Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
Unknown	0	broad.mit.edu	37	1	10241	10242	+	5'Flank	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10241_10242insA	uc001aaa.3	+						uc010nxq.1_5'Flank|uc010nxr.1_5'Flank					Homo sapiens mRNA for DEAD/H box polypeptide 11 like 1 (DDX11L1 gene).																		cccctaaccctaaccctaaacc	0.000													5	3	---	---	---	---	
CDK11B	984	broad.mit.edu	37	1	1628330	1628331	+	Intron	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:1628330_1628331delGT	uc001agv.1	-						CDK11B_uc001ags.1_Intron|CDK11B_uc001agt.1_Intron|CDK11B_uc001aha.1_Intron|CDK11B_uc001agw.1_Intron|CDK11B_uc001agy.1_Intron|CDK11B_uc001agx.1_Intron|CDK11B_uc001agz.1_Intron|SLC35E2B_uc001ahh.3_Intron|SLC35E2_uc009vkm.1_Intron	NM_033486	NP_277021	P21127	CD11B_HUMAN	cell division cycle 2-like 1 (PITSLRE proteins)						apoptosis|cell proliferation|mitosis|regulation of cell growth|regulation of mRNA processing|regulation of transcription, DNA-dependent	cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity|protein binding			skin(1)	1						tgGTGTTAGCGTGTGTCTCAGT	0.173													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	2619326	2619326	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:2619326delC								MMEL1 (54845 upstream) : ACTRT2 (318720 downstream)																							GAACCCACATCCCCAGGTGAG	0.607													9	4	---	---	---	---	
NPHP4	261734	broad.mit.edu	37	1	5939835	5939836	+	Intron	INS	-	CA	CA	rs149843560	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:5939835_5939836insCA	uc001alq.1	-						NPHP4_uc001als.1_Intron|NPHP4_uc009vlt.1_Intron|NPHP4_uc001alt.1_Intron	NM_015102	NP_055917	O75161	NPHP4_HUMAN	nephroretinin						actin cytoskeleton organization|cell-cell adhesion|signal transduction|visual behavior	cell-cell junction|centrosome|cilium|microtubule basal body	protein binding|structural molecule activity			pancreas(1)	1	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		CACGAATGGTGCGcacacacac	0.302													4	2	---	---	---	---	
ENO1	2023	broad.mit.edu	37	1	8941466	8941470	+	5'Flank	DEL	GAAAG	-	-	rs12121516		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8941466_8941470delGAAAG	uc001apj.1	-						ENO1_uc001apk.1_5'Flank|ENO1_uc001apl.1_5'Flank|ENO1_uc009vmi.1_5'Flank|ENO1_uc009vmj.1_5'Flank|ENO1_uc009vmk.1_5'Flank|ENO1_uc009vml.1_5'Flank|ENO1_uc009vmm.1_5'Flank	NM_001428	NP_001419	P06733	ENOA_HUMAN	enolase 1						gluconeogenesis|glycolysis|negative regulation of cell growth|negative regulation of transcription from RNA polymerase II promoter|response to virus	phosphopyruvate hydratase complex|plasma membrane|sarcomere	DNA binding|magnesium ion binding|phosphopyruvate hydratase activity|protein binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			ovary(2)|kidney(1)|central_nervous_system(1)	4	Ovarian(185;0.0661)|all_lung(157;0.127)	all_epithelial(116;2.54e-20)|all_lung(118;2.99e-06)|Lung NSC(185;6.25e-06)|Renal(390;0.000147)|Breast(348;0.00086)|Colorectal(325;0.00205)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;2.42e-07)|COAD - Colon adenocarcinoma(227;2.78e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		aaaaaaaaaagaaagaaaGAAAGAA	0.044													4	2	---	---	---	---	
EXOSC10	5394	broad.mit.edu	37	1	11150817	11150817	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11150817delT	uc001asa.2	-						EXOSC10_uc001asb.2_Intron|EXOSC10_uc009vmy.1_Intron	NM_001001998	NP_001001998	Q01780	EXOSX_HUMAN	exosome component 10 isoform 1						CUT catabolic process|histone mRNA catabolic process|maturation of 5.8S rRNA|nuclear polyadenylation-dependent rRNA catabolic process|nuclear retention of unspliced pre-mRNA at the site of transcription|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytoplasm|nuclear exosome (RNase complex)|nucleolus|transcriptionally active chromatin	3'-5' exonuclease activity|exoribonuclease activity|identical protein binding|nucleotide binding|protein serine/threonine kinase activity|RNA binding			upper_aerodigestive_tract(1)	1	Ovarian(185;0.249)	Lung NSC(185;1.74e-05)|all_lung(284;2.05e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.18e-07)|COAD - Colon adenocarcinoma(227;8.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000315)|Kidney(185;0.000832)|KIRC - Kidney renal clear cell carcinoma(229;0.00269)|READ - Rectum adenocarcinoma(331;0.0526)|STAD - Stomach adenocarcinoma(313;0.202)		gttttttggcttttttttttg	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	14226653	14226654	+	IGR	INS	-	TC	TC	rs145084395		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:14226653_14226654insTC								PRDM2 (75081 upstream) : KAZ (698559 downstream)																							AGTCCTCAAGTTTGCCTCGACC	0.436													4	2	---	---	---	---	
NBPF1	55672	broad.mit.edu	37	1	16938209	16938212	+	Intron	DEL	ACTC	-	-	rs147138514		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16938209_16938212delACTC	uc009vos.1	-						NBPF1_uc001aza.3_Intron|NBPF1_uc001azb.1_Intron|NBPF1_uc001azc.1_Intron	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		aataaaagatactcaatctcaatg	0.000													3	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	26463815	26463816	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26463815_26463816insA								PDIK1L (11791 upstream) : GRRP1 (21695 downstream)																							aaaacagaaacaaaaaaaaAGA	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	30937318	30937323	+	IGR	DEL	ATGGTG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:30937318_30937323delATGGTG								None (None upstream) : MATN1 (246803 downstream)																							tagtgatgatatggtgatggtgatgg	0.000													5	3	---	---	---	---	
CSMD2	114784	broad.mit.edu	37	1	34184683	34184684	+	Intron	INS	-	G	G	rs148629908	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34184683_34184684insG	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGAGGAAGAATGGGAACTATGC	0.366													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	39435171	39435171	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39435171delT								RHBDL2 (27715 upstream) : AKIRIN1 (21745 downstream)																							tgctcaattattttttttttt	0.000													4	2	---	---	---	---	
MACF1	23499	broad.mit.edu	37	1	39770237	39770238	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39770237_39770238insT	uc010ois.1	+						MACF1_uc001cda.1_Intron|MACF1_uc001cdc.1_Intron|MACF1_uc009vvq.1_Intron|MACF1_uc001cdb.1_Intron	NM_012090	NP_036222	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker						cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			tcttttctttcttttttttttt	0.158													5	3	---	---	---	---	
CCDC30	728621	broad.mit.edu	37	1	43031411	43031412	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43031411_43031412delTG	uc009vwk.1	+						CCDC30_uc001chm.2_Intron|CCDC30_uc001chn.2_Intron|CCDC30_uc010oju.1_Intron|CCDC30_uc001chp.2_Intron	NM_001080850	NP_001074319	Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30												0						gcaGAAGTGATGTGTGTGTGTG	0.193													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	44672874	44672875	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44672874_44672875insA								KLF17 (72067 upstream) : DMAP1 (6250 downstream)																							ccctgtctcagaaaaaaaaaaa	0.000													3	5	---	---	---	---	
TMEM53	79639	broad.mit.edu	37	1	45122393	45122393	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45122393delA	uc001cmc.2	-						TMEM53_uc001cmb.1_Intron|TMEM53_uc001cmd.2_Intron|TMEM53_uc009vxh.1_Intron|TMEM53_uc010ola.1_Intron	NM_024587	NP_078863	Q6P2H8	TMM53_HUMAN	transmembrane protein 53							integral to membrane				ovary(2)	2	Acute lymphoblastic leukemia(166;0.155)					tctaaaaaagaaaaaaaaaat	0.119													3	3	---	---	---	---	
TESK2	10420	broad.mit.edu	37	1	45868159	45868159	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45868159delT	uc001cns.1	-						TESK2_uc009vxr.1_Intron|TESK2_uc010olo.1_Intron|TESK2_uc009vxs.1_Intron|TESK2_uc010olp.1_Intron	NM_007170	NP_009101	Q96S53	TESK2_HUMAN	testis-specific protein kinase 2						actin cytoskeleton organization|focal adhesion assembly|spermatogenesis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(2)|breast(2)|pancreas(1)	5	Acute lymphoblastic leukemia(166;0.155)					CTAttttttcttttttttttt	0.075													4	3	---	---	---	---	
PDZK1IP1	10158	broad.mit.edu	37	1	47650299	47650300	+	Intron	INS	-	C	C			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:47650299_47650300insC	uc001cqw.2	-							NM_005764	NP_005755	Q13113	PDZ1I_HUMAN	PDZK1 interacting protein 1							integral to membrane					0						CCCCCACTGAGTCCATACCCCA	0.579													4	2	---	---	---	---	
USP24	23358	broad.mit.edu	37	1	55566412	55566416	+	Intron	DEL	TAGTC	-	-	rs141686128		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:55566412_55566416delTAGTC	uc001cyg.3	-							NM_015306	NP_056121	Q9UPU5	UBP24_HUMAN	ubiquitin specific protease 24						ubiquitin-dependent protein catabolic process		binding|cysteine-type peptidase activity|ubiquitin thiolesterase activity			ovary(6)|kidney(6)|breast(1)	13						GGCAAGAGATTAGTCTAAAGTTAAT	0.302													4	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57994335	57994336	+	Intron	INS	-	ACAT	ACAT	rs7418077		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57994335_57994336insACAT	uc001cys.1	-						DAB1_uc001cyt.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						cacacacacacacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	59071372	59071373	+	IGR	INS	-	C	C	rs138275968	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:59071372_59071373insC								TACSTD2 (28206 upstream) : MYSM1 (54217 downstream)																							cagcacctgttcagtggaggtg	0.000													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	60951494	60951494	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:60951494delA								C1orf87 (412068 upstream) : NFIA (591452 downstream)																							actctgtctcaaaaaaacaca	0.085													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	75309535	75309535	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75309535delA								TYW3 (77177 upstream) : LHX8 (284584 downstream)																							agtaactgccaaaaaaaaaaa	0.045													4	2	---	---	---	---	
SLC44A5	204962	broad.mit.edu	37	1	75788407	75788407	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75788407delA	uc001dgu.2	-						SLC44A5_uc001dgt.2_Intron|SLC44A5_uc001dgs.2_Intron|SLC44A5_uc001dgr.2_Intron|SLC44A5_uc010oqz.1_Intron|SLC44A5_uc010ora.1_Intron|SLC44A5_uc010orb.1_Intron	NM_152697	NP_689910	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5 isoform A							integral to membrane|plasma membrane	choline transmembrane transporter activity			ovary(2)|skin(2)	4						AAaaacaaacaaacaaacaaa	0.289													4	2	---	---	---	---	
USP33	23032	broad.mit.edu	37	1	78227104	78227105	+	5'Flank	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78227104_78227105insA	uc001dht.2	-						USP33_uc001dhu.2_5'Flank|USP33_uc001dhw.2_5'Flank	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						ATCTACAGAAGAAAAAAAAAGA	0.104													4	2	---	---	---	---	
BRDT	676	broad.mit.edu	37	1	92430468	92430468	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92430468delT	uc001dok.3	+						BRDT_uc001dol.3_Intron|BRDT_uc010osz.1_Intron|BRDT_uc009wdf.2_Intron|BRDT_uc010ota.1_Intron|BRDT_uc010otb.1_Intron|BRDT_uc001dom.3_Intron	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		gtgtATATAAttttttttttt	0.104													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	97043717	97043718	+	IGR	INS	-	A	A	rs138656744	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:97043717_97043718insA								None (None upstream) : PTBP2 (143457 downstream)																							ttggtacagGGAAAAAAATGTT	0.203													2	4	---	---	---	---	
PHTF1	10745	broad.mit.edu	37	1	114241230	114241233	+	Intron	DEL	TATA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114241230_114241233delTATA	uc009wgp.1	-						PHTF1_uc001edm.2_Intron	NM_006608	NP_006599	Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1							nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TTTGTAGTTTTATATATATATATa	0.230													3	3	---	---	---	---	
SYT6	148281	broad.mit.edu	37	1	114678133	114678141	+	Intron	DEL	TGAGGATGA	-	-	rs66724737		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:114678133_114678141delTGAGGATGA	uc001eev.2	-							NM_205848	NP_995320	Q5T7P8	SYT6_HUMAN	synaptotagmin VI						acrosomal vesicle exocytosis	cell junction|cytosol|integral to membrane|perinuclear endoplasmic reticulum|peripheral to membrane of membrane fraction|synaptic vesicle membrane	clathrin binding|metal ion binding|protein homodimerization activity|syntaxin binding|transporter activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5	Lung SC(450;0.184)	all_cancers(81;4.41e-08)|all_epithelial(167;5.18e-08)|all_lung(203;1.58e-05)|Lung NSC(69;2.82e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGATACTAGTTGAGGATGATGAGGATGAT	0.531													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	116036467	116036467	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:116036467delC								NGF (155610 upstream) : VANGL1 (148107 downstream)																							TCTCCTGAGGCCCCCAAAGGC	0.557													4	2	---	---	---	---	
TRIM45	80263	broad.mit.edu	37	1	117659023	117659023	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:117659023delT	uc001egz.2	-						TRIM45_uc009whe.2_Intron|TRIM45_uc001eha.2_Intron	NM_025188	NP_079464	Q9H8W5	TRI45_HUMAN	tripartite motif-containing 45 isoform 1							cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)	1	Lung SC(450;0.225)	all_cancers(81;0.000979)|all_lung(203;7.65e-05)|all_epithelial(167;0.000134)|Lung NSC(69;0.000389)		Lung(183;0.0537)|Colorectal(144;0.172)|LUSC - Lung squamous cell carcinoma(189;0.187)		tcccggctaattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	120023108	120023111	+	IGR	DEL	GAAA	-	-	rs61808475	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120023108_120023111delGAAA								HSD3B2 (33988 upstream) : HSD3B1 (26715 downstream)																							aggaaggaaggaaagaaggaagga	0.127													9	7	---	---	---	---	
NOTCH2	4853	broad.mit.edu	37	1	120545153	120545153	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:120545153delA	uc001eik.2	-						NOTCH2_uc001eil.2_Intron|NOTCH2_uc001eim.3_Intron	NM_024408	NP_077719	Q04721	NOTC2_HUMAN	notch 2 preproprotein						anti-apoptosis|bone remodeling|cell cycle arrest|cell fate determination|cell growth|hemopoiesis|induction of apoptosis|negative regulation of cell proliferation|nervous system development|Notch receptor processing|Notch signaling pathway|organ morphogenesis|positive regulation of Ras protein signal transduction|regulation of transcription, DNA-dependent|stem cell maintenance|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|ligand-regulated transcription factor activity|protein binding|receptor activity			lung(8)|haematopoietic_and_lymphoid_tissue(7)|ovary(4)|central_nervous_system(2)|skin(2)|kidney(2)|breast(1)|prostate(1)	27	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ctccatcaggaaaaaaaaaaa	0.000			N|F|Mis		marginal zone lymphoma|DLBCL				Alagille_Syndrome				6	3	---	---	---	---	
LOC647121	647121	broad.mit.edu	37	1	121289386	121289387	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:121289386_121289387insA	uc001eiu.1	+							NR_003955				Homo sapiens cDNA FLJ46881 fis, clone UTERU3015647, moderately similar to Embigin precursor.												0						CTCCTTTGATGAAATCCAGTTA	0.238													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	142572257	142572258	+	IGR	INS	-	G	G	rs145671478	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:142572257_142572258insG								None (None upstream) : None (None downstream)																							TAAACAACTTTTTTTACTGGCA	0.347													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143120268	143120268	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143120268delA	uc001eiw.1	+						uc001ejf.1_Intron					Homo sapiens PNAS-130 mRNA, complete cds.																		gggctttatgatactatctct	0.000													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143395683	143395684	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143395683_143395684insA								None (None upstream) : LOC100286793 (251955 downstream)																							caaaacaaaacaaaaaaaaaGG	0.069													4	2	---	---	---	---	
PDE4DIP	9659	broad.mit.edu	37	1	145024569	145024570	+	Intron	DEL	AC	-	-	rs10535581		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145024569_145024570delAC	uc001elx.3	-						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elm.3_Intron|PDE4DIP_uc001eln.3_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron	NM_014644	NP_055459	Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein isoform						cellular protein complex assembly	centrosome|Golgi apparatus|myofibril|nucleus	enzyme binding			ovary(4)|haematopoietic_and_lymphoid_tissue(1)	5				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CCAAGCATGGacacacacacac	0.287			T	PDGFRB	MPD								1	5	---	---	---	---	
