Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
ARHGEF16	27237	broad.mit.edu	37	1	3389705	3389705	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3389705C>T	uc001akg.3	+	7	1334	c.1086C>T	c.(1084-1086)ATC>ATT	p.I362I	ARHGEF16_uc001aki.2_Silent_p.I74I|ARHGEF16_uc001akj.2_Silent_p.I74I|ARHGEF16_uc009vli.1_Silent_p.I66I|ARHGEF16_uc010nzh.1_Silent_p.I66I	NM_014448	NP_055263	Q5VV41	ARHGG_HUMAN	Rho guanine exchange factor 16	362	DH.|Required for RHOG activation and mediates interaction with EPHA2.				activation of Cdc42 GTPase activity|activation of Rac GTPase activity|apoptosis|cell chemotaxis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|positive regulation of establishment of protein localization in plasma membrane|small GTPase mediated signal transduction	cytosol	PDZ domain binding|receptor tyrosine kinase binding|Rho GTPase binding|Rho guanyl-nucleotide exchange factor activity			ovary(1)	1	all_cancers(77;0.00276)|all_epithelial(69;0.00102)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.101)	all_epithelial(116;7.14e-21)|all_lung(118;2.24e-08)|Lung NSC(185;3.55e-06)|Breast(487;0.000765)|Renal(390;0.00121)|Hepatocellular(190;0.0046)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.211)		Epithelial(90;8.62e-38)|OV - Ovarian serous cystadenocarcinoma(86;3.62e-22)|GBM - Glioblastoma multiforme(42;2.49e-12)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.000681)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		TCAGTGACATCCTGGAGGAGC	0.622													12	24	---	---	---	---	PASS
H6PD	9563	broad.mit.edu	37	1	9323660	9323660	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:9323660C>A	uc001apt.2	+	5	1381	c.1108C>A	c.(1108-1110)CGG>AGG	p.R370R		NM_004285	NP_004276	O95479	G6PE_HUMAN	hexose-6-phosphate dehydrogenase precursor	370	Glucose 1-dehydrogenase.					endoplasmic reticulum lumen	6-phosphogluconolactonase activity|glucose 1-dehydrogenase|glucose-6-phosphate dehydrogenase activity|NADP binding				0	all_lung(157;0.23)	all_epithelial(116;1.28e-19)|all_lung(118;5.22e-06)|Lung NSC(185;1.98e-05)|Renal(390;0.000147)|Breast(348;0.00109)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;1.88e-07)|COAD - Colon adenocarcinoma(227;7.47e-05)|Kidney(185;0.000244)|KIRC - Kidney renal clear cell carcinoma(229;0.000905)|STAD - Stomach adenocarcinoma(132;0.00176)|BRCA - Breast invasive adenocarcinoma(304;0.00183)|READ - Rectum adenocarcinoma(331;0.0419)	NADH(DB00157)	GGGCTACGCTCGGATCTTGTT	0.617													4	45	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10228182	10228182	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10228182G>A	uc001aqs.3	+						UBE4B_uc001aqr.3_Intron|UBE4B_uc010oai.1_Intron|UBE4B_uc010oaj.1_Intron|UBE4B_uc001aqu.2_5'Flank	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1						apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCGTCTGTTCGATGTGTCCTA	0.552													10	33	---	---	---	---	PASS
UBE4B	10277	broad.mit.edu	37	1	10228233	10228233	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10228233G>A	uc001aqs.3	+	24	3951	c.3238G>A	c.(3238-3240)GAG>AAG	p.E1080K	UBE4B_uc001aqr.3_Missense_Mutation_p.E951K|UBE4B_uc010oai.1_RNA|UBE4B_uc010oaj.1_Missense_Mutation_p.E535K|UBE4B_uc001aqu.2_5'Flank	NM_001105562	NP_001099032	O95155	UBE4B_HUMAN	ubiquitination factor E4B isoform 1	1080					apoptosis|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|response to UV	cytoplasm|ubiquitin ligase complex	enzyme binding			ovary(2)|skin(2)	4		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		TGCTCAGGATGAGCGTGTGTC	0.587													10	42	---	---	---	---	PASS
C1orf127	148345	broad.mit.edu	37	1	11015097	11015097	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11015097T>C	uc010oao.1	-	5	483	c.478A>G	c.(478-480)AAG>GAG	p.K160E	C1orf127_uc001arr.1_Missense_Mutation_p.K142E|C1orf127_uc001ars.1_Missense_Mutation_p.K160E	NM_173507	NP_775778	B7ZLG7	B7ZLG7_HUMAN	hypothetical protein LOC148345	160										ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;0.000226)|all_lung(284;0.000302)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.0139)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0731)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.71e-07)|COAD - Colon adenocarcinoma(227;7.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000305)|Kidney(185;0.000785)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|READ - Rectum adenocarcinoma(331;0.0509)		ACAAAGTCCTTGTTCTCAGTC	0.557													21	26	---	---	---	---	PASS
CELA2A	63036	broad.mit.edu	37	1	15792535	15792535	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15792535C>G	uc001awk.2	+	6	561	c.535C>G	c.(535-537)CTG>GTG	p.L179V		NM_033440	NP_254275	P08217	CEL2A_HUMAN	elastase 2A preproprotein	179	Peptidase S1.				proteolysis	extracellular region	serine-type endopeptidase activity			ovary(2)	2						GGGCCGGTTGCTGGTTGTGGA	0.572													116	76	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19491316	19491316	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19491316G>T	uc001bbi.2	-	32	4492	c.4488C>A	c.(4486-4488)ACC>ACA	p.T1496T	UBR4_uc001bbm.1_Silent_p.T707T	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	1496					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAATGTATGTGGTCAGTAACT	0.488													7	121	---	---	---	---	PASS
ECE1	1889	broad.mit.edu	37	1	21571587	21571587	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21571587G>A	uc001bek.2	-	10	1248	c.1173C>T	c.(1171-1173)AAC>AAT	p.N391N	ECE1_uc001bem.2_Silent_p.N375N|ECE1_uc001bej.2_Silent_p.N379N|ECE1_uc001bei.2_Silent_p.N388N|ECE1_uc010odl.1_Silent_p.N391N|ECE1_uc009vqa.1_Silent_p.N391N	NM_001397	NP_001388	P42892	ECE1_HUMAN	endothelin converting enzyme 1 isoform 1	391	Extracellular (Potential).				bradykinin catabolic process|calcitonin catabolic process|ear development|embryonic digit morphogenesis|endothelin maturation|heart development|positive regulation of receptor recycling|substance P catabolic process	early endosome|external side of plasma membrane|integral to membrane|intrinsic to endosome membrane|membrane fraction|perinuclear region of cytoplasm|plasma membrane|Weibel-Palade body	metal ion binding|metalloendopeptidase activity|protein homodimerization activity			ovary(2)|skin(1)	3		Lung NSC(340;1.14e-05)|all_lung(284;1.23e-05)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00147)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0183)|OV - Ovarian serous cystadenocarcinoma(117;4.83e-27)|COAD - Colon adenocarcinoma(152;1.36e-06)|GBM - Glioblastoma multiforme(114;1.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000162)|STAD - Stomach adenocarcinoma(196;0.00326)|KIRC - Kidney renal clear cell carcinoma(1967;0.00755)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.206)		TCATGTAGTTGTTGAGCAGGC	0.592											OREG0013200	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	23	---	---	---	---	PASS
NBPF3	84224	broad.mit.edu	37	1	21799324	21799324	+	Intron	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21799324C>T	uc001ber.2	+						NBPF3_uc001bes.2_Intron|NBPF3_uc009vqb.2_Intron|NBPF3_uc010odm.1_Intron	NM_032264	NP_115640	Q9H094	NBPF3_HUMAN	neuroblastoma breakpoint family, member 3							cytoplasm				upper_aerodigestive_tract(1)|ovary(1)	2		all_lung(284;2.16e-05)|Lung NSC(340;2.19e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00432)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|OV - Ovarian serous cystadenocarcinoma(117;7.53e-27)|COAD - Colon adenocarcinoma(152;1.18e-05)|GBM - Glioblastoma multiforme(114;3.47e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000143)|STAD - Stomach adenocarcinoma(196;0.00306)|KIRC - Kidney renal clear cell carcinoma(1967;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		ATGAACACTTCTGTATTTACA	0.423													14	31	---	---	---	---	PASS
CELA3A	10136	broad.mit.edu	37	1	22336303	22336303	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22336303C>T	uc001bfl.2	+	7	767	c.748C>T	c.(748-750)CCC>TCC	p.P250S		NM_005747	NP_005738	P09093	CEL3A_HUMAN	elastase 3A, pancreatic preproprotein	250	Peptidase S1.				cholesterol metabolic process|digestion|proteolysis		serine-type endopeptidase activity			haematopoietic_and_lymphoid_tissue(1)	1						CATCTGGAAGCCCACGGTGTT	0.607													10	27	---	---	---	---	PASS
OPRD1	4985	broad.mit.edu	37	1	29189343	29189343	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29189343G>A	uc001brf.1	+	3	909	c.667G>A	c.(667-669)GTG>ATG	p.V223M		NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1	223	Helical; Name=5; (Potential).				immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	CTTCGCCTTCGTGGTGCCCAT	0.647													14	10	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36509055	36509055	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36509055G>T	uc001bzp.2	+	17	2436	c.2180G>T	c.(2179-2181)AGA>ATA	p.R727I	EIF2C3_uc001bzq.2_Missense_Mutation_p.R493I	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	727	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TAGGTTGGAAGAAGTGGCAAT	0.353													6	47	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36509093	36509093	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36509093G>T	uc001bzp.2	+	17	2474	c.2218G>T	c.(2218-2220)GAC>TAC	p.D740Y	EIF2C3_uc001bzq.2_Missense_Mutation_p.D506Y	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	740	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				AGTTGATACAGACATTACACA	0.353													12	51	---	---	---	---	PASS
EIF2C3	192669	broad.mit.edu	37	1	36509117	36509117	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:36509117G>A	uc001bzp.2	+	17	2498	c.2242G>A	c.(2242-2244)GAT>AAT	p.D748N	EIF2C3_uc001bzq.2_Missense_Mutation_p.D514N	NM_024852	NP_079128	Q9H9G7	AGO3_HUMAN	eukaryotic translation initiation factor 2C, 3	748	Piwi.				mRNA catabolic process|negative regulation of translation involved in gene silencing by miRNA	cytoplasmic mRNA processing body|cytosol	protein binding|RNA binding				0		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ATATGAGTTCGATTTTTACCT	0.353													9	54	---	---	---	---	PASS
CDCA8	55143	broad.mit.edu	37	1	38171130	38171130	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38171130G>A	uc001cbr.2	+	9	709	c.602G>A	c.(601-603)GGC>GAC	p.G201D	CDCA8_uc001cbs.2_Missense_Mutation_p.G201D|CDCA8_uc010oih.1_Missense_Mutation_p.G134D	NM_018101	NP_060571	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	201					cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				AAGACCCCTGGCCTGCGTACT	0.507													30	63	---	---	---	---	PASS
MAST2	23139	broad.mit.edu	37	1	46488582	46488582	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46488582A>G	uc001cov.2	+	13	1707	c.1424A>G	c.(1423-1425)GAA>GGA	p.E475G	MAST2_uc001cow.2_Missense_Mutation_p.E475G|MAST2_uc001coy.1_Missense_Mutation_p.E149G|MAST2_uc001coz.1_Missense_Mutation_p.E360G|MAST2_uc009vya.2_Missense_Mutation_p.E397G|MAST2_uc001cpa.2_RNA	NM_015112	NP_055927	Q6P0Q8	MAST2_HUMAN	microtubule associated serine/threonine kinase	475					regulation of interleukin-12 biosynthetic process|spermatid differentiation	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|phosphatase binding|protein serine/threonine kinase activity			ovary(5)|lung(3)|stomach(2)|breast(1)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					TTGTTTCCAGAAATGGCCCAG	0.473													8	79	---	---	---	---	PASS
PGM1	5236	broad.mit.edu	37	1	64097450	64097450	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64097450G>T	uc001dbh.2	+	4	892	c.679G>T	c.(679-681)GGA>TGA	p.G227*	PGM1_uc010ooy.1_Nonsense_Mutation_p.G30*|PGM1_uc010ooz.1_Nonsense_Mutation_p.G245*	NM_002633	NP_002624	P36871	PGM1_HUMAN	phosphoglucomutase 1	227					cellular calcium ion homeostasis|galactose catabolic process|glucose 1-phosphate metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	magnesium ion binding|phosphoglucomutase activity			ovary(2)|kidney(1)	3						TGCTATGCATGGAGGTATACA	0.413													42	106	---	---	---	---	PASS
ROR1	4919	broad.mit.edu	37	1	64644214	64644214	+	Silent	SNP	G	A	A	rs146764088	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64644214G>A	uc001dbj.2	+	9	2889	c.2490G>A	c.(2488-2490)GCG>GCA	p.A830A	uc001dbm.2_5'Flank	NM_005012	NP_005003	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	830	Cytoplasmic (Potential).|Pro-rich.				transmembrane receptor protein tyrosine kinase signaling pathway	cytoplasm|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			ovary(6)|large_intestine(3)|breast(3)|stomach(2)|lung(2)|central_nervous_system(1)|skin(1)|kidney(1)	19						GATATGCAGCGTTTCCAGCTG	0.562													17	37	---	---	---	---	PASS
TNNI3K	51086	broad.mit.edu	37	1	74929215	74929215	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:74929215G>A	uc001dgf.1	+	21	2153	c.2102G>A	c.(2101-2103)GGG>GAG	p.G701E	TNNI3K_uc001dgd.2_Missense_Mutation_p.G802E|TNNI3K_uc001dge.1_Missense_Mutation_p.G802E	NM_015978	NP_057062	Q59H18	TNI3K_HUMAN	TNNI3 interacting kinase isoform b	701	Protein kinase.					cytoplasm|nucleus	ATP binding|metal ion binding|protein C-terminus binding|protein serine/threonine kinase activity|troponin I binding			large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(1)	10						CTGATACGAGGGTGGAACGCA	0.443													31	84	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75065437	75065437	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75065437G>T	uc001dgg.2	-	11	1887	c.1668C>A	c.(1666-1668)GAC>GAA	p.D556E	uc001dgh.2_Intron|C1orf173_uc001dgi.3_Missense_Mutation_p.D350E	NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	556	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTTCACATTGTCACGGGCAT	0.413													51	112	---	---	---	---	PASS
ST6GALNAC5	81849	broad.mit.edu	37	1	77510258	77510258	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:77510258C>A	uc001dhi.2	+	3	806	c.631C>A	c.(631-633)CAG>AAG	p.Q211K	ST6GALNAC5_uc010ori.1_Intron|ST6GALNAC5_uc009wbw.2_RNA	NM_030965	NP_112227	Q9BVH7	SIA7E_HUMAN	sialyltransferase 7E	211	Lumenal (Potential).				protein glycosylation	integral to Golgi membrane	sialyltransferase activity			pancreas(1)|skin(1)	2						CAAGATGCTGCAGTTTGATGA	0.567													55	92	---	---	---	---	PASS
GBP4	115361	broad.mit.edu	37	1	89652027	89652027	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:89652027G>C	uc001dnb.2	-	10	1812	c.1696C>G	c.(1696-1698)CAC>GAC	p.H566D		NM_052941	NP_443173	Q96PP9	GBP4_HUMAN	guanylate binding protein 4	566	Potential.					cytoplasm	GTP binding|GTPase activity				0				all cancers(265;0.00723)|Epithelial(280;0.0291)		TTCAGCTTGTGTTTTAGCAGC	0.478													6	78	---	---	---	---	PASS
DPYD	1806	broad.mit.edu	37	1	98165061	98165061	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:98165061G>A	uc001drv.2	-	6	663	c.526C>T	c.(526-528)CTG>TTG	p.L176L	DPYD_uc010oub.1_RNA	NM_000110	NP_000101	Q12882	DPYD_HUMAN	dihydropyrimidine dehydrogenase isoform 1	176					'de novo' pyrimidine base biosynthetic process|purine base catabolic process|thymidine catabolic process|thymine catabolic process|UMP biosynthetic process|uracil catabolic process	cytosol	4 iron, 4 sulfur cluster binding|dihydroorotate oxidase activity|dihydropyrimidine dehydrogenase (NADP+) activity|electron carrier activity|flavin adenine dinucleotide binding|metal ion binding|NADP binding|protein homodimerization activity			ovary(3)|skin(3)|breast(2)	8		all_epithelial(167;0.000185)|all_lung(203;0.00318)|Lung NSC(277;0.00994)		Colorectal(170;0.0165)|Epithelial(280;0.0526)|all cancers(265;0.104)|READ - Rectum adenocarcinoma(84;0.171)|Lung(183;0.216)	Capecitabine(DB01101)|Enfuvirtide(DB00109)	GGGGGAGGCAGCGAAGGATTT	0.413													18	66	---	---	---	---	PASS
RSBN1	54665	broad.mit.edu	37	1	114340245	114340245	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114340245G>T	uc001edq.2	-	2	1153	c.1117C>A	c.(1117-1119)CTT>ATT	p.L373I	RSBN1_uc001edr.2_RNA	NM_018364	NP_060834	Q5VWQ0	RSBN1_HUMAN	round spermatid basic protein 1	373						nucleus				ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TAAGCATGAAGGACAAGAGCA	0.318													4	32	---	---	---	---	PASS
DENND2C	163259	broad.mit.edu	37	1	115137122	115137122	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:115137122G>C	uc001efd.1	-	18	3105	c.2403C>G	c.(2401-2403)ATC>ATG	p.I801M	DENND2C_uc001eez.2_RNA|DENND2C_uc001efc.1_Missense_Mutation_p.I744M	NM_198459	NP_940861	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	801										skin(3)	3	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTGAGTCAAGATTTCATTTC	0.383													14	27	---	---	---	---	PASS
MAN1A2	10905	broad.mit.edu	37	1	118003163	118003163	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118003163G>A	uc001ehd.1	+	7	1724	c.1003G>A	c.(1003-1005)GAA>AAA	p.E335K	MAN1A2_uc009whg.1_Missense_Mutation_p.E125K	NM_006699	NP_006690	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	335	Lumenal (Potential).				N-glycan processing|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane|membrane fraction	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity				0	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		CATTCTGGCTGAATTTGGTAC	0.448													20	35	---	---	---	---	PASS
MTMR11	10903	broad.mit.edu	37	1	149906927	149906927	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149906927C>A	uc001etl.3	-	5	671	c.420G>T	c.(418-420)CTG>CTT	p.L140L	MTMR11_uc001etm.1_Silent_p.L68L|MTMR11_uc010pbm.1_Silent_p.L112L|MTMR11_uc010pbn.1_5'UTR	NM_001145862	NP_001139334	A4FU01	MTMRB_HUMAN	myotubularin related protein 11 isoform a	140							phosphatase activity			central_nervous_system(1)	1	Breast(34;0.0009)|Ovarian(49;0.0377)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAACTCTGAGCAGCCGGAAGT	0.557													32	30	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152279085	152279085	+	Silent	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152279085A>G	uc001ezu.1	-	3	8313	c.8277T>C	c.(8275-8277)ACT>ACC	p.T2759T		NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	2759	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCTTCCTCTAGTGCTGGGCC	0.582									Ichthyosis				12	184	---	---	---	---	PASS
KPRP	448834	broad.mit.edu	37	1	152732698	152732698	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152732698C>T	uc001fal.1	+	2	692	c.634C>T	c.(634-636)CCT>TCT	p.P212S		NM_001025231	NP_001020402	Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	212						cytoplasm				ovary(4)|pancreas(1)	5	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGTTGAGGCCTTCCTACAG	0.567													13	115	---	---	---	---	PASS
KCNN3	3782	broad.mit.edu	37	1	154832198	154832198	+	Intron	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154832198G>C	uc001ffp.2	-						KCNN3_uc001ffo.2_5'UTR|KCNN3_uc009wox.1_Intron	NM_002249	NP_002240	Q9UGI6	KCNN3_HUMAN	small conductance calcium-activated potassium							integral to membrane	calmodulin binding			lung(1)	1	all_lung(78;2.29e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.108)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00819)			TCTATAACCTGAAGCAAAACA	0.542													21	39	---	---	---	---	PASS
DCST2	127579	broad.mit.edu	37	1	155006051	155006051	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155006051G>A	uc001fgm.2	-	1	207	c.127C>T	c.(127-129)CTG>TTG	p.L43L	DCST2_uc009wpb.2_RNA|DCST1_uc010per.1_5'Flank|DCST1_uc001fgn.1_5'Flank|DCST1_uc010pes.1_5'Flank	NM_144622	NP_653223	Q5T1A1	DCST2_HUMAN	DC-STAMP domain containing 2	43	Helical; (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			AGTAGCTCCAGAAGCCCGTAG	0.632													8	44	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158614993	158614993	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158614993C>A	uc001fst.1	-	29	4378	c.4179G>T	c.(4177-4179)CAG>CAT	p.Q1393H		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1393	Spectrin 13.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					ACTCCAGGCACTGGTCTAGGA	0.433													24	91	---	---	---	---	PASS
TAGLN2	8407	broad.mit.edu	37	1	159889626	159889626	+	Splice_Site	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159889626C>A	uc001fum.1	-	2	231	c.181_splice	c.e2-1	p.V61_splice	CCDC19_uc001ful.2_Intron|TAGLN2_uc001fun.1_Splice_Site_p.V61_splice|TAGLN2_uc001fuo.1_Splice_Site_p.V61_splice|TAGLN2_uc010piy.1_3'UTR	NM_003564	NP_003555	P37802	TAGL2_HUMAN	transgelin 2						muscle organ development	nuclear membrane|plasma membrane	protein binding				0	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CACATAGCACCTGGATGAGGA	0.552													6	102	---	---	---	---	PASS
CD244	51744	broad.mit.edu	37	1	160801188	160801188	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160801188G>C	uc009wtq.2	-	9	1240	c.1062C>G	c.(1060-1062)AAC>AAG	p.N354K	CD244_uc001fxa.2_Missense_Mutation_p.N349K|CD244_uc009wtp.2_RNA|CD244_uc009wtr.2_Missense_Mutation_p.N257K	NM_016382	NP_057466	Q9BZW8	CD244_HUMAN	CD244 natural killer cell receptor 2B4	354	Cytoplasmic (Potential).				blood coagulation|leukocyte migration	integral to membrane|plasma membrane	protein binding|receptor activity			ovary(1)	1	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			ATCGAGCAGGGTTCTGGGCTT	0.393													49	87	---	---	---	---	PASS
USP21	27005	broad.mit.edu	37	1	161132464	161132464	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161132464A>T	uc010pke.1	+	6	1218	c.841A>T	c.(841-843)ACT>TCT	p.T281S	USP21_uc010pkc.1_Missense_Mutation_p.T281S|USP21_uc010pkd.1_Missense_Mutation_p.T281S|USP21_uc010pkf.1_Missense_Mutation_p.T281S	NM_001014443	NP_001014443	Q9UK80	UBP21_HUMAN	ubiquitin-specific protease 21	281					histone deubiquitination|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	nucleus	metal ion binding|NEDD8-specific protease activity|protein binding|transcription coactivator activity|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(2)|lung(1)|prostate(1)|breast(1)	5	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TGTGAATCCTACTCGATTCCG	0.532													9	24	---	---	---	---	PASS
ALDH9A1	223	broad.mit.edu	37	1	165667753	165667753	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:165667753G>A	uc001gdh.1	-	1	148	c.43C>T	c.(43-45)CGC>TGC	p.R15C	uc001gdi.2_5'Flank|ALDH9A1_uc010pky.1_5'UTR|ALDH9A1_uc010pkz.1_Missense_Mutation_p.R15C|ALDH9A1_uc010pla.1_5'UTR	NM_000696	NP_000687	P49189	AL9A1_HUMAN	aldehyde dehydrogenase 9A1	Error:Variant_position_missing_in_P49189_after_alignment					carnitine biosynthetic process|cellular aldehyde metabolic process|hormone metabolic process|neurotransmitter biosynthetic process	cytosol|plasma membrane	3-chloroallyl aldehyde dehydrogenase activity|4-trimethylammoniobutyraldehyde dehydrogenase activity|aldehyde dehydrogenase (NAD) activity|aminobutyraldehyde dehydrogenase activity				0	all_hematologic(923;0.0773)|Acute lymphoblastic leukemia(8;0.155)				NADH(DB00157)	CGAAGACTGCGAAGAAGCGGG	0.612													4	4	---	---	---	---	PASS
FMO1	2326	broad.mit.edu	37	1	171227315	171227315	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171227315G>A	uc009wvz.2	+	2	225	c.89G>A	c.(88-90)TGC>TAC	p.C30Y	FMO1_uc010pme.1_Missense_Mutation_p.C30Y|FMO1_uc001ghl.2_Missense_Mutation_p.C30Y|FMO1_uc001ghm.2_Missense_Mutation_p.C30Y|FMO1_uc001ghn.2_Missense_Mutation_p.C30Y	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	30					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GAGCCCACCTGCTTTGAGAGG	0.557													33	73	---	---	---	---	PASS
RFWD2	64326	broad.mit.edu	37	1	176153775	176153775	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176153775C>T	uc001gku.1	-	2	717	c.461G>A	c.(460-462)AGC>AAC	p.S154N	RFWD2_uc001gkv.1_Missense_Mutation_p.S154N|RFWD2_uc001gkw.1_5'UTR|RFWD2_uc001gkt.1_Missense_Mutation_p.S13N	NM_022457	NP_071902	Q8NHY2	RFWD2_HUMAN	ring finger and WD repeat domain 2 isoform a	154	RING-type.				DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest	centrosome|cytosol|focal adhesion|nuclear speck	protein binding|ubiquitin-protein ligase activity|zinc ion binding				0						TTACCAAAAGCTGTGGCCACA	0.284													11	173	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176918373	176918373	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176918373T>A	uc001glc.2	-	12	2214	c.2002A>T	c.(2002-2004)ATG>TTG	p.M668L	ASTN1_uc001glb.1_Missense_Mutation_p.M668L|ASTN1_uc001gld.1_Missense_Mutation_p.M668L|ASTN1_uc009wwx.1_Missense_Mutation_p.M668L	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	676	EGF-like 3.				cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						AAGGGCGCCATCTGCTGGAGG	0.592											OREG0014004	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	43	---	---	---	---	PASS
ASTN1	460	broad.mit.edu	37	1	176934344	176934344	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176934344C>A	uc001glc.2	-	9	1765	c.1553G>T	c.(1552-1554)GGC>GTC	p.G518V	ASTN1_uc001glb.1_Missense_Mutation_p.G518V|ASTN1_uc001gld.1_Missense_Mutation_p.G518V|ASTN1_uc009wwx.1_Missense_Mutation_p.G518V	NM_004319	NP_004310	O14525	ASTN1_HUMAN	astrotactin isoform 1	526					cell migration|neuron cell-cell adhesion	integral to membrane				ovary(6)|skin(5)|central_nervous_system(2)|large_intestine(1)|lung(1)	15						CAGGTCAAAGCCTCGCTGAAA	0.328													64	61	---	---	---	---	PASS
CACNA1E	777	broad.mit.edu	37	1	181765947	181765947	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:181765947C>A	uc001gow.2	+	46	6388	c.6223C>A	c.(6223-6225)CAA>AAA	p.Q2075K	CACNA1E_uc009wxs.2_Missense_Mutation_p.Q1963K|CACNA1E_uc009wxt.2_Missense_Mutation_p.Q1344K	NM_000721	NP_000712	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type,	2118	Cytoplasmic (Potential).				energy reserve metabolic process|membrane depolarization|synaptic transmission	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(3)|central_nervous_system(2)|pancreas(1)	6						AGAGCGCCGTCAATCCAGGTC	0.592													4	11	---	---	---	---	PASS
APOBEC4	403314	broad.mit.edu	37	1	183617486	183617486	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183617486G>A	uc001gqn.2	-	2	703	c.431C>T	c.(430-432)ACG>ATG	p.T144M	RGL1_uc010pof.1_Intron|RGL1_uc001gqm.2_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_203454	NP_982279	Q8WW27	ABEC4_HUMAN	apolipoprotein B	144					mRNA processing		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amidines|zinc ion binding				0						GCCTGGATACGTAATCAGGAA	0.428													15	105	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186291483	186291483	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186291483G>T	uc001grv.2	-	45	6725	c.6428C>A	c.(6427-6429)CCA>CAA	p.P2143Q		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	2143					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AGTACGATGTGGCACCACAAG	0.338			T	NTRK1	papillary thyroid								5	49	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202568477	202568477	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202568477G>C	uc001gye.2	-	8	1115	c.922C>G	c.(922-924)CCG>GCG	p.P308A	SYT2_uc010pqb.1_Missense_Mutation_p.P308A|SYT2_uc009xaf.2_Missense_Mutation_p.P138A	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	308	Phospholipid binding (By similarity).|C2 2.|Cytoplasmic (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	TTCACGTACGGGTCTGCGGAG	0.557													25	61	---	---	---	---	PASS
AVPR1B	553	broad.mit.edu	37	1	206230826	206230826	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206230826T>A	uc001hds.2	+	2	1117	c.959T>A	c.(958-960)TTC>TAC	p.F320Y		NM_000707	NP_000698	P47901	V1BR_HUMAN	arginine vasopressin receptor 1B	320	Extracellular (Potential).				activation of phospholipase C activity|elevation of cytosolic calcium ion concentration	endosome|integral to plasma membrane	protein kinase C binding|vasopressin receptor activity			ovary(2)|large_intestine(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.0312)		Desmopressin(DB00035)|Terlipressin(DB02638)|Vasopressin(DB00067)	AATGTGGCTTTCACCATCTCT	0.348													4	9	---	---	---	---	PASS
IL10	3586	broad.mit.edu	37	1	206944738	206944738	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206944738T>C	uc001hen.1	-	2	247	c.188A>G	c.(187-189)AAC>AGC	p.N63S		NM_000572	NP_000563	P22301	IL10_HUMAN	interleukin 10 precursor	63					anti-apoptosis|B cell differentiation|B cell proliferation|cytoplasmic sequestering of NF-kappaB|inflammatory response|leukocyte chemotaxis|negative regulation of B cell proliferation|negative regulation of cytokine secretion involved in immune response|negative regulation of interferon-alpha biosynthetic process|negative regulation of interleukin-6 production|negative regulation of membrane protein ectodomain proteolysis|negative regulation of MHC class II biosynthetic process|negative regulation of T cell proliferation|positive regulation of B cell apoptosis|positive regulation of cytokine secretion|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription, DNA-dependent|receptor biosynthetic process|regulation of isotype switching|response to glucocorticoid stimulus|type 2 immune response	extracellular space	cytokine activity|growth factor activity|interleukin-10 receptor binding				0	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			TAACAACAAGTtgtccagctg	0.368													4	15	---	---	---	---	PASS
DUSP10	11221	broad.mit.edu	37	1	221879746	221879746	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221879746C>G	uc001hmy.1	-	3	1056	c.874G>C	c.(874-876)GAG>CAG	p.E292Q	DUSP10_uc001hmx.1_5'UTR|DUSP10_uc001hmz.1_5'UTR	NM_007207	NP_009138	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10 isoform a	292					inactivation of MAPK activity|JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|negative regulation of stress-activated MAPK cascade	Golgi apparatus|nucleus	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)|lung(1)	2				GBM - Glioblastoma multiforme(131;0.0103)		TCCCGGCACTCTTGGAGCTGG	0.567													21	33	---	---	---	---	PASS
C1orf65	164127	broad.mit.edu	37	1	223568431	223568431	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223568431G>A	uc001hoa.2	+	1	1717	c.1614G>A	c.(1612-1614)CTG>CTA	p.L538L		NM_152610	NP_689823	Q8N715	CA065_HUMAN	hypothetical protein LOC164127	538	Potential.									central_nervous_system(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0704)		TCAACCACCTGAGGGAGAAAA	0.542													22	48	---	---	---	---	PASS
CAPN2	824	broad.mit.edu	37	1	223949944	223949944	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223949944G>C	uc001hob.3	+	14	1847	c.1623G>C	c.(1621-1623)TTG>TTC	p.L541F	CAPN2_uc010puy.1_Missense_Mutation_p.L463F|CAPN2_uc001hoc.2_Missense_Mutation_p.L122F	NM_001748	NP_001739	P17655	CAN2_HUMAN	calpain 2 isoform 1	541	Domain IV.				proteolysis	cytoplasm|plasma membrane				lung(3)|breast(1)|skin(1)	5				GBM - Glioblastoma multiforme(131;0.109)		TTGCCCAGTTGGCAGGAGAGG	0.483													10	25	---	---	---	---	PASS
GNG4	2786	broad.mit.edu	37	1	235747056	235747056	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:235747056C>A	uc001hxe.3	-	3	537	c.83G>T	c.(82-84)TGT>TTT	p.C28F	GNG4_uc009xfz.2_Missense_Mutation_p.C28F|GNG4_uc001hxh.3_Missense_Mutation_p.C28F	NM_001098722	NP_001092192	P50150	GBG4_HUMAN	guanine nucleotide binding protein (G protein),	28					cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|negative regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|synaptic transmission	heterotrimeric G-protein complex	signal transducer activity				0	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00168)|Prostate(94;0.0776)|Acute lymphoblastic leukemia(190;0.23)	OV - Ovarian serous cystadenocarcinoma(106;0.000882)			CCTGTCCATACAGGCTTCCAT	0.522													9	46	---	---	---	---	PASS
RYR2	6262	broad.mit.edu	37	1	237732496	237732496	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:237732496G>T	uc001hyl.1	+	29	3595	c.3475G>T	c.(3475-3477)GGC>TGC	p.G1159C		NM_001035	NP_001026	Q92736	RYR2_HUMAN	cardiac muscle ryanodine receptor	1159	Cytoplasmic (By similarity).|4 X approximate repeats.|B30.2/SPRY 2.				cardiac muscle contraction|detection of calcium ion|induction of apoptosis by ionic changes|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum|response to caffeine|response to hypoxia|response to redox state	calcium channel complex|cytosol|plasma membrane|plasma membrane enriched fraction|sarcoplasmic reticulum membrane	calcium ion binding|calmodulin binding|identical protein binding|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|receptor activity|ryanodine-sensitive calcium-release channel activity|suramin binding			ovary(17)|large_intestine(6)|central_nervous_system(6)|pancreas(3)|breast(1)	33	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTGGCAAGCAGGCGATGTCGT	0.493													13	29	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240976973	240976973	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240976973C>A	uc001hyv.2	-	13	1231	c.901G>T	c.(901-903)GAC>TAC	p.D301Y	RGS7_uc010pyh.1_Missense_Mutation_p.D275Y|RGS7_uc010pyj.1_Missense_Mutation_p.D217Y|RGS7_uc001hyu.2_Missense_Mutation_p.D301Y|RGS7_uc009xgn.1_Missense_Mutation_p.D248Y|RGS7_uc001hyw.2_Missense_Mutation_p.D301Y|RGS7_uc001hyt.2_Missense_Mutation_p.D133Y	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	301	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TTAGAAGGGTCAGGTGGCAAA	0.423													8	27	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240976974	240976974	+	Silent	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240976974A>G	uc001hyv.2	-	13	1230	c.900T>C	c.(898-900)CCT>CCC	p.P300P	RGS7_uc010pyh.1_Silent_p.P274P|RGS7_uc010pyj.1_Silent_p.P216P|RGS7_uc001hyu.2_Silent_p.P300P|RGS7_uc009xgn.1_Silent_p.P247P|RGS7_uc001hyw.2_Silent_p.P300P|RGS7_uc001hyt.2_Silent_p.P132P	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7	300	G protein gamma.				G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TAGAAGGGTCAGGTGGCAAAA	0.428													8	26	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242035469	242035469	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242035469C>A	uc001hzh.2	+	12	1943	c.1403C>A	c.(1402-1404)ACT>AAT	p.T468N	EXO1_uc001hzi.2_Missense_Mutation_p.T468N|EXO1_uc001hzj.2_Missense_Mutation_p.T468N|EXO1_uc009xgq.2_Missense_Mutation_p.T467N	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	468	Interaction with MLH1.				meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AATGGACCTACTAACAAAAAG	0.383								Direct_reversal_of_damage|Editing_and_processing_nucleases					4	56	---	---	---	---	PASS
EXO1	9156	broad.mit.edu	37	1	242035547	242035547	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242035547G>C	uc001hzh.2	+	12	2021	c.1481G>C	c.(1480-1482)AGT>ACT	p.S494T	EXO1_uc001hzi.2_Missense_Mutation_p.S494T|EXO1_uc001hzj.2_Missense_Mutation_p.S494T|EXO1_uc009xgq.2_Missense_Mutation_p.S493T	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b	494					meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AATGAAGAAAGTGGTGCAGTT	0.383								Direct_reversal_of_damage|Editing_and_processing_nucleases					6	53	---	---	---	---	PASS
TFB2M	64216	broad.mit.edu	37	1	246704449	246704449	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246704449C>T	uc001ibn.2	-	8	1200	c.1075G>A	c.(1075-1077)GAT>AAT	p.D359N		NM_022366	NP_071761	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	359					positive regulation of transcription, DNA-dependent|transcription initiation from mitochondrial promoter	mitochondrial nucleoid	protein binding|rRNA (adenine-N6,N6-)-dimethyltransferase activity|transcription cofactor activity			ovary(1)	1	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			ACTTTCTCATCCTCCTGTTTT	0.348													15	29	---	---	---	---	PASS
OR11L1	391189	broad.mit.edu	37	1	248004383	248004383	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248004383C>G	uc001idn.1	-	1	816	c.816G>C	c.(814-816)AAG>AAC	p.K272N		NM_001001959	NP_001001959	Q8NGX0	O11L1_HUMAN	olfactory receptor, family 11, subfamily L,	272	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3	all_cancers(71;8.78e-05)|all_epithelial(71;9.15e-06)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)		OV - Ovarian serous cystadenocarcinoma(106;0.0319)			CAGAAATGATCTTGTTGATTT	0.478													21	35	---	---	---	---	PASS
OR2T4	127074	broad.mit.edu	37	1	248525278	248525278	+	Missense_Mutation	SNP	G	T	T	rs143377817		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248525278G>T	uc001ieh.1	+	1	396	c.396G>T	c.(394-396)CAG>CAT	p.Q132H		NM_001004696	NP_001004696	Q8NH00	OR2T4_HUMAN	olfactory receptor, family 2, subfamily T,	132	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GTGGGATGCAGATGTTCTTCT	0.522													43	55	---	---	---	---	PASS
OR2T3	343173	broad.mit.edu	37	1	248637397	248637397	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248637397A>T	uc001iel.1	+	1	746	c.746A>T	c.(745-747)CAC>CTC	p.H249L		NM_001005495	NP_001005495	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T,	249	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGCTCCTCCCACATGATCATA	0.547													36	121	---	---	---	---	PASS
OR2G6	391211	broad.mit.edu	37	1	248685501	248685501	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248685501T>A	uc001ien.1	+	1	554	c.554T>A	c.(553-555)ATC>AAC	p.I185N		NM_001013355	NP_001013373	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G,	185	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCAGTGCTCATCAAACTGGCC	0.502													4	41	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21232830	21232830	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21232830T>C	uc002red.2	-	26	7038	c.6910A>G	c.(6910-6912)ACA>GCA	p.T2304A		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	2304					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AATGAAATTGTAGTTCCCAAT	0.338													12	101	---	---	---	---	PASS
ADCY3	109	broad.mit.edu	37	2	25062839	25062839	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25062839C>T	uc002rfs.3	-	6	1457	c.1258G>A	c.(1258-1260)GTG>ATG	p.V420M	ADCY3_uc002rfr.3_Missense_Mutation_p.V31M|ADCY3_uc010ykm.1_Missense_Mutation_p.V420M	NM_004036	NP_004027	O60266	ADCY3_HUMAN	adenylate cyclase 3	420	Cytoplasmic (Potential).				activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|sensory perception of smell|synaptic transmission|transmembrane transport|water transport	cytoplasm|integral to plasma membrane	ATP binding|calmodulin binding|metal ion binding			breast(3)|ovary(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					CCCCCCAGCACGGTGCCCGTG	0.642													14	30	---	---	---	---	PASS
HADHB	3032	broad.mit.edu	37	2	26502980	26502980	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26502980C>G	uc002rgz.2	+	10	1181	c.930C>G	c.(928-930)TTC>TTG	p.F310L	HADHB_uc010ykv.1_Missense_Mutation_p.F288L|HADHB_uc010ykw.1_Missense_Mutation_p.F295L|HADHB_uc002rha.2_Missense_Mutation_p.F187L|HADHB_uc010ykx.1_Missense_Mutation_p.F236L	NM_000183	NP_000174	P55084	ECHB_HUMAN	mitochondrial trifunctional protein, beta	310					fatty acid beta-oxidation	mitochondrial nucleoid	3-hydroxyacyl-CoA dehydrogenase activity|acetyl-CoA C-acyltransferase activity|enoyl-CoA hydratase activity|protein binding			ovary(1)|breast(1)	2	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCTTCTTTCTTGGTAACTG	0.383													58	38	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28816919	28816919	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28816919G>A	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rmc.2_Silent_p.*489*	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					CCAAATCCCTGAATCTTCACC	0.418													31	20	---	---	---	---	PASS
SRD5A2	6716	broad.mit.edu	37	2	31754473	31754473	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31754473C>T	uc002rnw.1	-	5	673	c.602G>A	c.(601-603)TGG>TAG	p.W201*		NM_000348	NP_000339	P31213	S5A2_HUMAN	3-oxo-5 alpha-steroid 4-dehydrogenase 2	201					androgen biosynthetic process|cell differentiation|cell-cell signaling|male gonad development	endoplasmic reticulum membrane|integral to membrane|microsome	3-oxo-5-alpha-steroid 4-dehydrogenase activity|sterol 5-alpha reductase activity				0	Acute lymphoblastic leukemia(172;0.155)				Azelaic Acid(DB00548)|Dutasteride(DB01126)	ATAGCCGATCCATTCAATGAT	0.473													51	28	---	---	---	---	PASS
THADA	63892	broad.mit.edu	37	2	43547631	43547631	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43547631G>C	uc002rsw.3	-	31	4744	c.4392C>G	c.(4390-4392)TTC>TTG	p.F1464L	THADA_uc010far.2_Missense_Mutation_p.F659L|THADA_uc002rsx.3_Missense_Mutation_p.F1464L|THADA_uc002rsy.3_RNA	NM_001083953	NP_001077422	Q6YHU6	THADA_HUMAN	thyroid adenoma associated	1464							binding			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(82;0.00361)|all_hematologic(82;0.00837)				AAGTCAATAGGAAGAGAATAT	0.368													62	43	---	---	---	---	PASS
AFTPH	54812	broad.mit.edu	37	2	64780367	64780367	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64780367G>C	uc002sdc.2	+	1	1791	c.1759G>C	c.(1759-1761)GCT>CCT	p.A587P	AFTPH_uc002scz.2_Missense_Mutation_p.A587P|AFTPH_uc002sda.2_Missense_Mutation_p.A587P|AFTPH_uc002sdb.2_Missense_Mutation_p.A587P	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a	587					protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						TTCTTGGGCTGCTTTTGGAGA	0.438													28	20	---	---	---	---	PASS
CCT7	10574	broad.mit.edu	37	2	73466796	73466796	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73466796A>G	uc002siz.2	+	2	134	c.32A>G	c.(31-33)GAG>GGG	p.E11G	CCT7_uc002sja.2_Intron|CCT7_uc010yrf.1_5'UTR|CCT7_uc010feu.2_Missense_Mutation_p.E11G|CCT7_uc010yrg.1_5'UTR|CCT7_uc010yrh.1_5'UTR|CCT7_uc010yri.1_Intron	NM_006429	NP_006420	Q99832	TCPH_HUMAN	chaperonin containing TCP1, subunit 7 isoform a	11					'de novo' posttranslational protein folding		ATP binding|unfolded protein binding				0						CTATTGAAAGAGGGGACTGAT	0.473													3	28	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	79878772	79878772	+	Silent	SNP	A	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79878772A>C	uc010ysh.1	+	1	95	c.90A>C	c.(88-90)CCA>CCC	p.P30P	CTNNA2_uc010yse.1_Silent_p.P30P|CTNNA2_uc010ysf.1_Silent_p.P30P|CTNNA2_uc010ysg.1_Silent_p.P30P|hsa-mir-4264|MI0015877_5'Flank	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	30					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						TGTTGGAGCCACTTGTTACAC	0.413													31	20	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102475492	102475492	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102475492G>C	uc002tbg.2	+	14	1485	c.1430G>C	c.(1429-1431)CGG>CCG	p.R477P	MAP4K4_uc002tbc.2_Missense_Mutation_p.R477P|MAP4K4_uc002tbd.2_Missense_Mutation_p.R477P|MAP4K4_uc002tbe.2_Missense_Mutation_p.R477P|MAP4K4_uc002tbf.2_Missense_Mutation_p.R477P|MAP4K4_uc010yvy.1_Missense_Mutation_p.R477P|MAP4K4_uc002tbh.2_Missense_Mutation_p.R477P|MAP4K4_uc002tbi.2_Missense_Mutation_p.R330P|MAP4K4_uc010yvz.1_Missense_Mutation_p.R457P|MAP4K4_uc002tbk.2_5'UTR|MAP4K4_uc002tbj.1_Missense_Mutation_p.R373P	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	477					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						GAGGAGCAGCGGCACTTGGAA	0.507													11	44	---	---	---	---	PASS
UXS1	80146	broad.mit.edu	37	2	106761715	106761715	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106761715C>G	uc002tdm.2	-	6	486	c.388G>C	c.(388-390)GAG>CAG	p.E130Q	UXS1_uc002tdn.2_Missense_Mutation_p.E135Q|UXS1_uc002tdo.2_Missense_Mutation_p.E73Q|UXS1_uc010ywh.1_Intron	NM_025076	NP_079352	Q8NBZ7	UXS1_HUMAN	UDP-glucuronate decarboxylase 1	130	NAD.|Lumenal (Potential).				cellular metabolic process	Golgi cisterna membrane|integral to membrane	coenzyme binding|UDP-glucuronate decarboxylase activity			ovary(2)	2						ATCCAGTGCTCCACGTTTCTC	0.517													16	28	---	---	---	---	PASS
NCKAP5	344148	broad.mit.edu	37	2	133539570	133539570	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133539570C>A	uc002ttp.2	-	14	5188	c.4814G>T	c.(4813-4815)AGA>ATA	p.R1605I	NCKAP5_uc002ttq.2_Intron	NM_207363	NP_997246	O14513	NCKP5_HUMAN	Nck-associated protein 5 isoform 1	1605							protein binding				0						AGGGCTGTGTCTATTCCTTGG	0.443													14	76	---	---	---	---	PASS
MGAT5	4249	broad.mit.edu	37	2	135185973	135185973	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135185973G>C	uc002ttv.1	+	14	1977	c.1832G>C	c.(1831-1833)GGG>GCG	p.G611A		NM_002410	NP_002401	Q09328	MGT5A_HUMAN	N-acetylglucosaminyltransferase V	611	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi membrane|integral to membrane	alpha-1,6-mannosyl-glycoprotein 6-beta-N-acetylglucosaminyltransferase activity			ovary(2)|skin(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.0964)		ACGTGCGAGGGGATGCTACAG	0.453													8	37	---	---	---	---	PASS
LCT	3938	broad.mit.edu	37	2	136555694	136555694	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136555694C>A	uc002tuu.1	-	13	4892	c.4881G>T	c.(4879-4881)TGG>TGT	p.W1627C		NM_002299	NP_002290	P09848	LPH_HUMAN	lactase-phlorizin hydrolase preproprotein	1627	Extracellular (Potential).|4.|4 X approximate repeats.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|integral to plasma membrane|membrane fraction	cation binding|glycosylceramidase activity|lactase activity			ovary(7)|central_nervous_system(2)|skin(2)|pancreas(1)|lung(1)	13				BRCA - Breast invasive adenocarcinoma(221;0.169)		GATGTGCAAACCAGCCTCCCA	0.567											OREG0014998	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	29	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137814061	137814061	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137814061G>C	uc002tva.1	+	2	118	c.118G>C	c.(118-120)GTT>CTT	p.V40L	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_5'UTR	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		GTGTTTTCATGTTGACGGGTG	0.512													12	21	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137852667	137852667	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137852667G>T	uc002tva.1	+	3	1082	c.1082G>T	c.(1081-1083)GGA>GTA	p.G361V	THSD7B_uc010zbj.1_RNA|THSD7B_uc002tvb.2_Missense_Mutation_p.G251V	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		ATTGTTGAAGGAGAACTTCTG	0.448													15	38	---	---	---	---	PASS
THSD7B	80731	broad.mit.edu	37	2	137917791	137917791	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:137917791C>A	uc002tva.1	+	5	1285	c.1285C>A	c.(1285-1287)CCT>ACT	p.P429T	THSD7B_uc010zbj.1_Intron|THSD7B_uc002tvb.2_Missense_Mutation_p.P319T	NM_001080427	NP_001073896			thrombospondin, type I, domain containing 7B											ovary(4)|central_nervous_system(2)|pancreas(1)	7				BRCA - Breast invasive adenocarcinoma(221;0.19)		AGTCTCTAGACCTGTGGAAAA	0.488													17	52	---	---	---	---	PASS
SCN3A	6328	broad.mit.edu	37	2	165952979	165952979	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:165952979C>G	uc002ucx.2	-	24	4783	c.4291G>C	c.(4291-4293)GAT>CAT	p.D1431H	SCN3A_uc010zcy.1_5'Flank|SCN3A_uc002ucy.2_Missense_Mutation_p.D1382H|SCN3A_uc002ucz.2_Missense_Mutation_p.D1382H	NM_006922	NP_008853	Q9NY46	SCN3A_HUMAN	sodium channel, voltage-gated, type III, alpha	1431						voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(4)|breast(3)|skin(2)|central_nervous_system(1)	10					Lamotrigine(DB00555)	ATACTTACATCTCGTGAATCA	0.284													11	29	---	---	---	---	PASS
TLK1	9874	broad.mit.edu	37	2	171902795	171902795	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171902795G>C	uc002ugn.2	-	11	1530	c.1058C>G	c.(1057-1059)ACA>AGA	p.T353R	TLK1_uc002ugo.2_Missense_Mutation_p.T374R|TLK1_uc002ugp.2_Missense_Mutation_p.T305R|TLK1_uc002ugq.2_RNA|TLK1_uc010zdn.1_Missense_Mutation_p.T257R|TLK1_uc002ugr.1_Missense_Mutation_p.T136R	NM_012290	NP_036422	Q9UKI8	TLK1_HUMAN	tousled-like kinase 1 isoform 1	353					cell cycle|chromatin modification|intracellular protein transport|intracellular signal transduction|regulation of chromatin assembly or disassembly|response to DNA damage stimulus	nucleus	ATP binding|protein binding|protein serine/threonine kinase activity			central_nervous_system(1)	1						ATTATTAGCTGTGGGAGGTTT	0.388													22	37	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179436183	179436183	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179436183A>T	uc010zfg.1	-	275	67196	c.66972T>A	c.(66970-66972)AGT>AGA	p.S22324R	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.S16019R|TTN_uc010zfi.1_Missense_Mutation_p.S15952R|TTN_uc010zfj.1_Missense_Mutation_p.S15827R	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	23251							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGAGGTAGGTACTCTTCCCAT	0.458													20	27	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179597774	179597774	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179597774C>A	uc010zfg.1	-	52	12621	c.12397G>T	c.(12397-12399)GAC>TAC	p.D4133Y	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.D794Y	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	5060							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTGCAGTCCAGTCTGCAG	0.468													19	22	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179616631	179616631	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179616631G>T	uc002unb.2	-	46	10720	c.10496C>A	c.(10495-10497)CCT>CAT	p.P3499H	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAAATATTCAGGCCAGGAGCT	0.378													32	112	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	202025610	202025610	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202025610C>A	uc002uxb.3	+	9	1701	c.1249C>A	c.(1249-1251)CAC>AAC	p.H417N	CFLAR_uc010zhk.1_Missense_Mutation_p.H321N|CFLAR_uc002uxc.3_Missense_Mutation_p.H382N|CFLAR_uc010zhl.1_Missense_Mutation_p.H321N|CFLAR_uc010fsw.1_RNA|CFLAR_uc002uxd.3_Missense_Mutation_p.H417N|CFLAR_uc002uxf.2_Missense_Mutation_p.H417N|CFLAR_uc010fsy.2_RNA|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_Missense_Mutation_p.H321N|CFLAR_uc010fsz.2_Missense_Mutation_p.H172N|CFLAR_uc002uxg.2_Missense_Mutation_p.H172N	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform	417	Interaction with caspase-8.|Interaction with caspase-3.|Interaction with TRAF1 and TRAF2.|Not proteolytically processed and involved in apoptosis inhibition.|Interaction with caspase-8 subunits p18 and p10.				anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						GGAGCAGTCTCACAGCTCACC	0.557													11	36	---	---	---	---	PASS
PIKFYVE	200576	broad.mit.edu	37	2	209136333	209136333	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209136333T>C	uc002vcz.2	+	2	248	c.90T>C	c.(88-90)TTT>TTC	p.F30F	PIKFYVE_uc010fun.1_5'UTR|PIKFYVE_uc002vcy.1_Silent_p.F30F|PIKFYVE_uc002vcv.2_Silent_p.F30F|PIKFYVE_uc002vcw.2_Silent_p.F30F|PIKFYVE_uc002vcx.2_Silent_p.F30F	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type	30					cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						TCACACACTTTAAACCTTTGA	0.388													46	76	---	---	---	---	PASS
CHPF	79586	broad.mit.edu	37	2	220404600	220404600	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220404600G>A	uc002vmc.3	-	4	2060	c.1833C>T	c.(1831-1833)TTC>TTT	p.F611F	CHPF_uc010zlh.1_Silent_p.F449F	NM_024536	NP_078812	Q8IZ52	CHSS2_HUMAN	chondroitin polymerizing factor	611	Lumenal (Potential).					Golgi cisterna membrane|integral to membrane	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity|metal ion binding|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity|protein binding				0		Renal(207;0.0183)		Epithelial(149;3.02e-08)|all cancers(144;3.41e-06)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CGGCCAGCAGGAACAGTGTGT	0.637													28	34	---	---	---	---	PASS
CHRND	1144	broad.mit.edu	37	2	233390916	233390916	+	5'Flank	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:233390916G>A	uc002vsw.2	+						CHRND_uc010zmg.1_5'Flank|CHRND_uc010fyc.2_5'Flank|CHRND_uc010zmh.1_5'Flank	NM_000751	NP_000742	Q07001	ACHD_HUMAN	nicotinic acetylcholine receptor delta						muscle contraction|musculoskeletal movement|neuromuscular process|skeletal muscle tissue growth|synaptic transmission	cell junction|nicotinic acetylcholine-gated receptor-channel complex|postsynaptic membrane	nicotinic acetylcholine-activated cation-selective channel activity|receptor activity			ovary(1)|breast(1)|skin(1)	3		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.89e-16)|BRCA - Breast invasive adenocarcinoma(100;0.00078)|Lung(119;0.00579)|LUSC - Lung squamous cell carcinoma(224;0.00754)		GTCCCAGTCAGAGGGATGGGA	0.672													6	23	---	---	---	---	PASS
NDUFA10	4705	broad.mit.edu	37	2	240960628	240960628	+	Missense_Mutation	SNP	T	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240960628T>G	uc002vyn.2	-	3	526	c.446A>C	c.(445-447)CAC>CCC	p.H149P	NDUFA10_uc010fzc.1_Missense_Mutation_p.H149P|NDUFA10_uc002vyo.1_Missense_Mutation_p.H149P|NDUFA10_uc002vyp.2_Missense_Mutation_p.H149P	NM_004544	NP_004535	O95299	NDUAA_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	149					mitochondrial electron transport, NADH to ubiquinone|nucleobase, nucleoside, nucleotide and nucleic acid metabolic process|transport	mitochondrial matrix|mitochondrial respiratory chain complex I	ATP binding|NADH dehydrogenase (ubiquinone) activity|phosphotransferase activity, alcohol group as acceptor			central_nervous_system(1)	1		all_epithelial(40;4.26e-15)|Breast(86;4.4e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0396)|Lung NSC(271;0.128)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(121;7.82e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.5e-13)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;2.39e-05)|Lung(119;0.00519)|LUSC - Lung squamous cell carcinoma(224;0.0202)	NADH(DB00157)	GGTCAGCAAGTGCTCCAAGGC	0.473											OREG0015348	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	22	---	---	---	---	PASS
BTD	686	broad.mit.edu	37	3	15643402	15643402	+	Splice_Site	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:15643402G>A	uc003cah.2	+	1	147	c.44_splice	c.e1+1	p.R15_splice	HACL1_uc011avr.1_5'Flank|HACL1_uc011avs.1_5'Flank|HACL1_uc011avt.1_5'Flank|HACL1_uc003cag.2_5'Flank|HACL1_uc011avu.1_5'Flank|HACL1_uc010hep.2_5'Flank|HACL1_uc003caf.2_5'Flank|BTD_uc011avv.1_Intron|BTD_uc011avw.1_Splice_Site|BTD_uc011avx.1_5'Flank	NM_000060	NP_000051	P43251	BTD_HUMAN	biotinidase precursor						central nervous system development|epidermis development|nitrogen compound metabolic process	extracellular space	biotin carboxylase activity|biotinidase activity				0						CTAAGAGCAGGTACGGAGGGG	0.677													3	5	---	---	---	---	PASS
SCN10A	6336	broad.mit.edu	37	3	38798202	38798202	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38798202A>T	uc003ciq.2	-	9	1253	c.1253T>A	c.(1252-1254)TTC>TAC	p.F418Y		NM_006514	NP_006505	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha	418					sensory perception	voltage-gated sodium channel complex				ovary(5)|skin(3)|large_intestine(1)|kidney(1)	10				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dibucaine(DB00527)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)	GGCCTCCTGGAACTTCTTCTC	0.493													50	39	---	---	---	---	PASS
XCR1	2829	broad.mit.edu	37	3	46063247	46063247	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:46063247G>A	uc003cpe.2	-	3	417	c.193C>T	c.(193-195)CTC>TTC	p.L65F	uc003cpd.1_5'Flank|XCR1_uc003cpf.2_Missense_Mutation_p.L65F	NM_005283	NP_005274	P46094	XCR1_HUMAN	XC chemokine receptor 1	65	Cytoplasmic (Potential).				chemotaxis|G-protein signaling, coupled to cyclic nucleotide second messenger|inflammatory response	integral to plasma membrane	chemokine receptor activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		ATGTTGGTGAGGGACTCCAGG	0.587													12	11	---	---	---	---	PASS
CELSR3	1951	broad.mit.edu	37	3	48677858	48677858	+	Missense_Mutation	SNP	C	A	A	rs150459522		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48677858C>A	uc003cul.2	-	34	9441	c.9160G>T	c.(9160-9162)GGG>TGG	p.G3054W	CELSR3_uc003cuf.1_Missense_Mutation_p.G3152W|CELSR3_uc010hkf.2_Missense_Mutation_p.G344W|CELSR3_uc010hkg.2_Missense_Mutation_p.G1037W	NM_001407	NP_001398	Q9NYQ7	CELR3_HUMAN	cadherin EGF LAG seven-pass G-type receptor 3	3054	Cytoplasmic (Potential).				homophilic cell adhesion|multicellular organismal development|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein binding			ovary(5)|upper_aerodigestive_tract(2)|central_nervous_system(2)|skin(2)	11				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCCGTGCCCCCGCCAGCATAG	0.657													3	16	---	---	---	---	PASS
MAGI1	9223	broad.mit.edu	37	3	65342290	65342290	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:65342290G>T	uc003dmn.2	-	23	4678	c.4152C>A	c.(4150-4152)CCC>CCA	p.P1384P	MAGI1_uc003dmm.2_3'UTR	NM_001033057	NP_001028229	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ	1413					cell adhesion|cell surface receptor linked signaling pathway|protein complex assembly	tight junction	ATP binding|protein C-terminus binding			lung(2)|skin(1)|breast(1)|kidney(1)|pancreas(1)	6		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCCTGCGCTCGGGGGACCTCC	0.726													3	13	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89528545	89528545	+	Splice_Site	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89528545A>T	uc003dqy.2	+	17	3072	c.2847_splice	c.e17-2	p.D949_splice	EPHA3_uc010hon.1_Splice_Site	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor							extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CTTTTTTTACAGTGACATGAA	0.383										TSP Lung(6;0.00050)			16	11	---	---	---	---	PASS
DZIP3	9666	broad.mit.edu	37	3	108363257	108363257	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108363257A>T	uc003dxd.2	+	14	1810	c.1388A>T	c.(1387-1389)AAA>ATA	p.K463I	DZIP3_uc003dxf.1_Missense_Mutation_p.K463I|DZIP3_uc011bhm.1_Intron|DZIP3_uc003dxe.1_Missense_Mutation_p.K463I|DZIP3_uc003dxg.1_Missense_Mutation_p.K186I	NM_014648	NP_055463	Q86Y13	DZIP3_HUMAN	DAZ interacting protein 3, zinc finger	463					protein polyubiquitination	cytoplasm	polyubiquitin binding|RNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						CCGCAATCCAAACAGTTTGAC	0.423													73	72	---	---	---	---	PASS
FSTL1	11167	broad.mit.edu	37	3	120121721	120121721	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:120121721C>A	uc003eds.2	-	9	914	c.739G>T	c.(739-741)GAG>TAG	p.E247*	FSTL1_uc011bjh.1_Nonsense_Mutation_p.E212*	NM_007085	NP_009016	Q12841	FSTL1_HUMAN	follistatin-like 1 precursor	247	VWFC.				BMP signaling pathway	extracellular space	calcium ion binding|heparin binding			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.189)		CAGTCCACCTCGGTCTCAGCT	0.532													5	95	---	---	---	---	PASS
KALRN	8997	broad.mit.edu	37	3	124431836	124431836	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124431836G>T	uc003ehg.2	+	58	8257	c.8130G>T	c.(8128-8130)GTG>GTT	p.V2710V	KALRN_uc003ehk.2_Silent_p.V1013V	NM_001024660	NP_001019831	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase isoform 1	2709	Protein kinase.				apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|nervous system development|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|vesicle-mediated transport	actin cytoskeleton|cytosol	ATP binding|GTPase activator activity|metal ion binding|protein binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6						GCAAAGATGTGGCTGTGAAAT	0.438													27	31	---	---	---	---	PASS
HEG1	57493	broad.mit.edu	37	3	124724179	124724179	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124724179C>G	uc003ehs.3	-	9	3295	c.3227G>C	c.(3226-3228)AGA>ACA	p.R1076T	HEG1_uc011bke.1_Missense_Mutation_p.R1176T	NM_020733	NP_065784	Q9ULI3	HEG1_HUMAN	HEG homolog 1 precursor	1076	Extracellular (Potential).					extracellular region|integral to membrane	calcium ion binding			ovary(2)	2						AAGAAAAGTTCTCTTTAATTT	0.353													11	19	---	---	---	---	PASS
TMCC1	23023	broad.mit.edu	37	3	129389574	129389574	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129389574T>A	uc003emz.3	-	5	1611	c.1110A>T	c.(1108-1110)AGA>AGT	p.R370S	TMCC1_uc003emy.3_Missense_Mutation_p.R46S|TMCC1_uc011blc.1_Missense_Mutation_p.R191S|TMCC1_uc010htg.2_Missense_Mutation_p.R256S	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	370						integral to membrane				skin(1)	1						AGGCAATCTCTCTGGGCTTTG	0.532													40	35	---	---	---	---	PASS
COL6A6	131873	broad.mit.edu	37	3	130287403	130287403	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130287403C>A	uc010htl.2	+	5	2387	c.2356C>A	c.(2356-2358)CGC>AGC	p.R786S		NM_001102608	NP_001096078	A6NMZ7	CO6A6_HUMAN	collagen type VI alpha 6 precursor	786	Nonhelical region.|VWFA 4.				axon guidance|cell adhesion	collagen				ovary(6)|central_nervous_system(1)|pancreas(1)	8						CATTCTGCAGCGCATTGAAGA	0.458													39	48	---	---	---	---	PASS
PIK3R4	30849	broad.mit.edu	37	3	130452690	130452690	+	Silent	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130452690G>C	uc003enj.2	-	4	1733	c.1152C>G	c.(1150-1152)TCC>TCG	p.S384S		NM_014602	NP_055417	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	384					fibroblast growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway	cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|breast(2)|skin(2)|stomach(1)|central_nervous_system(1)|kidney(1)	12						TCTGTAGGCAGGATGTTATAA	0.408													38	141	---	---	---	---	PASS
ATP2C1	27032	broad.mit.edu	37	3	130715610	130715610	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130715610A>G	uc003enl.2	+	24	2435	c.2213A>G	c.(2212-2214)AAT>AGT	p.N738S	ATP2C1_uc011blg.1_Missense_Mutation_p.N772S|ATP2C1_uc011blh.1_Missense_Mutation_p.N733S|ATP2C1_uc011bli.1_Missense_Mutation_p.N772S|ATP2C1_uc003enk.2_Missense_Mutation_p.N722S|ATP2C1_uc003enm.2_Missense_Mutation_p.N738S|ATP2C1_uc003enn.2_Missense_Mutation_p.N722S|ATP2C1_uc003eno.2_Missense_Mutation_p.N738S|ATP2C1_uc003enp.2_Missense_Mutation_p.N738S|ATP2C1_uc003enq.2_Missense_Mutation_p.N738S|ATP2C1_uc003enr.2_Missense_Mutation_p.N738S|ATP2C1_uc003ens.2_Missense_Mutation_p.N738S|ATP2C1_uc003ent.2_Missense_Mutation_p.N738S|ATP2C1_uc003enu.2_Missense_Mutation_p.N416S	NM_014382	NP_055197	P98194	AT2C1_HUMAN	calcium-transporting ATPase 2C1 isoform 1a	738	Helical; Name=6; (By similarity).	Calcium 2 (By similarity).			actin cytoskeleton reorganization|ATP biosynthetic process|calcium-dependent cell-cell adhesion|cellular calcium ion homeostasis|cellular manganese ion homeostasis|epidermis development|Golgi calcium ion homeostasis|Golgi calcium ion transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi apparatus|Golgi membrane|integral to membrane|trans-Golgi network	ATP binding|ATP binding|calcium ion binding|calcium-transporting ATPase activity|manganese ion binding|manganese-transporting ATPase activity|metal ion binding|signal transducer activity			skin(1)	1					Arsenic trioxide(DB01169)|Desflurane(DB01189)|Enflurane(DB00228)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Miconazole(DB01110)|Sevoflurane(DB01236)	TTGTGGATCAATATTATTATG	0.363									Hailey-Hailey_disease				26	67	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133327499	133327499	+	Silent	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133327499T>A	uc003eps.2	-	27	4437	c.4305A>T	c.(4303-4305)ACA>ACT	p.T1435T		NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1435	BRCT 8.				DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						AAAAAAGATGTGTGGCCTCTT	0.388								Other_conserved_DNA_damage_response_genes					11	64	---	---	---	---	PASS
KY	339855	broad.mit.edu	37	3	134339655	134339655	+	Silent	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:134339655G>C	uc010hty.2	-	7	590	c.528C>G	c.(526-528)CTC>CTG	p.L176L	KY_uc011blw.1_Silent_p.L176L|KY_uc011blx.1_Silent_p.L155L|KY_uc003eqr.1_5'UTR	NM_178554	NP_848649	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	176						cytoskeleton|Z disc	peptidase activity			ovary(2)	2						GGGCCTCCTGGAGCAGGTCAC	0.602													9	19	---	---	---	---	PASS
STAG1	10274	broad.mit.edu	37	3	136068095	136068095	+	Missense_Mutation	SNP	T	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136068095T>G	uc003era.1	-	29	3468	c.3176A>C	c.(3175-3177)GAT>GCT	p.D1059A	STAG1_uc003erb.1_Missense_Mutation_p.D1059A	NM_005862	NP_005853	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1059					cell division|chromosome segregation|mitotic metaphase/anaphase transition|mitotic prometaphase	cell junction|chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(2)	2						AGACATTCTATCATCTTCACC	0.428													42	62	---	---	---	---	PASS
TMEM22	80723	broad.mit.edu	37	3	136573495	136573495	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136573495G>A	uc003erf.3	+	2	407	c.193G>A	c.(193-195)GGG>AGG	p.G65R	TMEM22_uc003erg.3_Missense_Mutation_p.G65R|TMEM22_uc010hub.2_Missense_Mutation_p.G65R	NM_001097600	NP_001091069	Q8TBE7	TMM22_HUMAN	transmembrane protein 22	65						Golgi apparatus|integral to membrane				ovary(1)	1						GAAAAAAAAAGGGAGAGCTTT	0.403													25	94	---	---	---	---	PASS
ZIC1	7545	broad.mit.edu	37	3	147130317	147130317	+	Missense_Mutation	SNP	T	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147130317T>G	uc003ewe.2	+	2	1714	c.995T>G	c.(994-996)TTC>TGC	p.F332C		NM_003412	NP_003403	Q15915	ZIC1_HUMAN	zinc finger protein of the cerebellum 1	332	C2H2-type 4.				behavior|brain development|cell differentiation|inner ear morphogenesis|pattern specification process|positive regulation of protein import into nucleus|positive regulation of transcription, DNA-dependent|regulation of smoothened signaling pathway	cytoplasm|nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2						GAGAAGCCCTTCAAGTGCGAG	0.473													10	71	---	---	---	---	PASS
SGEF	26084	broad.mit.edu	37	3	153909148	153909148	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153909148A>G	uc011bog.1	+	8	1922	c.1711A>G	c.(1711-1713)ATG>GTG	p.M571V	SGEF_uc011boh.1_Missense_Mutation_p.M571V	NM_015595	NP_056410	Q96DR7	ARHGQ_HUMAN	Src homology 3 domain-containing guanine	571	DH.				regulation of Rho protein signal transduction	intracellular|ruffle	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)	1			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			GAACTTACCCATGATCTCTTT	0.463													16	33	---	---	---	---	PASS
GPR149	344758	broad.mit.edu	37	3	154139080	154139080	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154139080G>T	uc003faa.2	-	3	1471	c.1371C>A	c.(1369-1371)AGC>AGA	p.S457R		NM_001038705	NP_001033794	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	457	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(6)	6			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			AGGGCGTGGTGCTGATTTCTA	0.408													13	206	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154859822	154859822	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154859822G>T	uc010hvr.1	+	11	1211	c.1000G>T	c.(1000-1002)GTG>TTG	p.V334L	MME_uc003fab.1_Missense_Mutation_p.V334L|MME_uc003fac.1_Missense_Mutation_p.V334L|MME_uc003fad.1_Missense_Mutation_p.V334L|MME_uc003fae.1_Missense_Mutation_p.V334L	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase	334	Extracellular (Potential).				cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	CATGTCAACTGTGAATATTAG	0.363													54	57	---	---	---	---	PASS
CCNL1	57018	broad.mit.edu	37	3	156867178	156867178	+	Intron	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156867178C>T	uc003fbf.2	-						CCNL1_uc003fbd.1_Intron|CCNL1_uc003fbe.2_Intron|CCNL1_uc003fbg.2_Intron|CCNL1_uc011bor.1_Intron|CCNL1_uc003fbi.1_Intron	NM_020307	NP_064703	Q9UK58	CCNL1_HUMAN	cyclin L1						regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|RNA processing|transcription, DNA-dependent	nuclear speck	protein kinase binding			lung(3)|breast(1)|skin(1)	5			LUSC - Lung squamous cell carcinoma(72;0.0295)|Lung(72;0.0308)			TCTTACACTTCAAAAAATCAT	0.368													16	68	---	---	---	---	PASS
MFSD1	64747	broad.mit.edu	37	3	158541245	158541245	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158541245T>C	uc003fcl.1	+	12	1136	c.1106T>C	c.(1105-1107)CTT>CCT	p.L369P	MFSD1_uc003fcm.1_RNA|MFSD1_uc003fcn.1_Missense_Mutation_p.L272P|MFSD1_uc011bow.1_Missense_Mutation_p.L330P|MFSD1_uc011box.1_Missense_Mutation_p.L296P	NM_022736	NP_073573	Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing	369	Helical; (Potential).				transmembrane transport	integral to membrane					0			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TACTCATTGCTTGCCTGTGCA	0.428													30	103	---	---	---	---	PASS
SI	6476	broad.mit.edu	37	3	164750383	164750383	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164750383G>T	uc003fei.2	-	24	2725	c.2663C>A	c.(2662-2664)ACA>AAA	p.T888K		NM_001041	NP_001032	P14410	SUIS_HUMAN	sucrase-isomaltase	888	Lumenal.|Isomaltase.				carbohydrate metabolic process|polysaccharide digestion	apical plasma membrane|brush border|Golgi apparatus|integral to membrane	carbohydrate binding|oligo-1,6-glucosidase activity|sucrose alpha-glucosidase activity			ovary(7)|upper_aerodigestive_tract(4)|skin(2)|pancreas(1)	14		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)	TCTAACTTCTGTAACACTGTC	0.348										HNSCC(35;0.089)			24	37	---	---	---	---	PASS
USP13	8975	broad.mit.edu	37	3	179501871	179501871	+	Nonsense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:179501871C>G	uc003fkh.2	+	21	2615	c.2534C>G	c.(2533-2535)TCA>TGA	p.S845*		NM_003940	NP_003931	Q92995	UBP13_HUMAN	ubiquitin thiolesterase 13	845					ubiquitin-dependent protein catabolic process		cysteine-type endopeptidase activity|omega peptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(1)	1	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			GTTTGTGCCTCAGAAAGGCCC	0.398													58	176	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186445035	186445035	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186445035G>T	uc011bsa.1	+	5	786	c.574G>T	c.(574-576)GGA>TGA	p.G192*	KNG1_uc003fqr.2_Nonsense_Mutation_p.G192*	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	192	Cystatin 2.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	GGTGGTGGCTGGATTGAACTT	0.368													6	61	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197427648	197427648	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197427648G>A	uc003fyc.2	-	7	1280	c.1097C>T	c.(1096-1098)GCC>GTC	p.A366V	KIAA0226_uc003fyd.3_Missense_Mutation_p.A306V|KIAA0226_uc003fye.1_Missense_Mutation_p.A73V|KIAA0226_uc003fyf.2_Missense_Mutation_p.A199V|KIAA0226_uc003fyg.2_Missense_Mutation_p.A359V	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	366	Ser-rich.				autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		TAAGGAAGAGGCAGCAGAATC	0.597													14	37	---	---	---	---	PASS
PDE6B	5158	broad.mit.edu	37	4	656969	656969	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:656969C>A	uc003gap.2	+	15	1966	c.1913C>A	c.(1912-1914)TCG>TAG	p.S638*	PDE6B_uc003gao.3_Nonsense_Mutation_p.S638*|PDE6B_uc011buy.1_Nonsense_Mutation_p.S359*|PDE6B_uc011buz.1_Nonsense_Mutation_p.S70*	NM_000283	NP_000274	P35913	PDE6B_HUMAN	phosphodiesterase 6B isoform 1	638					cytosolic calcium ion homeostasis|GMP metabolic process|phototransduction, visible light|platelet activation|visual perception	cytosol|membrane	3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding				0						TTCCTGCTCTCGGAGGAGGTT	0.617													3	21	---	---	---	---	PASS
RGS12	6002	broad.mit.edu	37	4	3318706	3318706	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3318706C>A	uc003ggw.2	+	2	1713	c.809C>A	c.(808-810)TCG>TAG	p.S270*	RGS12_uc003ggu.2_Nonsense_Mutation_p.S270*|RGS12_uc010ics.1_Intron|RGS12_uc011bvr.1_RNA|RGS12_uc003ggv.2_Nonsense_Mutation_p.S270*|RGS12_uc003ggx.1_Nonsense_Mutation_p.S270*	NM_198229	NP_937872	O14924	RGS12_HUMAN	regulator of G-protein signalling 12 isoform 1	270	PID.					condensed nuclear chromosome|cytoplasm|plasma membrane	GTPase activator activity|receptor signaling protein activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		AAAATCCACTCGCTGGTGACC	0.617													3	27	---	---	---	---	PASS
FGFBP2	83888	broad.mit.edu	37	4	15964609	15964609	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15964609G>C	uc003gon.2	-	1	251	c.144C>G	c.(142-144)AGC>AGG	p.S48R		NM_031950	NP_114156	Q9BYJ0	FGFP2_HUMAN	killer-specific secretory protein of 37 kDa	48						extracellular space	growth factor binding				0						GCCCCAAGCTGCTGGGACGCA	0.592													11	32	---	---	---	---	PASS
SLIT2	9353	broad.mit.edu	37	4	20533630	20533630	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20533630C>T	uc003gpr.1	+	17	1841	c.1637C>T	c.(1636-1638)ACC>ATC	p.T546I	SLIT2_uc003gps.1_Missense_Mutation_p.T538I	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor	546	LRR 12.				apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						AATGAATTTACCGTGTTGGAA	0.299													14	31	---	---	---	---	PASS
SEL1L3	23231	broad.mit.edu	37	4	25821452	25821452	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25821452G>A	uc003gru.3	-	8	1553	c.1401C>T	c.(1399-1401)CAC>CAT	p.H467H		NM_015187	NP_056002	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3	467						integral to membrane	binding				0						TCTCGCCCCCGTGCTTTGCTG	0.433													12	33	---	---	---	---	PASS
LNX1	84708	broad.mit.edu	37	4	54327114	54327114	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:54327114A>G	uc003hag.3	-	11	2403	c.2147T>C	c.(2146-2148)ATT>ACT	p.I716T	PDGFRA_uc003haa.2_Intron|LNX1_uc003haf.3_Missense_Mutation_p.I620T|LNX1_uc003hah.3_RNA	NM_001126328	NP_001119800	Q8TBB1	LNX1_HUMAN	ligand of numb-protein X 1 isoform a	716	PDZ 4.					cytoplasm	zinc ion binding			ovary(2)|central_nervous_system(2)	4	all_neural(26;0.153)		GBM - Glioblastoma multiforme(3;8.2e-46)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGTTAGAGTAATTCTTCCTTT	0.363													27	54	---	---	---	---	PASS
PPAT	5471	broad.mit.edu	37	4	57261688	57261688	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57261688C>T	uc003hbr.2	-	11	1586	c.1384G>A	c.(1384-1386)GTA>ATA	p.V462I		NM_002703	NP_002694	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	462					glutamine metabolic process|nucleoside metabolic process|purine base biosynthetic process|purine ribonucleoside monophosphate biosynthetic process	cytosol	4 iron, 4 sulfur cluster binding|amidophosphoribosyltransferase activity|metal ion binding				0	Glioma(25;0.08)|all_neural(26;0.101)				L-Glutamine(DB00130)|Thioguanine(DB00352)	AGTCCTTCTACTGACAGATAC	0.343													16	36	---	---	---	---	PASS
ODAM	54959	broad.mit.edu	37	4	71064348	71064348	+	Intron	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71064348A>G	uc003hfc.2	+							NM_017855	NP_060325	A1E959	ODAM_HUMAN	odontogenic ameloblast-associated protein						biomineral tissue development|odontogenesis of dentine-containing tooth	fibril				ovary(3)|large_intestine(1)	4						GGACAGGTAAATGGATATAAC	0.368													16	101	---	---	---	---	PASS
GK2	2712	broad.mit.edu	37	4	80328018	80328018	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:80328018A>G	uc003hlu.2	-	1	1355	c.1337T>C	c.(1336-1338)GTA>GCA	p.V446A		NM_033214	NP_149991	Q14410	GLPK2_HUMAN	glycerol kinase 2	446					glycerol-3-phosphate metabolic process	mitochondrial outer membrane	ATP binding|glycerol kinase activity			ovary(2)|skin(2)	4						GGGTTTTATTACTGGAATATG	0.473													4	43	---	---	---	---	PASS
UNC5C	8633	broad.mit.edu	37	4	96163623	96163623	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96163623G>T	uc003htp.1	-	7	1219	c.1065C>A	c.(1063-1065)CTC>CTA	p.L355L	UNC5C_uc010ilc.1_Silent_p.L355L|UNC5C_uc003htq.2_Silent_p.L355L	NM_003728	NP_003719	O95185	UNC5C_HUMAN	unc5C precursor	355	Extracellular (Potential).|TSP type-1 2.				apoptosis|axon guidance|brain development	integral to membrane	netrin receptor activity			ovary(3)|pancreas(1)	4		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		ATTGCAAGACGAGGCCGTCGC	0.552													15	11	---	---	---	---	PASS
NPNT	255743	broad.mit.edu	37	4	106888366	106888366	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106888366C>A	uc003hya.2	+	11	1572	c.1367C>A	c.(1366-1368)TCG>TAG	p.S456*	NPNT_uc011cfc.1_Nonsense_Mutation_p.S473*|NPNT_uc011cfd.1_Nonsense_Mutation_p.S486*|NPNT_uc011cfe.1_Nonsense_Mutation_p.S457*|NPNT_uc010ilt.1_Nonsense_Mutation_p.S427*|NPNT_uc011cff.1_Nonsense_Mutation_p.S427*|NPNT_uc010ilu.1_Intron	NM_001033047	NP_001028219	Q6UXI9	NPNT_HUMAN	nephronectin precursor	456	MAM.				cell differentiation	membrane	calcium ion binding			skin(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		CTGACAGTGTCGGCAGCCAAA	0.537													3	19	---	---	---	---	PASS
