	---	---	---	PASS
DDX39	10212	broad.mit.edu	37	19	14522397	14522397	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14522397A>G	uc010xnp.1	-	4	395	c.350T>C	c.(349-351)GTC>GCC	p.V117A	DDX39_uc002myo.2_Missense_Mutation_p.V117A|DDX39_uc010dzl.2_RNA|DDX39_uc010dzm.1_Missense_Mutation_p.V117A	NM_005804	NP_005795	O00148	DX39A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 39	117	Helicase ATP-binding.				mRNA export from nucleus|nuclear mRNA splicing, via spliceosome	nucleus	ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding				0						GTGGCACATGACCAGGACCGT	0.582													6	66	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16035633	16035633	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16035633G>A	uc002nbu.2	-	6	621	c.585C>T	c.(583-585)ATC>ATT	p.I195I	CYP4F11_uc010eab.1_Silent_p.I195I|CYP4F11_uc002nbt.2_Silent_p.I195I	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	195					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						TCATGAGGCTGATGTGTTCAA	0.532													7	72	---	---	---	---	PASS
SIN3B	23309	broad.mit.edu	37	19	16942351	16942351	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16942351G>A	uc002ney.1	+	3	288	c.274G>A	c.(274-276)GAG>AAG	p.E92K	SIN3B_uc002new.2_Missense_Mutation_p.E92K|SIN3B_uc002nex.2_Missense_Mutation_p.E24K|SIN3B_uc002nez.1_Missense_Mutation_p.E92K	NM_015260	NP_056075	O75182	SIN3B_HUMAN	SIN3 homolog B, transcription regulator	92	Interaction with REST (By similarity).|PAH 1.				cellular lipid metabolic process|transcription, DNA-dependent	nucleoplasm	protein binding			ovary(2)	2						GCTCTTCCACGAGCACCCTGA	0.453													7	241	---	---	---	---	PASS
TSSK6	83983	broad.mit.edu	37	19	19625912	19625912	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19625912C>T	uc002nmr.2	-	1	558	c.325G>A	c.(325-327)GGA>AGA	p.G109R	TSSK6_uc002nmq.2_RNA|NDUFA13_uc002nms.2_5'Flank|NDUFA13_uc010xqx.1_5'Flank|NDUFA13_uc010xqy.1_5'Flank	NM_032037	NP_114426	Q9BXA6	TSSK6_HUMAN	testis-specific serine kinase 6	109	Protein kinase.				multicellular organismal development|sperm chromatin condensation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity			stomach(1)	1						GCCTGAACTCCGGGGATGCGC	0.637													6	61	---	---	---	---	PASS
TSHZ3	57616	broad.mit.edu	37	19	31769840	31769840	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31769840G>T	uc002nsy.3	-	2	924	c.859C>A	c.(859-861)CTG>ATG	p.L287M		NM_020856	NP_065907	Q63HK5	TSH3_HUMAN	zinc finger protein 537	287	C2H2-type 2.				negative regulation of transcription, DNA-dependent|regulation of respiratory gaseous exchange by neurological system process	growth cone|nucleus	chromatin binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(2)|pancreas(1)|lung(1)	8	Esophageal squamous(110;0.226)					AAATCCTGCAGGGACTCAAAG	0.522													6	154	---	---	---	---	PASS
ZNF567	163081	broad.mit.edu	37	19	37210533	37210533	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37210533C>G	uc010xtl.1	+	6	1129	c.907C>G	c.(907-909)CAC>GAC	p.H303D	ZNF567_uc002oeo.1_Missense_Mutation_p.H303D|ZNF567_uc010xtk.1_Missense_Mutation_p.H303D|ZNF567_uc002oep.3_Missense_Mutation_p.H272D|ZNF567_uc002oeq.1_Missense_Mutation_p.H272D	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	303	C2H2-type 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			TCAGAGAACTCACACAGGAGA	0.423													3	56	---	---	---	---	PASS
DLL3	10683	broad.mit.edu	37	19	39998898	39998898	+	3'UTR	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39998898C>T	uc002olx.2	+	8					DLL3_uc002olw.2_3'UTR	NM_016941	NP_058637	Q9NYJ7	DLL3_HUMAN	delta-like 3 protein isoform 1 precursor						Notch signaling pathway|skeletal system development	integral to membrane	Notch binding			central_nervous_system(2)|breast(1)	3	all_cancers(60;4.04e-06)|all_lung(34;1.77e-07)|Lung NSC(34;2.09e-07)|all_epithelial(25;1.13e-05)|Ovarian(47;0.159)		Epithelial(26;5.89e-26)|all cancers(26;1.96e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			CTAGGCCTGACGCGTCTCCTC	0.552													7	92	---	---	---	---	PASS
PSG11	5680	broad.mit.edu	37	19	43523150	43523150	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43523150C>T	uc002ovm.1	-	3	588	c.481G>A	c.(481-483)GCC>ACC	p.A161T	PSG11_uc002ouw.2_Missense_Mutation_p.A167T|PSG10_uc002ouv.1_Intron|PSG6_uc002ovh.1_Intron|PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG11_uc002ovk.1_Missense_Mutation_p.A167T|PSG11_uc002ovn.1_Missense_Mutation_p.A167T|PSG11_uc002ovo.1_Missense_Mutation_p.A39T|PSG11_uc002ovp.1_Missense_Mutation_p.A39T	NM_002785	NP_002776	Q9UQ72	PSG11_HUMAN	pregnancy specific beta-1-glycoprotein 11	161	Ig-like C2-type 1.				female pregnancy	extracellular region					0		Prostate(69;0.00682)				GTCTCCATGGCCTCCCTGGGG	0.522													17	311	---	---	---	---	PASS
RCN3	57333	broad.mit.edu	37	19	50046438	50046438	+	Missense_Mutation	SNP	G	A	A	rs139927137	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50046438G>A	uc002poj.2	+	7	1402	c.955G>A	c.(955-957)GAG>AAG	p.E319K		NM_020650	NP_065701	Q96D15	RCN3_HUMAN	reticulocalbin 3, EF-hand calcium binding domain	319						endoplasmic reticulum lumen	calcium ion binding|protein binding			ovary(1)	1		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0159)		CAACTATGGCGAGGACCTGAC	0.632													3	45	---	---	---	---	PASS
ZNF614	80110	broad.mit.edu	37	19	52519532	52519532	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52519532C>T	uc002pyj.2	-	5	1721	c.1319G>A	c.(1318-1320)CGC>CAC	p.R440H	ZNF614_uc002pyi.3_Intron|ZNF614_uc010epj.2_Missense_Mutation_p.R143H	NM_025040	NP_079316	Q8N883	ZN614_HUMAN	zinc finger protein 614	440	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	5		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00513)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AATAAGAGTGCGCTTTGTGGT	0.408													8	186	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55708603	55708603	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55708603C>A	uc002qjq.2	-	9	1945	c.1872G>T	c.(1870-1872)AGG>AGT	p.R624S	PTPRH_uc010esv.2_Missense_Mutation_p.R446S|PTPRH_uc002qjs.2_Missense_Mutation_p.R631S	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	624	Extracellular (Potential).|Fibronectin type-III 7.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		TCTCATTGGTCCTGCTGGTCT	0.577													21	114	---	---	---	---	PASS
ZNF547	284306	broad.mit.edu	37	19	58024372	58024372	+	Intron	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58024372T>C	uc002qpm.3	+						ZNF773_uc002qoz.2_Intron			Q8IVP9	ZN547_HUMAN	RecName: Full=Zinc finger protein 547;						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		atttctgcatttgtccttctt	0.040													5	20	---	---	---	---	PASS
ZSCAN22	342945	broad.mit.edu	37	19	58849911	58849911	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58849911C>T	uc002qsc.2	+	3	842	c.695C>T	c.(694-696)GCG>GTG	p.A232V	ZSCAN22_uc010yhz.1_Missense_Mutation_p.R227C	NM_181846	NP_862829	P10073	ZSC22_HUMAN	zinc finger and SCAN domain containing 22	232					viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)	1		all_cancers(17;3.11e-12)|all_epithelial(17;9.43e-09)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0289)		AGTTCTAGTGCGTGGCCAAAC	0.522													22	307	---	---	---	---	PASS
ZNF324B	388569	broad.mit.edu	37	19	58966636	58966636	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58966636G>A	uc002qsv.1	+	4	432	c.325G>A	c.(325-327)GTC>ATC	p.V109I	ZNF324B_uc002qsu.1_Missense_Mutation_p.V99I|ZNF324B_uc010euq.1_Missense_Mutation_p.V109I	NM_207395	NP_997278	Q6AW86	Z324B_HUMAN	zinc finger protein 324B	109					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GACTACTAGCGTCTTCCCAGT	0.547													7	101	---	---	---	---	PASS
XRN2	22803	broad.mit.edu	37	20	21328833	21328833	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21328833C>T	uc002wsf.1	+	18	1810	c.1715C>T	c.(1714-1716)GCT>GTT	p.A572V	XRN2_uc002wsg.1_Missense_Mutation_p.A496V|XRN2_uc010zsk.1_Missense_Mutation_p.A518V	NM_012255	NP_036387	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	572					cell growth|DNA catabolic process, exonucleolytic|mRNA processing|regulation of transcription, DNA-dependent|RNA catabolic process|spermatogenesis|transcription termination, DNA-dependent	nucleolus	5'-3' exoribonuclease activity|nucleic acid binding|protein binding|zinc ion binding			skin(1)	1						GCACCATTTGCTTCAGACTTT	0.348													4	80	---	---	---	---	PASS
DLGAP4	22839	broad.mit.edu	37	20	35127697	35127697	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35127697C>T	uc002xff.2	+	9	2498	c.2063C>T	c.(2062-2064)GCG>GTG	p.A688V	DLGAP4_uc010zvp.1_Missense_Mutation_p.A688V|DLGAP4_uc002xfg.2_Intron|DLGAP4_uc002xfh.2_Intron|DLGAP4_uc002xfi.2_5'UTR|DLGAP4_uc002xfj.2_5'UTR	NM_014902	NP_055717	Q9Y2H0	DLGP4_HUMAN	disks large-associated protein 4 isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell-cell signaling	membrane	protein binding			skin(2)|ovary(1)	3	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				GGACCCAAAGCGATCGATGTG	0.433													4	88	---	---	---	---	PASS