NBPF9	400818	broad.mit.edu	37	1	145053941	145053941	+	Intron	DEL	A	-	-	rs71645749		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145053941delA	uc010oye.1	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|PDE4DIP_uc001elo.2_Intron|PDE4DIP_uc001emh.2_Intron			Q3BBV1	NBPFK_HUMAN	RecName: Full=Neuroblastoma breakpoint family member 8;							cytoplasm					0						cttaaagtataaaaaaaaaaa	0.214													4	5	---	---	---	---	
NBPF10	100132406	broad.mit.edu	37	1	145241173	145241174	+	Intron	INS	-	AG	AG			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145241173_145241174insAG	uc001emp.3	+						NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NOTCH2NL_uc001emn.3_Intron|NOTCH2NL_uc001emm.3_Intron|NOTCH2NL_uc001emo.2_Intron|NOTCH2NL_uc010oyh.1_Intron	NM_017940	NP_060410	A6NDV3	A6NDV3_HUMAN	hypothetical protein LOC55672												0	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		AGGAGGAAGACATGTTTCTCCG	0.332													5	5	---	---	---	---	
LOC200030	200030	broad.mit.edu	37	1	148349431	148349432	+	5'Flank	INS	-	G	G	rs67020224		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148349431_148349432insG	uc001eqf.2	-						LOC200030_uc001eqe.2_5'Flank|LOC200030_uc001eqg.2_5'Flank|NBPF14_uc009wkf.1_5'Flank|uc001erd.3_5'Flank|uc001erc.3_5'Flank|uc010paj.1_5'Flank|uc010pav.1_5'Flank|uc010paw.1_5'Flank	NM_017940	NP_060410	Q86T75	NBPFB_HUMAN	hypothetical protein LOC55672							cytoplasm					0						GGGCTGACACTGGGGGGCCAGA	0.559													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148848558	148848559	+	IGR	INS	-	TCATT	TCATT	rs149159637	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148848558_148848559insTCATT								NBPF16 (90247 upstream) : LOC645166 (79727 downstream)																							atcatttcatctcatttcatca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148850127	148850129	+	IGR	DEL	TCA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148850127_148850129delTCA								NBPF16 (91816 upstream) : LOC645166 (78157 downstream)																							tttcatcatttcatttcattctt	0.000													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	148851641	148851642	+	IGR	INS	-	TT	TT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:148851641_148851642insTT								NBPF16 (93330 upstream) : LOC645166 (76644 downstream)																							ATTCAGGTGGCTTTTTTTTTTC	0.436													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	149031564	149031565	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149031564_149031565insA								LOC645166 (78510 upstream) : LOC388692 (247911 downstream)																							actataaccacaaaaaaaaatc	0.020													4	2	---	---	---	---	
LOC388692	388692	broad.mit.edu	37	1	149287128	149287129	+	RNA	DEL	CT	-	-	rs140343451		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:149287128_149287129delCT	uc010pbf.1	+	1		c.7653_7654delCT			LOC388692_uc001esg.3_5'Flank	NR_027002				Homo sapiens cDNA FLJ13580 fis, clone PLACE1008851.												0						GGGGACTGGCCTCTCTGCACGG	0.594													3	5	---	---	---	---	
PIP5K1A	8394	broad.mit.edu	37	1	151175254	151175254	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151175254delT	uc001exj.2	+						PIP5K1A_uc001exi.2_Intron|PIP5K1A_uc010pcu.1_Intron|PIP5K1A_uc001exk.2_Intron	NM_001135638	NP_001129110	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type						phospholipid biosynthetic process|signal transduction	endomembrane system|Golgi stack|lamellipodium|nuclear speck	1-phosphatidylinositol-4-phosphate 5-kinase activity|ATP binding|kinase binding			ovary(1)|central_nervous_system(1)|skin(1)	3	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			cAGTAAAGTCttttttttttt	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	152630797	152630798	+	IGR	INS	-	T	T	rs78914527		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152630797_152630798insT								LCE3A (35218 upstream) : LCE2D (5074 downstream)																							GAGATGTTCTGTTTTTTTTTTT	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	154874906	154874906	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154874906delG								KCNN3 (32152 upstream) : PMVK (22303 downstream)																							CCACCATTCTGGTTTTACCCT	0.468													4	2	---	---	---	---	
C1orf204	284677	broad.mit.edu	37	1	159821951	159821954	+	Intron	DEL	AGAC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159821951_159821954delAGAC	uc001fug.1	-						C1orf204_uc001fuf.1_Intron	NM_001134233	NP_001127705	Q5VU13	VSIG8_HUMAN	hypothetical protein LOC284677							integral to membrane					0						AAAAAATCAAagacagacagacag	0.260													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	169007615	169007615	+	IGR	DEL	T	-	-	rs4348702	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169007615delT								MGC4473 (245495 upstream) : ATP1B1 (68332 downstream)																							accaaaaaaataaagcaggag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	169605601	169605601	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169605601delC								SELP (6224 upstream) : C1orf112 (25644 downstream)																							ataccagctacaaaaaaacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177256365	177256365	+	IGR	DEL	T	-	-	rs35231651		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177256365delT								FAM5B (4808 upstream) : SEC16B (641124 downstream)																							ccttccttccttccttccttc	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177738164	177738164	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177738164delC								FAM5B (486607 upstream) : SEC16B (159325 downstream)																							ccatctaaatccaatttcctt	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	177882255	177882256	+	IGR	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177882255_177882256delCA								FAM5B (630698 upstream) : SEC16B (15233 downstream)																							CTGGAGAGACcacacacacaca	0.371													4	2	---	---	---	---	
STX6	10228	broad.mit.edu	37	1	180960608	180960608	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180960608delG	uc010pnq.1	-						STX6_uc001goo.2_Intron|STX6_uc010pnr.1_Intron	NM_005819	NP_005810	O43752	STX6_HUMAN	syntaxin 6						Golgi vesicle transport|intracellular protein transport|vesicle fusion	clathrin-coated vesicle|early endosome|integral to membrane|perinuclear region of cytoplasm|plasma membrane|trans-Golgi network membrane	SNAP receptor activity			ovary(1)	1						ATGCATCACTGGCCTAAGGAC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	195765032	195765033	+	IGR	DEL	GT	-	-	rs143697428	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:195765032_195765033delGT								None (None upstream) : KCNT2 (429880 downstream)																							atcatcattggtgtgtgtgtgt	0.000													4	2	---	---	---	---	
REN	5972	broad.mit.edu	37	1	204132767	204132768	+	Intron	DEL	CC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204132767_204132768delCC	uc001haq.2	-							NM_000537	NP_000528	P00797	RENI_HUMAN	renin preproprotein						angiotensin maturation|regulation of MAPKKK cascade	extracellular space|membrane	aspartic-type endopeptidase activity			skin(3)|central_nervous_system(1)	4	all_cancers(21;0.00965)|Breast(84;0.116)|all_epithelial(62;0.157)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)		Aliskiren(DB01258)|Remikiren(DB00212)	ACCCCCACCTCCAGGAAGCTTA	0.535													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	212059366	212059366	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212059366delA								LPGAT1 (55252 upstream) : INTS7 (55332 downstream)																							AGATCTGTTTAACTAAATTCT	0.398													4	2	---	---	---	---	
FLVCR1	28982	broad.mit.edu	37	1	213056216	213056216	+	Intron	DEL	G	-	-	rs74429848		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213056216delG	uc001hjt.2	+							NM_014053	NP_054772	Q9Y5Y0	FLVC1_HUMAN	feline leukemia virus subgroup C cellular						cell death|cellular iron ion homeostasis|heme export|transmembrane transport	integral to plasma membrane	heme transporter activity|protein binding|receptor activity				0				OV - Ovarian serous cystadenocarcinoma(81;0.00733)|all cancers(67;0.013)|GBM - Glioblastoma multiforme(131;0.0845)|Epithelial(68;0.11)		tctccagcctgggcaacagag	0.119													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	213079605	213079606	+	IGR	INS	-	AAC	AAC			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213079605_213079606insAAC								FLVCR1 (9408 upstream) : VASH2 (44281 downstream)																							cttatctcaataacaacaacaa	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	221631041	221631042	+	IGR	DEL	AT	-	-	rs150747134		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:221631041_221631042delAT								LOC400804 (121403 upstream) : DUSP10 (243724 downstream)																							GGgtatgtgcatgtgtgtgtgt	0.272													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	223649269	223649269	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223649269delC								C1orf65 (80457 upstream) : CAPN8 (65703 downstream)																							CACCCAGGAGCCCCCATGGTT	0.542													4	2	---	---	---	---	
CAPN8	388743	broad.mit.edu	37	1	223807956	223807956	+	Frame_Shift_Del	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:223807956delC	uc009xee.2	-	8	1000	c.912delG	c.(910-912)TGGfs	p.W304fs		NM_001143962	NP_001137434	A6NHC0	CAN8_HUMAN	calpain 8	304	Calpain catalytic.				proteolysis	Golgi apparatus	calcium ion binding|calcium-dependent cysteine-type endopeptidase activity				0						CTATGTGATTCCACTCTGGTG	0.517													4	2	---	---	---	---	
DNAH14	127602	broad.mit.edu	37	1	225139102	225139102	+	Intron	DEL	T	-	-	rs67255011		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225139102delT	uc001how.2	+						DNAH14_uc001hou.3_Intron|DNAH14_uc001hot.3_Intron|DNAH14_uc001hov.3_Intron	NM_001373	NP_001364	Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy polypeptide 14 isoform						microtubule-based movement	cilium axoneme|cytoplasm|dynein complex|microtubule	ATP binding|microtubule motor activity			central_nervous_system(1)	1						GATTTAGGGATTTTTTTTTTT	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	229561474	229561474	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229561474delG								C1orf96 (82786 upstream) : ACTA1 (5521 downstream)																							aagaggaggaggggggaggat	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	232504826	232504829	+	IGR	DEL	ATCT	-	-	rs63451960		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232504826_232504829delATCT								DISC1 (327810 upstream) : SIPA1L2 (28885 downstream)																							CTGTCCATCCATCTATACAtctct	0.363													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	240186884	240186887	+	IGR	DEL	TTCT	-	-	rs67018339		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240186884_240186887delTTCT								CHRM3 (114169 upstream) : FMN2 (68298 downstream)																							AAATTCAGGCttctttctttcttt	0.245													2	5	---	---	---	---	
PXDN	7837	broad.mit.edu	37	2	1683526	1683529	+	Intron	DEL	GTGT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1683526_1683529delGTGT	uc002qxa.2	-						PXDN_uc002qxb.1_Intron|PXDN_uc002qxc.1_Intron	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor						extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		gtgtatgtgcgtgtgtgtggtttg	0.054													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	8170463	8170463	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8170463delT	uc010eww.1	-											Homo sapiens cDNA FLJ45673 fis, clone D9OST2003989.																		GATGTAAGCATGCGAAGATTC	0.463													4	2	---	---	---	---	
KIDINS220	57498	broad.mit.edu	37	2	8875008	8875009	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:8875008_8875009insA	uc002qzc.2	-						KIDINS220_uc010yiv.1_Intron|KIDINS220_uc002qzd.2_Intron|KIDINS220_uc010yiw.1_Intron|KIDINS220_uc002qzb.2_Intron	NM_020738	NP_065789	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate of 220 kDa						activation of MAPKK activity|nerve growth factor receptor signaling pathway	cytosol|integral to membrane				ovary(3)|central_nervous_system(1)	4	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					AAAGGCTGACCAAAAAAAAGGT	0.322													4	2	---	---	---	---	
ASAP2	8853	broad.mit.edu	37	2	9445647	9445648	+	Intron	INS	-	A	A	rs142522217	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9445647_9445648insA	uc002qzh.2	+						ASAP2_uc002qzi.2_Intron	NM_003887	NP_003878	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH						regulation of ARF GTPase activity	Golgi cisterna membrane|plasma membrane	ARF GTPase activator activity|protein binding|zinc ion binding				0						GGGGTATAGATATTGGTGGAGG	0.465													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	9825301	9825302	+	IGR	INS	-	T	T	rs149172533	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:9825301_9825302insT								YWHAQ (54195 upstream) : TAF1B (158269 downstream)																							ccatgaagcagtaagaccaaca	0.079													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	28693371	28693371	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28693371delG								FOSL2 (55857 upstream) : PLB1 (25611 downstream)																							GTGAGGTGCTGGGCTGGCCTC	0.577													4	2	---	---	---	---	
LTBP1	4052	broad.mit.edu	37	2	33394374	33394375	+	Intron	DEL	TA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:33394374_33394375delTA	uc002ros.2	+						LTBP1_uc002rot.2_Intron|LTBP1_uc002rou.2_Intron|LTBP1_uc002rov.2_Intron|LTBP1_uc010ymz.1_Intron|LTBP1_uc010yna.1_Intron	NM_206943	NP_996826	Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding						negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta	proteinaceous extracellular matrix	calcium ion binding|growth factor binding|transforming growth factor beta receptor activity			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|central_nervous_system(1)	8	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				ACTGCCACATTATATTTTTCTT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	39706413	39706413	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:39706413delA	uc002rrq.2	+						uc002rrr.1_Intron					Homo sapiens cDNA FLJ33477 fis, clone BRAMY2002604.																		TTTGGTCCATAAAAGGAGATC	0.303													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	41404940	41404940	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:41404940delT								SLC8A1 (665365 upstream) : PKDCC (870221 downstream)																							gatgttgagctttttttcata	0.000													4	2	---	---	---	---	
MSH2	4436	broad.mit.edu	37	2	47895578	47895578	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47895578delA	uc002rvz.2	+							NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			aagcaggcagaAACATtgtta	0.005			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	48148032	48148032	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48148032delT								FBXO11 (15218 upstream) : FOXN2 (393763 downstream)																							AAAATGCCTCTTTTTTTTTTC	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	54540179	54540179	+	IGR	DEL	A	-	-	rs67575344		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54540179delA								ACYP2 (7746 upstream) : C2orf73 (17892 downstream)																							cacagagctcaaggctccaga	0.000													3	3	---	---	---	---	
CCDC88A	55704	broad.mit.edu	37	2	55589071	55589072	+	Intron	INS	-	ACT	ACT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55589071_55589072insACT	uc002ryv.2	-						CCDC88A_uc010yoz.1_Intron|CCDC88A_uc010ypa.1_Intron|CCDC88A_uc010ypb.1_Intron	NM_001135597	NP_001129069	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A isoform 1						activation of protein kinase B activity|cell migration|cellular membrane organization|DNA replication|lamellipodium assembly|microtubule cytoskeleton organization|regulation of actin cytoskeleton organization|regulation of cell proliferation|regulation of DNA replication|regulation of neuron projection development|TOR signaling cascade	cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|Golgi apparatus|lamellipodium|plasma membrane	actin binding|microtubule binding|phosphatidylinositol binding|protein homodimerization activity|protein kinase B binding			ovary(2)|skin(2)	4						GTGGCAATAAAACTACGAAATT	0.327													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	55685522	55685523	+	IGR	INS	-	T	T	rs145070433	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55685522_55685523insT								CCDC88A (38465 upstream) : CCDC104 (61217 downstream)																							ccagcTGAGACTTTTTTTTTTA	0.168													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	57590496	57590497	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:57590496_57590497insA								CCDC85A (977188 upstream) : VRK2 (544289 downstream)																							tatgcagctggaaaaggagtaa	0.000													4	2	---	---	---	---	