LARP1B	55132	broad.mit.edu	37	4	129121824	129121824	+	Intron	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:129121824A>T	uc003iga.2	+						LARP1B_uc003igc.2_Intron|LARP1B_uc010ioa.1_Intron|LARP1B_uc003ige.2_Intron|LARP1B_uc003igd.2_Intron|LARP1B_uc003igf.2_Intron	NM_018078	NP_060548	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family member 2								RNA binding				0						ATTACAGGTCAGATATTTTCT	0.313													11	13	---	---	---	---	PASS
HPGD	3248	broad.mit.edu	37	4	175414319	175414319	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:175414319T>C	uc003itu.2	-	6	835	c.645A>G	c.(643-645)AAA>AAG	p.K215K	HPGD_uc003itt.2_Silent_p.K82K|HPGD_uc003itv.2_Intron|HPGD_uc011ckf.1_Silent_p.K94K|HPGD_uc010irp.2_Silent_p.K94K|HPGD_uc010irq.2_Intron|HPGD_uc011ckg.1_Silent_p.K147K|HPGD_uc011ckh.1_Silent_p.K94K	NM_000860	NP_000851	P15428	PGDH_HUMAN	hydroxyprostaglandin dehydrogenase 15-(NAD)	215					female pregnancy|lipoxygenase pathway|negative regulation of cell cycle|parturition|prostaglandin metabolic process|transforming growth factor beta receptor signaling pathway	cytosol|nucleus	15-hydroxyprostaglandin dehydrogenase (NAD+) activity|NAD+ binding|prostaglandin E receptor activity|protein homodimerization activity				0		Prostate(90;0.00763)|Melanoma(52;0.0179)|Renal(120;0.0376)|Breast(14;0.0991)|all_hematologic(60;0.124)|all_neural(102;0.196)		all cancers(43;2.6e-18)|Epithelial(43;4.19e-16)|OV - Ovarian serous cystadenocarcinoma(60;5.23e-09)|GBM - Glioblastoma multiforme(59;0.00176)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.0253)	NADH(DB00157)	TTCCATAGTATTTAATCATAT	0.289													6	10	---	---	---	---	PASS
SPCS3	60559	broad.mit.edu	37	4	177241318	177241318	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:177241318G>C	uc003iur.3	+	1	229	c.91G>C	c.(91-93)GCC>CCC	p.A31P		NM_021928	NP_068747	P61009	SPCS3_HUMAN	signal peptidase complex subunit 3	31	Helical; Signal-anchor for type II membrane protein; (Potential).				energy reserve metabolic process|regulation of insulin secretion|signal peptide processing	integral to membrane|microsome|signal peptidase complex	peptidase activity			ovary(1)	1		Breast(14;0.0011)|Prostate(90;0.0129)|Melanoma(52;0.0133)|Renal(120;0.0376)|all_hematologic(60;0.124)		all cancers(43;2.43e-19)|Epithelial(43;1.84e-16)|OV - Ovarian serous cystadenocarcinoma(60;4.51e-09)|GBM - Glioblastoma multiforme(59;0.000142)|STAD - Stomach adenocarcinoma(60;0.00279)|LUSC - Lung squamous cell carcinoma(193;0.0319)		CATCACCACCGCCTTCAAAGA	0.502													11	20	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183675635	183675635	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183675635G>T	uc003ivd.1	+	21	4152	c.4115G>T	c.(4114-4116)CGT>CTT	p.R1372L	ODZ3_uc003ive.1_Missense_Mutation_p.R785L	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1372	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		ACTGAAAATCGTCAAGTTCGC	0.493													13	9	---	---	---	---	PASS
SLC6A3	6531	broad.mit.edu	37	5	1432624	1432624	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1432624C>A	uc003jck.2	-	4	729	c.608G>T	c.(607-609)GGC>GTC	p.G203V		NM_001044	NP_001035	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter	203	Extracellular (Potential).				cell death|neurotransmitter biosynthetic process	axon|cytoplasm|integral to plasma membrane|neuronal cell body				ovary(3)|breast(2)|pancreas(1)	6			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amphetamine(DB00182)|Benztropine(DB00245)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Cocaine(DB00907)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Duloxetine(DB00476)|Fencamfamine(DB01463)|Mazindol(DB00579)|Methylphenidate(DB00422)|Modafinil(DB00745)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)	GTCGTTGAGGCCCGAGCTGTC	0.612													4	44	---	---	---	---	PASS
DNAH5	1767	broad.mit.edu	37	5	13716740	13716740	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13716740G>A	uc003jfd.2	-	74	12807	c.12765C>T	c.(12763-12765)GTC>GTT	p.V4255V	DNAH5_uc003jfc.2_Silent_p.V423V	NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	4255					microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					AGTCGTCAGTGACTCTGCCTC	0.388									Kartagener_syndrome				20	44	---	---	---	---	PASS
FAM134B	54463	broad.mit.edu	37	5	16475279	16475279	+	Silent	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16475279A>G	uc003jfs.2	-	9	1103	c.1065T>C	c.(1063-1065)AAT>AAC	p.N355N	FAM134B_uc003jfr.2_Silent_p.N214N	NM_001034850	NP_001030022	Q9H6L5	F134B_HUMAN	hypothetical protein LOC54463 isoform 1	355					sensory perception of pain	cis-Golgi network|endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3						TTCCCATGCCATTTTCTAGAG	0.428													39	46	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23510030	23510030	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23510030T>C	uc003jgo.2	+	4	377	c.195T>C	c.(193-195)GGT>GGC	p.G65G		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	65	KRAB-related.				meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						TCTTTTCAGGTCTCAGAGCCA	0.488										HNSCC(3;0.000094)			29	46	---	---	---	---	PASS
PRDM9	56979	broad.mit.edu	37	5	23526702	23526702	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23526702A>T	uc003jgo.2	+	11	1687	c.1505A>T	c.(1504-1506)CAG>CTG	p.Q502L		NM_020227	NP_064612	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	502					meiosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleoplasm	histone-lysine N-methyltransferase activity|nucleic acid binding|zinc ion binding			ovary(3)|large_intestine(2)|pancreas(1)	6						AGAACAGGCCAGAAAGTGAAT	0.453										HNSCC(3;0.000094)			29	55	---	---	---	---	PASS
CDH6	1004	broad.mit.edu	37	5	31299570	31299570	+	Splice_Site	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31299570G>T	uc003jhe.1	+	5	970	c.644_splice	c.e5-1	p.G215_splice	CDH6_uc003jhd.1_Splice_Site_p.G215_splice	NM_004932	NP_004923	P55285	CADH6_HUMAN	cadherin 6, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	cytoplasm|integral to membrane|nucleus|plasma membrane	calcium ion binding			ovary(4)|skin(2)|large_intestine(1)	7						CACATCCACAGGTATTATCAA	0.338													6	102	---	---	---	---	PASS
EGFLAM	133584	broad.mit.edu	37	5	38448391	38448391	+	Intron	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38448391G>T	uc003jlc.1	+						EGFLAM_uc003jlb.1_Intron|EGFLAM_uc003jle.1_Intron|EGFLAM_uc003jlf.1_Intron|EGFLAM_uc003jlg.1_Intron	NM_152403	NP_689616	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G							cell junction|proteinaceous extracellular matrix|synapse				pancreas(3)|skin(3)|ovary(1)	7	all_lung(31;0.000385)					TCCTTTTTCTGTTCTGTCCCA	0.458													8	149	---	---	---	---	PASS
HSPA9	3313	broad.mit.edu	37	5	137895598	137895598	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137895598G>T	uc003ldf.2	-	11	1473	c.1365C>A	c.(1363-1365)ACC>ACA	p.T455T	HSPA9_uc003lde.2_5'Flank|HSPA9_uc011cyw.1_Silent_p.T386T	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor	455					anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TAATAAGTTTGGTAAAGACAC	0.478													4	29	---	---	---	---	PASS
PSD2	84249	broad.mit.edu	37	5	139193044	139193044	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139193044C>T	uc003leu.1	+	3	727	c.522C>T	c.(520-522)GTC>GTT	p.V174V		NM_032289	NP_115665	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	174					regulation of ARF protein signal transduction	cytoplasm|integral to membrane	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGCTGCGTCAGCTTCGAGG	0.652													13	6	---	---	---	---	PASS
PCDHA2	56146	broad.mit.edu	37	5	140176083	140176083	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140176083G>A	uc003lhd.2	+	1	1640	c.1534G>A	c.(1534-1536)GCG>ACG	p.A512T	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhc.1_Missense_Mutation_p.A512T|PCDHA2_uc011czy.1_Missense_Mutation_p.A512T	NM_018905	NP_061728	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2 isoform 1 precursor	512	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(4)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCGGTGCACGCGGAGAGCGG	0.697													16	25	---	---	---	---	PASS
HAVCR1	26762	broad.mit.edu	37	5	156482466	156482466	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:156482466A>G	uc010jij.1	-	3	310	c.125T>C	c.(124-126)GTC>GCC	p.V42A	HAVCR1_uc011ddl.1_5'Flank|HAVCR1_uc003lwi.2_Missense_Mutation_p.V42A|HAVCR1_uc011ddm.1_Missense_Mutation_p.V42A	NM_001099414	NP_001092884	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	42	Extracellular (Potential).|Ig-like V-type.				interspecies interaction between organisms	integral to membrane	receptor activity			ovary(1)|skin(1)	2	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CATGGATGTGACAGCTCCACT	0.483													6	4	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	5	177482912	177482912	+	IGR	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177482912G>A								FAM153C (6824 upstream) : N4BP3 (57644 downstream)																							ACGATTTTGCGCCGGCTGCTC	0.542													5	36	---	---	---	---	PASS
HIST1H2BA	255626	broad.mit.edu	37	6	25727146	25727146	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25727146G>A	uc003nfd.2	+	1	10	c.10G>A	c.(10-12)GTG>ATG	p.V4M	HIST1H2AA_uc003nfc.2_5'Flank	NM_170610	NP_733759	Q96A08	H2B1A_HUMAN	histone cluster 1, H2ba	4					nucleosome assembly	nucleosome|nucleus	DNA binding			kidney(1)	1						TATGCCGGAGGTGTCATCTAA	0.473													25	36	---	---	---	---	PASS
SLC17A4	10050	broad.mit.edu	37	6	25770337	25770337	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25770337C>G	uc003nfe.2	+	4	459	c.340C>G	c.(340-342)CTC>GTC	p.L114V	SLC17A4_uc011djx.1_Intron|SLC17A4_uc003nff.1_Intron|SLC17A4_uc003nfg.2_Missense_Mutation_p.L51V	NM_005495	NP_005486	Q9Y2C5	S17A4_HUMAN	solute carrier family 17 (sodium phosphate),	114					phosphate metabolic process	integral to plasma membrane|membrane fraction	sodium:phosphate symporter activity			skin(1)	1						GGGAATCATCCTCAGCTCCCT	0.458													37	77	---	---	---	---	PASS
DEF6	50619	broad.mit.edu	37	6	35280413	35280413	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35280413G>T	uc003okk.2	+	5	710	c.671G>T	c.(670-672)TGG>TTG	p.W224L	DEF6_uc010jvs.2_Missense_Mutation_p.W224L|DEF6_uc010jvt.2_Intron	NM_022047	NP_071330	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog	224	PH.					cytoplasm|nucleus|plasma membrane					0						GGCTACCTGTGGAAGCGAGGG	0.612													8	9	---	---	---	---	PASS
DNAH8	1769	broad.mit.edu	37	6	38939383	38939383	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:38939383C>A	uc003ooe.1	+	81	12416	c.11816C>A	c.(11815-11817)TCA>TAA	p.S3939*	DNAH8_uc003oog.1_Nonsense_Mutation_p.S388*	NM_001371	NP_001362			dynein, axonemal, heavy polypeptide 8											skin(8)|ovary(7)|lung(2)|large_intestine(1)|central_nervous_system(1)|kidney(1)|pancreas(1)	21						AGAACTATCTCAATGGGGCAA	0.378													6	90	---	---	---	---	PASS
ABCC10	89845	broad.mit.edu	37	6	43400566	43400566	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43400566G>T	uc003ouy.1	+	3	1063	c.848G>T	c.(847-849)CGG>CTG	p.R283L	ABCC10_uc003ouz.1_Missense_Mutation_p.R240L|ABCC10_uc010jyo.1_5'Flank	NM_033450	NP_258261	Q5T3U5	MRP7_HUMAN	ATP-binding cassette, sub-family C, member 10	283						integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(6)|central_nervous_system(1)	7	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0152)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			GCCTTTGGACGGTGCTATCTG	0.627													4	20	---	---	---	---	PASS
PKHD1	5314	broad.mit.edu	37	6	51907930	51907930	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:51907930C>G	uc003pah.1	-	27	3100	c.2824G>C	c.(2824-2826)GGT>CGT	p.G942R	PKHD1_uc003pai.2_Missense_Mutation_p.G942R	NM_138694	NP_619639	P08F94	PKHD1_HUMAN	fibrocystin isoform 1	942	IPT/TIG 4.|Extracellular (Potential).				cell-cell adhesion|cilium assembly|homeostatic process|kidney development|negative regulation of cellular component movement	anchored to external side of plasma membrane|apical plasma membrane|integral to membrane|microtubule basal body	protein binding|receptor activity			lung(15)|ovary(15)|large_intestine(5)|central_nervous_system(3)|skin(3)|breast(2)|upper_aerodigestive_tract(1)	44	Lung NSC(77;0.0605)					TTGATGTCACCATCTTAAAGG	0.343													6	9	---	---	---	---	PASS
GSTA1	2938	broad.mit.edu	37	6	52656747	52656747	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52656747G>T	uc003paz.2	-	7	690	c.578C>A	c.(577-579)ACA>AAA	p.T193K		NM_145740	NP_665683	P08263	GSTA1_HUMAN	glutathione S-transferase alpha 1	193	GST C-terminal.				glutathione metabolic process|xenobiotic metabolic process	cytosol	glutathione transferase activity			ovary(1)	1	Lung NSC(77;0.118)				Amsacrine(DB00276)|Busulfan(DB01008)|Glutathione(DB00143)	CTTCTTCACTGTGGGCAGGTT	0.473													8	87	---	---	---	---	PASS
RIMS1	22999	broad.mit.edu	37	6	72967848	72967848	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:72967848A>G	uc003pga.2	+	17	2868	c.2791A>G	c.(2791-2793)AGA>GGA	p.R931G	RIMS1_uc011dyb.1_Missense_Mutation_p.R556G|RIMS1_uc003pgc.2_Missense_Mutation_p.R557G|RIMS1_uc010kaq.2_Missense_Mutation_p.R404G|RIMS1_uc011dyc.1_Missense_Mutation_p.R405G|RIMS1_uc010kar.2_Missense_Mutation_p.R324G|RIMS1_uc011dyd.1_Missense_Mutation_p.R390G|RIMS1_uc003pgf.2_Missense_Mutation_p.R147G|RIMS1_uc003pgg.2_Missense_Mutation_p.R148G|RIMS1_uc003pgi.2_Missense_Mutation_p.R147G|RIMS1_uc003pgh.2_Missense_Mutation_p.R147G|RIMS1_uc003pgd.2_Missense_Mutation_p.R148G|RIMS1_uc003pge.2_Missense_Mutation_p.R148G|RIMS1_uc011dye.1_5'UTR|RIMS1_uc011dyf.1_5'Flank|RIMS1_uc003pgb.3_Missense_Mutation_p.R557G|RIMS1_uc010kas.1_Missense_Mutation_p.R390G	NM_014989	NP_055804	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	931					calcium ion-dependent exocytosis|cellular membrane fusion|glutamate secretion|intracellular protein transport|protein complex assembly|regulated secretory pathway|response to stimulus|synaptic vesicle exocytosis|visual perception	cell junction|presynaptic membrane	metal ion binding|Rab GTPase binding			ovary(7)|pancreas(2)|breast(1)	10		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GTCTAGTGCTAGAGAAAGTAA	0.373													14	27	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79651056	79651056	+	Intron	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79651056G>C	uc003pir.2	-						PHIP_uc003piq.2_Intron|PHIP_uc011dyp.1_Intron|IRAK1BP1_uc010kbg.1_Intron|PHIP_uc003pio.3_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCCTAAAAGGGAACAACAGTA	0.393													4	36	---	---	---	---	PASS
KIAA1009	22832	broad.mit.edu	37	6	84865148	84865148	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84865148C>A	uc010kbp.2	-	22	2960	c.2863G>T	c.(2863-2865)GAT>TAT	p.D955Y	KIAA1009_uc003pkj.3_Missense_Mutation_p.D879Y|KIAA1009_uc003pki.3_Missense_Mutation_p.D341Y	NM_014895	NP_055710	Q5TB80	QN1_HUMAN	KIAA1009 protein	955	Potential.				cell division|mitosis	centrosome|nucleus|plasma membrane|spindle	protein binding			ovary(1)	1		all_cancers(76;1.5e-06)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00258)		BRCA - Breast invasive adenocarcinoma(397;0.089)		TCCACTGTATCACCAGCTGCT	0.363													13	23	---	---	---	---	PASS
HACE1	57531	broad.mit.edu	37	6	105281021	105281021	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105281021T>C	uc003pqu.1	-	6	707	c.430A>G	c.(430-432)ACA>GCA	p.T144A	HACE1_uc010kcy.1_5'UTR|HACE1_uc010kcz.1_Missense_Mutation_p.T144A	NM_020771	NP_065822	Q8IYU2	HACE1_HUMAN	HECT domain and ankyrin repeat containing, E3	144	ANK 3.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	endoplasmic reticulum	ubiquitin-protein ligase activity			ovary(5)|lung(2)	7		all_cancers(87;6.89e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0216)|Colorectal(196;0.202)		BRCA - Breast invasive adenocarcinoma(108;0.122)|Epithelial(106;0.204)		AGTAGTTCTGTCCGCCCATTC	0.423													10	56	---	---	---	---	PASS
ARMC2	84071	broad.mit.edu	37	6	109175566	109175566	+	Silent	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109175566A>G	uc003pss.3	+	2	270	c.96A>G	c.(94-96)GAA>GAG	p.E32E	ARMC2_uc011eao.1_5'UTR	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2	32							binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		TCATAAGTGAAGCAAGAAATG	0.393													41	60	---	---	---	---	PASS
SESN1	27244	broad.mit.edu	37	6	109415214	109415214	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109415214C>A	uc003psu.2	-	1	74	c.63G>T	c.(61-63)AGG>AGT	p.R21S	C6orf182_uc003psv.3_5'Flank|C6orf182_uc003psw.3_5'Flank|C6orf182_uc010kdk.2_5'Flank|C6orf182_uc003psx.3_5'Flank|C6orf182_uc010kdl.2_5'Flank	NM_014454	NP_055269	Q9Y6P5	SESN1_HUMAN	sestrin 1	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					cell cycle arrest|negative regulation of cell proliferation|response to DNA damage stimulus	nucleus				ovary(1)	1		all_cancers(87;6.45e-05)|Acute lymphoblastic leukemia(125;3.55e-10)|all_hematologic(75;1.68e-07)|all_epithelial(87;0.0106)|Colorectal(196;0.0637)		Epithelial(106;0.0014)|BRCA - Breast invasive adenocarcinoma(108;0.00146)|all cancers(137;0.0031)|OV - Ovarian serous cystadenocarcinoma(136;0.0117)		ATGCTGTCTCCCTAGTAGTTG	0.443													7	127	---	---	---	---	PASS
MICAL1	64780	broad.mit.edu	37	6	109769511	109769511	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109769511G>T	uc003ptj.2	-	12	2004	c.1750C>A	c.(1750-1752)CCG>ACG	p.P584T	MICAL1_uc003ptk.2_Missense_Mutation_p.P584T|MICAL1_uc010kdr.2_Missense_Mutation_p.P498T|MICAL1_uc011eaq.1_Missense_Mutation_p.P603T	NM_022765	NP_073602	Q8TDZ2	MICA1_HUMAN	microtubule associated monoxygenase, calponin	584	CH.				cytoskeleton organization|signal transduction	cytoplasm|intermediate filament	SH3 domain binding|zinc ion binding			breast(2)|ovary(1)	3		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0142)|all cancers(137;0.0197)|OV - Ovarian serous cystadenocarcinoma(136;0.0233)|BRCA - Breast invasive adenocarcinoma(108;0.0574)		GACACCACCGGTGTGATGCCC	0.607													15	100	---	---	---	---	PASS
DDO	8528	broad.mit.edu	37	6	110736689	110736689	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110736689C>A	uc003puc.2	-	1	65	c.61G>T	c.(61-63)GAC>TAC	p.D21Y	DDO_uc003pud.2_Missense_Mutation_p.D21Y	NM_003649	NP_003640	Q99489	OXDD_HUMAN	D-aspartate oxidase isoform a	Error:Variant_position_missing_in_Q99489_after_alignment					aspartate catabolic process	peroxisome	binding|D-amino-acid oxidase activity|D-aspartate oxidase activity			ovary(2)|breast(1)	3		all_cancers(87;3.47e-21)|all_epithelial(87;9.03e-20)|Acute lymphoblastic leukemia(125;2.13e-07)|all_hematologic(75;5.28e-06)|all_lung(197;2.98e-05)|Lung NSC(302;3.25e-05)|Colorectal(196;3.46e-05)|Ovarian(999;0.00327)		all cancers(137;2.54e-48)|Epithelial(106;3.11e-44)|OV - Ovarian serous cystadenocarcinoma(136;2.08e-24)|BRCA - Breast invasive adenocarcinoma(108;0.000141)|GBM - Glioblastoma multiforme(226;0.00046)		AAAAAGCAGTCTTGGAAGCCA	0.507													16	36	---	---	---	---	PASS
CLVS2	134829	broad.mit.edu	37	6	123318999	123318999	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123318999C>A	uc003pzi.1	+	2	946	c.77C>A	c.(76-78)ACG>AAG	p.T26K		NM_001010852	NP_001010852	Q5SYC1	CLVS2_HUMAN	retinaldehyde binding protein 1-like 2	26					lysosome organization	clathrin-coated vesicle|early endosome membrane|trans-Golgi network	phosphatidylinositol-3,5-bisphosphate binding|transporter activity			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	5						AACCCAGACACGCTGCACCAG	0.547													27	43	---	---	---	---	PASS
THEMIS	387357	broad.mit.edu	37	6	128134270	128134270	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:128134270C>A	uc003qbi.2	-	5	1835	c.1516G>T	c.(1516-1518)GTG>TTG	p.V506L	THEMIS_uc010kfa.2_Missense_Mutation_p.V409L|THEMIS_uc011ebt.1_Missense_Mutation_p.V506L|THEMIS_uc010kfb.2_Missense_Mutation_p.V471L	NM_001010923	NP_001010923	Q8N1K5	THMS1_HUMAN	thymocyte selection pathway associated isoform	506	CABIT 2.				negative T cell selection|positive T cell selection|T cell receptor signaling pathway	cytoplasm|nucleus				ovary(2)|skin(2)	4						AAGCGGCCCACAGGAATTTCC	0.478													20	38	---	---	---	---	PASS
GRM1	2911	broad.mit.edu	37	6	146673571	146673571	+	Missense_Mutation	SNP	T	A	A	rs151255685		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146673571T>A	uc010khw.1	+	5	1842	c.1372T>A	c.(1372-1374)TCA>ACA	p.S458T	GRM1_uc010khv.1_Missense_Mutation_p.S458T|GRM1_uc003qll.2_Missense_Mutation_p.S458T|GRM1_uc011edz.1_Missense_Mutation_p.S458T|GRM1_uc011eea.1_Missense_Mutation_p.S458T	NM_000838	NP_000829	Q13255	GRM1_HUMAN	glutamate receptor, metabotropic 1 isoform alpha	458	Extracellular (Potential).				synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			lung(8)|ovary(4)|central_nervous_system(3)|large_intestine(2)|breast(2)	19		Ovarian(120;0.0387)		OV - Ovarian serous cystadenocarcinoma(155;5.35e-08)|GBM - Glioblastoma multiforme(68;0.00762)	Acamprosate(DB00659)|L-Glutamic Acid(DB00142)	CATCAAGTCCTCATTCATTGG	0.522													15	144	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151859208	151859208	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151859208C>T	uc003qol.2	+	3	304	c.215C>T	c.(214-216)TCT>TTT	p.S72F		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	72	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		AAGATGCTTTCTAAAGAAGTC	0.353													31	48	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152949431	152949431	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152949431C>A	uc010kiw.2	-	3	638	c.36G>T	c.(34-36)CGG>CGT	p.R12R	SYNE1_uc003qot.3_Silent_p.R12R|SYNE1_uc003qou.3_Silent_p.R12R|SYNE1_uc010kjb.1_Silent_p.R12R|SYNE1_uc003qpa.1_Silent_p.R12R	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	12	Actin-binding.|Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TGGCGATATCCCGAGGACACC	0.502										HNSCC(10;0.0054)			17	52	---	---	---	---	PASS
ARID1B	57492	broad.mit.edu	37	6	157521975	157521975	+	Missense_Mutation	SNP	G	T	T	rs144424476		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157521975G>T	uc003qqn.2	+	18	4345	c.4193G>T	c.(4192-4194)CGC>CTC	p.R1398L	ARID1B_uc003qqo.2_Missense_Mutation_p.R1358L|ARID1B_uc003qqp.2_Missense_Mutation_p.R1345L	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1403					chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		GGCCCGGACCGCAGGCCCATC	0.632													6	18	---	---	---	---	PASS
TULP4	56995	broad.mit.edu	37	6	158914661	158914661	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:158914661C>A	uc003qrf.2	+	10	3045	c.1688C>A	c.(1687-1689)TCC>TAC	p.S563Y	TULP4_uc003qrg.2_Missense_Mutation_p.S563Y	NM_020245	NP_064630	Q9NRJ4	TULP4_HUMAN	tubby like protein 4 isoform 1	563					intracellular signal transduction|response to nutrient	cytoplasm	protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		CAGGAGCTCTCCCGGTCCCCA	0.657													4	29	---	---	---	---	PASS
FNDC1	84624	broad.mit.edu	37	6	159635967	159635967	+	Intron	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:159635967C>A	uc010kjv.2	+						FNDC1_uc010kjw.1_Intron	NM_032532	NP_115921	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1							extracellular region				large_intestine(4)|ovary(3)|central_nervous_system(1)	8		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		TGTGTCCTGCCCTCTTTAAGA	0.532													5	37	---	---	---	---	PASS
LPA	4018	broad.mit.edu	37	6	161006101	161006101	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161006101C>G	uc003qtl.2	-	27	4386	c.4266G>C	c.(4264-4266)AGG>AGC	p.R1422S		NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor	3930	Kringle 35.				blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	ATAATGGGATCCTCCGATGCC	0.443													38	91	---	---	---	---	PASS
C6orf70	55780	broad.mit.edu	37	6	170169666	170169666	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170169666G>C	uc003qxg.1	+	12	1123	c.1090G>C	c.(1090-1092)GAG>CAG	p.E364Q	C6orf70_uc011ehb.1_Missense_Mutation_p.E238Q|C6orf70_uc003qxh.1_Missense_Mutation_p.E364Q|C6orf70_uc010kky.1_Missense_Mutation_p.E238Q|C6orf70_uc003qxi.1_Missense_Mutation_p.E12Q	NM_018341	NP_060811	Q5T6L9	CF070_HUMAN	hypothetical protein LOC55780	364						integral to membrane				ovary(1)	1		Breast(66;5.08e-05)|Ovarian(120;0.208)		OV - Ovarian serous cystadenocarcinoma(33;1.2e-22)|BRCA - Breast invasive adenocarcinoma(81;1.49e-07)|GBM - Glioblastoma multiforme(31;0.00191)		GAACCATCAGGAGGGTCCCCG	0.403													7	20	---	---	---	---	PASS
SDK1	221935	broad.mit.edu	37	7	4089005	4089005	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4089005G>T	uc003smx.2	+	18	2767	c.2628G>T	c.(2626-2628)GTG>GTT	p.V876V	SDK1_uc010kso.2_Silent_p.V152V	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor	876	Fibronectin type-III 3.				cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CGCAGAACGTGCAGACGGAAG	0.572													8	29	---	---	---	---	PASS
COL28A1	340267	broad.mit.edu	37	7	7410440	7410440	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7410440T>C	uc003src.1	-	33	3099	c.2982A>G	c.(2980-2982)TCA>TCG	p.S994S	COL28A1_uc011jxe.1_Silent_p.S677S	NM_001037763	NP_001032852	Q2UY09	COSA1_HUMAN	collagen, type XXVIII precursor	994					cell adhesion	basement membrane|collagen	serine-type endopeptidase inhibitor activity			skin(3)	3		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		GAGGTGACGATGAACCAAAAA	0.368													23	39	---	---	---	---	PASS
GLCCI1	113263	broad.mit.edu	37	7	8099836	8099836	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:8099836G>A	uc003srk.2	+	5	1483	c.924G>A	c.(922-924)AAG>AAA	p.K308K		NM_138426	NP_612435	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	308											0		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		AATTAGAAAAGGTATTCATTA	0.368													17	43	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20762813	20762813	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20762813G>A	uc003suw.3	+	12	1807	c.1261G>A	c.(1261-1263)GAT>AAT	p.D421N	ABCB5_uc010kuh.2_Missense_Mutation_p.D866N|ABCB5_uc003sux.1_Missense_Mutation_p.D44N	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	421	Cytoplasmic (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						TGCCAACAAAGATAAGCAAGA	0.378													15	33	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21727028	21727028	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21727028T>A	uc003svc.2	+	35	5859	c.5828T>A	c.(5827-5829)GTG>GAG	p.V1943E		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1943	AAA 1 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						AAGGGATTGGTGCAGACAGGA	0.408									Kartagener_syndrome				25	31	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28848907	28848907	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28848907G>A	uc003szq.2	+	9	1520	c.1130G>A	c.(1129-1131)AGG>AAG	p.R377K	CREB5_uc003szo.2_Missense_Mutation_p.R344K|CREB5_uc003szr.2_Missense_Mutation_p.R370K|CREB5_uc003szs.2_Missense_Mutation_p.R238K	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	377	Basic motif.				positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						CCGGACGAGAGGCGGCGGAAA	0.592													24	30	---	---	---	---	PASS
PDE1C	5137	broad.mit.edu	37	7	31793173	31793173	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31793173G>A	uc003tcm.1	-						PDE1C_uc003tcn.1_Intron|PDE1C_uc003tco.1_Intron	NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			GATGACTGGCGGCCATGGAAA	0.483													19	40	---	---	---	---	PASS
ZPBP	11055	broad.mit.edu	37	7	50057886	50057886	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50057886G>T	uc003tou.2	-	6	803	c.733C>A	c.(733-735)CCC>ACC	p.P245T	ZPBP_uc011kci.1_Missense_Mutation_p.P171T|ZPBP_uc010kyw.2_Missense_Mutation_p.P244T	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	245					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					CATCGCTTGGGTCCTTTTTCA	0.299													8	20	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	78150946	78150946	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:78150946G>T	uc003ugx.2	-	4	809	c.555C>A	c.(553-555)ACC>ACA	p.T185T	MAGI2_uc003ugy.2_Silent_p.T185T|MAGI2_uc011kgr.1_Silent_p.T17T|MAGI2_uc011kgs.1_Silent_p.T22T	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	185	Guanylate kinase-like.					cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GCGGCTTTGGGGTACCGTAGT	0.383													8	143	---	---	---	---	PASS
SPDYE3	441272	broad.mit.edu	37	7	99917383	99917383	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99917383C>T	uc003uug.1	+	4	651	c.411C>T	c.(409-411)TTC>TTT	p.F137F	uc011kjm.1_5'Flank	NM_001004351	NP_001004351	A6NKU9	SPDE3_HUMAN	speedy homolog E3	514											0						TCCAGTTCTTCTGTTCCATGC	0.607													86	46	---	---	---	---	PASS
PILRA	29992	broad.mit.edu	37	7	99971747	99971747	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99971747G>T	uc003uuo.1	+	2	357	c.145G>T	c.(145-147)GTG>TTG	p.V49L	PILRA_uc011kjn.1_Missense_Mutation_p.V49L|PILRA_uc011kjo.1_Missense_Mutation_p.V49L|PILRA_uc003uup.1_Missense_Mutation_p.V49L|PILRA_uc003uuq.1_Missense_Mutation_p.V49L	NM_013439	NP_038467	Q9UKJ1	PILRA_HUMAN	paired immunoglobulin-like type 2 receptor alpha	49	Extracellular (Potential).|Ig-like V-type.				interspecies interaction between organisms	extracellular region|integral to membrane|plasma membrane	protein binding|receptor activity			skin(1)	1	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGGTGGCTCTGTGGAAATCCC	0.557													6	44	---	---	---	---	PASS
CADPS2	93664	broad.mit.edu	37	7	122111562	122111562	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:122111562C>A	uc010lkp.2	-	13	2216	c.2053G>T	c.(2053-2055)GGT>TGT	p.G685C	CADPS2_uc011knx.1_Missense_Mutation_p.G56C|CADPS2_uc003vkg.3_Missense_Mutation_p.G382C|CADPS2_uc010lkq.2_Missense_Mutation_p.G682C	NM_017954	NP_060424	Q86UW7	CAPS2_HUMAN	Ca2+-dependent activator protein for secretion 2	685					exocytosis|protein transport	cell junction|cytoplasmic vesicle membrane|synapse	lipid binding|metal ion binding			ovary(1)|central_nervous_system(1)	2						CCTCTCACACCATAACGGGCA	0.418													4	23	---	---	---	---	PASS
AGK	55750	broad.mit.edu	37	7	141315303	141315303	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:141315303C>T	uc003vwi.2	+	8	627	c.456C>T	c.(454-456)ATC>ATT	p.I152I	AGK_uc011krg.1_RNA	NM_018238	NP_060708	Q53H12	AGK_HUMAN	acylglycerol kinase precursor	152	DAGKc.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway	mitochondrial membrane	acylglycerol kinase activity|ATP binding|diacylglycerol kinase activity|NAD+ kinase activity			ovary(1)|breast(1)	2	Melanoma(164;0.0171)					TTGGATTTATCCCACTGGGAG	0.438													38	39	---	---	---	---	PASS
FAM115C	285966	broad.mit.edu	37	7	143421745	143421745	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143421745C>T	uc003wdf.2	+	7	2543	c.2460C>T	c.(2458-2460)CCC>CCT	p.P820P	FAM115C_uc003wdg.2_Silent_p.P539P|FAM115C_uc011ktk.1_Silent_p.P820P|FAM115C_uc003wdh.2_Silent_p.P820P|FAM115C_uc011ktm.1_Silent_p.P820P|uc011ktn.1_Intron|uc011kto.1_Intron|uc011ktp.1_Intron|LOC154761_uc011ktq.1_Intron|LOC154761_uc011ktr.1_Intron|LOC154761_uc011kts.1_Intron|LOC154761_uc003wdj.1_Intron|FAM115C_uc011ktt.1_Silent_p.P716P|FAM115C_uc003wdi.1_Silent_p.P539P	NM_001130025	NP_001123497	A6NFQ2	F115C_HUMAN	hypothetical protein LOC285966 isoform A	820											0						AGGGAGCCCCCCTGTGTGACT	0.572													4	11	---	---	---	---	PASS
ZNF862	643641	broad.mit.edu	37	7	149545452	149545452	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149545452C>T	uc010lpn.2	+	4	1062	c.870C>T	c.(868-870)ATC>ATT	p.I290I	ZNF862_uc003wgm.2_RNA	NM_001099220	NP_001092690	O60290	ZN862_HUMAN	zinc finger protein 862	290					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	metal ion binding|nucleic acid binding|protein dimerization activity			skin(1)	1						AAAAAGAAATCACTGATGGCA	0.403													6	6	---	---	---	---	PASS
NEIL2	252969	broad.mit.edu	37	8	11640745	11640745	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11640745G>T	uc003wug.2	+	4	1200	c.525G>T	c.(523-525)CTG>CTT	p.L175L	NEIL2_uc003wue.2_Silent_p.L175L|NEIL2_uc003wuf.2_Silent_p.L114L|NEIL2_uc011kxd.1_Silent_p.L59L	NM_145043	NP_659480	Q969S2	NEIL2_HUMAN	nei like 2 isoform a	175					base-excision repair|nucleotide-excision repair	nucleus	damaged DNA binding|DNA-(apurinic or apyrimidinic site) lyase activity|hydrolase activity, hydrolyzing N-glycosyl compounds|zinc ion binding				0	all_epithelial(15;0.103)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.166)		GTGGCTTCCTGGCATTTTATA	0.498								BER_DNA_glycosylases					18	13	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67547616	67547616	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67547616G>A	uc003xwn.2	-							NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex						protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			ACCTAAAAAGGGGAAAAGATA	0.299													11	36	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77618799	77618799	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77618799G>T	uc003yav.2	+	2	2863	c.2476G>T	c.(2476-2478)GCC>TCC	p.A826S	ZFHX4_uc003yat.1_Missense_Mutation_p.A826S|ZFHX4_uc003yau.1_Missense_Mutation_p.A826S|ZFHX4_uc003yaw.1_Missense_Mutation_p.A826S	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	826						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GTACTACCTAGCCCAGAACAT	0.527										HNSCC(33;0.089)			9	21	---	---	---	---	PASS
ZFHX4	79776	broad.mit.edu	37	8	77763701	77763701	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77763701C>A	uc003yav.2	+	10	4796	c.4409C>A	c.(4408-4410)TCT>TAT	p.S1470Y	ZFHX4_uc003yau.1_Missense_Mutation_p.S1515Y|ZFHX4_uc003yaw.1_Missense_Mutation_p.S1470Y	NM_024721	NP_078997	Q86UP3	ZFHX4_HUMAN	zinc finger homeodomain 4	1470						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(8)|large_intestine(4)|breast(2)|lung(1)	15			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GACATGGGCTCTGAACCAAAG	0.448										HNSCC(33;0.089)			20	45	---	---	---	---	PASS
KIAA1429	25962	broad.mit.edu	37	8	95543306	95543306	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95543306C>A	uc003ygo.1	-	6	505	c.492G>T	c.(490-492)GGG>GGT	p.G164G	KIAA1429_uc003ygp.2_Silent_p.G164G	NM_015496	NP_056311	Q69YN4	VIR_HUMAN	hypothetical protein LOC25962 isoform 1	164	Pro-rich.				mRNA processing|RNA splicing	nucleus				ovary(1)|skin(1)	2	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			CTTCTTTCTCCCCATCAGCTA	0.338													4	28	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113237043	113237043	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113237043A>G	uc003ynu.2	-	71	11240	c.11081T>C	c.(11080-11082)GTA>GCA	p.V3694A	CSMD3_uc003yns.2_Missense_Mutation_p.V2896A|CSMD3_uc003ynt.2_Missense_Mutation_p.V3654A|CSMD3_uc011lhx.1_Missense_Mutation_p.V3525A	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3694	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						ATCAAATCGTACCGCCTTCCC	0.438										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			40	82	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113418774	113418774	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113418774C>A	uc003ynu.2	-	35	5947	c.5788G>T	c.(5788-5790)GAT>TAT	p.D1930Y	CSMD3_uc003yns.2_Missense_Mutation_p.D1132Y|CSMD3_uc003ynt.2_Missense_Mutation_p.D1890Y|CSMD3_uc011lhx.1_Missense_Mutation_p.D1826Y	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1930	Sushi 10.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						GGTAAGGAATCATTCCACTGG	0.323										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			26	42	---	---	---	---	PASS
NDRG1	10397	broad.mit.edu	37	8	134262695	134262695	+	Missense_Mutation	SNP	T	C	C	rs137993172		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134262695T>C	uc003yuh.2	-	10	1272	c.686A>G	c.(685-687)AAT>AGT	p.N229S	NDRG1_uc003yuf.1_Missense_Mutation_p.N40S|NDRG1_uc003yug.2_Missense_Mutation_p.N229S|NDRG1_uc010mee.2_Missense_Mutation_p.N148S|NDRG1_uc010mef.2_Missense_Mutation_p.N163S|NDRG1_uc011ljh.1_Missense_Mutation_p.N57S|NDRG1_uc011lji.1_Intron	NM_001135242	NP_001128714	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1	229					cellular response to hypoxia|response to metal ion	cytoplasm|microtubule cytoskeleton|nucleus|plasma membrane	protein binding			ovary(4)	4	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GTTGTAGGCATTGATGAACAG	0.468													32	81	---	---	---	---	PASS
PLEC	5339	broad.mit.edu	37	8	144990859	144990859	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144990859C>G	uc003zaf.1	-	32	13711	c.13541G>C	c.(13540-13542)GGC>GCC	p.G4514A	PLEC_uc003zab.1_Missense_Mutation_p.G4377A|PLEC_uc003zac.1_Missense_Mutation_p.G4381A|PLEC_uc003zad.2_Missense_Mutation_p.G4377A|PLEC_uc003zae.1_Missense_Mutation_p.G4345A|PLEC_uc003zag.1_Missense_Mutation_p.G4355A|PLEC_uc003zah.2_Missense_Mutation_p.G4363A|PLEC_uc003zaj.2_Missense_Mutation_p.G4404A	NM_201380	NP_958782	Q15149	PLEC_HUMAN	plectin isoform 1	4514	Globular 2.|Plectin 31.				cellular component disassembly involved in apoptosis|hemidesmosome assembly	cytosol|focal adhesion|hemidesmosome|intermediate filament cytoskeleton|sarcolemma	actin binding|structural constituent of muscle|structural constituent of muscle			large_intestine(2)|ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	9						GTAGAGCCAGCCCTTCTTCAG	0.672													9	24	---	---	---	---	PASS
IFNA5	3442	broad.mit.edu	37	9	21305250	21305250	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21305250G>T	uc011lnh.1	-	1	6	c.6C>A	c.(4-6)GCC>GCA	p.A2A		NM_002169	NP_002160	P01569	IFNA5_HUMAN	interferon, alpha 5 precursor	2					blood coagulation|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway	extracellular space	cytokine activity|cytokine receptor binding			ovary(1)	1				Lung(24;2.34e-24)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		CAAAGGGCAAGGCCATTGGGG	0.507													22	11	---	---	---	---	PASS
AQP7	364	broad.mit.edu	37	9	33385652	33385652	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33385652G>A	uc003zst.2	-	7	910	c.738C>T	c.(736-738)GTC>GTT	p.V246V	SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Silent_p.V189V|AQP7_uc010mjs.2_Silent_p.V154V|AQP7_uc010mjt.2_Silent_p.V154V|AQP7_uc011lnx.1_Silent_p.V246V|AQP7_uc011lny.1_Silent_p.V245V|AQP7_uc003zss.3_Silent_p.V154V|AQP7_uc011lnz.1_Silent_p.V154V|AQP7_uc011loa.1_Missense_Mutation_p.L115F	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7	246	Extracellular (Potential).				excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGTACCTGAAGACCTGTTTGC	0.607													5	49	---	---	---	---	PASS
GALT	2592	broad.mit.edu	37	9	34647203	34647203	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34647203G>A	uc003zve.2	+	2	267	c.200G>A	c.(199-201)CGC>CAC	p.R67H	GALT_uc003zvf.2_5'UTR|GALT_uc003zvg.2_5'UTR|GALT_uc003zvh.2_Missense_Mutation_p.R19H|GALT_uc011lop.1_Missense_Mutation_p.R19H	NM_000155	NP_000146	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	67			R -> C (in GALCT).		galactose catabolic process	cytosol	UDP-glucose:hexose-1-phosphate uridylyltransferase activity|zinc ion binding				0	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		ACAGTGCCCCGCCATGACCCT	0.632									Galactosemia		OREG0019158	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	24	11	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74842874	74842874	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74842874G>A	uc004aiq.2	+	9	1021	c.838G>A	c.(838-840)GGC>AGC	p.G280S	GDA_uc011lse.1_Missense_Mutation_p.G206S|GDA_uc011lsf.1_Missense_Mutation_p.G206S|GDA_uc004air.2_Missense_Mutation_p.G280S|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Missense_Mutation_p.G202S|GDA_uc004ait.1_Missense_Mutation_p.G206S	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	280					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GATGGCACACGGCTGCTACCT	0.458													12	7	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77407667	77407667	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77407667C>G	uc004ajl.1	-	19	2649	c.2411G>C	c.(2410-2412)AGG>ACG	p.R804T	TRPM6_uc004ajk.1_Missense_Mutation_p.R799T|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Intron|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron|TRPM6_uc004ajm.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	804	Extracellular (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						ATCATGGCCCCTTTCCAAATC	0.368													12	6	---	---	---	---	PASS
C9orf64	84267	broad.mit.edu	37	9	86570396	86570396	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86570396G>C	uc004anb.2	-	2	745	c.497C>G	c.(496-498)TCT>TGT	p.S166C	C9orf64_uc004anc.2_Missense_Mutation_p.S25C	NM_032307	NP_115683	Q5T6V5	CI064_HUMAN	hypothetical protein LOC84267	166											0						GTTGAGAAAAGAGCCTCCAAA	0.443													19	18	---	---	---	---	PASS
DAPK1	1612	broad.mit.edu	37	9	90313720	90313720	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90313720G>A	uc004apc.2	+						DAPK1_uc004apd.2_Intron|DAPK1_uc011ltg.1_Intron|DAPK1_uc011lth.1_Intron	NM_004938	NP_004929	P53355	DAPK1_HUMAN	death-associated protein kinase 1						apoptosis|induction of apoptosis by extracellular signals|intracellular protein kinase cascade	actin cytoskeleton|cytoplasm	ATP binding|calmodulin binding|protein serine/threonine kinase activity			ovary(1)|breast(1)	2						GTGAGGGGCAGCCACTTAGTC	0.498									Chronic_Lymphocytic_Leukemia_Familial_Clustering_of				8	5	---	---	---	---	PASS
WNK2	65268	broad.mit.edu	37	9	95993306	95993306	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:95993306A>T	uc004ati.1	+	3	991	c.991A>T	c.(991-993)ATC>TTC	p.I331F	WNK2_uc011lud.1_Missense_Mutation_p.I331F|WNK2_uc004atj.2_Missense_Mutation_p.I331F|WNK2_uc010mrc.1_Missense_Mutation_p.I331F|WNK2_uc010mrd.1_5'UTR	NM_006648	NP_006639	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	331	Protein kinase.				intracellular protein kinase cascade		ATP binding|protein binding|protein serine/threonine kinase activity			lung(4)|stomach(3)|ovary(2)|large_intestine(1)|central_nervous_system(1)|breast(1)	12						CAATATTTTCATCACCGGACC	0.537													51	64	---	---	---	---	PASS
GRIN3A	116443	broad.mit.edu	37	9	104449076	104449076	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104449076C>A	uc004bbp.1	-	2	1707	c.1106G>T	c.(1105-1107)GGT>GTT	p.G369V	GRIN3A_uc004bbq.1_Missense_Mutation_p.G369V	NM_133445	NP_597702	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic,	369	Extracellular (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuron projection|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic density|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|identical protein binding|N-methyl-D-aspartate selective glutamate receptor activity|protein phosphatase 2A binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Ketamine(DB01221)|L-Glutamic Acid(DB00142)|Memantine(DB01043)|Meperidine(DB00454)|Methadone(DB00333)|Orphenadrine(DB01173)|Procaine(DB00721)|Riluzole(DB00740)	TAAGGGCAGACCCTCTGTCCT	0.517													11	3	---	---	---	---	PASS
ABCA1	19	broad.mit.edu	37	9	107602611	107602611	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107602611C>A	uc004bcl.2	-	9	1316	c.1003G>T	c.(1003-1005)GGA>TGA	p.G335*		NM_005502	NP_005493	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A member 1	335	Extracellular.				Cdc42 protein signal transduction|cellular lipid metabolic process|cholesterol efflux|cholesterol homeostasis|cholesterol metabolic process|endosome transport|G-protein coupled receptor protein signaling pathway|high-density lipoprotein particle assembly|interleukin-1 beta secretion|intracellular cholesterol transport|lysosome organization|negative regulation of cholesterol storage|negative regulation of macrophage derived foam cell differentiation|phospholipid efflux|phospholipid homeostasis|platelet dense granule organization|positive regulation of cAMP biosynthetic process|reverse cholesterol transport	integral to plasma membrane|membrane fraction|membrane raft|phagocytic vesicle	anion transmembrane transporter activity|apolipoprotein A-I receptor activity|ATP binding|ATPase activity|cholesterol transporter activity|phospholipid transporter activity|small GTPase binding|syntaxin-13 binding			large_intestine(4)|lung(4)|ovary(4)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	17				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	CCATTGCCTCCAAAGAGGGCT	0.547													18	15	---	---	---	---	PASS
TMEM38B	55151	broad.mit.edu	37	9	108536277	108536277	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:108536277C>A	uc004bcu.1	+	6	909	c.792C>A	c.(790-792)TCC>TCA	p.S264S	TMEM38B_uc010mtn.1_3'UTR	NM_018112	NP_060582	Q9NVV0	TM38B_HUMAN	transmembrane protein 38B	264	Cytoplasmic (Potential).					integral to membrane|nuclear membrane|sarcoplasmic reticulum membrane	potassium channel activity			ovary(1)|skin(1)	2						AGTCACCTTCCAATGGCGTTG	0.408													5	41	---	---	---	---	PASS
PTCHD3	374308	broad.mit.edu	37	10	27688069	27688069	+	Silent	SNP	C	T	T	rs140478412		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:27688069C>T	uc001itu.2	-	4	1576	c.1458G>A	c.(1456-1458)GCG>GCA	p.A486A		NM_001034842	NP_001030014	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	486	SSD.|Helical; (Potential).				spermatid development	integral to membrane	hedgehog receptor activity			ovary(2)|pancreas(1)|skin(1)	4						TAGACACTGCCGCTTTTGAAT	0.423													42	26	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89717708	89717708	+	Nonsense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89717708C>T	uc001kfb.2	+	8	1764	c.733C>T	c.(733-735)CAG>TAG	p.Q245*		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	245	C2 tensin-type.				activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.Q245*(6)|p.R55fs*1(4)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.?(1)|p.F243fs*9(1)|p.Q245fs*20(1)|p.G165_K342del(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TGAGTTCCCTCAGCCGTTACC	0.418		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			31	23	---	---	---	---	PASS
ITPRIP	85450	broad.mit.edu	37	10	106075422	106075422	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106075422G>T	uc001kye.2	-	2	461	c.388C>A	c.(388-390)CCC>ACC	p.P130T	ITPRIP_uc001kyf.2_Missense_Mutation_p.P130T|ITPRIP_uc001kyg.2_Missense_Mutation_p.P130T	NM_033397	NP_203755	Q8IWB1	IPRI_HUMAN	inositol 1,4,5-triphosphate receptor interacting	130						plasma membrane					0						CCCTGCAAGGGGGCGCCCCCC	0.687													4	18	---	---	---	---	PASS
DUSP5	1847	broad.mit.edu	37	10	112262559	112262559	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112262559G>A	uc001kzd.2	+	2	715	c.460G>A	c.(460-462)GAG>AAG	p.E154K		NM_004419	NP_004410	Q16690	DUS5_HUMAN	dual specificity phosphatase 5	154					endoderm formation|inactivation of MAPK activity	nucleoplasm	MAP kinase tyrosine/serine/threonine phosphatase activity|protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1		Breast(234;0.0848)		Epithelial(162;0.000276)|all cancers(201;0.00465)|BRCA - Breast invasive adenocarcinoma(275;0.12)		GATTGAGAGTGAGAGAGCCCT	0.453													28	53	---	---	---	---	PASS
C10orf118	55088	broad.mit.edu	37	10	115891764	115891764	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115891764T>C	uc001lbb.1	-	11	2487	c.1835A>G	c.(1834-1836)CAA>CGA	p.Q612R	C10orf118_uc009xyd.1_Missense_Mutation_p.Q210R|C10orf118_uc001lbc.1_Missense_Mutation_p.Q612R|C10orf118_uc009xye.1_RNA	NM_018017	NP_060487	Q7Z3E2	CJ118_HUMAN	CTCL tumor antigen L14-2	612	Potential.									ovary(2)	2		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		TTTATCAAATTGTGACTGCAA	0.348													22	48	---	---	---	---	PASS
TDRD1	56165	broad.mit.edu	37	10	115963163	115963163	+	Missense_Mutation	SNP	T	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115963163T>G	uc001lbg.1	+	8	971	c.818T>G	c.(817-819)TTC>TGC	p.F273C	TDRD1_uc001lbf.2_Missense_Mutation_p.F264C|TDRD1_uc001lbh.1_Missense_Mutation_p.F264C|TDRD1_uc001lbi.1_Missense_Mutation_p.F264C|TDRD1_uc010qsc.1_Translation_Start_Site|TDRD1_uc001lbj.2_Translation_Start_Site	NM_198795	NP_942090	Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	273					DNA methylation involved in gamete generation|gene silencing by RNA|germ cell development|meiosis|multicellular organismal development|piRNA metabolic process|spermatogenesis	pi-body	nucleic acid binding|protein binding|zinc ion binding				0		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		GTTACCGAATTCAAACACCCA	0.348													36	80	---	---	---	---	PASS
WDR11	55717	broad.mit.edu	37	10	122666322	122666322	+	Missense_Mutation	SNP	G	A	A	rs141544883		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122666322G>A	uc010qtf.1	+	28	3710	c.3472G>A	c.(3472-3474)GAA>AAA	p.E1158K	WDR11_uc010qte.1_Missense_Mutation_p.E760K|WDR11_uc001lfd.1_3'UTR|WDR11_uc009xzn.2_Intron|uc001lfe.1_5'Flank	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	1158						integral to membrane					0						CTTATTTGTGGAAGCTTGCCT	0.433													23	51	---	---	---	---	PASS
WDR11	55717	broad.mit.edu	37	10	122666349	122666349	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122666349G>T	uc010qtf.1	+	28	3737	c.3499G>T	c.(3499-3501)GAA>TAA	p.E1167*	WDR11_uc010qte.1_Nonsense_Mutation_p.E769*|WDR11_uc001lfd.1_3'UTR|WDR11_uc009xzn.2_Intron|uc001lfe.1_5'Flank	NM_018117	NP_060587	Q9BZH6	WDR11_HUMAN	bromodomain and WD repeat domain containing 2	1167						integral to membrane					0						TGGAGCATTTGAAGTCACTGA	0.418													23	50	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1018514	1018514	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1018514G>T	uc001lsw.2	-	31	4338	c.4287C>A	c.(4285-4287)GCC>GCA	p.A1429A		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1429	Pro-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGGTAGTGGTGGCATGGAAAG	0.567													9	156	---	---	---	---	PASS
BRSK2	9024	broad.mit.edu	37	11	1467072	1467072	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1467072C>A	uc001lti.2	+	12	1547	c.1161C>A	c.(1159-1161)AGC>AGA	p.S387R	BRSK2_uc009ycv.1_Missense_Mutation_p.S387R|BRSK2_uc001lth.1_Missense_Mutation_p.S387R|BRSK2_uc001ltj.2_Missense_Mutation_p.S387R|BRSK2_uc001ltk.2_RNA|BRSK2_uc001ltl.2_Missense_Mutation_p.S387R|BRSK2_uc001ltm.2_Missense_Mutation_p.S433R|BRSK2_uc001ltn.2_RNA|BRSK2_uc010qwx.1_RNA	NM_003957	NP_003948	Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	387					establishment of cell polarity|neuron differentiation		ATP binding|magnesium ion binding|protein serine/threonine kinase activity				0		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		AGGTGCTCAGCGTGACGGACG	0.692													5	12	---	---	---	---	PASS
OR52E2	119678	broad.mit.edu	37	11	5080752	5080752	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5080752C>G	uc010qyw.1	-	1	106	c.106G>C	c.(106-108)GTG>CTG	p.V36L		NM_001005164	NP_001005164	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|skin(1)	3		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ATCATGTACACAGCACAGAAG	0.512													4	24	---	---	---	---	PASS
TRIM22	10346	broad.mit.edu	37	11	5729506	5729506	+	Intron	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5729506A>G	uc001mbr.2	+						TRIM5_uc001mbq.1_Intron|TRIM22_uc009yet.1_Intron|TRIM22_uc009yes.2_Intron|TRIM22_uc010qzm.1_Intron|TRIM22_uc009yeu.2_Intron|OR56B1_uc001mbs.1_Intron|OR56B1_uc009yev.1_Intron	NM_006074	NP_006065	Q8IYM9	TRI22_HUMAN	tripartite motif-containing 22						immune response|interspecies interaction between organisms|protein trimerization|response to virus	Cajal body|Golgi apparatus|nuclear speck	ligase activity|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding				0		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		TCTTAAAGGTAAGGGGATTCA	0.443													5	32	---	---	---	---	PASS
OR56A3	390083	broad.mit.edu	37	11	5969164	5969164	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5969164C>T	uc010qzt.1	+	1	588	c.588C>T	c.(586-588)GTC>GTT	p.V196V		NM_001003443	NP_001003443	Q8NH54	O56A3_HUMAN	olfactory receptor, family 56, subfamily A,	196	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;9.41e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GCGATGATGTCACCATCAATC	0.473													6	56	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9167295	9167295	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9167295T>C	uc001mhl.2	-	17	3180	c.2925A>G	c.(2923-2925)CCA>CCG	p.P975P	DENND5A_uc001mhk.2_Silent_p.P318P|DENND5A_uc010rbw.1_Silent_p.P975P|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	975	PLAT.									liver(1)	1						TACAGATCCATGGGTTGGCAG	0.488													87	95	---	---	---	---	PASS
MUC15	143662	broad.mit.edu	37	11	26584733	26584733	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26584733G>A	uc001mqx.2	-	3	1040	c.774C>T	c.(772-774)TAC>TAT	p.Y258Y	ANO3_uc010rdr.1_Intron|ANO3_uc001mqt.3_Intron|ANO3_uc010rds.1_Intron|ANO3_uc010rdt.1_Intron|MUC15_uc001mqw.2_Silent_p.Y285Y|MUC15_uc001mqy.2_Intron	NM_145650	NP_663625	Q8N387	MUC15_HUMAN	mucin 15 isoform b	258	Cytoplasmic (Potential).					extracellular region|integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)|pancreas(1)	3						CACACAACAAGTAGCCCACAA	0.383													39	50	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	30974037	30974037	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:30974037C>T	uc009yjk.1	-	9	1083	c.1014G>A	c.(1012-1014)AAG>AAA	p.K338K	uc009yjl.1_Intron|DCDC1_uc001msu.1_Silent_p.K509K					RecName: Full=Doublecortin domain-containing protein 5;																		TGTAGGTAAGCTTGTTCCATA	0.423													13	26	---	---	---	---	PASS
C11orf41	25758	broad.mit.edu	37	11	33564652	33564652	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33564652G>T	uc001mup.3	+	1	776	c.652G>T	c.(652-654)GCC>TCC	p.A218S	C11orf41_uc001mun.1_Missense_Mutation_p.A218S	NM_012194	NP_036326	Q6ZVL6	CK041_HUMAN	hypothetical protein LOC25758	218						integral to membrane				ovary(2)	2						AGAGAATCATGCCTCCCCATC	0.557											OREG0020868	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	45	58	---	---	---	---	PASS
HSD17B12	51144	broad.mit.edu	37	11	43775641	43775641	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43775641G>T	uc001mxq.3	+	3	488	c.253G>T	c.(253-255)GAT>TAT	p.D85Y	HSD17B12_uc001mxp.2_RNA	NM_016142	NP_057226	Q53GQ0	DHB12_HUMAN	hydroxysteroid (17-beta) dehydrogenase 12	85					long-chain fatty-acyl-CoA biosynthetic process|steroid biosynthetic process|triglyceride biosynthetic process	endoplasmic reticulum membrane|integral to membrane	estradiol 17-beta-dehydrogenase activity|long-chain-3-hydroxyacyl-CoA dehydrogenase activity				0						CAGATCAAAGGATAAACTTGA	0.358													19	83	---	---	---	---	PASS
TSPAN18	90139	broad.mit.edu	37	11	44940762	44940762	+	Intron	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44940762C>T	uc001mye.3	+						TP53I11_uc001myf.1_Intron|TSPAN18_uc001myg.2_Intron	NM_130783	NP_570139	Q96SJ8	TSN18_HUMAN	tetraspanin 18 isoform 2							integral to membrane					0						CCTCTGCCCCCAGCTCACCCG	0.582													22	31	---	---	---	---	PASS
OR4C3	256144	broad.mit.edu	37	11	48346875	48346875	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48346875G>C	uc010rhv.1	+	1	383	c.383G>C	c.(382-384)GGA>GCA	p.G128A		NM_001004702	NP_001004702	Q8NH37	OR4C3_HUMAN	olfactory receptor, family 4, subfamily C,	101	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						CAGCTCTTTGGAGCTCATTTT	0.458													6	120	---	---	---	---	PASS
FOLH1	2346	broad.mit.edu	37	11	49207291	49207291	+	Silent	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49207291A>T	uc001ngy.2	-	6	1017	c.756T>A	c.(754-756)GGT>GGA	p.G252G	FOLH1_uc001ngz.2_Silent_p.G252G|FOLH1_uc009yly.2_Silent_p.G237G|FOLH1_uc009ylz.2_Silent_p.G237G|FOLH1_uc009yma.2_Intron	NM_004476	NP_004467	Q04609	FOLH1_HUMAN	folate hydrolase 1 isoform 1	252	Extracellular (Probable).				proteolysis	cytoplasm|integral to plasma membrane|membrane fraction|nucleus	carboxypeptidase activity|dipeptidase activity|metal ion binding|metallopeptidase activity			large_intestine(1)|ovary(1)|skin(1)	3					Capromab(DB00089)|L-Glutamic Acid(DB00142)	CACGCTGGACACCACCTCCAG	0.498													6	30	---	---	---	---	PASS
TRIM48	79097	broad.mit.edu	37	11	55032605	55032605	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55032605C>G	uc010rid.1	+	2	360	c.274C>G	c.(274-276)CTT>GTT	p.L92V		NM_024114	NP_077019	Q8IWZ4	TRI48_HUMAN	tripartite motif-containing 48	76						intracellular	zinc ion binding				0						GATGGCTTCCCTTGCCAGAAA	0.448													9	48	---	---	---	---	PASS
OR5L1	219437	broad.mit.edu	37	11	55579833	55579833	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55579833G>T	uc001nhw.1	+	1	891	c.891G>T	c.(889-891)GTG>GTT	p.V297V		NM_001004738	NP_001004738	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L,	297	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(2)	5		all_epithelial(135;0.208)				ATAAAGATGTGAAAGAAGCTC	0.458													7	30	---	---	---	---	PASS
OR5AS1	219447	broad.mit.edu	37	11	55798323	55798323	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55798323C>A	uc010riw.1	+	1	429	c.429C>A	c.(427-429)TGC>TGA	p.C143*		NM_001001921	NP_001001921	Q8N127	O5AS1_HUMAN	olfactory receptor, family 5, subfamily AS,	143	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)|liver(1)|skin(1)	5	Esophageal squamous(21;0.00693)					TCTGTGTCTGCTTCATTGTGT	0.468													27	36	---	---	---	---	PASS
OR8H2	390151	broad.mit.edu	37	11	55873110	55873110	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55873110C>T	uc010riy.1	+	1	592	c.592C>T	c.(592-594)CTG>TTG	p.L198L		NM_001005200	NP_001005200	Q8N162	OR8H2_HUMAN	olfactory receptor, family 8, subfamily H,	198	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	Esophageal squamous(21;0.00693)					CACCGAAATCCTGATATTCAT	0.388										HNSCC(53;0.14)			53	78	---	---	---	---	PASS
OR5J2	282775	broad.mit.edu	37	11	55944669	55944669	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55944669C>T	uc010rjb.1	+	1	576	c.576C>T	c.(574-576)ACC>ACT	p.T192T		NM_001005492	NP_001005492	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J,	192	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|large_intestine(1)|breast(1)|pancreas(1)	4	Esophageal squamous(21;0.00693)					GTTCTGACACCTCCATGAATG	0.453													18	44	---	---	---	---	PASS
MS4A7	58475	broad.mit.edu	37	11	60156870	60156870	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60156870G>A	uc001npe.2	+	5	492	c.347G>A	c.(346-348)AGC>AAC	p.S116N	MS4A7_uc001npf.2_Missense_Mutation_p.S116N|MS4A7_uc001npg.2_Missense_Mutation_p.S71N|MS4A7_uc001nph.2_Missense_Mutation_p.S71N|MS4A14_uc001npi.2_Intron|MS4A7_uc009ymx.1_Missense_Mutation_p.S71N	NM_206939	NP_996822	Q9GZW8	MS4A7_HUMAN	membrane-spanning 4-domains, subfamily A, member	116	Cytoplasmic (Potential).					integral to membrane	receptor activity			ovary(1)|central_nervous_system(1)	2						CAGGACCTGAGCAGCTTGACC	0.448													7	23	---	---	---	---	PASS
MS4A14	84689	broad.mit.edu	37	11	60183336	60183336	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60183336G>T	uc001npj.2	+	5	1460	c.895G>T	c.(895-897)GCG>TCG	p.A299S	MS4A14_uc001npi.2_Missense_Mutation_p.A187S|MS4A14_uc001npn.2_Missense_Mutation_p.A37S|MS4A14_uc001npk.2_Missense_Mutation_p.A282S|MS4A14_uc001npl.2_Missense_Mutation_p.A37S|MS4A14_uc001npm.2_Missense_Mutation_p.A37S	NM_032597	NP_115986	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member	299						integral to membrane	receptor activity			breast(1)	1						GGACCAAGCTGCGTCACTCCA	0.423													13	37	---	---	---	---	PASS
IGHMBP2	3508	broad.mit.edu	37	11	68673578	68673578	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:68673578G>T	uc001ook.1	+	2	230	c.128G>T	c.(127-129)CGA>CTA	p.R43L	IGHMBP2_uc001ooj.1_RNA|MRPL21_uc001ooh.2_5'Flank|MRPL21_uc001ooi.2_5'Flank|MRPL21_uc010rqe.1_5'Flank	NM_002180	NP_002171	P38935	SMBP2_HUMAN	immunoglobulin mu binding protein 2	43					cell death|DNA recombination|DNA repair|DNA replication|protein homooligomerization|transcription, DNA-dependent|translation	axon|growth cone|nucleus|ribonucleoprotein complex	ATP binding|ATP-dependent 5'-3' DNA helicase activity|ATP-dependent 5'-3' RNA helicase activity|ribosome binding|single-stranded DNA binding|transcription factor binding|tRNA binding|zinc ion binding				0			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			CTCCAGAGCCGAGGCGTGTGT	0.572													6	73	---	---	---	---	PASS
XRRA1	143570	broad.mit.edu	37	11	74559320	74559320	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74559320G>T	uc009yub.2	-	15	1876	c.1544C>A	c.(1543-1545)CCG>CAG	p.P515Q	XRRA1_uc001ovm.2_RNA|XRRA1_uc001ovn.2_Missense_Mutation_p.P138Q|XRRA1_uc001ovo.2_Missense_Mutation_p.P123Q|XRRA1_uc001ovq.3_Missense_Mutation_p.P428Q|XRRA1_uc001ovp.3_Missense_Mutation_p.P240Q|XRRA1_uc001ovr.2_Missense_Mutation_p.P138Q|XRRA1_uc001ovs.1_Missense_Mutation_p.P117Q	NM_182969	NP_892014	Q6P2D8	XRRA1_HUMAN	X-ray radiation resistance associated 1	515					response to X-ray	cytoplasm|nucleus				central_nervous_system(1)	1						CCGGCAAGACGGGGAATGGCC	0.572													4	17	---	---	---	---	PASS
CAPN5	726	broad.mit.edu	37	11	76831861	76831861	+	Nonsense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76831861G>T	uc001oxx.2	+	10	1578	c.1393G>T	c.(1393-1395)GAG>TAG	p.E465*	CAPN5_uc009yup.2_Nonsense_Mutation_p.E505*|CAPN5_uc009yuq.2_Nonsense_Mutation_p.E501*|CAPN5_uc001oxy.2_Nonsense_Mutation_p.E505*|CAPN5_uc001oya.2_Nonsense_Mutation_p.E27*	NM_004055	NP_004046	O15484	CAN5_HUMAN	calpain 5	465	Domain III.				proteolysis|signal transduction	intracellular	calcium-dependent cysteine-type endopeptidase activity				0						CGACCAGCCCGAGGGCCGCTA	0.617													8	63	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89069063	89069063	+	Silent	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89069063T>A	uc001pct.2	-	17	1805	c.1566A>T	c.(1564-1566)GGA>GGT	p.G522G	NOX4_uc009yvr.2_Silent_p.G497G|NOX4_uc001pcu.2_Silent_p.G448G|NOX4_uc001pcw.2_Silent_p.G215G|NOX4_uc001pcx.2_Silent_p.G175G|NOX4_uc001pcv.2_Silent_p.G482G|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Silent_p.G335G|NOX4_uc009yvp.2_Silent_p.G286G|NOX4_uc010rtv.1_Silent_p.G458G|NOX4_uc009yvq.2_Silent_p.G498G	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	522	Cytoplasmic (Potential).|Mediates interaction with TLR4.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ACCGAGGACGTCCTATAAACA	0.303													6	49	---	---	---	---	PASS
MAML2	84441	broad.mit.edu	37	11	95713100	95713100	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95713100G>A	uc001pfw.1	-	5	3768	c.2483C>T	c.(2482-2484)TCT>TTT	p.S828F		NM_032427	NP_115803	Q8IZL2	MAML2_HUMAN	mastermind-like 2	828					Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity		CRTC1/MAML2(516)|CRTC3/MAML2(26)	salivary_gland(500)|lung(36)|thyroid(4)|breast(3)|skin(2)|ovary(1)	546		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				AGCCTGGTTAGAGTTTAAGCT	0.408			T	MECT1|CRTC3	salivary gland mucoepidermoid								16	16	---	---	---	---	PASS
DYNC2H1	79659	broad.mit.edu	37	11	102988531	102988531	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:102988531C>G	uc001pho.2	+	6	1082	c.938C>G	c.(937-939)CCA>CGA	p.P313R	DYNC2H1_uc001phn.1_Missense_Mutation_p.P313R|DYNC2H1_uc009yxe.1_Missense_Mutation_p.P313R	NM_001080463	NP_001073932	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	313	Stem (By similarity).				cell projection organization|Golgi organization|microtubule-based movement|multicellular organismal development	cilium axoneme|dynein complex|Golgi apparatus|microtubule|plasma membrane	ATP binding|ATPase activity|microtubule motor activity				0		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GTTCCTCATCCATGGAAAAAT	0.368													3	37	---	---	---	---	PASS
DDX10	1662	broad.mit.edu	37	11	108547817	108547817	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108547817G>T	uc001pkm.2	+	4	449	c.384G>T	c.(382-384)CTG>CTT	p.L128L	DDX10_uc001pkl.1_Silent_p.L128L	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10	128	Helicase ATP-binding.						ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TTGAGGTGCTGGAAGCCTTAT	0.458			T	NUP98	AML*								5	48	---	---	---	---	PASS
TMEM225	338661	broad.mit.edu	37	11	123755245	123755245	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123755245G>C	uc001pzi.2	-	2	488	c.280C>G	c.(280-282)CAA>GAA	p.Q94E		NM_001013743	NP_001013765	Q6GV28	TM225_HUMAN	transmembrane protein 225	94						integral to membrane				upper_aerodigestive_tract(1)|pancreas(1)|skin(1)	3						TATTTATTTTGAGGAATCAGA	0.428													16	19	---	---	---	---	PASS
OR10G8	219869	broad.mit.edu	37	11	123901086	123901086	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123901086C>A	uc001pzp.1	+	1	757	c.757C>A	c.(757-759)CCT>ACT	p.P253T		NM_001004464	NP_001004464	Q8NGN5	O10G8_HUMAN	olfactory receptor, family 10, subfamily G,	253	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0521)		CTTCTTTGGCCCTGGTCTTTT	0.552													6	35	---	---	---	---	PASS
OR8B4	283162	broad.mit.edu	37	11	124294600	124294600	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124294600G>T	uc010sak.1	-	1	168	c.168C>A	c.(166-168)CAC>CAA	p.H56Q		NM_001005196	NP_001005196	Q96RC9	OR8B4_HUMAN	olfactory receptor, family 8, subfamily B,	56	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ACATGGGGGTGTGAAGGCTAG	0.418													16	27	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124763909	124763909	+	Missense_Mutation	SNP	T	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124763909T>G	uc001qbg.2	-	9	1491	c.1351A>C	c.(1351-1353)AGT>CGT	p.S451R	ROBO4_uc010sas.1_Missense_Mutation_p.S306R|ROBO4_uc001qbh.2_Missense_Mutation_p.S341R|ROBO4_uc001qbi.2_Missense_Mutation_p.S9R|ROBO4_uc010sat.1_Missense_Mutation_p.S9R	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	451					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CCATGCTCACTGGGTTCTTGG	0.627													6	6	---	---	---	---	PASS
STT3A	3703	broad.mit.edu	37	11	125472288	125472288	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:125472288G>A	uc001qcd.2	+	4	350	c.240G>A	c.(238-240)TTG>TTA	p.L80L	STT3A_uc009zbm.2_Silent_p.L80L|STT3A_uc001qce.2_Silent_p.L80L|STT3A_uc010sbg.1_5'UTR	NM_152713	NP_689926	P46977	STT3A_HUMAN	integral membrane protein 1	80	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity				0	all_hematologic(175;0.228)	Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0996)		GGTACCCTTTGGGACGAATCA	0.393													5	21	---	---	---	---	PASS
NCAPD3	23310	broad.mit.edu	37	11	134038450	134038450	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134038450C>A	uc001qhd.1	-	26	3893	c.3287G>T	c.(3286-3288)CGA>CTA	p.R1096L	NCAPD3_uc010scm.1_RNA|NCAPD3_uc009zda.1_Intron|NCAPD3_uc001qhc.1_Missense_Mutation_p.R46L	NM_015261	NP_056076	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1096					cell division|mitotic chromosome condensation	nuclear centromeric heterochromatin|nuclear condensin complex	methylated histone residue binding			ovary(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	5	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		GATTTTCATTCGTCTCTCTTT	0.443													5	28	---	---	---	---	PASS
SLC6A12	6539	broad.mit.edu	37	12	319118	319118	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:319118G>T	uc001qhz.2	-	4	578	c.35C>A	c.(34-36)CCT>CAT	p.P12H	SLC6A12_uc001qia.2_Missense_Mutation_p.P12H|SLC6A12_uc001qib.2_Missense_Mutation_p.P12H|SLC6A12_uc009zdh.1_Missense_Mutation_p.P12H|SLC6A12_uc009zdi.1_RNA	NM_003044	NP_003035	P48065	S6A12_HUMAN	solute carrier family 6 (neurotransmitter	12	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(1)	1	all_cancers(10;0.0172)|all_epithelial(11;0.0283)|all_lung(10;0.0392)|Lung NSC(10;0.0567)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00227)			GACTGCAGGAGGCCCACACTC	0.622													16	37	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2613601	2613601	+	Intron	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2613601G>T	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Splice_Site_p.M372_splice|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Splice_Site_p.M108_splice|CACNA1C_uc001qkj.1_Splice_Site_p.M108_splice|CACNA1C_uc001qkk.1_Splice_Site_p.M108_splice|CACNA1C_uc001qkm.1_Splice_Site_p.M108_splice|CACNA1C_uc009zdy.1_5'Flank|CACNA1C_uc001qkv.1_5'Flank	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CGTCTTTCCAGATGCAGGACG	0.488													12	102	---	---	---	---	PASS
NRIP2	83714	broad.mit.edu	37	12	2943895	2943895	+	Silent	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2943895G>C	uc001qlc.2	-	1	327	c.255C>G	c.(253-255)CTC>CTG	p.L85L	NRIP2_uc010sed.1_Silent_p.L85L|uc009zdz.1_5'Flank	NM_031474	NP_113662	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2	85					proteolysis|transcription, DNA-dependent	cytoplasm|nucleus	aspartic-type endopeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			TGGCCTGTTTGAGCCGGCGCT	0.657													17	68	---	---	---	---	PASS
KIAA1467	57613	broad.mit.edu	37	12	13220127	13220127	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13220127C>G	uc001rbi.2	+	7	1062	c.1039C>G	c.(1039-1041)CAG>GAG	p.Q347E	KIAA1467_uc009zhx.1_RNA	NM_020853	NP_065904	A2RU67	K1467_HUMAN	hypothetical protein LOC57613	347						integral to membrane				central_nervous_system(2)|skin(1)	3		Prostate(47;0.184)		BRCA - Breast invasive adenocarcinoma(232;0.157)		CATTTTTGTTCAGGCCCAAAA	0.458													32	49	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19440426	19440426	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19440426G>A	uc001reb.2	+	12	1867	c.1781G>A	c.(1780-1782)AGA>AAA	p.R594K	PLEKHA5_uc010sie.1_Missense_Mutation_p.R600K|PLEKHA5_uc001rea.2_Missense_Mutation_p.R594K|PLEKHA5_uc009zin.2_Missense_Mutation_p.R352K|PLEKHA5_uc010sif.1_Missense_Mutation_p.R486K|PLEKHA5_uc010sig.1_Missense_Mutation_p.R486K|PLEKHA5_uc010sih.1_Missense_Mutation_p.R486K|PLEKHA5_uc001rec.1_Missense_Mutation_p.R282K	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	594							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					GTGCCTGACAGAAGGTCAGTG	0.388													19	70	---	---	---	---	PASS
KIAA0528	9847	broad.mit.edu	37	12	22635541	22635541	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:22635541C>A	uc001rfq.2	-	14	1915	c.1687G>T	c.(1687-1689)GGA>TGA	p.G563*	KIAA0528_uc010sir.1_Nonsense_Mutation_p.G378*|KIAA0528_uc010sis.1_Nonsense_Mutation_p.G563*|KIAA0528_uc010sit.1_Nonsense_Mutation_p.G565*|KIAA0528_uc010siu.1_Nonsense_Mutation_p.G563*|KIAA0528_uc001rfr.2_Nonsense_Mutation_p.G554*|KIAA0528_uc009ziy.1_Nonsense_Mutation_p.G565*	NM_014802	NP_055617	Q86YS7	K0528_HUMAN	hypothetical protein LOC9847	563							protein binding			ovary(1)|large_intestine(1)|breast(1)|central_nervous_system(1)	4						ATTCTTAGTCCAAACAAAGCA	0.323													43	45	---	---	---	---	PASS
TMEM117	84216	broad.mit.edu	37	12	44782229	44782229	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44782229C>A	uc001rod.2	+	8	1385	c.1319C>A	c.(1318-1320)TCA>TAA	p.S440*	TMEM117_uc001roe.2_Nonsense_Mutation_p.S336*|TMEM117_uc009zkc.2_3'UTR	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117	440						endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		AAATCTCCATCAGAACATAGC	0.408													32	48	---	---	---	---	PASS
RPAP3	79657	broad.mit.edu	37	12	48090172	48090172	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48090172G>A	uc001rpr.2	-	5	548	c.432C>T	c.(430-432)TTC>TTT	p.F144F	RPAP3_uc010slk.1_5'UTR|RPAP3_uc001rps.2_Silent_p.F144F	NM_024604	NP_078880	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3 isoform	144	TPR 2.						binding			ovary(1)	1	Lung SC(27;0.192)					TTCCTTGTTTGAAGTATTTAT	0.284													8	24	---	---	---	---	PASS
CALCOCO1	57658	broad.mit.edu	37	12	54109789	54109789	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54109789C>G	uc001sef.2	-	9	1192	c.1048G>C	c.(1048-1050)GAG>CAG	p.E350Q	CALCOCO1_uc001see.2_5'Flank|CALCOCO1_uc010som.1_Missense_Mutation_p.E265Q|CALCOCO1_uc010son.1_Missense_Mutation_p.E227Q|CALCOCO1_uc001seh.2_Missense_Mutation_p.E350Q|CALCOCO1_uc009znd.2_Missense_Mutation_p.E350Q|CALCOCO1_uc001seg.2_Missense_Mutation_p.E175Q|CALCOCO1_uc010soo.1_Missense_Mutation_p.E343Q	NM_020898	NP_065949	Q9P1Z2	CACO1_HUMAN	coiled-coil transcriptional coactivator isoform	350					steroid hormone receptor signaling pathway|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm	armadillo repeat domain binding|beta-catenin binding|ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|sequence-specific DNA binding|transcription regulatory region DNA binding			ovary(1)	1						GCTGCAAGCTCCTGGGCCCCT	0.597													3	11	---	---	---	---	PASS
NFE2	4778	broad.mit.edu	37	12	54686346	54686346	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54686346G>T	uc009znk.2	-	2	1444	c.934C>A	c.(934-936)CGC>AGC	p.R312S	NFE2_uc001sfq.2_Missense_Mutation_p.R312S|NFE2_uc001sfr.3_Missense_Mutation_p.R312S|NFE2_uc009znl.2_Missense_Mutation_p.R312S	NM_006163	NP_006154	Q16621	NFE2_HUMAN	nuclear factor, erythroid derived 2 isoform 1	312	Leucine-zipper.				blood circulation|blood coagulation|multicellular organismal development|nucleosome disassembly|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter	actin cytoskeleton|cytoplasm|PML body	protein dimerization activity|protein N-terminus binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|WW domain binding				0						GCCTCCCCGCGGGCCCTGAGA	0.617													3	13	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57605310	57605310	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57605310G>T	uc001snd.2	+	85	13598	c.13132G>T	c.(13132-13134)GTC>TTC	p.V4378F		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	4378	Extracellular (Potential).|EGF-like 22.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TCTGACCTGCGTCGGCCACTG	0.637													8	11	---	---	---	---	PASS
R3HDM2	22864	broad.mit.edu	37	12	57662127	57662127	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57662127C>T	uc009zpm.1	-	16	1982	c.1947G>A	c.(1945-1947)GTG>GTA	p.V649V	R3HDM2_uc010srn.1_RNA|R3HDM2_uc001snu.2_Silent_p.V344V|R3HDM2_uc001snr.2_Silent_p.V376V|R3HDM2_uc001sns.2_Silent_p.V649V|R3HDM2_uc001snt.2_Silent_p.V663V|R3HDM2_uc009zpn.1_Intron	NM_014925	NP_055740	Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	649	Gln-rich.					nucleus	nucleic acid binding			ovary(2)	2						TGCTATAGTACACTGGTACCC	0.582													12	45	---	---	---	---	PASS
SRGAP1	57522	broad.mit.edu	37	12	64505777	64505777	+	Intron	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64505777G>A	uc010ssp.1	+						SRGAP1_uc001srv.2_Intron	NM_020762	NP_065813	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1						axon guidance	cytosol				ovary(2)|central_nervous_system(2)	4			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		GTAAGTCTAAGAATTTTAGTC	0.388													10	23	---	---	---	---	PASS
PTPRB	5787	broad.mit.edu	37	12	70918334	70918334	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:70918334A>T	uc001swb.3	-	31	5918	c.5888T>A	c.(5887-5889)GTC>GAC	p.V1963D	uc001svz.2_Intron|PTPRB_uc010sto.1_Missense_Mutation_p.V1873D|PTPRB_uc010stp.1_Missense_Mutation_p.V1873D|PTPRB_uc001swc.3_Missense_Mutation_p.V2181D|PTPRB_uc001swa.3_Missense_Mutation_p.V2093D	NM_002837	NP_002828	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1963	Cytoplasmic (Potential).|Tyrosine-protein phosphatase.				angiogenesis	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(2)|skin(1)	3	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			TGCTCTGAGGACATCTCTTAC	0.433													17	54	---	---	---	---	PASS
NAP1L1	4673	broad.mit.edu	37	12	76461258	76461258	+	Intron	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:76461258A>T	uc001sxw.2	-						NAP1L1_uc001sxv.2_Intron|NAP1L1_uc001sxz.2_Intron|NAP1L1_uc001sxx.2_Intron|NAP1L1_uc001sxy.2_Intron|NAP1L1_uc010sty.1_Intron|NAP1L1_uc010stz.1_Intron|NAP1L1_uc010sua.1_Intron|NAP1L1_uc001syb.2_Intron|NAP1L1_uc001sya.2_Intron|NAP1L1_uc001syc.2_Intron	NM_139207	NP_631946	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1						DNA replication|nucleosome assembly|positive regulation of cell proliferation	chromatin assembly complex|melanosome	protein binding			ovary(1)|skin(1)	2		Colorectal(145;0.09)				GACGTGCTTTAAAAAAAAAAG	0.363													16	31	---	---	---	---	PASS