TP53TG5	27296	broad.mit.edu	37	20	44002661	44002661	+	Intron	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44002661G>C	uc002xny.2	-						SYS1_uc002xnw.1_Intron|SYS1-DBNDD2_uc002xnx.2_Intron	NM_014477	NP_055292	Q9Y2B4	T53G5_HUMAN	TP53-target gene 5 protein						intracellular signal transduction|negative regulation of cell growth	cytoplasm|nucleus				central_nervous_system(1)	1						CCTGCCAGCAGAAACCTCGGT	0.612											OREG0025981	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	93	---	---	---	---	PASS
PTGIS	5740	broad.mit.edu	37	20	48164500	48164500	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48164500C>T	uc002xut.2	-	3	309	c.255G>A	c.(253-255)GCG>GCA	p.A85A	PTGIS_uc010zyi.1_Intron	NM_000961	NP_000952	Q16647	PTGIS_HUMAN	prostaglandin I2 synthase	85					hormone biosynthetic process|prostaglandin biosynthetic process|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|integral to membrane	electron carrier activity|heme binding|monooxygenase activity|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen|prostaglandin-I synthase activity			skin(2)|ovary(1)	3			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Phenylbutazone(DB00812)	CCCACACCACCGCGTCGTAGG	0.557													5	140	---	---	---	---	PASS
CTCFL	140690	broad.mit.edu	37	20	56094254	56094254	+	Intron	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56094254C>A	uc010gix.1	-						CTCFL_uc010giw.1_Intron|CTCFL_uc002xym.2_Intron|CTCFL_uc010giz.1_Intron|CTCFL_uc010giy.1_Intron|CTCFL_uc010gja.1_Intron|CTCFL_uc010gjb.1_Intron|CTCFL_uc010gjc.1_Intron|CTCFL_uc010gjd.1_Intron|CTCFL_uc010gje.2_Intron|CTCFL_uc010gjf.2_Intron|CTCFL_uc010gjg.2_Intron|CTCFL_uc010gjh.1_Intron|CTCFL_uc010gji.1_Intron|CTCFL_uc010gjj.1_Intron|CTCFL_uc010gjk.1_Intron|CTCFL_uc010gjl.1_Intron	NM_080618	NP_542185	Q8NI51	CTCFL_HUMAN	CCCTC-binding factor-like protein						cell cycle|DNA methylation involved in gamete generation|histone methylation|positive regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|regulation of histone H3-K4 methylation|transcription, DNA-dependent	cytoplasm|nucleus	histone binding|sequence-specific DNA binding|transcription regulatory region DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|skin(1)	4	Lung NSC(12;0.00132)|all_lung(29;0.00433)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;3.95e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.09e-07)			GCCTTCCCGGCAGTTTTACCT	0.453													4	105	---	---	---	---	PASS
TAF4	6874	broad.mit.edu	37	20	60578821	60578821	+	Silent	SNP	C	T	T	rs140240263		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60578821C>T	uc002ybs.2	-	8	2337	c.2337G>A	c.(2335-2337)ACG>ACA	p.T779T		NM_003185	NP_003176	O00268	TAF4_HUMAN	TBP-associated factor 4	779					interspecies interaction between organisms|positive regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter|viral reproduction	cytoplasm|MLL1 complex|transcription factor TFIID complex|transcription factor TFTC complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			ovary(2)|pancreas(1)	3	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			TCTGCTGAGGCGTGGTGAGCA	0.677													4	30	---	---	---	---	PASS
ZNF512B	57473	broad.mit.edu	37	20	62591483	62591483	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62591483G>A	uc002yhl.1	-	17	2491	c.2437C>T	c.(2437-2439)CGA>TGA	p.R813*		NM_020713	NP_065764	Q96KM6	Z512B_HUMAN	zinc finger protein 512B	813					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GCTGATGTTCGGAACCAGTTC	0.552													11	75	---	---	---	---	PASS
MRAP	56246	broad.mit.edu	37	21	33684247	33684247	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33684247C>T	uc002ypj.2	+	5	646	c.459C>T	c.(457-459)CTC>CTT	p.L153L	MRAP_uc002ypk.2_Intron|URB1_uc002ypn.2_3'UTR|MRAP_uc011ado.1_Silent_p.L94L|MRAP_uc002ypl.2_Silent_p.L153L	NM_178817	NP_848932	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	153	Extracellular (Potential).				positive regulation of cAMP biosynthetic process|protein localization at cell surface	endoplasmic reticulum|integral to membrane|perinuclear region of cytoplasm|plasma membrane	corticotropin hormone receptor binding|type 1 melanocortin receptor binding|type 3 melanocortin receptor binding|type 4 melanocortin receptor binding|type 5 melanocortin receptor binding				0						GGGGTCCCCTCGTCAGGAGCA	0.602													5	116	---	---	---	---	PASS
HMGN1	3150	broad.mit.edu	37	21	40720384	40720384	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40720384G>A	uc002yxo.2	-						HMGN1_uc002yxp.2_Intron|HMGN1_uc002yxq.2_Intron|HMGN1_uc002yxr.2_Intron	NM_004965	NP_004956	P05114	HMGN1_HUMAN	high-mobility group nucleosome binding domain 1						positive regulation of transcription elongation, DNA-dependent	chromatin|cytoplasm|nucleus	DNA binding			breast(1)	1		Prostate(19;8.69e-07)				TGGGCTTGGAGAAAGAAAAAG	0.617													14	140	---	---	---	---	PASS
PRDM15	63977	broad.mit.edu	37	21	43277285	43277285	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43277285C>A	uc002yzq.1	-	11	1494	c.1383G>T	c.(1381-1383)AAG>AAT	p.K461N	PRDM15_uc002yzo.2_Missense_Mutation_p.K132N|PRDM15_uc002yzp.2_Missense_Mutation_p.K132N|PRDM15_uc002yzr.1_Missense_Mutation_p.K132N	NM_022115	NP_071398	P57071	PRD15_HUMAN	PR domain containing 15 isoform 1	461	SET.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CAGCCTTTACCTTCAGGGGAA	0.527													7	78	---	---	---	---	PASS
FTCD	10841	broad.mit.edu	37	21	47575431	47575431	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47575431G>A	uc002zif.2	-	1	51	c.7C>T	c.(7-9)CAG>TAG	p.Q3*	FTCD_uc002zig.2_Nonsense_Mutation_p.Q3*|FTCD_uc002zih.2_Nonsense_Mutation_p.Q3*|FTCD_uc010gqf.2_Nonsense_Mutation_p.Q3*|FTCD_uc010gqg.1_5'UTR	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase	3	Formiminotransferase N-subdomain (By similarity).				folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	TCCACCAGCTGGGACATGGCC	0.622													13	58	---	---	---	---	PASS
FTCD	10841	broad.mit.edu	37	21	47575432	47575432	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47575432G>A	uc002zif.2	-	1	50	c.6C>T	c.(4-6)TCC>TCT	p.S2S	FTCD_uc002zig.2_Silent_p.S2S|FTCD_uc002zih.2_Silent_p.S2S|FTCD_uc010gqf.2_Silent_p.S2S|FTCD_uc010gqg.1_5'UTR	NM_006657	NP_006648	O95954	FTCD_HUMAN	formiminotransferase cyclodeaminase	2	Formiminotransferase N-subdomain (By similarity).				folic acid-containing compound metabolic process|histidine catabolic process	centriole|cytosol|Golgi apparatus	folic acid binding|formimidoyltetrahydrofolate cyclodeaminase activity|glutamate formimidoyltransferase activity			pancreas(1)|skin(1)	2	Breast(49;0.214)			Colorectal(79;0.235)	L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)|Tetrahydrofolic acid(DB00116)	CCACCAGCTGGGACATGGCCA	0.622													13	58	---	---	---	---	PASS
SLC25A18	83733	broad.mit.edu	37	22	18070729	18070729	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18070729C>T	uc002zmp.1	+	9	1108	c.614C>T	c.(613-615)GCC>GTC	p.A205V	SLC25A18_uc010gqx.2_Missense_Mutation_p.A205V|SLC25A18_uc002zmq.1_Missense_Mutation_p.A205V	NM_031481	NP_113669	Q9H1K4	GHC2_HUMAN	solute carrier	205	Solcar 2.|Helical; Name=4; (Potential).					integral to membrane|mitochondrial inner membrane	binding|symporter activity				0				Lung(27;0.124)	L-Glutamic Acid(DB00142)	CCACTGTTTGCCAACCTTAAC	0.557													6	135	---	---	---	---	PASS
ARVCF	421	broad.mit.edu	37	22	19959465	19959465	+	Missense_Mutation	SNP	G	A	A	rs34687532	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19959465G>A	uc002zqz.2	-	18	2996	c.2725C>T	c.(2725-2727)CGG>TGG	p.R909W	ARVCF_uc002zqy.2_Missense_Mutation_p.R425W	NM_001670	NP_001661	O00192	ARVC_HUMAN	armadillo repeat protein	909					cell adhesion|multicellular organismal development		protein binding			liver(1)	1	Colorectal(54;0.0993)					CGTGGCCTCCGCTCCCTCCGG	0.647													8	114	---	---	---	---	PASS
KLHL22	84861	broad.mit.edu	37	22	20819605	20819605	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20819605G>T	uc002zsl.1	-	4	761	c.652C>A	c.(652-654)CTT>ATT	p.L218I	KLHL22_uc011ahr.1_Missense_Mutation_p.L75I|KLHL22_uc002zsm.1_Missense_Mutation_p.L218I	NM_032775	NP_116164	Q53GT1	KLH22_HUMAN	kelch-like	218					cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TGGTAGAGAAGGGCCCCCTCA	0.582													3	49	---	---	---	---	PASS
KLHL22	84861	broad.mit.edu	37	22	20819760	20819760	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20819760C>T	uc002zsl.1	-	4	606	c.497G>A	c.(496-498)CGC>CAC	p.R166H	KLHL22_uc011ahr.1_Missense_Mutation_p.R23H|KLHL22_uc002zsm.1_Missense_Mutation_p.R166H	NM_032775	NP_116164	Q53GT1	KLH22_HUMAN	kelch-like	166					cell division	Cul3-RING ubiquitin ligase complex				lung(1)	1	Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CTCAGTCAGGCGGCTCAAGTC	0.502													7	63	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21064988	21064988	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21064988G>A	uc002zsz.3	-	52	6139	c.5908C>T	c.(5908-5910)CGG>TGG	p.R1970W	PI4KA_uc010gsp.2_Missense_Mutation_p.R361W|PI4KA_uc002zsy.3_Missense_Mutation_p.R780W	NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	1970	PI3K/PI4K.				phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CAGGCTCACCGCACAGCCAGG	0.587													4	84	---	---	---	---	PASS