VPS54	51542	broad.mit.edu	37	2	64230995	64230995	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64230995delC	uc002scq.2	-						VPS54_uc002scp.2_Intron	NM_016516	NP_057600	Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 isoform 1						protein transport|retrograde transport, endosome to Golgi						0						CCAGCCAGAaccccaccaagc	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64443717	64443717	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64443717delA								PELI1 (72112 upstream) : HSPC159 (237610 downstream)																							GTTGTGATATAAAAAAAAAAA	0.393													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	71961383	71961383	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71961383delC								DYSF (47491 upstream) : CYP26B1 (394984 downstream)																							gcctttgcctcctccttcacc	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	73410440	73410440	+	IGR	DEL	G	-	-	rs113492830		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73410440delG								RAB11FIP5 (70294 upstream) : NOTO (18946 downstream)																							aaggaaggaagggaaagaagg	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	75157617	75157618	+	RNA	INS	-	CCTC	CCTC	rs140131198	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75157617_75157618insCCTC	uc002sne.1	+	1		c.2252_2253insCCTC								Homo sapiens cDNA FLJ43972 fis, clone TESTI4017961.																		ttttgggtgataatcaggcgca	0.000													5	3	---	---	---	---	
LRRTM4	80059	broad.mit.edu	37	2	77602829	77602829	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:77602829delG	uc002snr.2	-						LRRTM4_uc002snq.2_Intron	NM_001134745	NP_001128217	Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4							integral to membrane				pancreas(3)|ovary(1)	4				Colorectal(11;0.059)		ctccttctctggcctataaca	0.000													4	2	---	---	---	---	
CTNNA2	1496	broad.mit.edu	37	2	80304712	80304713	+	Intron	INS	-	A	A	rs112388096		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80304712_80304713insA	uc010ysh.1	+						CTNNA2_uc010yse.1_Intron|CTNNA2_uc010ysf.1_Intron|CTNNA2_uc010ysg.1_Intron	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1						axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						ctgtctctattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	84478904	84478904	+	IGR	DEL	A	-	-	rs72410287		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:84478904delA								None (None upstream) : FUNDC2P2 (38902 downstream)																							agaaagaaagaaaagaaagaa	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	85701191	85701192	+	IGR	INS	-	AC	AC	rs148093783		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:85701191_85701192insAC								SH2D6 (37041 upstream) : MAT2A (65096 downstream)																							AGCACATCTATacacacacaca	0.361													3	4	---	---	---	---	
VPS24	51652	broad.mit.edu	37	2	86855833	86855834	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:86855833_86855834insT	uc010ytl.1	-							NM_001005753	NP_001005753	Q9Y3E7	CHMP3_HUMAN	vacuolar protein sorting 24 isoform 2						cell cycle|cell division|cellular membrane organization|endosome transport|protein transport	cytosol|late endosome membrane	protein binding			central_nervous_system(1)	1						taagcgcatacttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	89931888	89931888	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89931888delG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		TGATGGGAGAGGATATGGTGG	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90417154	90417155	+	Intron	INS	-	ATG	ATG			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90417154_90417155insATG	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		gaaatggtgaaatgaaatgaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90451278	90451278	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90451278delT	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		ACTGACCTTATTTTTTTTTAC	0.139													4	2	---	---	---	---	
LOC654342	654342	broad.mit.edu	37	2	91844365	91844366	+	Intron	INS	-	A	A	rs138066632	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:91844365_91844366insA	uc002sts.3	-						LOC654342_uc002stt.2_Intron|LOC654342_uc010yub.1_Intron					Homo sapiens cDNA clone IMAGE:4801360.												0						CACCAAGCCATGGGGGGGCGTG	0.644													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92121304	92121305	+	IGR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92121304_92121305delAC								GGT8P (151151 upstream) : FKSG73 (7854 downstream)																							gcaaagccatacacacacacac	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	92254688	92254688	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:92254688delT								FKSG73 (124194 upstream) : None (None downstream)																							cgtcagaatatttccctcatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	96617039	96617040	+	Intron	INS	-	C	C	rs74263747		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:96617039_96617040insC	uc010yug.1	-											Homo sapiens cDNA FLJ54441 complete cds, highly similar to Homo sapiens ankyrin repeat domain 36 (ANKRD36), mRNA.																		gaaaaaaaaaaaaaaaacaaaT	0.153													3	4	---	---	---	---	
LMAN2L	81562	broad.mit.edu	37	2	97371959	97371959	+	3'UTR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97371959delA	uc002swu.2	-	8					LMAN2L_uc002swv.2_3'UTR|LMAN2L_uc010yut.1_3'UTR|LMAN2L_uc010yuu.1_3'UTR|LMAN2L_uc010yuv.1_3'UTR|LMAN2L_uc010yuw.1_3'UTR|LMAN2L_uc002sww.2_3'UTR|LMAN2L_uc010yux.1_3'UTR	NM_030805	NP_110432	Q9H0V9	LMA2L_HUMAN	lectin, mannose-binding 2-like isoform 2						ER to Golgi vesicle-mediated transport|protein folding|protein transport	endoplasmic reticulum membrane|ER to Golgi transport vesicle|Golgi membrane|integral to membrane	mannose binding|metal ion binding				0						GTCCATTAAGAAAAAAAAAGC	0.428													4	2	---	---	---	---	
SEMA4C	54910	broad.mit.edu	37	2	97538096	97538096	+	5'Flank	DEL	C	-	-	rs150765276	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97538096delC	uc002sxh.3	-							NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor						muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2						aacaaacaaaccaaactagcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	110394835	110394835	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110394835delG								ANKRD57 (18272 upstream) : RGPD5 (155500 downstream)																							tcccaccatagggcggttttt	0.000													4	2	---	---	---	---	
LOC541471	541471	broad.mit.edu	37	2	112242571	112242571	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112242571delG	uc002the.2	-						LOC541471_uc010yxl.1_Intron|LOC541471_uc002thf.3_Intron					Homo sapiens hypothetical LOC541471, mRNA (cDNA clone IMAGE:3459303).												0						GGAAGGAGCTGGGGCTCATGC	0.378													4	2	---	---	---	---	
MERTK	10461	broad.mit.edu	37	2	112721945	112721946	+	Intron	INS	-	GTGTGTGT	GTGTGTGT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112721945_112721946insGTGTGTGT	uc002thk.1	+						MERTK_uc002thl.1_Intron	NM_006343	NP_006334	Q12866	MERTK_HUMAN	MER receptor tyrosine kinase precursor						cell surface receptor linked signaling pathway|cell-cell signaling|leukocyte migration	integral to plasma membrane|soluble fraction	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(6)|upper_aerodigestive_tract(1)|stomach(1)|kidney(1)	9						atcattgtctcgtgtgtgtgtg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	114730038	114730038	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114730038delT								ACTR3 (13871 upstream) : DPP10 (469861 downstream)																							cacaTAATTATTCAGAGAAGA	0.269													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	119636587	119636588	+	IGR	INS	-	A	A	rs141033067	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:119636587_119636588insA								EN1 (30828 upstream) : MARCO (63157 downstream)																							GGTAGGGGAGGAAAAAAAAATG	0.510													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	121888390	121888391	+	IGR	DEL	TG	-	-	rs112526404		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121888390_121888391delTG								GLI2 (138162 upstream) : TFCP2L1 (85775 downstream)																							tgcatgtgtatgtgtgtgtgtg	0.233													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	131670474	131670475	+	Intron	DEL	GA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131670474_131670475delGA	uc002try.1	+						ARHGEF4_uc010fmw.1_5'Flank|ARHGEF4_uc002trz.1_5'Flank					Homo sapiens cDNA FLJ45181 fis, clone BRAWH3047644, highly  similar to Homo sapiens Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4).																		aagatattttgagagagagaga	0.000													4	2	---	---	---	---	
ARHGEF4	50649	broad.mit.edu	37	2	131677114	131677114	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131677114delA	uc002tsa.1	+						ARHGEF4_uc010fmw.1_Intron|ARHGEF4_uc002tsb.1_Intron|ARHGEF4_uc002trz.1_Intron	NM_015320	NP_056135	Q9NR80	ARHG4_HUMAN	Rho guanine nucleotide exchange factor 4 isoform						apoptosis|filopodium assembly|induction of apoptosis by extracellular signals|lamellipodium assembly|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|ruffle membrane	protein domain specific binding|Rac guanyl-nucleotide exchange factor activity			breast(3)|ovary(2)|skin(1)	6		Prostate(154;0.055)		BRCA - Breast invasive adenocarcinoma(221;0.097)		TCAAGTAGTCAAAAAAAGATT	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133036892	133036892	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133036892delG								NCRNA00164 (21350 upstream) : GPR39 (137255 downstream)																							gatcgtcaaagcccagctttc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	133063665	133063665	+	Intron	DEL	T	-	-	rs112256640		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:133063665delT	uc002ttk.1	+											Homo sapiens cDNA FLJ37280 fis, clone BRAMY2012881.																		GAATGCTCTCTGTATATTTGA	0.338													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	136948418	136948418	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:136948418delG								CXCR4 (72693 upstream) : THSD7B (574697 downstream)																							agggaggagtggggaggaggg	0.299													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	170268044	170268044	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170268044delT								LRP2 (48922 upstream) : BBS5 (67962 downstream)																							tgttatacccttttttgacta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	170996356	170996356	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170996356delA								UBR3 (55719 upstream) : MYO3B (38299 downstream)																							tggaacatctaagatcttccc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	171654850	171654850	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171654850delC	uc002ugg.2	+											RecName: Full=Uncharacterized protein LOC285141;																		TCCCTGGGCACCAGGCATCAG	0.498													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	174738142	174738142	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:174738142delA								CDCA7 (504424 upstream) : SP3 (35117 downstream)																							ACAGACAAGTAAGGGGGTAGG	0.368													4	2	---	---	---	---	
PRKRA	8575	broad.mit.edu	37	2	179308737	179308737	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179308737delT	uc002umf.2	-						PRKRA_uc002umc.2_5'Flank|PRKRA_uc002umd.2_Intron|PRKRA_uc002ume.2_Intron|PRKRA_uc002umg.2_Intron	NM_003690	NP_003681	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double						immune response|negative regulation of cell proliferation|production of siRNA involved in RNA interference|response to virus	perinuclear region of cytoplasm	double-stranded RNA binding|enzyme activator activity|protein homodimerization activity			central_nervous_system(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			ATAGATAAAATTTTTTTTTTT	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	180757445	180757446	+	IGR	INS	-	A	A	rs143603404	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180757445_180757446insA								ZNF385B (31213 upstream) : CWC22 (52158 downstream)																							TTATGCTTCAGAAAACCAGTGT	0.421													2	4	---	---	---	---	
DUSP19	142679	broad.mit.edu	37	2	183950316	183950316	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183950316delA	uc002upd.2	+						DUSP19_uc010frp.2_Intron|DUSP19_uc010zfr.1_Intron|DUSP19_uc002upe.2_Intron	NM_080876	NP_543152	Q8WTR2	DUS19_HUMAN	dual specificity phosphatase 19 isoform 1						JNK cascade|negative regulation of JNK cascade|negative regulation of JUN kinase activity|positive regulation of JNK cascade|positive regulation of JUN kinase activity	cytoplasm	JUN kinase phosphatase activity|MAP-kinase scaffold activity|mitogen-activated protein kinase kinase kinase binding|protein kinase activator activity|protein kinase inhibitor activity|protein tyrosine phosphatase activity			ovary(4)|pancreas(1)	5						tggcaaagggaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PLCL1	5334	broad.mit.edu	37	2	198834375	198834375	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198834375delA	uc010fsp.2	+						PLCL1_uc002uuv.3_Intron	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;						intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	attgtacagcaaatatttcca	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	199161007	199161008	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:199161007_199161008insA								PLCL1 (146401 upstream) : SATB2 (973216 downstream)																							ATGAATTAGTGaaaaaaaaaaa	0.371													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	204782283	204782283	+	IGR	DEL	T	-	-	rs72206850		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:204782283delT								CTLA4 (43600 upstream) : ICOS (19188 downstream)																							TGTCACTATCttttttttttt	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	207291612	207291613	+	IGR	DEL	AC	-	-	rs35677560		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207291612_207291613delAC								ZDBF2 (112464 upstream) : ADAM23 (16755 downstream)																							acacacacatacacacacacac	0.327													3	3	---	---	---	---	
FN1	2335	broad.mit.edu	37	2	216235278	216235278	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:216235278delA	uc002vfa.2	-						FN1_uc002vfb.2_Intron|FN1_uc002vfc.2_Intron|FN1_uc002vfd.2_Intron|FN1_uc002vfe.2_Intron|FN1_uc002vff.2_Intron|FN1_uc002vfg.2_Intron|FN1_uc002vfh.2_Intron|FN1_uc002vfi.2_Intron|FN1_uc002vfj.2_Intron|FN1_uc002vez.2_Intron|FN1_uc010zjp.1_Intron|FN1_uc002vfk.1_Intron|FN1_uc010fva.1_Intron|FN1_uc010fvb.1_Intron|FN1_uc010fvc.1_Intron|FN1_uc010fvd.1_Intron	NM_212482	NP_997647	P02751	FINC_HUMAN	fibronectin 1 isoform 1 preproprotein						acute-phase response|angiogenesis|leukocyte migration|peptide cross-linking|platelet activation|platelet degranulation|regulation of cell shape|substrate adhesion-dependent cell spreading	ER-Golgi intermediate compartment|fibrinogen complex|platelet alpha granule lumen|proteinaceous extracellular matrix	collagen binding|extracellular matrix structural constituent|heparin binding			central_nervous_system(7)|large_intestine(2)|breast(2)|ovary(1)|pancreas(1)	13		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Tenecteplase(DB00031)	aacaaaaaacaaaaaaaaaaa	0.413													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	217481837	217481838	+	IGR	DEL	AG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217481837_217481838delAG								RPL37A (115651 upstream) : IGFBP2 (16289 downstream)																							ACACAGAGAAAGAGAGAGAGAG	0.450													4	2	---	---	---	---	
GLB1L	79411	broad.mit.edu	37	2	220108464	220108464	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220108464delA	uc002vkm.2	-						GLB1L_uc010zkx.1_5'Flank|GLB1L_uc002vkn.2_Intron|STK16_uc002vko.2_5'Flank|STK16_uc002vks.2_5'Flank|STK16_uc010zky.1_5'Flank|STK16_uc010fwf.2_5'Flank|STK16_uc002vkp.2_5'Flank|STK16_uc002vkr.2_5'Flank|STK16_uc002vkq.2_5'Flank	NM_024506	NP_078782	Q6UWU2	GLB1L_HUMAN	galactosidase, beta 1-like precursor						carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds				0		all_lung(227;1.19e-05)|Lung NSC(271;2.76e-05)|Medulloblastoma(418;0.0208)|Esophageal squamous(248;0.0559)		Epithelial(149;1.3e-11)|all cancers(144;2.07e-10)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACTAGTTTGTAAAATTTCTAC	0.308													4	2	---	---	---	---	
TUBA4B	80086	broad.mit.edu	37	2	220119769	220119770	+	Intron	DEL	TC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220119769_220119770delTC	uc002vkv.1	+						TUBA4A_uc002vkt.1_5'Flank|TUBA4A_uc010zkz.1_5'Flank|TUBA4B_uc002vku.2_Intron	NR_003063				RecName: Full=Putative tubulin-like protein alpha-4B; AltName: Full=Alpha-tubulin 4B;												0						GCtttctctttctctctctctc	0.238													4	3	---	---	---	---	