ZDHHC17	23390	broad.mit.edu	37	12	77208951	77208951	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77208951G>C	uc001syk.1	+	6	732	c.569G>C	c.(568-570)GGA>GCA	p.G190A	ZDHHC17_uc001syi.1_RNA|ZDHHC17_uc001syj.2_RNA	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14	190	ANK 4.|Cytoplasmic (Potential).				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						GATCAGAATGGAATGACGCCT	0.303													4	4	---	---	---	---	PASS
LRRIQ1	84125	broad.mit.edu	37	12	85441059	85441059	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:85441059G>T	uc001tac.2	+	6	600	c.489G>T	c.(487-489)GTG>GTT	p.V163V	LRRIQ1_uc001tab.1_Silent_p.V163V|LRRIQ1_uc001taa.1_Silent_p.V163V|LRRIQ1_uc001tad.2_Silent_p.V71V	NM_001079910	NP_001073379	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1	163	Glu-rich.									ovary(4)|central_nervous_system(1)|skin(1)	6				GBM - Glioblastoma multiforme(134;0.212)		ACTGTGAAGTGGAAGAAAAAT	0.338													5	62	---	---	---	---	PASS
C12orf50	160419	broad.mit.edu	37	12	88420267	88420267	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88420267C>G	uc001tam.1	-	3	299	c.131G>C	c.(130-132)AGC>ACC	p.S44T	C12orf50_uc001tan.2_Missense_Mutation_p.S98T	NM_152589	NP_689802	Q8NA57	CL050_HUMAN	hypothetical protein LOC160419	44										skin(2)|ovary(1)	3						GTACTCACTGCTACTTGGTGG	0.368													10	24	---	---	---	---	PASS
VEZT	55591	broad.mit.edu	37	12	95611630	95611630	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95611630A>G	uc001tdz.2	+	1	109	c.4A>G	c.(4-6)ACA>GCA	p.T2A	FGD6_uc001tdp.3_5'Flank|FGD6_uc009zsx.2_5'Flank|VEZT_uc009zsy.1_5'UTR|VEZT_uc001tdr.2_5'UTR|VEZT_uc001tds.2_5'UTR|VEZT_uc001tdt.2_5'UTR|VEZT_uc009zsz.1_Missense_Mutation_p.T2A|VEZT_uc001tdv.2_5'UTR|VEZT_uc001tdw.1_5'Flank	NM_017599	NP_060069	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane	2						acrosomal vesicle|adherens junction|integral to membrane|nucleus				ovary(1)	1						GAGAAGGATGACACCGGAGTT	0.582													13	15	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101368626	101368626	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101368626A>T	uc010svm.1	+	7	1133	c.561A>T	c.(559-561)AGA>AGT	p.R187S	ANO4_uc010svl.1_RNA|ANO4_uc001thw.2_Missense_Mutation_p.R152S|ANO4_uc001thx.2_Missense_Mutation_p.R187S	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	187	Extracellular (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						CTTCCAGGAGAAAAATCTATT	0.463										HNSCC(74;0.22)			20	59	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104030921	104030921	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104030921G>C	uc001tjw.2	+	7	802	c.616G>C	c.(616-618)GAA>CAA	p.E206Q		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	206	Extracellular (Potential).|EGF-like 3.				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GCTCTGCCCAGAAAATTCCAG	0.453													35	39	---	---	---	---	PASS
GIT2	9815	broad.mit.edu	37	12	110370897	110370897	+	Silent	SNP	G	T	T	rs149426484		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110370897G>T	uc001tps.2	-	20	2331	c.2166C>A	c.(2164-2166)CCC>CCA	p.P722P	TCHP_uc001tpo.1_Intron|GIT2_uc001tpr.2_3'UTR|GIT2_uc001tpq.2_Silent_p.P692P|GIT2_uc001tpv.2_Silent_p.P644P|GIT2_uc001tpu.2_Silent_p.P642P|GIT2_uc001tpt.2_Silent_p.P594P|GIT2_uc010sxu.1_Silent_p.P630P	NM_057169	NP_476510	Q14161	GIT2_HUMAN	G protein-coupled receptor kinase interacting	722					regulation of ARF GTPase activity|regulation of G-protein coupled receptor protein signaling pathway	nucleoplasm	ARF GTPase activator activity|protein binding|zinc ion binding			central_nervous_system(1)	1						TGGGTGAGCCGGGGTcccctg	0.313													4	19	---	---	---	---	PASS
NCOR2	9612	broad.mit.edu	37	12	124835125	124835125	+	Intron	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:124835125C>T	uc010tba.1	-						NCOR2_uc010tay.1_Intron|NCOR2_uc010taz.1_Intron|NCOR2_uc010tbb.1_Intron|NCOR2_uc010tbc.1_Intron|NCOR2_uc001ugj.1_Intron	NM_001077261	NP_001070729	Q9Y618	NCOR2_HUMAN	nuclear receptor co-repressor 2 isoform 2						cellular lipid metabolic process|negative regulation of transcription from RNA polymerase II promoter|regulation of cellular ketone metabolic process by negative regulation of transcription from an RNA polymerase II promoter|transcription, DNA-dependent	nuclear body|nucleus|transcriptional repressor complex	DNA binding|histone deacetylase binding|Notch binding|protein N-terminus binding|transcription corepressor activity			skin(3)|ovary(1)	4	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		TCTCCTCCTGCGACTCACCCT	0.627													13	38	---	---	---	---	PASS
C13orf23	80209	broad.mit.edu	37	13	39587671	39587671	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:39587671A>T	uc001uwy.2	-	11	2591	c.1718T>A	c.(1717-1719)GTT>GAT	p.V573D	C13orf23_uc001uwz.2_Missense_Mutation_p.V551D	NM_025138	NP_079414	Q86XN7	CM023_HUMAN	hypothetical protein LOC80209 isoform 1	573	Ser-rich.									ovary(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)	5		Lung NSC(96;6.01e-07)|Breast(139;0.00394)|Prostate(109;0.00676)|Lung SC(185;0.0548)|Hepatocellular(188;0.114)		all cancers(112;3.7e-08)|Epithelial(112;4.28e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00114)|BRCA - Breast invasive adenocarcinoma(63;0.00366)|GBM - Glioblastoma multiforme(144;0.0146)		GCCACAGCTAACTGGCACTGA	0.557													30	30	---	---	---	---	PASS
TSC22D1	8848	broad.mit.edu	37	13	45148757	45148757	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:45148757C>A	uc001uzn.3	-	1	1945	c.1454G>T	c.(1453-1455)GGA>GTA	p.G485V	TSC22D1_uc001uzo.1_Missense_Mutation_p.G485V	NM_183422	NP_904358	Q15714	T22D1_HUMAN	TSC22 domain family, member 1 isoform 1	485					transcription from RNA polymerase II promoter	cytoplasm|nucleus	protein binding|sequence-specific DNA binding transcription factor activity				0		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		CTCTCCACTTCCCACACTCTC	0.413													18	30	---	---	---	---	PASS
CYSLTR2	57105	broad.mit.edu	37	13	49281313	49281313	+	Silent	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:49281313C>G	uc010acx.1	+	6	1043	c.360C>G	c.(358-360)GTC>GTG	p.V120V	CYSLTR2_uc010acy.1_Silent_p.V120V|CYSLTR2_uc010acz.1_Silent_p.V120V|CYSLTR2_uc010ada.1_Silent_p.V120V|CYSLTR2_uc010adb.1_Silent_p.V120V|CYSLTR2_uc010adc.1_Silent_p.V120V|CYSLTR2_uc010add.1_Silent_p.V120V|CYSLTR2_uc010acw.1_Silent_p.V120V|CYSLTR2_uc001vck.2_Silent_p.V120V	NM_020377	NP_065110	Q9NS75	CLTR2_HUMAN	cysteinyl leukotriene receptor 2	120	Extracellular (Potential).				immune response	integral to membrane|plasma membrane				lung(2)	2		all_cancers(8;1.66e-53)|all_epithelial(8;1.96e-19)|all_lung(13;9.94e-09)|all_hematologic(8;7.13e-07)|Lung NSC(96;1.72e-06)|Breast(56;1.53e-05)|Acute lymphoblastic leukemia(8;6.86e-05)|Prostate(109;0.00174)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0416)|Lung SC(185;0.0787)		GBM - Glioblastoma multiforme(99;1.19e-09)	Nedocromil(DB00716)	CCTTGTATGTCAACATGTACA	0.468													22	34	---	---	---	---	PASS
THSD1	55901	broad.mit.edu	37	13	52971859	52971859	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52971859C>T	uc001vgo.2	-	3	1074	c.529G>A	c.(529-531)GAG>AAG	p.E177K	THSD1_uc001vgp.2_Missense_Mutation_p.E177K|THSD1_uc010tgz.1_Intron|THSD1_uc010aea.2_Intron	NM_018676	NP_061146	Q9NS62	THSD1_HUMAN	thrombospondin type I domain-containing 1	177	Extracellular (Potential).					extracellular region|integral to membrane|intracellular membrane-bounded organelle				ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTTCTTGCCTCAGGAAGACTG	0.502													13	15	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77672952	77672952	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77672952C>T	uc001vkf.2	-	57	8314	c.8223G>A	c.(8221-8223)TTG>TTA	p.L2741L	MYCBP2_uc010aev.2_Silent_p.L2145L|MYCBP2_uc001vkg.1_Silent_p.L264L|MYCBP2_uc010aew.2_Silent_p.L127L	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2741	Ser-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AATCTGACCTCAACTTTGCAG	0.473													29	31	---	---	---	---	PASS
GPC5	2262	broad.mit.edu	37	13	92380910	92380910	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:92380910A>G	uc010tif.1	+	4	1511	c.1145A>G	c.(1144-1146)AAC>AGC	p.N382S		NM_004466	NP_004457	P78333	GPC5_HUMAN	glypican 5 precursor	382						anchored to membrane|extracellular space|integral to plasma membrane|proteinaceous extracellular matrix	heparan sulfate proteoglycan binding			ovary(2)|skin(2)|upper_aerodigestive_tract(1)	5	all_cancers(3;1.43e-07)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)	Lung NSC(4;0.00454)				ACGCTTGCCAACAGAAGAAAG	0.368													39	50	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110827678	110827678	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110827678C>A	uc001vqw.3	-	37	3207	c.3085G>T	c.(3085-3087)GGC>TGC	p.G1029C	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1029	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCAGGGATGCCAGGCACACCT	0.507													7	5	---	---	---	---	PASS
F7	2155	broad.mit.edu	37	13	113768231	113768231	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113768231C>T	uc001vsv.2	+	5	438	c.387C>T	c.(385-387)ATC>ATT	p.I129I	F7_uc010agp.1_Silent_p.I122I|F7_uc001vsw.2_Silent_p.I107I|F7_uc010tjt.1_Silent_p.I60I	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor	129	EGF-like 1; calcium-binding (Potential).				anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	AGTCCTATATCTGCTTCTGCC	0.602													11	11	---	---	---	---	PASS
OR11H4	390442	broad.mit.edu	37	14	20711715	20711715	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20711715G>A	uc010tld.1	+	1	765	c.765G>A	c.(763-765)TTG>TTA	p.L255L		NM_001004479	NP_001004479	Q8NGC9	O11H4_HUMAN	olfactory receptor, family 11, subfamily H,	255	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	all_cancers(95;0.000888)		Epithelial(56;1.75e-06)|all cancers(55;1.22e-05)	GBM - Glioblastoma multiforme(265;0.0146)		GTTCTCATTTGGTTGTGGTAT	0.418													45	53	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23884939	23884939	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23884939C>G	uc001wjx.2	-	35	5162	c.5056G>C	c.(5056-5058)GAG>CAG	p.E1686Q		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1686	Potential.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CGCAACTCCTCCAGCTCAGCC	0.622													4	32	---	---	---	---	PASS
LRRC16B	90668	broad.mit.edu	37	14	24531686	24531686	+	Intron	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24531686C>A	uc001wlj.2	+						LRRC16B_uc001wlk.2_5'UTR	NM_138360	NP_612369	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B											ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(265;0.019)		CCTGTGCCCACAGTGAAGTGA	0.577													7	126	---	---	---	---	PASS
C14orf21	161424	broad.mit.edu	37	14	24772988	24772988	+	Silent	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24772988C>G	uc001wol.1	+	7	1398	c.1335C>G	c.(1333-1335)CTC>CTG	p.L445L	C14orf21_uc001wom.1_5'UTR	NM_174913	NP_777573	Q86U38	CN021_HUMAN	hypothetical protein LOC161424	445							RNA binding			breast(2)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(265;0.0185)		GTGTGCCTCTCTTTGCCACTT	0.552													12	33	---	---	---	---	PASS
BAZ1A	11177	broad.mit.edu	37	14	35240723	35240723	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:35240723G>C	uc001wsk.2	-	21	3863	c.3295C>G	c.(3295-3297)CCA>GCA	p.P1099A	BAZ1A_uc001wsl.2_Missense_Mutation_p.P1067A	NM_013448	NP_038476	Q9NRL2	BAZ1A_HUMAN	bromodomain adjacent to zinc finger domain, 1A	1099					chromatin remodeling|regulation of transcription, DNA-dependent|transcription, DNA-dependent	ACF complex	zinc ion binding			lung(2)|central_nervous_system(2)|ovary(1)|breast(1)|skin(1)	7	Breast(36;0.0388)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(48;7.23e-05)|Lung(238;0.00019)|Epithelial(34;0.0793)|all cancers(34;0.175)	GBM - Glioblastoma multiforme(112;0.0659)		TTACCAAGTGGAGCTTTCAGA	0.363													40	118	---	---	---	---	PASS
INSM2	84684	broad.mit.edu	37	14	36004316	36004316	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36004316C>A	uc001wth.1	+	1	1069	c.858C>A	c.(856-858)ATC>ATA	p.I286I		NM_032594	NP_115983	Q96T92	INSM2_HUMAN	insulinoma-associated protein IA-6	286					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			lung(1)|skin(1)	2	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		GCTCCCGCATCGTGCGCGTAG	0.677													9	16	---	---	---	---	PASS
KTN1	3895	broad.mit.edu	37	14	56085932	56085932	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:56085932C>A	uc001xcb.2	+	6	1167	c.865C>A	c.(865-867)CTG>ATG	p.L289M	KTN1_uc001xce.2_Missense_Mutation_p.L289M|KTN1_uc001xcc.2_Missense_Mutation_p.L289M|KTN1_uc001xcd.2_Missense_Mutation_p.L289M|KTN1_uc010trb.1_Missense_Mutation_p.L289M|KTN1_uc001xcf.1_Missense_Mutation_p.L289M	NM_182926	NP_891556	Q86UP2	KTN1_HUMAN	kinectin 1 isoform a	289	Lumenal (Potential).				microtubule-based movement	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction				breast(3)|ovary(2)|lung(1)|central_nervous_system(1)	7						AGATTTTCTTCTGTCCTTGAA	0.313			T	RET	papillary thryoid								10	39	---	---	---	---	PASS
SLC38A6	145389	broad.mit.edu	37	14	61517235	61517235	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61517235G>C	uc001xfg.1	+	13	1047	c.931G>C	c.(931-933)GTG>CTG	p.V311L	SLC38A6_uc001xfh.1_Missense_Mutation_p.V311L|SLC38A6_uc001xfi.2_RNA|SLC38A6_uc001xfj.1_RNA|SLC38A6_uc001xfk.2_RNA|SLC38A6_uc010trz.1_Missense_Mutation_p.V288L	NM_153811	NP_722518	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6	311					amino acid transport|sodium ion transport	integral to membrane				ovary(1)|central_nervous_system(1)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		TACAGACAAAGTGGAGTCAGA	0.294													4	23	---	---	---	---	PASS
NEK9	91754	broad.mit.edu	37	14	75587213	75587213	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:75587213C>A	uc001xrl.2	-	4	678	c.524G>T	c.(523-525)AGA>ATA	p.R175I		NM_033116	NP_149107	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	175	Protein kinase.				cell division|mitosis	mitochondrion|nucleus	ATP binding|metal ion binding|protein kinase binding|protein serine/threonine kinase activity			lung(2)|stomach(2)|ovary(1)	5				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TACTTCTTACCTATGAAGGAT	0.398													5	46	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76948971	76948971	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76948971C>A	uc001xsq.1	+	5	723	c.656C>A	c.(655-657)GCT>GAT	p.A219D	ESRRB_uc001xsr.2_Missense_Mutation_p.A219D|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	219						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CTACTGGTGGCTGAGCCGGAC	0.567													8	24	---	---	---	---	PASS
C14orf4	64207	broad.mit.edu	37	14	77492209	77492209	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77492209C>T	uc001xsy.2	-	1	2826	c.1927G>A	c.(1927-1929)GGC>AGC	p.G643S		NM_024496	NP_078772	Q9H1B7	I2BPL_HUMAN	chromosome 14 open reading frame 4	643						nucleus					0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.00347)|KIRC - Kidney renal clear cell carcinoma(182;0.0878)		ACGGAACTGCCATCCTTGGGC	0.672													6	6	---	---	---	---	PASS
C14orf145	145508	broad.mit.edu	37	14	81302659	81302659	+	Missense_Mutation	SNP	A	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81302659A>C	uc001xux.2	-	11	1118	c.947T>G	c.(946-948)CTT>CGT	p.L316R	C14orf145_uc010asz.1_RNA|C14orf145_uc001xuz.2_Missense_Mutation_p.L316R|C14orf145_uc001xuy.1_Missense_Mutation_p.L174R	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508	316	Potential.					centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		TGCTTTCGTAAGTTGTGTACG	0.408													10	78	---	---	---	---	PASS
CDC42BPB	9578	broad.mit.edu	37	14	103442072	103442072	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103442072C>G	uc001ymi.1	-	11	1688	c.1456G>C	c.(1456-1458)GAA>CAA	p.E486Q		NM_006035	NP_006026	Q9Y5S2	MRCKB_HUMAN	CDC42-binding protein kinase beta	486	Potential.				actin cytoskeleton reorganization|establishment or maintenance of cell polarity|intracellular signal transduction	cell leading edge|cell-cell junction|cytoplasm|cytoskeleton	ATP binding|magnesium ion binding|protein serine/threonine kinase activity|small GTPase regulator activity			large_intestine(3)|skin(3)|lung(2)|stomach(1)|breast(1)|ovary(1)	11		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TTTTTGATTTCTTTATCTCGG	0.448													15	69	---	---	---	---	PASS
KIAA0284	283638	broad.mit.edu	37	14	105344820	105344820	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105344820C>T	uc010axb.2	+	5	539	c.315C>T	c.(313-315)GTC>GTT	p.V105V	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Silent_p.V35V|KIAA0284_uc001yps.2_Silent_p.V11V	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	105						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		AGCACCGAGTCCCGGAGGAGG	0.627													19	18	---	---	---	---	PASS
AHNAK2	113146	broad.mit.edu	37	14	105405698	105405698	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105405698T>A	uc010axc.1	-	7	16210	c.16090A>T	c.(16090-16092)ATG>TTG	p.M5364L	AHNAK2_uc001ypx.2_Missense_Mutation_p.M5264L	NM_138420	NP_612429	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	5364						nucleus				ovary(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			TGGGATGGCATATCAGTACTT	0.443													10	41	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25334021	25334021	+	Intron	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25334021C>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-20_uc001yyf.2_RNA|SNORD116-22_uc001yyg.1_5'Flank|SNORD116-23_uc001yyh.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCTATACCGTCATCCTCGTCG	0.458													20	113	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25334030	25334030	+	Intron	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25334030C>G	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-20_uc001yyf.2_RNA|SNORD116-22_uc001yyg.1_5'Flank|SNORD116-23_uc001yyh.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						TCATCCTCGTCGAACTGAGGT	0.468													17	107	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31294476	31294476	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31294476T>C	uc001zfm.2	-	27	4489	c.4361A>G	c.(4360-4362)CAG>CGG	p.Q1454R	TRPM1_uc010azy.2_Missense_Mutation_p.Q1361R|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	1454	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		CTCTACATCCTGGTTAACCCC	0.468													31	43	---	---	---	---	PASS
TGM5	9333	broad.mit.edu	37	15	43527676	43527676	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43527676G>T	uc001zrd.1	-	10	1713	c.1705C>A	c.(1705-1707)CCT>ACT	p.P569T	TGM5_uc001zrc.1_Missense_Mutation_p.P226T|TGM5_uc001zre.1_Missense_Mutation_p.P487T	NM_201631	NP_963925	O43548	TGM5_HUMAN	transglutaminase 5 isoform 1	569					epidermis development|peptide cross-linking	cytoplasm	acyltransferase activity|metal ion binding|protein-glutamine gamma-glutamyltransferase activity			central_nervous_system(1)	1		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	CCTTCTTTAGGAGAGAGTGTG	0.557													4	24	---	---	---	---	PASS
ATP8B4	79895	broad.mit.edu	37	15	50158593	50158593	+	Missense_Mutation	SNP	A	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50158593A>C	uc001zxu.2	-	26	3258	c.3116T>G	c.(3115-3117)ATG>AGG	p.M1039R	ATP8B4_uc010ber.2_Missense_Mutation_p.M912R|ATP8B4_uc010ufd.1_Missense_Mutation_p.M849R|ATP8B4_uc010ufe.1_RNA|ATP8B4_uc001zxt.2_Missense_Mutation_p.M42R	NM_024837	NP_079113	Q8TF62	AT8B4_HUMAN	ATPase class I type 8B member 4	1039	Helical; (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			skin(3)|ovary(2)|breast(2)|large_intestine(1)	8		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		ATTACTGTGCATTGTAAATAA	0.393													11	49	---	---	---	---	PASS
UNC13C	440279	broad.mit.edu	37	15	54707216	54707216	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54707216C>T	uc002ack.2	+	17	4884	c.4884C>T	c.(4882-4884)GCC>GCT	p.A1628A	UNC13C_uc002acl.2_Silent_p.A458A	NM_001080534	NP_001074003	Q8NB66	UN13C_HUMAN	unc-13 homolog C	1628					exocytosis|intracellular signal transduction	cell junction|cytoplasm|presynaptic membrane	metal ion binding			ovary(5)|pancreas(2)	7				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		AAATAAGTGCCGAAATTATGT	0.313													6	44	---	---	---	---	PASS
LCTL	197021	broad.mit.edu	37	15	66850219	66850219	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66850219G>T	uc002aqc.2	-	8	895	c.763C>A	c.(763-765)CTG>ATG	p.L255M	LCTL_uc002aqd.3_Missense_Mutation_p.L82M|LCTL_uc010bhw.2_Translation_Start_Site	NM_207338	NP_997221	Q6UWM7	LCTL_HUMAN	lactase-like precursor	255	Extracellular (Potential).				carbohydrate metabolic process	endoplasmic reticulum membrane|integral to membrane	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(2)	2						ATTCCCACCAGACCTTAAAAG	0.537													38	45	---	---	---	---	PASS
ITGA11	22801	broad.mit.edu	37	15	68624279	68624279	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68624279C>T	uc002ari.2	-	14	1775	c.1688G>A	c.(1687-1689)GGA>GAA	p.G563E	ITGA11_uc010bib.2_Missense_Mutation_p.G563E	NM_001004439	NP_001004439	Q9UKX5	ITA11_HUMAN	integrin, alpha 11 precursor	563	FG-GAP 6.|Extracellular (Potential).				cell-matrix adhesion|integrin-mediated signaling pathway|muscle organ development	integrin complex	collagen binding|receptor activity			kidney(2)|pancreas(1)	3					Tirofiban(DB00775)	CAGGGGGGCTCCCACCACCAC	0.562													5	9	---	---	---	---	PASS
AP3B2	8120	broad.mit.edu	37	15	83358145	83358145	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83358145C>T	uc010uoh.1	-	2	351	c.174G>A	c.(172-174)ATG>ATA	p.M58I	AP3B2_uc010uoi.1_Missense_Mutation_p.M58I|AP3B2_uc010uoj.1_Missense_Mutation_p.M58I|AP3B2_uc010uok.1_Missense_Mutation_p.M58I	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2	58					endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			CAATCCTCTTCATGGCCTCCA	0.587													11	14	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85407730	85407730	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85407730G>A	uc002ble.2	+	12	5330	c.5163G>A	c.(5161-5163)CTG>CTA	p.L1721L	ALPK3_uc010upc.1_Silent_p.L22L	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1721	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ATGCTACCCTGGAGGAAGACC	0.532													16	35	---	---	---	---	PASS
PDE8A	5151	broad.mit.edu	37	15	85661024	85661024	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85661024A>T	uc002blh.2	+	17	1877	c.1688A>T	c.(1687-1689)GAT>GTT	p.D563V	PDE8A_uc002bli.2_Missense_Mutation_p.D517V|PDE8A_uc010bnc.2_Missense_Mutation_p.D316V|PDE8A_uc010bnd.2_Missense_Mutation_p.D316V|PDE8A_uc002blj.2_Missense_Mutation_p.D183V|PDE8A_uc002blk.2_Missense_Mutation_p.D183V|PDE8A_uc002bll.2_5'Flank	NM_002605	NP_002596	O60658	PDE8A_HUMAN	phosphodiesterase 8A isoform 1	563	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity			ovary(2)|pancreas(1)|skin(1)	4	Colorectal(223;0.227)		BRCA - Breast invasive adenocarcinoma(143;0.0608)			CATTCTGCTGATGTGCTTCAT	0.448													35	63	---	---	---	---	PASS
ARRDC4	91947	broad.mit.edu	37	15	98509239	98509239	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98509239T>C	uc010bom.2	+	3	648	c.489T>C	c.(487-489)GTT>GTC	p.V163V	ARRDC4_uc002bui.3_Silent_p.V76V	NM_183376	NP_899232	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	163					signal transduction						0	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			TCCAGGTTGTTAGTCATGTCG	0.333													5	39	---	---	---	---	PASS
RHOT2	89941	broad.mit.edu	37	16	722740	722740	+	Missense_Mutation	SNP	C	T	T	rs150996889	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:722740C>T	uc002cip.2	+	17	1509	c.1442C>T	c.(1441-1443)TCG>TTG	p.S481L	RHOT2_uc002ciq.2_Missense_Mutation_p.S374L|RHOT2_uc010bqy.2_Missense_Mutation_p.S260L|RHBDL1_uc002cir.1_5'Flank|RHBDL1_uc010uun.1_5'Flank	NM_138769	NP_620124	Q8IXI1	MIRO2_HUMAN	ras homolog gene family, member T2	481	Miro 2.|Mitochondrial intermembrane (Potential).				apoptosis|cellular homeostasis|mitochondrion transport along microtubule|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|integral to mitochondrial outer membrane|plasma membrane	calcium ion binding|GTP binding|GTPase activity|protein binding			pancreas(1)	1		Hepatocellular(780;0.0218)				CTGGCCACATCGCTGGACGCC	0.622													6	11	---	---	---	---	PASS
TIGD7	91151	broad.mit.edu	37	16	3349210	3349210	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:3349210C>G	uc002cus.2	-	1	2191	c.1405G>C	c.(1405-1407)GAG>CAG	p.E469Q	ZNF263_uc002cur.2_3'UTR	NM_033208	NP_149985	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	469					regulation of transcription, DNA-dependent	chromosome, centromeric region|nucleus	DNA binding				0						GTCTGCTTCTCAGCTTCTCCT	0.398													47	69	---	---	---	---	PASS
UBN1	29855	broad.mit.edu	37	16	4924300	4924300	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4924300G>A	uc002cyb.2	+	15	2228	c.1889G>A	c.(1888-1890)GGA>GAA	p.G630E	UBN1_uc010uxw.1_Missense_Mutation_p.G630E|UBN1_uc002cyc.2_Missense_Mutation_p.G630E	NM_001079514	NP_001072982	Q9NPG3	UBN1_HUMAN	ubinuclein 1	630					chromatin modification|interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter	PML body|tight junction	DNA binding|sequence-specific DNA binding transcription factor activity			skin(2)	2						CACCAAACAGGAGGCCTGAGT	0.542													20	85	---	---	---	---	PASS
TNP2	7142	broad.mit.edu	37	16	11362982	11362982	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:11362982G>C	uc002das.2	-	1	179	c.138C>G	c.(136-138)AGC>AGG	p.S46R	C16orf75_uc002daq.1_Intron	NM_005425	NP_005416	Q05952	STP2_HUMAN	transition protein 2 (during histone to	46					cell differentiation|multicellular organismal development|spermatogenesis	nucleosome|nucleus	DNA binding				0						TGGAGCTCTGGCTCCGGCTGC	0.632													12	39	---	---	---	---	PASS
KIAA0430	9665	broad.mit.edu	37	16	15690595	15690595	+	Silent	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15690595G>C	uc002ddr.2	-	27	5377	c.5184C>G	c.(5182-5184)GTC>GTG	p.V1728V	KIAA0430_uc002ddq.2_Silent_p.V1562V|KIAA0430_uc010uzv.1_Silent_p.V1724V|KIAA0430_uc010uzw.1_Silent_p.V1727V	NM_014647	NP_055462	Q9Y4F3	LKAP_HUMAN	limkain b1	1727						peroxisome	nucleotide binding|RNA binding				0						CTGCCAATTTGACTCTATTTT	0.498													20	29	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18847402	18847402	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18847402C>A	uc002dfm.2	-	48	8273	c.7910G>T	c.(7909-7911)TGT>TTT	p.C2637F	SMG1_uc010bwb.2_Missense_Mutation_p.C2497F|SMG1_uc010bwa.2_Missense_Mutation_p.C1368F	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2637					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						TTGCTCCAGACAGCCACGGAG	0.567													4	15	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19027784	19027784	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19027784G>C	uc002dfq.2	+	3	454	c.324G>C	c.(322-324)GAG>GAC	p.E108D	TMC7_uc010vao.1_Missense_Mutation_p.E108D|TMC7_uc002dfp.2_Missense_Mutation_p.E108D|TMC7_uc010vap.1_5'UTR	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	108	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3						ACATTCAAGAGACACAAATGA	0.418													4	39	---	---	---	---	PASS
CP110	9738	broad.mit.edu	37	16	19548053	19548053	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19548053C>G	uc002dgl.3	+	4	1309	c.1062C>G	c.(1060-1062)ATC>ATG	p.I354M	CP110_uc002dgk.3_Missense_Mutation_p.I354M			O43303	CP110_HUMAN	RecName: Full=Centrosomal protein of 110 kDa;          Short=Cep110;	354	Interaction with CEP76.				centriole replication|G2/M transition of mitotic cell cycle|regulation of cytokinesis	centriole|cytosol	protein binding				0						ATAATGTTATCAAAAGTCTTA	0.398													7	25	---	---	---	---	PASS
ACSM2B	348158	broad.mit.edu	37	16	20565212	20565212	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20565212C>A	uc002dhj.3	-	6	837	c.627G>T	c.(625-627)GAG>GAT	p.E209D	ACSM2B_uc002dhk.3_Missense_Mutation_p.E209D|ACSM2B_uc010bwf.1_Missense_Mutation_p.E209D	NM_182617	NP_872423	Q68CK6	ACS2B_HUMAN	acyl-CoA synthetase medium-chain family member	209					fatty acid metabolic process|xenobiotic metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|CoA-ligase activity|metal ion binding			skin(3)|ovary(1)|central_nervous_system(1)	5						GGCTTCCAGTCTCCACACAGT	0.502													5	46	---	---	---	---	PASS
CACNG3	10368	broad.mit.edu	37	16	24372945	24372945	+	Missense_Mutation	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24372945T>C	uc002dmf.2	+	4	1909	c.709T>C	c.(709-711)TCT>CCT	p.S237P		NM_006539	NP_006530	O60359	CCG3_HUMAN	voltage-dependent calcium channel gamma-3	237					regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|endocytic vesicle membrane|voltage-gated calcium channel complex	voltage-gated calcium channel activity				0				GBM - Glioblastoma multiforme(48;0.0809)		GCGGTCAAGTTCTCGCTCCAC	0.567													7	42	---	---	---	---	PASS
MT1A	4489	broad.mit.edu	37	16	56673832	56673832	+	Silent	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56673832G>C	uc002ejq.2	+	3	229	c.156G>C	c.(154-156)GGG>GGC	p.G52G	MT1A_uc002eji.2_RNA	NM_005946	NP_005937	P04731	MT1A_HUMAN	metallothionein 1A	52	Alpha.					cytoplasm	cadmium ion binding|copper ion binding|zinc ion binding				0						TCTGCAAAGGGGCATCAGAGA	0.542													12	48	---	---	---	---	PASS
RSPRY1	89970	broad.mit.edu	37	16	57250871	57250871	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57250871G>T	uc002elb.2	+	8	1103	c.825G>T	c.(823-825)TTG>TTT	p.L275F	RSPRY1_uc002elc.2_Missense_Mutation_p.L275F|RSPRY1_uc002eld.2_Missense_Mutation_p.L275F	NM_133368	NP_588609	Q96DX4	RSPRY_HUMAN	ring finger and SPRY domain containing 1	275						extracellular region	zinc ion binding			ovary(1)	1						TTGTCACATTGGAGTCCTGGG	0.393													5	42	---	---	---	---	PASS
ZNF319	57567	broad.mit.edu	37	16	58032164	58032164	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58032164C>A	uc002emx.1	-	2	629	c.6G>T	c.(4-6)TCG>TCT	p.S2S		NM_020807	NP_065858	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	2					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GCCAGCTTTCCGACATGCTTG	0.597													3	15	---	---	---	---	PASS
CDH5	1003	broad.mit.edu	37	16	66429952	66429952	+	Intron	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:66429952C>A	uc002eom.3	+							NM_001795	NP_001786	P33151	CADH5_HUMAN	cadherin 5, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|regulation of establishment of cell polarity	integral to membrane|membrane fraction	beta-catenin binding|calcium ion binding|ion channel binding|receptor binding			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)		AAACTCTCTCCCCTGGGCAGA	0.507													5	29	---	---	---	---	PASS
WWP2	11060	broad.mit.edu	37	16	69874130	69874130	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:69874130C>T	uc002exu.1	+	6	531	c.442C>T	c.(442-444)CTG>TTG	p.L148L	WWP2_uc002ext.2_Silent_p.L148L|WWP2_uc002exv.1_Silent_p.L148L|WWP2_uc010vlm.1_Silent_p.L32L	NM_007014	NP_008945	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase	148					entry of virus into host cell|negative regulation of protein transport|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transporter activity|proteasomal ubiquitin-dependent protein catabolic process|protein K63-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus|ubiquitin ligase complex	RNA polymerase II transcription factor binding|ubiquitin-protein ligase activity			lung(3)|ovary(1)|breast(1)|skin(1)	6						AACTGTTGATCTGGGAAATGT	0.612													7	32	---	---	---	---	PASS
ADAMTS18	170692	broad.mit.edu	37	16	77398203	77398203	+	Nonsense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:77398203G>C	uc002ffc.3	-	5	1273	c.854C>G	c.(853-855)TCA>TGA	p.S285*	ADAMTS18_uc010chc.1_5'Flank|ADAMTS18_uc002ffe.1_Translation_Start_Site|ADAMTS18_uc010vni.1_RNA	NM_199355	NP_955387	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1	285					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			large_intestine(4)|lung(4)|kidney(4)|skin(3)|breast(1)|ovary(1)|pancreas(1)	18						TTTTCCAGCTGATCTTCTGGG	0.483													6	26	---	---	---	---	PASS
OR1D2	4991	broad.mit.edu	37	17	2995592	2995592	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2995592C>T	uc010vrb.1	-	1	699	c.699G>A	c.(697-699)AAG>AAA	p.K233K		NM_002548	NP_002539	P34982	OR1D2_HUMAN	olfactory receptor, family 1, subfamily D,	233	Cytoplasmic (Potential).				cellular component movement|chemotaxis|protein import into nucleus, translocation|sensory perception of smell|single fertilization	integral to plasma membrane	olfactory receptor activity			ovary(1)	1						CTTTGTATTTCTTAGAGACTG	0.468													11	74	---	---	---	---	PASS
ASGR1	432	broad.mit.edu	37	17	7080327	7080327	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7080327C>A	uc002ges.3	-	4	666	c.256G>T	c.(256-258)GCC>TCC	p.A86S	ASGR1_uc010clx.1_5'UTR	NM_001671	NP_001662	P07306	ASGR1_HUMAN	asialoglycoprotein receptor 1	86	Potential.|Extracellular (Probable).				receptor-mediated endocytosis	integral to plasma membrane	asialoglycoprotein receptor activity|metal ion binding|sugar binding			breast(1)|central_nervous_system(1)	2						TTGACCTGGGCCTCCGTGCTC	0.527													3	13	---	---	---	---	PASS
NEURL4	84461	broad.mit.edu	37	17	7226420	7226420	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7226420C>A	uc002gga.1	-	15	2447	c.2440G>T	c.(2440-2442)GGT>TGT	p.G814C	NEURL4_uc002ggb.1_Missense_Mutation_p.G814C|NEURL4_uc002ggc.1_Missense_Mutation_p.G160C	NM_032442	NP_115818	Q96JN8	NEUL4_HUMAN	neuralized homolog 4 isoform 1	814	NHR 4.						protein binding			upper_aerodigestive_tract(1)|ovary(1)	2						ATCGTGTTACCGTCTTGCATG	0.572													3	15	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578271	7578271	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578271T>A	uc002gim.2	-	6	772	c.578A>T	c.(577-579)CAT>CTT	p.H193L	TP53_uc002gig.1_Missense_Mutation_p.H193L|TP53_uc002gih.2_Missense_Mutation_p.H193L|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.H61L|TP53_uc010cng.1_Missense_Mutation_p.H61L|TP53_uc002gii.1_Missense_Mutation_p.H61L|TP53_uc010cnh.1_Missense_Mutation_p.H193L|TP53_uc010cni.1_Missense_Mutation_p.H193L|TP53_uc002gij.2_Missense_Mutation_p.H193L|TP53_uc010cnj.1_Intron|TP53_uc002gin.2_Missense_Mutation_p.H100L|TP53_uc002gio.2_Missense_Mutation_p.H61L|TP53_uc010vug.1_Missense_Mutation_p.H154L	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	193	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		H -> D (in sporadic cancers; somatic mutation).|H -> Q (in sporadic cancers; somatic mutation).|H -> Y (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|H -> N (in sporadic cancers; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).|H -> L (in sporadic cancers; somatic mutation).|H -> P (in sporadic cancers; somatic mutation).|H -> R (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.H193R(67)|p.H193L(31)|p.H193Y(26)|p.H193P(12)|p.0?(7)|p.H193D(7)|p.H193N(4)|p.A189_V197delAPPQHLIRV(4)|p.H193fs*16(3)|p.H193H(2)|p.P191fs*53(2)|p.K164_P219del(1)|p.P191fs*15(1)|p.P191fs*6(1)|p.H100L(1)|p.H61L(1)|p.H193_I195delHLI(1)|p.H193_I195>AP(1)|p.A189fs*53(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCGGATAAGATGCTGAGGAGG	0.562		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	14	---	---	---	---	PASS
MYH1	4619	broad.mit.edu	37	17	10406144	10406144	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10406144G>T	uc002gmo.2	-	24	3116	c.3022C>A	c.(3022-3024)CAG>AAG	p.Q1008K	uc002gml.1_Intron	NM_005963	NP_005954	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	1008	Potential.					muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity			ovary(10)|skin(6)|breast(3)|upper_aerodigestive_tract(1)|kidney(1)	21						AGGGTCTGCTGGTGGGCCTCC	0.493													6	88	---	---	---	---	PASS
MYH2	4620	broad.mit.edu	37	17	10428145	10428145	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10428145G>T	uc010coi.2	-	34	5028	c.4900C>A	c.(4900-4902)CAG>AAG	p.Q1634K	uc002gml.1_Intron|MYH2_uc002gmp.3_Missense_Mutation_p.Q1634K|MYH2_uc010coj.2_Intron	NM_001100112	NP_001093582	Q9UKX2	MYH2_HUMAN	myosin heavy chain IIa	1634	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle	p.Q1634L(1)		ovary(5)|pancreas(4)|skin(3)|lung(1)|kidney(1)	14						TGGTTCAGCTGGATTTCCATT	0.517													40	16	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11603086	11603086	+	Silent	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11603086C>G	uc002gne.2	+	23	4979	c.4911C>G	c.(4909-4911)GCC>GCG	p.A1637A	DNAH9_uc010coo.2_Silent_p.A931A	NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	1637	Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		ACAACATGGCCAAGATGCGAT	0.473													8	35	---	---	---	---	PASS
HOXB5	3215	broad.mit.edu	37	17	46669566	46669566	+	3'UTR	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46669566C>A	uc002inr.2	-	2					HOXB3_uc010wlm.1_5'Flank|HOXB3_uc010dbf.2_5'Flank|HOXB3_uc010dbg.2_5'Flank	NM_002147	NP_002138	P09067	HXB5_HUMAN	homeobox B5							nucleus	sequence-specific DNA binding				0						CTCCTCTGGGCGGGCTCAGGG	0.652													4	7	---	---	---	---	PASS
CUEDC1	404093	broad.mit.edu	37	17	55948728	55948728	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:55948728G>T	uc002ivd.1	-	6	1506	c.787C>A	c.(787-789)CGA>AGA	p.R263R	CUEDC1_uc002ive.1_Silent_p.R263R	NM_017949	NP_060419	Q9NWM3	CUED1_HUMAN	CUE domain-containing 1	263										skin(2)	2						TATTTCAATCGATCTGGAAAA	0.542													9	40	---	---	---	---	PASS
MARCH10	162333	broad.mit.edu	37	17	60788625	60788625	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60788625C>G	uc010ddr.2	-	9	2533	c.2295G>C	c.(2293-2295)ATG>ATC	p.M765I	MARCH10_uc002jag.3_Missense_Mutation_p.M765I|MARCH10_uc010dds.2_Missense_Mutation_p.M803I|MARCH10_uc002jah.2_Missense_Mutation_p.M764I|uc002jaj.1_Intron|uc002jak.2_Intron	NM_001100875	NP_001094345	Q8NA82	MARHA_HUMAN	ring finger protein 190	765							ligase activity|zinc ion binding				0						GGTTGAGCCTCATGAGTTCTG	0.507													16	85	---	---	---	---	PASS
LRRC37A3	374819	broad.mit.edu	37	17	62856037	62856037	+	Silent	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62856037T>C	uc002jey.2	-	11	4758	c.4227A>G	c.(4225-4227)CCA>CCG	p.P1409P	LRRC37A3_uc010wqg.1_Silent_p.P527P|LRRC37A3_uc002jex.1_Silent_p.P386P|LRRC37A3_uc010wqf.1_Silent_p.P447P|LRRC37A3_uc010dek.1_Silent_p.P415P	NM_199340	NP_955372	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	1409	Extracellular (Potential).					integral to membrane					0						TGGTTCCTTCTGGCATGTTAG	0.383													5	88	---	---	---	---	PASS
KPNA2	3838	broad.mit.edu	37	17	66033297	66033297	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66033297T>A	uc002jgk.2	+	2	181	c.49T>A	c.(49-51)TTC>ATC	p.F17I	KPNA2_uc002jgl.2_Missense_Mutation_p.F17I	NM_002266	NP_002257	P52292	IMA2_HUMAN	karyopherin alpha 2	17	IBB.				DNA metabolic process|G2 phase of mitotic cell cycle|interspecies interaction between organisms|M phase specific microtubule process|NLS-bearing substrate import into nucleus|regulation of DNA recombination	cytoplasm|nuclear pore|nucleoplasm	histone deacetylase binding|nuclear localization sequence binding|protein transporter activity			central_nervous_system(2)	2	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTTCACAGATTCAAGAACAA	0.423													174	71	---	---	---	---	PASS
ABCA6	23460	broad.mit.edu	37	17	67119511	67119511	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:67119511C>G	uc002jhw.1	-	10	1480	c.1305G>C	c.(1303-1305)TTG>TTC	p.L435F		NM_080284	NP_525023	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A, member 6	435					transport	integral to membrane	ATP binding|ATPase activity			upper_aerodigestive_tract(2)|large_intestine(2)|ovary(2)|skin(1)	7	Breast(10;5.65e-12)					ATGATGAATTCAAGAAAAATA	0.358													32	24	---	---	---	---	PASS
CD300LB	124599	broad.mit.edu	37	17	72519002	72519002	+	Missense_Mutation	SNP	T	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72519002T>A	uc002jkx.2	-	4	605	c.592A>T	c.(592-594)ATC>TTC	p.I198F		NM_174892	NP_777552	A8K4G0	CLM7_HUMAN	CD300 molecule-like family member b	161	Helical; (Potential).					integral to membrane|plasma membrane	receptor activity			ovary(1)	1						ATGAGCAAGATGGGCACCTTC	0.577													7	152	---	---	---	---	PASS
RNF157	114804	broad.mit.edu	37	17	74150388	74150388	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74150388C>T	uc002jqz.2	-	17	1855	c.1786G>A	c.(1786-1788)GAG>AAG	p.E596K	RNF157_uc002jra.2_Missense_Mutation_p.E574K|uc002jrb.1_5'Flank	NM_052916	NP_443148	Q96PX1	RN157_HUMAN	ring finger protein 157	596							zinc ion binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.187)			GATCCATCCTCTTCCTCTATA	0.423													203	62	---	---	---	---	PASS
ARHGAP28	79822	broad.mit.edu	37	18	6859824	6859824	+	Intron	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:6859824C>G	uc010wzi.1	+						ARHGAP28_uc002knc.2_Silent_p.L166L|ARHGAP28_uc002knd.2_Silent_p.L59L|ARHGAP28_uc002kne.2_Silent_p.L59L|ARHGAP28_uc002knf.2_Silent_p.L50L			B4DXL2	B4DXL2_HUMAN	SubName: Full=Putative uncharacterized protein ARHGAP28;						signal transduction	intracellular				pancreas(1)	1		Colorectal(10;0.168)				ATGCTTCTCTCAACAGTACTA	0.423													14	91	---	---	---	---	PASS
PTPRM	5797	broad.mit.edu	37	18	8113592	8113592	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8113592G>A	uc002knn.3	+	12	2468	c.1965G>A	c.(1963-1965)CTG>CTA	p.L655L	PTPRM_uc010dkv.2_Silent_p.L655L|PTPRM_uc010wzl.1_Silent_p.L442L	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	655	Fibronectin type-III 4.|Extracellular (Potential).				homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				CTTCTCTGCTGAACTCACAGT	0.418													31	56	---	---	---	---	PASS
DSC3	1825	broad.mit.edu	37	18	28587056	28587056	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28587056C>A	uc002kwj.3	-	12	1860	c.1705G>T	c.(1705-1707)GAT>TAT	p.D569Y	DSC3_uc002kwi.3_Missense_Mutation_p.D569Y	NM_001941	NP_001932	Q14574	DSC3_HUMAN	desmocollin 3 isoform Dsc3a preproprotein	569	Cadherin 4.|Extracellular (Potential).				homophilic cell adhesion|protein stabilization	desmosome|integral to membrane|membrane fraction	calcium ion binding|gamma-catenin binding			ovary(2)|skin(2)	4			OV - Ovarian serous cystadenocarcinoma(10;0.125)			TCATTTACATCTTCAATGTTC	0.333													10	41	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28934414	28934414	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28934414G>T	uc002kwp.2	+	15	2467	c.2255G>T	c.(2254-2256)GGA>GTA	p.G752V	DSG1_uc010xbp.1_Missense_Mutation_p.G111V	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein	752	Cytoplasmic (Potential).				calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			GATACCCTGGGACCTAAATTT	0.468													34	65	---	---	---	---	PASS
CDH20	28316	broad.mit.edu	37	18	59166620	59166620	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59166620G>C	uc010dps.1	+	2	460	c.448G>C	c.(448-450)GAG>CAG	p.E150Q	CDH20_uc002lif.2_Missense_Mutation_p.E144Q	NM_031891	NP_114097	Q9HBT6	CAD20_HUMAN	cadherin 20, type 2 preproprotein	150	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			breast(3)|ovary(1)|pancreas(1)	5		Colorectal(73;0.186)				GCCCGAGTCAGAGTTCATCAT	0.542													13	24	---	---	---	---	PASS
RNF152	220441	broad.mit.edu	37	18	59483298	59483298	+	Silent	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59483298C>A	uc002lih.1	-	2	811	c.399G>T	c.(397-399)GTG>GTT	p.V133V		NM_173557	NP_775828	Q8N8N0	RN152_HUMAN	ring finger protein 152	133					apoptosis|protein K48-linked ubiquitination	integral to membrane|lysosomal membrane	ubiquitin-protein ligase activity|zinc ion binding			breast(1)	1		Colorectal(73;0.186)				CAGGGATGGTCACCACGGTGA	0.677													13	14	---	---	---	---	PASS
AP3D1	8943	broad.mit.edu	37	19	2129329	2129329	+	Missense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2129329C>G	uc002luz.2	-	7	943	c.720G>C	c.(718-720)AAG>AAC	p.K240N	AP3D1_uc002luy.2_Intron|AP3D1_uc002lva.2_Missense_Mutation_p.K240N	NM_003938	NP_003929	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1	240					eye pigment biosynthetic process|intracellular protein transport|regulation of sequestering of zinc ion|vesicle-mediated transport	endosome membrane|Golgi membrane|membrane coat	binding|protein transporter activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTTGATGATCTTGATGAGGA	0.597													10	8	---	---	---	---	PASS
SPPL2B	56928	broad.mit.edu	37	19	2345327	2345327	+	Silent	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2345327C>T	uc002lvs.2	+	14	1433	c.1353C>T	c.(1351-1353)ATC>ATT	p.I451I	SPPL2B_uc002lvr.2_Silent_p.I451I	NM_152988	NP_694533	Q8TCT7	PSL1_HUMAN	signal peptide peptidase-like 2B isoform 2	451	Helical; (Potential).					Golgi membrane|integral to membrane	aspartic-type endopeptidase activity				0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCTGCACCATCGGTAAGTGCC	0.542													5	12	---	---	---	---	PASS
INSR	3643	broad.mit.edu	37	19	7122698	7122698	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7122698G>T	uc002mgd.1	-	19	3565	c.3456C>A	c.(3454-3456)GCC>GCA	p.A1152A	INSR_uc002mge.1_Silent_p.A1140A	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor	1152	Protein kinase.|Cytoplasmic (Potential).				activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	CAAACTTCTTGGCGTTCAGGT	0.502													6	51	---	---	---	---	PASS
CYP4F11	57834	broad.mit.edu	37	19	16025601	16025601	+	Missense_Mutation	SNP	A	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16025601A>T	uc002nbu.2	-	10	1256	c.1220T>A	c.(1219-1221)GTG>GAG	p.V407E	CYP4F11_uc010eab.1_Missense_Mutation_p.V407E|CYP4F11_uc002nbt.2_Missense_Mutation_p.V407E	NM_001128932	NP_001122404	Q9HBI6	CP4FB_HUMAN	cytochrome P450 family 4 subfamily F polypeptide	407					inflammatory response|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	aromatase activity|electron carrier activity|heme binding			ovary(1)	1						GTCTGGGAGCACAAAGTCCTG	0.647													45	15	---	---	---	---	PASS
ZNF254	9534	broad.mit.edu	37	19	24309470	24309470	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:24309470C>T	uc002nru.2	+	4	802	c.668C>T	c.(667-669)TCA>TTA	p.S223L	ZNF254_uc010xrk.1_Missense_Mutation_p.S138L	NM_203282	NP_975011	O75437	ZN254_HUMAN	zinc finger protein 254	223	C2H2-type 1; degenerate.				negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(12;0.086)|all_lung(12;0.00528)|Lung NSC(12;0.00731)|all_epithelial(12;0.0186)				AATTGGTCCTCAACCCTTACT	0.323													44	33	---	---	---	---	PASS
RBM42	79171	broad.mit.edu	37	19	36120495	36120495	+	Missense_Mutation	SNP	A	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36120495A>G	uc002oan.2	+	2	278	c.202A>G	c.(202-204)ACG>GCG	p.T68A	RBM42_uc010xsx.1_Missense_Mutation_p.T68A|RBM42_uc010eef.2_Missense_Mutation_p.T68A|RBM42_uc002oao.2_Missense_Mutation_p.T68A|RBM42_uc002oap.2_Missense_Mutation_p.T68A|RBM42_uc002oaq.2_Missense_Mutation_p.T68A|RBM42_uc010eeg.2_Missense_Mutation_p.T68A	NM_024321	NP_077297	Q9BTD8	RBM42_HUMAN	RNA binding motif protein 42	68						cytoplasm|nucleus	nucleotide binding|RNA binding				0	all_lung(56;1.58e-07)|Lung NSC(56;2.43e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CACTGTCCCCACGGTCCCCAC	0.592													15	54	---	---	---	---	PASS
NPHS1	4868	broad.mit.edu	37	19	36333142	36333142	+	Silent	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36333142C>G	uc002oby.2	-	19	2547	c.2547G>C	c.(2545-2547)GTG>GTC	p.V849V	NPHS1_uc010eem.1_5'Flank	NM_004646	NP_004637	O60500	NPHN_HUMAN	nephrin precursor	849	Ig-like C2-type 8.|Extracellular (Potential).				cell adhesion|excretion|muscle organ development	integral to plasma membrane				ovary(4)|skin(1)	5	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CAGCTGCAGCCACCTTAGTTA	0.602													3	10	---	---	---	---	PASS
TBCB	1155	broad.mit.edu	37	19	36611661	36611661	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36611661G>C	uc002odg.1	+	3	883	c.308G>C	c.(307-309)CGG>CCG	p.R103P	TBCB_uc002odh.1_Missense_Mutation_p.R84P	NM_001281	NP_001272	Q99426	TBCB_HUMAN	cytoskeleton associated protein 1	103					'de novo' posttranslational protein folding|cell differentiation|nervous system development	cytoplasm|microtubule	protein binding				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GACGTGTCCCGGGTGGAGAAG	0.642													21	18	---	---	---	---	PASS
ZNF570	148268	broad.mit.edu	37	19	37961251	37961251	+	5'UTR	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37961251G>C	uc002ogk.1	+	2					ZNF569_uc002ogi.2_5'Flank|ZNF569_uc002ogj.2_5'Flank|ZNF570_uc010efl.1_Missense_Mutation_p.E55Q|ZNF570_uc010xtr.1_Intron	NM_144694	NP_653295	Q96NI8	ZN570_HUMAN	zinc finger protein 570						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCAGGAGGAAGAAAGAATGGC	0.443													8	58	---	---	---	---	PASS
SPRED3	399473	broad.mit.edu	37	19	38882630	38882630	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38882630G>A	uc002oim.2	+	2	226	c.222G>A	c.(220-222)AAG>AAA	p.K74K	SPRED3_uc002oil.1_Silent_p.K74K	NM_001042522	NP_001035987	Q2MJR0	SPRE3_HUMAN	sprouty-related, EVH1 domain containing 3	74	WH1.				multicellular organismal development					central_nervous_system(2)|lung(1)|skin(1)	4	all_cancers(60;3.4e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTTACAACAAGGTGAATCCCA	0.542													15	98	---	---	---	---	PASS
CEACAM8	1088	broad.mit.edu	37	19	43092953	43092953	+	Missense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43092953C>A	uc002oud.2	-	4	1043	c.941G>T	c.(940-942)AGG>ATG	p.R314M	uc010eif.1_Intron|uc010eig.1_Intron|uc010eih.1_Intron	NM_001816	NP_001807	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion	314	Ig-like C2-type 2.				immune response	anchored to membrane|extracellular space|integral to plasma membrane				ovary(1)	1		Prostate(69;0.00899)				TGTGATCATCCTGACTGTGGT	0.478													6	91	---	---	---	---	PASS
TEX101	83639	broad.mit.edu	37	19	43910665	43910665	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43910665G>A	uc002owk.2	+	4	570	c.9G>A	c.(7-9)GCG>GCA	p.A3A		NM_031451	NP_113639	Q9BY14	TX101_HUMAN	testis expressed 101 isoform 1	Error:Variant_position_missing_in_Q9BY14_after_alignment						anchored to membrane|plasma membrane				ovary(1)	1		Prostate(69;0.0199)				gcatgggggcgaggcaggtac	0.000													8	11	---	---	---	---	PASS
TMEM160	54958	broad.mit.edu	37	19	47549873	47549873	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47549873G>T	uc002pfz.2	-	2	289	c.279C>A	c.(277-279)GAC>GAA	p.D93E		NM_017854	NP_060324	Q9NX00	TM160_HUMAN	transmembrane protein 160	93						integral to membrane					0		all_cancers(25;8.13e-05)|all_lung(116;0.000901)|all_epithelial(76;0.00185)|Lung NSC(112;0.00215)|all_neural(266;0.0652)|Ovarian(192;0.15)		all cancers(93;5.36e-05)|OV - Ovarian serous cystadenocarcinoma(262;6.95e-05)|Epithelial(262;0.00363)|GBM - Glioblastoma multiforme(486;0.0242)		CCCGACCCATGTCACTCTGCA	0.617													10	78	---	---	---	---	PASS
PPP1R15A	23645	broad.mit.edu	37	19	49377887	49377887	+	Nonsense_Mutation	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49377887C>G	uc002pky.3	+	2	1666	c.1397C>G	c.(1396-1398)TCA>TGA	p.S466*		NM_014330	NP_055145	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	466	4 X 34 AA approximate repeats.|Glu-rich.|Interaction with SMAD7.				apoptosis|cell cycle arrest|regulation of translation|response to DNA damage stimulus	endoplasmic reticulum	protein binding			lung(1)	1		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GAAGCTGAGTCAGACCCACAT	0.567													9	62	---	---	---	---	PASS
HRC	3270	broad.mit.edu	37	19	49654775	49654775	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49654775G>C	uc002pmv.2	-	5	2249	c.2062C>G	c.(2062-2064)CAG>GAG	p.Q688E		NM_002152	NP_002143	P23327	SRCH_HUMAN	histidine rich calcium binding protein	688					muscle contraction	sarcoplasmic reticulum lumen	calcium ion binding			ovary(1)	1		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		all cancers(93;2.01e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.00019)|GBM - Glioblastoma multiforme(486;0.00279)|Epithelial(262;0.00622)		CACACTTACTGATAAAGGGAC	0.398													8	34	---	---	---	---	PASS
AP2A1	160	broad.mit.edu	37	19	50304215	50304215	+	Intron	SNP	C	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50304215C>G	uc002ppn.2	+						AP2A1_uc010enj.1_Intron|AP2A1_uc002ppo.2_Intron|AP2A1_uc002ppp.1_5'Flank	NM_014203	NP_055018	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1						axon guidance|endocytosis|epidermal growth factor receptor signaling pathway|Golgi to endosome transport|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|viral reproduction	AP-2 adaptor complex|clathrin coat of trans-Golgi network vesicle|cytosol	protein binding|protein transporter activity			ovary(2)	2		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CCACCCCACTCAGGCGCTCCA	0.627													3	9	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51132558	51132558	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132558C>T	uc002pst.2	-	4	1908	c.1274G>A	c.(1273-1275)GGC>GAC	p.G425D	SYT3_uc002psv.2_Missense_Mutation_p.G425D|SYT3_uc010ycd.1_Missense_Mutation_p.G425D	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	425	Cytoplasmic (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GACCGAGCCGCCCTCCACGAT	0.677													5	3	---	---	---	---	PASS
ZIM2	23619	broad.mit.edu	37	19	57286681	57286681	+	Missense_Mutation	SNP	G	A	A	rs138884282	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57286681G>A	uc002qnr.2	-	11	1341	c.959C>T	c.(958-960)TCA>TTA	p.S320L	uc010ygp.1_Intron|uc002qnp.1_Intron|ZIM2_uc010ygq.1_Missense_Mutation_p.S116L|ZIM2_uc010ygr.1_Missense_Mutation_p.S116L|ZIM2_uc002qnq.2_Missense_Mutation_p.S320L|ZIM2_uc010etp.2_Missense_Mutation_p.S320L|ZIM2_uc010ygs.1_Missense_Mutation_p.S320L	NM_015363	NP_056178	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	320					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		TTGGGATGCTGACTGGGGACT	0.453													9	48	---	---	---	---	PASS
HAO1	54363	broad.mit.edu	37	20	7915149	7915149	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:7915149C>T	uc002wmw.1	-	2	295	c.271G>A	c.(271-273)GAG>AAG	p.E91K	HAO1_uc010gbu.2_Missense_Mutation_p.E91K	NM_017545	NP_060015	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase 1	91	FMN hydroxy acid dehydrogenase.				cellular nitrogen compound metabolic process|fatty acid alpha-oxidation|glycolate catabolic process|glyoxylate metabolic process	peroxisomal matrix	FMN binding|glycolate oxidase activity|glyoxylate oxidase activity			ovary(3)	3						GTGGCAAGCTCGCCGTCCACA	0.522													23	110	---	---	---	---	PASS
TM9SF4	9777	broad.mit.edu	37	20	30745599	30745599	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30745599G>A	uc002wxj.2	+	14	1567	c.1332G>A	c.(1330-1332)GTG>GTA	p.V444V	TM9SF4_uc010zts.1_Silent_p.V351V|TM9SF4_uc002wxk.2_Silent_p.V427V|TM9SF4_uc010gdz.2_Silent_p.V323V	NM_014742	NP_055557	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4	444						integral to membrane				central_nervous_system(1)|pancreas(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			GTCTACAGGTGCCCTTTCCCA	0.627													54	56	---	---	---	---	PASS
C20orf4	25980	broad.mit.edu	37	20	34828318	34828318	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34828318G>C	uc002xfc.1	+	2	621	c.528G>C	c.(526-528)CAG>CAC	p.Q176H	C20orf4_uc002xfd.1_Missense_Mutation_p.Q176H|C20orf4_uc002xfe.1_Missense_Mutation_p.Q176H	NM_015511	NP_056326	Q9Y312	CT004_HUMAN	hypothetical protein LOC25980	176											0	Breast(12;0.0162)	Myeloproliferative disorder(115;0.0393)				GCGTGGGGCAGAATCTACCCC	0.582													62	61	---	---	---	---	PASS
CDH22	64405	broad.mit.edu	37	20	44815288	44815288	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44815288G>C	uc002xrm.2	-	9	2003	c.1602C>G	c.(1600-1602)TTC>TTG	p.F534L	CDH22_uc010ghk.1_Missense_Mutation_p.F534L	NM_021248	NP_067071	Q9UJ99	CAD22_HUMAN	cadherin 22 precursor	534	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|skin(1)	5		Myeloproliferative disorder(115;0.0122)				GGCGGAAATAGAAGCGGTGCC	0.587													7	46	---	---	---	---	PASS
BCAS1	8537	broad.mit.edu	37	20	52645430	52645430	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:52645430G>T	uc002xws.2	-	4	562	c.224C>A	c.(223-225)GCC>GAC	p.A75D	BCAS1_uc010zzb.1_5'UTR|BCAS1_uc010gim.2_5'UTR|BCAS1_uc002xwt.2_Missense_Mutation_p.A75D|BCAS1_uc010gil.1_Missense_Mutation_p.A75D|BCAS1_uc010zzc.1_5'UTR	NM_003657	NP_003648	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	75						cytoplasm	protein binding			ovary(2)|central_nervous_system(1)	3	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			CTTTCCGTTGGCATCCGCAAC	0.493													29	19	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	20	57393278	57393278	+	5'Flank	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57393278G>T	uc002xzr.1	-						MIR296_hsa-mir-296|MI0000747_5'Flank					DM004486																		AAGGGGAGCCGGCAGCTCACT	0.562													3	12	---	---	---	---	PASS
NCAM2	4685	broad.mit.edu	37	21	22910240	22910240	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:22910240G>T	uc002yld.1	+	18	2725	c.2476G>T	c.(2476-2478)GAC>TAC	p.D826Y	NCAM2_uc011acb.1_Missense_Mutation_p.D684Y	NM_004540	NP_004531	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2 precursor	826	Cytoplasmic (Potential).				neuron cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)	4		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGTTTCTAACGACATCATTCA	0.343													30	21	---	---	---	---	PASS
USP16	10600	broad.mit.edu	37	21	30402983	30402983	+	Silent	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:30402983G>T	uc002ymy.2	+	3	331	c.129G>T	c.(127-129)GTG>GTT	p.V43V	USP16_uc002ymx.2_Silent_p.V43V|USP16_uc002ymw.2_Silent_p.V43V|USP16_uc011acm.1_Silent_p.V29V|USP16_uc011acn.1_Intron	NM_006447	NP_006438	Q9Y5T5	UBP16_HUMAN	ubiquitin specific protease 16 isoform a	43					cell division|histone deubiquitination|mitosis|positive regulation of transcription, DNA-dependent|protein homotetramerization|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	cysteine-type endopeptidase activity|histone binding|transcription coactivator activity|ubiquitin binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			ovary(2)|breast(1)|pancreas(1)	4						TAGTGAATGTGGAATGGAATA	0.333													6	53	---	---	---	---	PASS
DIP2A	23181	broad.mit.edu	37	21	47985788	47985788	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47985788G>A	uc002zjo.2	+	36	4510	c.4327G>A	c.(4327-4329)GAT>AAT	p.D1443N	DIP2A_uc011afz.1_Missense_Mutation_p.D1439N|DIP2A_uc002zjs.2_Missense_Mutation_p.D123N|DIP2A_uc002zjt.2_RNA	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a	1443					multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGAGCTCACTGATGCCAGTGG	0.602													35	27	---	---	---	---	PASS
TXNRD2	10587	broad.mit.edu	37	22	19865933	19865933	+	Nonsense_Mutation	SNP	C	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:19865933C>A	uc011ahc.1	-	15	1336	c.1303G>T	c.(1303-1305)GAG>TAG	p.E435*	TXNRD2_uc002zql.1_Nonsense_Mutation_p.E189*|TXNRD2_uc002zqm.1_RNA|TXNRD2_uc002zqn.1_RNA|TXNRD2_uc002zqo.1_RNA|TXNRD2_uc002zqp.1_RNA|TXNRD2_uc002zqr.1_Nonsense_Mutation_p.E434*|TXNRD2_uc002zqj.1_RNA|TXNRD2_uc002zqq.1_Nonsense_Mutation_p.E85*	NM_006440	NP_006431	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2 precursor	435					cell redox homeostasis|response to oxygen radical	mitochondrion	flavin adenine dinucleotide binding|NADP binding|thioredoxin-disulfide reductase activity			ovary(2)	2	Colorectal(54;0.0993)					ACCGTGAACTCCAGTGGTTTA	0.567													21	146	---	---	---	---	PASS
PI4KA	5297	broad.mit.edu	37	22	21119167	21119167	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21119167G>C	uc002zsz.3	-	22	2703	c.2472C>G	c.(2470-2472)ATC>ATG	p.I824M		NM_058004	NP_477352	P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase type 3 alpha	824					phosphatidylinositol biosynthetic process|phosphatidylinositol-mediated signaling|synaptic transmission	Golgi-associated vesicle	1-phosphatidylinositol 4-kinase activity|ATP binding|protein binding			lung(2)|upper_aerodigestive_tract(1)|salivary_gland(1)	4	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			CCAGCTTGTTGATGAGTGCGG	0.582													5	36	---	---	---	---	PASS
KREMEN1	83999	broad.mit.edu	37	22	29533453	29533453	+	Missense_Mutation	SNP	C	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29533453C>T	uc011akm.1	+	6	768	c.755C>T	c.(754-756)TCC>TTC	p.S252F	KREMEN1_uc003ael.2_Missense_Mutation_p.S252F|KREMEN1_uc011akn.1_Missense_Mutation_p.S135F	NM_032045	NP_114434	Q96MU8	KREM1_HUMAN	kringle-containing transmembrane protein 1	250	Extracellular (Potential).|CUB.				cell communication|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	integral to membrane|membrane fraction	protein binding			ovary(3)|lung(2)	5						CCGGGGGCCTCCCACATCCAC	0.597													11	62	---	---	---	---	PASS
MYH9	4627	broad.mit.edu	37	22	36717798	36717798	+	Intron	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36717798G>C	uc003apg.2	-						MYH9_uc003aph.1_Intron	NM_002473	NP_002464	P35579	MYH9_HUMAN	myosin, heavy polypeptide 9, non-muscle						actin cytoskeleton reorganization|actin filament-based movement|angiogenesis|axon guidance|blood vessel endothelial cell migration|cytokinesis|integrin-mediated signaling pathway|leukocyte migration|membrane protein ectodomain proteolysis|monocyte differentiation|platelet formation|protein transport|regulation of cell shape	actomyosin contractile ring|cleavage furrow|cytosol|myosin complex|nucleus|ruffle|stress fiber|uropod	actin filament binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|microfilament motor activity|protein anchor|protein homodimerization activity			breast(3)|ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|lung(1)|skin(1)|kidney(1)|pancreas(1)	11						GAACCACAAGGATACAAGTCT	0.473			T	ALK	ALCL		Deafness|autosomal dominant 17|Epstein syndrome|Fechtner syndrome|May-Hegglin anomaly|Sebastian syndrome		Hereditary_Macrothrombocytopenia_MYH9-associated				64	36	---	---	---	---	PASS
SMCR7L	54471	broad.mit.edu	37	22	39908032	39908032	+	Splice_Site	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39908032G>A	uc003axx.2	+	4	820	c.322_splice	c.e4+1	p.D108_splice	SMCR7L_uc003axw.2_Splice_Site_p.D108_splice|SMCR7L_uc010gxz.1_Splice_Site|SMCR7L_uc003axy.2_Splice_Site	NM_019008	NP_061881	Q9NQG6	SMC7L_HUMAN	hypothetical protein LOC54471							integral to membrane|mitochondrion				central_nervous_system(1)	1	Melanoma(58;0.04)					TTCGACACAGGTGAGAAGGGC	0.453													9	39	---	---	---	---	PASS
MEI1	150365	broad.mit.edu	37	22	42099442	42099442	+	Silent	SNP	C	T	T	rs147144334	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42099442C>T	uc003baz.1	+	2	307	c.282C>T	c.(280-282)TTC>TTT	p.F94F	MEI1_uc003bay.3_Silent_p.F94F|MEI1_uc011apd.1_RNA	NM_152513	NP_689726	Q5TIA1	MEI1_HUMAN	meiosis defective 1	94							binding			central_nervous_system(1)|skin(1)	2						GCATCCACTTCATAAGTGTGC	0.428													6	15	---	---	---	---	PASS
MTMR8	55613	broad.mit.edu	37	X	63568544	63568544	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63568544G>T	uc004dvs.2	-	6	796	c.728C>A	c.(727-729)CCA>CAA	p.P243Q	MTMR8_uc011mou.1_Missense_Mutation_p.P243Q|MTMR8_uc004dvt.1_Missense_Mutation_p.P243Q	NM_017677	NP_060147	Q96EF0	MTMR8_HUMAN	myotubularin related protein 8	243	Myotubularin phosphatase.					nuclear envelope	protein tyrosine phosphatase activity			ovary(2)|breast(2)	4						AGATACCTTTGGTCTTGTGTC	0.403													4	24	---	---	---	---	PASS
TAF1	6872	broad.mit.edu	37	X	70678145	70678145	+	Missense_Mutation	SNP	G	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70678145G>T	uc004dzu.3	+	35	5041	c.4990G>T	c.(4990-4992)GTA>TTA	p.V1664L	BCYRN1_uc011mpt.1_Intron|TAF1_uc004dzt.3_Missense_Mutation_p.V1685L|TAF1_uc004dzv.3_Missense_Mutation_p.V838L|TAF1_uc010nle.1_RNA|TAF1_uc010nlf.1_Missense_Mutation_p.V89L|TAF1_uc004dzx.2_RNA|TAF1_uc004dzy.2_RNA|TAF1_uc004dzw.1_RNA|TAF1_uc010nlg.1_5'Flank	NM_138923	NP_620278	P21675	TAF1_HUMAN	TBP-associated factor 1 isoform 2	1664	Asp/Glu-rich (acidic tail).|Protein kinase 2.				G1 phase of mitotic cell cycle|interspecies interaction between organisms|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription initiation from RNA polymerase II promoter|protein autophosphorylation|regulation of transcription involved in G2/M-phase of mitotic cell cycle|RNA polymerase II transcriptional preinitiation complex assembly|transcription elongation from RNA polymerase II promoter|viral reproduction	MLL1 complex|transcription factor TFIID complex	ATP binding|histone acetyl-lysine binding|histone acetyltransferase activity|p53 binding|protein binding|protein serine/threonine kinase activity|sequence-specific DNA binding|TBP-class protein binding|transcription coactivator activity			ovary(7)|breast(4)|large_intestine(2)|central_nervous_system(2)|lung(1)|skin(1)	17	Renal(35;0.156)	all_lung(315;0.000321)				AGATGCCTCTGTATTTCAAGA	0.408													48	22	---	---	---	---	PASS
PCDH19	57526	broad.mit.edu	37	X	99663159	99663159	+	Missense_Mutation	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99663159G>A	uc010nmz.2	-	1	2113	c.437C>T	c.(436-438)ACG>ATG	p.T146M	PCDH19_uc004efw.3_Missense_Mutation_p.T146M|PCDH19_uc004efx.3_Missense_Mutation_p.T146M	NM_020766	NP_001098713	Q8TAB3	PCD19_HUMAN	protocadherin 19 isoform b	146	Cadherin 2.|Extracellular (Potential).		T -> R (in EIEE9).		homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|breast(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	7						CGGGATGCGCGTGCCAGGGCT	0.597													14	7	---	---	---	---	PASS
ARL13A	392509	broad.mit.edu	37	X	100243362	100243362	+	Intron	SNP	T	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100243362T>C	uc004ego.2	+						ARL13A_uc011mrf.1_Intron|ARL13A_uc010nng.2_Intron	NM_001012990	NP_001013008	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13 isoform a								GTP binding			ovary(1)	1						CTTCTTGCTGTACAGAAAGAA	0.398													13	9	---	---	---	---	PASS
XIAP	331	broad.mit.edu	37	X	123020331	123020331	+	Silent	SNP	G	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123020331G>A	uc010nqu.2	+	2	945	c.819G>A	c.(817-819)GGG>GGA	p.G273G	XIAP_uc004etx.2_Silent_p.G273G|XIAP_uc010nqv.2_Intron	NM_001167	NP_001158	P98170	XIAP_HUMAN	baculoviral IAP repeat-containing protein 4	273	BIR 3.				anti-apoptosis|apoptosis|induction of apoptosis by intracellular signals|response to DNA damage stimulus	cytosol	caspase inhibitor activity|ligase activity|protein binding|zinc ion binding			ovary(1)|lung(1)	2						TTACTTTTGGGACATGGATAT	0.363									X-linked_Lymphoproliferative_syndrome				27	13	---	---	---	---	PASS
PCDH11Y	83259	broad.mit.edu	37	Y	4925417	4925417	+	Missense_Mutation	SNP	G	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:4925417G>C	uc004fqo.2	+	1	1287	c.553G>C	c.(553-555)GCT>CCT	p.A185P	PCDH11Y_uc010nwg.1_Missense_Mutation_p.A174P|PCDH11Y_uc004fql.1_Missense_Mutation_p.A174P|PCDH11Y_uc004fqm.1_Missense_Mutation_p.A174P|PCDH11Y_uc004fqn.1_Missense_Mutation_p.A185P	NM_032973	NP_116755	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked isoform c	185	Extracellular (Potential).|Cadherin 2.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0						AGAGAACTCGGCTATAAACTC	0.368													11	9	---	---	---	---	PASS
PEX10	5192	broad.mit.edu	37	1	2340916	2340917	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2340916_2340917delTG	uc001ajh.2	-						PEX10_uc001ajg.2_Intron	NM_002617	NP_002608	O60683	PEX10_HUMAN	peroxisome biogenesis factor 10 isoform 2						protein import into peroxisome matrix|protein import into peroxisome matrix	integral to peroxisomal membrane|peroxisomal membrane	protein binding|protein C-terminus binding|zinc ion binding|zinc ion binding			central_nervous_system(1)	1	all_cancers(77;0.000247)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;5.35e-20)|all_lung(118;2.78e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.1e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.02e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00102)|BRCA - Breast invasive adenocarcinoma(365;0.00435)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0169)|Lung(427;0.199)		gcaccttccctgtgtgttccac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2376416	2376416	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2376416delA								PEX10 (32406 upstream) : PLCH2 (31338 downstream)																							GAGGCCGGGGAGGGGCAAGTC	0.642													4	2	---	---	---	---	
PRDM16	63976	broad.mit.edu	37	1	3092717	3092724	+	Intron	DEL	ATCCATCC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3092717_3092724delATCCATCC	uc001akf.2	+						PRDM16_uc001akc.2_Intron|PRDM16_uc001akd.2_Intron|PRDM16_uc001ake.2_Intron|PRDM16_uc009vlh.2_Intron	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1						brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		tcattcatctatccatccatccatccat	0.000			T	EVI1	MDS|AML								7	4	---	---	---	---	
CAMTA1	23261	broad.mit.edu	37	1	6855416	6855416	+	Intron	DEL	T	-	-	rs35720197		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6855416delT	uc001aoi.2	+						CAMTA1_uc001aoh.2_Intron	NM_015215	NP_056030	Q9Y6Y1	CMTA1_HUMAN	calmodulin-binding transcription activator 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	calmodulin binding			ovary(5)|central_nervous_system(2)|breast(1)|pancreas(1)	9	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		gctgcttaggttttttttttc	0.000													4	3	---	---	---	---	
MTOR	2475	broad.mit.edu	37	1	11266717	11266717	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11266717delC	uc001asd.2	-							NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated						cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						TAGGCCAAGTCCCCCATGTGG	0.333													4	2	---	---	---	---	
MFN2	9927	broad.mit.edu	37	1	12066218	12066219	+	Intron	INS	-	A	A	rs147025945	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12066218_12066219insA	uc001atn.3	+						MFN2_uc009vni.2_Intron	NM_014874	NP_055689	O95140	MFN2_HUMAN	mitofusin 2						blood coagulation|mitochondrial fusion|mitochondrial membrane organization|mitochondrion localization|negative regulation of Ras protein signal transduction|negative regulation of smooth muscle cell proliferation|protein targeting to mitochondrion	cytosol|integral to membrane|intrinsic to mitochondrial outer membrane	GTP binding|GTPase activity|ubiquitin protein ligase binding			ovary(1)	1	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		taatacacattaaagtaagtat	0.188													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	12975322	12975323	+	IGR	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12975322_12975323delTT								PRAMEF10 (17228 upstream) : PRAMEF8 (1127 downstream)																							tctctctctctttctttctttc	0.188													4	5	---	---	---	---	
PRDM2	7799	broad.mit.edu	37	1	14120331	14120332	+	Intron	INS	-	A	A	rs80100440		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14120331_14120332insA	uc001avi.2	+						PRDM2_uc001avg.2_Intron|PRDM2_uc009voe.2_Intron|PRDM2_uc009vof.2_Intron	NM_012231	NP_036363	Q13029	PRDM2_HUMAN	retinoblastoma protein-binding zinc finger							Golgi apparatus|nucleus	DNA binding|histone-lysine N-methyltransferase activity|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)	1	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		aaagatatcgcaaaaaaaaaag	0.054													4	3	---	---	---	---	
KAZ	23254	broad.mit.edu	37	1	15199434	15199435	+	Intron	INS	-	GATG	GATG	rs143254162	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:15199434_15199435insGATG	uc001avm.3	+						KAZ_uc009vog.1_Intron|KAZ_uc010obj.1_Intron	NM_201628	NP_963922	Q674X7	KAZRN_HUMAN	kazrin isoform E						keratinization	cornified envelope|cytoplasm|desmosome|nucleus					0						atggatggatagatggatggat	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16515904	16515904	+	IGR	DEL	G	-	-	rs35201497		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16515904delG								EPHA2 (33340 upstream) : ARHGEF19 (8695 downstream)																							AATACAATCTGGGGGGAGACA	0.363													5	3	---	---	---	---	
C1orf144	26099	broad.mit.edu	37	1	16697945	16697945	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16697945delT	uc001aym.3	+						C1orf144_uc010ocb.1_Intron|C1orf144_uc001ayi.3_Intron|C1orf144_uc001ayk.3_Intron	NM_001114600	NP_001108072	Q7Z422	CA144_HUMAN	putative MAPK activating protein PM20,PM21												0		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00475)|all_lung(284;0.00671)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(227;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;4.12e-05)|Kidney(64;0.00018)|KIRC - Kidney renal clear cell carcinoma(64;0.00267)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0649)		ttttttttccttttttttttt	0.035													4	2	---	---	---	---	
SPATA21	374955	broad.mit.edu	37	1	16764545	16764545	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16764545delA	uc001ayn.2	-						NECAP2_uc001ayp.3_5'Flank|NECAP2_uc001ayo.2_5'Flank|NECAP2_uc010ocd.1_5'Flank|NECAP2_uc001ayq.2_5'Flank|SPATA21_uc001ayl.1_5'Flank|SPATA21_uc010occ.1_5'Flank	NM_198546	NP_940948	Q7Z572	SPT21_HUMAN	spermatogenesis associated 21								calcium ion binding			ovary(2)|breast(1)	3		Colorectal(325;0.000147)|Renal(390;0.00145)|Lung NSC(340;0.00215)|Breast(348;0.00224)|all_lung(284;0.00351)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(227;1.15e-05)|BRCA - Breast invasive adenocarcinoma(304;4.2e-05)|Kidney(64;0.000183)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(313;0.0122)|READ - Rectum adenocarcinoma(331;0.0651)		acttagtctcaaaaaaaaaaa	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	16858336	16858337	+	IGR	INS	-	AA	AA			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16858336_16858337insAA								CROCCL2 (39140 upstream) : NBPF1 (32075 downstream)																							ccaccagcaacaaaaaagcaaa	0.000													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16911110	16911112	+	Intron	DEL	TTC	-	-	rs68047686		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16911110_16911112delTTC	uc009vos.1	-						NBPF1_uc009vot.1_Intron|NBPF1_uc001ayz.1_Intron|NBPF1_uc010oce.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		CTGCTTCttattcttatttttat	0.251													4	2	---	---	---	---	
CROCCL1	84809	broad.mit.edu	37	1	16947282	16947282	+	Intron	DEL	C	-	-	rs5772695		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16947282delC	uc010ocf.1	-						CROCCL1_uc009vov.1_Intron|CROCCL1_uc001aze.2_Intron|CROCCL1_uc001azf.2_Intron					Homo sapiens mRNA for FLJ00313 protein.												0						CAGCAGTTGTCCCTAGCAACT	0.438													9	4	---	---	---	---	
PADI1	29943	broad.mit.edu	37	1	17555559	17555559	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17555559delC	uc001bah.1	+							NM_013358	NP_037490	Q9ULC6	PADI1_HUMAN	peptidylarginine deiminase type I						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm	calcium ion binding|protein-arginine deiminase activity				0		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	GAGGCTCCCTCCCTCCAGCCC	0.632													6	5	---	---	---	---	
PADI6	353238	broad.mit.edu	37	1	17699385	17699386	+	Intron	INS	-	AA	AA	rs142613833	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17699385_17699386insAA	uc001bak.1	+							NM_207421	NP_997304	Q6TGC4	PADI6_HUMAN	peptidylarginine deiminase type 6						peptidyl-citrulline biosynthetic process from peptidyl-arginine	cytoplasm|nucleus	calcium ion binding|protein-arginine deiminase activity			breast(1)	1		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	AGCAAACACAGGGGTCCTTTGG	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	17778018	17778018	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17778018delG								RCC2 (11798 upstream) : ARHGEF10L (88312 downstream)																							tgggattacaggtgtgagcca	0.144													4	2	---	---	---	---	
IGSF21	84966	broad.mit.edu	37	1	18476903	18476903	+	Intron	DEL	G	-	-	rs34970358		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18476903delG	uc001bau.1	+							NM_032880	NP_116269	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21 precursor							extracellular region				ovary(2)|large_intestine(1)|skin(1)	4		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		ttggcaTGGCGGGGGGGGTCT	0.284													3	5	---	---	---	---	