SLC2A11	66035	broad.mit.edu	37	22	24226125	24226125	+	Intron	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:24226125G>A	uc002zyn.3	+						SLC2A11_uc002zyl.1_3'UTR|SLC2A11_uc002zym.3_Intron|SLC2A11_uc002zyo.3_Intron|SLC2A11_uc011ajc.1_Missense_Mutation_p.R357H|SLC2A11_uc002zyp.3_Intron	NM_001024938	NP_001020109	Q9BYW1	GTR11_HUMAN	glucose transporter protein 10 isoform c							integral to membrane|plasma membrane	sugar transmembrane transporter activity			ovary(1)	1						CCCCCGCCCCGTCCACGGCAG	0.652													6	128	---	---	---	---	PASS
MYO18B	84700	broad.mit.edu	37	22	26422432	26422432	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26422432C>A	uc003abz.1	+	43	6742	c.6492C>A	c.(6490-6492)GAC>GAA	p.D2164E	MYO18B_uc003aca.1_Missense_Mutation_p.D2045E|MYO18B_uc010guy.1_Missense_Mutation_p.D2046E|MYO18B_uc010guz.1_Missense_Mutation_p.D2044E|MYO18B_uc011aka.1_Missense_Mutation_p.D1318E|MYO18B_uc011akb.1_Missense_Mutation_p.D1677E|MYO18B_uc010gva.1_Missense_Mutation_p.D147E|MYO18B_uc010gvb.1_RNA	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB	2164						nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						AGGCTGGGGACACTGAGAGGA	0.512													15	258	---	---	---	---	PASS
SEC14L3	266629	broad.mit.edu	37	22	30864530	30864530	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30864530G>A	uc003ahy.2	-	5	477	c.388C>T	c.(388-390)CGC>TGC	p.R130C	SEC14L3_uc003ahz.2_Missense_Mutation_p.R53C|SEC14L3_uc003aia.2_Missense_Mutation_p.R71C|SEC14L3_uc003aib.2_Missense_Mutation_p.R71C	NM_174975	NP_777635	Q9UDX4	S14L3_HUMAN	SEC14-like 3	130	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			ovary(3)|pancreas(1)|skin(1)	5					Vitamin E(DB00163)	TGCAGGATGCGCTCACAGTCC	0.607													9	112	---	---	---	---	PASS
TMPRSS6	164656	broad.mit.edu	37	22	37491609	37491609	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:37491609C>A	uc003aqs.1	-	6	754	c.640G>T	c.(640-642)GCA>TCA	p.A214S	TMPRSS6_uc003aqt.1_Missense_Mutation_p.A205S|TMPRSS6_uc003aqu.2_Missense_Mutation_p.A205S	NM_153609	NP_705837	Q8IU80	TMPS6_HUMAN	transmembrane protease, serine 6	214	CUB 1.|Extracellular (Potential).				angiogenesis|extracellular matrix organization|fibrinolysis|intracellular signal transduction|proteolysis	integral to membrane|intracellular|plasma membrane	serine-type endopeptidase activity			breast(4)|ovary(1)|skin(1)	6						GAATTCAATGCAGCTATGTCT	0.308													6	57	---	---	---	---	PASS
CACNA1I	8911	broad.mit.edu	37	22	40038863	40038863	+	Missense_Mutation	SNP	A	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40038863A>G	uc003ayc.2	+	7	1118	c.1118A>G	c.(1117-1119)TAC>TGC	p.Y373C	CACNA1I_uc003ayd.2_Missense_Mutation_p.Y373C|CACNA1I_uc003aye.2_Missense_Mutation_p.Y288C|CACNA1I_uc003ayf.2_Missense_Mutation_p.Y288C	NM_021096	NP_066919	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type,	373	I.|Extracellular (Potential).				axon guidance|signal transduction	voltage-gated calcium channel complex	low voltage-gated calcium channel activity|protein binding			breast(1)|central_nervous_system(1)	2	Melanoma(58;0.0749)				Flunarizine(DB04841)|Paramethadione(DB00617)|Verapamil(DB00661)	CACTCCTTCTACAACTTCATC	0.557													5	20	---	---	---	---	PASS
SLC25A17	10478	broad.mit.edu	37	22	41173355	41173355	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41173355G>A	uc003azc.2	-	6	614	c.474C>T	c.(472-474)CGC>CGT	p.R158R	SLC25A17_uc010gyg.2_RNA|SLC25A17_uc011aou.1_Silent_p.R121R|SLC25A17_uc003azd.2_RNA|SLC25A17_uc011aov.1_Silent_p.R85R	NM_006358	NP_006349	O43808	PM34_HUMAN	solute carrier family 25 (mitochondrial carrier;	158	Lumenal (Potential).|Solcar 2.				fatty acid alpha-oxidation	integral to plasma membrane|mitochondrial inner membrane|peroxisomal membrane	adenine nucleotide transmembrane transporter activity|protein binding				0						TTCCTTCATCGCGAATGATCT	0.408													5	49	---	---	---	---	PASS
TUBGCP6	85378	broad.mit.edu	37	22	50657616	50657616	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50657616C>T	uc003bkb.1	-	20	5019	c.4507G>A	c.(4507-4509)GCT>ACT	p.A1503T	TUBGCP6_uc003bka.1_Missense_Mutation_p.A590T|TUBGCP6_uc010har.1_Missense_Mutation_p.A1495T|TUBGCP6_uc010has.1_RNA	NM_020461	NP_065194	Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1503					G2/M transition of mitotic cell cycle|microtubule nucleation	centrosome|cytosol|gamma-tubulin ring complex|microtubule|spindle pole	microtubule binding			ovary(2)|central_nervous_system(2)	4		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TAGTCGACAGCGGCCTTGTTC	0.662													4	27	---	---	---	---	PASS
ARSH	347527	broad.mit.edu	37	X	2945446	2945446	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2945446G>A	uc011mhj.1	+	7	1129	c.1129G>A	c.(1129-1131)GAG>AAG	p.E377K		NM_001011719	NP_001011719	Q5FYA8	ARSH_HUMAN	arylsulfatase family, member H	377						integral to membrane	arylsulfatase activity|metal ion binding			lung(1)	1		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGTGATCAATGAGCCCACCAG	0.527													5	144	---	---	---	---	PASS
ATXN3L	92552	broad.mit.edu	37	X	13337594	13337594	+	Nonsense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13337594G>A	uc010ned.2	-	1	925	c.460C>T	c.(460-462)CGA>TGA	p.R154*		NM_001135995	NP_001129467	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	154	Josephin.				protein deubiquitination|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ubiquitin-specific protease activity			lung(2)|ovary(2)|large_intestine(1)|skin(1)	6						TGTTGTAATCGAGCCAAGAAA	0.398													9	81	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17744705	17744705	+	Nonsense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17744705C>T	uc004cxx.2	+	6	2754	c.2416C>T	c.(2416-2418)CAG>TAG	p.Q806*	NHS_uc011mix.1_Nonsense_Mutation_p.Q827*|NHS_uc004cxy.2_Nonsense_Mutation_p.Q650*|NHS_uc004cxz.2_Nonsense_Mutation_p.Q629*|NHS_uc004cya.2_Nonsense_Mutation_p.Q529*	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	806						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TTGTGCCTGGCAGGACTACTT	0.522													8	276	---	---	---	---	PASS
PPEF1	5475	broad.mit.edu	37	X	18775754	18775754	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18775754G>A	uc004cyq.2	+	8	887	c.406G>A	c.(406-408)GCC>ACC	p.A136T	PPEF1_uc004cyp.2_Missense_Mutation_p.A136T|PPEF1_uc004cyr.2_Missense_Mutation_p.A136T|PPEF1_uc004cys.2_Missense_Mutation_p.A136T|PPEF1_uc011mja.1_Missense_Mutation_p.A71T|PPEF1_uc011mjb.1_Missense_Mutation_p.A80T	NM_006240	NP_006231	O14829	PPE1_HUMAN	protein phosphatase with EF hand calcium-binding	136	Catalytic.				detection of stimulus involved in sensory perception|protein dephosphorylation		calcium ion binding|iron ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity				0	Hepatocellular(33;0.183)					GATACTTCATGCCCATTATGT	0.413													9	391	---	---	---	---	PASS
DCAF8L1	139425	broad.mit.edu	37	X	27998586	27998586	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:27998586G>A	uc004dbx.1	-	1	981	c.866C>T	c.(865-867)GCC>GTC	p.A289V		NM_001017930	NP_001017930	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	289	WD 3.									ovary(3)|skin(1)	4						CAACTCGTGGGCAGGTCCCCT	0.527													8	114	---	---	---	---	PASS
FAM47C	442444	broad.mit.edu	37	X	37027835	37027835	+	Missense_Mutation	SNP	G	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37027835G>C	uc004ddl.1	+	1	1366	c.1352G>C	c.(1351-1353)CGC>CCC	p.R451P		NM_001013736	NP_001013758	Q5HY64	FA47C_HUMAN	hypothetical protein LOC442444	451										ovary(3)	3						TCCCATCTCCGCCCAGAGCCT	0.617													16	103	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37913575	37913575	+	Silent	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37913575C>A	uc004ddu.2	+	4	763	c.229C>A	c.(229-231)CGG>AGG	p.R77R	SYTL5_uc004ddv.2_Silent_p.R77R|SYTL5_uc004ddx.2_Silent_p.R77R	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	77	FYVE-type.|RabBD.				intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						AATCTTTGACCGGGGAGACCC	0.507													16	115	---	---	---	---	PASS
ARAF	369	broad.mit.edu	37	X	47426043	47426043	+	Missense_Mutation	SNP	G	A	A	rs66933407		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:47426043G>A	uc011mlq.1	+	7	696	c.563G>A	c.(562-564)CGC>CAC	p.R188H	ARAF_uc011mln.1_Intron|ARAF_uc011mlo.1_Missense_Mutation_p.R54H|ARAF_uc011mlp.1_Missense_Mutation_p.R188H|ARAF_uc004dic.1_5'UTR	NM_001654	NP_001645	P10398	ARAF_HUMAN	v-raf murine sarcoma 3611 viral oncogene	188					intracellular signal transduction|negative regulation of apoptosis|positive regulation of peptidyl-serine phosphorylation		ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|receptor signaling protein activity			large_intestine(3)|lung(2)|ovary(1)|skin(1)	7					Adenosine triphosphate(DB00171)	GGCAGCCCCCGCACCCAGCAC	0.622													4	32	---	---	---	---	PASS