SPEG	10290	broad.mit.edu	37	2	220335023	220335027	+	Intron	DEL	GCCCA	-	-	rs72334051		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220335023_220335027delGCCCA	uc010fwg.2	+							NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus						muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		tgaccctggtgcccagctcttaacc	0.132													3	6	---	---	---	---	
AP1S3	130340	broad.mit.edu	37	2	224652683	224652684	+	Intron	INS	-	T	T	rs140920838	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224652683_224652684insT	uc010fwx.1	-						AP1S3_uc002vnn.2_Intron|AP1S3_uc010fww.2_Intron|AP1S3_uc002vno.2_Intron	NM_001039569	NP_001034658	Q96PC3	AP1S3_HUMAN	adaptor-related protein complex 1, sigma 3						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport|regulation of defense response to virus by virus|viral reproduction	coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane coat	protein transporter activity				0		Renal(207;0.0112)|Lung NSC(271;0.0186)|all_lung(227;0.0272)		Epithelial(121;7.6e-10)|all cancers(144;3.62e-07)|Lung(261;0.0086)|LUSC - Lung squamous cell carcinoma(224;0.00902)		tgccacagttcttttttttggg	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	224713467	224713467	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:224713467delC								AP1S3 (11148 upstream) : WDFY1 (26599 downstream)																							GGTTGGTCTGCCTTATTGTTT	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227157773	227157773	+	IGR	DEL	G	-	-	rs56921784		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227157773delG								KIAA1486 (562302 upstream) : IRS1 (438261 downstream)																							ATGTTAAAATGCATTTCTTAA	0.358													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	227449322	227449322	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227449322delG								KIAA1486 (853851 upstream) : IRS1 (146712 downstream)																							CCTTGAGGCTGGTCTCAGCGC	0.458													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	239507183	239507183	+	IGR	DEL	C	-	-	rs34679708		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:239507183delC								ASB1 (146293 upstream) : TWIST2 (249490 downstream)																							TGTGCTTGAACCCTGTGCCCG	0.597													3	3	---	---	---	---	
CNTN6	27255	broad.mit.edu	37	3	1235657	1235657	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1235657delT	uc003boz.2	+						CNTN6_uc010hbo.2_Intron|CNTN6_uc011asj.1_Intron|CNTN6_uc003bpa.2_Intron	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor						axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTTATCTATGTTTTTTTTCCC	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	10784421	10784421	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10784421delA								ATP2B2 (34705 upstream) : LOC285370 (16748 downstream)																							tcaaaaatgtaaatccgatca	0.219													1	6	---	---	---	---	
IQSEC1	9922	broad.mit.edu	37	3	13033379	13033380	+	Intron	INS	-	GGCAG	GGCAG	rs145077535	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:13033379_13033380insGGCAG	uc011auw.1	-							NM_001134382	NP_001127854	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1 isoform a						regulation of ARF protein signal transduction	cytoplasm|nucleus	ARF guanyl-nucleotide exchange factor activity			ovary(1)	1						GGCATGGGACAGGCAGGGCAGG	0.604													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	19589220	19589222	+	IGR	DEL	CCT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19589220_19589222delCCT								KCNH8 (12085 upstream) : EFHB (331746 downstream)																							ctttgccacccctcctcccattc	0.232													4	2	---	---	---	---	
ZNF385D	79750	broad.mit.edu	37	3	21527095	21527095	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:21527095delT	uc003cce.2	-						ZNF385D_uc010hfb.1_Intron	NM_024697	NP_078973	Q9H6B1	Z385D_HUMAN	zinc finger protein 385D							nucleus	nucleic acid binding|zinc ion binding			large_intestine(2)|skin(2)|ovary(1)	5						CCTTTCACCATTTTTCCCATC	0.328													4	2	---	---	---	---	
TRIM71	131405	broad.mit.edu	37	3	32870489	32870490	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32870489_32870490insT	uc003cff.2	+							NM_001039111	NP_001034200	Q2Q1W2	LIN41_HUMAN	tripartite motif-containing 71						multicellular organismal development	cytoplasm	zinc ion binding			ovary(2)|large_intestine(1)	3						GAAAGCACTAAttttttttttt	0.030													4	2	---	---	---	---	
MYRIP	25924	broad.mit.edu	37	3	39889957	39889957	+	Intron	DEL	G	-	-	rs11288652		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39889957delG	uc003cka.2	+						MYRIP_uc010hhu.2_Intron|MYRIP_uc010hhv.2_Intron|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Intron	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein						intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGCTTATTTTGACTCCTCTTT	0.333													4	2	---	---	---	---	
ULK4	54986	broad.mit.edu	37	3	41987524	41987524	+	Intron	DEL	C	-	-	rs10716860		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:41987524delC	uc003ckv.3	-						ULK4_uc003ckw.2_Intron|ULK4_uc003ckx.1_Intron	NM_017886	NP_060356	Q96C45	ULK4_HUMAN	unc-51-like kinase 4								ATP binding|protein serine/threonine kinase activity				0				KIRC - Kidney renal clear cell carcinoma(284;0.214)		aagaaagagacgggcaggggg	0.000													4	4	---	---	---	---	
ITIH1	3697	broad.mit.edu	37	3	52818892	52818893	+	Intron	INS	-	A	A	rs5848960		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52818892_52818893insA	uc003dfs.2	+						ITIH1_uc010hmn.1_Intron|ITIH1_uc003dft.2_Intron|ITIH1_uc010hmo.1_Intron	NM_002215	NP_002206	P19827	ITIH1_HUMAN	inter-alpha (globulin) inhibitor H1						hyaluronan metabolic process|leukocyte activation	extracellular region	calcium ion binding|serine-type endopeptidase inhibitor activity			ovary(3)	3				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		ctctgtctcagaaaaaaaaaaa	0.045													6	4	---	---	---	---	
PTPRG	5793	broad.mit.edu	37	3	61721202	61721202	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:61721202delA	uc003dlb.2	+						PTPRG_uc003dlc.2_Intron|PTPRG_uc003dla.3_Intron	NM_002841	NP_002832	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G						transmembrane receptor protein tyrosine kinase signaling pathway	integral to plasma membrane	identical protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(5)|lung(2)	7				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		CAATTCCTTGAGTTTTTTTTT	0.393													4	2	---	---	---	---	
SUCLG2	8801	broad.mit.edu	37	3	67607597	67607597	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:67607597delG	uc003dna.3	-							NM_003848	NP_003839	Q96I99	SUCB2_HUMAN	succinate-CoA ligase, GDP-forming beta subunit						succinyl-CoA metabolic process|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|GTP binding|succinate-CoA ligase (GDP-forming) activity			central_nervous_system(1)|skin(1)	2		Renal(2;0.00294)|Lung NSC(201;0.012)|Hepatocellular(537;0.121)		BRCA - Breast invasive adenocarcinoma(55;3.53e-05)|Epithelial(33;0.000153)	Succinic acid(DB00139)	ATAAAGGATAGGAAGAATCTC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	70174186	70174187	+	IGR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:70174186_70174187delAC								MITF (156700 upstream) : FOXP1 (830550 downstream)																							CTTGAAAGATACAGGATTCAAA	0.351													4	2	---	---	---	---	
SHQ1	55164	broad.mit.edu	37	3	72822635	72822635	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:72822635delA	uc003dpf.2	-						SHQ1_uc010hod.2_Intron	NM_018130	NP_060600	Q6PI26	SHQ1_HUMAN	SHQ1 homolog						ribonucleoprotein complex assembly	cytosol|nucleoplasm	protein binding			ovary(2)|large_intestine(1)	3		Prostate(10;0.00482)|Lung NSC(201;0.0339)|Myeloproliferative disorder(1037;0.204)		BRCA - Breast invasive adenocarcinoma(55;9.68e-05)|Epithelial(33;0.000563)|LUSC - Lung squamous cell carcinoma(21;0.00229)|Lung(16;0.00688)|KIRC - Kidney renal clear cell carcinoma(39;0.018)|Kidney(39;0.0213)		AAGACAGCTTaaaaaaaaaaa	0.383													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	99274230	99274230	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99274230delG								DCBLD2 (653697 upstream) : COL8A1 (83224 downstream)																							tttctgggatgcaagatcggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	107737286	107737287	+	IGR	INS	-	TCGA	TCGA			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:107737286_107737287insTCGA								LOC285205 (89535 upstream) : CD47 (24654 downstream)																							TCCCATTGCACCCGAATGATCT	0.431													4	2	---	---	---	---	
BOC	91653	broad.mit.edu	37	3	112930206	112930206	+	5'Flank	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:112930206delA	uc003dzx.2	+						BOC_uc010hqi.2_5'Flank|BOC_uc003dzy.2_5'Flank|BOC_uc003dzz.2_5'Flank|BOC_uc003dzw.1_5'Flank	NM_033254	NP_150279	Q9BWV1	BOC_HUMAN	brother of CDO precursor						cell adhesion|muscle cell differentiation|positive regulation of myoblast differentiation	integral to membrane|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|pancreas(1)	6			Epithelial(53;0.227)			GAGGCACAGCAAAAAGTGGGT	0.473													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	121861043	121861044	+	IGR	DEL	CT	-	-	rs113166240		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121861043_121861044delCT								CD86 (21061 upstream) : CASR (41486 downstream)																							ggtttttctgctctgttttttt	0.000													1	5	---	---	---	---	
KPNA1	3836	broad.mit.edu	37	3	122211807	122211807	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122211807delG	uc003efd.1	-						KPNA1_uc011bjr.1_Intron|KPNA1_uc010hrh.2_Intron|KPNA1_uc003efe.2_Intron	NM_002264	NP_002255	P52294	IMA1_HUMAN	karyopherin alpha 1						DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|regulation of DNA recombination|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein binding|protein transporter activity				0				GBM - Glioblastoma multiforme(114;0.0898)		TCCATAATCAGATACTTAAAG	0.209													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	125453580	125453580	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125453580delT								OSBPL11 (139199 upstream) : MIR548I1 (55667 downstream)																							ATTTGTTGTCTTTTTTTTTTT	0.438													4	2	---	---	---	---	
CHCHD6	84303	broad.mit.edu	37	3	126436611	126436612	+	Intron	INS	-	GT	GT	rs143258758	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126436611_126436612insGT	uc003ejf.1	+						CHCHD6_uc010hsj.1_Intron	NM_032343	NP_115719	Q9BRQ6	CHCH6_HUMAN	coiled-coil-helix-coiled-coil-helix domain												0						AGTGCTGAGGGGTGTGTGTGTG	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	129634740	129634740	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129634740delC								TMCC1 (22337 upstream) : TRH (58374 downstream)																							tcctgtctcacaaaaaaaaaa	0.199													3	3	---	---	---	---	
TF	7018	broad.mit.edu	37	3	133452109	133452110	+	Intron	INS	-	G	G	rs138169693	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133452109_133452110insG	uc003epu.1	+							NM_001063	NP_001054	P02787	TRFE_HUMAN	transferrin precursor						cellular iron ion homeostasis|platelet activation|platelet degranulation|transferrin transport|transmembrane transport	apical plasma membrane|basal plasma membrane|coated pit|early endosome|endocytic vesicle|endosome membrane|extracellular region|late endosome|perinuclear region of cytoplasm|recycling endosome|stored secretory granule	ferric iron binding			ovary(1)|skin(1)	2					Aluminium(DB01370)|Bismuth(DB01402)|Iron Dextran(DB00893)	CACCTGGGAGAGGGGCCTGTGG	0.515													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	133779366	133779367	+	IGR	INS	-	A	A	rs147610491	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133779366_133779367insA								SLCO2A1 (30446 upstream) : RYK (96611 downstream)																							GGCTGGAATTCAACCCCTCTCC	0.525													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	138753842	138753842	+	IGR	DEL	A	-	-	rs36117665		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:138753842delA								PRR23B (14074 upstream) : PRR23C (7102 downstream)																							attgaaggacagcttggttgc	0.005													5	3	---	---	---	---	
RASA2	5922	broad.mit.edu	37	3	141275738	141275739	+	Intron	INS	-	A	A	rs142470754	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141275738_141275739insA	uc003etz.1	+						RASA2_uc010huq.1_Intron|RASA2_uc003eua.1_Intron|RASA2_uc011bnc.1_Intron	NM_006506	NP_006497	Q15283	RASA2_HUMAN	RAS p21 protein activator 2						intracellular signal transduction|negative regulation of Ras protein signal transduction	intracellular membrane-bounded organelle|intrinsic to internal side of plasma membrane|perinuclear region of cytoplasm	metal ion binding|Ras GTPase activator activity			ovary(2)|lung(2)|breast(1)|skin(1)	6						AAGCAAGGGAGAAAAAAAAAAC	0.411													4	3	---	---	---	---	
SIAH2	6478	broad.mit.edu	37	3	150460927	150460927	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150460927delT	uc003eyi.2	-							NM_005067	NP_005058	O43255	SIAH2_HUMAN	seven in absentia homolog 2						apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATAGACAATATTAACAACAGT	0.453													4	2	---	---	---	---	
MED12L	116931	broad.mit.edu	37	3	150828548	150828549	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150828548_150828549delTG	uc003eyp.2	+						MED12L_uc011bnz.1_Intron|MED12L_uc003eym.1_Intron|MED12L_uc003eyn.2_Intron|MED12L_uc003eyo.2_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			tatgtatgtttgtgtgtgtgtg	0.376													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163648896	163648896	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163648896delA								None (None upstream) : MIR1263 (240363 downstream)																							TTTGACTTCCAAAATAAATAA	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	164443359	164443359	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:164443359delG								MIR720 (384121 upstream) : SI (253328 downstream)																							aaactatactgggaatgcagg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	165827787	165827788	+	IGR	INS	-	T	T	rs140179447	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165827787_165827788insT								BCHE (272534 upstream) : None (None downstream)																							agagtggaacatttactagctg	0.020													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	166546610	166546610	+	IGR	DEL	C	-	-	rs139982211		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:166546610delC								BCHE (991357 upstream) : ZBBX (411471 downstream)																							acttgcccttcccccagaaaa	0.000													4	3	---	---	---	---	
NLGN1	22871	broad.mit.edu	37	3	173610366	173610366	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173610366delA	uc003fio.1	+						NLGN1_uc010hww.1_Intron|NLGN1_uc003fip.1_Intron	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1						calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			AAGGCAAACTAAAAAAAAAAA	0.159													5	3	---	---	---	---	
TBL1XR1	79718	broad.mit.edu	37	3	176767668	176767671	+	Intron	DEL	TTAC	-	-	rs35503291		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:176767668_176767671delTTAC	uc003fiw.3	-						TBL1XR1_uc003fix.3_Intron|TBL1XR1_uc011bpz.1_Intron	NM_024665	NP_078941	Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1						canonical Wnt receptor signaling pathway|cellular lipid metabolic process|chromatin modification|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|proteasomal ubiquitin-dependent protein catabolic process|transcription, DNA-dependent	spindle microtubule|transcriptional repressor complex	beta-catenin binding|histone binding|protein N-terminus binding|transcription corepressor activity|transcription regulatory region DNA binding			ovary(1)	1	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			CGGTTTGTTGTTACTAGTTAATAA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	177313145	177313145	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:177313145delC								TBL1XR1 (398097 upstream) : KCNMB2 (941079 downstream)																							TTGAGGGTAACCAGCAGGCCA	0.393													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	178160350	178160350	+	IGR	DEL	A	-	-	rs5854794		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178160350delA								None (None upstream) : KCNMB2 (93874 downstream)																							AACCAAGATCAAAAACACTCA	0.393													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181600968	181600969	+	IGR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181600968_181600969delAC								SOX2OT (141965 upstream) : ATP11B (910322 downstream)																							acgtgtgcatacacacacacac	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	191271227	191271228	+	IGR	DEL	TC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:191271227_191271228delTC								PYDC2 (91984 upstream) : FGF12 (588456 downstream)																							AAATACTTGTTCAGACAGGATG	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192470454	192470454	+	IGR	DEL	C	-	-	rs11299530		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192470454delC								FGF12 (25066 upstream) : C3orf59 (44153 downstream)																							aaaaaaaaaacaaagtctcgc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	192855753	192855754	+	IGR	INS	-	CT	CT	rs151327730	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192855753_192855754insCT								C3orf59 (219803 upstream) : HRASLS (103164 downstream)																							caggctctaggctcagagacac	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	194551138	194551138	+	IGR	DEL	G	-	-	rs11293916		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194551138delG								FAM43A (141374 upstream) : C3orf21 (237877 downstream)																							AACAGTTCTTGGGGGGAGTGG	0.453													4	2	---	---	---	---	