PAX7	5081	broad.mit.edu	37	1	18972147	18972148	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:18972147_18972148delGT	uc001bay.2	+						PAX7_uc001baz.2_Intron|PAX7_uc010oct.1_Intron	NM_002584	NP_002575	P23759	PAX7_HUMAN	paired box 7 isoform 1						anti-apoptosis	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX7/FOXO1(197)	soft_tissue(197)|lung(3)|prostate(1)|ovary(1)|breast(1)	203		Colorectal(325;3.46e-05)|all_lung(284;0.000439)|Renal(390;0.000518)|Lung NSC(340;0.000543)|Breast(348;0.00093)|Ovarian(437;0.00768)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00609)|BRCA - Breast invasive adenocarcinoma(304;4.71e-05)|Kidney(64;0.000279)|KIRC - Kidney renal clear cell carcinoma(64;0.00371)|STAD - Stomach adenocarcinoma(196;0.00658)|READ - Rectum adenocarcinoma(331;0.0576)		TTTGTGAGGCGTGTGTGTGTTT	0.520			T	FOXO1A	alveolar rhabdomyosarcoma								4	2	---	---	---	---	
CAPZB	832	broad.mit.edu	37	1	19677451	19677454	+	Intron	DEL	TTTT	-	-	rs10608370		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19677451_19677454delTTTT	uc010ocz.1	-						CAPZB_uc001bce.2_Intron|CAPZB_uc009vpk.2_Intron|CAPZB_uc001bcd.2_Intron|uc001bcf.1_5'Flank	NM_004930	NP_004921	P47756	CAPZB_HUMAN	F-actin capping protein beta subunit						actin cytoskeleton organization|actin filament capping|blood coagulation|cellular component movement	cytosol|F-actin capping protein complex|WASH complex	actin binding				0		Colorectal(325;3.93e-05)|Renal(390;0.000147)|all_lung(284;0.000169)|Lung NSC(340;0.000202)|Breast(348;0.000496)|Ovarian(437;0.00428)|Myeloproliferative disorder(586;0.0262)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Kidney(64;8.63e-06)|BRCA - Breast invasive adenocarcinoma(304;4.06e-05)|KIRC - Kidney renal clear cell carcinoma(64;0.000175)|GBM - Glioblastoma multiforme(114;0.000525)|STAD - Stomach adenocarcinoma(196;0.00779)|READ - Rectum adenocarcinoma(331;0.103)|Lung(427;0.173)		TGTAAAACAGTTTTTTGTTTCTAC	0.078													1	5	---	---	---	---	
TMCO4	255104	broad.mit.edu	37	1	20020389	20020389	+	Intron	DEL	G	-	-	rs1883566	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20020389delG	uc001bcn.2	-						TMCO4_uc001bcm.2_Intron|TMCO4_uc001bco.1_Intron|TMCO4_uc001bcp.1_Intron	NM_181719	NP_859070	Q5TGY1	TMCO4_HUMAN	transmembrane and coiled-coil domains 4							integral to membrane					0		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00519)|Breast(348;0.00526)|Lung NSC(340;0.00544)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00708)|COAD - Colon adenocarcinoma(152;2.28e-05)|BRCA - Breast invasive adenocarcinoma(304;5.8e-05)|Kidney(64;0.000367)|GBM - Glioblastoma multiforme(114;0.000377)|KIRC - Kidney renal clear cell carcinoma(64;0.00459)|STAD - Stomach adenocarcinoma(196;0.0072)|READ - Rectum adenocarcinoma(331;0.0862)|Lung(427;0.223)		AGCCCTGGGTGGGGGGGACTC	0.358													4	2	---	---	---	---	
EIF4G3	8672	broad.mit.edu	37	1	21233290	21233291	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21233290_21233291insA	uc001bec.2	-						EIF4G3_uc010odi.1_Intron|EIF4G3_uc010odj.1_Intron|EIF4G3_uc009vpz.2_Intron|EIF4G3_uc001bed.2_Intron|EIF4G3_uc001bef.2_Intron|EIF4G3_uc001bee.2_Intron	NM_003760	NP_003751	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4						interspecies interaction between organisms|regulation of translational initiation|RNA metabolic process	eukaryotic translation initiation factor 4F complex	protein binding|RNA cap binding|translation initiation factor activity			skin(1)	1		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ACTTAGTCCTTAAAAAAAACTG	0.307													4	2	---	---	---	---	
FUCA1	2517	broad.mit.edu	37	1	24175456	24175456	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24175456delT	uc001bie.2	-							NM_000147	NP_000138	P04066	FUCO_HUMAN	fucosidase, alpha-L-1, tissue precursor						fucose metabolic process|glycosaminoglycan catabolic process	lysosome	alpha-L-fucosidase activity|cation binding			breast(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		GCTGTTTTAAttttttttttt	0.184													4	2	---	---	---	---	
GPN2	54707	broad.mit.edu	37	1	27209335	27209335	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27209335delT	uc001bnd.1	-							NM_018066	NP_060536	Q9H9Y4	GPN2_HUMAN	ATP binding domain 1 family, member B								GTP binding				0						CCAGCTCTTGTCCCTTTCATC	0.522													4	2	---	---	---	---	
RPA2	6118	broad.mit.edu	37	1	28243617	28243618	+	5'Flank	INS	-	CTT	CTT	rs112146684		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28243617_28243618insCTT	uc001bpe.1	-						RPA2_uc001bpd.1_5'Flank|RPA2_uc010ofp.1_5'Flank	NM_002946	NP_002937	P15927	RFA2_HUMAN	replication protein A2, 32kDa						cell cycle checkpoint|DNA recombinase assembly|DNA strand elongation involved in DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA gap filling|regulation of double-strand break repair via homologous recombination|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	DNA replication factor A complex|PML body	protein phosphatase binding|single-stranded DNA binding			skin(1)	1		Colorectal(325;0.000147)|Renal(390;0.00357)|Lung NSC(340;0.00588)|all_lung(284;0.00645)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0545)|all_neural(195;0.0557)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0429)|OV - Ovarian serous cystadenocarcinoma(117;3.62e-24)|Colorectal(126;3.23e-08)|COAD - Colon adenocarcinoma(152;1.75e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00294)|STAD - Stomach adenocarcinoma(196;0.00308)|BRCA - Breast invasive adenocarcinoma(304;0.00613)|READ - Rectum adenocarcinoma(331;0.0649)		tcctcctcctgcttcttctcct	0.010								Direct_reversal_of_damage|NER					3	3	---	---	---	---	
OPRD1	4985	broad.mit.edu	37	1	29181170	29181170	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29181170delT	uc001brf.1	+							NM_000911	NP_000902	P41143	OPRD_HUMAN	opioid receptor, delta 1						immune response|protein import into nucleus, translocation	integral to plasma membrane	delta-opioid receptor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(325;3.46e-05)|Lung NSC(340;0.000947)|all_lung(284;0.00131)|Renal(390;0.00758)|Breast(348;0.00765)|all_neural(195;0.0199)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-07)|COAD - Colon adenocarcinoma(152;7.51e-06)|STAD - Stomach adenocarcinoma(196;0.00306)|BRCA - Breast invasive adenocarcinoma(304;0.0241)|READ - Rectum adenocarcinoma(331;0.0649)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)	Butorphanol(DB00611)|Codeine(DB00318)|Fentanyl(DB00813)|Hydrocodone(DB00956)|Hydromorphone(DB00327)|Loperamide(DB00836)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pimozide(DB01100)|Propoxyphene(DB00647)	GTGAGCCTGCttttttttttt	0.279													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	32339579	32339580	+	IGR	INS	-	A	A	rs113933814		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32339579_32339580insA								SPOCD1 (57999 upstream) : PTP4A2 (34213 downstream)																							gacaccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	34789507	34789508	+	IGR	INS	-	T	T	rs71029034		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34789507_34789508insT								C1orf94 (104778 upstream) : MIR552 (345692 downstream)																							tccttccttcctccttccttcc	0.025													4	3	---	---	---	---	
CDCA8	55143	broad.mit.edu	37	1	38167346	38167346	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38167346delA	uc001cbr.2	+						CDCA8_uc001cbs.2_Intron|CDCA8_uc010oih.1_Intron	NM_018101	NP_060571	Q53HL2	BOREA_HUMAN	cell division cycle associated 8						cell division|chromosome organization|mitotic metaphase|mitotic prometaphase	chromosome passenger complex|chromosome, centromeric region|cytosol|nucleolus|spindle	protein binding			central_nervous_system(1)	1		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				TTAATGCTTTAAAAAAAAAAA	0.318													8	8	---	---	---	---	
BMP8A	353500	broad.mit.edu	37	1	39991730	39991731	+	3'UTR	INS	-	GAGT	GAGT	rs144982119	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39991730_39991731insGAGT	uc001cdi.2	+	7					PPIEL_uc001cdj.1_5'Flank|PPIEL_uc001cdk.2_Intron	NM_181809	NP_861525	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8A precursor						cartilage development|cell differentiation|growth|ossification	extracellular space	cytokine activity|growth factor activity				0	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TGCACTGTCTGGAGTCAGCACA	0.589													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	40575916	40575917	+	IGR	DEL	AA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:40575916_40575917delAA								PPT1 (12774 upstream) : RLF (51124 downstream)																							gactctgtctaaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SCMH1	22955	broad.mit.edu	37	1	41533131	41533131	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41533131delA	uc001cgo.2	-						SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Intron|SCMH1_uc001cgr.2_Intron|SCMH1_uc001cgs.2_Intron|SCMH1_uc001cgt.2_Intron|SCMH1_uc001cgq.2_Intron|SCMH1_uc010ojs.1_Intron	NM_001031694	NP_001026864	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 1						anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				caacaacaacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PIK3R3	8503	broad.mit.edu	37	1	46614752	46614752	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46614752delG	uc010olw.1	-							NM_003629	NP_003620	Q92569	P55G_HUMAN	phosphoinositide-3-kinase, regulatory subunit 3						insulin receptor signaling pathway|platelet activation|T cell costimulation		1-phosphatidylinositol-3-kinase activity|protein binding				0	Acute lymphoblastic leukemia(166;0.155)					aatgacctctggtccctcact	0.000													4	2	---	---	---	---	
CMPK1	51727	broad.mit.edu	37	1	47803288	47803288	+	Intron	DEL	T	-	-	rs71884658		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47803288delT	uc001cri.2	+						CMPK1_uc010omp.1_Intron|CMPK1_uc010omq.1_Intron|CMPK1_uc001crh.2_Intron	NM_016308	NP_057392	P30085	KCY_HUMAN	UMP-CMP kinase 1 isoform a						nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)	GGAATATCTAttttttttttt	0.164													4	2	---	---	---	---	
CMPK1	51727	broad.mit.edu	37	1	47805373	47805374	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47805373_47805374insT	uc001cri.2	+						CMPK1_uc010omp.1_Intron|CMPK1_uc010omq.1_Intron|CMPK1_uc001crh.2_Intron	NM_016308	NP_057392	P30085	KCY_HUMAN	UMP-CMP kinase 1 isoform a						nucleobase, nucleoside and nucleotide interconversion	cytosol|nucleus	ATP binding|cytidylate kinase activity|nucleoside phosphate kinase activity|uridine kinase activity			ovary(1)	1					Gemcitabine(DB00441)	TCTTCCtttccttttttttttt	0.228													3	3	---	---	---	---	
AGBL4	84871	broad.mit.edu	37	1	49357102	49357102	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49357102delC	uc001cru.2	-						AGBL4_uc010omw.1_Intron|AGBL4_uc010omx.1_Intron|AGBL4_uc001crv.1_Intron|AGBL4_uc010omy.1_Intron	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4						C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		gtattttggaccaggcactag	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	51519592	51519592	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51519592delT								CDKN2C (79285 upstream) : C1orf185 (48314 downstream)																							actattgctctttagttttct	0.000													4	2	---	---	---	---	
FGGY	55277	broad.mit.edu	37	1	59796990	59796990	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59796990delA	uc001czi.3	+						FGGY_uc001czg.2_Intron|FGGY_uc001czh.2_Intron|FGGY_uc009wac.2_Intron|FGGY_uc001czj.3_Intron|FGGY_uc001czk.3_Intron|FGGY_uc001czl.3_Intron	NM_018291	NP_060761	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process|cell death|neuron homeostasis		kinase activity|phosphotransferase activity, alcohol group as acceptor			ovary(1)	1	all_cancers(7;7.36e-05)					CTACGTAGGTAAAGGATTAGG	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	64781720	64781720	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:64781720delT								UBE2U (71693 upstream) : CACHD1 (154756 downstream)																							TTAAACCTAATTTAAGCCTCC	0.448													4	2	---	---	---	---	
WLS	79971	broad.mit.edu	37	1	68572400	68572419	+	Intron	DEL	TGTGTGTGTGTGTGTGTGTG	-	-	rs113403859		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68572400_68572419delTGTGTGTGTGTGTGTGTGTG	uc001dee.2	-						uc001deb.1_Intron|uc001dec.1_Intron	NM_001002292	NP_001002292	Q5T9L3	WLS_HUMAN	G protein-coupled receptor 177 isoform 2						multicellular organismal development|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|Wnt receptor signaling pathway	cytoplasmic vesicle membrane|Golgi membrane|integral to membrane	signal transducer activity				0						TGTTTGTCACtgtgtgtgtgtgtgtgtgtgtgtgtgtgtg	0.427													3	3	---	---	---	---	
ACADM	34	broad.mit.edu	37	1	76195140	76195141	+	Intron	INS	-	T	T	rs143414020		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76195140_76195141insT	uc001dgw.3	+						ACADM_uc010orc.1_Intron|ACADM_uc010ord.1_Intron|ACADM_uc009wbp.2_Intron|ACADM_uc009wbr.2_Intron|ACADM_uc010ore.1_Intron|ACADM_uc010orf.1_Intron|ACADM_uc001dgx.3_Intron	NM_000016	NP_000007	P11310	ACADM_HUMAN	medium-chain acyl-CoA dehydrogenase isoform a						carnitine biosynthetic process|carnitine metabolic process, CoA-linked|fatty acid beta-oxidation using acyl-CoA dehydrogenase|medium-chain fatty acid catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|identical protein binding|medium-chain-acyl-CoA dehydrogenase activity			breast(2)|ovary(1)|skin(1)	4						AAGTTTCTGTGTTTTTTTTTTT	0.104													4	2	---	---	---	---	
ST6GALNAC3	256435	broad.mit.edu	37	1	76567921	76567922	+	Intron	DEL	TG	-	-	rs140522082		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76567921_76567922delTG	uc001dhh.2	+						ST6GALNAC3_uc001dhg.3_Intron|ST6GALNAC3_uc010orh.1_Intron	NM_152996	NP_694541	Q8NDV1	SIA7C_HUMAN	sialyltransferase 7C isoform 1						protein glycosylation	integral to Golgi membrane	sialyltransferase activity			ovary(3)|skin(2)	5						ctggtgtgtttgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	79215760	79215761	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:79215760_79215761insA								IFI44 (85999 upstream) : ELTD1 (139690 downstream)																							AACTCATGTGGAAAAAGAGGAT	0.455													43	22	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	80365608	80365608	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:80365608delC								ELTD1 (893113 upstream) : None (None downstream)																							CTTTGCAGTGCCAGCCCAGAT	0.448													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	82575002	82575002	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:82575002delC								LPHN2 (116896 upstream) : None (None downstream)																							tgtgtttccaccacctgaaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	84282869	84282870	+	Intron	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:84282869_84282870delCA	uc001diz.3	-						uc001dja.1_Intron					Homo sapiens cDNA clone IMAGE:4815396.																		cattcacacccacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	85108557	85108560	+	IGR	DEL	AGAA	-	-	rs149485105		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85108557_85108560delAGAA								C1orf180 (7854 upstream) : SSX2IP (1038 downstream)																							AATTTCACTTAGAAAGCCCTACAA	0.319													4	3	---	---	---	---	
DDAH1	23576	broad.mit.edu	37	1	85992847	85992848	+	Intron	DEL	CT	-	-	rs142998762		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85992847_85992848delCT	uc001dlc.2	-							NM_001134445	NP_001127917	O94760	DDAH1_HUMAN	dimethylarginine dimethylaminohydrolase 1						arginine catabolic process|citrulline metabolic process|nitric oxide mediated signal transduction		dimethylargininase activity|metal ion binding				0				all cancers(265;0.0318)|Epithelial(280;0.0657)	L-Citrulline(DB00155)	CTGCTGGAAACTCTGCCTCACT	0.421													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88025668	88025668	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88025668delA								LMO4 (211065 upstream) : None (None downstream)																							ccatctcaggaaaaaaaaaaa	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	88301655	88301655	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:88301655delA								LMO4 (487052 upstream) : PKN2 (848267 downstream)																							AAAAGTGGAGAAAAAAATAAT	0.289													4	2	---	---	---	---	
FNBP1L	54874	broad.mit.edu	37	1	93982601	93982601	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:93982601delT	uc001dpw.2	+						FNBP1L_uc001dpv.2_Intron	NM_001024948	NP_001020119	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like isoform 1						endocytosis	cell cortex|cytoplasmic membrane-bounded vesicle|cytoskeleton|plasma membrane	lipid binding				0		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		ttcctcttccttttttttttt	0.060													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94349977	94349977	+	IGR	DEL	T	-	-	rs113472371		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94349977delT								DNTTIP2 (5235 upstream) : GCLM (2613 downstream)																							CAGATACAGCttttttttttt	0.209													2	5	---	---	---	---	
ABCA4	24	broad.mit.edu	37	1	94491773	94491774	+	Intron	INS	-	C	C	rs146210738	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94491773_94491774insC	uc001dqh.2	-							NM_000350	NP_000341	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A member 4						phototransduction, visible light|visual perception	integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)|skin(4)|central_nervous_system(2)|upper_aerodigestive_tract(1)|breast(1)	12		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TTCTATCTCCTCCCCCTGTTTT	0.411											OREG0013609	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	95892375	95892375	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:95892375delA								RWDD3 (179602 upstream) : None (None downstream)																							ttgaTATTAGAATAACAAACT	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	113425285	113425286	+	IGR	INS	-	AGA	AGA	rs141871120	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113425285_113425286insAGA								FAM19A3 (155431 upstream) : SLC16A1 (29186 downstream)																							TGTCCCAGAGCAGGAAGAGGAA	0.550													2	4	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120570924	120570924	+	Intron	DEL	A	-	-	rs11357836		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120570924delA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAAGAGTTGCATAACAGAATA	0.368			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				7	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142583243	142583243	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142583243delC								None (None upstream) : None (None downstream)																							aaatctaaaacaagagagcaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142614233	142614233	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142614233delT								None (None upstream) : None (None downstream)																							tatctttccatttttttggtg	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142616671	142616672	+	5'Flank	INS	-	ACTACAAT	ACTACAAT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142616671_142616672insACTACAAT	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		gaacactaaaaacATGGTTAGT	0.248													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142651168	142651168	+	Intron	DEL	A	-	-	rs71582734		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142651168delA	uc001eiw.1	+						uc001eix.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		attcaataataaaaagcttaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143982423	143982423	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143982423delG	uc010oxm.1	+											SubName: Full=Novel protein similar to SLIT-ROBO Rho GTPase activating protein 2 SRGAP2; Flags: Fragment;																		AGAGCACTGAGGACTGCAAAG	0.542													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144527481	144527481	+	Intron	DEL	A	-	-	rs58060514		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144527481delA	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						caatccttccacctcagccta	0.000													4	3	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144529125	144529126	+	Intron	INS	-	TT	TT	rs57443720		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144529125_144529126insTT	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tactttatatatttttttgaga	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144533512	144533514	+	Intron	DEL	AAG	-	-	rs66523280		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144533512_144533514delAAG	uc010oxr.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						cgtatgtgaaaagaaccgttttt	0.172													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144825139	144825140	+	Intron	DEL	CT	-	-	rs33954645		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144825139_144825140delCT	uc009wig.1	+						NBPF9_uc010oxn.1_Intron|NBPF9_uc010oxo.1_Intron|NBPF9_uc010oxr.1_Intron|NBPF9_uc010oxt.1_Intron|NBPF9_uc001ekg.1_Intron|NBPF9_uc001ekk.1_Intron|NBPF10_uc009wir.2_Intron|NBPF9_uc010oyd.1_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc001eli.3_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|NBPF9_uc001elp.2_Intron	NM_001037675	NP_001032764	Q3BBV1	NBPFK_HUMAN	hypothetical protein LOC400818							cytoplasm					0						tcactttctcctctctctctct	0.371													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	144833040	144833046	+	Intron	DEL	AAAAAAT	-	-	rs28494534		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:144833040_144833046delAAAAAAT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elk.1_Intron|PDE4DIP_uc001ell.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|uc001els.1_5'Flank			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						caaaaaaaaaaaaaaataaaaataaaa	0.000													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145040064	145040064	+	Intron	DEL	T	-	-	rs3214745		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145040064delT	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_5'Flank|PDE4DIP_uc001eln.3_5'Flank|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001elx.3_5'Flank|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						ACACGCCCCCTGAACCACCCT	0.657													4	2	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145089529	145089530	+	Intron	DEL	CC	-	-	rs622980		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145089529_145089530delCC	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						aaaaaaaaaaccaaaaattagc	0.000													4	3	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145237179	145237179	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145237179delA	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGCCTTTATCAAAGACAATGT	0.348													10	5	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145740724	145740724	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145740724delA	uc001emp.3	+						PDZK1_uc001eon.1_Intron|PDZK1_uc001eoo.1_Intron|PDZK1_uc010oza.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TGGGAAAGGGAAGAGATTGGT	0.463													4	2	---	---	---	---	
BCL9	607	broad.mit.edu	37	1	147016176	147016179	+	Intron	DEL	CTCT	-	-	rs113842878		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:147016176_147016179delCTCT	uc001epq.2	+							NM_004326	NP_004317	O00512	BCL9_HUMAN	B-cell CLL/lymphoma 9						Wnt receptor signaling pathway	nucleus	protein binding			ovary(2)|large_intestine(2)|breast(1)|skin(1)	6	all_hematologic(923;0.115)					TTCTCCTTCCCTCTCTCACCATCC	0.480			T	IGH@|IGL@	B-ALL								3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148661794	148661794	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148661794delT								PPIAL4E (17001 upstream) : NBPF16 (77648 downstream)																							TTAAAAGATGTTTTATACAAC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148898510	148898510	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148898510delG	uc009wkv.1	+											Homo sapiens cDNA, FLJ17483.																		tttaccccatgttttttttat	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149061807	149061807	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149061807delT								LOC645166 (108753 upstream) : LOC388692 (217669 downstream)																							GAAAGTTGAGTTTAGTCCCCC	0.318													4	2	---	---	---	---	
SF3B4	10262	broad.mit.edu	37	1	149899306	149899306	+	Intron	DEL	A	-	-	rs75973795		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149899306delA	uc001etj.1	-						SF3B4_uc001eti.1_5'Flank|SF3B4_uc001etk.1_Intron|SF3B4_uc009wll.1_Intron	NM_005850	NP_005841	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4							nucleoplasm|U12-type spliceosomal complex	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			GGACAGGAGCAAAAAAAAAAG	0.443													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	150538521	150538525	+	IGR	DEL	TTTTG	-	-	rs71668531		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150538521_150538525delTTTTG								ADAMTSL4 (5111 upstream) : MCL1 (8512 downstream)																							TTGAATAGTTttttgttttgttttg	0.161													4	2	---	---	---	---	
ARNT	405	broad.mit.edu	37	1	150831265	150831265	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150831265delT	uc001evr.1	-						ARNT_uc001evs.1_Intron|ARNT_uc009wmb.1_Intron|ARNT_uc009wmc.1_Intron|ARNT_uc009wmd.1_Intron|ARNT_uc009wme.1_Intron|ARNT_uc010pcl.1_Intron	NM_001668	NP_001659	P27540	ARNT_HUMAN	aryl hydrocarbon receptor nuclear translocator						positive regulation of hormone biosynthetic process|positive regulation vascular endothelial growth factor production|regulation of transcription from RNA polymerase II promoter in response to oxidative stress|response to hypoxia		aryl hydrocarbon receptor binding|protein heterodimerization activity|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription coactivator activity			skin(4)|lung(3)|central_nervous_system(1)|kidney(1)	9	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.02)|BRCA - Breast invasive adenocarcinoma(12;0.00606)|LUSC - Lung squamous cell carcinoma(543;0.211)			acccagttaattttttttttt	0.000			T	ETV6	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152169856	152169859	+	IGR	DEL	TCTT	-	-	rs138883689		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152169856_152169859delTCTT								RPTN (38152 upstream) : HRNR (14699 downstream)																							ctctttcctctctttctttcttct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	153470379	153470380	+	IGR	INS	-	TT	TT	rs73020485	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153470379_153470380insTT								S100A7 (37242 upstream) : S100A6 (36696 downstream)																							TCATGCCACACttttttttttt	0.094													4	2	---	---	---	---	
NUP210L	91181	broad.mit.edu	37	1	153969325	153969327	+	Intron	DEL	TTT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153969325_153969327delTTT	uc001fdw.2	-						NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Intron	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TAGACTTGCCTtttttttttttt	0.192													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154265991	154265992	+	IGR	INS	-	AT	AT	rs140076178	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154265991_154265992insAT								HAX1 (17642 upstream) : AQP10 (27600 downstream)																							cacacacacacacacacacaca	0.272													5	4	---	---	---	---	
CLK2	1196	broad.mit.edu	37	1	155234828	155234831	+	Intron	DEL	TAGT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155234828_155234831delTAGT	uc001fjy.2	-						RAG1AP1_uc010pey.1_Intron|SCAMP3_uc001fjs.2_5'Flank|SCAMP3_uc001fju.2_5'Flank|SCAMP3_uc001fjv.2_5'Flank|SCAMP3_uc001fjt.2_5'Flank|CLK2_uc001fjw.2_Intron|CLK2_uc001fjx.2_Intron|CLK2_uc009wqm.2_Intron	NM_003993	NP_003984	P49760	CLK2_HUMAN	CDC-like kinase 2							nucleus	ATP binding|protein serine/threonine kinase activity|protein tyrosine kinase activity				0	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GCCAGATATATAGTTATTCTGAAA	0.333								Other_conserved_DNA_damage_response_genes					3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	155559172	155559173	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155559172_155559173insT								LOC645676 (25440 upstream) : MSTO1 (20834 downstream)																							AAGTTTTGGTGTTTTTTTTTTT	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	157693960	157693960	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157693960delA								FCRL3 (23185 upstream) : FCRL2 (21563 downstream)																							ctccatctccaaaaaaaaaaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	158068553	158068553	+	3'UTR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158068553delA	uc001frp.2	+	1										SubName: Full=HCG1995134; SubName: Full=cDNA FLJ33235 fis, clone ASTRO2002202;																		GCTTGGAATGAAAACATCTGA	0.493													4	2	---	---	---	---	
MNDA	4332	broad.mit.edu	37	1	158800962	158800962	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158800962delA	uc001fsz.1	+							NM_002432	NP_002423	P41218	MNDA_HUMAN	myeloid cell nuclear differentiation antigen						B cell receptor signaling pathway|cellular defense response|negative regulation of B cell proliferation|positive regulation of apoptosis|regulation of transcription, DNA-dependent|response to DNA damage stimulus|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding			ovary(2)|skin(2)	4	all_hematologic(112;0.0378)					TTTGTAAGTCAAAAAAGCGAA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	161942588	161942588	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161942588delC								ATF6 (9628 upstream) : OLFML2B (10396 downstream)																							TAGGGTCTTTCGGGGGCAGAG	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	164413455	164413456	+	IGR	DEL	AC	-	-	rs140932873		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164413455_164413456delAC								None (None upstream) : PBX1 (115346 downstream)																							GTAGTAGTATacacacacacac	0.104													5	4	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164791260	164791260	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164791260delA	uc001gct.2	+						PBX1_uc010pku.1_Intron|PBX1_uc010pkv.1_Intron|PBX1_uc001gcs.2_Intron|PBX1_uc010pkw.1_Intron	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1						negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						CTGTGGTCTGAAAAAAAAAAT	0.438			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								4	2	---	---	---	---	
DCAF6	55827	broad.mit.edu	37	1	167978584	167978595	+	Intron	DEL	CCTTCCTTCCTT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167978584_167978595delCCTTCCTTCCTT	uc001gew.2	+						DCAF6_uc001gev.2_Intron|DCAF6_uc001gex.2_Intron|DCAF6_uc010plk.1_Intron|DCAF6_uc001gey.2_Intron	NM_001017977	NP_001017977	Q58WW2	DCAF6_HUMAN	IQ motif and WD repeats 1 isoform b						positive regulation of transcription from RNA polymerase II promoter	CUL4 RING ubiquitin ligase complex|nucleus	ligand-dependent nuclear receptor transcription coactivator activity			ovary(1)|central_nervous_system(1)|skin(1)	3						ttccttcctcccttccttccttccttccttcc	0.000													5	3	---	---	---	---	
F5	2153	broad.mit.edu	37	1	169526261	169526262	+	Intron	INS	-	A	A	rs148401141	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169526261_169526262insA	uc001ggg.1	-						F5_uc010plr.1_Intron	NM_000130	NP_000121	P12259	FA5_HUMAN	coagulation factor V precursor						cell adhesion|platelet activation|platelet degranulation	plasma membrane|platelet alpha granule lumen	copper ion binding|oxidoreductase activity			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	all_hematologic(923;0.208)				Drotrecogin alfa(DB00055)	ttgtgccctgcaaaagcagaca	0.050													4	7	---	---	---	---	
C1orf129	80133	broad.mit.edu	37	1	170925737	170925737	+	Intron	DEL	T	-	-	rs67916022		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170925737delT	uc001ghg.2	+						C1orf129_uc009wvy.2_Intron|C1orf129_uc010plz.1_Intron	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2								binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					tttttttttgttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	172977449	172977449	+	IGR	DEL	G	-	-	rs34343483		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:172977449delG								FASLG (341439 upstream) : TNFSF18 (32911 downstream)																							gctttctactgaggaatccac	0.000													3	3	---	---	---	---	
TNN	63923	broad.mit.edu	37	1	175103989	175103989	+	Intron	DEL	T	-	-	rs11345549		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:175103989delT	uc001gkl.1	+							NM_022093	NP_071376	Q9UQP3	TENN_HUMAN	tenascin N precursor						cell growth|cell migration|signal transduction	extracellular space|proteinaceous extracellular matrix				large_intestine(5)|ovary(3)|central_nervous_system(1)	9		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ctcttgcccctgaccagtcca	0.000													4	3	---	---	---	---	
PAPPA2	60676	broad.mit.edu	37	1	176729954	176729954	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176729954delT	uc001gkz.2	+						PAPPA2_uc009www.2_Intron	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1						cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TTTGtttttgttttttttgtt	0.184													4	2	---	---	---	---	
SOAT1	6646	broad.mit.edu	37	1	179313777	179313777	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:179313777delG	uc001gml.2	+						SOAT1_uc010pni.1_Intron|SOAT1_uc001gmm.2_Intron|SOAT1_uc010pnj.1_Intron|SOAT1_uc010pnk.1_Intron	NM_003101	NP_003092	P35610	SOAT1_HUMAN	sterol O-acyltransferase 1						cholesterol efflux|cholesterol esterification|cholesterol homeostasis|cholesterol metabolic process|cholesterol storage|macrophage derived foam cell differentiation|positive regulation of amyloid precursor protein biosynthetic process|very-low-density lipoprotein particle assembly	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol binding|cholesterol O-acyltransferase activity|fatty-acyl-CoA binding			central_nervous_system(1)|skin(1)	2					Ezetimibe(DB00973)|Hesperetin(DB01094)	ccaaagtgctgggattacaag	0.124													4	2	---	---	---	---	
RGL1	23179	broad.mit.edu	37	1	183691363	183691364	+	Intron	INS	-	AA	AA	rs79769872		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183691363_183691364insAA	uc001gqm.2	+						RGL1_uc010pof.1_Intron|RGL1_uc010pog.1_Intron|RGL1_uc010poh.1_Intron	NM_015149	NP_055964	Q9NZL6	RGL1_HUMAN	ral guanine nucleotide dissociation						cellular lipid metabolic process|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular	protein binding|Ral guanyl-nucleotide exchange factor activity			breast(5)|ovary(4)|lung(2)	11						AGTCTGGGACCAAAAAAaaaaa	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	193891551	193891552	+	IGR	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:193891551_193891552delGT								CDC73 (667611 upstream) : None (None downstream)																							TAAAATGTGCGTGTGTGTGTGT	0.223													5	3	---	---	---	---	
CRB1	23418	broad.mit.edu	37	1	197410789	197410790	+	Intron	INS	-	T	T	rs71933700		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197410789_197410790insT	uc001gtz.2	+						CRB1_uc010poz.1_Intron|CRB1_uc010ppa.1_Intron|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Intron|CRB1_uc010ppd.1_Intron|CRB1_uc001gub.1_3'UTR	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor						cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						ttccctccttcttttttttttt	0.272													6	4	---	---	---	---	
NR5A2	2494	broad.mit.edu	37	1	200022698	200022699	+	Intron	DEL	CA	-	-	rs113229960	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200022698_200022699delCA	uc001gvb.2	+						NR5A2_uc001gvc.2_Intron|NR5A2_uc009wzh.2_Intron|NR5A2_uc010pph.1_Intron	NM_205860	NP_995582	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2						embryo development|positive regulation of viral genome replication|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cytoplasm|nucleoplasm	lipid binding|protein binding|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|steroid hormone receptor activity|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2	Prostate(682;0.19)					CATGcacacgcacacacacaca	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200500148	200500149	+	IGR	INS	-	TG	TG	rs56229841	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200500148_200500149insTG								ZNF281 (120982 upstream) : KIF14 (20476 downstream)																							TTGTGCCTGCATGTGTGTGTGT	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	200644822	200644824	+	IGR	DEL	TTC	-	-	rs67169534		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:200644822_200644824delTTC								DDX59 (5696 upstream) : CAMSAP1L1 (63862 downstream)																							AGGTCAATAGTTCTTCTTGATAG	0.222													4	2	---	---	---	---	
RPS10P7	376693	broad.mit.edu	37	1	201492016	201492016	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201492016delT	uc009wzz.1	+											Homo sapiens cDNA FLJ31028 fis, clone HLUNG2000570, weakly similar to 40S RIBOSOMAL PROTEIN S10.												0						tcccacctcatttttttggat	0.025													2	4	---	---	---	---	
PPFIA4	8497	broad.mit.edu	37	1	203018583	203018583	+	5'Flank	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203018583delC	uc001gyz.2	+						PPFIA4_uc009xaj.2_Intron|PPFIA4_uc010pqf.1_Intron|PPFIA4_uc001gza.2_5'Flank	NM_015053	NP_055868	O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f						cell communication	cell surface|cytoplasm	protein binding			ovary(4)|skin(1)	5						CCCCTCCTGGCCCTGCCCCTG	0.632													4	2	---	---	---	---	
SRGAP2	23380	broad.mit.edu	37	1	206559013	206559014	+	Intron	INS	-	A	A	rs143346842		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:206559013_206559014insA	uc001hdy.2	+						SRGAP2_uc009xbt.2_Intron|SRGAP2_uc010prt.1_Intron|SRGAP2_uc001hdx.2_Intron|SRGAP2_uc010pru.1_Intron|SRGAP2_uc010prv.1_Intron	NM_015326	NP_056141	O75044	FNBP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2						axon guidance|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding				0	Breast(84;0.137)					TGCTGTGCTTTAAAAAAAAAAA	0.446													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	208450679	208450679	+	IGR	DEL	A	-	-	rs67068293		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:208450679delA								PLXNA2 (33014 upstream) : None (None downstream)																							AGCAAACTGGAAAAAAAAAAA	0.438													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	209026951	209026951	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209026951delT								PLXNA2 (609286 upstream) : LOC642587 (575217 downstream)																							AAAATTTAACttttttttttt	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	210351657	210351657	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:210351657delG								SYT14 (14026 upstream) : C1orf133 (53147 downstream)																							atataagttcgcaaatggtcc	0.000													4	3	---	---	---	---	
LPGAT1	9926	broad.mit.edu	37	1	211993327	211993327	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211993327delA	uc001hiu.2	-						LPGAT1_uc001hiv.2_Intron	NM_014873	NP_055688	Q92604	LGAT1_HUMAN	lysophosphatidylglycerol acyltransferase 1						phospholipid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	acyltransferase activity			ovary(1)|skin(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.00773)|all cancers(67;0.0765)|Epithelial(68;0.114)		actccgtctcaaaaaaaaaaa	0.239													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	214055225	214055225	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:214055225delC	uc001hkf.1	-											Homo sapiens cDNA FLJ34932 fis, clone NT2RP7005631.																		ataagatataccagagagcag	0.000													4	2	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	216363841	216363841	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216363841delT	uc001hku.1	-						USH2A_uc001hkv.2_Intron	NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGGAAAAGGGTTTTTTTTTTT	0.338										HNSCC(13;0.011)			3	3	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	216742453	216742454	+	Intron	INS	-	GAAG	GAAG	rs56064287		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216742453_216742454insGAAG	uc001hkw.1	-						ESRRG_uc001hky.1_Intron|ESRRG_uc009xdp.1_Intron|ESRRG_uc001hkz.1_Intron|ESRRG_uc010puc.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron|ESRRG_uc001hkx.1_Intron|ESRRG_uc009xdo.1_Intron|ESRRG_uc001hle.1_Intron	NM_001438	NP_001429	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 1						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	gaaggaaggaagaaggaaggaa	0.000													5	3	---	---	---	---	
ESRRG	2104	broad.mit.edu	37	1	217167807	217167808	+	Intron	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217167807_217167808delAC	uc010puc.1	-						ESRRG_uc001hkz.1_Intron|ESRRG_uc001hla.1_Intron|ESRRG_uc001hlb.1_Intron|ESRRG_uc010pud.1_Intron|ESRRG_uc001hlc.1_Intron|ESRRG_uc001hld.1_Intron	NM_206595	NP_996318	P62508	ERR3_HUMAN	estrogen-related receptor gamma isoform 2						positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	nucleoplasm	AF-2 domain binding|retinoic acid receptor activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|kidney(1)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	ATGTGTGTAAacacacacacac	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	217495486	217495486	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:217495486delA								ESRRG (184389 upstream) : GPATCH2 (108348 downstream)																							TTGCTACATTAAAAAAAAAAA	0.378													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	224211687	224211687	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224211687delA								TP53BP2 (178013 upstream) : FBXO28 (90104 downstream)																							AGTTTGCTTGAAAAAAAAAAA	0.234													4	2	---	---	---	---	
CNIH3	149111	broad.mit.edu	37	1	224826661	224826661	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:224826661delC	uc001hos.1	+							NM_152495	NP_689708	Q8TBE1	CNIH3_HUMAN	cornichon homolog 3						intracellular signal transduction|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|dendritic shaft|postsynaptic membrane					0	Breast(184;0.218)			GBM - Glioblastoma multiforme(131;0.073)		TTCTTACCTGCCAGTTTCCCT	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	225894271	225894272	+	Intron	INS	-	A	A	rs79788385		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225894271_225894272insA	uc001hpe.1	+											Homo sapiens cDNA FLJ42062 fis, clone SYNOV2005673.																		gaccctgtatcaaaaaaaaaaa	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	236489713	236489721	+	IGR	DEL	AACAACAAC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236489713_236489721delAACAACAAC								ERO1LB (44374 upstream) : EDARADD (67959 downstream)																							atctAaacaaaacaacaacaacaacaaca	0.000													3	4	---	---	---	---	
LOC100130331	100130331	broad.mit.edu	37	1	238060490	238060491	+	Intron	DEL	TA	-	-	rs146476501		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238060490_238060491delTA	uc010pyc.1	+							NR_027247				Homo sapiens mRNA; cDNA DKFZp434B2115 (from clone DKFZp434B2115).												0						tccctttgtgtatatatatctc	0.000													2	4	---	---	---	---	
EXO1	9156	broad.mit.edu	37	1	242047975	242047976	+	Intron	INS	-	CA	CA	rs150808310	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:242047975_242047976insCA	uc001hzh.2	+						EXO1_uc001hzi.2_Intron|EXO1_uc001hzj.2_Intron|EXO1_uc009xgq.2_Intron	NM_130398	NP_569082	Q9UQ84	EXO1_HUMAN	exonuclease 1 isoform b						meiosis|mismatch repair	nucleus	double-stranded DNA specific 5'-3' exodeoxyribonuclease activity|flap endonuclease activity|metal ion binding|protein binding|protein binding|ribonuclease H activity|single-stranded DNA specific 5'-3' exodeoxyribonuclease activity			ovary(2)|lung(2)|skin(1)	5	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			gtgtgtgtgtgtgtgCACGTGC	0.252								Direct_reversal_of_damage|Editing_and_processing_nucleases					5	3	---	---	---	---	
TSSC1	7260	broad.mit.edu	37	2	3282573	3282573	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3282573delA	uc002qxj.2	-						TSSC1_uc002qxi.2_Intron	NM_003310	NP_003301	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1								protein binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GCAACCCCATAACTGGCAACC	0.617													4	2	---	---	---	---	
RNF144A	9781	broad.mit.edu	37	2	7127497	7127498	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:7127497_7127498delGT	uc002qys.2	+						RNF144A_uc002qyt.2_Intron	NM_014746	NP_055561	P50876	R144A_HUMAN	ring finger protein 144							Golgi apparatus|integral to membrane	ligase activity|zinc ion binding			ovary(1)|kidney(1)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;0.226)		OV - Ovarian serous cystadenocarcinoma(76;0.195)		GGTTTCTGGGGTGTGTGTGTGT	0.574													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8787864	8787865	+	IGR	INS	-	AG	AG	rs141570112	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8787864_8787865insAG								LOC339788 (670887 upstream) : ID2 (31475 downstream)																							gggtagaggacagaggatggaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	20316428	20316429	+	IGR	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:20316428_20316429delCA								LAPTM4A (64639 upstream) : SDC1 (84129 downstream)																							cacatacatgcacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	26514799	26514799	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26514799delA								HADHB (1467 upstream) : GPR113 (16242 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
OTOF	9381	broad.mit.edu	37	2	26697491	26697491	+	Frame_Shift_Del	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:26697491delC	uc002rhk.2	-	26	3305	c.3178delG	c.(3178-3180)GCAfs	p.A1060fs	OTOF_uc010yla.1_5'Flank|OTOF_uc002rhh.2_Frame_Shift_Del_p.A313fs|OTOF_uc002rhi.2_Frame_Shift_Del_p.A370fs|OTOF_uc002rhj.2_Frame_Shift_Del_p.A313fs	NM_194248	NP_919224	Q9HC10	OTOF_HUMAN	otoferlin isoform a	1060	Cytoplasmic (Potential).				cellular membrane fusion|sensory perception of sound|synaptic vesicle exocytosis	basolateral plasma membrane|cell junction|cytosol|endoplasmic reticulum membrane|integral to membrane|membrane fraction|synaptic vesicle membrane	calcium ion binding			ovary(3)|breast(2)|central_nervous_system(1)|pancreas(1)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCCTCGTCTGCCATCTTCACC	0.587													10	23	---	---	---	---	
PLB1	151056	broad.mit.edu	37	2	28835477	28835477	+	Intron	DEL	T	-	-	rs71403613		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28835477delT	uc002rmb.1	+						PLB1_uc010ezj.1_Intron|PLB1_uc002rme.1_Intron|PLB1_uc002rmf.1_Intron	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor						lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					TGGttttcccttttttttttt	0.214													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	31103856	31103856	+	IGR	DEL	C	-	-	rs112023559		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31103856delC								CAPN13 (73545 upstream) : GALNT14 (29478 downstream)																							AGATAAGGGACCCCCACAGGG	0.537													1	5	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33367307	33367308	+	Intron	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33367307_33367308delAG	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				tattttcagtagagatggggtt	0.000													4	2	---	---	---	---	
ACYP2	98	broad.mit.edu	37	2	54428245	54428246	+	Intron	INS	-	T	T	rs74677387		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54428245_54428246insT	uc002rxq.3	+							NM_138448	NP_612457	P14621	ACYP2_HUMAN	acylphosphatase 2						phosphate metabolic process		acylphosphatase activity				0						ttctctctctcttttttttttt	0.000													4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54731613	54731614	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54731613_54731614insA	uc002rxu.2	+						SPTBN1_uc002rxv.1_Intron	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			aaatatttgggaaaaaaaatcc	0.069													4	2	---	---	---	---	
C2orf63	130162	broad.mit.edu	37	2	55425734	55425734	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55425734delC	uc002ryi.2	-						C2orf63_uc002ryh.2_Intron|C2orf63_uc002ryj.2_Intron	NM_152385	NP_689598	Q8NHS4	CB063_HUMAN	hypothetical protein LOC130162 isoform 1								binding			ovary(2)|central_nervous_system(1)	3			LUSC - Lung squamous cell carcinoma(58;0.179)|Lung(47;0.189)			aaatccaaaacaaaaaaaagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	60400573	60400573	+	IGR	DEL	A	-	-	rs76593672		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60400573delA								None (None upstream) : BCL11A (277730 downstream)																							tatctttaggaaaaaaaaaaa	0.005													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	62625124	62625125	+	IGR	INS	-	T	T	rs146896231		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62625124_62625125insT								B3GNT2 (173260 upstream) : TMEM17 (102231 downstream)																							Tttttaaatggttttttttttt	0.020													4	2	---	---	---	---	
EHBP1	23301	broad.mit.edu	37	2	63090417	63090420	+	Intron	DEL	CACA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:63090417_63090420delCACA	uc002sby.2	+						EHBP1_uc010fcp.2_Intron|EHBP1_uc002sbx.2_Intron|EHBP1_uc002sbz.2_Intron|EHBP1_uc002scb.2_Intron	NM_015252	NP_056067	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1 isoform 1							cytoplasm|membrane				ovary(1)|breast(1)	2	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			gagactccgtcACACACACACACA	0.069									Hereditary_Prostate_Cancer				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	67846932	67846934	+	IGR	DEL	AAG	-	-	rs75097123		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:67846932_67846934delAAG								ETAA1 (209399 upstream) : C1D (422399 downstream)																							gaccagagaaaagaagagatgtt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	69058550	69058550	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:69058550delT								ARHGAP25 (4602 upstream) : BMP10 (34063 downstream)																							ATTGATGTCCTTTCAGTCCTG	0.468													4	2	---	---	---	---	
ZNF638	27332	broad.mit.edu	37	2	71628478	71628478	+	Intron	DEL	A	-	-	rs11297984		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71628478delA	uc002shx.2	+						ZNF638_uc010yqw.1_Intron|ZNF638_uc002shy.2_Intron|ZNF638_uc002shz.2_Intron|ZNF638_uc002sia.2_Intron|ZNF638_uc002sib.1_Intron|ZNF638_uc010fed.2_Intron|ZNF638_uc002sic.2_Intron	NM_014497	NP_055312	Q14966	ZN638_HUMAN	zinc finger protein 638						RNA splicing	cytoplasm|nuclear speck	double-stranded DNA binding|nucleotide binding|RNA binding|zinc ion binding			pancreas(2)|ovary(1)|skin(1)	4						GGCAGAAAACAAAAGTGCTTA	0.353													3	5	---	---	---	---	
DNAH6	1768	broad.mit.edu	37	2	84958695	84958695	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84958695delT	uc010fgb.2	+						DNAH6_uc002sot.2_Intron	NM_001370	NP_001361	Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy polypeptide 6						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|ATPase activity|microtubule motor activity			central_nervous_system(1)	1						ggcttggaggtttttcctgag	0.000													4	2	---	---	---	---	
RMND5A	64795	broad.mit.edu	37	2	87614184	87614185	+	Intron	INS	-	T	T	rs143929453		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:87614184_87614185insT	uc002srs.3	+						uc002ssi.1_5'Flank			Q9H871	RMD5A_HUMAN	SubName: Full=cDNA FLJ10361 fis, clone NT2RM2001256, highly similar to Anaphase-promoting complex subunit 1;											ovary(1)|skin(1)	2						CTCtctctctcttttttttttt	0.188													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91660726	91660726	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91660726delA								None (None upstream) : LOC654342 (144466 downstream)																							ctcttttaacaaaataacata	0.149													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91784574	91784579	+	IGR	DEL	TTAACT	-	-	rs67885824		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91784574_91784579delTTAACT								None (None upstream) : LOC654342 (20613 downstream)																							acttaatacattaactttaaatcccg	0.073													5	3	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91849866	91849867	+	5'Flank	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91849866_91849867insC	uc002sts.3	-						LOC654342_uc002stt.2_5'Flank|LOC654342_uc010yub.1_5'Flank					Homo sapiens cDNA clone IMAGE:4801360.												0						agtttttttttttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	91898830	91898830	+	IGR	DEL	G	-	-	rs151199858		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91898830delG								LOC654342 (50855 upstream) : GGT8P (64538 downstream)																							acctgtctcagaaaaaaaaaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92035731	92035731	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92035731delA								GGT8P (65578 upstream) : FKSG73 (93428 downstream)																							gggcgacagGAAAAAAAAAAA	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92241904	92241905	+	IGR	INS	-	AC	AC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92241904_92241905insAC								FKSG73 (111410 upstream) : None (None downstream)																							ttctctttctttctttctttct	0.000													11	6	---	---	---	---	
ANKRD20B	729171	broad.mit.edu	37	2	95479106	95479106	+	3'UTR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95479106delA	uc010fhq.1	-	2					ANKRD20B_uc010fhp.2_Intron	NM_001012421	NP_001012421			ankyrin repeat domain 20 family, member A2												0						GCTACAGAATAACTGTTGACA	0.284													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	95861900	95861900	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95861900delT								ZNF2 (11838 upstream) : PROM2 (78301 downstream)																							CCtttctctcttttttttttt	0.194													4	2	---	---	---	---	
FER1L5	90342	broad.mit.edu	37	2	97331343	97331343	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97331343delT	uc010fia.2	+							NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2							integral to membrane				ovary(1)	1						tttgttcatcttttttttttt	0.209													4	2	---	---	---	---	
ANKRD36	375248	broad.mit.edu	37	2	97814479	97814479	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97814479delT	uc010yva.1	+						ANKRD36_uc010yuz.1_Intron|ANKRD36_uc010fic.2_Intron|ANKRD36_uc002sxo.2_Intron|ANKRD36_uc002sxp.3_Intron	NM_001164315	NP_001157787	A6QL64	AN36A_HUMAN	ankyrin repeat domain 36												0						GGGGGCTCCCTGTAGTGTTCT	0.269													4	2	---	---	---	---	
TSGA10	80705	broad.mit.edu	37	2	99696875	99696875	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99696875delG	uc002szg.3	-						TSGA10_uc002szh.3_Intron|TSGA10_uc002szi.3_Intron|TSGA10_uc010fin.1_Intron|TSGA10_uc010yvn.1_Intron	NM_182911	NP_878915	Q9BZW7	TSG10_HUMAN	testis specific, 10						spermatogenesis	cytoplasm|nuclear membrane				ovary(1)|central_nervous_system(1)	2						actcagtcctggatcctcttc	0.000													4	2	---	---	---	---	
MRPL30	51263	broad.mit.edu	37	2	99853675	99853675	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:99853675delC	uc002szl.1	+							NM_145213		Q8TCC3	RM30_HUMAN	Homo sapiens HSPC249 mRNA, complete cds.						translation	mitochondrion|ribosome	structural constituent of ribosome			ovary(1)	1						tgggacttgtcccagcagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	103204808	103204808	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:103204808delC								SLC9A4 (54378 upstream) : SLC9A2 (31358 downstream)																							CTCTGTTTCTCCCCTTGCCTG	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	106966260	106966261	+	IGR	DEL	AT	-	-	rs61614274		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:106966260_106966261delAT								UXS1 (155465 upstream) : PLGLA (36508 downstream)																							TTTGCAGGAGAtgtgtgtgtgt	0.292													2	4	---	---	---	---	
SH3RF3	344558	broad.mit.edu	37	2	109930355	109930356	+	Intron	INS	-	G	G	rs140145271	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109930355_109930356insG	uc010ywt.1	+						hsa-mir-4266|MI0015870_5'Flank	NM_001099289	NP_001092759	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3								zinc ion binding			ovary(1)	1						AGGAGATATTTGAAAGGTGTGT	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	112332615	112332615	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112332615delC								LOC541471 (79923 upstream) : ANAPC1 (194026 downstream)																							gcttatatttccgggctggac	0.065													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	113477764	113477764	+	5'Flank	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113477764delT	uc002tid.2	+											RecName: Full=5'-nucleotidase domain-containing protein 4;																		aagaggctaattttttttttc	0.000													4	2	---	---	---	---	
ERCC3	2071	broad.mit.edu	37	2	128031500	128031502	+	Intron	DEL	TGA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128031500_128031502delTGA	uc002toh.1	-						ERCC3_uc002toe.1_Intron|ERCC3_uc002tof.1_Intron|ERCC3_uc002tog.1_Intron	NM_000122	NP_000113	P19447	ERCC3_HUMAN	excision repair cross-complementing rodent						cell cycle checkpoint|DNA topological change|hair cell differentiation|induction of apoptosis|interspecies interaction between organisms|mRNA capping|nucleotide-excision repair, DNA damage removal|nucleotide-excision repair, DNA duplex unwinding|nucleotide-excision repair, DNA incision|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein localization|response to oxidative stress|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	holo TFIIH complex	3'-5' DNA helicase activity|ATP binding|damaged DNA binding|protein C-terminus binding|protein N-terminus binding|transcription factor binding			ovary(2)|lung(2)|breast(2)|kidney(1)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.073)		ATAACAACAGTGATGATGATGAT	0.414			Mis|S			skin basal cell|skin squamous cell|melanoma		Direct_reversal_of_damage|NER	Xeroderma_Pigmentosum				4	2	---	---	---	---	
MYO7B	4648	broad.mit.edu	37	2	128341532	128341533	+	Intron	DEL	GT	-	-	rs150669299		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128341532_128341533delGT	uc002top.2	+							NM_001080527	NP_001073996	Q6PIF6	MYO7B_HUMAN	myosin VIIB							apical plasma membrane|myosin complex	actin binding|ATP binding|motor activity			ovary(1)|pancreas(1)	2	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGAGAGAGAGTGTGCAGGAAT	0.515													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133021070	133021071	+	IGR	INS	-	AAA	AAA	rs148734070		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133021070_133021071insAAA								NCRNA00164 (5528 upstream) : GPR39 (153076 downstream)																							TTGGATAATAGAAAAAAACACT	0.312													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133053343	133053344	+	IGR	INS	-	A	A	rs140692458	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133053343_133053344insA								NCRNA00164 (37801 upstream) : GPR39 (120803 downstream)																							actaaaaatacaaaattagcag	0.000													4	2	---	---	---	---	
CCNT2	905	broad.mit.edu	37	2	135693721	135693722	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135693721_135693722insT	uc002tuc.1	+						CCNT2_uc002tub.1_Intron|CCNT2_uc010zbf.1_Intron|CCNT2_uc002tud.1_Intron	NM_058241	NP_490595	O60583	CCNT2_HUMAN	cyclin T2 isoform b						cell cycle|cell division|interspecies interaction between organisms|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein kinase binding			ovary(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(221;0.107)		CGCTTTTCATCTTTTTTTTTTT	0.297													4	2	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141141718	141141718	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141141718delA	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAAGTTCTCCAAGACATGTCT	0.428										TSP Lung(27;0.18)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	148388267	148388267	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:148388267delA								None (None upstream) : ACVR2A (213819 downstream)																							TCTGGCTGGCAAAATggcaag	0.209													4	2	---	---	---	---	
KIF5C	3800	broad.mit.edu	37	2	149858969	149858969	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149858969delT	uc010zbu.1	+						KIF5C_uc002tws.1_Intron|KIF5C_uc002twu.1_Intron	NM_004522	NP_004513	O60282	KIF5C_HUMAN	kinesin family member 5C						microtubule-based movement|organelle organization	cytoplasm|kinesin complex|microtubule	ATP binding|microtubule motor activity			skin(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.108)		CACTCACTCCTGCATGCTCCT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	156989055	156989055	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:156989055delA	uc002tyw.2	-											Homo sapiens cDNA clone IMAGE:5209417.																		TACAGAAGAGAAAAAAAAAAA	0.308													4	2	---	---	---	---	
PKP4	8502	broad.mit.edu	37	2	159409090	159409090	+	Intron	DEL	C	-	-	rs34824373		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159409090delC	uc002tzv.2	+						PKP4_uc002tzt.1_Intron|PKP4_uc002tzu.2_Intron|PKP4_uc002tzw.2_Intron|PKP4_uc002tzx.2_Intron|PKP4_uc002tzy.1_Intron|PKP4_uc002tzz.1_Intron	NM_003628	NP_003619	Q99569	PKP4_HUMAN	plakophilin 4 isoform a						cell adhesion	desmosome	protein binding			ovary(5)|skin(2)	7						ggtgagagctcagaaggaaat	0.000										HNSCC(62;0.18)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	159751709	159751709	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159751709delA								DAPL1 (79215 upstream) : TANC1 (73437 downstream)																							actccatctcaaaaaaaaaaa	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	167714639	167714640	+	IGR	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167714639_167714640insC								SCN7A (363922 upstream) : XIRP2 (30357 downstream)																							gaatccaacttaaagggacatg	0.000													4	2	---	---	---	---	
XIRP2	129446	broad.mit.edu	37	2	167931146	167931147	+	Intron	DEL	GT	-	-	rs72225253		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167931146_167931147delGT	uc002udx.2	+						XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						gtgtgtgtgcgtgtgtgtgtgt	0.144													5	3	---	---	---	---	
ABCB11	8647	broad.mit.edu	37	2	169889912	169889915	+	5'Flank	DEL	GAGA	-	-	rs112506506		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169889912_169889915delGAGA	uc002ueo.1	-							NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),						bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	tatgctgtgtgagagagagagtgt	0.000													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170078363	170078363	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170078363delA	uc002ues.2	-							NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	TCCTAAGACTAAGGATCTCTT	0.413													4	2	---	---	---	---	
LRP2	4036	broad.mit.edu	37	2	170100356	170100358	+	Intron	DEL	ACC	-	-	rs35544194		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170100356_170100358delACC	uc002ues.2	-						LRP2_uc010zdf.1_Intron	NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2						hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ATGACTCTAGACCAAAGCCAAGC	0.433													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	173232506	173232507	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:173232506_173232507insT								DLX2 (265028 upstream) : ITGA6 (59575 downstream)																							cagatgctgtgttttttgcaaa	0.030													4	2	---	---	---	---	
PDE11A	50940	broad.mit.edu	37	2	178553307	178553309	+	Intron	DEL	ATT	-	-	rs148407430		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178553307_178553309delATT	uc002ulq.2	-						PDE11A_uc002ulp.2_Intron|PDE11A_uc002ulr.2_Intron|PDE11A_uc002uls.1_Intron|PDE11A_uc002ult.1_Intron|PDE11A_uc002ulu.1_Intron	NM_016953	NP_058649	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A isoform 4						platelet activation|signal transduction	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|metal ion binding			ovary(3)|large_intestine(1)	4			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)			GAACTGTATCATTAACTTCTCAC	0.379									Primary_Pigmented_Nodular_Adrenocortical_Disease_Familial				2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	179382963	179382963	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179382963delG								PLEKHA3 (13183 upstream) : TTN (7757 downstream)																							CCCTTCACGTGACACGCTGGG	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	188872284	188872285	+	IGR	INS	-	ACACACAC	ACACACAC	rs143985976	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:188872284_188872285insACACACAC								TFPI (453065 upstream) : GULP1 (284319 downstream)																							TCTATGATACTacacacacaca	0.376													3	4	---	---	---	---	
TMEFF2	23671	broad.mit.edu	37	2	193015562	193015563	+	Intron	INS	-	T	T	rs143239567	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:193015562_193015563insT	uc002utc.2	-							NM_016192	NP_057276	Q9UIK5	TEFF2_HUMAN	transmembrane protein with EGF-like and two							extracellular region|integral to membrane				lung(2)|pancreas(1)|breast(1)|skin(1)	5			OV - Ovarian serous cystadenocarcinoma(117;0.0835)			TCAAGTTTACATTTTCATTCTC	0.366													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	195369896	195369896	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:195369896delT								None (None upstream) : None (None downstream)																							gggggtagggttacagattaa	0.000													4	4	---	---	---	---	
HECW2	57520	broad.mit.edu	37	2	197394258	197394258	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:197394258delA	uc002utm.1	-							NM_020760	NP_065811	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin						protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm	ubiquitin-protein ligase activity			skin(5)|ovary(5)|lung(4)|pancreas(2)|central_nervous_system(1)|kidney(1)	18						ataaggatTTAAAAAATTAAC	0.169													4	2	---	---	---	---	
AOX1	316	broad.mit.edu	37	2	201498888	201498896	+	Intron	DEL	TTTTTTTTT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201498888_201498896delTTTTTTTTT	uc002uvx.2	+						AOX1_uc010zhf.1_Intron|AOX1_uc010fsu.2_Intron	NM_001159	NP_001150	Q06278	ADO_HUMAN	aldehyde oxidase 1						inflammatory response|reactive oxygen species metabolic process	cytoplasm	2 iron, 2 sulfur cluster binding|aldehyde oxidase activity|flavin adenine dinucleotide binding|iron ion binding|NAD binding|xanthine dehydrogenase activity			ovary(4)|pancreas(1)|skin(1)	6					Brimonidine(DB00484)|Chlorpromazine(DB00477)|Famciclovir(DB00426)|Menadione(DB00170)|Methotrexate(DB00563)|NADH(DB00157)|Palonosetron(DB00377)|Penciclovir(DB00299)|Raloxifene(DB00481)|Zaleplon(DB00962)|Zonisamide(DB00909)	ttcttgaggattttttttttttttttttt	0.000													4	2	---	---	---	---	
ICA1L	130026	broad.mit.edu	37	2	203661796	203661796	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:203661796delC	uc002uzh.1	-						ICA1L_uc002uzi.1_Intron	NM_138468	NP_612477	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like isoform 1												0						AAATCAGAATCGAAAACATAC	0.204													3	11	---	---	---	---	
INO80D	54891	broad.mit.edu	37	2	206874787	206874790	+	Intron	DEL	ACAC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206874787_206874790delACAC	uc002vaz.3	-							NM_017759	NP_060229	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D						DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						gacactgtctacacacacacacac	0.000													4	3	---	---	---	---	
PIKFYVE	200576	broad.mit.edu	37	2	209188679	209188682	+	Intron	DEL	TTGT	-	-	rs72292607		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209188679_209188682delTTGT	uc002vcz.2	+						PIKFYVE_uc010fun.1_Intron|PIKFYVE_uc002vcy.1_Intron	NM_015040	NP_055855	Q9Y2I7	FYV1_HUMAN	phosphatidylinositol-3-phosphate 5-kinase type						cellular protein metabolic process|intracellular signal transduction|protein localization to nucleus|retrograde transport, endosome to Golgi	early endosome membrane|membrane raft	1-phosphatidylinositol-3-phosphate 5-kinase activity|1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|metal ion binding|protein binding			ovary(5)|kidney(2)|pancreas(1)|central_nervous_system(1)|skin(1)	10						tttgatggggttgtttgttttttt	0.000													3	3	---	---	---	---	
SPAG16	79582	broad.mit.edu	37	2	215133468	215133469	+	Intron	INS	-	GT	GT	rs147917627	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:215133468_215133469insGT	uc002veq.2	+						SPAG16_uc002ver.2_Intron|SPAG16_uc010zjk.1_Intron	NM_024532	NP_078808	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16 isoform 1						cilium assembly	cilium axoneme|flagellar axoneme				ovary(1)|skin(1)	2		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		GCATCTGAAGGgtgtgtgtgtg	0.228													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	216625274	216625275	+	Intron	INS	-	A	A	rs151234716	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216625274_216625275insA	uc002vfm.1	-						uc002vfn.1_Intron					Homo sapiens cDNA FLJ34546 fis, clone HLUNG2008959.																		GGGGAGCTATTAAAAAAAAACA	0.302													5	4	---	---	---	---	
DIRC3	729582	broad.mit.edu	37	2	218614758	218614758	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:218614758delC	uc002vgo.2	-							NR_026597				Homo sapiens cDNA FLJ14199 fis, clone NT2RP3002713.												0						ATTATATCCTCCCTCACCAGG	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	219026390	219026390	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219026390delA								CXCR2 (24415 upstream) : CXCR1 (1180 downstream)																							ctgtctcattaaaaaaaaaaa	0.139													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	219717804	219717805	+	IGR	DEL	GT	-	-	rs112289133		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219717804_219717805delGT								PRKAG3 (21292 upstream) : WNT6 (6741 downstream)																							TAGTGGTGGGGTGTGTGTGTGT	0.559											OREG0015206	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	3	---	---	---	---	
DOCK10	55619	broad.mit.edu	37	2	225668718	225668719	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225668718_225668719delTG	uc010fwz.1	-						DOCK10_uc002vob.2_Intron|DOCK10_uc002voa.2_Intron|DOCK10_uc002voc.2_Intron	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10								GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		AATAGAAATAtgtgtgtgtgtg	0.282													4	3	---	---	---	---	
DNER	92737	broad.mit.edu	37	2	230575699	230575700	+	Intron	INS	-	CA	CA	rs34720917		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:230575699_230575700insCA	uc002vpv.2	-							NM_139072	NP_620711	Q8NFT8	DNER_HUMAN	delta-notch-like EGF repeat-containing						central nervous system development|endocytosis|neuron migration|Notch signaling pathway|synapse assembly	dendrite|early endosome|integral to membrane|plasma membrane	calcium ion binding|clathrin binding|transmembrane receptor activity			lung(5)|ovary(2)|skin(1)	8		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		gcatacacgcgcacacacacac	0.045													4	2	---	---	---	---	
SPATA3	130560	broad.mit.edu	37	2	231881394	231881394	+	Intron	DEL	T	-	-	rs35822296		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:231881394delT	uc002vrk.2	+							NM_139073		Q8NHX4	SPTA3_HUMAN	testis and spermatogenesis cell apoptosis						apoptosis|spermatogenesis						0						attgagactcttatctcaaaa	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235591695	235591696	+	IGR	INS	-	GGTGGTGAT	GGTGGTGAT	rs35695458		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235591695_235591696insGGTGGTGAT								ARL4C (186002 upstream) : SH3BP4 (268932 downstream)																							tggtggtggtgggtggtgatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	235973931	235973931	+	IGR	DEL	A	-	-	rs57822670		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:235973931delA								SH3BP4 (9575 upstream) : AGAP1 (428805 downstream)																							TCACACCGACAGATCAGCATA	0.433													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	236077954	236077954	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236077954delA								SH3BP4 (113598 upstream) : AGAP1 (324782 downstream)																							gatgatggtgaatggtgatga	0.035													5	3	---	---	---	---	
LRRFIP1	9208	broad.mit.edu	37	2	238580469	238580470	+	Intron	DEL	AT	-	-	rs11679732	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238580469_238580470delAT	uc002vxc.2	+							NM_001137550	NP_001131022	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	cytoplasm|cytoskeleton|nucleus	DNA binding|double-stranded RNA binding|protein binding			breast(3)	3		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		gtgtgtgcacatgtgtgtgtgt	0.228													4	2	---	---	---	---	
HDAC4	9759	broad.mit.edu	37	2	240174206	240174206	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240174206delT	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		ATTTCTCAGGTTTTAGCAGAA	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	242890671	242890672	+	IGR	INS	-	TGA	TGA			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:242890671_242890672insTGA								C2orf85 (75189 upstream) : LOC728323 (140172 downstream)																							gattgtgtccgtgtgtgatcat	0.010													4	2	---	---	---	---	
IL5RA	3568	broad.mit.edu	37	3	3118334	3118334	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:3118334delC	uc011ask.1	-						IL5RA_uc010hbq.2_Intron|IL5RA_uc010hbr.2_Intron|IL5RA_uc010hbs.2_Intron|IL5RA_uc011asl.1_Intron|IL5RA_uc010hbp.2_Intron	NM_000564	NP_000555	Q01344	IL5RA_HUMAN	interleukin 5 receptor, alpha isoform 1						cell proliferation	extracellular space|integral to membrane|plasma membrane	interleukin-5 receptor activity			ovary(1)	1				Epithelial(13;0.00278)|all cancers(10;0.00809)|OV - Ovarian serous cystadenocarcinoma(96;0.00944)		AAAAAAGAAACAAAAAAATAT	0.264													18	10	---	---	---	---	
GALNTL2	117248	broad.mit.edu	37	3	16001553	16001554	+	Intron	INS	-	AC	AC	rs143368752		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:16001553_16001554insAC	uc003caq.3	+							NM_054110	NP_473451	Q8N3T1	GLTL2_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide							Golgi membrane|integral to membrane|transport vesicle	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			breast(1)	1						cacacatatgtacacacacaca	0.158													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	44050506	44050507	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44050506_44050507insT								ABHD5 (286290 upstream) : MIR138-1 (105197 downstream)																							CTTTTCTTTTCTTTTTTTTGGT	0.248													4	2	---	---	---	---	
ZNF167	55888	broad.mit.edu	37	3	44618773	44618774	+	Intron	INS	-	T	T	rs35642284		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:44618773_44618774insT	uc010hio.2	+						ZNF167_uc003cni.2_Intron|ZNF167_uc003cnk.2_Intron|uc011azz.1_5'Flank	NM_018651	NP_061121	Q9P0L1	ZN167_HUMAN	zinc finger protein 167 isoform 1						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2				KIRC - Kidney renal clear cell carcinoma(197;0.0486)|Kidney(197;0.0609)		ATAACCAATTCTTTTTTTTTTT	0.208													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	48248275	48248275	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48248275delT								CDC25A (18474 upstream) : CAMP (16587 downstream)																							acaggagccctttgtatctta	0.234													4	2	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	50758471	50758471	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50758471delT	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ttttaatgtgtttttttttgt	0.000													4	3	---	---	---	---	