MAGED1	9500	broad.mit.edu	37	X	51640678	51640678	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51640678G>A	uc004dpm.2	+	6	1617	c.1522G>A	c.(1522-1524)GTT>ATT	p.V508I	MAGED1_uc004dpn.2_Missense_Mutation_p.V564I|MAGED1_uc004dpo.2_Missense_Mutation_p.V508I	NM_001005332	NP_001005332	Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1 isoform b	508	MAGE.				apoptosis|induction of apoptosis by extracellular signals|negative regulation of epithelial cell proliferation|nerve growth factor receptor signaling pathway|regulation of transcription, DNA-dependent	cytoplasm|plasma membrane|protein complex	protein binding			ovary(3)	3	Ovarian(276;0.236)					ATACACTGATGTTTATCCAGA	0.493										Multiple Myeloma(10;0.10)			22	124	---	---	---	---	PASS
HSD17B10	3028	broad.mit.edu	37	X	53459056	53459056	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53459056G>A	uc004dsl.1	-	4	397	c.366C>T	c.(364-366)CTC>CTT	p.L122L	HSD17B10_uc004dsm.1_Silent_p.L122L	NM_004493	NP_004484	Q99714	HCD2_HUMAN	hydroxysteroid (17-beta) dehydrogenase 10	122					branched chain family amino acid catabolic process|lipid metabolic process|tRNA processing	mitochondrial matrix|plasma membrane	3-hydroxy-2-methylbutyryl-CoA dehydrogenase activity|3-hydroxyacyl-CoA dehydrogenase activity|cholate 7-alpha-dehydrogenase activity				0					NADH(DB00157)	AGGTGCCCATGAGATTCACCT	0.537													10	124	---	---	---	---	PASS
FGD1	2245	broad.mit.edu	37	X	54476175	54476175	+	Missense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54476175G>T	uc004dtg.2	-	14	2799	c.2065C>A	c.(2065-2067)CTG>ATG	p.L689M	FGD1_uc011moi.1_Missense_Mutation_p.L447M	NM_004463	NP_004454	P98174	FGD1_HUMAN	faciogenital dysplasia protein	689	PH 1.				actin cytoskeleton organization|apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|organ morphogenesis|regulation of Cdc42 GTPase activity|regulation of cell shape|small GTPase mediated signal transduction	cytoskeleton|cytosol|Golgi apparatus|lamellipodium|nucleus|plasma membrane|ruffle	metal ion binding|Rho guanyl-nucleotide exchange factor activity|small GTPase binding			ovary(3)|skin(2)|central_nervous_system(1)	6						TCATGCTTCAGGAGGGTGGAG	0.517													8	130	---	---	---	---	PASS
GNL3L	54552	broad.mit.edu	37	X	54566564	54566564	+	Intron	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54566564C>T	uc004dth.1	+						GNL3L_uc004dti.2_Intron	NM_019067	NP_061940	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3						ribosome biogenesis	nucleolus	GTP binding			ovary(1)	1						TATGTGGTGGCCAGCCTGCAA	0.448													4	26	---	---	---	---	PASS
TRO	7216	broad.mit.edu	37	X	54954175	54954175	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54954175C>T	uc004dtq.2	+	11	1946	c.1839C>T	c.(1837-1839)CAC>CAT	p.H613H	TRO_uc004dts.2_Silent_p.H613H|TRO_uc004dtr.2_Silent_p.H613H|TRO_uc004dtt.2_RNA|TRO_uc004dtu.2_RNA|TRO_uc004dtv.2_Silent_p.H216H|TRO_uc011mok.1_Silent_p.H144H|TRO_uc004dtw.2_Silent_p.H216H|TRO_uc004dtx.2_Translation_Start_Site	NM_001039705	NP_001034794	Q12816	TROP_HUMAN	trophinin isoform 5	613	MAGE.				embryo implantation|homophilic cell adhesion	integral to plasma membrane				ovary(1)	1						GCTCCTACCACGAGACTAGCA	0.502													4	72	---	---	---	---	PASS
EFNB1	1947	broad.mit.edu	37	X	68060194	68060194	+	Silent	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68060194C>T	uc004dxd.3	+	5	1518	c.738C>T	c.(736-738)GCC>GCT	p.A246A	EFNB1_uc004dxe.2_Silent_p.A246A	NM_004429	NP_004420	P98172	EFNB1_HUMAN	ephrin-B1 precursor	246	Helical; (Potential).				cell adhesion|cell-cell signaling	integral to plasma membrane|soluble fraction|synapse	ephrin receptor binding				0						CTGTCGGTGCCGGTTGCGTCA	0.612													8	41	---	---	---	---	PASS
HDX	139324	broad.mit.edu	37	X	83723684	83723684	+	Missense_Mutation	SNP	C	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:83723684C>T	uc004eek.1	-	3	1156	c.1047G>A	c.(1045-1047)ATG>ATA	p.M349I	HDX_uc011mqv.1_Missense_Mutation_p.M349I|HDX_uc004eel.1_Missense_Mutation_p.M291I	NM_144657	NP_653258	Q7Z353	HDX_HUMAN	highly divergent homeobox	349						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)|ovary(1)	2						GTGAATTTGGCATATTTCTTC	0.408													8	117	---	---	---	---	PASS
BHLHB9	80823	broad.mit.edu	37	X	102005284	102005284	+	Missense_Mutation	SNP	C	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:102005284C>G	uc010nog.2	+	4	1932	c.1361C>G	c.(1360-1362)TCC>TGC	p.S454C	BHLHB9_uc011mrq.1_Missense_Mutation_p.S454C|BHLHB9_uc011mrr.1_Missense_Mutation_p.S454C|BHLHB9_uc011mrs.1_Missense_Mutation_p.S454C|BHLHB9_uc011mrt.1_Missense_Mutation_p.S454C|BHLHB9_uc004ejo.2_Missense_Mutation_p.S454C|BHLHB9_uc011mru.1_Missense_Mutation_p.S454C|BHLHB9_uc011mrv.1_Missense_Mutation_p.S454C	NM_001142526	NP_001135998	Q6PI77	BHLH9_HUMAN	basic helix-loop-helix domain containing, class	454						cytoplasm|nucleus	binding			ovary(2)	2						CATTTGCTGTCCTCAGGAAAT	0.368													19	159	---	---	---	---	PASS
CXorf41	139212	broad.mit.edu	37	X	106462113	106462113	+	Silent	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106462113G>A	uc004enc.2	+	4	308	c.246G>A	c.(244-246)GAG>GAA	p.E82E	CXorf41_uc004end.2_Silent_p.E82E	NM_173494	NP_775765	Q9NQM4	CX041_HUMAN	hypothetical protein LOC139212	82											0						AAACCAGCGAGGAAAATAATG	0.398													3	60	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111195610	111195610	+	Silent	SNP	C	T	T	rs150908311	byFrequency	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111195610C>T	uc004epl.1	-	2	958	c.39G>A	c.(37-39)CCG>CCA	p.P13P	TRPC5_uc004epm.1_Silent_p.P13P	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	13	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						GGTCTCTGTACGGTGAGTAGT	0.483													6	122	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119680457	119680457	+	Missense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119680457C>A	uc004esw.2	-	6	1282	c.845G>T	c.(844-846)AGC>ATC	p.S282I	CUL4B_uc010nqq.2_5'UTR|CUL4B_uc004esv.2_Missense_Mutation_p.S264I	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	282					cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						AAAAAGAACGCTATCCAATGA	0.333													6	54	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123019782	123019782	+	Nonsense_Mutation	SNP	C	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123019782C>A	uc010nqu.2	+	2	396	c.270C>A	c.(268-270)TGC>TGA	p.C90*	XIAP_uc004etx.2_Nonsense_Mutation_p.C90*|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	90	BIR 1.				anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						CCCCAAATTGCAGATTTATCA	0.423									X-linked_Lymphoproliferative_syndrome				21	131	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	124097472	124097472	+	Missense_Mutation	SNP	T	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:124097472T>C	uc004euj.2	-	1	195	c.131A>G	c.(130-132)GAG>GGG	p.E44G	ODZ1_uc011muj.1_Missense_Mutation_p.E44G|ODZ1_uc010nqy.2_Missense_Mutation_p.E44G	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	44	Teneurin N-terminal.|Cytoplasmic (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding	p.E44K(1)		ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						GTGCAGGGTCTCCCTGGAGTT	0.408													8	487	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128674794	128674794	+	Missense_Mutation	SNP	A	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128674794A>T	uc004euq.2	+	2	278	c.113A>T	c.(112-114)CAA>CTA	p.Q38L	OCRL_uc004eur.2_Missense_Mutation_p.Q38L	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	38					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						AGGAACGGGCAATATGAGTAA	0.597													12	105	---	---	---	---	PASS
ARHGAP36	158763	broad.mit.edu	37	X	130220305	130220305	+	Silent	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130220305G>T	uc004evz.2	+	10	1629	c.1284G>T	c.(1282-1284)GTG>GTT	p.V428V	ARHGAP36_uc004ewa.2_Silent_p.V416V|ARHGAP36_uc004ewb.2_Silent_p.V397V|ARHGAP36_uc004ewc.2_Silent_p.V292V	NM_144967	NP_659404	Q6ZRI8	RHG36_HUMAN	hypothetical protein LOC158763 precursor	428					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(3)	3						ACCCTCAGGTGCCTCCCCATA	0.483													7	78	---	---	---	---	PASS
EMD	2010	broad.mit.edu	37	X	153609143	153609143	+	Missense_Mutation	SNP	G	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153609143G>A	uc004fkl.2	+	5	678	c.430G>A	c.(430-432)GAA>AAA	p.E144K		NM_000117	NP_000108	P50402	EMD_HUMAN	emerin	144	Interaction with F-actin (Probable).				cellular response to growth factor stimulus|muscle contraction|muscle organ development|negative regulation of catenin import into nucleus|negative regulation of fibroblast proliferation|positive regulation of protein export from nucleus|regulation of canonical Wnt receptor signaling pathway	endoplasmic reticulum|integral to membrane|microtubule|nuclear inner membrane|nuclear outer membrane	actin binding|beta-tubulin binding				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GTCTTCTTCTGAAGAGGAGTG	0.612													18	204	---	---	---	---	PASS