DLG1	1739	broad.mit.edu	37	3	196922700	196922701	+	Intron	INS	-	A	A	rs148164861	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196922700_196922701insA	uc003fxo.3	-						DLG1_uc011bud.1_Intron|DLG1_uc003fxn.3_Intron|DLG1_uc011bue.1_Intron|DLG1_uc010ial.2_Intron|DLG1_uc011buf.1_Intron|DLG1_uc003fxp.2_Intron|DLG1_uc010iam.1_Intron	NM_001098424	NP_001091894	Q12959	DLG1_HUMAN	discs, large homolog 1 isoform 1						actin filament organization|axon guidance|cell-cell adhesion|cortical actin cytoskeleton organization|endothelial cell proliferation|establishment or maintenance of cell polarity|interspecies interaction between organisms|mitotic cell cycle G1/S transition checkpoint|negative regulation of mitotic cell cycle|protein localization in plasma membrane|synaptic transmission|tight junction assembly	basolateral plasma membrane|cytosol|endoplasmic reticulum membrane|immunological synapse|MPP7-DLG1-LIN7 complex|nucleus|postsynaptic density|postsynaptic membrane|sarcolemma|tight junction	cytoskeletal protein binding|guanylate kinase activity|L27 domain binding|phosphatase binding|phosphoprotein phosphatase activity|potassium channel regulator activity|protein binding|protein C-terminus binding|protein kinase binding			ovary(3)	3	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		ctcagtgacaccaatttaccca	0.079													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3601952	3601952	+	IGR	DEL	T	-	-	rs67516442		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3601952delT								LRPAP1 (67728 upstream) : ADRA2C (166123 downstream)																							CATTCCTTACTTTTTTTTAGC	0.562													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3619299	3619300	+	IGR	INS	-	CCTT	CCTT	rs144281803	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3619299_3619300insCCTT								LRPAP1 (85075 upstream) : ADRA2C (148775 downstream)																							tccttcccctcccttcttccct	0.000													5	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	7133058	7133059	+	IGR	INS	-	GT	GT	rs143352846		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:7133058_7133059insGT								FLJ36777 (27955 upstream) : SORCS2 (61315 downstream)																							gtgtgaatgtggtgttgtgtgg	0.000													2	4	---	---	---	---	
SH3TC1	54436	broad.mit.edu	37	4	8205004	8205005	+	Intron	INS	-	GT	GT	rs144236288	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:8205004_8205005insGT	uc003gkv.3	+						SH3TC1_uc003gkw.3_Intron|SH3TC1_uc003gkx.3_Intron	NM_018986	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1								binding			large_intestine(2)|pancreas(1)	3						tgtgcgggtgcgtgtgtgtgtg	0.302													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	9582404	9582405	+	IGR	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:9582404_9582405delCA								MIR548I2 (24467 upstream) : DRD5 (200853 downstream)																							catgtccggccacacagcagtt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	14449324	14449325	+	IGR	INS	-	GT	GT	rs112527762		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:14449324_14449325insGT								BOD1L (819996 upstream) : CPEB2 (556197 downstream)																							GTGGTGGTGGGgtgtgtgtgtg	0.416													4	2	---	---	---	---	
TAPT1	202018	broad.mit.edu	37	4	16174453	16174454	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16174453_16174454insT	uc010ied.1	-						TAPT1_uc011bxd.1_Intron|TAPT1_uc011bxe.1_Intron	NM_153365	NP_699196	Q6NXT6	TAPT1_HUMAN	transmembrane anterior posterior transformation							integral to membrane	growth hormone-releasing hormone receptor activity				0						tgtttttgttgttttttttttt	0.149													4	2	---	---	---	---	
LDB2	9079	broad.mit.edu	37	4	16816159	16816159	+	Intron	DEL	C	-	-	rs141603338		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:16816159delC	uc003goz.2	-						LDB2_uc003gpa.2_Intron|LDB2_uc003gpb.2_Intron|LDB2_uc011bxh.1_Intron|LDB2_uc010iee.2_Intron	NM_001290	NP_001281	O43679	LDB2_HUMAN	LIM domain binding 2 isoform a								LIM domain binding|transcription cofactor activity				0						atatgagcaacccctgtaatc	0.114													2	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	18466650	18466653	+	IGR	DEL	ACAC	-	-	rs113918627		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:18466650_18466653delACAC								LCORL (443265 upstream) : None (None downstream)																							atgtacacatacacacacacacac	0.206													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	20780480	20780480	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20780480delA	uc003gqe.2	-						KCNIP4_uc003gqf.1_Intron|KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqh.1_Intron|KCNIP4_uc003gqi.1_Intron|KCNIP4_uc010iel.2_Intron|KCNIP4_uc003gqd.3_Intron	NM_147182	NP_671711	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 3							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				atagttagagagagctgtgtg	0.119													4	2	---	---	---	---	
KCNIP4	80333	broad.mit.edu	37	4	21425432	21425432	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:21425432delT	uc003gqh.1	-						KCNIP4_uc003gqg.1_Intron|KCNIP4_uc003gqi.1_Intron	NM_001035003	NP_001030175	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4 isoform 5							plasma membrane	calcium ion binding|potassium channel activity|protein binding|voltage-gated ion channel activity				0		Breast(46;0.134)				CTTATGAGAAttttttttttt	0.179													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	26465641	26465641	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:26465641delT								RBPJ (32363 upstream) : CCKAR (17377 downstream)																							CATTCATCCCTTTTAGTTTCC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38215058	38215058	+	IGR	DEL	T	-	-	rs36007424		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38215058delT								TBC1D1 (74265 upstream) : FLJ13197 (399264 downstream)																							AAGGGTAAGATTTTTTTTTTT	0.388													3	3	---	---	---	---	
LIMCH1	22998	broad.mit.edu	37	4	41373663	41373664	+	Intron	INS	-	T	T	rs146118609	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:41373663_41373664insT	uc003gvu.3	+						LIMCH1_uc003gvt.1_Intron|LIMCH1_uc003gvv.3_Intron|LIMCH1_uc003gvw.3_Intron|LIMCH1_uc003gvx.3_Intron|LIMCH1_uc003gwe.3_Intron	NM_014988	NP_055803	Q9UPQ0	LIMC1_HUMAN	LIM and calponin homology domains 1 isoform a						actomyosin structure organization		actin binding|zinc ion binding			ovary(2)|pancreas(1)|skin(1)	4						CTGCTGCCCCCGTCCCAGTTTG	0.485													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49133539	49133548	+	IGR	DEL	CACTCGGGTA	-	-	rs142760702		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49133539_49133548delCACTCGGGTA								CWH43 (69446 upstream) : None (None downstream)																							cattccattccactcgggtagattccattc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	55304853	55304853	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55304853delT								PDGFRA (140442 upstream) : KIT (219242 downstream)																							acccaccacattttctttatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	55682204	55682204	+	IGR	DEL	T	-	-	rs111446864		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55682204delT								KIT (75325 upstream) : KDR (262223 downstream)																							tcctagaaaatttttttttca	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	57718514	57718515	+	IGR	INS	-	T	T	rs71657228		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:57718514_57718515insT								SPINK2 (30621 upstream) : REST (55527 downstream)																							ATGCCAGTGGAttttttttttt	0.208													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	58952676	58952677	+	IGR	INS	-	T	T	rs146575316	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:58952676_58952677insT								IGFBP7 (976137 upstream) : None (None downstream)																							ACTATAGCTTCTTTTTTTATTT	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	68049882	68049882	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68049882delT								MIR1269 (907236 upstream) : CENPC1 (288107 downstream)																							cccctgaaaattatctactca	0.000													4	2	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81851513	81851513	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81851513delC	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						ctgtgagctgccgtagcaagt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	94780599	94780599	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94780599delA								ATOH1 (29457 upstream) : SMARCAD1 (348160 downstream)																							caacaacaacaaaaaaaaaaa	0.000													7	4	---	---	---	---	
TSPAN5	10098	broad.mit.edu	37	4	99436664	99436665	+	Intron	DEL	CT	-	-	rs72287095		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99436664_99436665delCT	uc003hub.2	-						TSPAN5_uc011cdz.1_Intron	NM_005723	NP_005714	P62079	TSN5_HUMAN	transmembrane 4 superfamily member 9							integral to membrane					0				OV - Ovarian serous cystadenocarcinoma(123;1.89e-07)		TGATCAGAGGctctctctctct	0.381													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	114704632	114704633	+	IGR	INS	-	TC	TC	rs138406764	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114704632_114704633insTC								CAMK2D (21549 upstream) : ARSJ (116807 downstream)																							atgtgactcagtctctctctct	0.000													3	3	---	---	---	---	
NDST4	64579	broad.mit.edu	37	4	115978512	115978513	+	Intron	INS	-	AGA	AGA	rs141844452	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:115978512_115978513insAGA	uc003ibu.2	-						NDST4_uc010imw.2_Intron	NM_022569	NP_072091	Q9H3R1	NDST4_HUMAN	heparan sulfate N-deacetylase/N-sulfotransferase							Golgi membrane|integral to membrane	[heparan sulfate]-glucosamine N-sulfotransferase activity|hydrolase activity			skin(3)|ovary(1)	4		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		gccagagagagaaaaggagaaa	0.104													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	130240382	130240384	+	IGR	DEL	CTT	-	-	rs138939095	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:130240382_130240384delCTT								C4orf33 (206540 upstream) : None (None downstream)																							cctcctcctccttcttcttcttc	0.000													4	2	---	---	---	---	
MAML3	55534	broad.mit.edu	37	4	140977061	140977061	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:140977061delA	uc003ihz.1	-						MAML3_uc011chd.1_Intron	NM_018717	NP_061187	Q96JK9	MAML3_HUMAN	mastermind-like 3						Notch signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear speck	transcription coactivator activity			ovary(1)	1	all_hematologic(180;0.162)					CAGTACCTATAAAAGACATTA	0.234													4	2	---	---	---	---	
ARHGAP10	79658	broad.mit.edu	37	4	148729477	148729477	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:148729477delT	uc003ilf.2	+						ARHGAP10_uc003ile.1_Intron	NM_024605	NP_078881	A1A4S6	RHG10_HUMAN	Rho GTPase activating protein 10						apoptosis|filopodium assembly|regulation of apoptosis|small GTPase mediated signal transduction	cytosol|perinuclear region of cytoplasm|plasma membrane	cytoskeletal adaptor activity|SH3 domain binding			skin(2)|pancreas(1)|lung(1)	4	all_hematologic(180;0.151)	Renal(17;0.0166)		GBM - Glioblastoma multiforme(119;0.0423)		aactttggcattttttttttt	0.070													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	152956938	152956939	+	IGR	INS	-	CCC	CCC	rs151201324	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:152956938_152956939insCCC								PET112L (274792 upstream) : FBXW7 (285472 downstream)																							GTTTGCAAGTGCCCTGCATGGC	0.292													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	156573936	156573939	+	IGR	DEL	AGAC	-	-	rs144703774		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:156573936_156573939delAGAC								MAP9 (275814 upstream) : GUCY1A3 (13923 downstream)																							gtgaagatggagacagggactaga	0.000													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	167315960	167315961	+	IGR	INS	-	GATA	GATA	rs140452900	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:167315960_167315961insGATA								TLL1 (290967 upstream) : SPOCK3 (338575 downstream)																							caatgtgagatgatatgttaac	0.000													3	3	---	---	---	---	
PALLD	23022	broad.mit.edu	37	4	169819991	169819991	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169819991delT	uc011cjx.1	+						CBR4_uc011cjy.1_Intron|PALLD_uc003iru.2_Intron|PALLD_uc003irv.2_Intron|PALLD_uc003irw.2_Intron|PALLD_uc003irx.2_Intron	NM_016081	NP_057165	Q8WX93	PALLD_HUMAN	palladin isoform 2						cytoskeleton organization	actin filament|focal adhesion|lamellipodium|nucleus|ruffle|sarcomere	actin binding|muscle alpha-actinin binding			ovary(1)	1		Prostate(90;0.00996)|Renal(120;0.0203)|Melanoma(52;0.144)		GBM - Glioblastoma multiforme(119;0.204)		ATATAAAGGGTTTTAAATATT	0.393									Pancreatic_Cancer_Familial_Clustering_of				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	181686631	181686632	+	IGR	DEL	TT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:181686631_181686632delTT								None (None upstream) : None (None downstream)																							AATAAACAGATTTAGAATCACT	0.198													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	185425404	185425405	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:185425404_185425405insA								IRF2 (29678 upstream) : CASP3 (123447 downstream)																							CCTCGAGTGCCAGGGTGGCAGA	0.530													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190614967	190614968	+	IGR	INS	-	AGCA	AGCA	rs147138340		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190614967_190614968insAGCA								None (None upstream) : FRG1 (247006 downstream)																							gtgcagtgagcagcaggactta	0.119													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190615855	190615856	+	IGR	INS	-	TC	TC	rs146855852		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190615855_190615856insTC								None (None upstream) : FRG1 (246118 downstream)																							aattggtgggttcttggtctca	0.005													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190638976	190638977	+	IGR	DEL	AC	-	-	rs72085475		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190638976_190638977delAC								None (None upstream) : FRG1 (222997 downstream)																							aacaagacagacaaaattctcA	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	190808154	190808154	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:190808154delA	uc003izq.2	-											Homo sapiens cDNA clone IMAGE:30384438.																		AAACATTATCAGGGGCCAGCT	0.338													4	2	---	---	---	---	
LRRC14B	389257	broad.mit.edu	37	5	190459	190460	+	5'Flank	INS	-	CT	CT	rs150691545	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:190459_190460insCT	uc003jal.1	+							NM_001080478	NP_001073947	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B											skin(1)	1						tctgtctccccgtctgtctgtc	0.272													2	4	---	---	---	---	
SLC12A7	10723	broad.mit.edu	37	5	1052736	1052740	+	Intron	DEL	GAGCA	-	-	rs142533833		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1052736_1052740delGAGCA	uc003jbu.2	-							NM_006598	NP_006589	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride						potassium ion transport|sodium ion transport	integral to plasma membrane	potassium:chloride symporter activity			skin(2)|large_intestine(1)|ovary(1)	4	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	AGGCGGGGAGGAGCAGGGCAGGGGA	0.605													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	4003068	4003068	+	IGR	DEL	A	-	-	rs67074237		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:4003068delA								IRX1 (401552 upstream) : None (None downstream)																							GCACTGGTACAAGCCATACAT	0.428													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	8050588	8050589	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:8050588_8050589insA								MTRR (149355 upstream) : SEMA5A (984549 downstream)																							ggaaggaaaggaaggaaagaag	0.000													4	2	---	---	---	---	