DOCK3	1795	broad.mit.edu	37	3	51320946	51320946	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51320946delC	uc011bds.1	+							NM_004947	NP_004938	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding				0				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		aaatgcagctccatgtgtctc	0.000													4	2	---	---	---	---	
APPL1	26060	broad.mit.edu	37	3	57293836	57293836	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:57293836delA	uc003dio.2	+						APPL1_uc010hnb.2_Intron|APPL1_uc011bey.1_Intron	NM_012096	NP_036228	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH						apoptosis|cell cycle|cell proliferation|insulin receptor signaling pathway|regulation of apoptosis|regulation of establishment of protein localization in plasma membrane|regulation of glucose import	cytosol|early endosome membrane|microsome|nucleus|vesicle membrane	protein kinase B binding			breast(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		TTTATACAGTAAAAAAAAAAT	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	67779193	67779193	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67779193delA	uc003dnb.2	+						uc003dnc.2_Intron					Homo sapiens mRNA; cDNA DKFZp686F1220 (from clone DKFZp686F1220).																		AGCGCCAAAGAAAAAGGAGGG	0.438													4	2	---	---	---	---	
CADM2	253559	broad.mit.edu	37	3	85070268	85070268	+	Intron	DEL	A	-	-	rs142438202		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85070268delA	uc003dqj.2	+						CADM2_uc003dqk.2_Intron	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D						adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		accctgtctcaaaaaaaaaaa	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90498940	90498940	+	IGR	DEL	A	-	-	rs141646871	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90498940delA								EPHA3 (967658 upstream) : None (None downstream)																							atgtgaagatatttccttttc	0.000													8	4	---	---	---	---	
NSUN3	63899	broad.mit.edu	37	3	93844904	93844904	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:93844904delA	uc003drl.1	+							NM_022072	NP_071355	Q9H649	NSUN3_HUMAN	NOL1/NOP2/Sun domain family, member 3								methyltransferase activity			skin(1)	1						actctgtctcaaaaaaaaaaa	0.169													4	2	---	---	---	---	
SENP7	57337	broad.mit.edu	37	3	101146795	101146796	+	Intron	INS	-	T	T	rs150999630	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101146795_101146796insT	uc003dut.2	-						SENP7_uc003duu.2_Intron|SENP7_uc003duv.2_Intron|SENP7_uc003duw.2_Intron|SENP7_uc003dux.2_Intron	NM_020654	NP_065705	Q9BQF6	SENP7_HUMAN	sentrin/SUMO-specific protease 7 isoform 1						proteolysis	nucleus	cysteine-type peptidase activity			ovary(3)|lung(2)	5						gcagtgttttgttttctcttct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	101782485	101782485	+	IGR	DEL	G	-	-	rs11347854		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101782485delG								LOC152225 (65715 upstream) : ZPLD1 (35603 downstream)																							ACTGCACAGTGGGGACACCTG	0.537													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	110636173	110636174	+	IGR	DEL	GC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:110636173_110636174delGC								None (None upstream) : PVRL3 (154691 downstream)																							ccactgacctgcgcccactgtc	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	111062108	111062108	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111062108delT								PVRL3 (149735 upstream) : CD96 (198818 downstream)																							TAATTTCTCCTTTTGGTTACC	0.403													4	2	---	---	---	---	
PHLDB2	90102	broad.mit.edu	37	3	111459746	111459747	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111459746_111459747insA	uc003dyc.2	+						PLCXD2_uc003dya.2_Intron|PLCXD2_uc003dxz.2_Intron	NM_001134437	NP_001127909	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B,							cytoplasm|intermediate filament cytoskeleton|plasma membrane				ovary(4)|skin(2)	6						CCCATCAAGTTAAAAAAAAAAA	0.376													3	6	---	---	---	---	
UPK1B	7348	broad.mit.edu	37	3	118916207	118916207	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118916207delA	uc003ecc.2	+						UPK1B_uc011bix.1_Intron|UPK1B_uc003ecd.2_Intron	NM_006952	NP_008883	O75841	UPK1B_HUMAN	uroplakin 1B						epithelial cell differentiation	integral to membrane	structural molecule activity				0				GBM - Glioblastoma multiforme(114;0.222)		AATGATGGTGAAAAAAATGGG	0.199													4	2	---	---	---	---	
POPDC2	64091	broad.mit.edu	37	3	119386508	119386508	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119386508delA	uc003ecy.1	-									Q9HBU9	POPD2_HUMAN	Homo sapiens popeye protein 2 (POP2) mRNA, complete cds.							integral to membrane				central_nervous_system(1)	1				GBM - Glioblastoma multiforme(114;0.242)		CAGAGTAGCCAAAAAAAAAAA	0.264													4	3	---	---	---	---	
NR1I2	8856	broad.mit.edu	37	3	119518831	119518832	+	Intron	DEL	AA	-	-	rs112418315		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119518831_119518832delAA	uc003edj.2	+						NR1I2_uc003edi.2_Intron|NR1I2_uc003edk.2_Intron	NM_003889	NP_003880	O75469	NR1I2_HUMAN	nuclear receptor subfamily 1, group I, member 2						drug export|exogenous drug catabolic process|negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|steroid metabolic process|xenobiotic metabolic process|xenobiotic transport	nucleoplasm	drug binding|protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|zinc ion binding			ovary(2)	2				GBM - Glioblastoma multiforme(114;0.175)	Estradiol(DB00783)|Ethinyl Estradiol(DB00977)|Rifampin(DB01045)|Vitamin E(DB00163)	acaaacaaacaaacacacacac	0.000													4	3	---	---	---	---	
KPNA1	3836	broad.mit.edu	37	3	122199136	122199137	+	Intron	INS	-	AAT	AAT	rs142641504	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122199136_122199137insAAT	uc003efd.1	-						KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		ctttgggtgacgatgtgtcaat	0.000													3	4	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126221797	126221798	+	Intron	INS	-	TGTG	TGTG	rs144044419	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126221797_126221798insTGTG	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		tgtgtgttatatgtgtgtttat	0.010													4	2	---	---	---	---	
TXNRD3IT1	645840	broad.mit.edu	37	3	126352628	126352629	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126352628_126352629delGT	uc003ejd.1	-						TXNRD3IT1_uc011bkl.1_Intron			Q6F5E7	TR3N_HUMAN	RecName: Full=Thioredoxin reductase 3;          EC=1.8.1.9; AltName: Full=Thioredoxin reductase TR2; AltName: Full=Thioredoxin and glutathione reductase;												0						ATGCATGGCCGTGTGTGTGTGT	0.361													6	3	---	---	---	---	
CHCHD6	84303	broad.mit.edu	37	3	126583849	126583850	+	Intron	INS	-	CCA	CCA			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126583849_126583850insCCA	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719	Q9BRQ6	CHCH6_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						cTTTTCTTcctccaccaccacc	0.020													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	127273046	127273046	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127273046delA								PLXNA1 (516818 upstream) : TPRA1 (18862 downstream)																							AAACCATTTGAAgtgtgtgtg	0.214													4	2	---	---	---	---	
RAB7A	7879	broad.mit.edu	37	3	128485811	128485812	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128485811_128485812insT	uc003eks.1	+						RAB7A_uc010hsv.1_Intron	NM_004637	NP_004628	P51149	RAB7A_HUMAN	RAB7, member RAS oncogene family						endocytosis|endosome to lysosome transport|epidermal growth factor catabolic process|protein transport|small GTPase mediated signal transduction	Golgi apparatus|late endosome|lysosome|melanosome|phagocytic vesicle	GDP binding|GTP binding|GTPase activity|protein binding				0				GBM - Glioblastoma multiforme(114;0.231)		ctcgttttctgttttttttttt	0.129													4	2	---	---	---	---	
RAB43	339122	broad.mit.edu	37	3	128850387	128850388	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:128850387_128850388delTG	uc003elo.1	-						ISY1_uc010hsz.1_Intron|ISY1_uc003elp.1_Intron|ISY1_uc010hta.1_Intron	NM_020701	NP_065752	Q86YS6	RAB43_HUMAN	ISY1 splicing factor homolog						protein transport|small GTPase mediated signal transduction	plasma membrane	GTP binding			lung(1)	1						gtatttgctatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
BFSP2	8419	broad.mit.edu	37	3	133178020	133178021	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133178020_133178021insA	uc003epn.1	+							NM_003571	NP_003562	Q13515	BFSP2_HUMAN	phakinin						response to stimulus|visual perception	cytoplasm|intermediate filament|membrane	structural constituent of cytoskeleton|structural constituent of eye lens				0						cccacctctacaaaaaaaaatg	0.000													4	2	---	---	---	---	
CDV3	55573	broad.mit.edu	37	3	133290961	133290961	+	5'Flank	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133290961delT	uc003epq.2	+						CDV3_uc003epp.3_5'Flank|CDV3_uc003epr.2_5'Flank	NM_017548	NP_060018	Q9UKY7	CDV3_HUMAN	carnitine deficiency-associated gene expressed						cell proliferation	cytoplasm					0						GAAGTTAGACttttttttttt	0.209													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133796930	133796930	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133796930delA								SLCO2A1 (48010 upstream) : RYK (79048 downstream)																							ATTAGGTGCCAGGGGGGGTGC	0.438													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	135027808	135027809	+	IGR	INS	-	GT	GT	rs149559918	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:135027808_135027809insGT								EPHB1 (48503 upstream) : PPP2R3A (656758 downstream)																							TAAGTATACACgtgtgtgtgta	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	137234797	137234797	+	IGR	DEL	T	-	-	rs72119986		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137234797delT								IL20RB (504877 upstream) : SOX14 (248782 downstream)																							TCATCTAGTATTTTTTTTTAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	140723385	140723386	+	IGR	INS	-	TGCCTCCCTGTTT	TGCCTCCCTGTTT	rs139952432	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140723385_140723386insTGCCTCCCTGTTT								SLC25A36 (24600 upstream) : SPSB4 (47357 downstream)																							GAGTAGGGCCCTGCCTCCCTGG	0.500													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	142666682	142666683	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142666682_142666683delTG								PCOLCE2 (58748 upstream) : PAQR9 (1323 downstream)																							GTTTCTGAGTtgtgtgtgtgtg	0.450													4	3	---	---	---	---	
SLC9A9	285195	broad.mit.edu	37	3	143165719	143165720	+	Intron	DEL	TG	-	-	rs35669058		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:143165719_143165720delTG	uc003evn.2	-							NM_173653	NP_775924	Q8IVB4	SL9A9_HUMAN	solute carrier family 9 (sodium/hydrogen						regulation of pH	integral to membrane|late endosome membrane|recycling endosome	sodium:hydrogen antiporter activity			ovary(2)|skin(1)	3						TAGgtgtgtatgtgtgtgtgtg	0.342													3	3	---	---	---	---	
PLSCR2	57047	broad.mit.edu	37	3	146187575	146187575	+	Intron	DEL	A	-	-	rs78594520		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:146187575delA	uc003evv.1	-						PLSCR2_uc003evw.1_Intron	NM_020359	NP_065092	Q9NRY7	PLS2_HUMAN	phospholipid scramblase 2						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|phospholipid scramblase activity				0						CCACCCCCCCACGCCGTGTGC	0.687													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	147622618	147622621	+	IGR	DEL	CAAA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:147622618_147622621delCAAA								ZIC1 (488114 upstream) : AGTR1 (793037 downstream)																							gaccttgtctcaaacaaacaaaca	0.157													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	148147791	148147791	+	IGR	DEL	T	-	-	rs112920564		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148147791delT								None (None upstream) : AGTR1 (267867 downstream)																							GCCAAGGTCATTTTTTAGCAC	0.294													4	3	---	---	---	---	
GYG1	2992	broad.mit.edu	37	3	148741675	148741676	+	Intron	INS	-	A	A	rs139508166	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:148741675_148741676insA	uc003ewn.2	+						GYG1_uc011bnp.1_Intron|GYG1_uc003ewo.2_Intron|GYG1_uc003ewp.2_Intron	NM_004130	NP_004121	P46976	GLYG_HUMAN	glycogenin 1						glucose metabolic process|glycogen biosynthetic process|glycogen catabolic process	cytosol	glycogenin glucosyltransferase activity|metal ion binding|protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			ggtgggaagttagaggctgtag	0.045													2	7	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149412936	149412936	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149412936delC	uc003exh.2	-							NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			atgatgattaccagaggctgg	0.000													4	2	---	---	---	---	
EIF2A	83939	broad.mit.edu	37	3	150280507	150280507	+	Intron	DEL	A	-	-	rs5853483		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150280507delA	uc003eya.2	+						SERP1_uc003exz.2_Intron|EIF2A_uc003eyb.2_Intron|EIF2A_uc003eyc.2_Intron|EIF2A_uc011bnv.1_Intron|EIF2A_uc011bnw.1_Intron|EIF2A_uc003eyd.2_Intron	NM_032025	NP_114414	Q9BY44	EIF2A_HUMAN	eukaryotic translation initiation factor 2A						regulation of translation|ribosome assembly	eukaryotic translation initiation factor 2 complex	ribosome binding|translation initiation factor activity|tRNA binding				0		Melanoma(1037;0.0575)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGTGGGGGGGAAAAAGTTATA	0.333													9	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153560476	153560477	+	IGR	INS	-	A	A	rs150337489	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153560476_153560477insA								C3orf79 (339993 upstream) : SGEF (278672 downstream)																							GGGTATGGATGAAAAAAAAGGA	0.208													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	153824802	153824802	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:153824802delT	uc003ezu.1	-											Homo sapiens cDNA clone IMAGE:4823793.																		GTTTGGTTGCttttttttttt	0.209													3	4	---	---	---	---	
MME	4311	broad.mit.edu	37	3	154792229	154792229	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154792229delT	uc010hvr.1	+							NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	tctttctttcttttttttttg	0.000													4	2	---	---	---	---	
VEPH1	79674	broad.mit.edu	37	3	156994684	156994684	+	Intron	DEL	T	-	-	rs36002636		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:156994684delT	uc003fbj.1	-						VEPH1_uc003fbk.1_Intron|VEPH1_uc010hvu.1_Intron	NM_024621	NP_078897	Q14D04	MELT_HUMAN	ventricular zone expressed PH domain homolog 1							plasma membrane				breast(3)|ovary(1)|lung(1)	5			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			AAGAAGATAAttttttttttt	0.199													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	160400228	160400229	+	IGR	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160400228_160400229delAC								ARL14 (3995 upstream) : PPM1L (73767 downstream)																							CCAAGATTAAacacacacacac	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	161194547	161194548	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161194547_161194548insT								C3orf57 (104676 upstream) : OTOL1 (20048 downstream)																							gagtttcgctcttgttgcccag	0.134													4	2	---	---	---	---	
PLD1	5337	broad.mit.edu	37	3	171424231	171424234	+	Intron	DEL	TTTG	-	-	rs113647068		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171424231_171424234delTTTG	uc003fhs.2	-						PLD1_uc003fht.2_Intron	NM_002662	NP_002653	Q13393	PLD1_HUMAN	phospholipase D1 isoform a						cell communication|chemotaxis|Ras protein signal transduction	endoplasmic reticulum membrane|Golgi membrane|late endosome membrane|perinuclear region of cytoplasm	NAPE-specific phospholipase D activity|phosphatidylinositol binding|phospholipase D activity			ovary(2)|lung(1)	3	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TGGAATAGTCTTTGTTTGTGAGTC	0.289													4	2	---	---	---	---	
FNDC3B	64778	broad.mit.edu	37	3	171984950	171984950	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:171984950delT	uc003fhy.2	+						FNDC3B_uc003fhz.3_Intron|FNDC3B_uc003fia.2_Intron	NM_022763	NP_073600	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B							endoplasmic reticulum|integral to membrane				ovary(2)|breast(1)	3	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		ACACACACACttttttttttt	0.214													5	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173789259	173789260	+	Intron	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173789259_173789260insC	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			atcacttgagtccagctgttca	0.025													7	4	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176767668	176767671	+	Intron	DEL	TTAC	-	-	rs35503291		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176767668_176767671delTTAC	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CGGTTTGTTGTTACTAGTTAATAA	0.333													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177046412	177046412	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177046412delT								TBL1XR1 (131364 upstream) : None (None downstream)																							gcccagcctcttgtatcttaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177097683	177097683	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177097683delT								TBL1XR1 (182635 upstream) : None (None downstream)																							ctctccttccttttttttttt	0.025													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	180294087	180294090	+	IGR	DEL	TGTG	-	-	rs112491130		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180294087_180294090delTGTG								PEX5L (539570 upstream) : TTC14 (25828 downstream)																							AAAGGAAGCTtgtgtgtgtgtgtg	0.275													4	2	---	---	---	---	
CCDC39	339829	broad.mit.edu	37	3	180381458	180381458	+	Intron	DEL	A	-	-	rs113125291		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180381458delA	uc010hxe.2	-						CCDC39_uc003fkn.2_Intron	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39						axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			acttcatctcaaaaaaaaaaa	0.139													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	182446678	182446679	+	IGR	INS	-	TT	TT	rs147466522	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182446678_182446679insTT								SOX2OT (987675 upstream) : ATP11B (64612 downstream)																							aGACATAACACttttttttttc	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184478490	184478490	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184478490delG								MAGEF1 (48654 upstream) : VPS8 (51441 downstream)																							GTGTCACTGAGGCCACCTTGG	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	184486266	184486268	+	IGR	DEL	AAG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184486266_184486268delAAG								MAGEF1 (56430 upstream) : VPS8 (43663 downstream)																							tcaaaaaaaaaagaagaagaaga	0.222													5	5	---	---	---	---	
DGKG	1608	broad.mit.edu	37	3	186045180	186045180	+	Intron	DEL	T	-	-	rs36076414		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186045180delT	uc003fqa.2	-						DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Intron|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	tttcttcttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	189103432	189103432	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189103432delT								TPRG1 (62162 upstream) : TP63 (245784 downstream)																							gcctggctaatttttttttgt	0.000													4	2	---	---	---	---	
TP63	8626	broad.mit.edu	37	3	189504236	189504237	+	Intron	DEL	AC	-	-	rs142033420		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:189504236_189504237delAC	uc003fry.2	+						TP63_uc003frx.2_Intron|TP63_uc003frz.2_Intron|TP63_uc010hzc.1_Intron	NM_003722	NP_003713	Q9H3D4	P63_HUMAN	tumor protein p63 isoform 1						anti-apoptosis|cellular response to UV|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|mitotic cell cycle G1/S transition DNA damage checkpoint|negative regulation of transcription from RNA polymerase II promoter|Notch signaling pathway|positive regulation of Notch signaling pathway|protein homotetramerization|regulation of neuron apoptosis|response to gamma radiation|response to X-ray	chromatin|cytosol|dendrite|Golgi apparatus|transcription factor complex	chromatin binding|damaged DNA binding|double-stranded DNA binding|identical protein binding|metal ion binding|p53 binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			skin(5)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	12	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		ACATacctaaacacacacacac	0.158									Hay-Wells_syndrome	HNSCC(45;0.13)			1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	193547618	193547619	+	IGR	INS	-	G	G	rs140045876	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193547618_193547619insG								OPA1 (132019 upstream) : LOC100128023 (163265 downstream)																							acaacagctctggaagtaggca	0.054													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194276285	194276285	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194276285delC								ATP13A3 (87317 upstream) : TMEM44 (32118 downstream)																							cctcaccattctttgttggtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194598680	194598680	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194598680delC								FAM43A (188916 upstream) : C3orf21 (190335 downstream)																							gaacttccttccccccgcacc	0.015													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194830122	194830123	+	Intron	INS	-	GTGT	GTGT	rs55878810		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194830122_194830123insGTGT	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		tataagtgtgcatgtatgtgtg	0.139													4	2	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194830229	194830230	+	Intron	INS	-	GT	GT	rs145975941		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194830229_194830230insGT	uc003fum.3	-						C3orf21_uc003ful.2_Intron|C3orf21_uc003fuk.2_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		ggtatgtgtacgtgtgtggtgt	0.000													5	3	---	---	---	---	
C3orf21	152002	broad.mit.edu	37	3	194957837	194957837	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194957837delG	uc003fum.3	-						C3orf21_uc011bsw.1_Intron	NM_152531	NP_689744	Q8NBI6	CC021_HUMAN	hypothetical protein LOC152002							integral to membrane	transferase activity, transferring glycosyl groups				0	all_cancers(143;9.33e-09)|Ovarian(172;0.0634)		Epithelial(36;1.73e-20)|all cancers(36;1.42e-18)|OV - Ovarian serous cystadenocarcinoma(49;1.56e-17)|Lung(62;0.000117)|LUSC - Lung squamous cell carcinoma(58;0.000146)	GBM - Glioblastoma multiforme(46;1.36e-05)		tgtctcattaggtcatgtaac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	195353401	195353402	+	IGR	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195353401_195353402delCA								APOD (42325 upstream) : SDHAP2 (31508 downstream)																							cacacacgtgcacacacacgca	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	197061794	197061798	+	IGR	DEL	TTTTG	-	-	rs78014531		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197061794_197061798delTTTTG								DLG1 (35651 upstream) : BDH1 (174857 downstream)																							ttttttttttttttggagacagggt	0.176													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	16767	16768	+	IGR	INS	-	T	T	rs141189818		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16767_16768insT								None (None upstream) : ZNF595 (36459 downstream)																							actctgtctcctttgttcggtg	0.000													4	4	---	---	---	---	
ZNF595	152687	broad.mit.edu	37	4	62561	62563	+	Intron	DEL	ATT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:62561_62563delATT	uc003fzv.1	+						ZNF595_uc003fzu.1_Intron|ZNF718_uc003fzt.3_Intron|ZNF595_uc010iay.1_Intron|ZNF595_uc011bus.1_Intron|ZNF595_uc011but.1_Intron	NM_182524	NP_872330	Q7Z3I0	Q7Z3I0_HUMAN	zinc finger protein 595						regulation of transcription, DNA-dependent	intracellular	nucleic acid binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0654)|Epithelial(2;0.0921)|all cancers(2;0.146)|LUSC - Lung squamous cell carcinoma(95;0.173)		ggttatcatcattattgttttgc	0.010													3	4	---	---	---	---	
ZNF876P	642280	broad.mit.edu	37	4	212236	212236	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:212236delA	uc010iba.2	+							NR_027481				Homo sapiens cDNA clone IMAGE:4828836.												0						ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ZNF141	7700	broad.mit.edu	37	4	358664	358665	+	Intron	INS	-	G	G	rs139640323	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:358664_358665insG	uc003gaa.2	+						ZNF141_uc003gab.2_Intron	NM_003441	NP_003432	Q15928	ZN141_HUMAN	zinc finger protein 141						anatomical structure morphogenesis|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0						gccatcatacaggacgattaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	1132514	1132515	+	IGR	INS	-	T	T	rs146200292		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1132514_1132515insT								RNF212 (24932 upstream) : SPON2 (28207 downstream)																							accaatacttgttttttttttt	0.000													4	2	---	---	---	---	
KIAA1530	57654	broad.mit.edu	37	4	1345112	1345112	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1345112delA	uc003gde.3	+							NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654												0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			tcggcctcccaaagtgctggg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3570036	3570037	+	IGR	DEL	AT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3570036_3570037delAT								LRPAP1 (35812 upstream) : ADRA2C (198038 downstream)																							GTGcacacacataagctacaca	0.139													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	10344251	10344251	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:10344251delT								WDR1 (225678 upstream) : ZNF518B (97254 downstream)																							AGATTGATACTTTTTTTTTTC	0.423													4	2	---	---	---	---	
HS3ST1	9957	broad.mit.edu	37	4	11427680	11427680	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:11427680delC	uc003gmq.2	-							NM_005114	NP_005105	O14792	HS3S1_HUMAN	heparan sulfate D-glucosaminyl							Golgi lumen|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity			skin(1)	1						AACACAGGGACCCAGGCTTAG	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	13234449	13234450	+	IGR	DEL	AG	-	-	rs113530075		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:13234449_13234450delAG								None (None upstream) : HSP90AB2P (100587 downstream)																							agacaaagaaagagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14408888	14408889	+	IGR	DEL	CA	-	-	rs71965383		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14408888_14408889delCA								BOD1L (779560 upstream) : CPEB2 (596633 downstream)																							TCTTCACAAGcacacacacaca	0.302													4	2	---	---	---	---	
BST1	683	broad.mit.edu	37	4	15710506	15710507	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15710506_15710507insA	uc003goh.3	+							NM_004334	NP_004325	Q10588	BST1_HUMAN	bone marrow stromal cell antigen 1 precursor						humoral immune response|multicellular organismal development	anchored to membrane|extrinsic to membrane|plasma membrane	binding|NAD+ nucleosidase activity			central_nervous_system(1)	1						tcggcacacacaaaaaaaaGAG	0.069													4	2	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20347317	20347317	+	Intron	DEL	C	-	-	rs34459647		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20347317delC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						caccaccatgcccggctaatt	0.000													4	2	---	---	---	---	
LGI2	55203	broad.mit.edu	37	4	25024691	25024696	+	Intron	DEL	TGATGA	-	-	rs71907605		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25024691_25024696delTGATGA	uc003grf.2	-							NM_018176	NP_060646	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2							extracellular region					0		Breast(46;0.173)				atgttgatgttgatgatgatgatgat	0.233													4	3	---	---	---	---	
ANAPC4	29945	broad.mit.edu	37	4	25415553	25415554	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:25415553_25415554delGT	uc003gro.2	+						ANAPC4_uc003grp.2_Intron|ANAPC4_uc003grq.2_5'UTR	NM_013367	NP_037499	Q9UJX5	APC4_HUMAN	anaphase-promoting complex subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|G2/M transition of mitotic cell cycle|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm	protein phosphatase binding|ubiquitin-protein ligase activity			ovary(2)|large_intestine(1)|pancreas(1)|skin(1)	5		Breast(46;0.0503)				TCTTACACACgtgtgtgtgtgt	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	28522620	28522621	+	IGR	INS	-	C	C	rs5857087		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:28522620_28522621insC								None (None upstream) : None (None downstream)																							ccttccttccttccttcctctc	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	31774586	31774586	+	IGR	DEL	A	-	-	rs113480523		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:31774586delA								PCDH7 (626165 upstream) : None (None downstream)																							AAGTATACCGAAAAAAAAAAT	0.184													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33017759	33017759	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33017759delT								None (None upstream) : None (None downstream)																							AATTTCAGTGTTTTTTTTTTA	0.294													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33209463	33209463	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33209463delG								None (None upstream) : None (None downstream)																							ttaagactttggggaattgtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	33838451	33838452	+	IGR	INS	-	T	T	rs143116224	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:33838451_33838452insT								None (None upstream) : None (None downstream)																							TACTTGTGAGGTTTTTATGTTA	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	35580858	35580858	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:35580858delG								None (None upstream) : ARAP2 (368986 downstream)																							ctttgtgtgtggcattattaa	0.050													4	2	---	---	---	---	
FLJ13197	79667	broad.mit.edu	37	4	38659849	38659849	+	Intron	DEL	T	-	-	rs138944704		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38659849delT	uc003gte.1	-						FLJ13197_uc003gtf.2_Intron	NR_026804				Homo sapiens clone pp6414 unknown mRNA.												0						TTCTCAGACATTTTTTTTTTT	0.239													3	3	---	---	---	---	
APBB2	323	broad.mit.edu	37	4	40992302	40992303	+	Intron	INS	-	TC	TC	rs142954247	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40992302_40992303insTC	uc003gvl.2	-						APBB2_uc003gvm.2_Intron|APBB2_uc003gvn.2_Intron|APBB2_uc011byt.1_Intron	NM_173075	NP_775098	Q92870	APBB2_HUMAN	amyloid beta A4 precursor protein-binding,						cell cycle arrest|intracellular signal transduction|negative regulation of cell growth|negative regulation of S phase of mitotic cell cycle|regulation of transcription, DNA-dependent	growth cone|lamellipodium|membrane|nucleus|synapse	beta-amyloid binding|transcription factor binding			ovary(2)|large_intestine(1)	3						tctctctttcttctctctccct	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	41980023	41980024	+	IGR	INS	-	ACAC	ACAC	rs140239216	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41980023_41980024insACAC								TMEM33 (17199 upstream) : DCAF4L1 (3689 downstream)																							AGGAATTTAAAACACACACACA	0.381													4	3	---	---	---	---	
FRYL	285527	broad.mit.edu	37	4	48763024	48763025	+	Intron	INS	-	TT	TT	rs71600795		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48763024_48763025insTT	uc003gyh.1	-						FRYL_uc003gyk.2_Intron|FRYL_uc003gym.1_Intron|FRYL_uc003gyn.3_Intron	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like						regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						ATTACTCtgtctgtgtgtgtgt	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49128974	49128978	+	IGR	DEL	TTTCA	-	-	rs150043522		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49128974_49128978delTTTCA								CWH43 (64881 upstream) : None (None downstream)																							attccattcctttcaattccgttcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49573452	49573452	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49573452delC								CWH43 (509359 upstream) : None (None downstream)																							acagtgaagaccagccttgta	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	59970465	59970466	+	IGR	DEL	TG	-	-	rs5858535		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:59970465_59970466delTG								None (None upstream) : None (None downstream)																							TCCTAAAGATtgtgtgtgtgtg	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	63142769	63142769	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:63142769delA								LPHN3 (204602 upstream) : None (None downstream)																							GAAATATACTAAAGGGGAACC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	75223854	75223855	+	IGR	INS	-	A	A	rs148771484	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75223854_75223855insA								EPGN (43467 upstream) : EREG (7005 downstream)																							ATAAAAAAAGGAAAAAAAAAAG	0.342													3	3	---	---	---	---	
BTC	685	broad.mit.edu	37	4	75706431	75706432	+	Intron	INS	-	TGAAGGTAAG	TGAAGGTAAG	rs139258126	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:75706431_75706432insTGAAGGTAAG	uc003hig.2	-							NM_001729	NP_001720	P35070	BTC_HUMAN	betacellulin precursor						positive regulation of cell division|positive regulation of cell proliferation	extracellular space|integral to membrane|plasma membrane|soluble fraction	epidermal growth factor receptor binding|growth factor activity			central_nervous_system(1)|skin(1)	2			Lung(101;0.219)			tttcttccaaatgctgccttcc	0.000													4	2	---	---	---	---	
NAAA	27163	broad.mit.edu	37	4	76852128	76852129	+	Intron	INS	-	C	C	rs147323616	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:76852128_76852129insC	uc003hjb.2	-						NAAA_uc003hja.2_Intron|NAAA_uc003hjc.3_Intron|NAAA_uc003hjd.3_Intron|NAAA_uc011cbq.1_Intron	NM_014435	NP_055250	Q02083	NAAA_HUMAN	N-acylethanolamine acid amidase isoform 1						lipid metabolic process	lysosome	hydrolase activity			skin(1)	1						acctgtactaaccaccccacct	0.000													3	9	---	---	---	---	
NUP54	53371	broad.mit.edu	37	4	77045737	77045740	+	Intron	DEL	TATT	-	-	rs10567710		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77045737_77045740delTATT	uc003hjs.2	-						NUP54_uc010ije.2_Intron|NUP54_uc011cbs.1_Intron|NUP54_uc011cbt.1_Intron|NUP54_uc003hjt.2_Intron	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa						carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						TAAAAATCTATATTTAGTACATTA	0.279													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	84628680	84628681	+	IGR	INS	-	AC	AC	rs28585627	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:84628680_84628681insAC								AGPAT9 (101655 upstream) : NKX6-1 (785755 downstream)																							gagagagaaaaacacacacaca	0.000													5	3	---	---	---	---	
GRID2	2895	broad.mit.edu	37	4	93806087	93806087	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:93806087delA	uc011cdt.1	+						GRID2_uc010ikx.2_Intron|GRID2_uc011cdu.1_Intron|GRID2_uc011cdv.1_Intron	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TGGTCTCCCCAAAAAAAAAAA	0.343													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	101027425	101027425	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101027425delT								LOC256880 (153805 upstream) : DDIT4L (79604 downstream)																							gcctggACAATTTTTTTTTTT	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	106589442	106589442	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:106589442delA	uc003hxv.1	+											Homo sapiens cDNA FLJ43963 fis, clone TESTI4016882.																		aggttcaagcaattctcctgt	0.000													4	2	---	---	---	---	
COL25A1	84570	broad.mit.edu	37	4	110156703	110156704	+	Intron	INS	-	AC	AC	rs140356842	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:110156703_110156704insAC	uc003hze.1	-						COL25A1_uc003hzg.2_Intron|COL25A1_uc003hzh.1_Intron	NM_198721	NP_942014	Q9BXS0	COPA1_HUMAN	collagen, type XXV, alpha 1 isoform 1							collagen|extracellular space	beta-amyloid binding|heparin binding			ovary(2)	2		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		cacacacgaatacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	128495454	128495455	+	IGR	INS	-	GTGTGT	GTGTGT	rs35164678		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:128495454_128495455insGTGTGT								None (None upstream) : INTU (58665 downstream)																							gtctgtgtgtggtgtgtgtgtg	0.020													3	3	---	---	---	---	
SCLT1	132320	broad.mit.edu	37	4	130008911	130008912	+	Intron	DEL	AA	-	-	rs113899037		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130008911_130008912delAA	uc003igp.2	-						SCLT1_uc003igq.2_Intron|SCLT1_uc010iob.1_Intron|SCLT1_uc003igr.2_Intron|SCLT1_uc003igs.2_Intron|SCLT1_uc003igt.3_Intron	NM_144643	NP_653244	Q96NL6	SCLT1_HUMAN	sodium channel associated protein 1							centrosome				ovary(3)|lung(1)|central_nervous_system(1)	5						tgcgcaagttaaaaaaaaaaaa	0.030													5	3	---	---	---	---	
RAB33B	83452	broad.mit.edu	37	4	140387051	140387052	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140387051_140387052insT	uc003ihv.2	+							NM_031296	NP_112586	Q9H082	RB33B_HUMAN	RAB33B, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	Golgi membrane	GTP binding				0	all_hematologic(180;0.162)					tcccagctcacttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	149859866	149859867	+	IGR	INS	-	T	T	rs149525199	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149859866_149859867insT								NR3C2 (496223 upstream) : None (None downstream)																							CCATTCTCCTAttttttttttc	0.139													3	3	---	---	---	---	
TRIM2	23321	broad.mit.edu	37	4	154099096	154099096	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154099096delG	uc003ing.2	+							NM_001130067	NP_001123539	Q9C040	TRIM2_HUMAN	tripartite motif-containing 2 isoform 2							cytoplasm	zinc ion binding			central_nervous_system(1)	1	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		tgggactacaggtgcacacca	0.000													4	2	---	---	---	---	
LOC285501	285501	broad.mit.edu	37	4	178820230	178820231	+	Intron	DEL	AC	-	-	rs67352191		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178820230_178820231delAC	uc010iru.2	+							NR_028342				Homo sapiens cDNA clone IMAGE:4828874.												0		all_lung(41;6.03e-08)|Lung NSC(41;4.26e-07)|Breast(14;0.00066)|Melanoma(52;0.00168)|Prostate(90;0.0129)|all_hematologic(60;0.0202)|Renal(120;0.0246)|Colorectal(36;0.0508)|Hepatocellular(41;0.236)		all cancers(43;9.24e-25)|Epithelial(43;6.28e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.29e-10)|LUSC - Lung squamous cell carcinoma(1;2.61e-05)|Lung(1;3.22e-05)|GBM - Glioblastoma multiforme(59;0.000185)|Colorectal(24;0.000244)|STAD - Stomach adenocarcinoma(60;0.000777)|COAD - Colon adenocarcinoma(29;0.000884)		CCTCGGCCCAacacacacacac	0.292													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	179189128	179189128	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:179189128delA								LOC285501 (277225 upstream) : None (None downstream)																							ggcagcaggtaaagagagtga	0.000													4	2	---	---	---	---	
CCDC110	256309	broad.mit.edu	37	4	186387725	186387726	+	Intron	INS	-	T	T	rs139757644	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186387725_186387726insT	uc003ixu.3	-						CCDC110_uc003ixv.3_Intron|CCDC110_uc011ckt.1_Intron	NM_152775	NP_689988	Q8TBZ0	CC110_HUMAN	coiled-coil domain containing 110 isoform a							nucleus				central_nervous_system(1)	1		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;7.86e-05)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|Colorectal(36;0.0381)|all_hematologic(60;0.0749)		OV - Ovarian serous cystadenocarcinoma(60;1.13e-10)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.00014)|STAD - Stomach adenocarcinoma(60;0.000777)|LUSC - Lung squamous cell carcinoma(40;0.00921)|COAD - Colon adenocarcinoma(29;0.0105)|READ - Rectum adenocarcinoma(43;0.164)		GTCAAGAGGGAttttttttctt	0.238													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190588715	190588716	+	IGR	DEL	AG	-	-	rs67332528		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190588715_190588716delAG								None (None upstream) : FRG1 (273258 downstream)																							gtgtgtgtgtagagagagatta	0.054													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190597276	190597277	+	IGR	INS	-	A	A	rs149616832		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190597276_190597277insA								None (None upstream) : FRG1 (264697 downstream)																							TGATTTTTAAGAAAAAAATCTA	0.342													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190797700	190797703	+	Intron	DEL	AAAT	-	-	rs111691388		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190797700_190797703delAAAT	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		TGAAGCTAACAAATAACACTGTCA	0.490													6	3	---	---	---	---	
CCDC127	133957	broad.mit.edu	37	5	215142	215143	+	Intron	INS	-	A	A	rs7729982	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:215142_215143insA	uc003jam.1	-							NM_145265	NP_660308	Q96BQ5	CC127_HUMAN	coiled-coil domain containing 127												0			all cancers(22;0.0236)|Lung(60;0.113)			actccgtctcgaaaaaaaaaaa	0.153													4	3	---	---	---	---	
ZDHHC11	79844	broad.mit.edu	37	5	842413	842414	+	Intron	INS	-	G	G	rs143640098	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:842413_842414insG	uc011cma.1	-						ZDHHC11_uc003jbj.2_Intron|ZDHHC11_uc010itd.1_RNA|ZDHHC11_uc003jbk.2_Intron	NM_024786	NP_079062	Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							integral to membrane	acyltransferase activity|zinc ion binding			skin(1)|pancreas(1)	2			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GACTTGCTACTGGGGGAGAAGA	0.624													11	8	---	---	---	---	
TERT	7015	broad.mit.edu	37	5	1273121	1273122	+	Intron	DEL	CA	-	-	rs72045676		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1273121_1273122delCA	uc003jcb.1	-						TERT_uc003jbz.1_Intron|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Intron|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_Intron	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1						anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			CCACAGTCACCACACATCAGAC	0.604									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2533350	2533354	+	IGR	DEL	AGGAA	-	-	rs58192914		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2533350_2533354delAGGAA								IRX4 (650470 upstream) : IRX2 (212927 downstream)																							GAGGAGGAGGAGGAAGAGCCTGGGG	0.483													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	2921669	2921670	+	IGR	INS	-	TTCA	TTCA	rs143477212	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:2921669_2921670insTTCA								C5orf38 (166157 upstream) : IRX1 (674498 downstream)																							gctcaccacgcttcaggtggca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3420842	3420842	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3420842delA	uc003jdd.2	-											Homo sapiens cDNA clone IMAGE:4823480.																		TGGTGGGCAGAATACAGCTGT	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3631356	3631357	+	IGR	DEL	GA	-	-	rs111684635		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3631356_3631357delGA								IRX1 (29840 upstream) : None (None downstream)																							TGGGCATTCTgagagagagaga	0.421													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	3736126	3736127	+	IGR	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3736126_3736127delAC								IRX1 (134610 upstream) : None (None downstream)																							atatacacagacacacacacac	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4382487	4382488	+	IGR	INS	-	T	T	rs66910978		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4382487_4382488insT								IRX1 (780971 upstream) : LOC340094 (651984 downstream)																							ttttcttttccttttttttttt	0.307													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	6545727	6545728	+	IGR	INS	-	T	T	rs144489657	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:6545727_6545728insT								UBE2QL1 (53022 upstream) : LOC255167 (36559 downstream)																							tccaccagtgcgagtggagtgg	0.000													4	2	---	---	---	---	
ADCY2	108	broad.mit.edu	37	5	7792614	7792614	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:7792614delG	uc003jdz.1	+						ADCY2_uc011cmo.1_Intron|ADCY2_uc010itm.1_Intron	NM_020546	NP_065433	Q08462	ADCY2_HUMAN	adenylate cyclase 2						activation of adenylate cyclase activity by G-protein signaling pathway|activation of phospholipase C activity|activation of protein kinase A activity|cellular response to glucagon stimulus|energy reserve metabolic process|inhibition of adenylate cyclase activity by G-protein signaling pathway|nerve growth factor receptor signaling pathway|synaptic transmission|transmembrane transport|water transport	cytoplasm|dendrite|integral to membrane|plasma membrane	ATP binding|metal ion binding			ovary(5)|pancreas(1)|skin(1)	7						GCTCTGTGAAGGTCTGTGGGG	0.542													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8615630	8615631	+	IGR	INS	-	AC	AC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8615630_8615631insAC								MTRR (714397 upstream) : SEMA5A (419507 downstream)																							cacacacacagacacacacaca	0.000													3	3	---	---	---	---	
DAP	1611	broad.mit.edu	37	5	10698213	10698213	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:10698213delG	uc003jez.3	-						DAP_uc011cmw.1_Intron	NM_004394	NP_004385	P51397	DAP1_HUMAN	death-associated protein						activation of caspase activity|cellular response to amino acid starvation|induction of apoptosis by extracellular signals|negative regulation of autophagy|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription, DNA-dependent		death domain binding				0		Ovarian(839;1.34e-05)|Breast(839;0.0634)|Lung NSC(810;0.0804)				CAGCAAGGGAGGGAGTTGGTG	0.408													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11865124	11865124	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11865124delC	uc003jfa.1	-						CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ctcctgccttcagcctctcaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	13174029	13174032	+	IGR	DEL	CACA	-	-	rs140463917	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13174029_13174032delCACA								None (None upstream) : DNAH5 (516405 downstream)																							TCAAGCCAGTcacacacacacaca	0.348													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14004165	14004165	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14004165delA								DNAH5 (59576 upstream) : TRIO (139664 downstream)																							ctttgggagtaatctgctgtg	0.144													4	2	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14192369	14192369	+	Intron	DEL	C	-	-	rs79291740	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14192369delC	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					tttccttcttctttttttttt	0.159													4	4	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14499823	14499823	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14499823delT	uc003jff.2	+						TRIO_uc003jfg.2_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					ACACAGGTGATTTTTTTTTTT	0.219													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14937710	14937711	+	IGR	INS	-	TT	TT	rs112706492		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14937710_14937711insTT								ANKH (65823 upstream) : FBXL7 (562594 downstream)																							CAATGAATCACTTTTTTTTTTT	0.475													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	16430752	16430755	+	IGR	DEL	AGAG	-	-	rs71963261		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:16430752_16430755delAGAG								MARCH11 (250855 upstream) : ZNF622 (20874 downstream)																							aaagagtgaaagagagagagagag	0.118													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23759574	23759574	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23759574delA								PRDM9 (230870 upstream) : CDH10 (727636 downstream)																							ACAGACAACTAAAGAAAGCAA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	26570964	26570964	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26570964delG								None (None upstream) : CDH9 (309745 downstream)																							aggaaacagagaagttgtccg	0.015													2	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31663962	31663963	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31663962_31663963delGT	uc003jhl.2	+							NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						GAAGTTTAGGgtgtgtgtgtgt	0.441													3	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31687203	31687203	+	Intron	DEL	A	-	-	rs79698540		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31687203delA	uc003jhl.2	+							NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						TCATAGATATAAAAAAAGTTC	0.378													2	4	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31872249	31872250	+	Intron	DEL	GT	-	-	rs71987627		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31872249_31872250delGT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AAGGTGAGTGgtgtgtgtgtgt	0.426													4	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	31962584	31962585	+	Intron	DEL	AG	-	-	rs142136111		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:31962584_31962585delAG	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						AAATGTCTGCAGAGAGTCAGGG	0.520													4	4	---	---	---	---	
GOLPH3	64083	broad.mit.edu	37	5	32175897	32175898	+	5'Flank	INS	-	C	C	rs142668841	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32175897_32175898insC	uc003jhp.1	-							NM_022130	NP_071413	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3						cell proliferation|positive regulation of TOR signaling cascade|regulation of mitochondrion organization	cytosol|endosome|Golgi cisterna membrane|mitochondrial intermembrane space|plasma membrane|trans-Golgi network	protein binding			ovary(1)	1						gagccaccgcgccAGCCCACAC	0.139													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34011320	34011320	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34011320delA								AMACR (3114 upstream) : C1QTNF3 (6644 downstream)																							ctctgtcttgaaaaaaaaaaa	0.030													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	34626024	34626025	+	IGR	INS	-	T	T	rs72532954		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:34626024_34626025insT								C1QTNF3 (582707 upstream) : RAI14 (30408 downstream)																							actgCCAGAGGGGAATTTGTGG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	35324128	35324128	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35324128delC								PRLR (93334 upstream) : SPEF2 (293861 downstream)																							gagcaacttgccctcatcaag	0.000													4	4	---	---	---	---	
NUP155	9631	broad.mit.edu	37	5	37292320	37292320	+	Intron	DEL	T	-	-	rs34382591		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37292320delT	uc003jku.1	-						NUP155_uc003jkt.1_Intron|NUP155_uc010iuz.1_Intron	NM_153485	NP_705618	O75694	NU155_HUMAN	nucleoporin 155kDa isoform 1						carbohydrate metabolic process|glucose transport|mRNA transport|nucleocytoplasmic transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear membrane|nuclear pore	protein binding|structural constituent of nuclear pore|transporter activity			ovary(1)	1	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CATTTGAAGAttttttttttt	0.169													4	2	---	---	---	---	
LIFR	3977	broad.mit.edu	37	5	38585825	38585825	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38585825delT	uc003jli.2	-						uc003jlj.2_Intron	NM_002310	NP_002301	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor precursor						positive regulation of cell proliferation	extracellular region|integral to plasma membrane	ciliary neurotrophic factor receptor binding|growth factor binding|leukemia inhibitory factor receptor activity			ovary(3)|large_intestine(1)	4	all_lung(31;0.00021)					TAGTTGCTCATTTTTTTTTTC	0.333			T	PLAG1	salivary adenoma								4	2	---	---	---	---	
RPL37	6167	broad.mit.edu	37	5	40836764	40836765	+	5'Flank	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:40836764_40836765insA	uc003jme.1	-							NM_000997	NP_000988	P61927	RL37_HUMAN	ribosomal protein L37						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	metal ion binding|protein binding|rRNA binding|structural constituent of ribosome				0		Breast(839;0.238)				tcctgcaaagggaaaccttgga	0.054													4	2	---	---	---	---	
MGC42105	167359	broad.mit.edu	37	5	43214429	43214433	+	Intron	DEL	CACAC	-	-	rs147273694		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:43214429_43214433delCACAC	uc003jno.2	+							NM_153361	NP_699192	Q8IY84	NIM1_HUMAN	serine/threonine-protein kinase NIM1								ATP binding|magnesium ion binding|protein serine/threonine kinase activity			lung(4)|ovary(2)|stomach(1)|large_intestine(1)|breast(1)	9						ACAATAAAAACACACCCAGAAGTAT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	51023482	51023483	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:51023482_51023483delTG								ISL1 (332925 upstream) : None (None downstream)																							gtatattggctgtgtgtgtgtg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	62833997	62833997	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:62833997delG								ISCA1P1 (760827 upstream) : HTR1A (422282 downstream)																							TTCTACTATAGGGCCTTGCCA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	75299878	75299878	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75299878delA								POC5 (286565 upstream) : SV2C (79427 downstream)																							AGGGACAAGGAAAAAAAAAAG	0.438													4	2	---	---	---	---	
DMGDH	29958	broad.mit.edu	37	5	78361043	78361043	+	Intron	DEL	T	-	-	rs147413902		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:78361043delT	uc003kfs.2	-						DMGDH_uc011ctf.1_Intron|DMGDH_uc011ctg.1_Intron	NM_013391	NP_037523	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase precursor						choline metabolic process|glycine catabolic process	mitochondrial matrix	aminomethyltransferase activity|dimethylglycine dehydrogenase activity|electron carrier activity			ovary(2)|liver(1)|skin(1)	4		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		tttcttttccttttttttttt	0.000													4	2	---	---	---	---	
ATG10	83734	broad.mit.edu	37	5	81513872	81513873	+	Intron	DEL	AC	-	-	rs66831232		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:81513872_81513873delAC	uc003khs.2	+						ATG10_uc003khr.2_Intron|ATG10_uc010jas.2_Intron	NM_001131028	NP_001124500	Q9H0Y0	ATG10_HUMAN	APG10 autophagy 10-like						autophagy in response to ER overload|positive regulation of protein modification process|protein lipidation|protein modification by small protein conjugation|protein transport	cytoplasm	Atg12 ligase activity|protein binding				0		Lung NSC(167;0.0258)|all_lung(232;0.0294)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;9.94e-41)|Epithelial(54;6.3e-36)|all cancers(79;2.31e-30)		TTCTCTCTTTacacacacacac	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	100557870	100557871	+	IGR	DEL	GA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:100557870_100557871delGA								ST8SIA4 (318883 upstream) : None (None downstream)																							gaagtaataggagagagagaga	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	134823570	134823571	+	IGR	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:134823570_134823571delGT								TIFAB (35481 upstream) : NEUROG1 (46409 downstream)																							GCATTGGGTGgtgtgtgtgtgt	0.416													4	2	---	---	---	---	
PKD2L2	27039	broad.mit.edu	37	5	137272145	137272146	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137272145_137272146insT	uc003lby.2	+						PKD2L2_uc003lbw.1_Intron|PKD2L2_uc003lbx.2_Intron|PKD2L2_uc011cyi.1_Intron	NM_014386	NP_055201	Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2							integral to membrane	calcium ion binding|ion channel activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			ATCATTGAGCAtttcttttttt	0.188													4	2	---	---	---	---	
ECSCR	641700	broad.mit.edu	37	5	138782130	138782133	+	Intron	DEL	CTCC	-	-	rs137954362	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138782130_138782133delCTCC	uc011czd.1	-									Q19T08	ECSCR_HUMAN	Homo sapiens cDNA FLJ56777 complete cds.						angiogenesis|cell differentiation|chemotaxis	integral to membrane|plasma membrane					0						ttctttctttctccttccttcctt	0.000													3	3	---	---	---	---	
SRA1	10011	broad.mit.edu	37	5	139934175	139934176	+	Intron	INS	-	TT	TT	rs150297559	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:139934175_139934176insTT	uc003lga.2	-						SRA1_uc003lfz.2_Intron|SRA1_uc010jfm.2_Intron	NM_001035235	NP_001030312	Q9HD15	SRA1_HUMAN	steroid receptor RNA activator 1						apoptosis|cell differentiation|cell proliferation|transcription, DNA-dependent	cytoplasm|ribonucleoprotein complex	receptor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			cttccctactgtaactatcttc	0.000													3	4	---	---	---	---	
PCDHGA9	56107	broad.mit.edu	37	5	140783285	140783285	+	Frame_Shift_Del	DEL	C	-	-	rs77227638	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140783285delC	uc003lkh.1	+	1	766	c.766delC	c.(766-768)CCCfs	p.P256fs	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc011dax.1_Frame_Shift_Del_p.P256fs	NM_018921	NP_061744	Q9Y5G4	PCDG9_HUMAN	protocadherin gamma subfamily A, 9 isoform 1	256	Cadherin 3.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGAACGTGCCCCCAGGCAC	0.473													30	22	---	---	---	---	
SPINK6	404203	broad.mit.edu	37	5	147585430	147585430	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147585430delA	uc003lpa.2	+							NM_205841	NP_995313	Q6UWN8	ISK6_HUMAN	serine protease inhibitor, Kazal type 6							extracellular region	serine-type endopeptidase inhibitor activity			ovary(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGAGCAGATTaaaaaaaaaaa	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	6728709	6728709	+	Intron	DEL	A	-	-	rs78580952		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:6728709delA	uc003mxa.2	+											Homo sapiens, clone IMAGE:5189615, mRNA.																		ATAGAAGGGCAAAAAAAAAAG	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	7270448	7270448	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7270448delA								RREB1 (18756 upstream) : SSR1 (10842 downstream)																							ccaaaccaggaaaaaaaatag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	9546052	9546052	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:9546052delG								HULC (891975 upstream) : TFAP2A (850865 downstream)																							GTGAAAAAAAGTGGAGGACTA	0.229													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	18565945	18565946	+	Intron	INS	-	TTCC	TTCC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18565945_18565946insTTCC	uc003nct.1	+											Homo sapiens cDNA FLJ25799 fis, clone TST07088.																		tccttccttcttgccttccttc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	19266101	19266101	+	IGR	DEL	G	-	-	rs139771671	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:19266101delG								MIR548A1 (693990 upstream) : ID4 (571516 downstream)																							aggaggaggtggggggggcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	23578024	23578025	+	IGR	INS	-	TTG	TTG	rs149695526		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:23578024_23578025insTTG								None (None upstream) : NRSN1 (548389 downstream)																							AATTTGtgtttttgttgttgtt	0.228													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	32445857	32445857	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32445857delA								HLA-DRA (33036 upstream) : HLA-DRB1 (39306 downstream)																							aggtctgaataagggccatta	0.000													4	2	---	---	---	---	
HLA-DRB5	3127	broad.mit.edu	37	6	32547921	32547922	+	Intron	INS	-	AGAC	AGAC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32547921_32547922insAGAC	uc003obk.3	-						HLA-DRB1_uc011dqa.1_Intron|HLA-DRB6_uc003obo.1_Intron|uc010jub.1_5'Flank|HLA-DRB1_uc003obp.3_Intron|HLA-DRB1_uc011dqb.1_Intron	NM_002125	NP_002116	Q30154	DRB5_HUMAN	major histocompatibility complex, class II, DR						antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|immune response	endoplasmic reticulum membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						aacctcttgtaagaaaagttct	0.074													4	2	---	---	---	---	
VEGFA	7422	broad.mit.edu	37	6	43754177	43754177	+	3'UTR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43754177delA	uc003owh.2	+	8					VEGFA_uc003owd.2_3'UTR|VEGFA_uc003owf.2_3'UTR|VEGFA_uc003owe.2_3'UTR|VEGFA_uc003owg.2_3'UTR|VEGFA_uc003owi.2_3'UTR|VEGFA_uc003owj.2_3'UTR|VEGFA_uc010jyx.2_3'UTR|VEGFA_uc003owk.2_RNA	NM_001025366	NP_001020537	P15692	VEGFA_HUMAN	vascular endothelial growth factor A isoform a						basophil chemotaxis|cellular response to hypoxia|induction of positive chemotaxis|induction of positive chemotaxis|platelet activation|platelet degranulation|platelet-derived growth factor receptor signaling pathway|positive regulation of angiogenesis|positive regulation of blood vessel endothelial cell migration|positive regulation of cell adhesion|positive regulation of cell division|positive regulation of endothelial cell proliferation|positive regulation of leukocyte migration|positive regulation of mast cell chemotaxis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of vascular endothelial growth factor receptor signaling pathway|positive regulation of vascular permeability|regulation of cell shape|vascular endothelial growth factor receptor signaling pathway|vasculogenesis	cell surface|extracellular space|membrane|platelet alpha granule lumen	cell surface binding|chemoattractant activity|cytokine activity|fibronectin binding|growth factor activity|heparin binding|platelet-derived growth factor receptor binding|protein heterodimerization activity|protein homodimerization activity|vascular endothelial growth factor receptor 1 binding|vascular endothelial growth factor receptor 2 binding|vascular endothelial growth factor receptor binding			ovary(1)|breast(1)	2	all_cancers(18;5.46e-07)|all_epithelial(2;5.96e-08)|Lung NSC(15;0.000157)|all_lung(25;0.000486)|Hepatocellular(11;0.00309)		all cancers(41;0.000413)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0742)|OV - Ovarian serous cystadenocarcinoma(102;0.196)		Atorvastatin(DB01076)|Bevacizumab(DB00112)|Carvedilol(DB01136)|Ginkgo biloba(DB01381)|Gliclazide(DB01120)|Minocycline(DB01017)|Ranibizumab(DB01270)|Simvastatin(DB00641)	GATATATCTTAAAAAAAAAAA	0.318													4	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57402197	57402197	+	Intron	DEL	T	-	-	rs68138830		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57402197delT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		tatacatggatttttaactgt	0.000													5	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57415142	57415142	+	Intron	DEL	A	-	-	rs11346545		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57415142delA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		CTTTTCATTTAAAAAGTATAA	0.338													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57445155	57445155	+	Intron	DEL	C	-	-	rs71309377		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57445155delC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTTTTTTTTTCGATACATTTC	0.303													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57503574	57503575	+	Intron	INS	-	A	A	rs150588289		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57503574_57503575insA	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AATTATCTCTGAAAAAAAGGCA	0.198													3	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57504123	57504123	+	Intron	DEL	C	-	-	rs113225647		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57504123delC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		gtagataaatccacaaagact	0.000													8	6	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57511895	57511896	+	Intron	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57511895_57511896delAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		Tcacacacatacacacacacac	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57515828	57515828	+	IGR	DEL	C	-	-	rs11292500		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57515828delC								PRIM2 (2453 upstream) : GUSBL2 (730331 downstream)																							AAGCAAACTTCTGTAATTCTT	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57525749	57525750	+	IGR	INS	-	C	C	rs149294374		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57525749_57525750insC								PRIM2 (12374 upstream) : GUSBL2 (720409 downstream)																							ttgattttttttgatgggctta	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57527646	57527646	+	IGR	DEL	G	-	-	rs61665278		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57527646delG								PRIM2 (14271 upstream) : GUSBL2 (718513 downstream)																							AAATGATGATGAGTCACTTTG	0.408													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57544979	57544979	+	IGR	DEL	A	-	-	rs112612652		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57544979delA								PRIM2 (31604 upstream) : GUSBL2 (701180 downstream)																							aactagaaataagtaacagaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57856418	57856418	+	IGR	DEL	T	-	-	rs111732292		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57856418delT								PRIM2 (343043 upstream) : GUSBL2 (389741 downstream)																							CTTCTTCTTCTTTTTTTTTTT	0.279													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	58141113	58141114	+	IGR	INS	-	AGG	AGG			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:58141113_58141114insAGG								PRIM2 (627738 upstream) : GUSBL2 (105045 downstream)																							gaaaaagaagaagaagaaggag	0.144													4	2	---	---	---	---	
EYS	346007	broad.mit.edu	37	6	65749362	65749362	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:65749362delT	uc011dxu.1	-							NM_001142800	NP_001136272	Q5T1H1	EYS_HUMAN	eyes shut homolog isoform 1						response to stimulus|visual perception	extracellular region	calcium ion binding			lung(4)|ovary(1)|skin(1)	6						ccattatatgtttatacattt	0.000													4	2	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69578797	69578799	+	Intron	DEL	ATA	-	-	rs34955904		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69578797_69578799delATA	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GGACTTCCAGATAATGAtgtgtg	0.261													3	3	---	---	---	---	
BAI3	577	broad.mit.edu	37	6	69818438	69818439	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69818438_69818439delTG	uc003pev.3	+						BAI3_uc010kak.2_Intron	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				caccttattttgtgtgtgtgtg	0.050													4	2	---	---	---	---	
SLC17A5	26503	broad.mit.edu	37	6	74320415	74320415	+	Intron	DEL	A	-	-	rs10707321		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74320415delA	uc003phn.3	-						SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_Intron|SLC17A5_uc011dyo.1_Intron	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin						anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						ATTTCATGAGAAAAAAAAAAT	0.308													8	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	79262283	79262285	+	IGR	DEL	TTT	-	-	rs148355141		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79262283_79262285delTTT								None (None upstream) : IRAK1BP1 (314904 downstream)																							cctgggttaatttgcttaggata	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	84710735	84710735	+	IGR	DEL	T	-	-	rs66482032		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84710735delT								CYB5R4 (40591 upstream) : MRAP2 (32685 downstream)																							GAAAATCttcttttttttttt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	89802429	89802429	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:89802429delT								PNRC1 (7551 upstream) : SFRS13B (3250 downstream)																							TGAGTAACACttttttttttg	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95239129	95239136	+	IGR	DEL	TTACATTT	-	-	rs140762		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95239129_95239136delTTACATTT								TSG1 (752930 upstream) : MANEA (786277 downstream)																							GGGCTTTCTATTACATTTTTACATTTTT	0.293													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	95934245	95934246	+	IGR	INS	-	AC	AC	rs71705824		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:95934245_95934246insAC								None (None upstream) : MANEA (91167 downstream)																							tatgcatgtatacacatatgca	0.010													5	3	---	---	---	---	
C6orf167	253714	broad.mit.edu	37	6	97592889	97592889	+	3'UTR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:97592889delA	uc003ppb.2	-	25					C6orf167_uc011eaf.1_3'UTR	NM_198468	NP_940870	Q6ZRQ5	MMS22_HUMAN	hypothetical protein LOC253714						double-strand break repair via homologous recombination|replication fork processing	nuclear replication fork	protein binding				0		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.148)|Colorectal(196;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.0457)		TCTCCTTTGGAAAAAAAAAAC	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	104383401	104383401	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:104383401delA								None (None upstream) : HACE1 (792567 downstream)																							accataattgaaagggagggg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	105324172	105324174	+	IGR	DEL	TTG	-	-	rs116388527	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105324172_105324174delTTG								HACE1 (16378 upstream) : LIN28B (80749 downstream)																							aggtagttttttgttgttgttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	115968638	115968639	+	IGR	INS	-	AGC	AGC	rs141831731	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:115968638_115968639insAGC								None (None upstream) : FRK (294054 downstream)																							aatatttaccaagcaaatcaaa	0.000													4	2	---	---	---	---	
ARHGAP18	93663	broad.mit.edu	37	6	129968819	129968819	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129968819delA	uc003qbr.2	-						ARHGAP18_uc011ebw.1_Intron	NM_033515	NP_277050	Q8N392	RHG18_HUMAN	Rho GTPase activating protein 18						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			ovary(2)|skin(1)	3				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		TTTAATGTGTAAAAAAAAAAA	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	134377763	134377764	+	IGR	DEL	AT	-	-	rs34332025		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134377763_134377764delAT								SLC2A12 (3974 upstream) : SGK1 (112621 downstream)																							TTGCTATAACATGTGATAAATC	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	135553597	135553598	+	IGR	DEL	TG	-	-	rs56907719	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135553597_135553598delTG								MYB (13284 upstream) : MIR548A2 (6700 downstream)																							TTTGTGGGGTtgtgtgtgtgtg	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	139094629	139094630	+	Intron	INS	-	G	G	rs143951524	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:139094629_139094630insG	uc003qid.1	-						CCDC28A_uc003qie.2_5'Flank					Homo sapiens cDNA FLJ35273 fis, clone PROST2006020.																		AATTGTAGTTCGGGGGGGGAAT	0.554													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140449965	140449965	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140449965delC								CITED2 (754180 upstream) : None (None downstream)																							acagagttgtcccacaactgt	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	140843372	140843372	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:140843372delT								None (None upstream) : None (None downstream)																							CCGTAGACCCTTTTAACATAG	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	141880663	141880666	+	IGR	DEL	CTAT	-	-	rs71656105		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:141880663_141880666delCTAT								None (None upstream) : NMBR (516080 downstream)																							AGAtatctacctatctatctatct	0.270													4	2	---	---	---	---	
HIVEP2	3097	broad.mit.edu	37	6	143203584	143203585	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:143203584_143203585insA	uc003qjd.2	-							NM_006734	NP_006725	P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)|central_nervous_system(1)	6				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		cctgtttccacaaaaaataaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	147394865	147394865	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:147394865delT	uc003qlt.1	-						uc003qlu.1_Intron|uc003qlv.2_Intron					Homo sapiens cDNA FLJ34275 fis, clone FEBRA2003454.																		CCATGGCACCTTTTGCTCACT	0.418													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	153133030	153133031	+	IGR	INS	-	TTCT	TTCT	rs144267325	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153133030_153133031insTTCT								VIP (52132 upstream) : FBXO5 (158629 downstream)																							tcctcccttccttcctttcttc	0.050													7	4	---	---	---	---	
RGS17	26575	broad.mit.edu	37	6	153356131	153356131	+	Intron	DEL	A	-	-	rs66879058		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153356131delA	uc003qpm.2	-							NM_012419	NP_036551	Q9UGC6	RGS17_HUMAN	regulator of G-protein signalling 17						negative regulation of signal transduction	cytoplasm|nucleus|plasma membrane	GTPase activator activity|signal transducer activity			pancreas(1)	1		Ovarian(120;0.126)		OV - Ovarian serous cystadenocarcinoma(155;1.09e-09)|BRCA - Breast invasive adenocarcinoma(81;0.0429)		ctaaaaatacaaaaaaaaatt	0.000									Lung_Cancer_Familial_Clustering_of				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	156447305	156447306	+	IGR	DEL	CA	-	-	rs66726286		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:156447305_156447306delCA								MIR1202 (179292 upstream) : ARID1B (651780 downstream)																							GAATATCAGTcacacacacaca	0.332													4	2	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157228877	157228877	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157228877delA	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		ctaaaaatgcaaaaaaaaaaa	0.000													6	3	---	---	---	---	
PACRG	135138	broad.mit.edu	37	6	163218960	163218960	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:163218960delG	uc003qua.2	+						PACRG_uc003qub.2_Intron|PACRG_uc003quc.2_Intron	NM_152410	NP_689623	Q96M98	PACRG_HUMAN	parkin co-regulated gene protein isoform 1												0		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		cataattcttggtctcctttc	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	164459260	164459261	+	IGR	DEL	AG	-	-	rs137858446		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:164459260_164459261delAG								QKI (464368 upstream) : None (None downstream)																							ATGGGCAGGCAGAGATCAGTGG	0.540													3	4	---	---	---	---	
TCP10L2	401285	broad.mit.edu	37	6	167583316	167583317	+	5'Flank	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167583316_167583317insT	uc010kkp.2	+							NM_001145121	NP_001138593	B9ZVM9	B9ZVM9_HUMAN	t-complex 10-like 2												0						CACACACAACCCTCACACACCT	0.416													3	3	---	---	---	---	