EMD	2010	broad.mit.edu	37	X	153609540	153609540	+	Nonsense_Mutation	SNP	G	T	T			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153609540G>T	uc004fkl.2	+	6	996	c.748G>T	c.(748-750)GAA>TAA	p.E250*		NM_000117	NP_000108	P50402	EMD_HUMAN	emerin	250					cellular response to growth factor stimulus|muscle contraction|muscle organ development|negative regulation of catenin import into nucleus|negative regulation of fibroblast proliferation|positive regulation of protein export from nucleus|regulation of canonical Wnt receptor signaling pathway	endoplasmic reticulum|integral to membrane|microtubule|nuclear inner membrane|nuclear outer membrane	actin binding|beta-tubulin binding				0	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCAGGCTGAAGAAGGCAACCC	0.527													9	79	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	10241	10242	+	5'Flank	INS	-	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10241_10242insA	uc001aaa.3	+						uc010nxq.1_5'Flank|uc010nxr.1_5'Flank					Homo sapiens mRNA for DEAD/H box polypeptide 11 like 1 (DDX11L1 gene).																		cccctaaccctaaccctaaacc	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	100288423	100288431	+	IGR	DEL	CCTCTACCT	-	-	rs71075457		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:100288423_100288431delCCTCTACCT								FRRS1 (57074 upstream) : AGL (27209 downstream)																							tctacctctacctctacctcctctacctc	0.105													6	5	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148023147	148023147	+	Intron	DEL	G	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148023147delG	uc001eqf.2	-						LOC200030_uc001eqe.2_Intron|LOC200030_uc001eqg.2_Intron|FLJ39739_uc001eqo.1_Intron|NBPF14_uc010pab.1_Intron|NBPF14_uc010pac.1_Intron|NBPF14_uc001eqx.2_Intron|NBPF14_uc010pae.1_Intron|NBPF14_uc010paf.1_Intron|NBPF14_uc009wkf.1_Intron|NBPF14_uc001eqq.2_Intron|NBPF14_uc001eqs.1_Intron	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						TGAGCCAGGTGGGACAGAGAT	0.507													7	6	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790790	153790790	+	Intron	DEL	C	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790790delC	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TCAAGGttttctttttttttt	0.189													4	3	---	---	---	---	
DAP3	7818	broad.mit.edu	37	1	155697259	155697260	+	Intron	INS	-	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155697259_155697260insA	uc001flq.2	+						DAP3_uc001flr.2_Intron|DAP3_uc001fls.2_Intron|DAP3_uc010pgl.1_Intron|DAP3_uc001flt.2_Intron|DAP3_uc001flu.2_Intron|DAP3_uc010pgm.1_Intron	NM_033657	NP_387506	P51398	RT29_HUMAN	death-associated protein 3						induction of apoptosis by extracellular signals	mitochondrial ribosome|nucleolus|small ribosomal subunit	protein binding			ovary(1)	1	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					gaccctgtctcaaaaaaaaaaa	0.099													6	3	---	---	---	---	
RIT1	6016	broad.mit.edu	37	1	155880754	155880755	+	Intron	INS	-	C	C	rs11387126		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155880754_155880755insC	uc001fmh.1	-						RIT1_uc010pgr.1_Intron	NM_006912	NP_008843	Q92963	RIT1_HUMAN	Ras-like without CAAX 1						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			breast(1)	1	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;1.79e-05)			GCCCTAAGAAACCCCCCCATCT	0.455													6	3	---	---	---	---	
DARS2	55157	broad.mit.edu	37	1	173819744	173819744	+	Intron	DEL	T	-	-	rs66665709		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173819744delT	uc001gjh.1	+							NM_018122	NP_060592	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial						tRNA aminoacylation for protein translation	mitochondrial matrix|nucleus	aspartate-tRNA ligase activity|ATP binding|nucleic acid binding			central_nervous_system(2)	2					L-Aspartic Acid(DB00128)	TGCATAAATCttttttttttt	0.184													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89875638	89875642	+	IGR	DEL	GGAAA	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89875638_89875642delGGAAA								FLJ40330 (769513 upstream) : None (None downstream)																							caaccctagtggaaaggaatgatat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	97691619	97691620	+	IGR	INS	-	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97691619_97691620insA								FAM178B (39318 upstream) : FAHD2B (57704 downstream)																							CACTAAAGTACAAAAAAGCCTG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232451695	232451696	+	IGR	INS	-	A	A	rs78686494		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232451695_232451696insA								NMUR1 (56513 upstream) : C2orf57 (5916 downstream)																							CTTTTCACCAGAAAAAAAAAAA	0.178													6	3	---	---	---	---	
KIF1A	547	broad.mit.edu	37	2	241723311	241723311	+	Intron	DEL	C	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241723311delC	uc002vzy.2	-						KIF1A_uc010fzk.2_Intron|KIF1A_uc002vzz.1_Intron	NM_004321	NP_004312	Q12756	KIF1A_HUMAN	axonal transport of synaptic vesicles						anterograde axon cargo transport	cytoplasm|microtubule|nucleus	ATP binding|microtubule motor activity			lung(1)	1		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		GGCAAGGTCTCCACAGCTGTT	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	32677110	32677111	+	IGR	INS	-	G	G	rs148064913	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32677110_32677111insG								DYNC1LI1 (64760 upstream) : CNOT10 (49587 downstream)																							CCAGGACGCGAGAAAAAAAAAA	0.292													3	5	---	---	---	---	
XCR1	2829	broad.mit.edu	37	3	46065707	46065707	+	Intron	DEL	A	-	-	rs35174940		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46065707delA	uc003cpe.2	-						XCR1_uc003cpf.2_Intron	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1						chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TTAATCCAGCAAAAAAAAAAA	0.388													5	3	---	---	---	---	
MON1A	84315	broad.mit.edu	37	3	49948682	49948684	+	Intron	DEL	TTG	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:49948682_49948684delTTG	uc003cxz.2	-						MON1A_uc003cya.2_Intron|MON1A_uc003cyb.2_Intron	NM_032355	NP_115731	Q86VX9	MON1A_HUMAN	MON1 homolog A isoform a								protein binding			ovary(2)	2				BRCA - Breast invasive adenocarcinoma(193;4.62e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		tagatagaGTttgttgttgttgt	0.271													4	2	---	---	---	---	
MAN2B2	23324	broad.mit.edu	37	4	6581122	6581123	+	Intron	INS	-	CAC	CAC	rs141552652	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:6581122_6581123insCAC	uc003gjf.1	+						MAN2B2_uc003gje.1_Intron|MAN2B2_uc011bwf.1_Intron	NM_015274	NP_056089	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2						mannose metabolic process	extracellular region	alpha-mannosidase activity|carbohydrate binding|zinc ion binding			ovary(2)	2						cccttcaccatcaccaccacca	0.000													9	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49113504	49113504	+	IGR	DEL	A	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49113504delA								CWH43 (49411 upstream) : None (None downstream)																							attccattccattccattcca	0.000													4	2	---	---	---	---	
COX18	285521	broad.mit.edu	37	4	73927448	73927448	+	Intron	DEL	G	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73927448delG	uc003hgm.1	-						COX18_uc003hgn.1_Intron|COX18_uc011cbc.1_Intron|COX18_uc010iih.1_Intron	NM_173827	NP_776188	Q8N8Q8	COX18_HUMAN	mitochondrial COX18 precursor						protein insertion into mitochondrial membrane|respiratory chain complex IV assembly	integral to mitochondrial inner membrane	protein transporter activity				0	Breast(15;0.00096)		Epithelial(6;1.26e-06)|OV - Ovarian serous cystadenocarcinoma(6;9.45e-06)|all cancers(17;2.05e-05)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			aaaaaaaaaagaaGAGGCAGG	0.239													7	4	---	---	---	---	
ANK2	287	broad.mit.edu	37	4	114274006	114274007	+	Intron	INS	-	T	T	rs34053670	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114274006_114274007insT	uc003ibe.3	+						ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_5'Flank|ANK2_uc011cgb.1_Intron	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1						axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTTTTCAGTTGTTTTTTTTTTC	0.431													4	2	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37292320	37292321	+	Intron	DEL	TT	-	-	rs34382591		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37292320_37292321delTT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATTTGAAGAtttttttttttt	0.168													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	90475785	90475786	+	IGR	INS	-	A	A	rs140241795	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:90475785_90475786insA								GPR98 (15753 upstream) : ARRDC3 (188755 downstream)																							aggaaggaaggaggaaggaagg	0.030													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	180165983	180165984	+	IGR	INS	-	C	C	rs2054696	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180165983_180165984insC								FLT4 (89359 upstream) : OR2Y1 (139 downstream)																							tgttccccccgccaccaaaaaa	0.188													9	4	---	---	---	---	