CTNND2	1501	broad.mit.edu	37	5	11311389	11311393	+	Intron	DEL	CCTCA	-	-	rs72483583		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:11311389_11311393delCCTCA	uc003jfa.1	-						CTNND2_uc010itt.2_Intron|CTNND2_uc011cmy.1_Intron|CTNND2_uc011cmz.1_Intron|CTNND2_uc010itu.1_Intron|CTNND2_uc011cmx.1_Intron	NM_001332	NP_001323	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2						multicellular organismal development|neuron cell-cell adhesion|regulation of transcription, DNA-dependent|signal transduction|transcription, DNA-dependent	adherens junction|cytoplasm|nucleus	protein binding			large_intestine(2)|ovary(2)|skin(2)|pancreas(1)|lung(1)	8						ctccatgcaccctcacctcacatgc	0.088													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	14129221	14129221	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14129221delG								DNAH5 (184632 upstream) : TRIO (14608 downstream)																							CCAAGGTTGTGAAGAACTAGG	0.453													4	2	---	---	---	---	
TRIO	7204	broad.mit.edu	37	5	14184853	14184853	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14184853delA	uc003jff.2	+						TRIO_uc003jfg.2_Intron|TRIO_uc011cna.1_Intron	NM_007118	NP_009049	O75962	TRIO_HUMAN	triple functional domain (PTPRF interacting)						apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|transmembrane receptor protein tyrosine phosphatase signaling pathway	cytosol	ATP binding|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity			skin(4)|central_nervous_system(3)|ovary(3)|large_intestine(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|kidney(1)	18	Lung NSC(4;0.000742)					GGTGTTTCAGAAAAAAAATGA	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	15032201	15032201	+	IGR	DEL	T	-	-	rs74311285		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15032201delT								ANKH (160314 upstream) : FBXL7 (468104 downstream)																							ACAGAAACAGTTAACTGTAAG	0.279													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	17713033	17713033	+	IGR	DEL	G	-	-	rs141578367		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:17713033delG								BASP1 (436098 upstream) : None (None downstream)																							ccttgctttaggggagactat	0.055													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	23643778	23643778	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:23643778delG								PRDM9 (115074 upstream) : CDH10 (843432 downstream)																							atgctgttttggttactgtag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27236941	27236941	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27236941delT								CDH9 (198252 upstream) : None (None downstream)																							ATATCCTGAGTTTTCTGGACA	0.318													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	27962934	27962934	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:27962934delA								CDH9 (924245 upstream) : None (None downstream)																							taaaacaggcaatctgacttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	33111479	33111480	+	IGR	DEL	GT	-	-	rs10544573		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33111479_33111480delGT								C5orf23 (319660 upstream) : TARS (329322 downstream)																							attaaataaggtgtgtgtgtgt	0.198													4	3	---	---	---	---	
WDR70	55100	broad.mit.edu	37	5	37379190	37379190	+	5'Flank	DEL	A	-	-	rs35727443		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37379190delA	uc003jkv.2	+						WDR70_uc010iva.1_5'Flank	NM_018034	NP_060504	Q9NW82	WDR70_HUMAN	WD repeat domain 70											ovary(1)|central_nervous_system(1)	2	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			gctctggcttaaaaaaaaaaa	0.229													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	38665206	38665207	+	Intron	DEL	CA	-	-	rs79965106		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:38665206_38665207delCA	uc003jlj.2	+											Homo sapiens cDNA clone IMAGE:4829282.																		AGTGCGTGCGcacacacacaca	0.416													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	39947737	39947738	+	IGR	DEL	AC	-	-	rs34755185		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:39947737_39947738delAC								DAB2 (522402 upstream) : PTGER4 (732294 downstream)																							acacacacagacacacacacTA	0.277													4	2	---	---	---	---	
FBXO4	26272	broad.mit.edu	37	5	41937006	41937007	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:41937006_41937007insT	uc003jmq.2	+						FBXO4_uc003jmr.2_Intron	NM_012176	NP_036308	Q9UKT5	FBX4_HUMAN	F-box only protein 4 isoform 1						positive regulation of protein ubiquitination|protein polyubiquitination|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process|telomere maintenance|ubiquitin-dependent protein catabolic process	cytoplasm|SCF ubiquitin ligase complex	protein binding|protein homodimerization activity|ubiquitin-protein ligase activity			liver(1)	1		Lung NSC(810;4.15e-05)|Breast(839;0.00093)|Ovarian(839;0.00965)|Myeloproliferative disorder(839;0.0255)|all_neural(839;0.0604)				cagtttttttgtttttttttta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	49536652	49536653	+	IGR	INS	-	T	T	rs77251900		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:49536652_49536653insT								None (None upstream) : EMB (155380 downstream)																							cttctgtctagtttttatgtga	0.000													3	3	---	---	---	---	
PDE4D	5144	broad.mit.edu	37	5	58511378	58511379	+	Intron	INS	-	GT	GT	rs139193497	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:58511378_58511379insGT	uc003jsa.2	-						PDE4D_uc003jrx.2_Intron|PDE4D_uc003jry.2_Intron|PDE4D_uc003jrz.2_Intron|PDE4D_uc003jsb.2_Intron|PDE4D_uc003jsc.2_Intron|PDE4D_uc003jrv.2_Intron|PDE4D_uc003jrw.2_Intron|PDE4D_uc010iwi.1_Intron	NM_001104631	NP_001098101	Q08499	PDE4D_HUMAN	phosphodiesterase 4D isoform 1						signal transduction	cytosol|insoluble fraction|membrane|microtubule organizing center|soluble fraction	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding			breast(1)|central_nervous_system(1)	2		all_cancers(5;6.5e-58)|all_epithelial(5;1.75e-57)|all_lung(5;6.84e-18)|Lung NSC(5;1.29e-17)|Melanoma(5;0.00168)|Prostate(74;0.00234)|Colorectal(97;0.00629)|Ovarian(174;0.00832)|Breast(144;0.00996)|all_hematologic(6;0.0344)|Hepatocellular(6;0.0742)|Esophageal squamous(6;0.0954)		Epithelial(2;2.6e-55)|all cancers(2;2.66e-49)|OV - Ovarian serous cystadenocarcinoma(10;1.48e-39)|Colorectal(2;8.29e-08)|Lung(2;4.47e-07)|STAD - Stomach adenocarcinoma(2;1.11e-05)|COAD - Colon adenocarcinoma(2;0.00012)|LUSC - Lung squamous cell carcinoma(2;0.000775)|LUAD - Lung adenocarcinoma(3;0.0173)|READ - Rectum adenocarcinoma(2;0.0276)	Adenosine monophosphate(DB00131)|Dyphylline(DB00651)	TAAATACAtgcgtgtgtgtgtg	0.213													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	67744423	67744424	+	IGR	INS	-	A	A	rs139040959	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:67744423_67744424insA								PIK3R1 (146776 upstream) : SLC30A5 (645394 downstream)																							CTCCTCCCCCTGACCACTATAT	0.515													6	5	---	---	---	---	
GPR98	84059	broad.mit.edu	37	5	89947156	89947156	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89947156delA	uc003kju.2	+						GPR98_uc003kjt.2_Intron	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor						cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATTTGTAACTAAAAAAAATGG	0.259													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	104305144	104305145	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:104305144_104305145insA	uc003koj.1	-											full-length cDNA clone CS0DI081YP23 of Placenta Cot 25-normalized of Homo sapiens (human).																		GTGAGGTTGATAAAAAAATTGG	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	126088192	126088193	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:126088192_126088193insA								C5orf48 (116218 upstream) : LMNB1 (24640 downstream)																							CTACCCAGGACAAAAAAAAAAA	0.267													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	128654141	128654141	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128654141delT								ISOC1 (204424 upstream) : ADAMTS19 (141962 downstream)																							tcttcttcaattttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	138003623	138003624	+	IGR	DEL	AA	-	-	rs28445417	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:138003623_138003624delAA								HSPA9 (92508 upstream) : CTNNA1 (85483 downstream)																							agaaagaaagaaagagagagag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	143284086	143284086	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:143284086delT								HMHB1 (83804 upstream) : YIPF5 (253645 downstream)																							tatattttgattttttttttt	0.000													4	2	---	---	---	---	
PPARGC1B	133522	broad.mit.edu	37	5	149133874	149133874	+	Intron	DEL	G	-	-	rs78753619		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:149133874delG	uc003lrc.2	+						PPARGC1B_uc003lrb.1_Intron|PPARGC1B_uc003lrd.2_Intron	NM_133263	NP_573570	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor						estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter	mediator complex	AF-2 domain binding|estrogen receptor binding|ligand-dependent nuclear receptor transcription coactivator activity|nucleotide binding|receptor activator activity|RNA binding|RNA polymerase II transcription cofactor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TCCTTCTTGCGTGCCCCCCTC	0.323													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	159597477	159597477	+	IGR	DEL	A	-	-	rs112870298		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:159597477delA								PWWP2A (51025 upstream) : FABP6 (16897 downstream)																							cctctctaccaaaaataaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	166705626	166705626	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:166705626delT								None (None upstream) : ODZ2 (6217 downstream)																							agttgctgcattgtacatacg	0.000													4	2	---	---	---	---	
C5orf25	375484	broad.mit.edu	37	5	175725864	175725864	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:175725864delA	uc003mds.3	+						C5orf25_uc003mdt.3_Intron|C5orf25_uc003mdr.3_Intron|C5orf25_uc011dfk.1_Intron			Q8NDZ2	CE025_HUMAN	RecName: Full=Uncharacterized protein C5orf25;												0	all_cancers(89;0.00381)|Renal(175;0.000269)|Lung NSC(126;0.0122)|all_lung(126;0.0193)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	Kidney(146;0.119)		atgtcactacaaaaaaaatca	0.000													4	2	---	---	---	---	
CDYL	9425	broad.mit.edu	37	6	4927663	4927666	+	Intron	DEL	GTGT	-	-	rs67375014		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4927663_4927666delGTGT	uc003mwi.2	+						CDYL_uc003mwj.2_Intron|CDYL_uc003mwk.2_Intron|CDYL_uc011dhx.1_Intron|CDYL_uc011dhy.1_Intron	NM_001143971	NP_001137443	Q9Y232	CDYL1_HUMAN	chromodomain protein, Y chromosome-like isoform						regulation of transcription, DNA-dependent|spermatogenesis|transcription, DNA-dependent	nucleus	histone acetyltransferase activity				0	Ovarian(93;0.11)	all_hematologic(90;0.0901)|Lung NSC(90;0.244)		OV - Ovarian serous cystadenocarcinoma(45;0.182)		TTTACtgtacgtgtgtgtgtgtgt	0.127													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	8119523	8119523	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:8119523delA								EEF1E1 (16695 upstream) : SLC35B3 (292210 downstream)																							ccgtctcaagaaaaaaaaaaa	0.194													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	15147014	15147015	+	IGR	INS	-	T	T	rs112558126		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:15147014_15147015insT								None (None upstream) : JARID2 (98719 downstream)																							ATGGAGTCCTAttttttttttt	0.223													3	3	---	---	---	---	
GMPR	2766	broad.mit.edu	37	6	16276303	16276304	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:16276303_16276304insA	uc003nbs.2	+							NM_006877	NP_006868	P36959	GMPR1_HUMAN	guanosine monophosphate reductase						nucleotide metabolic process|purine base metabolic process|purine-containing compound salvage|response to cold	cytosol	GMP reductase activity|metal ion binding			ovary(1)	1	Breast(50;0.0427)|Ovarian(93;0.103)	all_hematologic(90;0.0895)				cctgtctcaagaaaaaaaaaag	0.203													4	2	---	---	---	---	
DEK	7913	broad.mit.edu	37	6	18249242	18249243	+	Intron	DEL	CA	-	-	rs139796206		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:18249242_18249243delCA	uc003ncr.1	-						DEK_uc011djf.1_Intron|DEK_uc011djg.1_Intron	NM_003472	NP_003463	P35659	DEK_HUMAN	DEK oncogene isoform 1						chromatin modification|regulation of transcription from RNA polymerase II promoter|signal transduction|transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|histone binding			kidney(1)	1	Ovarian(93;0.00769)|Breast(50;0.0495)	all_hematologic(90;0.053)	OV - Ovarian serous cystadenocarcinoma(7;0.00291)|all cancers(50;0.031)|Epithelial(50;0.0332)			CTCCTGTACCCACTCTCCATGA	0.366			T	NUP214	AML								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	29207946	29207946	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29207946delC								OR2J2 (65596 upstream) : OR14J1 (66521 downstream)																							aagaaggggtccagtttcagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	35511247	35511247	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35511247delT								TULP1 (30600 upstream) : FKBP5 (30115 downstream)																							TGAGTGATTGTTTTTTTCCTC	0.139													4	2	---	---	---	---	
UNC5CL	222643	broad.mit.edu	37	6	41006667	41006667	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41006667delC	uc003opi.2	-						UNC5CL_uc010jxe.1_Intron	NM_173561	NP_775832	Q8IV45	UN5CL_HUMAN	unc-5 homolog C-like						signal transduction	cytoplasm|integral to membrane				ovary(2)	2	Ovarian(28;0.0418)|Colorectal(47;0.196)					ATGGTCCAAACCCAAGTCATG	0.483											OREG0017424	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
TRERF1	55809	broad.mit.edu	37	6	42268880	42268880	+	Intron	DEL	G	-	-	rs35574294		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42268880delG	uc003osd.2	-						TRERF1_uc003osb.2_Intron|TRERF1_uc003osc.2_Intron|TRERF1_uc003ose.2_Intron|TRERF1_uc010jxu.1_Intron	NM_033502	NP_277037	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1						cholesterol catabolic process|homeostatic process|multicellular organismal development|positive regulation of transcription, DNA-dependent|regulation of hormone biosynthetic process|steroid biosynthetic process	nucleus	DNA bending activity|ligand-dependent nuclear receptor transcription coactivator activity|RNA polymerase II transcription cofactor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding|zinc ion binding			ovary(3)|pancreas(1)|skin(1)	5	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CTTTCCTCATGGGGGAGCTAC	0.229													1	5	---	---	---	---	
TJAP1	93643	broad.mit.edu	37	6	43445071	43445072	+	5'Flank	INS	-	TT	TT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43445071_43445072insTT	uc003ovd.2	+						TJAP1_uc003ovf.2_5'Flank|TJAP1_uc003ove.2_5'Flank|TJAP1_uc003ovc.2_5'Flank|TJAP1_uc010jyp.2_5'Flank|TJAP1_uc011dvh.1_5'Flank	NM_001146016	NP_001139488	Q5JTD0	TJAP1_HUMAN	tight junction associated protein 1 isoform a							Golgi apparatus|tight junction	protein binding				0	all_lung(25;0.00536)		Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0122)|OV - Ovarian serous cystadenocarcinoma(102;0.0804)			TTCCCCTATTCTTTTTTTTTTT	0.455													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	53218726	53218726	+	IGR	DEL	G	-	-	rs11285148		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53218726delG								ELOVL5 (4784 upstream) : GCLC (143414 downstream)																							tttctccttagcacttaacat	0.000													2	4	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57357807	57357808	+	Intron	INS	-	AGG	AGG	rs10693664		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57357807_57357808insAGG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TTGTAATAAAAAGCATTAATAC	0.287													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57380158	57380163	+	Intron	DEL	TACTTT	-	-	rs147894615		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57380158_57380163delTACTTT	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TAGATATATCTACTTTTACTTAGCCA	0.286													4	2	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57400857	57400860	+	Intron	DEL	ACAC	-	-	rs67833639		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57400857_57400860delACAC	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		TCTGTCACTTACACACACATGCac	0.206													3	3	---	---	---	---	