SMOC2	64094	broad.mit.edu	37	6	168919705	168919710	+	Intron	DEL	ATGTGT	-	-	rs142937762		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:168919705_168919710delATGTGT	uc003qws.1	+						SMOC2_uc003qwr.1_Intron	NM_022138	NP_071421	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						signal transduction	basement membrane	calcium ion binding			ovary(1)	1		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		gcatgcgaacatgtgtgtgtatgtgt	0.000													5	4	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	1906986	1906987	+	Intron	INS	-	A	A	rs78147760		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1906986_1906987insA	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc003sld.1_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		AGGACCCCCCCGGAAGATGTAG	0.649													4	2	---	---	---	---	
MAD1L1	8379	broad.mit.edu	37	7	2073856	2073857	+	Intron	INS	-	TT	TT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2073856_2073857insTT	uc003slh.1	-						MAD1L1_uc003sle.1_Intron|MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Intron|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		aaagagtctccttttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	2435348	2435349	+	IGR	INS	-	AT	AT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2435348_2435349insAT								EIF3B (14973 upstream) : CHST12 (7874 downstream)																							tggatagatagatacatagatc	0.000													3	3	---	---	---	---	
SDK1	221935	broad.mit.edu	37	7	4258025	4258025	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4258025delA	uc003smx.2	+						SDK1_uc010kso.2_Intron|SDK1_uc003smy.2_Intron	NM_152744	NP_689957	Q7Z5N4	SDK1_HUMAN	sidekick 1 precursor						cell adhesion	integral to membrane				large_intestine(3)|ovary(2)|skin(1)	6		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		actccgtctcaaaaaaaaaaa	0.129													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	4380520	4380520	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:4380520delT								SDK1 (71891 upstream) : FOXK1 (302868 downstream)																							ctatgccttcttttttttttt	0.000													5	3	---	---	---	---	
LOC389458	389458	broad.mit.edu	37	7	5056861	5056861	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5056861delA	uc003snr.2	+											Synthetic construct DNA, clone: pF1KB3788, Homo sapiens RBAK gene for RB-associated KRAB repressor, complete cds, without stop codon, in Flexi system.												0						ctccatctcgaaagagagaaa	0.209													4	2	---	---	---	---	
TNRC18	84629	broad.mit.edu	37	7	5382884	5382885	+	Intron	INS	-	TT	TT	rs144217599	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5382884_5382885insTT	uc003soi.3	-							NM_001080495	NP_001073964	O15417	TNC18_HUMAN	trinucleotide repeat containing 18								DNA binding				0		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		actcgggaggctgaggcaggag	0.000													3	3	---	---	---	---	
RNF216	54476	broad.mit.edu	37	7	5780328	5780329	+	Intron	INS	-	A	A	rs6952587		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5780328_5780329insA	uc003soy.1	-						RNF216_uc010ksz.1_Intron|RNF216_uc010kta.1_Intron|RNF216_uc011jwj.1_Intron|RNF216_uc003sox.1_Intron	NM_207116	NP_996999	Q9NWF9	RN216_HUMAN	ring finger protein 216 isoform b						apoptosis|interspecies interaction between organisms|proteasomal ubiquitin-dependent protein catabolic process|protein K48-linked ubiquitination|regulation of defense response to virus by host|regulation of interferon-beta production	cytoplasm|nucleus|nucleus	ligase activity|protein binding|protein binding|zinc ion binding			ovary(3)|breast(2)	5		Ovarian(82;0.07)		UCEC - Uterine corpus endometrioid carcinoma (126;0.135)|OV - Ovarian serous cystadenocarcinoma(56;2.69e-13)		CAAGGAATTTGAAAAAAACAAG	0.332													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	13290579	13290579	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13290579delT								ARL4A (560023 upstream) : ETV1 (640279 downstream)																							ttctcttgaatttttttgaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	15092375	15092375	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:15092375delG								DGKB (149825 upstream) : TMEM195 (147568 downstream)																							tcaggctgaagtgcgatggtg	0.000													4	2	---	---	---	---	
HDAC9	9734	broad.mit.edu	37	7	18826460	18826463	+	Intron	DEL	TTCC	-	-	rs5022872	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18826460_18826463delTTCC	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc003sua.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	ccttccttcattccttccttcctt	0.201													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	21158215	21158215	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21158215delG								RPL23P8 (290776 upstream) : SP4 (309474 downstream)																							CCTCAACCCAGGGGTCATTGT	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	23124221	23124221	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23124221delG								FAM126A (70451 upstream) : KLHL7 (21132 downstream)																							tcagaacactgggcaatcctt	0.000													4	2	---	---	---	---	
KLHL7	55975	broad.mit.edu	37	7	23144372	23144373	+	5'Flank	INS	-	CAC	CAC	rs145460085	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23144372_23144373insCAC	uc003svr.3	+						KLHL7_uc003svs.3_5'Flank|KLHL7_uc011jys.1_5'Flank|KLHL7_uc011jyt.1_5'Flank|KLHL7_uc003svt.2_5'Flank|uc003svo.1_Intron|KLHL7_uc003svp.2_5'Flank|KLHL7_uc003svq.2_5'Flank|KLHL7_uc011jyu.1_5'Flank	NM_018846	NP_061334	Q8IXQ5	KLHL7_HUMAN	kelch-like 7 isoform 2							Golgi apparatus|nucleolus|plasma membrane					0						tgtgacctcttcaccaccacca	0.000													6	3	---	---	---	---	
SKAP2	8935	broad.mit.edu	37	7	26814119	26814120	+	Intron	DEL	TG	-	-	rs10551497		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:26814119_26814120delTG	uc003syc.2	-						SKAP2_uc011jzi.1_Intron|SKAP2_uc011jzj.1_Intron	NM_003930	NP_003921	O75563	SKAP2_HUMAN	src kinase associated phosphoprotein 2						B cell activation|cell junction assembly|protein complex assembly|signal transduction	cytosol|plasma membrane	SH3/SH2 adaptor activity			pancreas(1)	1						AAGATCAAGTTGtgtgtgtgtg	0.307													3	3	---	---	---	---	
HOXA9	3205	broad.mit.edu	37	7	27206436	27206437	+	5'Flank	INS	-	TAC	TAC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27206436_27206437insTAC	uc003syt.2	-							NM_152739	NP_689952	P31269	HXA9_HUMAN	homeobox A9								protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)|central_nervous_system(1)	2						CTCGCCTTGGTTACCTACGGGG	0.644			T	NUP98|MSI2	AML*								2	4	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28396545	28396545	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28396545delT	uc003szo.2	+							NM_182899	NP_878902	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GTTATCACCATAAAGAAGGGC	0.483													4	3	---	---	---	---	
CREB5	9586	broad.mit.edu	37	7	28649882	28649882	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28649882delG	uc003szq.2	+						CREB5_uc003szo.2_Intron|CREB5_uc003szr.2_Intron	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5						positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GGAGGGGCCAGAGGGAAGGCG	0.517													4	2	---	---	---	---	
GGCT	79017	broad.mit.edu	37	7	30544197	30544198	+	Frame_Shift_Del	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30544197_30544198delCA	uc003tba.2	-	1	255_256	c.128_129delTG	c.(127-129)GTGfs	p.V43fs	GGCT_uc003tbb.2_Frame_Shift_Del_p.V43fs|GGCT_uc003tbc.2_RNA	NM_024051	NP_076956	O75223	GGCT_HUMAN	gamma-glutamyl cyclotransferase	43					release of cytochrome c from mitochondria	cytosol	acyltransferase activity|gamma-glutamylcyclotransferase activity|protein homodimerization activity				0						GCAGGCGGGCCACACAGAAGAA	0.668													26	14	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	31489981	31489981	+	IGR	DEL	T	-	-	rs35899147		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31489981delT								NEUROD6 (109443 upstream) : CCDC129 (63704 downstream)																							acttcccccctcttccctgga	0.000													3	4	---	---	---	---	
PDE1C	5137	broad.mit.edu	37	7	32264955	32264956	+	Intron	DEL	CA	-	-	rs66924231		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32264955_32264956delCA	uc003tco.1	-							NM_005020	NP_005011	Q14123	PDE1C_HUMAN	phosphodiesterase 1C						activation of phospholipase C activity|nerve growth factor receptor signaling pathway	cytosol	calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(3)|central_nervous_system(1)	4			GBM - Glioblastoma multiforme(11;0.216)			ATTCAacatgcacacacacaca	0.272													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	32398469	32398469	+	IGR	DEL	A	-	-	rs71559223		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32398469delA								PDE1C (59528 upstream) : LSM5 (126476 downstream)																							tcCATAGCATACCTCATCATC	0.070													3	3	---	---	---	---	
AVL9	23080	broad.mit.edu	37	7	32636737	32636737	+	Intron	DEL	A	-	-	rs77852075		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32636737delA	uc011kai.1	+						uc003tcw.2_Intron	NM_015060	NP_055875	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)							integral to membrane					0						CCTGGAATTTaaaaaaaaaaa	0.199													3	3	---	---	---	---	
BMPER	168667	broad.mit.edu	37	7	33990664	33990664	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:33990664delT	uc011kap.1	+							NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor						blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CTGGTGGGACttttttttttt	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	35573721	35573724	+	IGR	DEL	TCTG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35573721_35573724delTCTG								TBX20 (280479 upstream) : HERPUD2 (98548 downstream)																							ccccctttgttctgtctttctcct	0.000													4	2	---	---	---	---	
SEPT7	989	broad.mit.edu	37	7	35849937	35849937	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:35849937delT	uc010kxc.2	+						SEPT7_uc011kat.1_Intron|SEPT7_uc011kau.1_Intron	NM_001788	NP_001779	Q16181	SEPT7_HUMAN	cell division cycle 10 isoform 1						cilium morphogenesis|cytokinesis|mitosis|protein heterooligomerization|regulation of embryonic cell shape	cilium axoneme|cleavage furrow|condensed chromosome kinetochore|midbody|nucleus|septin complex|spindle|stress fiber	GTP binding|protein binding|structural molecule activity				0						AAATGtttccttttttttttt	0.169													4	2	---	---	---	---	
VWC2	375567	broad.mit.edu	37	7	49913777	49913778	+	Intron	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:49913777_49913778delCA	uc003tot.1	+							NM_198570	NP_940972	Q2TAL6	VWC2_HUMAN	von Willebrand factor C domain containing 2						negative regulation of BMP signaling pathway|positive regulation of neuron differentiation	basement membrane|extracellular space					0						tgcacacacccacacacacaca	0.198													5	3	---	---	---	---	
COBL	23242	broad.mit.edu	37	7	51085963	51085968	+	Intron	DEL	TGGTGA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:51085963_51085968delTGGTGA	uc003tpr.3	-						COBL_uc003tps.2_Intron|COBL_uc011kcl.1_Intron|COBL_uc003tpp.3_Intron|COBL_uc003tpq.3_Intron|COBL_uc003tpo.3_Intron	NM_015198	NP_056013	O75128	COBL_HUMAN	cordon-bleu homolog											skin(3)|ovary(2)	5	Glioma(55;0.08)					gtggtggtggtggtgatggtgatggt	0.175													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57609986	57609986	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57609986delG								ZNF716 (76721 upstream) : None (None downstream)																							GAGAAATGCTGTACAGTATCA	0.318													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57701099	57701099	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57701099delT								ZNF716 (167834 upstream) : None (None downstream)																							ctggccCAAGTTTTTTTCTAT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57703982	57703997	+	IGR	DEL	ATAAATAAATAAATAC	-	-	rs62450250		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57703982_57703997delATAAATAAATAAATAC								ZNF716 (170717 upstream) : None (None downstream)																							TTCTCTGAAAataaataaataaatacatacatacat	0.231													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57996510	57996510	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57996510delG								ZNF716 (463245 upstream) : None (None downstream)																							tggcctcaaagctctccaaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61817477	61817477	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61817477delT								None (None upstream) : LOC643955 (934195 downstream)																							CAATAAGAGCTTTTTGCTTAA	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61836631	61836632	+	IGR	INS	-	AA	AA			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61836631_61836632insAA								None (None upstream) : LOC643955 (915040 downstream)																							CTCTTCTGTGGAGAAAACACAG	0.277													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61889846	61889846	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61889846delC								None (None upstream) : LOC643955 (861826 downstream)																							agagttaaaacttccttttga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	62047713	62047713	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:62047713delA								None (None upstream) : LOC643955 (703959 downstream)																							ttcctttttcaccataggcct	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67511724	67511725	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67511724_67511725insA								STAG3L4 (725212 upstream) : None (None downstream)																							aaaacaaaaacaaaaaaaaaCC	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67729993	67729993	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67729993delA								STAG3L4 (943481 upstream) : None (None downstream)																							CTTTGGAGGCAAAAAAAATCA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67831043	67831044	+	IGR	DEL	CA	-	-	rs34490543		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67831043_67831044delCA								None (None upstream) : None (None downstream)																							cactgcattccacacagagttt	0.000													0	6	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71796333	71796333	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71796333delA	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				agactccatcaaaaaaaagaa	0.174													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	72840444	72840444	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72840444delT								FKBP6 (67803 upstream) : FZD9 (7665 downstream)																							ACTCGCTGTCttttttttttt	0.224													4	2	---	---	---	---	
YWHAG	7532	broad.mit.edu	37	7	75960603	75960604	+	Intron	INS	-	GGAGAGGAGA	GGAGAGGAGA	rs150745881	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75960603_75960604insGGAGAGGAGA	uc011kgj.1	-							NM_012479	NP_036611	P61981	1433G_HUMAN	tyrosine 3-monooxygenase/tryptophan						G2/M transition of mitotic cell cycle|regulation of neuron differentiation|regulation of signal transduction|regulation of synaptic plasticity	cytosol	insulin-like growth factor receptor binding|protein kinase C binding|protein kinase C inhibitor activity			ovary(1)|lung(1)	2						GCTGGGGATGGggagaggagag	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79546952	79546952	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79546952delA								MAGI2 (464062 upstream) : GNAI1 (217188 downstream)																							ttaacaccccactgccagtat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	79658238	79658241	+	IGR	DEL	CTTC	-	-	rs68077809		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:79658238_79658241delCTTC								MAGI2 (575348 upstream) : GNAI1 (105899 downstream)																							tgtctttcttcttccttccttcct	0.098													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	82233344	82233344	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82233344delA								CACNA2D1 (160313 upstream) : PCLO (149977 downstream)																							acttattgtgaggattacatg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	85907324	85907325	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:85907324_85907325insA								None (None upstream) : GRM3 (365905 downstream)																							GAGAGAGAGAGAGAAAAAAAAT	0.386													2	5	---	---	---	---	
GRM3	2913	broad.mit.edu	37	7	86402301	86402301	+	Intron	DEL	T	-	-	rs10262456	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86402301delT	uc003uid.2	+						GRM3_uc010lef.2_Intron|GRM3_uc010leg.2_Intron|GRM3_uc010leh.2_Intron	NM_000840	NP_000831	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3 precursor						synaptic transmission	integral to plasma membrane				lung(4)|ovary(3)|central_nervous_system(2)|skin(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)	13	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)				Acamprosate(DB00659)|Nicotine(DB00184)	taaaactgagtttttttttta	0.100													4	2	---	---	---	---	
CDK14	5218	broad.mit.edu	37	7	90833572	90833572	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:90833572delC	uc003uky.2	+						CDK14_uc003ukz.1_Intron|CDK14_uc010les.1_Intron|CDK14_uc011khl.1_Intron	NM_012395	NP_036527	O94921	CDK14_HUMAN	PFTAIRE protein kinase 1						cell division|G2/M transition of mitotic cell cycle|regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway	cytoplasmic cyclin-dependent protein kinase holoenzyme complex|nucleus|plasma membrane	ATP binding|cyclin binding|cyclin-dependent protein kinase activity			lung(3)|ovary(1)	4						ctacctcataccatatacaaa	0.169													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	91065408	91065408	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:91065408delC								FZD1 (167277 upstream) : MTERF (366052 downstream)																							AGTGtgctgtccccacctcat	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98100991	98100992	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98100991_98100992insT								BAIAP2L1 (70564 upstream) : NPTX2 (145605 downstream)																							tcatttgatccttttttttttt	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98106051	98106051	+	IGR	DEL	G	-	-	rs34234451		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98106051delG								BAIAP2L1 (75624 upstream) : NPTX2 (140546 downstream)																							GATCATGGGTGGGGGGGGGGT	0.542													4	3	---	---	---	---	
CDHR3	222256	broad.mit.edu	37	7	105629666	105629667	+	Intron	INS	-	CA	CA	rs145755625	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105629666_105629667insCA	uc003vdl.3	+						CDHR3_uc003vdk.2_Intron|CDHR3_uc011kls.1_Intron|CDHR3_uc003vdm.3_Intron|CDHR3_uc011klt.1_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GTACCCACCCCCCCACCTCTTC	0.485													4	2	---	---	---	---	
CDHR3	222256	broad.mit.edu	37	7	105638246	105638247	+	Intron	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:105638246_105638247delAG	uc003vdl.3	+						CDHR3_uc003vdk.2_Intron|CDHR3_uc011kls.1_Intron|CDHR3_uc003vdm.3_Intron|CDHR3_uc011klt.1_Intron	NM_152750	NP_689963	Q6ZTQ4	CDHR3_HUMAN	hypothetical protein LOC222256 precursor						homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(1)	1						GACTTTTAGCAGAGAGAGAGAG	0.465													4	2	---	---	---	---	
IMMP2L	83943	broad.mit.edu	37	7	111025979	111025979	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111025979delT	uc003vfq.1	-						IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron	NM_032549	NP_115938	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane protease-like						protein processing involved in protein targeting to mitochondrion|proteolysis	integral to membrane|mitochondrial inner membrane peptidase complex|nucleus	serine-type peptidase activity				0				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		TCCACATGAAttttttttttt	0.189													4	2	---	---	---	---	
IFRD1	3475	broad.mit.edu	37	7	112074050	112074050	+	Intron	DEL	T	-	-	rs35432506		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:112074050delT	uc003vgh.2	+						IFRD1_uc011kmn.1_Intron	NM_001007245	NP_001007246	O00458	IFRD1_HUMAN	interferon-related developmental regulator 1						multicellular organismal development|myoblast cell fate determination		binding			kidney(1)|central_nervous_system(1)	2						aatttttgtatttttttttta	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119260478	119260479	+	IGR	INS	-	CA	CA			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119260478_119260479insCA								None (None upstream) : KCND2 (653243 downstream)																							GTGTGCACGTGcacacacacac	0.218													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119395073	119395074	+	IGR	INS	-	T	T	rs150861297	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119395073_119395074insT								None (None upstream) : KCND2 (518648 downstream)																							TGCTCCGTCAGTTTTTTCACAA	0.376													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	119896438	119896438	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119896438delT								None (None upstream) : KCND2 (17284 downstream)																							agtttgaaacttactagaaac	0.000													4	2	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121513382	121513383	+	5'UTR	INS	-	CA	CA	rs146505882	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121513382_121513383insCA	uc003vjy.2	+	1					PTPRZ1_uc003vjz.2_5'UTR	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						tctctctctctcacacacacac	0.243													4	2	---	---	---	---	
GRM8	2918	broad.mit.edu	37	7	126261785	126261786	+	Intron	INS	-	A	A	rs144861483		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:126261785_126261786insA	uc003vlr.2	-						GRM8_uc003vls.2_Intron|GRM8_uc011kof.1_Intron|GRM8_uc003vlt.2_Intron|GRM8_uc010lkz.1_Intron	NM_000845	NP_000836	O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8 isoform a						negative regulation of cAMP biosynthetic process|sensory perception of smell|visual perception	integral to plasma membrane				lung(15)|ovary(5)|pancreas(1)|breast(1)|skin(1)	23		Prostate(267;0.186)			L-Glutamic Acid(DB00142)	aatcaccatttaaaaaaaaaaa	0.000										HNSCC(24;0.065)			1	5	---	---	---	---	
FSCN3	29999	broad.mit.edu	37	7	127234214	127234215	+	Intron	INS	-	TG	TG	rs72287259		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127234214_127234215insTG	uc003vmd.1	+						FSCN3_uc003vmc.1_Intron|FSCN3_uc011kog.1_Intron|FSCN3_uc011koh.1_Intron|FSCN3_uc010llc.1_Intron	NM_020369	NP_065102	Q9NQT6	FSCN3_HUMAN	fascin 3							actin cytoskeleton|cytoplasm	actin filament binding|protein binding, bridging			ovary(1)	1						AGTGGCCAAGCtgtgtgtgtgt	0.223													4	2	---	---	---	---	
KCP	375616	broad.mit.edu	37	7	128550051	128550051	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:128550051delG	uc011kor.1	-						KCP_uc011kos.1_Intron	NM_001135914	NP_001129386	Q6ZWJ8	KCP_HUMAN	cysteine rich BMP regulator 2 isoform 1							extracellular region				central_nervous_system(1)	1						CTGCTGCCCAGGGCCCCTCCT	0.612													4	2	---	---	---	---	
NUP205	23165	broad.mit.edu	37	7	135287859	135287860	+	Intron	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135287859_135287860delAC	uc003vsw.2	+							NM_015135	NP_055950	Q92621	NU205_HUMAN	nucleoporin 205kDa						carbohydrate metabolic process|glucose transport|mRNA transport|protein import into nucleus, docking|regulation of glucose transport|transmembrane transport|viral reproduction	nuclear pore	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6						GCCTCAttttactttttttttt	0.153													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	137803958	137803961	+	IGR	DEL	AGGG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:137803958_137803961delAGGG								AKR1D1 (908 upstream) : TRIM24 (341118 downstream)																							gaaggaaggaagggagggagggag	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142166551	142166551	+	Intron	DEL	A	-	-	rs74213276		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142166551delA	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CCATGCACAGAGCTGCTCAGA	0.567													4	2	---	---	---	---	
CHPF2	54480	broad.mit.edu	37	7	150931964	150931965	+	Intron	INS	-	CA	CA	rs72573487	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150931964_150931965insCA	uc003wjr.1	+						CHPF2_uc003wjq.1_Intron	NM_019015	NP_061888	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2							Golgi cisterna membrane|integral to membrane	N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity			ovary(1)	1						CAAATCAATTCGTGTCAGCTAC	0.426													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	156309879	156309892	+	IGR	DEL	TGTGTGAGGGAGGC	-	-	rs72225753		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156309879_156309892delTGTGTGAGGGAGGC								SHH (704912 upstream) : C7orf4 (23293 downstream)																							TCATGAAGGTTGTGTGAGGGAGGCTGTGTGAGGG	0.603													1	5	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	2813342	2813343	+	Intron	DEL	AT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2813342_2813343delAT	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		AAGTTAGCACATGTGTCTAGAG	0.307													27	18	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3992852	3992853	+	Intron	INS	-	GGGGAAGG	GGGGAAGG	rs139140204	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3992852_3992853insGGGGAAGG	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		gagcgaaggaaggggaaagaag	0.074													4	2	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	9985891	9985891	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:9985891delA	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	ctcttgtctcaaaaaaaaaaa	0.159													4	2	---	---	---	---	
MSRA	4482	broad.mit.edu	37	8	10157635	10157638	+	Intron	DEL	TGTG	-	-	rs72441649		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10157635_10157638delTGTG	uc003wsx.2	+						MSRA_uc011kwx.1_Intron|MSRA_uc011kwy.1_Intron|MSRA_uc003wsz.2_Intron|MSRA_uc003wsy.2_Intron	NM_012331	NP_036463	Q9UJ68	MSRA_HUMAN	methionine sulfoxide reductase A isoform a						methionine metabolic process|protein modification process|response to oxidative stress	mitochondrion|nucleus	peptide-methionine-(S)-S-oxide reductase activity				0		Myeloproliferative disorder(644;0.178)			L-Methionine(DB00134)	GGAAGAAATTtgtgtgtgtgtgtg	0.206													4	2	---	---	---	---	
FAM66D	100132923	broad.mit.edu	37	8	12019464	12019464	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:12019464delA	uc011kxp.1	+											Homo sapiens cDNA FLJ37098 fis, clone BRACE2019004.												0						TCATAAAAACAAAAAAAAAAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	26327267	26327267	+	IGR	DEL	A	-	-	rs139544014		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:26327267delA								BNIP3L (56623 upstream) : PNMA2 (34929 downstream)																							taatcccagtactttgggagg	0.025													2	4	---	---	---	---	
NRG1	3084	broad.mit.edu	37	8	32349939	32349940	+	Intron	INS	-	T	T	rs112351125		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:32349939_32349940insT	uc003xip.2	+							NM_013962	NP_039256	Q02297	NRG1_HUMAN	neuregulin 1 isoform GGF2						activation of transmembrane receptor protein tyrosine kinase activity|anti-apoptosis|cardiac muscle cell differentiation|cell communication|cell proliferation|cellular protein complex disassembly|embryo development|mammary gland development|negative regulation of cardiac muscle cell apoptosis|negative regulation of secretion|negative regulation of transcription, DNA-dependent|nervous system development|neural crest cell development|Notch signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell adhesion|positive regulation of cell growth|positive regulation of striated muscle cell differentiation|regulation of protein heterodimerization activity|regulation of protein homodimerization activity|transmembrane receptor protein tyrosine kinase signaling pathway|ventricular cardiac muscle cell differentiation|wound healing|wound healing	apical plasma membrane|extracellular region|extracellular space|integral to membrane|nucleus|plasma membrane	cytokine activity|ErbB-3 class receptor binding|growth factor activity|growth factor activity|protein binding|protein tyrosine kinase activator activity|receptor tyrosine kinase binding|transcription cofactor activity|transmembrane receptor protein tyrosine kinase activator activity				0		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		TCCCTTTCATCTTTTTTTTTTT	0.361													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	34099666	34099667	+	IGR	INS	-	GAAGT	GAAGT	rs147605684	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34099666_34099667insGAAGT								DUSP26 (642227 upstream) : UNC5D (993308 downstream)																							agggagagaaagtgagagagag	0.153													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	34145506	34145506	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:34145506delA								DUSP26 (688067 upstream) : UNC5D (947469 downstream)																							TCATTTTCCTaaaaggccact	0.189													4	2	---	---	---	---	
KCNU1	157855	broad.mit.edu	37	8	36770121	36770122	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:36770121_36770122delTG	uc010lvw.2	+						KCNU1_uc003xjw.2_Intron	NM_001031836	NP_001027006	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1							voltage-gated potassium channel complex	binding|large conductance calcium-activated potassium channel activity|voltage-gated potassium channel activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		ACTCATCATTtgtgtgtgtgtg	0.282													4	3	---	---	---	---	
DDHD2	23259	broad.mit.edu	37	8	38096452	38096453	+	Intron	DEL	TG	-	-	rs35242983		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38096452_38096453delTG	uc003xlb.2	+						DDHD2_uc003xla.2_3'UTR|DDHD2_uc003xlc.2_Intron|DDHD2_uc011lbl.1_Intron	NM_015214	NP_056029	O94830	DDHD2_HUMAN	DDHD domain containing 2 isoform 1						lipid catabolic process	centrosome	hydrolase activity|metal ion binding			large_intestine(1)|ovary(1)	2	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			gaaaaataaatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ZMAT4	79698	broad.mit.edu	37	8	40390501	40390501	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40390501delA	uc003xnr.2	-						ZMAT4_uc003xns.2_Intron	NM_024645	NP_078921	Q9H898	ZMAT4_HUMAN	zinc finger, matrin type 4 isoform a							nucleus	DNA binding|zinc ion binding			pancreas(1)|central_nervous_system(1)|skin(1)	3	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			actccatgtcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	40986044	40986045	+	IGR	DEL	GT	-	-	rs71546348		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:40986044_40986045delGT								ZMAT4 (230701 upstream) : SFRP1 (133434 downstream)																							TTTTAGAGGGgtgtgtgtgtgt	0.114													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	41107888	41107888	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41107888delT								ZMAT4 (352545 upstream) : SFRP1 (11591 downstream)																							ttttaaaaaataaaaaaaaaa	0.000													4	2	---	---	---	---	
NKX6-3	157848	broad.mit.edu	37	8	41503854	41503857	+	3'UTR	DEL	AAAG	-	-	rs5891165		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41503854_41503857delAAAG	uc003xoa.2	-	2					NKX6-3_uc010lxa.1_3'UTR	NM_152568	NP_689781	A6NJ46	NKX63_HUMAN	NK6 homeobox 3							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.00541)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Esophageal squamous(32;0.0844)|Hepatocellular(245;0.154)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCCCTCATCCAAAGAAAGACTCAG	0.475													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	46869224	46869224	+	IGR	DEL	T	-	-	rs76498531		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:46869224delT								None (None upstream) : BEYLA (883284 downstream)																							actcacagagttgaacattcc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49826831	49826831	+	IGR	DEL	A	-	-	rs141577976		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49826831delA								EFCAB1 (178961 upstream) : SNAI2 (3408 downstream)																							ggaaaaaggcaaaaaaaAAAa	0.070													7	5	---	---	---	---	
SNTG1	54212	broad.mit.edu	37	8	51173070	51173071	+	Intron	INS	-	AC	AC	rs148412303	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:51173070_51173071insAC	uc010lxy.1	+						SNTG1_uc003xqs.1_Intron|SNTG1_uc010lxz.1_Intron|SNTG1_uc011ldl.1_Intron	NM_018967	NP_061840	Q9NSN8	SNTG1_HUMAN	syntrophin, gamma 1						cell communication	cytoplasm|cytoskeleton|nucleus|ruffle membrane|syntrophin complex	actin binding|protein C-terminus binding			ovary(5)	5		all_cancers(86;0.00754)|all_epithelial(80;9.76e-05)|Lung NSC(129;0.000865)|all_lung(136;0.00249)|Colorectal(162;0.22)				tccagcttttaacacacacaca	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	52027533	52027534	+	IGR	INS	-	T	T	rs150706359	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52027533_52027534insT								SNTG1 (322106 upstream) : PXDNL (204610 downstream)																							TTGTTTGTTTGTTTTTTGGCTT	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53354225	53354225	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53354225delA								ST18 (31786 upstream) : FAM150A (92373 downstream)																							agactccctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TGS1	96764	broad.mit.edu	37	8	56687800	56687800	+	Intron	DEL	A	-	-	rs112803051		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:56687800delA	uc003xsj.3	+						TMEM68_uc003xsh.1_5'Flank|TMEM68_uc003xsi.1_5'Flank|TGS1_uc010lyh.2_Intron	NM_024831	NP_079107	Q96RS0	TGS1_HUMAN	trimethylguanosine synthase homolog						cellular lipid metabolic process|ncRNA metabolic process|regulation of transcription, DNA-dependent|RNA capping|spliceosomal snRNP assembly|transcription, DNA-dependent	Cajal body|cytosol	RNA trimethylguanosine synthase activity			ovary(1)|lung(1)|breast(1)	3		all_lung(136;0.119)|all_epithelial(80;0.125)|Lung NSC(129;0.147)	Epithelial(17;0.00027)|all cancers(17;0.00251)			ctctgtcccgaaaaaaaaaaa	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	58633568	58633568	+	IGR	DEL	A	-	-	rs111578705		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:58633568delA								C8orf71 (436280 upstream) : FAM110B (273545 downstream)																							TTCTTACATTAAAAAAAAAAA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	60883663	60883664	+	IGR	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:60883663_60883664delAG								TOX (851896 upstream) : CA8 (217759 downstream)																							agtcaagtgaagagagagagag	0.000													4	2	---	---	---	---	
YTHDF3	253943	broad.mit.edu	37	8	64118642	64118643	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64118642_64118643insT	uc003xuy.2	+						YTHDF3_uc010lys.2_Intron|YTHDF3_uc003xuz.2_Intron|YTHDF3_uc003xva.2_Intron|YTHDF3_uc011len.1_Intron	NM_152758	NP_689971	Q7Z739	YTHD3_HUMAN	YTH domain family, member 3												0	Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			gttttgttttgttttttgagac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	66235013	66235013	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:66235013delA								CYP7B1 (523665 upstream) : ARMC1 (280059 downstream)																							AACAAAACAGAAACCTCAAGT	0.403													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68880305	68880306	+	Intron	INS	-	A	A	rs34592130		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68880305_68880306insA	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						acttaaagtataaaaaaaaaaa	0.218													4	2	---	---	---	---	
PREX2	80243	broad.mit.edu	37	8	68934554	68934554	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68934554delG	uc003xxv.1	+						PREX2_uc003xxu.1_Intron|PREX2_uc011lez.1_Intron	NM_024870	NP_079146	Q70Z35	PREX2_HUMAN	DEP domain containing 2 isoform a						G-protein coupled receptor protein signaling pathway|intracellular signal transduction	intracellular	protein binding|Rac GTPase activator activity|Rac guanyl-nucleotide exchange factor activity			skin(6)|large_intestine(4)|pancreas(3)|lung(2)|ovary(1)|kidney(1)	17						GCTTGTGTTTGGGGAAGTACT	0.483													6	3	---	---	---	---	
SULF1	23213	broad.mit.edu	37	8	70424807	70424807	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70424807delT	uc010lza.1	+						SULF1_uc003xyd.2_Intron|SULF1_uc003xye.2_Intron|SULF1_uc003xyf.2_Intron|SULF1_uc003xyg.2_Intron	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor						apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			gataacagcatttacctcata	0.085													4	2	---	---	---	---	
STAU2	27067	broad.mit.edu	37	8	74514963	74514964	+	Intron	INS	-	A	A	rs35280918		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74514963_74514964insA	uc003xzm.2	-						STAU2_uc011lfg.1_Intron|STAU2_uc003xzn.2_Intron|STAU2_uc011lfh.1_Intron|STAU2_uc003xzo.2_Intron|STAU2_uc003xzp.2_Intron|STAU2_uc011lfi.1_Intron|STAU2_uc003xzq.2_Intron|STAU2_uc010lzk.2_Intron|STAU2_uc010lzl.1_Intron	NM_014393	NP_055208	Q9NUL3	STAU2_HUMAN	staufen homolog 2 isoform e						transport	endoplasmic reticulum|microtubule|nucleolus	double-stranded RNA binding				0	Breast(64;0.0138)		Epithelial(68;0.026)|BRCA - Breast invasive adenocarcinoma(89;0.0483)|all cancers(69;0.0972)			gttgccccaccaaaaaaaaaaa	0.099													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74945069	74945069	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74945069delC								LY96 (3764 upstream) : JPH1 (201872 downstream)																							tgtgtgtgatccaaatacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	76131065	76131066	+	IGR	INS	-	GGAA	GGAA	rs148982283	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:76131065_76131066insGGAA								CRISPLD1 (184274 upstream) : HNF4G (189117 downstream)																							gaaggagagagggaaggaagga	0.025													8	4	---	---	---	---	
LOC100192378	100192378	broad.mit.edu	37	8	77548801	77548801	+	Intron	DEL	A	-	-	rs34686065		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77548801delA	uc003yas.3	-							NR_024360				Homo sapiens cDNA clone IMAGE:4811567.												0						tgtctctattaaaaaaaaaaa	0.000													3	3	---	---	---	---	
LOC100192378	100192378	broad.mit.edu	37	8	77581198	77581199	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:77581198_77581199delGT	uc003yas.3	-							NR_024360				Homo sapiens cDNA clone IMAGE:4811567.												0						GTTTGGGGGGGTGTGTGTGTGT	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	78199114	78199133	+	IGR	DEL	CAGGGGGAACTGGGAGCATT	-	-	rs72579714		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:78199114_78199133delCAGGGGGAACTGGGAGCATT								PEX2 (286590 upstream) : None (None downstream)																							tccatagagccagggggaactgggagcattcagggggaac	0.014													4	3	---	---	---	---	
ZNF704	619279	broad.mit.edu	37	8	81612064	81612074	+	Intron	DEL	CTCCCCACCCA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81612064_81612074delCTCCCCACCCA	uc003yby.1	-							NM_001033723	NP_001028895	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704							intracellular	zinc ion binding				0	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			TACAACTTCTCTCCCCACCCACTCTGCCCAC	0.502													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	89912359	89912360	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89912359_89912360insT								MMP16 (572642 upstream) : RIPK2 (857615 downstream)																							tccaaaagctgtttttttgaaa	0.000													4	2	---	---	---	---	
MATN2	4147	broad.mit.edu	37	8	98882039	98882039	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:98882039delT	uc003yic.2	+						MATN2_uc003yib.1_Intron|MATN2_uc010mbh.1_Intron|MATN2_uc003yid.2_Intron	NM_002380	NP_002371	O00339	MATN2_HUMAN	matrilin 2 isoform a precursor							proteinaceous extracellular matrix	calcium ion binding			ovary(2)	2	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			GGGGAAGGCATTTTGTGGTAG	0.512													4	2	---	---	---	---	
ANKRD46	157567	broad.mit.edu	37	8	101523617	101523620	+	Intron	DEL	TTGT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101523617_101523620delTTGT	uc003yjm.2	-							NM_198401	NP_940683	Q86W74	ANR46_HUMAN	ankyrin repeat domain 46							integral to membrane					0	all_cancers(14;5.07e-05)|all_epithelial(15;2.84e-07)|Lung NSC(17;0.000353)|all_lung(17;0.000998)		Epithelial(11;2.61e-11)|all cancers(13;5.03e-09)|OV - Ovarian serous cystadenocarcinoma(57;4.49e-06)|STAD - Stomach adenocarcinoma(118;0.0957)			AAGGAGTGTCTTGTTTATTTTCTT	0.240													3	3	---	---	---	---	
GRHL2	79977	broad.mit.edu	37	8	102621578	102621579	+	Intron	INS	-	TA	TA	rs5893576		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:102621578_102621579insTA	uc010mbu.2	+							NM_024915	NP_079191	Q6ISB3	GRHL2_HUMAN	transcription factor CP2-like 3							cytoplasm|nucleus	DNA binding			ovary(2)|skin(1)	3	all_cancers(14;4.39e-08)|all_epithelial(15;4.09e-10)|Lung NSC(17;7.11e-06)|all_lung(17;1.44e-05)		Epithelial(11;5.81e-09)|all cancers(13;3.81e-07)|OV - Ovarian serous cystadenocarcinoma(57;0.000213)			acaaatacttgtctcccaaccc	0.059													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	107820026	107820026	+	IGR	DEL	A	-	-	rs72109197		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:107820026delA								ABRA (37554 upstream) : ANGPT1 (441685 downstream)																							CCCCGCCCCTAAAAAAAAAAA	0.353													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	110082238	110082238	+	IGR	DEL	C	-	-	rs146473065		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:110082238delC								TMEM74 (282468 upstream) : TRHR (17501 downstream)																							tttttcttttctttttttttt	0.060													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	111641995	111641995	+	IGR	DEL	T	-	-	rs11334556		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:111641995delT								KCNV1 (653919 upstream) : None (None downstream)																							attgtccccctataATACCGA	0.159													2	5	---	---	---	---	
RAD21	5885	broad.mit.edu	37	8	117889124	117889124	+	5'Flank	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:117889124delG	uc003yod.2	-							NM_006265	NP_006256	O60216	RAD21_HUMAN	RAD21 homolog						apoptosis|cell division|chromosome segregation|double-strand break repair|mitotic metaphase/anaphase transition|mitotic prometaphase|protein localization to chromatin|reciprocal meiotic recombination|regulation of transcription from RNA polymerase II promoter	chromosome, centromeric region|cohesin complex|nuclear chromosome|nucleoplasm	protein binding			lung(1)|skin(1)	2	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					aaaaaaaaaagaactcattga	0.000													4	2	---	---	---	---	
DEPDC6	64798	broad.mit.edu	37	8	121050507	121050508	+	Intron	INS	-	A	A	rs79515758		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:121050507_121050508insA	uc003yow.3	+						DEPDC6_uc011lid.1_Intron	NM_022783	NP_073620	Q8TB45	DPTOR_HUMAN	DEP domain containing 6						intracellular signal transduction|negative regulation of cell size|negative regulation of protein kinase activity|negative regulation of TOR signaling cascade|regulation of apoptosis	intracellular	protein binding				0	Lung NSC(37;9.35e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			gagtctgtctcaaaaaaaaaaa	0.020													4	2	---	---	---	---	
ZHX2	22882	broad.mit.edu	37	8	123944550	123944551	+	Intron	INS	-	TTC	TTC	rs140369092	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:123944550_123944551insTTC	uc003ypk.1	+							NM_014943	NP_055758	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2							cytoplasm|nucleus|plasma membrane	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			ccacaagtttattctctttaat	0.094													4	4	---	---	---	---	
TATDN1	83940	broad.mit.edu	37	8	125512995	125512995	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125512995delA	uc003yrd.2	-						TATDN1_uc003yre.2_Intron|TATDN1_uc010mdm.2_Intron|TATDN1_uc003yrf.2_Intron	NM_032026	NP_114415	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1 isoform a							nucleus	endodeoxyribonuclease activity, producing 5'-phosphomonoesters|metal ion binding				0	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			CCCTTCTCTTAAAAAAAAAAA	0.244													4	2	---	---	---	---	
FAM49B	51571	broad.mit.edu	37	8	130955671	130955671	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:130955671delA	uc003ysw.2	-						FAM49B_uc003ysx.2_Intron|FAM49B_uc003ysy.1_Intron	NM_016623	NP_057707	Q9NUQ9	FA49B_HUMAN	hypothetical protein LOC51571												0	Ovarian(5;0.000567)|Esophageal squamous(12;0.00693)|Acute lymphoblastic leukemia(118;0.155)		LUAD - Lung adenocarcinoma(14;0.0989)			atctctactgaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	132695002	132695002	+	IGR	DEL	A	-	-	rs79400145		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132695002delA								ADCY8 (642167 upstream) : EFR3A (221357 downstream)																							tgtgaagaagaagtgcttggt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	138137767	138137768	+	IGR	INS	-	A	A	rs143482694	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:138137767_138137768insA								None (None upstream) : None (None downstream)																							ccatgtccctgaaaatcacatg	0.000													3	6	---	---	---	---	
FAM135B	51059	broad.mit.edu	37	8	139207877	139207878	+	Intron	DEL	AC	-	-	rs34987954		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139207877_139207878delAC	uc003yuy.2	-						FAM135B_uc003yux.2_Intron|FAM135B_uc003yuz.2_Intron	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059											ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTTTGCAGGTacacacacacac	0.312										HNSCC(54;0.14)			5	4	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139618733	139618736	+	Intron	DEL	ACGT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139618733_139618736delACGT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			CCTCAAGGTCACGTACCAACTCAA	0.500										HNSCC(7;0.00092)			9	7	---	---	---	---	
COL22A1	169044	broad.mit.edu	37	8	139704411	139704414	+	Intron	DEL	GTGT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139704411_139704414delGTGT	uc003yvd.2	-						COL22A1_uc011ljo.1_Intron	NM_152888	NP_690848	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						cell adhesion	collagen|cytoplasm	structural molecule activity			ovary(11)|pancreas(1)|skin(1)	13	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			atgtgtggaggtgtgtgtgtatgt	0.000										HNSCC(7;0.00092)			4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	140184536	140184536	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140184536delC								COL22A1 (258300 upstream) : KCNK9 (428546 downstream)																							GGCTCCCTTGCCTATAATGGA	0.463													6	3	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141343225	141343225	+	Intron	DEL	A	-	-	rs35642454		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141343225delA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						actttgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TRAPPC9	83696	broad.mit.edu	37	8	141384669	141384670	+	Intron	INS	-	A	A	rs111455824		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141384669_141384670insA	uc003yvj.2	-						TRAPPC9_uc003yvh.2_Intron|TRAPPC9_uc003yvi.1_Intron	NM_001160372	NP_001153844	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9 isoform						cell differentiation	endoplasmic reticulum|Golgi apparatus				skin(2)	2						aactccatgtcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142110499	142110499	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142110499delT								PTK2 (99167 upstream) : DENND3 (28221 downstream)																							cccttatttcttttttttttt	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	143513812	143513814	+	IGR	DEL	CAC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143513812_143513814delCAC								TSNARE1 (29269 upstream) : BAI1 (31563 downstream)																							atatcaccatcaccaccaccatc	0.103													6	5	---	---	---	---	
LOC100133669	100133669	broad.mit.edu	37	8	144086790	144086790	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144086790delT	uc011ljz.1	-							NR_026913				Homo sapiens, clone IMAGE:3342869, mRNA.												0						tttttctggattttctagttt	0.000													4	2	---	---	---	---	
C8orf31	286122	broad.mit.edu	37	8	144117839	144117840	+	5'Flank	INS	-	A	A	rs78956601		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144117839_144117840insA	uc003yxp.1	+						C8orf31_uc003yxq.1_5'Flank|C8orf31_uc003yxr.1_5'Flank	NM_173687	NP_775958	Q8N9H6	CH031_HUMAN	hypothetical protein LOC286122											ovary(1)	1	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					gactccatctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
ZNF696	79943	broad.mit.edu	37	8	144377253	144377254	+	Intron	INS	-	AAGA	AAGA	rs140331052	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144377253_144377254insAAGA	uc003yxy.3	+							NM_030895	NP_112157	Q9H7X3	ZN696_HUMAN	zinc finger protein 696						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			ccctggctcacaagaaaggaag	0.292													3	5	---	---	---	---	
TOP1MT	116447	broad.mit.edu	37	8	144418961	144418961	+	5'Flank	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144418961delT	uc003yxz.2	-						TOP1MT_uc011lkd.1_Intron|TOP1MT_uc011lke.1_Intron|TOP1MT_uc010mfb.2_5'Flank|TOP1MT_uc010mfd.1_5'Flank	NM_052963	NP_443195	Q969P6	TOP1M_HUMAN	mitochondrial topoisomerase I precursor						DNA topological change	chromosome|mitochondrial nucleoid	ATP binding|chromatin DNA binding|DNA topoisomerase (ATP-hydrolyzing) activity|DNA topoisomerase type I activity			ovary(1)	1	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)		Irinotecan(DB00762)|Topotecan(DB01030)	aagaccagcctgggcaacata	0.000													4	2	---	---	---	---	
AK3	50808	broad.mit.edu	37	9	4713915	4713916	+	Intron	INS	-	AC	AC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:4713915_4713916insAC	uc003ziq.1	-						AK3_uc003zip.1_Intron|AK3_uc011lma.1_Intron|AK3_uc003zir.1_Intron	NM_016282	NP_057366	Q9UIJ7	KAD3_HUMAN	adenylate kinase 3						blood coagulation	mitochondrial matrix	ATP binding|GTP binding|nucleoside triphosphate adenylate kinase activity			ovary(2)	2	all_hematologic(13;0.137)	Breast(48;0.238)		GBM - Glioblastoma multiforme(50;0.0302)		cctacacatatacacctccaca	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	6530170	6530170	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:6530170delA								UHRF2 (23121 upstream) : GLDC (2296 downstream)																							agactctgttaaaaaaaaaaa	0.189													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	20271674	20271674	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20271674delT								SLC24A2 (482866 upstream) : MLLT3 (73294 downstream)																							AGATGTTGAATTTTTTTTTAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	36409309	36409322	+	IGR	DEL	AAAGAAAGAAAGAA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36409309_36409322delAAAGAAAGAAAGAA								RNF38 (8114 upstream) : MELK (163583 downstream)																							aaagaaaaagaaagaaagaaagaaaaagaaagaa	0.164													3	3	---	---	---	---	
MELK	9833	broad.mit.edu	37	9	36652039	36652040	+	Intron	INS	-	TT	TT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:36652039_36652040insTT	uc003zzn.2	+						MELK_uc011lpm.1_Intron|MELK_uc011lpn.1_Intron|MELK_uc011lpo.1_Intron|MELK_uc010mll.2_Intron|MELK_uc011lpp.1_Intron|MELK_uc010mlm.2_Intron|MELK_uc011lpq.1_Intron|MELK_uc011lpr.1_Intron|MELK_uc011lps.1_Intron	NM_014791	NP_055606	Q14680	MELK_HUMAN	maternal embryonic leucine zipper kinase							cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(3)|upper_aerodigestive_tract(1)|lung(1)|skin(1)	6		Acute lymphoblastic leukemia(2;1.09e-08)|all_hematologic(2;8.15e-06)	STAD - Stomach adenocarcinoma(86;0.228)			TTGAACTCTAAttttttttttt	0.183													4	2	---	---	---	---	
SHB	6461	broad.mit.edu	37	9	38001982	38001983	+	Intron	DEL	CA	-	-	rs145129319		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:38001982_38001983delCA	uc004aax.2	-							NM_003028	NP_003019	Q15464	SHB_HUMAN	Src homology 2 domain containing adaptor protein						angiogenesis|apoptosis|cell differentiation|signal transduction	cytoplasm|plasma membrane	SH3/SH2 adaptor activity			central_nervous_system(2)|skin(1)	3		all_epithelial(88;0.122)		GBM - Glioblastoma multiforme(29;3.27e-05)|Lung(182;0.0658)		TGGCTCTGAGCACAGACTCTTT	0.416													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66267203	66267203	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66267203delA								FAM74A4 (772817 upstream) : LOC442421 (229267 downstream)																							GTCCTGCTTTAAAAAAAAAAC	0.284													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66477358	66477358	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66477358delT								FAM74A4 (982972 upstream) : LOC442421 (19112 downstream)																							agaagaaaaatttaaaaattt	0.000													4	3	---	---	---	---	
LOC442421	442421	broad.mit.edu	37	9	66498655	66498655	+	5'Flank	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66498655delT	uc004aee.1	+						LOC442421_uc004aed.1_Intron					Homo sapiens hypothetical LOC442421, mRNA (cDNA clone IMAGE:40031134).												0						ggtttcatgattttagagctc	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68352138	68352138	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68352138delG								FAM27B (557949 upstream) : MIR1299 (650101 downstream)																							tgctatagccgcctaactggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68394113	68394113	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68394113delT								FAM27B (599924 upstream) : MIR1299 (608126 downstream)																							ttttaaatagtctggcttcaa	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69056460	69056461	+	IGR	INS	-	A	A	rs145372655		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69056460_69056461insA								MIR1299 (54139 upstream) : PGM5P2 (23784 downstream)																							ccaaataagacaaaaaaatcac	0.000													10	9	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69951552	69951552	+	IGR	DEL	A	-	-	rs147067066		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69951552delA								LOC100133920 (286603 upstream) : FOXD4L5 (224157 downstream)																							ggcggaaaacaaaatattttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	76490521	76490521	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:76490521delA								ANXA1 (705214 upstream) : RORB (621731 downstream)																							cagacagaggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	81812850	81812852	+	IGR	DEL	TTC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:81812850_81812852delTTC								PSAT1 (867843 upstream) : TLE4 (374026 downstream)																							catcctgtttttcttcttcttct	0.049													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	89526595	89526595	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:89526595delA								ZCCHC6 (557217 upstream) : GAS1 (32684 downstream)																							agactctgtcaaaaaaaaaaa	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	90097522	90097523	+	IGR	INS	-	A	A	rs142888868	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90097522_90097523insA								C9orf170 (322881 upstream) : DAPK1 (15135 downstream)																							gaaTATCTAGGAAAAAAACAAT	0.193													2	4	---	---	---	---	
ROR2	4920	broad.mit.edu	37	9	94367237	94367237	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94367237delA	uc004ari.1	-							NM_004560	NP_004551	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2						negative regulation of cell proliferation|positive regulation of cell migration|transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity|Wnt-protein binding			lung(8)|central_nervous_system(5)|ovary(3)|large_intestine(2)|stomach(1)|breast(1)	20						AGGACCTGGCAAAACCCCAGC	0.413													4	2	---	---	---	---	
SVEP1	79987	broad.mit.edu	37	9	113229917	113229918	+	Intron	DEL	TT	-	-	rs11366981		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:113229917_113229918delTT	uc010mtz.2	-						SVEP1_uc010mua.1_Intron	NM_153366	NP_699197	Q4LDE5	SVEP1_HUMAN	polydom						cell adhesion	cytoplasm|extracellular region|membrane	calcium ion binding			ovary(7)	7						tcttttttactttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	130793526	130793527	+	IGR	DEL	TT	-	-	rs77529466		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130793526_130793527delTT								FAM102A (51031 upstream) : NAIF1 (29986 downstream)																							gggtttaccctttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	132200344	132200345	+	IGR	INS	-	C	C	rs143031604	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:132200344_132200345insC								C9orf106 (115462 upstream) : C9orf50 (174161 downstream)																							aatcaggccgacagggtttgaa	0.371													3	5	---	---	---	---	
VAV2	7410	broad.mit.edu	37	9	136798852	136798853	+	Intron	INS	-	TGGATGGA	TGGATGGA	rs149852975	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136798852_136798853insTGGATGGA	uc004ces.2	-						VAV2_uc004cer.2_Intron	NM_001134398	NP_001127870	P52735	VAV2_HUMAN	vav 2 guanine nucleotide exchange factor isoform						angiogenesis|apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|platelet activation|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	metal ion binding|Rho guanyl-nucleotide exchange factor activity			central_nervous_system(3)|ovary(2)|lung(2)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(145;3.9e-07)|Epithelial(140;2.07e-06)|all cancers(34;9.39e-06)		tggatggatggtggatgaatgg	0.000													4	2	---	---	---	---	
OLFM1	10439	broad.mit.edu	37	9	137987965	137987966	+	Intron	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137987965_137987966insC	uc010nar.2	+						OLFM1_uc004cfl.3_Intron|OLFM1_uc004cfk.3_Intron|OLFM1_uc004cfm.3_Intron	NM_014279	NP_055094	Q99784	NOE1_HUMAN	olfactomedin related ER localized protein						nervous system development	endoplasmic reticulum lumen	protein binding			ovary(1)|skin(1)	2		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		ttcctcctcctcttctcctcct	0.025													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139882462	139882462	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139882462delT								LCNL1 (2252 upstream) : C9orf142 (4408 downstream)																							TCTCCGGACCTTTTGCTCCTC	0.313													4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140610741	140610742	+	Intron	INS	-	GG	GG			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140610741_140610742insGG	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ggtgtcatggtgggggaggaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	107939	107940	+	IGR	INS	-	G	G	rs145426513		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:107939_107940insG								TUBB8 (12435 upstream) : ZMYND11 (72484 downstream)																							aggtaaagtattttttttttgt	0.000													4	3	---	---	---	---	
FAM107B	83641	broad.mit.edu	37	10	14612231	14612232	+	Intron	DEL	GG	-	-	rs72206829		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:14612231_14612232delGG	uc001ina.1	-						FAM107B_uc010qbu.1_Intron|FAM107B_uc009xjg.1_Intron|FAM107B_uc001imy.1_Intron|FAM107B_uc001imz.1_Intron	NM_031453	NP_113641	Q9H098	F107B_HUMAN	hypothetical protein LOC83641											breast(4)	4						AAAATGTGgtgggtgtgtgtgt	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	15780731	15780733	+	IGR	DEL	AGA	-	-	rs149585593		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15780731_15780733delAGA								ITGA8 (18961 upstream) : FAM188A (39442 downstream)																							TATGCCGGAGAGAAGGCCAAAGC	0.483													3	3	---	---	---	---	
CUBN	8029	broad.mit.edu	37	10	16964144	16964145	+	Intron	INS	-	T	T	rs144905367	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:16964144_16964145insT	uc001ioo.2	-							NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor						cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	gattttgtttgtttactgccac	0.025													3	4	---	---	---	---	
ST8SIA6	338596	broad.mit.edu	37	10	17421313	17421316	+	Intron	DEL	AGTA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17421313_17421316delAGTA	uc001ipd.2	-						ST8SIA6_uc010qce.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide						post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						agagagaaagagtaagaatgagaa	0.299													0	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	25267364	25267365	+	IGR	DEL	CT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25267364_25267365delCT								PRTFDC1 (25831 upstream) : ENKUR (3552 downstream)																							ctctcctgtcctctctctctct	0.144													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	26631656	26631656	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26631656delT								GAD2 (38165 upstream) : APBB1IP (95610 downstream)																							CTTCTGCTCCTTTTACACCAC	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	29640473	29640474	+	IGR	DEL	TT	-	-	rs72448737		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:29640473_29640474delTT								LYZL1 (40316 upstream) : LOC387647 (58009 downstream)																							GGttttattctttttttttttt	0.208													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	38886743	38886752	+	IGR	DEL	ATCACATGGA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:38886743_38886752delATCACATGGA								LOC399744 (145663 upstream) : None (None downstream)																							tggaatcatcatcacatggaatcgaatgga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42539661	42539661	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42539661delA								None (None upstream) : LOC441666 (287654 downstream)																							ctgctcaattaaaagaaaggt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42642538	42642538	+	IGR	DEL	A	-	-	rs74632924	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42642538delA								None (None upstream) : LOC441666 (184777 downstream)																							GTTGCTTTTTATTTCCTTACT	0.443													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42809123	42809132	+	IGR	DEL	CATTCCATTA	-	-	rs112345119		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42809123_42809132delCATTCCATTA								None (None upstream) : LOC441666 (18183 downstream)																							tgttccattccattccattacattccattG	0.038													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	43366029	43366030	+	IGR	INS	-	A	A	rs138908515		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:43366029_43366030insA								BMS1 (35646 upstream) : RET (206487 downstream)																							AAGAAACCAGGAGGCATCGTTG	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45451517	45451517	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45451517delC	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																		ctggactctgccactatctgc	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69637643	69637643	+	IGR	DEL	A	-	-	rs112434136		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69637643delA								DNAJC12 (39706 upstream) : SIRT1 (6784 downstream)																							aagaaaaaagaaaaaaaaaaa	0.050													3	3	---	---	---	---	
CDH23	64072	broad.mit.edu	37	10	73550827	73550827	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73550827delC	uc001jrx.3	+							NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor						calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TTGGTTCTTGCCCTGTCTTCC	0.577													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78982460	78982460	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78982460delC	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	AGAGAACAGGCCAACAGAACG	0.443													4	2	---	---	---	---	
LGI1	9211	broad.mit.edu	37	10	95523039	95523054	+	Intron	DEL	ACACACACACACACAG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95523039_95523054delACACACACACACACAG	uc001kjc.3	+						LGI1_uc010qnv.1_Intron|LGI1_uc001kjd.3_Intron|LGI1_uc009xui.2_Intron|LGI1_uc001kje.2_Intron	NM_005097	NP_005088	O95970	LGI1_HUMAN	leucine-rich, glioma inactivated 1 precursor						axon guidance|cell proliferation|positive regulation of cell growth|positive regulation of synaptic transmission	cell junction|extracellular space|synapse	receptor binding			ovary(2)|central_nervous_system(1)|skin(1)	4		Colorectal(252;0.124)				acacacagacacacacacacacacagacacacacac	0.347													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	102900623	102900623	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102900623delT								TLX1 (3078 upstream) : LBX1 (86111 downstream)																							TGCAGTGCGGTGGGTGGCACA	0.627													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	103038528	103038528	+	IGR	DEL	T	-	-	rs113811685		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103038528delT								LBX1 (49811 upstream) : BTRC (75297 downstream)																							ttattgaagcttttttttttt	0.000													4	2	---	---	---	---	
SH3PXD2A	9644	broad.mit.edu	37	10	105508733	105508734	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105508733_105508734insT	uc001kxj.1	-						uc001kxk.1_Intron	NM_014631	NP_055446	Q5TCZ1	SPD2A_HUMAN	SH3 multiple domains 1						cell communication|superoxide metabolic process	cell junction|cell projection|cytoplasm|podosome	phosphatidylinositol binding|protein binding				0		Colorectal(252;0.0815)|Breast(234;0.131)		Epithelial(162;4.09e-10)|all cancers(201;2.73e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0119)		TTTCttctttcttttttttttt	0.233													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	113681317	113681317	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:113681317delA								ADRA2A (840657 upstream) : GPAM (228305 downstream)																							actccatctcaaaaaaaaaaa	0.144													4	2	---	---	---	---	
NRAP	4892	broad.mit.edu	37	10	115370114	115370114	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115370114delA	uc001laj.2	-						NRAP_uc009xyb.2_Intron|NRAP_uc001lak.2_Intron|NRAP_uc001lal.3_Intron	NM_198060	NP_932326	Q86VF7	NRAP_HUMAN	nebulin-related anchoring protein isoform S							fascia adherens|muscle tendon junction	actin binding|muscle alpha-actinin binding|zinc ion binding			ovary(6)|central_nervous_system(3)|upper_aerodigestive_tract(1)	10		Colorectal(252;0.0233)|Breast(234;0.188)		Epithelial(162;0.00392)|all cancers(201;0.00569)		atctcaaattaaaaaaaaaaa	0.154													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	116781321	116781321	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116781321delC								TRUB1 (43883 upstream) : ATRNL1 (71803 downstream)																							ctcactgcaacctccacctcc	0.005													4	3	---	---	---	---	
EIF3A	8661	broad.mit.edu	37	10	120826728	120826729	+	Intron	INS	-	A	A	rs77298498		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120826728_120826729insA	uc001ldu.2	-						EIF3A_uc010qsu.1_Intron	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,						formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		aattctgtctcaaaaaaaaaaa	0.149													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	121390387	121390388	+	IGR	INS	-	CT	CT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121390387_121390388insCT								TIAL1 (33846 upstream) : BAG3 (20494 downstream)																							CCTATAACCGACTCTGCAAGCA	0.391													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	122140408	122140408	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122140408delA								SEC23IP (439163 upstream) : PPAPDC1A (76058 downstream)																							CTTTCTGGCCAAATGGCTCTG	0.493													4	2	---	---	---	---	
PPAPDC1A	196051	broad.mit.edu	37	10	122335817	122335817	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:122335817delT	uc001lev.1	+						PPAPDC1A_uc010qtd.1_Intron|PPAPDC1A_uc009xzl.1_Intron|PPAPDC1A_uc001lew.1_Intron|PPAPDC1A_uc001lex.1_Intron|PPAPDC1A_uc001ley.1_Intron	NM_001030059	NP_001025230	Q5VZY2	PPC1A_HUMAN	phosphatidic acid phosphatase type 2 domain						phospholipid dephosphorylation	integral to membrane	phosphatidate phosphatase activity			breast(1)	1		Lung NSC(174;0.1)|all_lung(145;0.132)		all cancers(201;0.0117)		CCCTTTCTTGTTTTCCGACTG	0.493													4	2	---	---	---	---	
FGFR2	2263	broad.mit.edu	37	10	123344354	123344354	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123344354delC	uc010qtk.1	-						FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Intron|FGFR2_uc010qti.1_Intron|FGFR2_uc010qtj.1_Intron|FGFR2_uc010qtl.1_Intron|FGFR2_uc010qtm.1_Intron|FGFR2_uc001lfl.3_Intron|FGFR2_uc001lfm.2_Intron|FGFR2_uc001lfn.3_Intron|FGFR2_uc010qtn.1_Intron|FGFR2_uc010qto.1_Intron|FGFR2_uc001lfo.1_Intron|FGFR2_uc010qtp.1_Intron|FGFR2_uc010qtq.1_Intron	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1						angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding			endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	gatcccataacccctctccat	0.025		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				4	2	---	---	---	---	
DOCK1	1793	broad.mit.edu	37	10	129207221	129207221	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129207221delT	uc001ljt.2	+						DOCK1_uc010qun.1_Intron|DOCK1_uc009yaq.2_Intron	NM_001380	NP_001371	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1						apoptosis|axon guidance|blood coagulation|integrin-mediated signaling pathway|phagocytosis, engulfment|small GTPase mediated signal transduction	cytosol|membrane	GTP binding|GTPase activator activity|GTPase binding|guanyl-nucleotide exchange factor activity|SH3 domain binding			central_nervous_system(4)|ovary(2)|lung(1)|breast(1)|kidney(1)	9		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GTAAGGCATATTTTAAGGCCA	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	129422487	129422488	+	IGR	DEL	GT	-	-	rs7099821	byFrequency	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:129422487_129422488delGT								NPS (71552 upstream) : FOXI2 (113050 downstream)																							tattttaagggtgtgtgtgtgt	0.000													2	4	---	---	---	---	
MUC6	4588	broad.mit.edu	37	11	1021077	1021077	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1021077delC	uc001lsw.2	-							NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric						maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGCCAGGGTCCTGGAGAGTG	0.622													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	2356566	2356568	+	Intron	DEL	TTC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2356566_2356568delTTC	uc001lwe.2	-											Homo sapiens, clone IMAGE:4940779, mRNA.																		TCTCAATAAGTTCTTCTTTATAT	0.389													20	13	---	---	---	---	
OSBPL5	114879	broad.mit.edu	37	11	3132579	3132580	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3132579_3132580insT	uc001lxk.2	-						OSBPL5_uc010qxq.1_Intron|OSBPL5_uc009ydw.2_Intron|OSBPL5_uc001lxl.2_Intron|OSBPL5_uc009ydx.2_Intron	NM_020896	NP_065947	Q9H0X9	OSBL5_HUMAN	oxysterol-binding protein-like protein 5 isoform						cholesterol metabolic process|cholesterol transport|Golgi to plasma membrane transport	cytosol	oxysterol binding|protein binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		gggaagatgaattttttttttt	0.000													4	2	---	---	---	---	
SAA4	6291	broad.mit.edu	37	11	18257625	18257626	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18257625_18257626insT	uc001mny.2	-							NM_006512	NP_006503	P35542	SAA4_HUMAN	serum amyloid A4, constitutive precursor						acute-phase response	high-density lipoprotein particle					0						ttctttctttcttttttttttc	0.040													4	2	---	---	---	---	
NAV2	89797	broad.mit.edu	37	11	19663161	19663161	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19663161delC	uc001mpp.2	+							NM_001111018	NP_001104488	Q8IVL1	NAV2_HUMAN	neuron navigator 2 isoform 3							nucleus	ATP binding|helicase activity			skin(4)|ovary(1)|pancreas(1)	6						catggctatgcagacccccac	0.000													4	2	---	---	---	---	
RCN1	5954	broad.mit.edu	37	11	31992576	31992576	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:31992576delT	uc010rea.1	+							NM_002901	NP_002892	Q15293	RCN1_HUMAN	reticulocalbin 1 precursor							endoplasmic reticulum lumen	calcium ion binding			large_intestine(1)	1	Lung SC(675;0.225)					TCTGCATTCCTTtttttttct	0.209													4	2	---	---	---	---	
HIPK3	10114	broad.mit.edu	37	11	33307938	33307938	+	Intron	DEL	T	-	-	rs145290650		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33307938delT	uc001mul.1	+						HIPK3_uc001mum.1_Intron|HIPK3_uc009yjv.1_Intron	NM_005734	NP_005725	Q9H422	HIPK3_HUMAN	homeodomain interacting protein kinase 3 isoform						anti-apoptosis|apoptosis|negative regulation of JUN kinase activity|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	ATP binding|protein serine/threonine kinase activity			large_intestine(1)|skin(1)|stomach(1)|ovary(1)|pancreas(1)	5						tttcttttccttttttttttt	0.264													3	3	---	---	---	---	
LDLRAD3	143458	broad.mit.edu	37	11	36199968	36199968	+	Intron	DEL	C	-	-	rs144398896		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36199968delC	uc001mwk.1	+						LDLRAD3_uc010rey.1_Intron|LDLRAD3_uc010rez.1_Intron|LDLRAD3_uc010rfa.1_Intron	NM_174902	NP_777562	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain							integral to membrane	receptor activity			central_nervous_system(1)	1	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				CAGTGGTCTTCCCACCTCCTC	0.537													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	46619981	46619981	+	IGR	DEL	T	-	-	rs76992433		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46619981delT								AMBRA1 (4410 upstream) : HARBI1 (4876 downstream)																							tttttttctcttttttttttt	0.164													4	2	---	---	---	---	
FNBP4	23360	broad.mit.edu	37	11	47767438	47767438	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47767438delA	uc009ylv.2	-						FNBP4_uc001ngj.2_Intron|FNBP4_uc001ngl.2_Intron	NM_015308	NP_056123	Q8N3X1	FNBP4_HUMAN	formin binding protein 4											ovary(1)	1						ATCAAGGACCAAAAAACCTAC	0.214													4	2	---	---	---	---	
NUP160	23279	broad.mit.edu	37	11	47870640	47870640	+	5'Flank	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47870640delC	uc001ngm.2	-						NUP160_uc009ylw.2_5'Flank|NUP160_uc001ngn.1_5'Flank	NM_015231	NP_056046	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process|glucose transport|mitotic prometaphase|mRNA export from nucleus|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytosol|Nup107-160 complex	nucleocytoplasmic transporter activity|protein binding			ovary(4)|lung(1)|central_nervous_system(1)|skin(1)	7						ATGCTAATCTCCAGCGGGGAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	47992777	47992778	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47992777_47992778insT								NUP160 (122720 upstream) : PTPRJ (9332 downstream)																							AGATTACAttcttttttttttt	0.015													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	48342432	48342433	+	IGR	INS	-	T	T	rs150320710		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48342432_48342433insT								OR4S1 (13729 upstream) : OR4C3 (4060 downstream)																							GGCCTAGGACCATGCCTAGAAT	0.426													3	5	---	---	---	---	
EML3	256364	broad.mit.edu	37	11	62375015	62375015	+	Intron	DEL	A	-	-	rs112711782		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62375015delA	uc001ntu.1	-						EML3_uc001ntr.1_Intron|EML3_uc001nts.1_Intron|EML3_uc001ntt.1_Intron|EML3_uc010rly.1_Intron|EML3_uc009yny.1_Intron	NM_153265	NP_694997	Q32P44	EMAL3_HUMAN	echinoderm microtubule associated protein like							cytoplasm|microtubule	protein binding			ovary(1)	1						gtctcaaaagaaaaaaaaaaa	0.269													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	65446035	65446035	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65446035delT								RELA (15592 upstream) : KAT5 (33454 downstream)																							TTCACTTTTGTTTTAATTAAA	0.214													4	2	---	---	---	---	