RSPH9	221421	broad.mit.edu	37	6	43623774	43623782	+	Intron	DEL	CCCTTCTTT	-	-	rs70993404		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43623774_43623782delCCCTTCTTT	uc003ovw.1	+						RSPH9_uc003ovx.1_Intron	NM_152732	NP_689945	Q9H1X1	RSPH9_HUMAN	radial spoke head 9 homolog						cilium axoneme assembly|cilium movement	cytoplasm|cytoskeleton				upper_aerodigestive_tract(1)|skin(1)	2						tccttccttccccttctttcccttctttc	0.129									Kartagener_syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	73308513	73308513	+	IGR	DEL	T	-	-	rs1147570	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:73308513delT								RIMS1 (196006 upstream) : KCNQ5 (23058 downstream)																							AAATCGAGGGTTTTTTTTTTT	0.363													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		gcccggccCCttttttttttt	0.149													4	2	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75990616	75990617	+	5'Flank	INS	-	AAAAAAAAAAA	AAAAAAAAAAA			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75990616_75990617insAAAAAAAAAAA	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						gactccgtctcaaaaaaaaaaa	0.243													5	3	---	---	---	---	
UBN2	254048	broad.mit.edu	37	7	138936950	138936950	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138936950delT	uc011kqr.1	+							NM_173569	NP_775840	Q6ZU65	UBN2_HUMAN	ubinuclein 2											ovary(1)|skin(1)	2						TTCTTTACCCTTTTTTTTTTT	0.284													3	3	---	---	---	---	
KIAA1147	57189	broad.mit.edu	37	7	141374031	141374032	+	Intron	DEL	AC	-	-	rs35125206		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141374031_141374032delAC	uc003vwk.2	-							NM_001080392	NP_001073861	A4D1U4	LCHN_HUMAN	hypothetical protein LOC57189											ovary(1)	1	Melanoma(164;0.0171)					CTGCAGAAAAacacacacacac	0.490													4	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	153844580	153844580	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:153844580delT	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlj.2_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ccttcctttcttTTTCTGTcg	0.119													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	42640964	42640967	+	IGR	DEL	AAAG	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:42640964_42640967delAAAG								CHRNA6 (17345 upstream) : THAP1 (50851 downstream)																							gaaggaaggaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
SNAI2	6591	broad.mit.edu	37	8	49831218	49831219	+	3'UTR	DEL	GT	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49831218_49831219delGT	uc003xqp.2	-	3						NM_003068	NP_003059	O43623	SNAI2_HUMAN	snail 2						canonical Wnt receptor signaling pathway|ectoderm and mesoderm interaction|multicellular organismal development|negative regulation of transcription from RNA polymerase II promoter|osteoblast differentiation|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2		all_cancers(86;0.0368)|all_epithelial(80;0.000624)|Lung NSC(129;0.0019)|all_lung(136;0.00502)				CTCTCtgtgggtgtgtgtgtgt	0.282													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58844436	58844437	+	IGR	INS	-	G	G	rs140041203	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58844436_58844437insG								C8orf71 (647148 upstream) : FAM110B (62676 downstream)																							gaggaagggaagagggagggag	0.000													3	3	---	---	---	---	
RECQL4	9401	broad.mit.edu	37	8	145738594	145738594	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145738594delT	uc003zdj.2	-							NM_004260	NP_004251	O94761	RECQ4_HUMAN	RecQ protein-like 4						DNA duplex unwinding|DNA recombination|DNA repair	cytoplasm|nucleus	ATP binding|ATP-dependent 3'-5' DNA helicase activity|bubble DNA binding|DNA strand annealing activity|zinc ion binding			breast(2)|lung(1)|skin(1)	4	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGGGGGGGGGTGCCAACCTGG	0.706			N|F|S			osteosarcoma|skin basal and sqamous cell		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	RAPADILINO_syndrome|Rothmund-Thomson_syndrome|Baller-Gerold_syndrome				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	44109097	44109098	+	IGR	INS	-	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:44109097_44109098insA								FAM75A6 (478367 upstream) : FAM27C (881138 downstream)																							ATAAAGGTCTCAAAAATCCAGA	0.347													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68421236	68421236	+	IGR	DEL	T	-	-	rs67952768		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68421236delT								FAM27B (627047 upstream) : MIR1299 (581003 downstream)																							CCCGGGGATCTCCTTAAAATG	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68426278	68426278	+	IGR	DEL	G	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68426278delG								FAM27B (632089 upstream) : MIR1299 (575961 downstream)																							GTTTGTGCCAGGAAAGCCAGT	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	92861202	92861202	+	IGR	DEL	C	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:92861202delC								LOC100129066 (526528 upstream) : DIRAS2 (510912 downstream)																							agcacacatgccacatcacac	0.075													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	99685055	99685056	+	IGR	INS	-	A	A			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:99685055_99685056insA								LOC441454 (12319 upstream) : FAM22G (5536 downstream)																							gactccgtctcaaaaaaaaaaa	0.178													7	4	---	---	---	---	
C5	727	broad.mit.edu	37	9	123725783	123725783	+	Intron	DEL	A	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123725783delA	uc004bkv.2	-							NM_001735	NP_001726	P01031	CO5_HUMAN	complement component 5 preproprotein						activation of MAPK activity|chemotaxis|complement activation, alternative pathway|complement activation, classical pathway|cytolysis|G-protein coupled receptor protein signaling pathway|inflammatory response|negative regulation of macrophage chemotaxis|positive regulation of chemokine secretion|positive regulation vascular endothelial growth factor production	extracellular space|membrane attack complex	chemokine activity|endopeptidase inhibitor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)	atccacctccaaaaaaaaaaa	0.104													4	2	---	---	---	---	
BAT2L1	84726	broad.mit.edu	37	9	134348819	134348819	+	Intron	DEL	G	-	-	rs5900941		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134348819delG	uc004can.3	+						BAT2L1_uc010mzj.1_Intron|BAT2L1_uc004cao.3_Intron	NM_013318	NP_037450	Q5JSZ5	PRC2B_HUMAN	HLA-B associated transcript 2-like								protein binding				0						TAACTTCTTTGGGCCTTTGGT	0.478													6	3	---	---	---	---	
CARD9	64170	broad.mit.edu	37	9	139259410	139259411	+	Intron	INS	-	AGG	AGG	rs146336925	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139259410_139259411insAGG	uc004chg.3	-						DNLZ_uc004chf.1_5'Flank|DNLZ_uc011mdv.1_5'Flank|CARD9_uc011mdw.1_Intron	NM_052813	NP_434700	Q9H257	CARD9_HUMAN	caspase recruitment domain protein 9 isoform 1						positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of JNK cascade|positive regulation of stress-activated MAPK cascade|regulation of apoptosis	cytoplasm	CARD domain binding|protein homodimerization activity			pancreas(1)|lung(1)|skin(1)	3		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GTGCCCAAGAAAGGGGGATCCA	0.624													3	3	---	---	---	---	
STK32C	282974	broad.mit.edu	37	10	134145420	134145421	+	Intron	INS	-	C	C	rs71013521		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134145420_134145421insC	uc009ybd.1	-						STK32C_uc010quu.1_5'Flank|STK32C_uc009ybc.1_5'Flank|LRRC27_uc001llf.2_5'Flank|LRRC27_uc010quv.1_5'Flank|LRRC27_uc010quw.1_5'Flank|LRRC27_uc001llg.2_5'Flank|LRRC27_uc001lli.2_5'Flank			Q86UX6	ST32C_HUMAN	Homo sapiens cDNA FLJ25120 fis, clone CBR06020.								ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(2)|lung(2)|breast(1)	5		all_cancers(35;2.72e-11)|all_epithelial(44;2.33e-08)|Lung NSC(174;0.000855)|all_lung(145;0.00146)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.112)|Melanoma(40;0.124)|Glioma(114;0.203)		Epithelial(32;3.99e-05)|all cancers(32;5.58e-05)|OV - Ovarian serous cystadenocarcinoma(35;9.96e-05)|BRCA - Breast invasive adenocarcinoma(275;0.222)		GCGCACCACAACCCCCCCACCG	0.772													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	321076	321077	+	Intron	INS	-	A	A	rs144605457	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:321076_321077insA	uc001loz.2	+						IFITM3_uc001lpa.2_5'Flank					Homo sapiens cDNA clone IMAGE:5200448, partial cds.																		TAGTGGTGTGGGGTCCTGGAGA	0.609													4	2	---	---	---	---	