PRIM2	5558	broad.mit.edu	37	6	57475370	57475371	+	Intron	INS	-	GGAG	GGAG	rs112647916		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57475370_57475371insGGAG	uc003pdx.2	+							NM_000947	NP_000938	P49643	PRI2_HUMAN	DNA primase polypeptide 2						DNA replication, synthesis of RNA primer|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle|telomere maintenance via recombination|telomere maintenance via semi-conservative replication	alpha DNA polymerase:primase complex|nucleoplasm	4 iron, 4 sulfur cluster binding|DNA binding|DNA primase activity|metal ion binding				0				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		AAGTAAAGTAAGGTCATCAGCT	0.381													11	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57524230	57524231	+	IGR	INS	-	CAA	CAA	rs150481877		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57524230_57524231insCAA								PRIM2 (10855 upstream) : GUSBL2 (721928 downstream)																							ggaagtgggacctttgggaggt	0.000													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57538651	57538652	+	IGR	DEL	GC	-	-	rs141707943		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57538651_57538652delGC								PRIM2 (25276 upstream) : GUSBL2 (707507 downstream)																							TCACCAGTGGGCTATTGAATTA	0.401													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57563307	57563307	+	IGR	DEL	G	-	-	rs67382068		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57563307delG								PRIM2 (49932 upstream) : GUSBL2 (682852 downstream)																							GGAGAAATTAGCCTTCAGGAT	0.328													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57564479	57564480	+	IGR	INS	-	A	A	rs33964245		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57564479_57564480insA								PRIM2 (51104 upstream) : GUSBL2 (681679 downstream)																							tttcaagtgccacaggataaaa	0.079													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57565371	57565372	+	IGR	INS	-	CTA	CTA	rs149489760		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57565371_57565372insCTA								PRIM2 (51996 upstream) : GUSBL2 (680787 downstream)																							GAATCTGGACCCTACTAGTCAG	0.208													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57575464	57575464	+	IGR	DEL	A	-	-	rs68142183		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57575464delA								PRIM2 (62089 upstream) : GUSBL2 (670695 downstream)																							AGAAACCCATAAAAGATTGAC	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	57577557	57577558	+	IGR	INS	-	A	A	rs150323846	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:57577557_57577558insA								PRIM2 (64182 upstream) : GUSBL2 (668601 downstream)																							cttagcagtttaaagtccttgt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	63867187	63867188	+	IGR	INS	-	A	A	rs34616584		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:63867187_63867188insA								KHDRBS2 (871087 upstream) : LGSN (118669 downstream)																							ctccatctcagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TMEM30A	55754	broad.mit.edu	37	6	75997520	75997520	+	5'Flank	DEL	A	-	-	rs11307527		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75997520delA	uc003phw.2	-						TMEM30A_uc003phx.2_5'Flank|uc010kbd.1_Intron	NM_018247	NP_060717	Q9NV96	CC50A_HUMAN	transmembrane protein 30A isoform 1							integral to membrane					0						GGGCTGAGAGATGTGCCATAG	0.373													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	85892357	85892372	+	IGR	DEL	GAAAGCAATAAGATGA	-	-	rs149212324		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:85892357_85892372delGAAAGCAATAAGATGA								TBX18 (418458 upstream) : NT5E (266930 downstream)																							acgtggaagggaaagcaataagatgagaaagcaata	0.046													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	114293068	114293068	+	Intron	DEL	G	-	-	rs79061012	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114293068delG	uc003pwf.2	+						HDAC2_uc003pwc.1_5'Flank|HDAC2_uc003pwd.1_5'Flank|HDAC2_uc003pwe.1_5'Flank					Homo sapiens, clone IMAGE:5770470, mRNA.																		tataggtggaggcagattaag	0.000													4	2	---	---	---	---	
HS3ST5	222537	broad.mit.edu	37	6	114463159	114463160	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:114463159_114463160insT	uc003pwh.3	-						uc003pwf.2_Intron	NM_153612	NP_705840	Q8IZT8	HS3S5_HUMAN	heparan sulfate (glucosamine)						heparan sulfate proteoglycan biosynthetic process, enzymatic modification|negative regulation of coagulation|protein sulfation|regulation of virion penetration into host cell	Golgi membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity|protein binding			ovary(1)|pancreas(1)	2		all_cancers(87;0.0587)|Colorectal(196;0.0676)|all_epithelial(87;0.154)		OV - Ovarian serous cystadenocarcinoma(136;0.00937)|all cancers(137;0.0117)|Epithelial(106;0.0274)|GBM - Glioblastoma multiforme(226;0.143)		GTTCCATCTCATTTTTTTTTCC	0.351													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	117966884	117966884	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117966884delT								GOPC (43203 upstream) : NUS1 (29733 downstream)																							caggagtttcttttttttttt	0.000													6	3	---	---	---	---	
C6orf204	387119	broad.mit.edu	37	6	118860819	118860820	+	Intron	INS	-	A	A	rs149656340	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118860819_118860820insA	uc003pxz.1	-						C6orf204_uc003pya.1_Intron|C6orf204_uc003pyb.2_Intron|C6orf204_uc011ebj.1_Intron|C6orf204_uc003pyc.2_Intron	NM_001042475	NP_001035940	Q5SZL2	CF204_HUMAN	chromosome 6 open reading frame 204 isoform a							centrosome				breast(1)	1		all_cancers(87;0.0814)|all_epithelial(87;0.115)		GBM - Glioblastoma multiforme(226;0.0114)|all cancers(137;0.035)|OV - Ovarian serous cystadenocarcinoma(136;0.0618)		cttacataggtaaacctgtgcc	0.030													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	123479150	123479151	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:123479150_123479151insA								CLVS2 (94087 upstream) : TRDN (58332 downstream)																							AAATGCAAAGGAAAAAAAATAA	0.342													4	2	---	---	---	---	
NCOA7	135112	broad.mit.edu	37	6	126158389	126158392	+	Intron	DEL	TCAT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:126158389_126158392delTCAT	uc010kes.2	+						NCOA7_uc003qae.3_Intron|NCOA7_uc003qah.2_Intron|NCOA7_uc003qai.2_Intron|NCOA7_uc010ket.2_Intron|NCOA7_uc003qaf.2_Intron|NCOA7_uc003qag.2_Intron|NCOA7_uc003qaj.2_Intron	NM_181782	NP_861447	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7 isoform 1						cell wall macromolecule catabolic process|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			lung(2)|ovary(1)	3				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		AGTTTGTTTCtcattcattcattc	0.338													4	2	---	---	---	---	
C6orf174	387104	broad.mit.edu	37	6	127799798	127799798	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:127799798delT	uc003qbd.2	-						C6orf174_uc003qbc.2_5'Flank	NM_001012279	NP_001012279	Q5TF21	CF174_HUMAN	hypothetical protein LOC387104 precursor							integral to membrane				breast(3)|ovary(2)|skin(1)	6				GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.161)		GACGTGTGGATGAGATGTGTA	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	130953453	130953456	+	IGR	DEL	AATC	-	-	rs141559887		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:130953453_130953456delAATC								TMEM200A (189245 upstream) : LOC285733 (194868 downstream)																							AACTCATCTTAATCAGAGTAAATG	0.397													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	132747078	132747078	+	IGR	DEL	T	-	-	rs141345990		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:132747078delT								MOXD1 (24414 upstream) : STX7 (31585 downstream)																							TCCTTCGTTAttttttttttt	0.060													3	3	---	---	---	---	
RAB32	10981	broad.mit.edu	37	6	146863403	146863404	+	5'Flank	DEL	GT	-	-	rs113378653		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:146863403_146863404delGT	uc003qln.1	+							NM_006834	NP_006825	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family						protein transport|small GTPase mediated signal transduction	mitochondrion	GTP binding				0		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		cacgtattccgtgtgtgtgtgt	0.000													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	150596938	150596939	+	IGR	DEL	TT	-	-	rs66720559		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150596938_150596939delTT								PPP1R14C (25412 upstream) : IYD (93089 downstream)																							AAACCAGTGCtttttttttttt	0.228													3	3	---	---	---	---	
SYNE1	23345	broad.mit.edu	37	6	152725239	152725240	+	Intron	INS	-	AT	AT	rs143864698	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152725239_152725240insAT	uc010kiw.2	-						SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc010kjb.1_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		agatatatgagatatatatata	0.114										HNSCC(10;0.0054)			4	2	---	---	---	---	
CNKSR3	154043	broad.mit.edu	37	6	154742770	154742771	+	Intron	INS	-	AGTT	AGTT	rs139964029	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:154742770_154742771insAGTT	uc003qpy.2	-							NM_173515	NP_775786	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3						negative regulation of ERK1 and ERK2 cascade|negative regulation of peptidyl-serine phosphorylation|positive regulation of sodium ion transport	cytoplasm|membrane				ovary(2)|breast(1)|skin(1)	4		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		AAAACTCAGTCAGTCTTCTATT	0.267													2	4	---	---	---	---	
ARID1B	57492	broad.mit.edu	37	6	157141081	157141082	+	Intron	INS	-	G	G	rs151276933	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:157141081_157141082insG	uc003qqn.2	+						ARID1B_uc003qqo.2_Intron|ARID1B_uc003qqp.2_Intron	NM_017519	NP_059989	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)						chromatin-mediated maintenance of transcription|nervous system development|transcription, DNA-dependent	SWI/SNF complex	DNA binding|protein binding|transcription coactivator activity			ovary(1)|breast(1)	2		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CTGGCAGAGATGGGGGGTCCCA	0.465													3	3	---	---	---	---	
PARK2	5071	broad.mit.edu	37	6	162388314	162388315	+	Intron	INS	-	A	A	rs141772754	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:162388314_162388315insA	uc003qtx.3	-						PARK2_uc003qtv.3_Intron|PARK2_uc010kkd.2_Intron|PARK2_uc003qtw.3_Intron|PARK2_uc003qty.3_Intron|PARK2_uc003qtz.3_Intron|PARK2_uc010kke.1_Intron	NM_004562	NP_004553	O60260	PRKN2_HUMAN	parkin isoform 1						aggresome assembly|central nervous system development|mitochondrion degradation|negative regulation of actin filament bundle assembly|negative regulation of cell death|negative regulation of protein phosphorylation|negative regulation of release of cytochrome c from mitochondria|neuron death|positive regulation of I-kappaB kinase/NF-kappaB cascade|protein autoubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|protein monoubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of autophagy|regulation of reactive oxygen species metabolic process	aggresome|cytosol|endoplasmic reticulum|Golgi apparatus|mitochondrion|nucleus|perinuclear region of cytoplasm	chaperone binding|PDZ domain binding|protein kinase binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			upper_aerodigestive_tract(1)	1		all_cancers(1;8.13e-65)|all_epithelial(1;5.77e-64)|Colorectal(1;9.65e-15)|all_lung(1;1.66e-13)|Lung NSC(1;7.54e-11)|Melanoma(1;1.75e-09)|Breast(66;7.81e-05)|Ovarian(120;0.000981)|Prostate(117;0.0288)|Esophageal squamous(34;0.102)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0663)|all cancers(1;1.9e-63)|Epithelial(1;1.5e-59)|Colorectal(1;2.16e-23)|OV - Ovarian serous cystadenocarcinoma(65;3.53e-20)|COAD - Colon adenocarcinoma(1;2.11e-15)|STAD - Stomach adenocarcinoma(1;4.64e-07)|BRCA - Breast invasive adenocarcinoma(81;1.49e-06)|READ - Rectum adenocarcinoma(1;2.95e-06)|GBM - Glioblastoma multiforme(2;7.23e-06)|Lung(1;0.00163)|KIRC - Kidney renal clear cell carcinoma(4;0.00371)|LUSC - Lung squamous cell carcinoma(1;0.00442)|Kidney(4;0.0046)		ATTTGGTAGGCGCATCATTGCA	0.351													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	167846747	167846749	+	IGR	DEL	GGT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167846747_167846749delGGT								TCP10 (48749 upstream) : C6orf123 (338472 downstream)																							tgtggatggaggtggtggtggca	0.000													4	2	---	---	---	---	
SNX8	29886	broad.mit.edu	37	7	2355509	2355512	+	5'Flank	DEL	TCAC	-	-	rs62637761		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2355509_2355512delTCAC	uc003slw.2	-							NM_013321	NP_037453	Q9Y5X2	SNX8_HUMAN	sorting nexin 8						cell communication|early endosome to Golgi transport|intracellular protein transport	early endosome membrane	phosphatidylinositol binding|protein binding			large_intestine(1)|ovary(1)	2		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		ctgcattcattcactcactcacta	0.020													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	7332662	7332662	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:7332662delG								C1GALT1 (48683 upstream) : COL28A1 (65582 downstream)																							ACTTCTCTGTGGGATGATGGG	0.478													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	9020879	9020880	+	IGR	INS	-	A	A	rs144010203		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:9020879_9020880insA								NXPH1 (228287 upstream) : PER4 (653020 downstream)																							GAATTATGGTTAAAAAAAAAAA	0.401													4	3	---	---	---	---	
THSD7A	221981	broad.mit.edu	37	7	11452107	11452108	+	Intron	INS	-	A	A	rs145407573	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11452107_11452108insA	uc003ssf.3	-							NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A							integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TAGTGTTTACTAAAAAAAAAAC	0.322										HNSCC(18;0.044)			2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	18022952	18022953	+	IGR	INS	-	C	C	rs148432280	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18022952_18022953insC								SNX13 (42821 upstream) : PRPS1L1 (43449 downstream)																							ttcttcttcttttcttcttctt	0.124													4	4	---	---	---	---	
HOXA3	3200	broad.mit.edu	37	7	27162525	27162525	+	Intron	DEL	T	-	-	rs68048055		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27162525delT	uc003syk.2	-						uc003syl.2_Intron	NM_153631	NP_705895	O43365	HXA3_HUMAN	homeobox A3 isoform a						angiogenesis	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(2)	2						TTTTTCTTTCTTTTTTTTGGC	0.438													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	32426874	32426874	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:32426874delC								PDE1C (87933 upstream) : LSM5 (98071 downstream)																							tgaaaagtctccatgtctact	0.000													2	5	---	---	---	---	
ELMO1	9844	broad.mit.edu	37	7	37345049	37345050	+	Intron	INS	-	GT	GT	rs147003634	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37345049_37345050insGT	uc003tfk.1	-						ELMO1_uc010kxg.1_Intron	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1						actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						CAGTACAGATAgtgtgtgtgtg	0.277													3	4	---	---	---	---	
PKD1L1	168507	broad.mit.edu	37	7	47951526	47951526	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:47951526delA	uc003tny.1	-							NM_138295	NP_612152	Q8TDX9	PK1L1_HUMAN	polycystin-1L1						cell-cell adhesion	integral to membrane				ovary(8)|upper_aerodigestive_tract(2)|breast(1)	11						TGCTGTGAAGAAAAAAAAAAA	0.224													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	53927956	53927957	+	IGR	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:53927956_53927957insT								POM121L12 (823339 upstream) : HPVC1 (340960 downstream)																							ttgagattggcttttttttttt	0.000													3	3	---	---	---	---	