CHKA	1119	broad.mit.edu	37	11	67831875	67831875	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67831875delA	uc001onj.2	-						CHKA_uc001onk.2_Intron	NM_001277	NP_001268	P35790	CHKA_HUMAN	choline kinase alpha isoform a						lipid transport|phosphatidylethanolamine biosynthetic process	cytoplasm	ATP binding|choline kinase activity|drug binding|ethanolamine kinase activity|signal transducer activity			ovary(1)|central_nervous_system(1)	2					Choline(DB00122)	actctgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
ODZ4	26011	broad.mit.edu	37	11	79125201	79125202	+	Intron	INS	-	AC	AC	rs140598353	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:79125201_79125202insAC	uc001ozl.3	-							NM_001098816	NP_001092286	Q6N022	TEN4_HUMAN	odz, odd Oz/ten-m homolog 4						signal transduction	integral to membrane				ovary(2)|pancreas(2)	4						cacacatgtgtacacacacaca	0.257													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	81346503	81346503	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:81346503delC								None (None upstream) : None (None downstream)																							aaccatcttacccagagacca	0.000													4	2	---	---	---	---	
CCDC67	159989	broad.mit.edu	37	11	93064330	93064331	+	Intron	INS	-	CC	CC	rs139801069	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:93064330_93064331insCC	uc001pdq.2	+						CCDC67_uc001pdo.1_Intron|CCDC67_uc001pdp.2_Intron	NM_181645	NP_857596	Q05D60	CCD67_HUMAN	coiled-coil domain containing 67											ovary(1)	1		Acute lymphoblastic leukemia(157;2.35e-05)|all_hematologic(158;0.00824)				CTCCGCTCTGTCTCTCTTAATT	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	104617180	104617181	+	IGR	INS	-	T	T	rs141580874	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:104617180_104617181insT								PDGFD (582153 upstream) : CASP12 (139261 downstream)																							ttaaagcataattaaaaaaaaa	0.000													3	3	---	---	---	---	
DDX10	1662	broad.mit.edu	37	11	108780806	108780806	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108780806delA	uc001pkm.2	+						DDX10_uc001pkl.1_Intron	NM_004398	NP_004389	Q13206	DDX10_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 10								ATP binding|ATP-dependent helicase activity|RNA binding|RNA helicase activity			breast(2)|lung(1)|prostate(1)	4		all_cancers(61;1.29e-11)|all_epithelial(67;2.96e-07)|Melanoma(852;1.54e-05)|Acute lymphoblastic leukemia(157;4.24e-05)|all_hematologic(158;0.000141)|Breast(348;0.026)|all_neural(223;0.0729)		BRCA - Breast invasive adenocarcinoma(274;2.48e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.000609)|OV - Ovarian serous cystadenocarcinoma(223;0.133)		TATTCTAGGCAAAAAAAAAAA	0.378			T	NUP98	AML*								1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	114525854	114525856	+	IGR	DEL	AGT	-	-	rs138420930		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:114525854_114525856delAGT								FAM55D (59370 upstream) : FAM55B (23344 downstream)																							tctttcgagaagtgtctgttcat	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	115565582	115565582	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:115565582delT								CADM1 (190341 upstream) : None (None downstream)																							tgctccaccattttttttttt	0.129													2	4	---	---	---	---	
SORL1	6653	broad.mit.edu	37	11	121322127	121322127	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:121322127delA	uc001pxx.2	+						uc001pxw.1_Intron	NM_003105	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor containing LDLR class						cholesterol metabolic process|lipid transport|receptor-mediated endocytosis	integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|transmembrane receptor activity			ovary(5)|breast(4)|large_intestine(2)|skin(2)|central_nervous_system(1)|pancreas(1)	15		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		AGGGACTGGTAAATATGTCTA	0.552													4	2	---	---	---	---	
CCDC77	84318	broad.mit.edu	37	12	531358	531359	+	Intron	INS	-	A	A	rs144287663		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:531358_531359insA	uc001qig.2	+						CCDC77_uc009zdk.2_Intron|CCDC77_uc010sdp.1_Intron|CCDC77_uc010sdq.1_Intron	NM_032358	NP_115734	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77 isoform a							centrosome				ovary(1)	1	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			AGTGAGAGGGTAAATACACACA	0.431													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2128745	2128746	+	IGR	INS	-	AA	AA	rs139954072	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2128745_2128746insAA								DCP1B (15068 upstream) : CACNA1C (33670 downstream)																							agaaaagaaagagagagagaaa	0.069													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	5122707	5122707	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5122707delA								KCNA1 (95287 upstream) : KCNA5 (30378 downstream)																							CCCCGTTGTTAATGAAATGAA	0.483													4	2	---	---	---	---	
ANO2	57101	broad.mit.edu	37	12	5922220	5922223	+	Intron	DEL	AGGA	-	-	rs147780677		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:5922220_5922223delAGGA	uc001qnm.2	-							NM_020373	NP_065106	Q9NQ90	ANO2_HUMAN	anoctamin 2							chloride channel complex|plasma membrane	intracellular calcium activated chloride channel activity			ovary(4)|large_intestine(2)|central_nervous_system(1)	7						agaaagaaagaggaaggaaggaag	0.137													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	6524193	6524194	+	IGR	DEL	TT	-	-	rs80207425		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6524193_6524194delTT								LTBR (23461 upstream) : LOC678655 (23973 downstream)																							ttttttttcctttttttttttt	0.000													3	3	---	---	---	---	
CLEC4C	170482	broad.mit.edu	37	12	7898810	7898810	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7898810delA	uc001qtg.1	-						CLEC4C_uc001qth.1_Intron|CLEC4C_uc001qti.1_Intron	NM_130441	NP_569708	Q8WTT0	CLC4C_HUMAN	C-type lectin domain family 4, member C isoform						innate immune response	integral to membrane	sugar binding			ovary(2)|skin(1)	3				Kidney(36;0.0915)		attccgtctcaaaaaaaaaaa	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	8064489	8064490	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8064489_8064490insA								SLC2A14 (20745 upstream) : SLC2A3 (7335 downstream)																							gattccgtctcaaaaaaaaaaa	0.064													3	4	---	---	---	---	
GRIN2B	2904	broad.mit.edu	37	12	14025782	14025782	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14025782delA	uc001rbt.2	-							NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B						response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	aaactttattaaaagatttga	0.174													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	14911033	14911034	+	IGR	INS	-	A	A	rs147584324	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:14911033_14911034insA								GUCY2C (61514 upstream) : HIST4H4 (9900 downstream)																							gaccctgtctcaaaaaataaat	0.059													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	17361475	17361477	+	IGR	DEL	CTT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:17361475_17361477delCTT								LMO3 (598717 upstream) : RERGL (872327 downstream)																							GTTTTATTTACTTCTTCTTACCA	0.320													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34325582	34325582	+	IGR	DEL	A	-	-	rs111444960		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34325582delA								ALG10 (144348 upstream) : None (None downstream)																							CTGGCAGGGGAGAGTTCAGCC	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	34389400	34389401	+	IGR	INS	-	CATCAT	CATCAT	rs112658574	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:34389400_34389401insCATCAT								ALG10 (208166 upstream) : None (None downstream)																							atcaccatcaccatcatcatca	0.010													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38044750	38044750	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38044750delA								None (None upstream) : ALG10B (665807 downstream)																							gcaagtggatatttggagacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	38667549	38667550	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:38667549_38667550insA								None (None upstream) : ALG10B (43007 downstream)																							ttaacacagccaaaaaaaatga	0.059													3	3	---	---	---	---	
TMEM117	84216	broad.mit.edu	37	12	44596597	44596597	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44596597delT	uc001rod.2	+						TMEM117_uc001roe.2_Intron|TMEM117_uc009zkc.2_Intron	NM_032256	NP_115632	Q9H0C3	TM117_HUMAN	transmembrane protein 117							endoplasmic reticulum|integral to membrane					0	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		aagtggtagcttttttttttt	0.000													4	2	---	---	---	---	
C12orf41	54934	broad.mit.edu	37	12	49048747	49048748	+	Frame_Shift_Ins	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49048747_49048748insA	uc001rrx.2	-	9	1398_1399	c.1323_1324insT	c.(1321-1326)ATTGCTfs	p.I441fs	C12orf41_uc001rrw.2_Frame_Shift_Ins_p.I212fs|C12orf41_uc001rrz.2_Frame_Shift_Ins_p.I624fs|C12orf41_uc001rry.2_RNA|C12orf41_uc001rru.2_Frame_Shift_Ins_p.I72fs|C12orf41_uc001rrv.2_Frame_Shift_Ins_p.I125fs|SNORA34_uc001rsa.1_5'Flank|MIR1291_hsa-mir-1291|MI0006353_5'Flank	NM_017822	NP_060292	Q9H9L4	CL041_HUMAN	hypothetical protein LOC54934	441_442										ovary(2)	2						GGGTCTTCAGCAATTTCTTTGA	0.465													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	51330391	51330391	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51330391delC								METTL7A (4092 upstream) : HIGD1C (17391 downstream)																							TGTATAGCTTCCCAAGATCAT	0.224													4	2	---	---	---	---	
ITGB7	3695	broad.mit.edu	37	12	53592203	53592203	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53592203delT	uc009zmv.2	-						ITGB7_uc001scc.2_Intron|ITGB7_uc010snz.1_Intron|ITGB7_uc010soa.1_Intron	NM_000889	NP_000880	P26010	ITB7_HUMAN	integrin, beta 7 precursor						cell-matrix adhesion|integrin-mediated signaling pathway|multicellular organismal development|regulation of immune response	integrin complex	identical protein binding|metal ion binding|receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)|breast(1)	8						ccaccacgccttttttttttt	0.000													3	3	---	---	---	---	
AMHR2	269	broad.mit.edu	37	12	53822880	53822880	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53822880delA	uc001scx.1	+						AMHR2_uc009zmy.1_Intron	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform						Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	AGATTGGGTCAAAAGAGGGAG	0.299									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				4	2	---	---	---	---	
DGKA	1606	broad.mit.edu	37	12	56342953	56342954	+	Intron	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56342953_56342954delCA	uc001sij.2	+						DGKA_uc001sih.1_Intron|DGKA_uc001sii.1_Intron|DGKA_uc009zod.1_Intron|DGKA_uc001sik.2_Intron|DGKA_uc001sil.2_Intron|DGKA_uc001sim.2_Intron|DGKA_uc001sin.2_Intron|DGKA_uc009zof.2_Intron|DGKA_uc001sio.2_Intron	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa						activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	Tacatgcatgcacacacacaca	0.158													3	3	---	---	---	---	
DCTN2	10540	broad.mit.edu	37	12	57927554	57927554	+	Intron	DEL	A	-	-	rs34012531		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57927554delA	uc001som.1	-						DCTN2_uc009zpu.1_Intron|DCTN2_uc009zpv.1_Intron|DCTN2_uc009zpw.1_Intron|DCTN2_uc001soo.1_Intron|DCTN2_uc001son.1_Intron|DCTN2_uc001sop.1_Intron|DCTN2_uc001soq.1_Intron|DCTN2_uc009zpx.1_Intron	NM_006400	NP_006391	Q13561	DCTN2_HUMAN	dynactin 2						cell proliferation|G2/M transition of mitotic cell cycle|mitosis	centrosome|cytosol|dynactin complex|dynein complex|kinetochore|membrane|microtubule|vesicle	motor activity|protein binding			ovary(1)	1						actccgtctcaaaaaaaaaaa	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	64949020	64949020	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64949020delA								TBK1 (53129 upstream) : RASSF3 (55273 downstream)																							agactctgtcaaaaaaaaaaa	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	65975221	65975221	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65975221delG								MSRB3 (114541 upstream) : RPSAP52 (176582 downstream)																							actcataagtgggagctaagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	68878710	68878710	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:68878710delC								MDM1 (152549 upstream) : RAP1B (125942 downstream)																							aaaaaaaaaacaaaGAACAAG	0.214													4	2	---	---	---	---	
GLIPR1L2	144321	broad.mit.edu	37	12	75796476	75796476	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75796476delT	uc001sxr.1	+						GLIPR1L2_uc001sxp.1_Intron|GLIPR1L2_uc001sxq.1_Intron	NM_152436	NP_689649	Q4G1C9	GRPL2_HUMAN	GLI pathogenesis-related 1 like 2							integral to membrane				ovary(1)	1						ttgcccagtgttattgcaaat	0.055													4	2	---	---	---	---	
PPP1R12A	4659	broad.mit.edu	37	12	80175933	80175934	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80175933_80175934insA	uc001syz.2	-						PPP1R12A_uc010suc.1_Intron|PPP1R12A_uc001sza.2_Intron|PPP1R12A_uc010sud.1_Intron|PPP1R12A_uc001szb.2_Intron|PPP1R12A_uc001syy.2_Intron	NM_002480	NP_002471	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory (inhibitor)							contractile fiber	protein binding|signal transducer activity			ovary(2)|breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	7						GGAAGAAAAACAAAAAAAAACT	0.406													4	2	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94614788	94614788	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94614788delA	uc001tdc.2	+							NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						GGGGACCATGAAGGGCCTTGT	0.303													4	2	---	---	---	---	
KIAA1033	23325	broad.mit.edu	37	12	105517705	105517705	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105517705delA	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						tgttctctgtaagtggaacaa	0.000													4	2	---	---	---	---	
ATP2A2	488	broad.mit.edu	37	12	110731350	110731350	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110731350delC	uc001tqk.3	+						ATP2A2_uc001tql.3_Intron|ATP2A2_uc010sxy.1_Intron	NM_170665	NP_733765	P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, slow twitch 2 isoform						ATP biosynthetic process|cell adhesion|epidermis development|platelet activation|sarcoplasmic reticulum calcium ion transport	integral to plasma membrane|microsome|platelet dense tubular network membrane|sarcoplasmic reticulum membrane	ATP binding|calcium-transporting ATPase activity|protein C-terminus binding|S100 alpha binding			ovary(3)|skin(1)	4						caggcacgtgccaccatgccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116095676	116095678	+	IGR	DEL	TCC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116095676_116095678delTCC								TBX3 (973707 upstream) : MED13L (300705 downstream)																							ctcctcctcttcctcctcctctt	0.039													4	2	---	---	---	---	
KSR2	283455	broad.mit.edu	37	12	118224482	118224484	+	Intron	DEL	GTG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118224482_118224484delGTG	uc001two.2	-							NM_173598	NP_775869	Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2						intracellular signal transduction	cytoplasm|membrane	ATP binding|metal ion binding|protein serine/threonine kinase activity			lung(10)|central_nervous_system(2)|stomach(1)|large_intestine(1)|breast(1)	15	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ttaactgggcgtggtggtgggtg	0.000													3	3	---	---	---	---	
CIT	11113	broad.mit.edu	37	12	120165728	120165728	+	Intron	DEL	A	-	-	rs113396996		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120165728delA	uc001txi.1	-						CIT_uc001txh.1_Intron|CIT_uc001txj.1_Intron	NM_007174	NP_009105	O14578	CTRO_HUMAN	citron						intracellular signal transduction		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding|small GTPase regulator activity			ovary(6)|urinary_tract(1)|lung(1)|breast(1)|skin(1)	10	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		gagcaagaccaaaaaaaaaaa	0.010													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	123938409	123938411	+	IGR	DEL	TTG	-	-	rs74838047	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123938409_123938411delTTG								RILPL2 (17145 upstream) : SNRNP35 (4240 downstream)																							gcAtttttttttgttttgttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126972085	126972086	+	IGR	INS	-	G	G	rs138142117	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126972085_126972086insG								LOC100128554 (14755 upstream) : None (None downstream)																							agggagtccttgggaacaagag	0.168													1	5	---	---	---	---	
TMEM132D	121256	broad.mit.edu	37	12	130172656	130172656	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130172656delG	uc009zyl.1	-							NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor							integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TGGAGCCACTGGGGATTAACA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	132641402	132641403	+	IGR	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132641402_132641403insC								NOC4L (4416 upstream) : GALNT9 (39515 downstream)																							cactacacacacactacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19042211	19042212	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19042211_19042212insA								None (None upstream) : LOC284232 (366331 downstream)																							AAAGGCTTTGCAACATTCTTCA	0.376													4	2	---	---	---	---	
C1QTNF9B	387911	broad.mit.edu	37	13	24466846	24466847	+	Intron	DEL	AC	-	-	rs113533575		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:24466846_24466847delAC	uc010tcw.1	-						C1QTNF9B_uc010tcv.1_Intron|C1QTNF9B_uc001uoz.1_Intron|C1QTNF9B_uc010tcx.1_Intron	NM_001007537	NP_001007538	B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B							collagen					0						GTGCACATGGACACACACACAC	0.287													4	2	---	---	---	---	
MTUS2	23281	broad.mit.edu	37	13	29976658	29976659	+	Intron	INS	-	A	A	rs147447778	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29976658_29976659insA	uc001usl.3	+							NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						AAACAGAAGATACAGGAAGAAG	0.485													3	3	---	---	---	---	
LCP1	3936	broad.mit.edu	37	13	46728917	46728918	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46728917_46728918insT	uc001vaz.3	-						LCP1_uc001vba.3_Intron	NM_002298	NP_002289	P13796	PLSL_HUMAN	L-plastin						regulation of intracellular protein transport|T cell activation involved in immune response	cell junction|cytosol|ruffle membrane	calcium ion binding			lung(4)|ovary(3)	7		Lung NSC(96;1.27e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.39e-05)		ATCCTGTATTATGGTAACGGTG	0.446			T	BCL6	NHL 								22	26	---	---	---	---	
RB1	5925	broad.mit.edu	37	13	48954160	48954160	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48954160delT	uc001vcb.2	+							NM_000321	NP_000312	P06400	RB_HUMAN	retinoblastoma 1						androgen receptor signaling pathway|cell cycle arrest|chromatin remodeling|G1 phase of mitotic cell cycle|interspecies interaction between organisms|maintenance of mitotic sister chromatid cohesion|mitotic cell cycle G1/S transition checkpoint|myoblast differentiation|negative regulation of cell growth|negative regulation of protein kinase activity|negative regulation of S phase of mitotic cell cycle|negative regulation of sequence-specific DNA binding transcription factor activity|positive regulation of mitotic metaphase/anaphase transition|protein localization to chromosome, centromeric region|Ras protein signal transduction|regulation of centromere complex assembly|regulation of cohesin localization to chromatin|regulation of lipid kinase activity|regulation of transcription involved in G1/S phase of mitotic cell cycle|S phase of mitotic cell cycle|sister chromatid biorientation	chromatin|PML body|Rb-E2F complex|SWI/SNF complex	androgen receptor binding|DNA binding|kinase binding|phosphoprotein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription factor binding|ubiquitin protein ligase binding	p.?(7)		lung(94)|eye(89)|central_nervous_system(47)|bone(22)|breast(21)|urinary_tract(17)|haematopoietic_and_lymphoid_tissue(14)|ovary(10)|prostate(9)|soft_tissue(8)|skin(7)|endometrium(5)|cervix(3)|liver(3)|salivary_gland(2)|stomach(2)|oesophagus(1)|adrenal_gland(1)|kidney(1)|gastrointestinal_tract_(site_indeterminate)(1)|pituitary(1)	358		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	AAACAACTTCTTTTTTTTTTT	0.129		6	D|Mis|N|F|S		retinoblastoma|sarcoma|breast|small cell lung	retinoblastoma|sarcoma|breast|small cell lung			Hereditary_Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63635859	63635859	+	IGR	DEL	T	-	-	rs67758040		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63635859delT								None (None upstream) : OR7E156P (675709 downstream)																							TATTTATTACTTTTTTTAAAA	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63635866	63635866	+	IGR	DEL	A	-	-	rs67882631		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63635866delA								None (None upstream) : OR7E156P (675702 downstream)																							TACTTTTTTTAAAAAAAACAA	0.254													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	89000209	89000210	+	IGR	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:89000209_89000210delAG								SLITRK5 (668341 upstream) : None (None downstream)																							aaggggaaaaagggagggaggg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	108735905	108735905	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:108735905delA								FAM155A (216445 upstream) : LIG4 (123889 downstream)																							AATGTCCCATAAGAGCTAAGT	0.289													4	2	---	---	---	---	
RASA3	22821	broad.mit.edu	37	13	114771253	114771254	+	Intron	DEL	CC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:114771253_114771254delCC	uc001vui.2	-						RASA3_uc010tkk.1_Intron|RASA3_uc001vuj.2_Intron	NM_007368	NP_031394	Q14644	RASA3_HUMAN	RAS p21 protein activator 3						intracellular signal transduction|negative regulation of Ras protein signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	calcium-release channel activity|metal ion binding|Ras GTPase activator activity			lung(3)|skin(1)	4	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ttacccttctcccccctcctgc	0.233													4	2	---	---	---	---	
SLC7A8	23428	broad.mit.edu	37	14	23597069	23597069	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23597069delG	uc001wiz.2	-						SLC7A8_uc001wiw.2_Intron|SLC7A8_uc001wix.2_Intron|SLC7A8_uc010tnk.1_Intron|SLC7A8_uc010tnl.1_Intron|SLC7A8_uc001wiy.2_Intron|SLC7A8_uc010akj.2_Intron	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid						blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TCTGGGAAAAGGCATCTGCTT	0.507													4	2	---	---	---	---	
MYH7	4625	broad.mit.edu	37	14	23885745	23885745	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23885745delA	uc001wjx.2	-							NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta						adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GACAAGGAGGAAAATGAAGAG	0.443													4	2	---	---	---	---	
STRN3	29966	broad.mit.edu	37	14	31450783	31450786	+	Intron	DEL	CACA	-	-	rs71430907		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:31450783_31450786delCACA	uc001wqu.2	-						STRN3_uc001wqv.2_Intron|STRN3_uc010tpj.1_Intron	NM_001083893	NP_001077362	Q13033	STRN3_HUMAN	nuclear autoantigen isoform 1						negative regulation of estrogen receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|response to estradiol stimulus	cytoplasm|dendrite|Golgi apparatus|neuronal cell body|nucleoplasm|nucleus|plasma membrane|protein complex	armadillo repeat domain binding|calmodulin binding|protein complex binding|protein phosphatase 2A binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(127;0.0877)|Breast(36;0.148)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)|BRCA - Breast invasive adenocarcinoma(188;0.0805)	GBM - Glioblastoma multiforme(265;0.0124)		GCTTAGAATTcacacacacacaca	0.275													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36996355	36996356	+	IGR	INS	-	TT	TT	rs140075313	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36996355_36996356insTT								NKX2-1 (6939 upstream) : NKX2-8 (52861 downstream)																							ttctgccaaacaacatatccaa	0.074													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	61571370	61571370	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:61571370delT								SLC38A6 (20920 upstream) : PRKCH (82917 downstream)																							ctatctccacttaaggtcaca	0.070													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	66754918	66754918	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:66754918delT								FUT8 (544957 upstream) : C14orf53 (198191 downstream)																							AAATTCTCACTTATAAATGCC	0.398													4	2	---	---	---	---	
GPHN	10243	broad.mit.edu	37	14	67407974	67407975	+	Intron	INS	-	AAA	AAA	rs140888439	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67407974_67407975insAAA	uc001xiy.2	+						GPHN_uc001xiw.2_Intron|GPHN_uc001xix.2_Intron|GPHN_uc010tss.1_Intron|GPHN_uc010tst.1_Intron|GPHN_uc010tsu.1_Intron	NM_001024218	NP_001019389	Q9NQX3	GEPH_HUMAN	gephyrin isoform 2						Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cell junction|cytoplasm|cytoskeleton|postsynaptic membrane	ATP binding|metal ion binding|nucleotidyltransferase activity			ovary(2)	2		all_cancers(7;0.0476)|all_hematologic(31;0.0116)		Epithelial(1;1.73e-08)|all cancers(60;3.15e-07)|OV - Ovarian serous cystadenocarcinoma(108;0.000275)|BRCA - Breast invasive adenocarcinoma(234;0.00323)|Colorectal(3;0.0938)|KIRC - Kidney renal clear cell carcinoma(182;0.184)		ttattttcattaaaaaaaaaat	0.000			T	MLL	AL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	73504010	73504010	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:73504010delA								ZFYVE1 (10171 upstream) : RBM25 (21211 downstream)																							ggaaaacactaaaaaaaaaat	0.000													4	2	---	---	---	---	
C14orf156	81892	broad.mit.edu	37	14	78180381	78180384	+	Intron	DEL	TCTC	-	-	rs145637879		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78180381_78180384delTCTC	uc001xue.3	+							NM_031210	NP_112487	Q9GZT3	SLIRP_HUMAN	SRA stem-loop-interacting RNA-binding protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	nucleotide binding|RNA binding				0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0276)		tgagacaggttctctctctcactc	0.113													5	5	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79249764	79249764	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79249764delA	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ggaagggagcatggcaaaata	0.000													4	2	---	---	---	---	
C14orf145	145508	broad.mit.edu	37	14	81363894	81363894	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81363894delT	uc001xux.2	-						C14orf145_uc001xuz.2_Intron|C14orf145_uc001xuy.1_Intron	NM_152446	NP_689659	Q6ZU80	CE128_HUMAN	hypothetical protein LOC145508							centriole|spindle pole					0				BRCA - Breast invasive adenocarcinoma(234;0.0586)		caaaccagtcttccatatctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	96318610	96318610	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96318610delA								TCL1A (138077 upstream) : C14orf132 (187052 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
AK7	122481	broad.mit.edu	37	14	96952975	96952975	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96952975delT	uc001yfn.2	+							NM_152327	NP_689540	Q96M32	KAD7_HUMAN	adenylate kinase 7						cell projection organization	cytosol	adenylate kinase activity|ATP binding|cytidylate kinase activity			ovary(1)	1		all_cancers(154;0.0482)|all_epithelial(191;0.128)|Melanoma(154;0.155)		Epithelial(152;0.134)|COAD - Colon adenocarcinoma(157;0.228)		GTGGCATTTCTTTTTTTTTTT	0.284													4	2	---	---	---	---	
CCNK	8812	broad.mit.edu	37	14	99974928	99974928	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99974928delG	uc001ygi.3	+						CCNK_uc001ygg.3_Intron	NM_001099402	NP_001092872	O75909	CCNK_HUMAN	cyclin K isoform 1						cell division|mitosis|regulation of cyclin-dependent protein kinase activity|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein kinase binding				0		all_cancers(154;0.224)|all_epithelial(191;0.0643)|Melanoma(154;0.0866)				TACGCTTCCTGGGAGGCCCTA	0.597													4	2	---	---	---	---	
WARS	7453	broad.mit.edu	37	14	100836018	100836019	+	5'Flank	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100836018_100836019insT	uc001yhf.1	-						WARS_uc001yhg.1_Intron|WARS_uc001yhh.1_Intron|WARS_uc001yhi.1_Intron|WARS_uc001yhj.1_Intron|WARS_uc001yhk.1_Intron|WARS_uc001yhl.1_Intron|WARS_uc010twz.1_Intron	NM_173701	NP_776049	P23381	SYWC_HUMAN	tryptophanyl-tRNA synthetase isoform a						angiogenesis|negative regulation of cell proliferation|regulation of angiogenesis|tryptophanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|protein binding|tryptophan-tRNA ligase activity			breast(1)	1		all_cancers(154;0.00223)|all_lung(585;2.48e-06)|all_epithelial(191;0.000564)|Melanoma(154;0.152)			L-Tryptophan(DB00150)	TTACTATTTGAttttttttttt	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20109593	20109594	+	IGR	DEL	AT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20109593_20109594delAT								None (None upstream) : GOLGA6L6 (627500 downstream)																							gacatataacatattaaatatg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20477298	20477298	+	IGR	DEL	T	-	-	rs113877718		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20477298delT								None (None upstream) : GOLGA6L6 (259796 downstream)																							tcttattttatttttttttga	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20484277	20484277	+	IGR	DEL	A	-	-	rs111867281		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20484277delA								None (None upstream) : GOLGA6L6 (252817 downstream)																							atggaaatgcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	22490731	22490731	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22490731delT								OR4N3P (76346 upstream) : MIR1268 (22498 downstream)																							ACGAGCTCACTTGTCCCCATC	0.468													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	23877449	23877450	+	IGR	INS	-	T	T	rs151162864	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23877449_23877450insT								MKRN3 (20742 upstream) : MAGEL2 (11248 downstream)																							ATCTCTCTCTCtttttttttta	0.223													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	26317060	26317060	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:26317060delC								ATP10A (206743 upstream) : GABRB3 (471635 downstream)																							TTGTCTCACACCAGGAATAGT	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	27907063	27907074	+	IGR	DEL	ACACACACACAC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27907063_27907074delACACACACACAC								GABRG3 (128929 upstream) : OCA2 (92951 downstream)																							caaaaaaaGAacacacacacacacacacacac	0.005													4	2	---	---	---	---	
OCA2	4948	broad.mit.edu	37	15	28313389	28313390	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28313389_28313390insA	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		agagaagatccaaataagcaca	0.000									Oculocutaneous_Albinism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	31137233	31137237	+	IGR	DEL	ATATG	-	-	rs147445876		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31137233_31137237delATATG								ARHGAP11B (159424 upstream) : MTMR15 (58818 downstream)																							agatcctgtcATatgaaatgaaatg	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	36045480	36045481	+	Intron	INS	-	T	T	rs34730370		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36045480_36045481insT	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																		tcttcttcttcttttttttttt	0.257													0	6	---	---	---	---	
CASC5	57082	broad.mit.edu	37	15	40921686	40921688	+	Intron	DEL	GCC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40921686_40921688delGCC	uc010bbs.1	+						CASC5_uc010bbt.1_Intron	NM_170589	NP_733468	Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5 isoform 1						acrosome assembly|attachment of spindle microtubules to kinetochore|cell division|CenH3-containing nucleosome assembly at centromere|mitotic prometaphase|spindle assembly checkpoint	acrosomal vesicle|condensed chromosome kinetochore|cytosol|nucleoplasm	protein binding			breast(3)|central_nervous_system(1)|skin(1)	5		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		ttttttttttgccttttcttttt	0.123													3	3	---	---	---	---	
SQRDL	58472	broad.mit.edu	37	15	45980713	45980714	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45980713_45980714insT	uc001zvt.2	+						SQRDL_uc001zvu.2_Intron|SQRDL_uc001zvv.2_Intron	NM_021199	NP_067022	Q9Y6N5	SQRD_HUMAN	sulfide dehydrogenase like precursor								oxidoreductase activity			ovary(1)	1		Lung NSC(122;0.000117)|all_lung(180;0.000737)|Melanoma(134;0.0417)		all cancers(107;5.89e-18)|GBM - Glioblastoma multiforme(94;1.21e-06)|COAD - Colon adenocarcinoma(120;0.17)|Colorectal(133;0.188)		ttctgtttttcttttttttttt	0.144													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	47102193	47102193	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:47102193delC								None (None upstream) : SEMA6D (374210 downstream)																							tgtttacctaccaggttcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	55039902	55039903	+	IGR	INS	-	A	A	rs146717974	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55039902_55039903insA								UNC13C (119097 upstream) : RSL24D1 (433618 downstream)																							CGCCCCCCACCAAAAAAAAAAC	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	60141875	60141876	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60141875_60141876delTG								BNIP2 (160233 upstream) : FOXB1 (154545 downstream)																							actgtgtgtatgtgtgtgtgtg	0.149													4	2	---	---	---	---	
ANXA2	302	broad.mit.edu	37	15	60642444	60642444	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:60642444delA	uc002agn.2	-						ANXA2_uc002agk.2_Intron|ANXA2_uc002agl.2_Intron|ANXA2_uc002agm.2_Intron|ANXA2_uc010uhd.1_Intron	NM_001136015	NP_001129487	P07355	ANXA2_HUMAN	annexin A2 isoform 2						angiogenesis|positive regulation of vesicle fusion|skeletal system development	basement membrane|melanosome|midbody|soluble fraction	calcium ion binding|calcium-dependent phospholipid binding|cytoskeletal protein binding|phospholipase inhibitor activity			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Tenecteplase(DB00031)	TGGGAATTCCAAACACACCAG	0.194													4	2	---	---	---	---	
TPM1	7168	broad.mit.edu	37	15	63333134	63333135	+	5'Flank	INS	-	A	A	rs142722809	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63333134_63333135insA	uc002alg.2	+						TPM1_uc002alh.2_5'Flank|TPM1_uc010bgn.2_5'Flank|TPM1_uc002ali.2_5'Flank|TPM1_uc002alj.2_5'Flank|TPM1_uc002alk.2_5'Flank|TPM1_uc002all.2_5'Flank|TPM1_uc002alm.2_5'Flank|TPM1_uc010uie.1_5'Flank|TPM1_uc002alp.2_5'Flank	NM_001018005	NP_001018005	P09493	TPM1_HUMAN	tropomyosin 1 alpha chain isoform 1						cardiac muscle contraction|cellular component movement|cellular response to reactive oxygen species|muscle filament sliding|negative regulation of cell migration|positive regulation of ATPase activity|positive regulation of cell adhesion|positive regulation of heart rate by epinephrine|positive regulation of stress fiber assembly|regulation of muscle contraction|ruffle organization|sarcomere organization|ventricular cardiac muscle tissue morphogenesis|wound healing	bleb|cytosol|muscle thin filament tropomyosin|ruffle membrane|stress fiber	actin binding|structural constituent of cytoskeleton|structural constituent of muscle				0						ttataagtgagaaaaaaggctt	0.149													3	4	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65244041	65244043	+	Intron	DEL	CTT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65244041_65244043delCTT	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						cctcttcttccttctttcctttt	0.000													4	2	---	---	---	---	
ANKDD1A	348094	broad.mit.edu	37	15	65245266	65245267	+	Intron	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65245266_65245267delTT	uc002aoa.2	+						ANKDD1A_uc002aoc.2_Intron|ANKDD1A_uc010bha.2_Intron	NM_182703	NP_874362	Q495B1	AKD1A_HUMAN	ankyrin repeat and death domain containing 1A						signal transduction					ovary(1)	1						tttcttcctcttttcttcttct	0.000													4	2	---	---	---	---	
IGDCC4	57722	broad.mit.edu	37	15	65701631	65701631	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65701631delT	uc002aou.1	-							NM_020962	NP_066013	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member							integral to membrane|plasma membrane				ovary(1)|pancreas(1)|skin(1)	3						GAAGGTTGGATCCAGGGGAGA	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69894627	69894627	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69894627delC	uc002asi.1	+											Homo sapiens cDNA FLJ40583 fis, clone THYMU2007952.																		GTTGATCCCACCCCATCTGTC	0.542													4	3	---	---	---	---	
AP3B2	8120	broad.mit.edu	37	15	83349151	83349151	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83349151delG	uc010uoh.1	-						AP3B2_uc010uoi.1_Intron|AP3B2_uc010uoj.1_Intron|AP3B2_uc010uog.1_5'Flank	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			GTGGGCGTGAGGGGGCGGAGC	0.567													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	84311432	84311432	+	IGR	DEL	A	-	-	rs71947283		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:84311432delA								SH3GL3 (23941 upstream) : ADAMTSL3 (11406 downstream)																							gatgattgctaaaaatccaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	93130744	93130744	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93130744delA	uc002bse.1	+						uc002bsf.2_5'Flank|uc002bsg.1_5'Flank					DQ591781																		AAGGCAGGGCAAAAAAAAAAA	0.512													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96716608	96716608	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96716608delT								LOC145820 (665534 upstream) : NR2F2 (152549 downstream)																							CATGTTGACCTTTTTTTTTTT	0.294													4	2	---	---	---	---	
PCSK6	5046	broad.mit.edu	37	15	101972833	101972833	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101972833delA	uc002bwy.2	-						PCSK6_uc010bpd.2_Intron|PCSK6_uc010bpe.2_Intron|PCSK6_uc002bxa.2_Intron|PCSK6_uc002bxb.2_Intron|PCSK6_uc002bxc.1_Intron|PCSK6_uc002bxd.1_Intron|PCSK6_uc002bxe.2_Intron|PCSK6_uc002bxg.1_Intron	NM_002570	NP_002561	P29122	PCSK6_HUMAN	paired basic amino acid cleaving system 4						glycoprotein metabolic process|nerve growth factor processing|nerve growth factor production|nerve growth factor receptor signaling pathway|regulation of BMP signaling pathway|secretion by cell	cell surface|endomembrane system|endoplasmic reticulum|extracellular matrix|extracellular space|Golgi lumen|membrane|soluble fraction	eukaryotic cell surface binding|heparin binding|nerve growth factor binding|serine-type endopeptidase activity			pancreas(2)	2	Lung NSC(78;0.00102)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000803)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			agaccctgtcaaaaaaaaaaa	0.090													4	2	---	---	---	---	
NPRL3	8131	broad.mit.edu	37	16	144366	144366	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:144366delG	uc002cfr.2	-						NPRL3_uc010uua.1_Intron|NPRL3_uc002cfp.1_Intron|NPRL3_uc002cfq.2_Intron|NPRL3_uc010uub.1_Intron|NPRL3_uc010uuc.1_Intron|NPRL3_uc002cfs.1_Intron	NM_001077350	NP_001070818	Q12980	NPRL3_HUMAN	conserved gene telomeric to alpha globin cluster								protein binding			ovary(1)	1						CCACCCTCTTGGCGGGTAGGC	0.587													4	2	---	---	---	---	
MSLNL	401827	broad.mit.edu	37	16	820927	820927	+	Frame_Shift_Del	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:820927delG	uc002cjz.1	-	13	2458	c.2458delC	c.(2458-2460)CAGfs	p.Q820fs		NM_001025190	NP_001020361	Q96KJ4	MSLNL_HUMAN	mesothelin-like	469	Extracellular (Potential).				cell adhesion	integral to membrane				breast(3)|ovary(1)	4						TTCCGGCTCTGGGGGCAGGAG	0.692													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	1303137	1303137	+	IGR	DEL	T	-	-	rs72067358		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1303137delT								TPSAB1 (10583 upstream) : TPSD1 (3136 downstream)																							TCATGCCTGCttttttttttt	0.085													4	2	---	---	---	---	
PDPK1	5170	broad.mit.edu	37	16	2640129	2640130	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2640129_2640130insT	uc002cqs.2	+						PDPK1_uc002cqt.2_Intron|PDPK1_uc010bsn.2_Intron|PDPK1_uc002cqu.2_Intron|uc002cqw.1_5'Flank	NM_002613	NP_002604	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase-1						actin cytoskeleton organization|activation of protein kinase B activity|insulin receptor signaling pathway|negative regulation of protein kinase activity|nerve growth factor receptor signaling pathway|peptidyl-threonine phosphorylation|phosphatidylinositol-mediated signaling|platelet activation|positive regulation of establishment of protein localization in plasma membrane|synaptic transmission|T cell costimulation|T cell receptor signaling pathway	cytosol|nucleoplasm|plasma membrane	3-phosphoinositide-dependent protein kinase activity|ATP binding			central_nervous_system(2)|ovary(1)	3		Ovarian(90;0.17)			Celecoxib(DB00482)	GGATGATGttcttttttttttg	0.064													4	2	---	---	---	---	
LOC342346	342346	broad.mit.edu	37	16	4605700	4605701	+	5'Flank	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4605700_4605701delTT	uc010uxn.1	+							NM_001145011	NP_001138483	C9JH24	C9JH24_HUMAN	hypothetical protein LOC342346												0						ttttcttttctttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9667777	9667777	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9667777delA								C16orf72 (454232 upstream) : GRIN2A (179490 downstream)																							tctgttgttgaagccactcag	0.095													4	2	---	---	---	---	
TEKT5	146279	broad.mit.edu	37	16	10731199	10731199	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10731199delA	uc002czz.1	-							NM_144674	NP_653275	Q96M29	TEKT5_HUMAN	tektin 5						microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(2)	2						agccCGCTTTAAAAAAAAAAA	0.080													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	10832883	10832883	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10832883delT								TEKT5 (44081 upstream) : NUBP1 (4815 downstream)																							acgcccaaccttttttttttt	0.000													3	3	---	---	---	---	
PDXDC1	23042	broad.mit.edu	37	16	15115242	15115242	+	Intron	DEL	A	-	-	rs79259340		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15115242delA	uc002dda.3	+						PDXDC1_uc010uzl.1_Intron|PDXDC1_uc010uzm.1_Intron|PDXDC1_uc002dcz.2_Intron|PDXDC1_uc002ddb.3_Intron|PDXDC1_uc010uzn.1_Intron|PDXDC1_uc002ddc.2_Intron	NM_015027	NP_055842	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain						carboxylic acid metabolic process		carboxy-lyase activity|protein binding|pyridoxal phosphate binding			skin(1)	1					Pyridoxal Phosphate(DB00114)	accctgtctcaaaaaaaaaaa	0.144													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	16726191	16726194	+	IGR	DEL	TTTT	-	-	rs11329944		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16726191_16726194delTTTT								LOC339047 (281754 upstream) : XYLT1 (469989 downstream)																							CCTATTACTGtttttttttttttt	0.064													4	3	---	---	---	---	
SMG1	23049	broad.mit.edu	37	16	18939148	18939149	+	5'Flank	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18939148_18939149insA	uc002dfm.2	-							NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1						DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ATGCCCCAGGGAAAAAAGTTCC	0.411													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21229562	21229563	+	IGR	INS	-	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21229562_21229563insG								ZP2 (6495 upstream) : ANKS4B (15453 downstream)																							cacagggaggaggggggcttac	0.000													4	2	---	---	---	---	
HS3ST2	9956	broad.mit.edu	37	16	22899705	22899706	+	Intron	INS	-	TC	TC	rs149029882		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22899705_22899706insTC	uc002dli.2	+						HS3ST2_uc002dlj.2_Intron	NM_006043	NP_006034	Q9Y278	HS3S2_HUMAN	heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity			ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(48;0.0299)		tttttttttttttttttttctt	0.178													4	3	---	---	---	---	
ARHGAP17	55114	broad.mit.edu	37	16	25021404	25021404	+	Intron	DEL	T	-	-	rs11433869		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25021404delT	uc002dnb.2	-						ARHGAP17_uc002dnc.2_Intron|ARHGAP17_uc010vcf.1_Intron|ARHGAP17_uc002dng.1_Intron	NM_001006634	NP_001006635	Q68EM7	RHG17_HUMAN	nadrin isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|tight junction	GTPase activator activity|SH3 domain binding				0				GBM - Glioblastoma multiforme(48;0.0407)		cttttttttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26556494	26556494	+	IGR	DEL	C	-	-	rs56302531		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26556494delC								HS3ST4 (407486 upstream) : C16orf82 (521725 downstream)																							GAAGGGAGCACTTGAAGTTTC	0.353													2	4	---	---	---	---	
SBK1	388228	broad.mit.edu	37	16	28309177	28309177	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28309177delG	uc002dpd.2	+							NM_001024401	NP_001019572	Q52WX2	SBK1_HUMAN	SH3-binding kinase 1							cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|kidney(1)	2						AGGGGTCCCTGGGAGGCAGGA	0.612													4	2	---	---	---	---	
SBK1	388228	broad.mit.edu	37	16	28324918	28324919	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28324918_28324919insA	uc002dpd.2	+							NM_001024401	NP_001019572	Q52WX2	SBK1_HUMAN	SH3-binding kinase 1							cytoplasm	ATP binding|protein serine/threonine kinase activity			ovary(1)|kidney(1)	2						taccctgtcttaaaaaaaaaaa	0.257													3	3	---	---	---	---	
INO80E	283899	broad.mit.edu	37	16	30007665	30007665	+	Frame_Shift_Del	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30007665delA	uc002dvg.1	+	1	135	c.34delA	c.(34-36)AAAfs	p.K12fs	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|INO80E_uc002dvh.1_RNA|INO80E_uc002dvi.1_Frame_Shift_Del_p.K12fs|INO80E_uc002dvj.1_RNA|INO80E_uc002dvk.1_Frame_Shift_Del_p.K12fs|HIRIP3_uc002dve.2_5'Flank|HIRIP3_uc002dvf.2_5'Flank	NM_173618	NP_775889	Q8NBZ0	IN80E_HUMAN	INO80 complex subunit E	12	Potential.				DNA recombination|DNA repair|regulation of transcription, DNA-dependent|transcription, DNA-dependent	Ino80 complex				skin(1)	1						AGTGGACTACAAAAAAAAATA	0.632													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	31188294	31188294	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31188294delT								PRSS36 (26879 upstream) : FUS (3159 downstream)																							GAGTCACATATTTTTTTTTTT	0.219													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32522604	32522605	+	IGR	INS	-	AACAGTGTT	AACAGTGTT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32522604_32522605insAACAGTGTT								HERC2P4 (358730 upstream) : TP53TG3B (162236 downstream)																							ggaaaaaaaaacagtgtttgca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32524502	32524502	+	IGR	DEL	A	-	-	rs112225322		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32524502delA								HERC2P4 (360628 upstream) : TP53TG3B (160339 downstream)																							gtgccgaatcaaaaaaaaatg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32818796	32818798	+	IGR	DEL	TCA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32818796_32818798delTCA								TP53TG3B (129918 upstream) : SLC6A10P (69999 downstream)																							tttcatcatttcatttcatcttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32831401	32831402	+	IGR	INS	-	T	T	rs146631815	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32831401_32831402insT								TP53TG3B (142523 upstream) : SLC6A10P (57395 downstream)																							TATATTTAATATTTTTTCTCTC	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33529273	33529274	+	IGR	INS	-	CTG	CTG	rs112273280		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33529273_33529274insCTG								SLC6A10P (632810 upstream) : MIR1826 (436234 downstream)																							ATCATTCACTTCTTGCAGGAAG	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33938724	33938724	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33938724delA								None (None upstream) : MIR1826 (26784 downstream)																							CACAGCACCCAAGAAAGCCAC	0.642													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33939019	33939019	+	IGR	DEL	C	-	-	rs113683091		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33939019delC								None (None upstream) : MIR1826 (26489 downstream)																							GTTGCACAGGCCGCCTGCGTG	0.667													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33960928	33960929	+	IGR	INS	-	AG	AG	rs34314021		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33960928_33960929insAG								None (None upstream) : MIR1826 (4579 downstream)																							AAAGCTTCCACAGTTATGACTT	0.198													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	34195167	34195169	+	IGR	DEL	CGA	-	-	rs111330731	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:34195167_34195169delCGA								MIR1826 (229575 upstream) : UBE2MP1 (208633 downstream)																							cgattccattcgatgatgattcc	0.044													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	46499562	46499563	+	IGR	INS	-	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:46499562_46499563insG								None (None upstream) : ANKRD26P1 (3686 downstream)																							atggaatctaaggaacaattca	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	52763556	52763556	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52763556delA								TOX3 (181842 upstream) : CHD9 (325389 downstream)																							AAGTTAGAGTAAAAAAAAAAC	0.378													4	2	---	---	---	---	
LOC283856	283856	broad.mit.edu	37	16	56139112	56139112	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:56139112delG	uc002eis.1	-							NR_027078				Homo sapiens hypothetical protein LOC283856, mRNA (cDNA clone IMAGE:5263025).												0						CCTTACAGGAGGGGGAAGATG	0.438													4	2	---	---	---	---	
CLEC18C	283971	broad.mit.edu	37	16	70098311	70098311	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70098311delA	uc002exy.2	+						PDXDC2_uc002eyc.2_Intron	NM_182619	NP_872425	Q8NCF0	CL18C_HUMAN	secretory protein LOC348174 precursor							extracellular region	sugar binding				0						ACACCCTGCTAATCAGACGAC	0.303													4	2	---	---	---	---	
CTRB1	1504	broad.mit.edu	37	16	75255337	75255337	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:75255337delA	uc002fds.2	+							NM_001906	NP_001897			chymotrypsin B1 precursor												0				BRCA - Breast invasive adenocarcinoma(221;0.166)		agcttactgcaacctctgtcc	0.050													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86242462	86242463	+	IGR	DEL	TG	-	-	rs150290778		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86242462_86242463delTG								IRF8 (286253 upstream) : LOC732275 (122993 downstream)																							TTAACAACTTtgtgtgtgtgtg	0.317													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87597709	87597710	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87597709_87597710delTG								ZCCHC14 (72249 upstream) : JPH3 (37731 downstream)																							tgtgcgcatttgtgtgtgttgg	0.000													2	4	---	---	---	---	
ZZEF1	23140	broad.mit.edu	37	17	3968318	3968318	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3968318delA	uc002fxe.2	-						ZZEF1_uc002fxh.2_5'Flank|ZZEF1_uc002fxi.2_5'Flank|ZZEF1_uc002fxj.1_Intron	NM_015113	NP_055928	O43149	ZZEF1_HUMAN	zinc finger, ZZ type with EF hand domain 1								calcium ion binding|zinc ion binding			ovary(2)|central_nervous_system(1)|pancreas(1)	4						atttaaagttaaaaaaaaaaG	0.129													3	4	---	---	---	---	
SHBG	6462	broad.mit.edu	37	17	7533957	7533963	+	Intron	DEL	GACACAT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7533957_7533963delGACACAT	uc002gie.2	+						SHBG_uc010cmo.2_Intron|SHBG_uc010cmp.2_Intron|SHBG_uc010cmq.2_Intron|SHBG_uc010cmr.2_Intron|SHBG_uc010cms.2_Intron|SHBG_uc010cmt.2_Intron|SHBG_uc010cmu.2_Intron|SAT2_uc002gib.1_5'Flank|SAT2_uc002gic.2_5'Flank|SHBG_uc010cmz.2_Intron|SHBG_uc010cmv.2_Intron|SHBG_uc010cmw.2_Intron|SHBG_uc010cmx.2_Intron|SHBG_uc010cmy.2_Intron|SHBG_uc002gid.3_Intron|SHBG_uc010cnd.2_Intron|SHBG_uc010cna.2_Intron|SHBG_uc010vue.1_Intron|SHBG_uc010vuf.1_Intron|SHBG_uc010cnb.2_Intron|SHBG_uc010cnc.2_Intron	NM_001040	NP_001031	P04278	SHBG_HUMAN	sex hormone-binding globulin isoform 1						hormone transport	extracellular region	androgen binding|protein homodimerization activity	p.?(1)			0		all_cancers(10;0.0867)		READ - Rectum adenocarcinoma(115;0.168)	Danazol(DB01406)|Dromostanolone(DB00858)|Estradiol(DB00783)|Estrone(DB00655)|Fluoxymesterone(DB01185)|Hydrocortisone(DB00741)|Mitotane(DB00648)|Norethindrone(DB00717)|Testosterone(DB00624)	GTTCTCAAAGGACACATGACATACACA	0.493													5	10	---	---	---	---	
SHISA6	388336	broad.mit.edu	37	17	11181257	11181258	+	Intron	INS	-	TTTC	TTTC	rs143989101	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11181257_11181258insTTTC	uc002gna.3	+						SHISA6_uc002gnb.3_Intron|SHISA6_uc010com.2_Intron	NM_207386	NP_997269	Q6ZSJ9	SHSA6_HUMAN	shisa homolog 6							integral to membrane				breast(1)	1						ctaatgtggtttttcttttcag	0.030													4	2	---	---	---	---	
HS3ST3A1	9955	broad.mit.edu	37	17	13503534	13503534	+	Intron	DEL	T	-	-	rs112200011		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:13503534delT	uc002gob.1	-							NM_006042	NP_006033	Q9Y663	HS3SA_HUMAN	heparan sulfate D-glucosaminyl							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity			ovary(1)|central_nervous_system(1)	2		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		TAGAAGAGACTTTTTTTTTTT	0.368													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	18276369	18276370	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18276369_18276370insA								SHMT1 (9513 upstream) : EVPLL (4709 downstream)																							gactccatttcaaaaaaaaaag	0.074													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	19663212	19663212	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:19663212delT								ALDH3A1 (11466 upstream) : ULK2 (10932 downstream)																							CCCCGAGGCCTGCTTGCCACC	0.592													4	2	---	---	---	---	
CCDC144NL	339184	broad.mit.edu	37	17	20777898	20777899	+	Intron	DEL	TT	-	-	rs145568290		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:20777898_20777899delTT	uc002gyf.2	-						uc002gyg.1_Intron|uc002gyh.1_Intron	NM_001004306	NP_001004306	Q6NUI1	C144L_HUMAN	coiled-coil domain containing 144 family,												0						ttttgttttctttttttttttt	0.000													4	3	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21316859	21316860	+	Intron	INS	-	G	G	rs142216456		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21316859_21316860insG	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	AGCTCCTCCGTCGGGGCTAATG	0.653										Prostate(3;0.18)			3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21556610	21556610	+	IGR	DEL	T	-	-	rs62051562		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21556610delT								C17orf51 (78879 upstream) : FAM27L (268760 downstream)																							CATGAGGTCCTTTTTCCATTC	0.463													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25335454	25335456	+	IGR	DEL	CAC	-	-	rs149731847		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25335454_25335456delCAC								None (None upstream) : WSB1 (285650 downstream)																							GCTCCATTGTCACCACGAGACAC	0.507													5	3	---	---	---	---	
TBC1D3	729873	broad.mit.edu	37	17	36354485	36354486	+	Intron	INS	-	A	A	rs66843634		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36354485_36354486insA	uc010cvk.2	-						TBC1D3_uc002hpr.2_5'Flank|TBC1D3_uc010wdn.1_Intron	NM_001123391	NP_001116863	Q8IZP1	TBC3A_HUMAN	TBC1 domain family, member 3							intracellular	Rab GTPase activator activity				0	Breast(7;2.97e-12)	Breast(25;0.102)|Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAAGAAGAGGGAAAAAAAAAAT	0.223													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36565867	36565868	+	IGR	INS	-	C	C	rs137973482	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36565867_36565868insC								SOCS7 (9850 upstream) : ARHGAP23 (47776 downstream)																							TCTTCCTGCTTCTGTTTCTCCT	0.302													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	51804585	51804586	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51804585_51804586insT								None (None upstream) : KIF2B (95653 downstream)																							ccacaaagccattttttttcct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	52681863	52681863	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:52681863delT								KIF2B (779290 upstream) : TOM1L1 (296189 downstream)																							TGCTTTTCACTTCCTTTGCCA	0.348													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	54700378	54700381	+	IGR	DEL	CATT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:54700378_54700381delCATT								NOG (27427 upstream) : C17orf67 (168894 downstream)																							AATCTCACTGcattcattcattca	0.235													2	4	---	---	---	---	
PTRH2	51651	broad.mit.edu	37	17	57783270	57783271	+	Intron	INS	-	A	A	rs34174073		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:57783270_57783271insA	uc002ixt.2	-						TMEM49_uc002ixu.3_5'Flank|TMEM49_uc010wog.1_5'Flank|TMEM49_uc010woh.1_5'Flank|TMEM49_uc010woi.1_5'Flank|TMEM49_uc010woj.1_5'Flank|PTRH2_uc002ixs.2_Intron	NM_016077	NP_057161	Q9Y3E5	PTH2_HUMAN	Bcl-2 inhibitor of transcription precursor						apoptosis|translation	mitochondrion	aminoacyl-tRNA hydrolase activity				0	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					accctgtctccaaaaaaaaaaa	0.144													4	2	---	---	---	---	
EFCAB3	146779	broad.mit.edu	37	17	60459782	60459783	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60459782_60459783delTG	uc002izu.1	+						EFCAB3_uc010wpc.1_Intron	NM_173503	NP_775774	Q8N7B9	EFCB3_HUMAN	EF-hand calcium binding domain 3 isoform b								calcium ion binding			skin(1)	1			BRCA - Breast invasive adenocarcinoma(2;2.27e-11)			agttactatttgtgtgtgtgtg	0.000													4	2	---	---	---	---	
ACE	1636	broad.mit.edu	37	17	61579104	61579104	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61579104delC	uc002jaw.1	+							NM_152830		P12821	ACE_HUMAN	angiotensin I converting enzyme 1 isoform 2						arachidonic acid secretion|hormone catabolic process|kidney development|peptide catabolic process|regulation of smooth muscle cell migration	endosome|external side of plasma membrane|extracellular space|integral to membrane|membrane fraction|plasma membrane	actin binding|bradykinin receptor binding|carboxypeptidase activity|chloride ion binding|drug binding|metallopeptidase activity|peptidyl-dipeptidase activity|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|pancreas(1)	4					Benazepril(DB00542)|Captopril(DB01197)|Deserpidine(DB01089)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	atagtgctcaccccatttcct	0.000													5	8	---	---	---	---	
FTSJ3	117246	broad.mit.edu	37	17	61904465	61904466	+	5'Flank	INS	-	G	G	rs72528040		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:61904465_61904466insG	uc002jbz.2	-						FTSJ3_uc002jca.2_5'UTR|PSMC5_uc002jcb.2_5'Flank|PSMC5_uc010ddy.2_5'Flank|PSMC5_uc010ddz.2_5'Flank|PSMC5_uc002jcc.2_5'Flank|PSMC5_uc002jcd.2_5'Flank	NM_017647	NP_060117	Q8IY81	RRMJ3_HUMAN	FtsJ homolog 3						RNA methylation|rRNA processing	nucleolus	methyltransferase activity|nucleic acid binding			ovary(1)	1						ATGCAGCTAACTACTTCCGCTT	0.569													4	2	---	---	---	---	
TEX2	55852	broad.mit.edu	37	17	62259184	62259185	+	Intron	INS	-	TT	TT	rs11326790		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62259184_62259185insTT	uc002jec.2	-						TEX2_uc002jed.2_Intron|TEX2_uc002jee.2_Intron	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2						signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		cTGGTTTTGTATTTTTTTTttt	0.015													3	3	---	---	---	---	
TEX2	55852	broad.mit.edu	37	17	62259449	62259449	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62259449delG	uc002jec.2	-						TEX2_uc002jed.2_Intron|TEX2_uc002jee.2_Intron	NM_018469	NP_060939	Q8IWB9	TEX2_HUMAN	testis expressed sequence 2						signal transduction|sphingolipid metabolic process	integral to membrane				ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		agcacccaccgatggaggaat	0.000													4	2	---	---	---	---	
CCDC45	90799	broad.mit.edu	37	17	62503564	62503564	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62503564delC	uc002jem.2	+						CCDC45_uc002jen.2_Intron|CCDC45_uc010wqb.1_Intron|DDX5_uc010deh.2_5'Flank|DDX5_uc002jek.2_5'Flank|DDX5_uc002jej.2_5'Flank|DDX5_uc010wqa.1_5'Flank	NM_138363	NP_612372	Q96GE4	CEP95_HUMAN	coiled-coil domain containing 45							centrosome|spindle pole	protein binding				0	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CGTGTGCCCTCCGCCCTTGCA	0.527													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	65777817	65777817	+	IGR	DEL	A	-	-	rs113738647		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65777817delA								NOL11 (37551 upstream) : BPTF (43963 downstream)																							actccatctcaaaaaaaaaag	0.010													2	5	---	---	---	---	
AMZ2	51321	broad.mit.edu	37	17	66247808	66247808	+	Intron	DEL	A	-	-	rs76065787		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66247808delA	uc002jgs.1	+						AMZ2_uc002jgr.1_Intron|AMZ2_uc002jgt.1_Intron|AMZ2_uc002jgu.1_Intron|AMZ2_uc002jgv.1_Intron|AMZ2_uc002jgw.1_Intron|AMZ2_uc002jgy.1_Intron	NM_001033572	NP_001028744	Q86W34	AMZ2_HUMAN	archaemetzincins-2 isoform 1								metallopeptidase activity|zinc ion binding				0	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			accgtgtctcaaaaaaaaaaT	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	68598494	68598494	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:68598494delC								KCNJ2 (422313 upstream) : None (None downstream)																							AAGCTTTTTTCCAAAGGGGAT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70222738	70222739	+	IGR	INS	-	T	T	rs35330275		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70222738_70222739insT								SOX9 (100186 upstream) : SLC39A11 (419347 downstream)																							tggttttttggttttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70347822	70347826	+	IGR	DEL	TGGCA	-	-	rs150945614		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70347822_70347826delTGGCA								SOX9 (225270 upstream) : SLC39A11 (294260 downstream)																							gcacagcacctggcacgtggtaagt	0.176													4	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	70439226	70439227	+	Intron	DEL	TG	-	-	rs140261829		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:70439226_70439227delTG	uc002jix.2	-						uc002jiz.1_Intron					Homo sapiens cDNA FLJ20470 fis, clone KAT06815.																		CCTTGGGTTTtgtgtgtgtgtg	0.342													8	4	---	---	---	---	
SLC39A11	201266	broad.mit.edu	37	17	71020845	71020845	+	Intron	DEL	T	-	-	rs111311150		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71020845delT	uc002jjb.2	-						SLC39A11_uc002jja.2_Intron|SLC39A11_uc002jjc.1_Intron	NM_001159770	NP_001153242	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11 isoform 1						zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)	1						GTTGTGTACAttttttttttt	0.199													3	3	---	---	---	---	
SDK2	54549	broad.mit.edu	37	17	71455841	71455842	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71455841_71455842insT	uc010dfm.2	-							NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2						cell adhesion	integral to membrane				ovary(2)	2						agatttctttcttttttttttt	0.000													4	3	---	---	---	---	
RPL38	6169	broad.mit.edu	37	17	72203019	72203019	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72203019delT	uc002jjz.2	+						RPL38_uc002jka.2_Intron	NM_000999	NP_000990	P63173	RL38_HUMAN	ribosomal protein L38						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit	protein binding|RNA binding|structural constituent of ribosome				0						gccgggctaattttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	72555441	72555442	+	IGR	INS	-	CT	CT	rs140631765	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72555441_72555442insCT								CD300C (13159 upstream) : CD300LD (20669 downstream)																							acatacatttcctctctctctc	0.000													7	8	---	---	---	---	
MIF4GD	57409	broad.mit.edu	37	17	73263266	73263267	+	Intron	INS	-	CAAACCACTTCTT	CAAACCACTTCTT	rs141887033	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73263266_73263267insCAAACCACTTCTT	uc002jnr.2	-						MIF4GD_uc002jno.2_Intron|MIF4GD_uc002jnp.2_Intron|MIF4GD_uc002jnq.2_Intron			A9UHW6	MI4GD_HUMAN	RecName: Full=MIF4G domain-containing protein; AltName: Full=SLBP-interacting protein 1;          Short=hSLIP1;						regulation of translation|RNA metabolic process	cytoplasm|nucleus	protein C-terminus binding			ovary(1)	1	all_cancers(13;1.25e-07)|all_epithelial(9;2.63e-08)|Breast(9;1.06e-07)		all cancers(21;3.02e-07)|Epithelial(20;2.92e-06)			aagcctgtctccaaaccacttc	0.243													9	4	---	---	---	---	
GRB2	2885	broad.mit.edu	37	17	73383533	73383533	+	Intron	DEL	A	-	-	rs111505022		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73383533delA	uc002jnx.3	-						GRB2_uc002jny.3_Intron	NM_002086	NP_002077	P62993	GRB2_HUMAN	growth factor receptor-bound protein 2 isoform						axon guidance|blood coagulation|cell junction assembly|cell-cell signaling|cellular response to ionizing radiation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interspecies interaction between organisms|leukocyte migration|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|positive regulation of reactive oxygen species metabolic process|Ras protein signal transduction|receptor internalization|signal transduction in response to DNA damage|T cell costimulation	cytosol|Golgi apparatus	epidermal growth factor receptor binding|insulin receptor substrate binding|SH3/SH2 adaptor activity			ovary(3)	3	all_cancers(13;5.44e-09)|all_epithelial(9;1.1e-09)|Breast(9;1.85e-09)|all_lung(278;0.222)		all cancers(21;1.09e-07)|Epithelial(20;1.23e-06)|Lung(188;0.185)		Pegademase bovine(DB00061)	actctgtcttaaaaaaaaaaa	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	73406762	73406763	+	IGR	INS	-	TC	TC	rs139098370	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:73406762_73406763insTC								GRB2 (4972 upstream) : KIAA0195 (45901 downstream)																							GCCTTTGCTTTtctctctctct	0.252													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74106905	74106906	+	IGR	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74106905_74106906delTT								EXOC7 (7037 upstream) : FOXJ1 (25511 downstream)																							gagcccggccTTtttttttttt	0.000													4	2	---	---	---	---	
PRPSAP1	5635	broad.mit.edu	37	17	74333529	74333530	+	Intron	INS	-	AAC	AAC	rs150837660	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74333529_74333530insAAC	uc010wta.1	-						PRPSAP1_uc010wtb.1_Intron	NM_002766	NP_002757	Q14558	KPRA_HUMAN	phosphoribosyl pyrophosphate						nucleotide biosynthetic process		enzyme inhibitor activity|identical protein binding|magnesium ion binding|ribose phosphate diphosphokinase activity			ovary(1)	1						caacaacaacaaACTAACCTGA	0.243													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74363030	74363030	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74363030delT								PRPSAP1 (12751 upstream) : SPHK1 (9712 downstream)																							AGCCTCACtcttttttttttt	0.090													6	3	---	---	---	---	
RHBDF2	79651	broad.mit.edu	37	17	74487514	74487515	+	Intron	INS	-	G	G	rs151214464	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74487514_74487515insG	uc002jrq.1	-						RHBDF2_uc002jrp.1_Intron	NM_024599	NP_078875	Q6PJF5	RHDF2_HUMAN	rhomboid, veinlet-like 6 isoform 1						negative regulation of protein secretion|protein transport|proteolysis	endoplasmic reticulum membrane|integral to membrane	growth factor binding|serine-type endopeptidase activity				0						GGCAATCAGTTGGGGGGGGGTC	0.644													8	4	---	---	---	---	
MXRA7	439921	broad.mit.edu	37	17	74673372	74673373	+	3'UTR	INS	-	CAAA	CAAA	rs146773182	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74673372_74673373insCAAA	uc002jsk.1	-	4						NM_001008528	NP_001008528	P84157	MXRA7_HUMAN	transmembrane anchor protein 1 isoform 1							integral to membrane					0						agactccatctcaaacaaacaa	0.223													6	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	74779235	74779235	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74779235delA								MFSD11 (3899 upstream) : MGAT5B (85563 downstream)																							ctccagcTCCAAAAAAAAAAA	0.119													4	2	---	---	---	---	
DNAH17	8632	broad.mit.edu	37	17	76449061	76449062	+	Intron	INS	-	TCT	TCT	rs75523356		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:76449061_76449062insTCT	uc010dhp.1	-						DNAH17_uc002jvs.2_Intron					SubName: Full=DNAH17 variant protein; Flags: Fragment;											ovary(6)|breast(2)|skin(1)	9			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			gtaccaaatgctcaattgtgta	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	78988601	78988601	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78988601delT								CHMP6 (14669 upstream) : FLJ90757 (14332 downstream)																							acctagctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	1420783	1420784	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:1420783_1420784delTG								C18orf2 (13602 upstream) : None (None downstream)																							TGTGTTTGTTTGTGTGTGTGTG	0.272													4	2	---	---	---	---	
DLGAP1	9229	broad.mit.edu	37	18	3581662	3581663	+	Intron	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:3581662_3581663insA	uc002kmf.2	-						DLGAP1_uc010wyz.1_Intron|DLGAP1_uc002kme.1_Intron|DLGAP1_uc010dkn.2_Intron|DLGAP1_uc010wyw.1_Intron|DLGAP1_uc010wyx.1_Intron|DLGAP1_uc010wyy.1_Intron|DLGAP1_uc002kmg.2_Intron	NM_004746	NP_004737	O14490	DLGP1_HUMAN	discs large homolog-associated protein 1 isoform						synaptic transmission	cell junction|postsynaptic density|postsynaptic membrane				ovary(2)|pancreas(1)|skin(1)	4		Colorectal(8;0.0257)				TTCTCACCATGaaaaaaaaaaa	0.381													6	3	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13445558	13445561	+	Intron	DEL	TGTT	-	-	rs141598397		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13445558_13445561delTGTT	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		tctatgtgtgtgtttgtgcatgtg	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15383163	15383163	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15383163delG								LOC644669 (57245 upstream) : None (None downstream)																							ggccaatggtggtaaaaggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15391943	15391944	+	IGR	INS	-	A	A	rs142303446		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15391943_15391944insA								LOC644669 (66025 upstream) : None (None downstream)																							cgcatatctacaactatcagat	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	19993208	19993208	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:19993208delA								GATA6 (210981 upstream) : CTAGE1 (356 downstream)																							gggacttggtaaggatacagt	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	20708879	20708880	+	IGR	INS	-	AG	AG			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:20708879_20708880insAG								RBBP8 (102434 upstream) : CABLES1 (5648 downstream)																							gcctgggtgacagagtgacacc	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	22995786	22995787	+	IGR	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22995786_22995787insC								ZNF521 (63572 upstream) : SS18 (600432 downstream)																							CCCTCACTTAGCCCTGAGTATA	0.490													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	28694694	28694694	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28694694delC								DSC2 (12306 upstream) : DSC1 (14522 downstream)																							GTGGCCCCTTCCcctagcagg	0.144													4	2	---	---	---	---	
CELF4	56853	broad.mit.edu	37	18	34904987	34904987	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:34904987delG	uc002lae.2	-						CELF4_uc010dnd.1_Intron|CELF4_uc002lag.2_Intron|CELF4_uc002laf.2_Intron|CELF4_uc002lai.2_Intron	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1						embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CCAGGAGTGTGGGGGAAAGAG	0.547													4	2	---	---	---	---	
RIT2	6014	broad.mit.edu	37	18	40602910	40602910	+	Intron	DEL	T	-	-	rs146949479	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:40602910delT	uc002lav.2	-						RIT2_uc010dnf.2_Intron	NM_002930	NP_002921	Q99578	RIT2_HUMAN	Ras-like without CAAX 2						nerve growth factor receptor signaling pathway|small GTPase mediated signal transduction|synaptic transmission	intracellular|plasma membrane	calmodulin binding|GTP binding|GTPase activity			ovary(1)	1						GTTTTTTCGATTTTTCTGGGA	0.239													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	42246822	42246822	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42246822delT								None (None upstream) : SETBP1 (13316 downstream)																							ctAAACTGCATTTTTTTTTTC	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	45134662	45134663	+	IGR	INS	-	T	T	rs35972631		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:45134662_45134663insT								IER3IP1 (431917 upstream) : SMAD2 (224804 downstream)																							ctttttctttcttttttttttt	0.183													4	2	---	---	---	---	
KIAA0427	9811	broad.mit.edu	37	18	46097540	46097543	+	Intron	DEL	TTTG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:46097540_46097543delTTTG	uc002ldc.2	+						KIAA0427_uc002ldd.2_Intron	NM_014772	NP_055587	O43310	CTIF_HUMAN	hypothetical protein LOC9811 isoform 1						nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of translational initiation	perinuclear region of cytoplasm	protein binding				0						TGGgtttgtttttgtttgtttgtt	0.225													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	48284618	48284619	+	IGR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:48284618_48284619insA								MAPK4 (26423 upstream) : MRO (36872 downstream)																							ctccatctcttaaaaaaaaaaa	0.149													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49729553	49729554	+	IGR	INS	-	GGTTC	GGTTC	rs139008679	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49729553_49729554insGGTTC								None (None upstream) : DCC (137017 downstream)																							GCTTATCTCAGGGTTCTCTTAC	0.431													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	49868650	49868651	+	Intron	INS	-	GT	GT	rs150869606	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49868650_49868651insGT	uc002lfe.1	+							NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		tgtgtgtgtgcgtgtgtgtgtg	0.554													4	2	---	---	---	---	
DCC	1630	broad.mit.edu	37	18	50497882	50497883	+	Intron	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50497882_50497883delCA	uc002lfe.1	+						DCC_uc010xdr.1_Intron|DCC_uc010dpf.1_Intron	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor						apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		TGTGTGCGCGcacacacacaca	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	51455534	51455535	+	IGR	DEL	AC	-	-	rs34748678		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:51455534_51455535delAC								DCC (397752 upstream) : MBD2 (225040 downstream)																							TACTCTCCTGacacacacacac	0.431													4	2	---	---	---	---	