ELP4	26610	broad.mit.edu	37	11	31785302	31785302	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31785302delT	uc001mtb.2	+						ELP4_uc001mtc.2_Intron|ELP4_uc010rdz.1_Intron	NM_019040	NP_061913	Q96EB1	ELP4_HUMAN	elongation protein 4 homolog						histone acetylation|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|DNA-directed RNA polymerase II, holoenzyme|Elongator holoenzyme complex|transcription elongation factor complex	phosphorylase kinase regulator activity|protein binding			upper_aerodigestive_tract(1)|ovary(1)|prostate(1)	3	Lung SC(675;0.225)					GAATGGTACCTTTTTTTTTTA	0.299													4	2	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76876976	76876977	+	Intron	INS	-	T	T	rs139393824	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76876976_76876977insT	uc001oyb.2	+						MYO7A_uc010rsl.1_Intron|MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						aggcctcagggcccccgtcatg	0.243													4	3	---	---	---	---	
DDX6	1656	broad.mit.edu	37	11	118630858	118630859	+	Intron	INS	-	A	A	rs148351786	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118630858_118630859insA	uc001pub.2	-						DDX6_uc001pua.2_5'Flank|DDX6_uc001puc.2_Intron	NM_004397	NP_004388	P26196	DDX6_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 6						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay	cytoplasmic mRNA processing body|cytosol|RNA-induced silencing complex|stress granule	ATP binding|ATP-dependent helicase activity|protein binding|RNA binding|RNA helicase activity			ovary(1)	1	all_hematologic(175;0.0839)	Renal(330;0.0183)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)|Hepatocellular(160;0.0893)|Breast(348;0.0979)|all_hematologic(192;0.103)		OV - Ovarian serous cystadenocarcinoma(223;3.39e-06)|BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Colorectal(284;0.0377)		AAGCATCCATGAAATGTTCCTG	0.347			T	IGH@	B-NHL								7	4	---	---	---	---	
CACNA2D4	93589	broad.mit.edu	37	12	1909657	1909657	+	Intron	DEL	C	-	-	rs111637110		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:1909657delC	uc001qjp.2	-						CACNA2D4_uc009zds.1_Intron|CACNA2D4_uc001qjo.2_Intron|CACNA2D4_uc001qjs.1_Intron|CACNA2D4_uc010sdw.1_Intron|CACNA2D4_uc009zdr.1_Intron	NM_172364	NP_758952	Q7Z3S7	CA2D4_HUMAN	voltage-gated calcium channel alpha(2)delta-4							integral to membrane	calcium channel activity|metal ion binding|voltage-gated ion channel activity			ovary(1)	1	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		GGTGAGGGTGCCCCCCCCCCA	0.667											OREG0021569	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	12	7	---	---	---	---	
KLRF1	51348	broad.mit.edu	37	12	9994746	9994747	+	Intron	INS	-	TG	TG	rs139435558	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9994746_9994747insTG	uc010sgw.1	+						KLRF1_uc009zgw.2_Intron|KLRF1_uc009zgx.2_Intron|KLRF1_uc001qwm.2_Intron|KLRF1_uc009zgy.2_Intron|KLRF1_uc009zgz.2_Intron|KLRF1_uc009zha.2_Intron	NM_016523	NP_057607	Q9NZS2	KLRF1_HUMAN	killer cell lectin-like receptor subfamily F,						cell surface receptor linked signaling pathway	integral to plasma membrane	MHC class I receptor activity|sugar binding			large_intestine(1)	1						CAACTTGCAATTGTGTGTGTGT	0.178													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	69594096	69594102	+	IGR	DEL	AAGAGAT	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:69594096_69594102delAAGAGAT								CPM (237076 upstream) : CPSF6 (39215 downstream)																							agagataagaaagagataagagataag	0.024													5	3	---	---	---	---	
KDM2B	84678	broad.mit.edu	37	12	122018158	122018158	+	Intron	DEL	G	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122018158delG	uc001uat.2	-						KDM2B_uc001uas.2_5'UTR|KDM2B_uc001uau.2_Intron|KDM2B_uc001uav.3_Intron	NM_032590	NP_115979	Q8NHM5	KDM2B_HUMAN	F-box and leucine-rich repeat protein 10 isoform						embryonic camera-type eye morphogenesis|fourth ventricle development|histone H2A monoubiquitination|initiation of neural tube closure|lateral ventricle development|midbrain development|midbrain-hindbrain boundary morphogenesis|negative regulation of neural precursor cell proliferation|negative regulation of neuron apoptosis|negative regulation of transcription from RNA polymerase II promoter|spermatogenesis|third ventricle development|transcription, DNA-dependent	nucleolus	DNA binding|histone demethylase activity (H3-K36 specific)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|protein binding|rRNA binding|zinc ion binding			ovary(1)|skin(1)	2						CAGCAGTTGTGGGGGGGGGGA	0.552													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	52482448	52482452	+	IGR	DEL	GGGGT	-	-	rs113880756	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52482448_52482452delGGGGT								CCDC70 (42077 upstream) : ATP7B (24354 downstream)																							TGTGGGGGTGGGGGTGGGGGCAAAA	0.532													10	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	102989877	102989878	+	IGR	INS	-	AGAGAGAG	AGAGAGAG	rs149529753	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102989877_102989878insAGAGAGAG								ANKRD9 (13749 upstream) : RCOR1 (69355 downstream)																							ggaagaaagaaagAGAAAAAAA	0.272													5	4	---	---	---	---	
USP8	9101	broad.mit.edu	37	15	50731132	50731132	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50731132delT	uc001zym.3	+						USP8_uc001zyk.1_Intron|USP8_uc001zyl.3_Intron|USP8_uc001zyn.3_Intron|USP8_uc010ufh.1_Intron|USP8_uc010bev.1_5'Flank	NM_001128611	NP_001122083	P40818	UBP8_HUMAN	ubiquitin specific peptidase 8						cell cycle|cell proliferation|endosome organization|protein K48-linked deubiquitination|protein K63-linked deubiquitination|ubiquitin-dependent protein catabolic process	cytosol|early endosome|extrinsic to plasma membrane|nucleus	cysteine-type endopeptidase activity|SH3 domain binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			lung(1)|central_nervous_system(1)	2				all cancers(107;0.000225)|GBM - Glioblastoma multiforme(94;0.000771)		GGTTTAGGAATTTTTTTTTTT	0.264													4	2	---	---	---	---	
IQCK	124152	broad.mit.edu	37	16	19830814	19830814	+	Intron	DEL	A	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19830814delA	uc002dgr.2	+						IQCK_uc002dgs.2_Intron|IQCK_uc010vat.1_Intron|IQCK_uc010bwc.2_Intron|IQCK_uc010vau.1_Intron	NM_153208	NP_694940	Q8N0W5	IQCK_HUMAN	IQ motif containing K											skin(1)	1						gactccatctaaaaaaaaaaa	0.154													4	2	---	---	---	---	
LOC100132247	100132247	broad.mit.edu	37	16	22545666	22545684	+	Frame_Shift_Del	DEL	TGAGCGTCTGCGGGGGCCG	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22545666_22545684delTGAGCGTCTGCGGGGGCCG	uc010bxg.2	+	9	1544_1562	c.1362_1380delTGAGCGTCTGCGGGGGCCG	c.(1360-1380)GCTGAGCGTCTGCGGGGGCCGfs	p.A454fs	LOC100132247_uc010vbv.1_Frame_Shift_Del_p.A454fs|LOC100132247_uc010vbw.1_Frame_Shift_Del_p.A454fs|LOC100132247_uc010bxi.2_Frame_Shift_Del_p.A435fs|LOC100132247_uc010bxk.2_Frame_Shift_Del_p.A271fs	NM_001135865	NP_001129337	A8MRT5	K220L_HUMAN	hypothetical protein LOC100132247	454_460	Pro-rich.					integral to membrane					0						AGACACCTGCTGAGCGTCTGCGGGGGCCGCTTCCACCCT	0.557													3	4	---	---	---	---	
SEZ6L2	26470	broad.mit.edu	37	16	29910430	29910431	+	5'UTR	DEL	TG	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29910430_29910431delTG	uc002duq.3	-	1					uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_5'UTR|SEZ6L2_uc002dur.3_5'UTR|SEZ6L2_uc002dus.3_5'UTR|SEZ6L2_uc010vec.1_5'UTR|SEZ6L2_uc010ved.1_5'UTR|ASPHD1_uc002dut.2_5'Flank|ASPHD1_uc002duu.3_5'Flank|ASPHD1_uc010bzi.2_5'Flank	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						TCCCTTTAATTGtttttttttt	0.485													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32490434	32490434	+	IGR	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32490434delT								HERC2P4 (326560 upstream) : TP53TG3B (194407 downstream)																							ACTGATTGGCTGGGGGATGAG	0.383													4	2	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76482606	76482606	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76482606delT	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						GAAGGGAACCTTTTTTTTTTT	0.393													5	3	---	---	---	---	
CMIP	80790	broad.mit.edu	37	16	81533877	81533878	+	Intron	INS	-	TCCT	TCCT	rs143054986	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:81533877_81533878insTCCT	uc002fgp.2	+						CMIP_uc002fgq.1_Intron	NM_198390	NP_938204	Q8IY22	CMIP_HUMAN	c-Maf-inducing protein isoform C-mip							cytoplasm|nucleus					0						ccttccttccgtccttccttcc	0.134													3	3	---	---	---	---	