ALPK2	115701	broad.mit.edu	37	18	56217640	56217641	+	Intron	INS	-	C	C	rs150211560		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56217640_56217641insC	uc002lhj.3	-							NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase								ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						tacaaccccatcccatttccat	0.129													4	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	59450289	59450290	+	IGR	INS	-	T	T	rs59450301		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59450289_59450290insT								CDH20 (227924 upstream) : RNF152 (32014 downstream)																							cttttcttttcttttttttttt	0.188													3	3	---	---	---	---	
PIGN	23556	broad.mit.edu	37	18	59790606	59790606	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:59790606delA	uc002lii.3	-						PIGN_uc002lij.3_Intron	NM_176787	NP_789744	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						C-terminal protein lipidation|preassembly of GPI anchor in ER membrane	endoplasmic reticulum membrane|integral to membrane	phosphotransferase activity, for other substituted phosphate groups			breast(2)|upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	5		Colorectal(73;0.187)				TGAGGATAATAAAAACATACT	0.294													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	60737612	60737613	+	IGR	INS	-	AG	AG	rs142012698	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60737612_60737613insAG								PHLPP1 (89947 upstream) : BCL2 (52966 downstream)																							GAATGAGTGACAGACATTTGGA	0.292													2	4	---	---	---	---	
CDH7	1005	broad.mit.edu	37	18	63518108	63518113	+	Intron	DEL	CACAAT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:63518108_63518113delCACAAT	uc002ljz.2	+						CDH7_uc002lka.2_Intron|CDH7_uc002lkb.2_Intron	NM_033646	NP_387450	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)|pancreas(1)|skin(1)	4		Esophageal squamous(42;0.129)				agtgcaatggcacaatcatggctcac	0.053													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	65005260	65005260	+	IGR	DEL	T	-	-	rs147312120		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65005260delT								CDH19 (734044 upstream) : DSEL (168559 downstream)																							CTCCTTGTCCTTTCTTTCTTT	0.189													0	7	---	---	---	---	
ZNF516	9658	broad.mit.edu	37	18	74152163	74152164	+	Intron	INS	-	T	T	rs139547423	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74152163_74152164insT	uc010dqx.1	-						ZNF516_uc002lme.2_Intron	NM_014643	NP_055458	Q92618	ZN516_HUMAN	zinc finger protein 516						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		ACATAACACACTGTGTAAGACG	0.391													5	3	---	---	---	---	
ZNF236	7776	broad.mit.edu	37	18	74546934	74546935	+	Intron	INS	-	T	T	rs111651599		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74546934_74546935insT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		tttattttctgttttttttttt	0.198													3	3	---	---	---	---	
MBP	4155	broad.mit.edu	37	18	74691917	74691918	+	3'UTR	INS	-	A	A			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74691917_74691918insA	uc010xfd.1	-	9					MBP_uc002lml.2_3'UTR|MBP_uc002lmn.2_3'UTR|MBP_uc002lmp.2_3'UTR|MBP_uc010xfe.1_3'UTR|MBP_uc010dqz.2_RNA	NM_001025101	NP_001020272	P02686	MBP_HUMAN	Golli-mbp isoform 1						central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)		AGAAGGACAGGAAAAAAAAACA	0.475													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76335477	76335477	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76335477delA								None (None upstream) : SALL3 (404798 downstream)																							ctaaaaatacaaaaaaaaaaa	0.000													4	2	---	---	---	---	
CTDP1	9150	broad.mit.edu	37	18	77445005	77445006	+	Intron	DEL	GG	-	-	rs71974203		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77445005_77445006delGG	uc002lnh.1	+						CTDP1_uc002lni.1_Intron|CTDP1_uc010drd.1_Intron	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,						positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		CTGGTGAGGAGGACGGTGCAGG	0.629													3	3	---	---	---	---	
PIAS4	51588	broad.mit.edu	37	19	4035907	4035908	+	Intron	DEL	GT	-	-	rs143190193	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4035907_4035908delGT	uc002lzg.2	+							NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4						positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		AGTCCACACCGTCTcacacaca	0.054													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	4593801	4593801	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4593801delT								SEMA6B (34030 upstream) : TNFAIP8L1 (45729 downstream)																							tctaCGGAGAttttttttttt	0.020													4	2	---	---	---	---	
C19orf10	56005	broad.mit.edu	37	19	4665290	4665290	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4665290delA	uc002may.2	-							NM_019107	NP_061980	Q969H8	CS010_HUMAN	hypothetical protein LOC56005 precursor							ER-Golgi intermediate compartment|extracellular region					0		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.015)		gctggcgtgcagtggcacgat	0.100													4	2	---	---	---	---	
KDM4B	23030	broad.mit.edu	37	19	4982304	4982304	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4982304delA	uc002mbq.3	+						KDM4B_uc010xil.1_Intron	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						ttctgtctccaaaaaaaaaaa	0.000													4	4	---	---	---	---	
SLC25A41	284427	broad.mit.edu	37	19	6432330	6432330	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6432330delT	uc010dus.2	-						SLC25A41_uc010dut.2_Intron	NM_173637	NP_775908	Q8N5S1	S2541_HUMAN	solute carrier family 25, member 41						transmembrane transport	integral to membrane|mitochondrial inner membrane	binding				0						CAAGTCTGCAttttttttttt	0.313													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	6519879	6519879	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6519879delT								TUBB4 (17549 upstream) : TNFSF9 (11131 downstream)																							GCACCTGGCCttttttttttt	0.070													4	2	---	---	---	---	
C3	718	broad.mit.edu	37	19	6692001	6692002	+	Intron	DEL	AC	-	-	rs113499505		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6692001_6692002delAC	uc002mfm.2	-						C3_uc002mfl.2_Intron	NM_000064	NP_000055	P01024	CO3_HUMAN	complement component 3 precursor						complement activation, alternative pathway|complement activation, classical pathway|G-protein coupled receptor protein signaling pathway|inflammatory response|positive regulation vascular endothelial growth factor production	extracellular space	endopeptidase inhibitor activity|receptor binding			skin(3)|ovary(1)|pancreas(1)	5				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)		tccatctcaaacacacacacac	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	7949345	7949348	+	IGR	DEL	AAGG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7949345_7949348delAAGG								EVI5L (19484 upstream) : LRRC8E (4042 downstream)																							AAAGAAaagaaaggaaggaaggaa	0.049													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	9165049	9165049	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9165049delC								MUC16 (73031 upstream) : OR1M1 (38872 downstream)																							cctcactcttccctcatctga	0.055													4	2	---	---	---	---	
PDE4A	5141	broad.mit.edu	37	19	10573778	10573779	+	Intron	INS	-	T	T	rs34214178		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10573778_10573779insT	uc002moj.2	+						PDE4A_uc002mok.2_Intron|PDE4A_uc002mol.2_Intron|PDE4A_uc002mom.2_Intron|PDE4A_uc002mon.2_Intron|PDE4A_uc002moo.2_Intron	NM_001111307	NP_001104777	P27815	PDE4A_HUMAN	phosphodiesterase 4A isoform 1						signal transduction	cytosol|membrane fraction|perinuclear region of cytoplasm|ruffle membrane|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|protein binding			ovary(1)|breast(1)|central_nervous_system(1)	3			OV - Ovarian serous cystadenocarcinoma(20;5.8e-10)|Epithelial(33;7.58e-07)|all cancers(31;3.91e-06)		Cilostazol(DB01166)|Dipyridamole(DB00975)|Dyphylline(DB00651)|Enprofylline(DB00824)|Iloprost(DB01088)|Milrinone(DB00235)|Pentoxifylline(DB00806)|Phentolamine(DB00692)|Tadalafil(DB00820)|Theophylline(DB00277)	tctgtttttggttttttttttt	0.000													4	2	---	---	---	---	
MAST1	22983	broad.mit.edu	37	19	12948572	12948572	+	5'Flank	DEL	T	-	-	rs35858668		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12948572delT	uc002mvm.2	+						RTBDN_uc002mvh.1_5'Flank|RTBDN_uc002mvj.2_5'Flank|MAST1_uc002mvk.2_Intron|MAST1_uc002mvl.2_5'Flank	NM_014975	NP_055790	Q9Y2H9	MAST1_HUMAN	microtubule associated serine/threonine kinase						cytoskeleton organization|intracellular protein kinase cascade	cytoplasm|cytoskeleton|plasma membrane	ATP binding|magnesium ion binding|protein serine/threonine kinase activity			ovary(3)|lung(2)|large_intestine(1)|skin(1)	7						ggccagaaacttttttttttt	0.000													4	2	---	---	---	---	
TRMT1	55621	broad.mit.edu	37	19	13217108	13217109	+	Intron	INS	-	AA	AA	rs147027521	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13217108_13217109insAA	uc002mwj.2	-						TRMT1_uc010xmy.1_Intron|TRMT1_uc002mwk.2_Intron|TRMT1_uc002mwl.3_Intron|TRMT1_uc010xmz.1_Intron	NM_017722	NP_060192	Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 isoform 1								RNA binding|tRNA (guanine-N2-)-methyltransferase activity|zinc ion binding			ovary(1)|pancreas(1)	2			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		aggctggtttcattcctgggct	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13729547	13729552	+	IGR	DEL	AGAGAG	-	-	rs112163024		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13729547_13729552delAGAGAG								CACNA1A (112273 upstream) : CCDC130 (113022 downstream)																							agacagagacagagagagagagagag	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	13729942	13729942	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13729942delG								CACNA1A (112668 upstream) : CCDC130 (112632 downstream)																							aaggaaggaagggaaggaagg	0.129													5	3	---	---	---	---	
GDF1	2657	broad.mit.edu	37	19	18984651	18984651	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:18984651delA	uc002nki.1	-							NM_021267	NP_067090	P27539	GDF1_HUMAN	LAG1 homolog, ceramide synthase 1 isoform 1						growth	extracellular space	cytokine activity|growth factor activity				0						ctctgtctcgaaaaaaaaaaa	0.244													4	2	---	---	---	---	
GATAD2A	54815	broad.mit.edu	37	19	19507124	19507124	+	Intron	DEL	A	-	-	rs78107089		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19507124delA	uc010xqt.1	+						GATAD2A_uc010xqu.1_Intron	NM_017660	NP_060130	Q86YP4	P66A_HUMAN	GATA zinc finger domain containing 2A						DNA methylation|negative regulation of transcription, DNA-dependent	nuclear speck|NuRD complex	protein binding, bridging|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						actccgtctgaaaaaaaaaTC	0.204													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	21425848	21425849	+	IGR	INS	-	AGG	AGG	rs145063799		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21425848_21425849insAGG								ZNF431 (57043 upstream) : ZNF708 (48114 downstream)																							atgaaaatataagttgtttgct	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27848130	27848130	+	IGR	DEL	G	-	-	rs34327208		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27848130delG								None (None upstream) : LOC148189 (433272 downstream)																							tcaaaagaaagtttcaattct	0.000													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27870563	27870563	+	IGR	DEL	T	-	-	rs111794544		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27870563delT								None (None upstream) : LOC148189 (410839 downstream)																							ggaaacactctttttgtagaa	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30149493	30149494	+	IGR	INS	-	CACACACACT	CACACACACT	rs141338358	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30149493_30149494insCACACACACT								POP4 (41331 upstream) : PLEKHF1 (6833 downstream)																							acacacacacactctcacacac	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30401324	30401327	+	IGR	DEL	CTTT	-	-	rs148411016		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30401324_30401327delCTTT								CCNE1 (86106 upstream) : C19orf2 (13224 downstream)																							tccttccttcctttcttttccttc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30741441	30741441	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30741441delG								C19orf2 (234830 upstream) : ZNF536 (121887 downstream)																							CAAGGGTCTTGGGGAAAGTGG	0.537													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31866679	31866679	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31866679delC								TSHZ3 (26489 upstream) : ZNF507 (969835 downstream)																							ctcaggtgatccaactgcctc	0.000													4	2	---	---	---	---	
TDRD12	91646	broad.mit.edu	37	19	33296013	33296013	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33296013delG	uc002ntq.2	+									Q587J7	TDR12_HUMAN	RecName: Full=Tudor domain-containing protein 12; AltName: Full=ES cell-associated transcript 8 protein;								ATP binding|ATP-dependent helicase activity|nucleic acid binding				0	Esophageal squamous(110;0.137)					agaccagcctgggcaacacac	0.000													4	2	---	---	---	---	
RHPN2	85415	broad.mit.edu	37	19	33499935	33499936	+	Intron	INS	-	AGC	AGC	rs148732425	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33499935_33499936insAGC	uc002nuf.2	-						RHPN2_uc010xro.1_Intron|RHPN2_uc002nue.2_Intron	NM_033103	NP_149094	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2						signal transduction	perinuclear region of cytoplasm	protein binding			central_nervous_system(5)|ovary(1)	6	Esophageal squamous(110;0.137)					acctactgtatacgctgtgtga	0.000													2	4	---	---	---	---	
GPATCH1	55094	broad.mit.edu	37	19	33617853	33617854	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:33617853_33617854insT	uc002nug.1	+						GPATCH1_uc002nuh.1_Intron	NM_018025	NP_060495	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1							catalytic step 2 spliceosome	nucleic acid binding			skin(1)	1	Esophageal squamous(110;0.137)					tgagaccccagctctacaaaaa	0.000													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34062556	34062557	+	IGR	INS	-	AC	AC	rs150469631	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34062556_34062557insAC								PEPD (49755 upstream) : CHST8 (50304 downstream)																							acaggctggatacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34082983	34082983	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34082983delG								PEPD (70182 upstream) : CHST8 (29878 downstream)																							ttttttttttgagacagagtt	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34530574	34530574	+	IGR	DEL	T	-	-	rs66758244		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34530574delT								KCTD15 (223909 upstream) : LSM14A (132778 downstream)																							CTTGCTTGAAttttttttttt	0.308													4	2	---	---	---	---	
LSM14A	26065	broad.mit.edu	37	19	34702700	34702700	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34702700delA	uc002nvb.3	+						LSM14A_uc002nva.3_Intron|LSM14A_uc010xru.1_Intron|LSM14A_uc002nvc.3_Intron	NM_001114093	NP_001107565	Q8ND56	LS14A_HUMAN	LSM14 homolog A isoform a						cytoplasmic mRNA processing body assembly|multicellular organismal development|regulation of translation	cytoplasmic mRNA processing body|intracellular membrane-bounded organelle|stress granule				skin(1)	1	Esophageal squamous(110;0.162)					gtccccccccaaaaaaaaaaG	0.124													4	2	---	---	---	---	
KIAA0355	9710	broad.mit.edu	37	19	34755303	34755304	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34755303_34755304insT	uc002nvd.3	+						KIAA0355_uc010edk.1_5'Flank	NM_014686	NP_055501	O15063	K0355_HUMAN	hypothetical protein LOC9710											ovary(1)	1	Esophageal squamous(110;0.162)					GATGACATGTCttttttttttt	0.262													3	4	---	---	---	---	
APLP1	333	broad.mit.edu	37	19	36358523	36358524	+	5'Flank	DEL	CA	-	-	rs113654729		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36358523_36358524delCA	uc002oce.2	+						APLP1_uc010xsz.1_5'Flank|APLP1_uc002ocf.2_5'Flank|APLP1_uc002ocg.2_5'Flank|APLP1_uc010xta.1_5'Flank	NM_005166	NP_005157	P51693	APLP1_HUMAN	amyloid precursor-like protein 1 isoform 2						apoptosis|cell adhesion|cellular response to norepinephrine stimulus|endocytosis|negative regulation of cAMP biosynthetic process|nervous system development|organ morphogenesis	basement membrane|integral to membrane|perinuclear region of cytoplasm|plasma membrane	alpha-2A adrenergic receptor binding|alpha-2B adrenergic receptor binding|alpha-2C adrenergic receptor binding|heparin binding|identical protein binding|metal ion binding			ovary(2)	2	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TATACATCTTcacacacacaca	0.168													4	3	---	---	---	---	
MAP3K10	4294	broad.mit.edu	37	19	40700854	40700854	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40700854delT	uc002ona.2	+							NM_002446	NP_002437	Q02779	M3K10_HUMAN	mitogen-activated protein kinase kinase kinase						activation of JUN kinase activity|induction of apoptosis|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription, DNA-dependent|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of JNK cascade|protein autophosphorylation|smoothened signaling pathway	cytoplasm	ATP binding|bHLH transcription factor binding|JUN kinase kinase kinase activity|protein homodimerization activity|transcription corepressor activity			ovary(2)|lung(2)|skin(1)|pancreas(1)	6						gagggttctctttatttagat	0.000													4	2	---	---	---	---	
LYPD4	147719	broad.mit.edu	37	19	42341769	42341769	+	Intron	DEL	A	-	-	rs74593362		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42341769delA	uc002orp.1	-						LYPD4_uc002orq.1_Intron	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor							anchored to membrane|plasma membrane				ovary(1)	1						ctcccatttcaaaaaaaaaaa	0.269													3	3	---	---	---	---	
LYPD4	147719	broad.mit.edu	37	19	42348493	42348493	+	5'UTR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42348493delC	uc002orp.1	-	1					LYPD4_uc002orq.1_5'UTR|DMRTC2_uc002orr.1_5'Flank|DMRTC2_uc002ors.2_5'Flank|DMRTC2_uc010xwe.1_5'Flank	NM_173506	NP_775777	Q6UWN0	LYPD4_HUMAN	LY6/PLAUR domain containing 4 precursor							anchored to membrane|plasma membrane				ovary(1)	1						AAAATCACAACCGACACAAAG	0.522													3	4	---	---	---	---	
SRRM5	100170229	broad.mit.edu	37	19	44106063	44106063	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44106063delT	uc002oxb.2	+							NM_001145641	NP_001139113	B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5												0						TCTTAAAttcttttttctttt	0.129													4	2	---	---	---	---	
MARK4	57787	broad.mit.edu	37	19	45771093	45771094	+	Intron	INS	-	T	T	rs148907985	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45771093_45771094insT	uc002pbb.1	+						MARK4_uc002paz.1_Intron|MARK4_uc002pba.1_Intron|MARK4_uc002pbc.1_Intron			Q96L34	MARK4_HUMAN	RecName: Full=MAP/microtubule affinity-regulating kinase 4;          EC=2.7.11.1; AltName: Full=MAP/microtubule affinity-regulating kinase-like 1;						microtubule bundle formation|nervous system development|positive regulation of programmed cell death	centrosome|neuron projection	ATP binding|gamma-tubulin binding|microtubule binding|protein serine/threonine kinase activity|tau-protein kinase activity|ubiquitin binding			central_nervous_system(2)|large_intestine(1)	3		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		taatttttgagttttttgtaga	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47002572	47002573	+	IGR	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47002572_47002573delTG								PNMAL2 (3403 upstream) : CALM3 (101939 downstream)																							GCTTGCACTTtgtgtgtgtgtg	0.168													4	2	---	---	---	---	
GRLF1	2909	broad.mit.edu	37	19	47429887	47429887	+	Intron	DEL	A	-	-	rs66896021		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47429887delA	uc010ekv.2	+							NM_004491	NP_004482	Q9NRY4	RHG35_HUMAN	glucocorticoid receptor DNA binding factor 1						axon guidance|negative regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|transcription, DNA-dependent	cytosol	DNA binding|Rho GTPase activator activity|transcription corepressor activity			central_nervous_system(1)	1		all_cancers(25;1.51e-09)|all_epithelial(76;1.87e-07)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|Ovarian(192;0.0129)|all_neural(266;0.026)|Breast(70;0.077)		all cancers(93;2.03e-05)|OV - Ovarian serous cystadenocarcinoma(262;2.57e-05)|Epithelial(262;0.00135)|GBM - Glioblastoma multiforme(486;0.0289)		TTTTGGTGCTAAAAAAAAAAA	0.343													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	48083521	48083521	+	IGR	DEL	G	-	-	rs67895432		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48083521delG								ZNF541 (24408 upstream) : GLTSCR1 (27932 downstream)																							aaacaaaaaagaaaagaaaag	0.000													2	4	---	---	---	---	
CRX	1406	broad.mit.edu	37	19	48345115	48345115	+	3'UTR	DEL	A	-	-	rs35850082		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48345115delA	uc002phq.3	+	4						NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein						organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		GGCAAGGTGTAAAAAAAAAAG	0.318													4	2	---	---	---	---	
LIG1	3978	broad.mit.edu	37	19	48656996	48656997	+	Intron	DEL	CA	-	-	rs34289915		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48656996_48656997delCA	uc002pia.1	-						LIG1_uc010xze.1_Intron|LIG1_uc002phz.1_Intron|LIG1_uc002pib.1_Intron|LIG1_uc010xzf.1_Intron|LIG1_uc010xzg.1_Intron|LIG1_uc010xzh.1_Intron	NM_000234	NP_000225	P18858	DNLI1_HUMAN	DNA ligase I						anatomical structure morphogenesis|base-excision repair|cell division|DNA ligation involved in DNA repair|DNA strand elongation involved in DNA replication|double-strand break repair via homologous recombination|nucleotide-excision repair, DNA gap filling|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication|transcription-coupled nucleotide-excision repair	nucleoplasm	ATP binding|DNA binding|DNA ligase (ATP) activity|metal ion binding			large_intestine(2)|lung(1)	3		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	ctcttggcttcacacacacaca	0.050								NER					4	3	---	---	---	---	
RUVBL2	10856	broad.mit.edu	37	19	49508897	49508898	+	Intron	INS	-	T	T	rs150154178		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49508897_49508898insT	uc002plr.1	+						RUVBL2_uc002plq.1_Intron|RUVBL2_uc010yab.1_Intron|RUVBL2_uc002pls.1_Intron|RUVBL2_uc010emn.1_Intron|RUVBL2_uc010yac.1_Intron	NM_006666	NP_006657	Q9Y230	RUVB2_HUMAN	RuvB-like 2						cellular response to UV|DNA recombination|DNA repair|histone H2A acetylation|histone H4 acetylation|protein folding|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|Ino80 complex|membrane|MLL1 complex|NuA4 histone acetyltransferase complex|nuclear matrix	ATP binding|ATP-dependent DNA helicase activity|damaged DNA binding|identical protein binding|unfolded protein binding				0		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		ACtcttcttcattttttttttt	0.134													4	2	---	---	---	---	
KCNC3	3748	broad.mit.edu	37	19	50830179	50830180	+	Intron	INS	-	G	G	rs147893901	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50830179_50830180insG	uc002pru.1	-						NR1H2_uc002prv.3_5'Flank|KCNC3_uc002prt.1_5'Flank	NM_004977	NP_004968	Q14003	KCNC3_HUMAN	Shaw-related voltage-gated potassium channel						cell death	voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1		all_neural(266;0.057)|Ovarian(192;0.208)		OV - Ovarian serous cystadenocarcinoma(262;0.00283)|GBM - Glioblastoma multiforme(134;0.0181)		TTTTGCACGGCGGGGGGGGAGG	0.490													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	51096130	51096152	+	IGR	DEL	TTCCTTCCTTCCTTCCCTCCTTC	-	-	rs144241755	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51096130_51096152delTTCCTTCCTTCCTTCCCTCCTTC								LRRC4B (24828 upstream) : SNAR-F (12068 downstream)																							ccttccttctttccttccttccttccctccttcctcccttctc	0.000													5	3	---	---	---	---	
BIRC8	112401	broad.mit.edu	37	19	53795885	53795886	+	5'Flank	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53795885_53795886delTG	uc002qbk.2	-							NM_033341	NP_203127	Q96P09	BIRC8_HUMAN	baculoviral IAP repeat-containing 8						apoptosis		zinc ion binding			lung(1)	1				GBM - Glioblastoma multiforme(134;0.00304)		tttggatatatgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	53863083	53863083	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53863083delG								ZNF845 (4961 upstream) : ZNF525 (5885 downstream)																							acaacaaactgtaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	54117211	54117212	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54117211_54117212insT								LOC284379 (10460 upstream) : DPRX (18098 downstream)																							tAtttcctttgttttttttttt	0.000													4	2	---	---	---	---	
MIR512-1	574458	broad.mit.edu	37	19	54167788	54167788	+	5'Flank	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54167788delC	hsa-mir-512-1|MI0003140	+																							0						gtggcacgcgcctgtaattcc	0.000													4	2	---	---	---	---	
PRKCG	5582	broad.mit.edu	37	19	54383761	54383762	+	5'Flank	INS	-	CAGATT	CAGATT			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54383761_54383762insCAGATT	uc002qcq.1	+						PRKCG_uc010eqz.1_5'Flank|PRKCG_uc010yef.1_5'Flank|PRKCG_uc010yeg.1_5'Flank	NM_002739	NP_002730	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity|cell death|intracellular signal transduction|negative regulation of protein catabolic process|negative regulation of protein ubiquitination|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of mismatch repair|synaptic transmission	cytosol	ATP binding|protein kinase C activity|zinc ion binding			lung(4)|ovary(2)|pancreas(2)|large_intestine(1)	9	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)		AGCCAGAGACACagagattcat	0.139													4	2	---	---	---	---	
CDC42EP5	148170	broad.mit.edu	37	19	54979537	54979538	+	Intron	INS	-	AC	AC	rs144632295	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54979537_54979538insAC	uc002qfz.1	-							NM_145057	NP_659494	Q6NZY7	BORG3_HUMAN	CDC42 effector protein 5						positive regulation of actin filament polymerization|positive regulation of pseudopodium assembly|regulation of cell shape	cytoplasm|cytoskeleton|endomembrane system|membrane	GTP-Rho binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.138)		AAGACTGGCCTacacacacaca	0.307													4	4	---	---	---	---	
RDH13	112724	broad.mit.edu	37	19	55552910	55552912	+	Intron	DEL	TAT	-	-	rs147316006		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55552910_55552912delTAT	uc010esr.1	-						uc002qim.1_RNA	NM_138412		Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 isoform 2								binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	AAGAAAATGGTATTATTCTTAGG	0.433													5	3	---	---	---	---	
SBK2	646643	broad.mit.edu	37	19	56048793	56048794	+	5'Flank	INS	-	C	C	rs34239249		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56048793_56048794insC	uc010ygc.1	-							NM_001101401	NP_001094871	P0C263	SBK2_HUMAN	SH3-binding domain kinase family, member 2								ATP binding|protein serine/threonine kinase activity				0						aggagtccaggccccagcccct	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57591018	57591018	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57591018delA								MIMT1 (231096 upstream) : USP29 (40491 downstream)																							CAGAGTGGGGAAAGGTGGCCA	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	57591981	57591981	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57591981delG								MIMT1 (232059 upstream) : USP29 (39528 downstream)																							TATTCCTTCTGGCATCCCTCT	0.259													3	5	---	---	---	---	
ZNF773	374928	broad.mit.edu	37	19	58017080	58017081	+	Intron	INS	-	TT	TT	rs116745421		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58017080_58017081insTT	uc002qox.2	+						ZNF547_uc002qpm.3_Intron|ZNF773_uc002qoy.2_Intron|ZNF773_uc002qoz.2_Intron	NM_198542	NP_940944	Q6PK81	ZN773_HUMAN	zinc finger protein 773						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		CATTCCAGTTGttttttttttt	0.248													11	5	---	---	---	---	
C20orf96	140680	broad.mit.edu	37	20	258441	258442	+	Intron	INS	-	AG	AG	rs151216421	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:258441_258442insAG	uc002wde.1	-						C20orf96_uc002wdc.2_Intron|C20orf96_uc002wdd.2_Intron|C20orf96_uc010zpi.1_Intron|C20orf96_uc010zpj.1_Intron|C20orf96_uc010zpk.1_Intron	NM_153269	NP_695001	Q9NUD7	CT096_HUMAN	hypothetical protein LOC140680												0		all_cancers(10;0.00959)|Lung NSC(37;0.227)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			TGTCTTCCTCCAGAGAGACCCC	0.545													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	414655	414655	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:414655delT								RBCK1 (3047 upstream) : TBC1D20 (1471 downstream)																							Gttttttttgttttttttttg	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	447669	447669	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:447669delT								TBC1D20 (4482 upstream) : CSNK2A1 (15669 downstream)																							agtgtgtttcttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	623887	623888	+	IGR	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:623887_623888insT								TCF15 (32977 upstream) : SRXN1 (3382 downstream)																							GATAGGTGGGGTTTTTTTTTCT	0.495													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	797337	797337	+	IGR	DEL	A	-	-	rs112232874		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:797337delA								C20orf54 (48109 upstream) : FAM110A (17019 downstream)																							catttatgtgaaaaaaaaaat	0.085													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	2659887	2659887	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2659887delG								IDH3B (15044 upstream) : EBF4 (13637 downstream)																							tagggaacaaggggagctgat	0.000													4	2	---	---	---	---	
PTPRA	5786	broad.mit.edu	37	20	2910643	2910643	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2910643delC	uc010zqb.1	+						VPS16_uc002whh.2_Intron|PTPRA_uc002whj.2_Intron|PTPRA_uc010zqc.1_Intron|PTPRA_uc002whk.2_Intron|PTPRA_uc010zqd.1_Intron|PTPRA_uc002whl.2_Intron|PTPRA_uc002whm.2_Intron|PTPRA_uc002whn.2_Intron			P18433	PTPRA_HUMAN	SubName: Full=cDNA FLJ60525, highly similar to Receptor-type tyrosine-protein phosphatase alpha (EC 3.1.3.48);						axon guidance|protein phosphorylation	integral to plasma membrane	transmembrane receptor protein tyrosine phosphatase activity			upper_aerodigestive_tract(1)	1						tggccatctgcaggccaagga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	3084913	3084914	+	5'Flank	INS	-	G	G			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3084913_3084914insG	uc002whv.1	+											Homo sapiens cDNA FLJ40197 fis, clone TESTI2019917.																		ttcatcatgttgccaggctggt	0.059													5	6	---	---	---	---	
C20orf194	25943	broad.mit.edu	37	20	3247501	3247502	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3247501_3247502insT	uc002wii.2	-						C20orf194_uc002wij.3_Intron|C20orf194_uc002wik.2_Intron	NM_001009984	NP_001009984	Q5TEA3	CT194_HUMAN	hypothetical protein LOC25943												0						ccccttccaccttttttttttt	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	4052527	4052528	+	IGR	INS	-	T	T	rs139574356	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:4052527_4052528insT								RNF24 (56311 upstream) : SMOX (76922 downstream)																							ctaagcatgaagtggtctcagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	5670894	5670894	+	IGR	DEL	A	-	-	rs66544835		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5670894delA								GPCPD1 (79222 upstream) : C20orf196 (60149 downstream)																							ctatctctacaaaaaaaaaaa	0.000													4	3	---	---	---	---	
FERMT1	55612	broad.mit.edu	37	20	6060958	6060959	+	Intron	DEL	TG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6060958_6060959delTG	uc002wmr.2	-						FERMT1_uc002wmq.2_Intron|FERMT1_uc010gbt.2_Intron	NM_017671	NP_060141	Q9BQL6	FERM1_HUMAN	kindlin-1						cell adhesion|establishment of epithelial cell polarity|keratinocyte migration|keratinocyte proliferation	cytosol|focal adhesion|ruffle membrane	binding			ovary(1)|pancreas(1)|skin(1)	3						cttcagattttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6957465	6957466	+	IGR	INS	-	TT	TT	rs111559589		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6957465_6957466insTT								BMP2 (196555 upstream) : HAO1 (906165 downstream)																							attttacttccttttttttttt	0.000													4	2	---	---	---	---	
PAK7	57144	broad.mit.edu	37	20	9789356	9789357	+	Intron	DEL	TA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:9789356_9789357delTA	uc002wnl.2	-						PAK7_uc002wnk.2_Intron|PAK7_uc002wnj.2_Intron|PAK7_uc010gby.1_Intron	NM_020341	NP_065074	Q9P286	PAK7_HUMAN	p21-activated kinase 7								ATP binding|protein binding|protein serine/threonine kinase activity			lung(11)|skin(5)|central_nervous_system(3)|ovary(2)|large_intestine(1)|stomach(1)	23			COAD - Colon adenocarcinoma(9;0.194)			ctggtaggagtataaggcttgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	10328276	10328277	+	IGR	INS	-	AC	AC	rs138430184	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10328276_10328277insAC								SNAP25 (40211 upstream) : MKKS (57556 downstream)																							gacacacacatacacacacaca	0.000													4	2	---	---	---	---	
C20orf94	128710	broad.mit.edu	37	20	10427938	10427939	+	Intron	INS	-	T	T	rs138731133	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:10427938_10427939insT	uc010zre.1	+							NM_001009608	NP_001009608	Q5VYV7	CT094_HUMAN	hypothetical protein LOC128710								protein binding				0						cagtacGTTAGTTTTTTTACCT	0.178													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11576360	11576361	+	IGR	INS	-	C	C	rs111300561	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11576360_11576361insC								JAG1 (921666 upstream) : BTBD3 (295116 downstream)																							ggaaagactggccccccatgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11592256	11592256	+	IGR	DEL	A	-	-	rs111531199		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11592256delA								JAG1 (937562 upstream) : BTBD3 (279221 downstream)																							CTTGGATGGGAAAAAAAAAAA	0.279													7	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12082330	12082330	+	IGR	DEL	A	-	-	rs150626985		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12082330delA								BTBD3 (175088 upstream) : SPTLC3 (907297 downstream)																							TGAATCTTTGAAAAAAAAAAA	0.378													4	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12354049	12354050	+	IGR	INS	-	TT	TT	rs5840493		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12354049_12354050insTT								BTBD3 (446807 upstream) : SPTLC3 (635577 downstream)																							ACAGATGACTATTTTTTTTTTT	0.287													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	12751453	12751453	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12751453delT								BTBD3 (844211 upstream) : SPTLC3 (238174 downstream)																							aaaattaaagttTTTTTTTTT	0.104													4	2	---	---	---	---	
SPTLC3	55304	broad.mit.edu	37	20	12987345	12987347	+	5'Flank	DEL	ATC	-	-	rs148164700		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:12987345_12987347delATC	uc002wod.1	+						SPTLC3_uc002wob.1_5'Flank|SPTLC3_uc002woc.2_5'Flank	NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base						sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	TGCTAATTTTATCATCTTTGCCT	0.394													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	16099481	16099482	+	IGR	INS	-	ATC	ATC	rs146816121	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:16099481_16099482insATC								MACROD2 (65642 upstream) : KIF16B (153267 downstream)																							caaaagaaactatcagcagagt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	17811334	17811335	+	IGR	INS	-	TTT	TTT	rs138147848	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:17811334_17811335insTTT								BANF2 (94817 upstream) : SNX5 (110911 downstream)																							aaagaTACTGATTTTTTTTTTG	0.084													5	3	---	---	---	---	
DTD1	92675	broad.mit.edu	37	20	18717918	18717919	+	Intron	INS	-	GAG	GAG	rs142844980	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18717918_18717919insGAG	uc002wrf.3	+							NM_080820	NP_543010	Q8TEA8	DTD1_HUMAN	D-tyrosyl-tRNA deacylase 1						D-amino acid catabolic process	cytoplasm	hydrolase activity, acting on ester bonds			ovary(2)	2						TGCCTGGGAGTGAGTAGACACT	0.594													5	4	---	---	---	---	
SLC24A3	57419	broad.mit.edu	37	20	19296158	19296158	+	Intron	DEL	G	-	-	rs140701000		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:19296158delG	uc002wrl.2	+							NM_020689	NP_065740	Q9HC58	NCKX3_HUMAN	solute carrier family 24							integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			ovary(1)	1						AAAGCTAAGTGGGTTATATGG	0.468													3	8	---	---	---	---	
C20orf26	26074	broad.mit.edu	37	20	20071333	20071338	+	Intron	DEL	AAAAAA	-	-	rs150625011		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:20071333_20071338delAAAAAA	uc002wru.2	+						C20orf26_uc010gcw.1_Intron|C20orf26_uc010zse.1_Intron|C20orf26_uc010zsf.1_Intron	NM_015585	NP_056400	Q8NHU2	CT026_HUMAN	hypothetical protein LOC26074											ovary(3)|pancreas(1)	4				READ - Rectum adenocarcinoma(2;0.171)		actccctctcaaaaaaaaaaaaaaaa	0.000													10	5	---	---	---	---	
PLK1S1	55857	broad.mit.edu	37	20	21110746	21110746	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:21110746delT	uc002wsb.2	+						PLK1S1_uc010zsh.1_Intron|PLK1S1_uc010zsi.1_Intron|PLK1S1_uc010zsj.1_Intron	NM_018474	NP_060944	Q2M2Z5	KIZ_HUMAN	polo-like kinase 1 substrate 1 isoform 1						spindle organization	centrosome	protein kinase binding				0						cgatgctcccttttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23207495	23207495	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23207495delG								CD93 (140518 upstream) : NXT1 (123878 downstream)																							CTGGATTCTAGGGCTGACACC	0.522													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	23722232	23722233	+	IGR	INS	-	C	C	rs149261924	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:23722232_23722233insC								CST4 (52570 upstream) : CST1 (5958 downstream)																							cgaggcctagactcctcactgc	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24745885	24745886	+	IGR	DEL	AC	-	-	rs34141414		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24745885_24745886delAC								TMEM90B (98718 upstream) : CST7 (183980 downstream)																							ACACAGGAGAacacacacacac	0.386													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24811792	24811793	+	IGR	DEL	TC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24811792_24811793delTC								TMEM90B (164625 upstream) : CST7 (118073 downstream)																							cagagagctttctctctctctc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25641427	25641428	+	Intron	INS	-	T	T			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25641427_25641428insT	uc002wuz.2	+											Homo sapiens zinc finger protein 337, mRNA (cDNA clone IMAGE:4826085).																		cttttcattccttttttttttt	0.005													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25906763	25906764	+	IGR	INS	-	TG	TG	rs2386759		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25906763_25906764insTG								FAM182B (57977 upstream) : LOC100134868 (83671 downstream)																							TCAGAATAACATTTTTTTTGCA	0.292													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26122614	26122614	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26122614delA								C20orf191 (27937 upstream) : MIR663 (66208 downstream)																							ATCAATAGGGAAAAATGAAAC	0.249													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26147215	26147215	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26147215delT								C20orf191 (52538 upstream) : MIR663 (41607 downstream)																							AATTTTAATCTGTTTAGATTT	0.318													11	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26205327	26205331	+	IGR	DEL	AGAAT	-	-	rs143534926		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26205327_26205331delAGAAT								MIR663 (16413 upstream) : None (None downstream)																							aaacaaaaaaaGAATATCTTAGCTT	0.156													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29465614	29465614	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29465614delT								None (None upstream) : FRG1B (146265 downstream)																							agattccaaattttttttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29585451	29585452	+	IGR	INS	-	C	C	rs151177380		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29585451_29585452insC								None (None upstream) : FRG1B (26427 downstream)																							ATCAACCATTTCCCATGTCCCT	0.356													5	3	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636113	29636114	+	Intron	INS	-	TTATT	TTATT	rs139291073		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636113_29636114insTTATT	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						acaactgattattttaattttg	0.040													4	2	---	---	---	---	
FRG1B	284802	broad.mit.edu	37	20	29636524	29636529	+	Intron	DEL	TTTATG	-	-	rs71693508		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29636524_29636529delTTTATG	uc010ztl.1	+						FRG1B_uc010ztj.1_Intron|FRG1B_uc010ztk.1_Intron					Homo sapiens cDNA FLJ32537 fis, clone SMINT2000400, highly similar to Homo sapiens FRG1 mRNA.												0						TCTCAAAATATTTATGTTTATGTTAA	0.112													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	31169417	31169417	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31169417delC	uc002wxx.2	-											SubName: Full=LOC284804 protein; Flags: Fragment;																		ACTCCCACCTCCCTTCTTCCT	0.582													4	2	---	---	---	---	
CBFA2T2	9139	broad.mit.edu	37	20	32075606	32075606	+	5'Flank	DEL	T	-	-	rs141616773		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32075606delT	uc002wze.1	+						CBFA2T2_uc010zug.1_5'Flank	NM_001032999	NP_001028171	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit							nucleus	protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			pancreas(1)|skin(1)	2						CTTCTCTCTCttttttttttt	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	32462995	32462995	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:32462995delA								CHMP4B (20826 upstream) : RALY (118737 downstream)																							ccctgtctacaaaaaaaaaaG	0.274													5	3	---	---	---	---	
NFS1	9054	broad.mit.edu	37	20	34276651	34276652	+	Intron	DEL	GA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34276651_34276652delGA	uc002xdw.1	-						NFS1_uc002xdt.1_Intron|NFS1_uc002xdu.1_Intron|NFS1_uc002xdv.1_Intron|NFS1_uc010zvk.1_Intron|NFS1_uc010zvl.1_Intron	NM_021100	NP_066923	Q9Y697	NFS1_HUMAN	NFS1 nitrogen fixation 1 precursor						cysteine metabolic process|iron incorporation into metallo-sulfur cluster|Mo-molybdopterin cofactor biosynthetic process|protein complex assembly|water-soluble vitamin metabolic process	cytosol|mitochondrial matrix|nucleus	cysteine desulfurase activity|protein homodimerization activity|pyridoxal phosphate binding			ovary(1)|skin(1)	2	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)|Pyridoxal Phosphate(DB00114)	aagaCAgagggagagagagaga	0.005													4	2	---	---	---	---	
C20orf118	140711	broad.mit.edu	37	20	35512496	35512497	+	Intron	INS	-	AAAC	AAAC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35512496_35512497insAAAC	uc002xgg.1	+							NM_080628	NP_542195	A0PJX2	CT118_HUMAN	hypothetical protein LOC140711												0		Myeloproliferative disorder(115;0.00874)				gactctgtcttaaacaaacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	35900801	35900801	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35900801delT								GHRH (10563 upstream) : MANBAL (17250 downstream)																							gtctggcTCCttttttttgga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	38323797	38323798	+	IGR	INS	-	TTTG	TTTG	rs139336475	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:38323797_38323798insTTTG								LOC339568 (470406 upstream) : MAFB (990721 downstream)																							GGTTtttgttttttgtttgttt	0.020													4	3	---	---	---	---	
CHD6	84181	broad.mit.edu	37	20	40192533	40192533	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40192533delA	uc002xka.1	-						CHD6_uc002xkd.2_Intron|CHD6_uc002xkc.2_Intron	NM_032221	NP_115597	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						chromatin remodeling|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ATP binding|ATP-dependent helicase activity|chromatin binding|DNA binding			ovary(6)|skin(5)|lung(2)|central_nervous_system(1)	14		Myeloproliferative disorder(115;0.00425)				CTTATGGGGGAAGACAAAGGG	0.368													9	4	---	---	---	---	
SGK2	10110	broad.mit.edu	37	20	42193291	42193292	+	5'Flank	DEL	AC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42193291_42193292delAC	uc002xkv.2	+						SGK2_uc002xkt.2_Intron|SGK2_uc002xkr.2_Intron|SGK2_uc010ggm.2_Intron|SGK2_uc002xks.2_Intron|SGK2_uc002xku.2_5'Flank|SGK2_uc002xkq.1_Intron	NM_016276	NP_057360	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2 isoform						intracellular protein kinase cascade|response to oxidative stress		ATP binding|potassium channel regulator activity|protein serine/threonine kinase activity|sodium channel regulator activity			lung(3)|upper_aerodigestive_tract(1)|breast(1)|central_nervous_system(1)	6		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			tcacccacatacacacacactg	0.099													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	42739069	42739070	+	IGR	DEL	TT	-	-	rs72435586		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42739069_42739070delTT								TOX2 (40817 upstream) : JPH2 (1267 downstream)																							AACttttgtgtttttttttttt	0.248													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	44055969	44055970	+	IGR	INS	-	AC	AC	rs139753361	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44055969_44055970insAC								PIGT (1085 upstream) : WFDC2 (42424 downstream)																							ctctgtctcaaacacacacaca	0.228													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45835088	45835089	+	IGR	INS	-	A	A	rs35501533		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45835088_45835089insA								EYA2 (17598 upstream) : ZMYND8 (3292 downstream)																							agattaagtttaaaaaaaaaaa	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	45992708	45992709	+	IGR	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:45992708_45992709delTT								ZMYND8 (7234 upstream) : NCOA3 (137948 downstream)																							cgcagccggAtttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46452454	46452454	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46452454delG								SULF2 (37094 upstream) : LOC284749 (536200 downstream)																							cttctggcttgggcaatctta	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	46618475	46618478	+	IGR	DEL	CAGA	-	-	rs11467039		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46618475_46618478delCAGA								SULF2 (203115 upstream) : LOC284749 (370176 downstream)																							CACTACCCCTCAGACAGtcttccc	0.324													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	47117978	47117978	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:47117978delA								LOC284749 (118597 upstream) : PREX1 (122815 downstream)																							CCATGTGTTCAAAAGCAGCCC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48577880	48577881	+	IGR	INS	-	A	A	rs141538503	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48577880_48577881insA								RNF114 (7460 upstream) : SNAI1 (21646 downstream)																							aaacagaaaagaaaaaaaaaag	0.000													5	3	---	---	---	---	
TSHZ2	128553	broad.mit.edu	37	20	51744716	51744717	+	Intron	INS	-	G	G	rs58310954		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:51744716_51744717insG	uc002xwo.2	+							NM_173485	NP_775756	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|haematopoietic_and_lymphoid_tissue(1)	6			STAD - Stomach adenocarcinoma(23;0.1)			TAGATGGTGGTGGGGAAAGGGA	0.396													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54558718	54558718	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54558718delA								None (None upstream) : CBLN4 (13779 downstream)																							catctctactaaaaatacaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	54592378	54592378	+	IGR	DEL	A	-	-	rs78719714		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54592378delA								CBLN4 (12366 upstream) : MC3R (231410 downstream)																							actctgcctcaaaaaaaaaaa	0.114													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	55364624	55364624	+	IGR	DEL	T	-	-	rs67186549		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55364624delT								TFAP2C (150288 upstream) : BMP7 (379185 downstream)																							tctttctttcttttttttttt	0.065													4	2	---	---	---	---	
BMP7	655	broad.mit.edu	37	20	55782347	55782348	+	Intron	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:55782347_55782348delAG	uc010gip.1	-						BMP7_uc010giq.1_Intron|BMP7_uc002xyc.2_Intron	NM_001719	NP_001710	P18075	BMP7_HUMAN	bone morphogenetic protein 7 precursor						BMP signaling pathway|cartilage development|cellular response to hypoxia|epithelial to mesenchymal transition|growth|mesonephros development|negative regulation of glomerular mesangial cell proliferation|negative regulation of MAP kinase activity|negative regulation of mitosis|negative regulation of neuron differentiation|negative regulation of NF-kappaB import into nucleus|negative regulation of NF-kappaB transcription factor activity|negative regulation of phosphorylation|negative regulation of striated muscle cell apoptosis|negative regulation of transcription, DNA-dependent|ossification|pathway-restricted SMAD protein phosphorylation|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|protein localization to nucleus|regulation of removal of superoxide radicals|SMAD protein signal transduction|steroid hormone mediated signaling pathway|ureteric bud development	extracellular space	cytokine activity|growth factor activity			skin(1)	1	all_lung(29;0.0133)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;2.49e-13)|Epithelial(14;1.74e-08)|all cancers(14;2.05e-07)			tctataaaccagagagagagag	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56536701	56536701	+	IGR	DEL	A	-	-	rs11086626		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56536701delA								PMEPA1 (250160 upstream) : C20orf85 (189282 downstream)																							AAAAAGAAACAAGAAAGAAAA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56552727	56552728	+	IGR	INS	-	A	A	rs150256039	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56552727_56552728insA								PMEPA1 (266186 upstream) : C20orf85 (173255 downstream)																							AATAAGATGCCAAAAAAAATTC	0.406													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	57391036	57391036	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57391036delG								NPEPL1 (99669 upstream) : MIR296 (1634 downstream)																							TGCAGGGCCTGGGGGCAGGGC	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58132261	58132262	+	IGR	DEL	CT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58132261_58132262delCT								EDN3 (231215 upstream) : PHACTR3 (20302 downstream)																							ctctctctgcctctctctctct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	59783596	59783597	+	IGR	INS	-	A	A	rs113917654		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59783596_59783597insA								MIR646 (899971 upstream) : CDH4 (43962 downstream)																							CCACTGCAAAGAAAAAAAAAAA	0.416													2	5	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60508390	60508390	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60508390delC	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			TGGGACCCCTCCCATCCTCGC	0.677													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61190103	61190104	+	IGR	DEL	GC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61190103_61190104delGC								C20orf166 (22133 upstream) : SLCO4A1 (83693 downstream)																							gtgtgtgtgtgcgtgcatgtat	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	61192539	61192539	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61192539delA								C20orf166 (24569 upstream) : SLCO4A1 (81258 downstream)																							ccccatctctaaaaaaaaaaa	0.000													4	3	---	---	---	---	
GMEB2	26205	broad.mit.edu	37	20	62231497	62231497	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62231497delG	uc002yfp.1	-						GMEB2_uc002yfo.1_Intron|GMEB2_uc002yfq.1_Intron	NM_012384	NP_036516	Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|metal ion binding				0	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			ccgggttcaagagattctctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9735166	9735166	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9735166delG	uc011abu.1	+											Homo sapiens, clone IMAGE:4720764, mRNA.																		TATTCTGGAAGAAAAAAGAAC	0.433													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10523794	10523794	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10523794delA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		caacaaatggaaaaaaggaga	0.104													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10580588	10580590	+	Intron	DEL	ATA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10580588_10580590delATA	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		AGGAAGAAACATAATATGAAAGG	0.340													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10597488	10597489	+	5'Flank	INS	-	CAT	CAT	rs143071377	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10597488_10597489insCAT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		tctcagggacccatcccttggc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10709230	10709231	+	IGR	INS	-	AC	AC	rs111503920		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10709230_10709231insAC								None (None upstream) : TPTE (197512 downstream)																							acagggttgaatttctttcaat	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10725424	10725425	+	IGR	INS	-	GA	GA	rs147920428		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10725424_10725425insGA								None (None upstream) : TPTE (181318 downstream)																							ttcaaatctgtgagatgaatgc	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10764395	10764396	+	IGR	INS	-	T	T	rs111268542		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10764395_10764396insT								None (None upstream) : TPTE (142347 downstream)																							cttctgtgtagttttatttgaa	0.000													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10794846	10794850	+	IGR	DEL	GAGTG	-	-	rs111709978		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10794846_10794850delGAGTG								None (None upstream) : TPTE (111893 downstream)																							atattgaacagagtggagtggagtg	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11037486	11037487	+	Intron	DEL	AG	-	-	rs147195770		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11037486_11037487delAG	uc002yit.1	-						TPTE_uc002yis.1_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		AAGTCTTTTCAGAGTCAGAATG	0.257													6	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11043637	11043638	+	Intron	INS	-	A	A	rs138908771		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11043637_11043638insA	uc002yit.1	-							NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTTGAAAAAAGAAAAAAACAAG	0.163													3	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11065702	11065703	+	Intron	INS	-	A	A	rs144462927		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11065702_11065703insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		acacattacagaaaaaaaaatc	0.025													5	3	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11092162	11092164	+	Intron	DEL	TTG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11092162_11092164delTTG	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CCTAGGTTTTTTGTTGTTGtttg	0.108													11	5	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11100123	11100123	+	5'Flank	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11100123delA	uc002yit.1	-						BAGE_uc002yix.2_5'Flank	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aggatagaggaaagaagaggg	0.000													5	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11150791	11150792	+	IGR	INS	-	A	A	rs142115257	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11150791_11150792insA								BAGE (51854 upstream) : None (None downstream)																							agtggagccagaaaaaaagaat	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11170954	11170955	+	IGR	DEL	TT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11170954_11170955delTT								BAGE (72017 upstream) : None (None downstream)																							tagtcccatatttttttttttt	0.119													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14383027	14383028	+	IGR	INS	-	G	G	rs3865590	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14383027_14383028insG								None (None upstream) : C21orf99 (27459 downstream)																							GGTGTTAAttttttgttgttgt	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	14525493	14525493	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14525493delT								C21orf99 (34924 upstream) : POTED (457005 downstream)																							catgcccaccttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	15405545	15405545	+	Intron	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15405545delG	uc002yjk.2	+						uc002yjl.2_Intron					Homo sapiens, clone IMAGE:4102980, mRNA.																		AAAATGAGGAGATCTGGAGAC	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	16055958	16055959	+	IGR	INS	-	AAGG	AAGG	rs146806868	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:16055958_16055959insAAGG								SAMSN1 (100235 upstream) : NRIP1 (277597 downstream)																							aggaaagaagaaaggaagaaag	0.079													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	29737809	29737809	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:29737809delT								C21orf94 (342281 upstream) : NCRNA00161 (173831 downstream)																							agaactcccattagcatttct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	42268569	42268570	+	IGR	INS	-	T	T	rs148403689	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42268569_42268570insT								DSCAM (49530 upstream) : C21orf130 (244857 downstream)																							ttggaactgggtaacaggcaga	0.015													2	7	---	---	---	---	
COL18A1	80781	broad.mit.edu	37	21	46899516	46899517	+	Intron	DEL	CA	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46899516_46899517delCA	uc011afs.1	+						COL18A1_uc002zhg.2_Intron|COL18A1_uc002zhi.2_Intron	NM_130444	NP_569711	P39060	COIA1_HUMAN	alpha 1 type XVIII collagen isoform 3 precursor						cell adhesion|negative regulation of cell proliferation|organ morphogenesis|visual perception	collagen|extracellular space	extracellular matrix structural constituent|metal ion binding|protein binding			central_nervous_system(1)	1				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		ccatgcataccacacacacaca	0.282													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	47376819	47376820	+	IGR	INS	-	AACT	AACT	rs144167750	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47376819_47376820insAACT								PCBP3 (14452 upstream) : COL6A1 (24843 downstream)																							gctctcatgggaactgagtgag	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	16943297	16943298	+	IGR	INS	-	A	A	rs146766102		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:16943297_16943298insA								OR11H1 (493493 upstream) : CCT8L2 (128350 downstream)																							ctctgaacaacaaaaaaaagat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	17383941	17383942	+	IGR	INS	-	T	T	rs142295247		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:17383941_17383942insT								HSFYL1 (73716 upstream) : GAB4 (58887 downstream)																							cactttttcacttttttctgcc	0.000													4	3	---	---	---	---	
ATP6V1E1	529	broad.mit.edu	37	22	18086130	18086131	+	Intron	INS	-	A	A	rs146597154		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18086130_18086131insA	uc002zmr.1	-						ATP6V1E1_uc002zms.1_Intron|ATP6V1E1_uc002zmt.1_Intron	NM_001696	NP_001687	P36543	VATE1_HUMAN	vacuolar H+ ATPase E1 isoform a						cellular iron ion homeostasis|insulin receptor signaling pathway|transferrin transport	apical plasma membrane|cytosol|endosome|proton-transporting two-sector ATPase complex, catalytic domain	protein binding|proton-transporting ATPase activity, rotational mechanism			large_intestine(1)|central_nervous_system(1)	2		all_epithelial(15;0.206)		Lung(27;0.19)		tctgtaaaattaaaaaaaaaaa	0.000													3	3	---	---	---	---	
BID	637	broad.mit.edu	37	22	18259302	18259302	+	5'Flank	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18259302delT	uc002znd.1	-						BID_uc002znc.1_5'Flank|BID_uc002zne.1_5'Flank|BID_uc010gra.1_5'Flank|BID_uc002znf.1_5'Flank|BID_uc010grb.1_5'Flank|BID_uc010grc.1_5'Flank	NM_001196	NP_001187	P55957	BID_HUMAN	BH3 interacting domain death agonist isoform 2						activation of pro-apoptotic gene products|establishment of protein localization in membrane|induction of apoptosis by intracellular signals|induction of apoptosis via death domain receptors|neuron apoptosis|positive regulation of protein homooligomerization|positive regulation of release of cytochrome c from mitochondria|release of cytochrome c from mitochondria	cytosol|membrane fraction|mitochondrial outer membrane	death receptor binding				0		all_epithelial(15;0.198)		Lung(27;0.0419)		GATGACtttattttttttttt	0.060													4	2	---	---	---	---	
GGT3P	2679	broad.mit.edu	37	22	18786972	18786972	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18786972delT	uc002zob.1	-											Homo sapiens cDNA clone IMAGE:5761295, **** WARNING: chimeric clone ****.												0						gttagagttctcccagtatct	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	18880305	18880306	+	IGR	INS	-	A	A	rs112911268	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18880305_18880306insA								GGT3P (87313 upstream) : DGCR6 (13235 downstream)																							aataattttttaataacatatt	0.000													3	6	---	---	---	---	
DGCR6	8214	broad.mit.edu	37	22	18897772	18897773	+	Frame_Shift_Ins	INS	-	GC	GC			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:18897772_18897773insGC	uc002zoh.3	+	3	511_512	c.359_360insGC	c.(358-360)CAGfs	p.Q120fs	DGCR6_uc002zog.2_RNA|DGCR6_uc002zoi.3_RNA	NM_005675	NP_005666	Q14129	DGCR6_HUMAN	DiGeorge syndrome critical region protein 6	120	Potential.				cell adhesion|organ morphogenesis	nucleus|proteinaceous extracellular matrix				upper_aerodigestive_tract(1)|central_nervous_system(1)	2						GCGGCTCAGCAGCGAGAACTAG	0.673													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	20212444	20212447	+	IGR	DEL	CACA	-	-	rs148193105	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20212444_20212447delCACA								LOC150197 (16384 upstream) : RTN4R (16493 downstream)																							gcagcatgctcacacacacacatg	0.044													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21017686	21017686	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21017686delT								MED15 (75768 upstream) : POM121L4P (26157 downstream)																							atccattatatttttcagctt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	21455237	21455237	+	5'Flank	DEL	A	-	-	rs113686626		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:21455237delA	uc011aia.1	+											Homo sapiens cDNA FLJ42953 fis, clone BRSTN2008418, moderately similar to Breakpoint cluster region protein (EC 2.7.1.-).																		ccatccctacaaaaaaaaaaa	0.025													4	2	---	---	---	---	
ZNF280B	140883	broad.mit.edu	37	22	22851135	22851136	+	Intron	INS	-	T	T	rs5844502		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22851135_22851136insT	uc002zwc.1	-						LOC96610_uc011aim.1_Intron	NM_080764	NP_542942	Q86YH2	Z280B_HUMAN	zinc finger protein 280B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(9;0.0135)|Acute lymphoblastic leukemia(84;0.17)	all_hematologic(6;1.74e-30)|Acute lymphoblastic leukemia(6;7.75e-22)		READ - Rectum adenocarcinoma(21;0.145)		GGGATCTACTCttttttttttt	0.218													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23294845	23294845	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23294845delC								LOC96610 (29763 upstream) : RTDR1 (106749 downstream)																							aatgcttcttccagcatcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23860311	23860314	+	IGR	DEL	GGAT	-	-	rs113312449		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23860311_23860314delGGAT								ZDHHC8P1 (115512 upstream) : IGLL1 (55001 downstream)																							gtgattgggaggatggatggatgg	0.206													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	23866731	23866731	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23866731delA								ZDHHC8P1 (121932 upstream) : IGLL1 (48584 downstream)																							tttatgtgttaagcagtgagg	0.010													4	2	---	---	---	---	
MYO18B	84700	broad.mit.edu	37	22	26400442	26400442	+	Intron	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26400442delC	uc003abz.1	+						MYO18B_uc003aca.1_Intron|MYO18B_uc010guy.1_Intron|MYO18B_uc010guz.1_Intron|MYO18B_uc011aka.1_Intron|MYO18B_uc011akb.1_Intron|MYO18B_uc010gva.1_Intron	NM_032608	NP_115997	Q8IUG5	MY18B_HUMAN	myosin XVIIIB							nucleus|sarcomere|unconventional myosin complex	actin binding|ATP binding|motor activity			ovary(5)|central_nervous_system(3)|large_intestine(2)|breast(2)	12						gggtttgcatcccaatttcat	0.134													4	2	---	---	---	---	
ASPHD2	57168	broad.mit.edu	37	22	26839376	26839377	+	3'UTR	INS	-	T	T	rs35706917		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26839376_26839377insT	uc003acg.2	+	4						NM_020437	NP_065170	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2						peptidyl-amino acid modification	integral to endoplasmic reticulum membrane	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peptide-aspartate beta-dioxygenase activity			ovary(1)	1						ATTTCCTTAGATTTTTTTTTTT	0.416													4	2	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31936570	31936570	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31936570delT	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						ccagccTACAttttttttttt	0.005													3	4	---	---	---	---	
SFI1	9814	broad.mit.edu	37	22	31973890	31973891	+	Intron	DEL	AG	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31973890_31973891delAG	uc003ale.2	+						SFI1_uc003ald.1_Intron|SFI1_uc003alf.2_Intron|SFI1_uc003alg.2_Intron|SFI1_uc011alp.1_Intron|SFI1_uc011alq.1_Intron|SFI1_uc003alh.2_Intron|SFI1_uc010gwi.2_Intron	NM_001007467	NP_001007468	A8K8P3	SFI1_HUMAN	spindle assembly associated Sfi1 homolog isoform						G2/M transition of mitotic cell cycle	centriole|cytosol				central_nervous_system(1)	1						acagaagagcagaaggggatgg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36671000	36671001	+	IGR	INS	-	G	G	rs145360581	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36671000_36671001insG								APOL1 (7424 upstream) : MYH9 (6323 downstream)																							aaacagtgcaaggggggggaaa	0.000													4	2	---	---	---	---	
GCAT	23464	broad.mit.edu	37	22	38207882	38207883	+	Intron	INS	-	A	A	rs55770597		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38207882_38207883insA	uc003atz.2	+						GCAT_uc003aua.1_Intron	NM_014291	NP_055106	O75600	KBL_HUMAN	glycine C-acetyltransferase precursor						biosynthetic process|cellular amino acid metabolic process		glycine C-acetyltransferase activity|pyridoxal phosphate binding|transferase activity, transferring nitrogenous groups				0	Melanoma(58;0.045)				Glycine(DB00145)|Pyridoxal Phosphate(DB00114)	aactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SUN2	25777	broad.mit.edu	37	22	39183250	39183250	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39183250delT	uc010gxr.1	-						DNAL4_uc003awj.2_Intron	NM_015374	NP_056189	Q9UH99	SUN2_HUMAN	unc-84 homolog B						centrosome localization|cytoskeletal anchoring at nuclear membrane|mitotic spindle organization|nuclear envelope organization|nuclear matrix anchoring at nuclear membrane|nuclear migration along microfilament|positive regulation of cell migration	endosome membrane|integral to membrane|nuclear inner membrane|SUN-KASH complex	lamin binding|microtubule binding			large_intestine(1)|skin(1)	2						tctttctttcttttttttttt	0.000													5	3	---	---	---	---	
TNRC6B	23112	broad.mit.edu	37	22	40666318	40666318	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:40666318delT	uc011aor.1	+						TNRC6B_uc003aym.2_Intron|TNRC6B_uc003ayn.3_Intron|TNRC6B_uc003ayo.2_Intron	NM_001162501	NP_001155973	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B isoform 1						gene silencing by RNA|regulation of translation	cytoplasmic mRNA processing body	nucleotide binding|RNA binding				0						TGAGGGATCCttttttttttt	0.269													4	2	---	---	---	---	
EP300	2033	broad.mit.edu	37	22	41552438	41552439	+	Intron	INS	-	A	A	rs137898232	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41552438_41552439insA	uc003azl.3	+							NM_001429	NP_001420	Q09472	EP300_HUMAN	E1A binding protein p300						apoptosis|cell cycle|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|histone H4 acetylation|interspecies interaction between organisms|N-terminal peptidyl-lysine acetylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of androgen receptor signaling pathway|response to estrogen stimulus|response to hypoxia	centrosome|histone acetyltransferase complex	androgen receptor binding|beta-catenin binding|DNA binding|histone acetyltransferase activity|RNA polymerase II activating transcription factor binding|transcription coactivator activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(22)|large_intestine(13)|breast(9)|central_nervous_system(5)|upper_aerodigestive_tract(4)|pancreas(4)|lung(3)|ovary(2)|stomach(1)|skin(1)	64						TTTAAACTGTTACTTggccggg	0.198			T| N|F|Mis|O	MLL|RUNXBP2	colorectal|breast|pancreatic|AML|ALL|DLBCL				Rubinstein-Taybi_syndrome				2	5	---	---	---	---	
WBP2NL	164684	broad.mit.edu	37	22	42346343	42346343	+	Intron	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:42346343delA	uc011ape.1	+						LOC339674_uc003bba.1_Intron|LOC339674_uc003bbq.3_5'Flank	NM_152613	NP_689826	Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation|male pronucleus assembly|meiosis	perinuclear theca	WW domain binding			ovary(2)	2						ccttcaccccaaaaagtttac	0.100													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	45013495	45013497	+	IGR	DEL	CAC	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45013495_45013497delCAC								NCRNA00207 (45166 upstream) : PRR5 (51096 downstream)																							ggcgcacacacaccacaccagac	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	45409363	45409364	+	IGR	INS	-	T	T	rs145679963		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:45409363_45409364insT								PHF21B (3554 upstream) : NUP50 (150362 downstream)																							gcccctttcacttttttttttt	0.059													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	47847873	47847874	+	IGR	DEL	AC	-	-	rs112757189		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:47847873_47847874delAC								TBC1D22A (278151 upstream) : None (None downstream)																							ctctctctctacacacacacac	0.223													3	4	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	48985798	48985799	+	Intron	INS	-	GT	GT	rs150238601	by1000genomes	TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:48985798_48985799insGT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		TTGCAGCCGACgtgtgtgtgtg	0.381													8	4	---	---	---	---	
FAM19A5	25817	broad.mit.edu	37	22	49038634	49038635	+	Intron	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49038634_49038635delGT	uc003bim.3	+						FAM19A5_uc003bio.3_Intron	NM_001082967	NP_001076436	Q7Z5A7	F19A5_HUMAN	family with sequence similarity 19 (chemokine							extracellular region|integral to membrane				large_intestine(1)	1		all_cancers(38;2.95e-11)|all_epithelial(38;3.07e-10)|all_lung(38;2.89e-05)|Breast(42;0.000396)|Lung NSC(38;0.000471)|Ovarian(80;0.00934)|Lung SC(80;0.195)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0227)|BRCA - Breast invasive adenocarcinoma(115;0.119)		cacgtgtgtggtgtgtgtgcat	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49379495	49379496	+	IGR	DEL	GA	-	-	rs35262551		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49379495_49379496delGA								FAM19A5 (231753 upstream) : C22orf34 (428680 downstream)																							aggaaggaaggagagagagaga	0.000													4	2	---	---	---	---	
BRD1	23774	broad.mit.edu	37	22	50182574	50182574	+	Intron	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50182574delT	uc003biv.2	-						BRD1_uc011arf.1_Intron|BRD1_uc011arg.1_Intron|BRD1_uc011arh.1_Intron|BRD1_uc003biu.3_Intron	NM_014577	NP_055392	O95696	BRD1_HUMAN	bromodomain containing protein 1						histone H3 acetylation	MOZ/MORF histone acetyltransferase complex	zinc ion binding			pancreas(1)	1		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GTATGTATGGTTACTATTGTC	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	51063386	51063386	+	IGR	DEL	C	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51063386delC								MAPK8IP2 (13408 upstream) : ARSA (64 downstream)																							acctcagtttcctcattcgta	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	1867727	1867727	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1867727delT								ASMT (105754 upstream) : DHRSX (269830 downstream)																							AGCAGCTTAATTTTGCTTGTT	0.423													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	61782448	61782449	+	IGR	INS	-	C	C			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:61782448_61782449insC								None (None upstream) : SPIN4 (784659 downstream)																							tttgaaacacttttttgtagaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	89367877	89367877	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:89367877delG								TGIF2LX (189997 upstream) : None (None downstream)																							CTAGGAAAAAGGAGAGCTTTC	0.403													8	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	133380035	133380036	+	IGR	DEL	GT	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133380035_133380036delGT								CCDC160 (229 upstream) : PHF6 (127306 downstream)																							TCATATCAGAgtgtgtgtgtgt	0.262													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10010670	10010670	+	IGR	DEL	G	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10010670delG								TTTY22 (359816 upstream) : None (None downstream)																							ATAGTCTTGAGTTTTCCAGGC	0.512													5	8	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10054312	10054312	+	IGR	DEL	A	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10054312delA								TTTY22 (403458 upstream) : None (None downstream)																							cacagagtagaaagctttctt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13482679	13482680	+	IGR	INS	-	T	T	rs145303557		TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13482679_13482680insT								None (None upstream) : None (None downstream)																							tgtaccaatgcccctgtaggca	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13706586	13706586	+	IGR	DEL	T	-	-			TCGA-43-3920-01	TCGA-43-3920-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13706586delT								None (None upstream) : None (None downstream)																							tggaatggaattgaatggaat	0.000													4	2	---	---	---	---	