C1QBP	708	broad.mit.edu	37	17	5338059	5338060	+	Intron	INS	-	A	A	rs138481159	by1000genomes	TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:5338059_5338060insA	uc002gby.1	-							NM_001212	NP_001203	Q07021	C1QBP_HUMAN	complement component 1, q subcomponent binding						blood coagulation, intrinsic pathway|immune response|interspecies interaction between organisms	mitochondrial matrix|nucleus|plasma membrane				ovary(1)	1						gtgctgggattataggcgtgag	0.193													3	3	---	---	---	---	
COPS3	8533	broad.mit.edu	37	17	17184550	17184551	+	5'UTR	INS	-	C	C			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17184550_17184551insC	uc002grd.2	-	1					COPS3_uc010vwv.1_5'Flank|COPS3_uc010vww.1_5'UTR	NM_003653	NP_003644	Q9UNS2	CSN3_HUMAN	COP9 constitutive photomorphogenic homolog						cullin deneddylation|response to light stimulus|signal transduction	cytoplasm|signalosome	protein binding			skin(1)	1						GCGGGAAAAGGCTGCCGCTCTG	0.668													4	2	---	---	---	---	
MED1	5469	broad.mit.edu	37	17	37596270	37596271	+	Intron	INS	-	GAAA	GAAA			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37596270_37596271insGAAA	uc002hrv.3	-						MED1_uc010wee.1_Intron|MED1_uc002hru.2_Intron	NM_004774	NP_004765	Q15648	MED1_HUMAN	mediator complex subunit 1						androgen biosynthetic process|androgen receptor signaling pathway|cellular lipid metabolic process|fat cell differentiation|positive regulation of transcription from RNA polymerase II promoter|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription initiation from RNA polymerase II promoter	mediator complex	DNA binding|estrogen receptor binding|ligand-dependent nuclear receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|peroxisome proliferator activated receptor binding|receptor activity|retinoic acid receptor binding|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			lung(2)|ovary(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	8		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		aaggaaggaaggaaagaaagaa	0.000										HNSCC(31;0.082)			4	2	---	---	---	---	
RBBP8	5932	broad.mit.edu	37	18	20526616	20526616	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20526616delT	uc002ktw.2	+						RBBP8_uc002kty.2_Intron|RBBP8_uc002ktz.2_Intron|RBBP8_uc002kua.2_Intron|RBBP8_uc002ktx.1_Intron	NM_002894	NP_002885	Q99708	COM1_HUMAN	retinoblastoma binding protein 8 isoform a						cell cycle checkpoint|DNA double-strand break processing involved in repair via single-strand annealing|meiosis|regulation of transcription from RNA polymerase II promoter	nucleus	damaged DNA binding|protein binding|single-stranded DNA specific endodeoxyribonuclease activity			ovary(1)|lung(1)|skin(1)	3	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			TCAGCAGCAGTTTTTTTTTTC	0.269								Direct_reversal_of_damage|Homologous_recombination					4	2	---	---	---	---	
PQLC1	80148	broad.mit.edu	37	18	77703664	77703665	+	Intron	INS	-	G	G			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77703664_77703665insG	uc002lnl.2	-						PQLC1_uc010dre.2_Intron|PQLC1_uc002lnk.2_Intron|PQLC1_uc010xfm.1_Intron	NM_025078	NP_079354	Q8N2U9	PQLC1_HUMAN	PQ loop repeat containing 1 isoform 1							integral to membrane				large_intestine(1)|ovary(1)	2		Esophageal squamous(42;0.0212)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;8.2e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0258)		GGGAGACACCTGGGTCAGGAGG	0.673													4	2	---	---	---	---	
CACNA1A	773	broad.mit.edu	37	19	13482465	13482465	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13482465delT	uc010dze.2	-						CACNA1A_uc002mwy.3_Intron	NM_001127221	NP_001120693	O00555	CAC1A_HUMAN	calcium channel, alpha 1A subunit isoform 3						cell death|elevation of cytosolic calcium ion concentration|energy reserve metabolic process|membrane depolarization|regulation of insulin secretion	cytoplasm|nucleus	syntaxin binding			large_intestine(2)	2			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Cinnarizine(DB00568)|Loperamide(DB00836)|Nisoldipine(DB00401)|Pregabalin(DB00230)	CTGGGGCCCGTGAGCAAACCC	0.612													3	5	---	---	---	---	
JOSD2	126119	broad.mit.edu	37	19	51011956	51011959	+	Intron	DEL	GTGT	-	-	rs143749342		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51011956_51011959delGTGT	uc002psn.1	-						JOSD2_uc002pso.1_Intron|JOSD2_uc002psp.1_Intron|JOSD2_uc002psq.1_Intron	NM_138334	NP_612207	Q8TAC2	JOS2_HUMAN	Josephin domain containing 2						protein deubiquitination		ubiquitin-specific protease activity				0		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00743)|GBM - Glioblastoma multiforme(134;0.0364)		GAAAACGCTCgtgtgtgtgtgtgt	0.471													4	3	---	---	---	---	
U2AF2	11338	broad.mit.edu	37	19	56181832	56181832	+	Intron	DEL	C	-	-	rs66835098		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56181832delC	uc002qlu.2	+						U2AF2_uc002qlt.2_Intron	NM_007279	NP_009210	P26368	U2AF2_HUMAN	U2 (RNU2) small nuclear RNA auxiliary factor 2						mRNA 3'-end processing|mRNA export from nucleus|termination of RNA polymerase II transcription	nucleoplasm|spliceosomal complex	enzyme binding|nucleotide binding|RNA binding			ovary(1)	1		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		ACCCTGCTGTCCCGTGCACCC	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10710739	10710739	+	IGR	DEL	T	-	-	rs71326346		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10710739delT								None (None upstream) : TPTE (196004 downstream)																							aacttctctgtgatgtgtgca	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10715466	10715466	+	IGR	DEL	A	-	-	rs145593257		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10715466delA								None (None upstream) : TPTE (191277 downstream)																							tgcagatcctaaaaaaagact	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14353155	14353155	+	IGR	DEL	A	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14353155delA								None (None upstream) : C21orf99 (57332 downstream)																							tgcacacctcacaaagaagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	42544516	42544517	+	IGR	DEL	AC	-	-	rs140105017		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42544516_42544517delAC								CYP2D7P1 (3941 upstream) : TCF20 (11502 downstream)																							tctcaagaaaacacacacacac	0.139													4	2	---	---	---	---	
ATP7A	538	broad.mit.edu	37	X	77299156	77299156	+	Intron	DEL	T	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:77299156delT	uc004ecx.3	+							NM_000052	NP_000043	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide						ATP biosynthetic process|blood vessel development|blood vessel remodeling|cartilage development|cellular copper ion homeostasis|cerebellar Purkinje cell differentiation|collagen fibril organization|copper ion import|detoxification of copper ion|dopamine metabolic process|elastic fiber assembly|elastin biosynthetic process|epinephrine metabolic process|hair follicle morphogenesis|locomotory behavior|lung alveolus development|negative regulation of metalloenzyme activity|neuroprotection|peptidyl-lysine modification|pigmentation|positive regulation of metalloenzyme activity|positive regulation of oxidoreductase activity|pyramidal neuron development|regulation of oxidative phosphorylation|removal of superoxide radicals|serotonin metabolic process|skin development|T-helper cell differentiation|tryptophan metabolic process	basolateral plasma membrane|cytosol|endoplasmic reticulum|endoplasmic reticulum|integral to membrane|late endosome|neuron projection|neuronal cell body|perinuclear region of cytoplasm|trans-Golgi network|trans-Golgi network transport vesicle	ATP binding|copper-dependent protein binding|copper-exporting ATPase activity|superoxide dismutase copper chaperone activity				0						TCCCTCCAACttttttttttt	0.129													6	4	---	---	---	---	
ACSL4	2182	broad.mit.edu	37	X	108908946	108908947	+	Intron	INS	-	A	A	rs145402329		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108908946_108908947insA	uc004eoi.2	-						ACSL4_uc004eoj.2_Intron|ACSL4_uc004eok.2_Intron|ACSL4_uc010npp.1_Intron	NM_022977	NP_075266	O60488	ACSL4_HUMAN	acyl-CoA synthetase long-chain family member 4						fatty acid metabolic process|learning or memory|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane|peroxisomal membrane	ATP binding|long-chain fatty acid-CoA ligase activity			large_intestine(1)|lung(1)|ovary(1)	3					Icosapent(DB00159)|Troglitazone(DB00197)	TAATTAAGTACAAAATATCTGT	0.252													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	155260416	155260416	+	5'Flank	DEL	G	-	-			TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:155260416delG	uc011nad.1	-											Homo sapiens partial mRNA for DEAD/H box polypeptide 11 like (DDX11L1 gene).																		ttaggggttaggggttagggg	0.000													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	58983162	58983163	+	IGR	INS	-	CACTA	CACTA	rs147469043		TCGA-39-5030-01	TCGA-39-5030-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:58983162_58983163insCACTA								None (None upstream) : None (None downstream)																							gcactgcactccactcaattcc	0.000													4	2	---	---	---	---	