EGFR	1956	broad.mit.edu	37	7	55099211	55099212	+	Intron	INS	-	GA	GA	rs144333902	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55099211_55099212insGA	uc003tqk.2	+						EGFR_uc003tqh.2_Intron|EGFR_uc003tqi.2_Intron|EGFR_uc003tqj.2_Intron|EGFR_uc010kzg.1_Intron	NM_005228	NP_005219	P00533	EGFR_HUMAN	epidermal growth factor receptor isoform a						activation of phospholipase A2 activity by calcium-mediated signaling|activation of phospholipase C activity|axon guidance|cell proliferation|cell-cell adhesion|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|ossification|positive regulation of catenin import into nucleus|positive regulation of cell migration|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of epithelial cell proliferation|positive regulation of MAP kinase activity|positive regulation of nitric oxide biosynthetic process|positive regulation of phosphorylation|positive regulation of protein kinase B signaling cascade|protein autophosphorylation|protein insertion into membrane|regulation of nitric-oxide synthase activity|regulation of peptidyl-tyrosine phosphorylation|response to stress|response to UV-A	basolateral plasma membrane|endoplasmic reticulum membrane|endosome|extracellular space|Golgi membrane|integral to membrane|nuclear membrane|Shc-EGFR complex	actin filament binding|ATP binding|double-stranded DNA binding|epidermal growth factor receptor activity|identical protein binding|MAP/ERK kinase kinase activity|protein heterodimerization activity|protein phosphatase binding|receptor signaling protein tyrosine kinase activity			lung(9213)|central_nervous_system(103)|stomach(41)|upper_aerodigestive_tract(39)|prostate(32)|ovary(31)|thyroid(24)|breast(11)|peritoneum(9)|oesophagus(9)|salivary_gland(9)|large_intestine(8)|kidney(8)|urinary_tract(6)|skin(5)|adrenal_gland(5)|soft_tissue(4)|bone(3)|NS(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(2)|thymus(2)|liver(2)|eye(1)	9571	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)	CTGGTGTCAGGGAGAGAGTTGA	0.436		8	A|O|Mis		glioma|NSCLC	NSCLC			Lung_Cancer_Familial_Clustering_of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)			4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57811326	57811326	+	IGR	DEL	G	-	-	rs149979755		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57811326delG								ZNF716 (278061 upstream) : None (None downstream)																							ttatctttttgagacaggttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57958720	57958721	+	IGR	INS	-	C	C	rs145961031		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57958720_57958721insC								ZNF716 (425455 upstream) : None (None downstream)																							ctagacagaagagtcttggaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57959382	57959382	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57959382delA								ZNF716 (426117 upstream) : None (None downstream)																							atatcttcacaaaaaaacaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	57999863	57999863	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57999863delT								ZNF716 (466598 upstream) : None (None downstream)																							ttcttctgtctaatttttatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	61785748	61785749	+	IGR	INS	-	A	A	rs140519983		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:61785748_61785749insA								None (None upstream) : LOC643955 (965923 downstream)																							gactcgaatggataatcgaatg	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	64188668	64188669	+	IGR	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:64188668_64188669insT								ZNF107 (17269 upstream) : ZNF138 (66102 downstream)																							ggctgaaggtagggccccaatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	65226569	65226569	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:65226569delT	uc003tud.1	-						CCT6P1_uc003tug.2_Intron|CCT6P1_uc003tuh.2_Intron|CCT6P1_uc003tui.2_Intron					Homo sapiens hypothetical LOC441242, mRNA (cDNA clone MGC:87648 IMAGE:5267764), complete cds.																		gcccggccCCttttttttttt	0.149													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67009331	67009332	+	IGR	INS	-	TGTG	TGTG	rs147963250	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67009331_67009332insTGTG								STAG3L4 (222819 upstream) : None (None downstream)																							attatgctgtctgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	67527414	67527417	+	IGR	DEL	AAAG	-	-	rs141045309		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:67527414_67527417delAAAG								STAG3L4 (740902 upstream) : None (None downstream)																							aaaaaagaaaaaagaaagaaagaa	0.000													4	2	---	---	---	---	
WBSCR17	64409	broad.mit.edu	37	7	71164485	71164485	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71164485delA	uc003tvy.2	+						WBSCR17_uc003tvz.2_Intron	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide							Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				cccaaaaaacaaaaaaaaaac	0.000													4	2	---	---	---	---	
CALN1	83698	broad.mit.edu	37	7	71689355	71689355	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:71689355delT	uc003twa.3	-						CALN1_uc003twb.3_Intron|CALN1_uc003twc.3_Intron	NM_001017440	NP_001017440	Q9BXU9	CABP8_HUMAN	calneuron 1 isoform 2							Golgi apparatus|integral to membrane|perinuclear region of cytoplasm|plasma membrane	calcium ion binding			skin(1)	1		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				GAAGGCAAAATTTTTTTTGGA	0.373													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	75780214	75780215	+	IGR	INS	-	CAGT	CAGT	rs145244400	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75780214_75780215insCAGT								MDH2 (84286 upstream) : SRRM3 (51001 downstream)																							GTTAGATGGTGCAAATAAATAT	0.351													5	3	---	---	---	---	
SEMA3A	10371	broad.mit.edu	37	7	83723647	83723647	+	Intron	DEL	T	-	-	rs112563828		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83723647delT	uc003uhz.2	-							NM_006080	NP_006071	Q14563	SEM3A_HUMAN	semaphorin 3A precursor						axon guidance	extracellular region|membrane	receptor activity			ovary(2)|breast(1)|kidney(1)	4						AGTTTTTGCCTTTTTTTTTTT	0.318													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	93001811	93001812	+	IGR	DEL	GG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:93001811_93001812delGG								CCDC132 (13474 upstream) : CALCR (51987 downstream)																							gccaaggcttggggcttgcacc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	95315256	95315256	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95315256delA								PDK4 (89331 upstream) : DYNC1I1 (86562 downstream)																							gtaaagatagaaaataaactg	0.040													4	2	---	---	---	---	
DLX6AS	285987	broad.mit.edu	37	7	96627112	96627113	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:96627112_96627113delTG	uc003uok.2	-						DLX6AS_uc003uol.2_Intron|DLX6AS_uc010lfo.1_Intron					Homo sapiens cDNA FLJ34048 fis, clone FCBBF3000102.												0						CGTCCTAGGTtgtgtgtgtgtg	0.485													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	98897166	98897166	+	IGR	DEL	G	-	-	rs147592770	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98897166delG								MYH16 (1574 upstream) : ARPC1A (26344 downstream)																							GAGGCACTTCGGCTCAAGAAG	0.542													4	2	---	---	---	---	
GNB2	2783	broad.mit.edu	37	7	100274423	100274424	+	Splice_Site	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100274423_100274424delGT	uc003uwb.2	+	4	476	c.203_splice	c.e4+1	p.R68_splice	GNB2_uc003uwc.2_Splice_Site_p.R24_splice|GNB2_uc010lhd.2_Splice_Site_p.R24_splice|GNB2_uc010lhe.2_Splice_Site_p.R24_splice|GNB2_uc003uwd.2_Intron|GNB2_uc010lhf.2_Intron|GNB2_uc003uwe.2_Splice_Site_p.R68_splice|GNB2_uc003uwf.2_5'Flank	NM_005273	NP_005264	P62879	GBB2_HUMAN	guanine nucleotide-binding protein, beta-2						cellular response to glucagon stimulus|energy reserve metabolic process|G-protein coupled receptor protein signaling pathway|synaptic transmission	perinuclear region of cytoplasm|plasma membrane	GTPase activity|GTPase binding|signal transducer activity			ovary(2)	2	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)	Ovarian(593;0.238)				CCGACTCAAGGTGTGTGTGTGT	0.634													4	2	---	---	---	---	
EMID2	136227	broad.mit.edu	37	7	101079204	101079204	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101079204delG	uc010lhy.1	+						EMID2_uc003uyo.1_Intron	NM_133457	NP_597714	Q96A83	EMID2_HUMAN	EMI domain containing 2							collagen				ovary(1)	1	Lung NSC(181;0.215)					TCCCCCCTCTGGTTGGGTCGC	0.587													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	101241446	101241446	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:101241446delT								EMID2 (39142 upstream) : MYL10 (15160 downstream)																							TGGGTAGTCATTGGCCTTATT	0.552													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	110044192	110044193	+	IGR	INS	-	TT	TT	rs143451074	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110044192_110044193insTT								EIF3IP1 (443922 upstream) : IMMP2L (258917 downstream)																							cctatttacccttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	110132140	110132140	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110132140delA								EIF3IP1 (531870 upstream) : IMMP2L (170970 downstream)																							TTTTAAACATAAAAAAGGCAC	0.358													4	2	---	---	---	---	
CFTR	1080	broad.mit.edu	37	7	117189072	117189072	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117189072delT	uc003vjd.2	+						CFTR_uc011knq.1_Intron	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance						respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	CCTCATATTATTTTCAGTGGC	0.229									Cystic_Fibrosis				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	124383676	124383676	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:124383676delT								TMEM229A (710153 upstream) : GPR37 (2440 downstream)																							TCCATCTTTCTTGCTGCTTGA	0.368													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	125560488	125560488	+	IGR	DEL	C	-	-	rs113404656		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:125560488delC								POT1 (990451 upstream) : GRM8 (518164 downstream)																							cctctcgtatcccccccctcg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	127248051	127248054	+	IGR	DEL	ACAG	-	-	rs140546421		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127248051_127248054delACAG								FSCN3 (6208 upstream) : PAX4 (2292 downstream)																							gtacacacacacagacacacacac	0.167													4	3	---	---	---	---	
LRGUK	136332	broad.mit.edu	37	7	133948037	133948039	+	Intron	DEL	CTC	-	-	rs138429294		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:133948037_133948039delCTC	uc003vrm.1	+							NM_144648	NP_653249	Q96M69	LRGUK_HUMAN	leucine-rich repeats and guanylate kinase domain								ATP binding|kinase activity			lung(2)|skin(2)|kidney(1)	5						ATCTTCTAAACTCCTCCTGCTTC	0.458													2	4	---	---	---	---	
SLC13A4	26266	broad.mit.edu	37	7	135378313	135378313	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:135378313delG	uc003vta.2	-						SLC13A4_uc003vtb.2_Intron	NM_012450	NP_036582	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate							integral to plasma membrane	sodium:sulfate symporter activity				0						GTGTCTACCTGGATTGTTTTA	0.264													4	2	---	---	---	---	
TRIM24	8805	broad.mit.edu	37	7	138255389	138255390	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138255389_138255390insT	uc003vuc.2	+						TRIM24_uc003vub.2_Intron	NM_015905	NP_056989	O15164	TIF1A_HUMAN	transcriptional intermediary factor 1 alpha						cellular response to estrogen stimulus|protein catabolic process|regulation of apoptosis|regulation of protein stability|transcription from RNA polymerase II promoter	cytoplasm	chromatin binding|estrogen response element binding|histone acetyl-lysine binding|p53 binding|transcription coactivator activity|ubiquitin-protein ligase activity|zinc ion binding			central_nervous_system(3)|ovary(2)|stomach(1)|breast(1)|skin(1)	8						TACTGTTTTGGTTTTTTTTTTT	0.307													3	3	---	---	---	---	
ATP6V0A4	50617	broad.mit.edu	37	7	138420067	138420067	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138420067delC	uc003vuf.2	-						ATP6V0A4_uc003vug.2_Intron|ATP6V0A4_uc003vuh.2_Intron	NM_130841	NP_570856	Q9HBG4	VPP4_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit						cellular iron ion homeostasis|excretion|insulin receptor signaling pathway|ossification|regulation of pH|sensory perception of sound|transferrin transport	apical plasma membrane|brush border membrane|endosome membrane|integral to membrane|proton-transporting two-sector ATPase complex, proton-transporting domain	ATPase binding|hydrogen ion transmembrane transporter activity			pancreas(1)	1						TGAGGTACATCCCAAATTGTT	0.493													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	139888590	139888591	+	IGR	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:139888590_139888591insT								LOC100134229 (9151 upstream) : SLC37A3 (144963 downstream)																							ATCATTCTTGCTTTTTTTTTTT	0.139													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142110900	142110901	+	Intron	INS	-	CT	CT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142110900_142110901insCT	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		GCTCTGACTTACTGACCAGGAT	0.426											OREG0018389	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	143208738	143208738	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143208738delC	uc003wda.2	+											Homo sapiens mRNA; cDNA DKFZp686O0656 (from clone DKFZp686O0656).																		CCTGCGGTGGCCCCGGCGTGC	0.667													3	10	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	152445927	152445928	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:152445927_152445928insA								XRCC2 (72677 upstream) : ACTR3B (10923 downstream)																							ggctctgtctcaaaaaaaaaaa	0.228													4	2	---	---	---	---	
INSIG1	3638	broad.mit.edu	37	7	155097158	155097158	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155097158delT	uc003wly.2	+						INSIG1_uc011kvu.1_Intron|INSIG1_uc003wlz.2_Intron	NM_005542	NP_005533	O15503	INSI1_HUMAN	insulin induced gene 1 isoform 1						cell proliferation|ER-nuclear sterol response pathway	endoplasmic reticulum membrane|integral to membrane	protein binding				0	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GTGGTGCGTGTTTTCTCCCAG	0.547													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155381567	155381568	+	IGR	DEL	TA	-	-	rs72322232		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155381567_155381568delTA								CNPY1 (55028 upstream) : RBM33 (55635 downstream)																							tcatgtgttttatgtgttcaca	0.173													3	3	---	---	---	---	
PTPRN2	5799	broad.mit.edu	37	7	157629949	157629952	+	Intron	DEL	CCAC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157629949_157629952delCCAC	uc003wno.2	-						PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron	NM_002847	NP_002838	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N							integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(4)|large_intestine(1)|pleura(1)|skin(1)	7	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		atgtgtccctccacccatccaccc	0.074													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	158999828	158999828	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:158999828delA								VIPR2 (62179 upstream) : None (None downstream)																							caaaggagagaagagagggga	0.164													4	3	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3432693	3432694	+	Intron	DEL	AA	-	-	rs71850597		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3432693_3432694delAA	uc011kwk.1	-							NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TAATCACAGTAAAAAAAAAAAA	0.381													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	6170144	6170144	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6170144delT								None (None upstream) : MCPH1 (93977 downstream)																							gcttggccaatatgtcaaaac	0.010													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	7386695	7386697	+	IGR	DEL	CTT	-	-	rs62639809	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:7386695_7386697delCTT								DEFB107A (19862 upstream) : FAM90A7 (26964 downstream)																							cctcctcctccttctcctcctcc	0.256													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	18930662	18930663	+	IGR	INS	-	C	C	rs143995576	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:18930662_18930663insC								PSD3 (59466 upstream) : SH2D4A (240544 downstream)																							CCATTTTTTTTCCCATAAGGCA	0.327													1	5	---	---	---	---	
LZTS1	11178	broad.mit.edu	37	8	20115486	20115487	+	5'Flank	INS	-	T	T	rs147848701	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20115486_20115487insT	uc003wzr.2	-						LZTS1_uc010ltg.1_5'Flank	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1						cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GACTGGgcacatttttttttta	0.020													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	23633130	23633130	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:23633130delA								NKX2-6 (69208 upstream) : STC1 (66304 downstream)																							ATCTGTATCTAATGTGCTTGT	0.453													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	38743304	38743311	+	IGR	DEL	GACATGGC	-	-	rs139136924		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38743304_38743311delGACATGGC								TACC1 (32759 upstream) : PLEKHA2 (15442 downstream)																							cggaaagaaagacatggcgacatggccg	0.106													3	3	---	---	---	---	
PLEKHA2	59339	broad.mit.edu	37	8	38808023	38808024	+	Intron	INS	-	T	T	rs150089121	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:38808023_38808024insT	uc003xmi.3	+						PLEKHA2_uc011lce.1_Intron	NM_021623	NP_067636	Q9HB19	PKHA2_HUMAN	pleckstrin homology domain containing, family A						positive regulation of cell-matrix adhesion	cytoplasm|nucleus|plasma membrane|protein complex	fibronectin binding|laminin binding				0		all_lung(54;0.0413)|Lung NSC(58;0.115)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;4.68e-08)|COAD - Colon adenocarcinoma(9;0.235)			tttgttttacgtttttttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	43265289	43265289	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43265289delA								POTEA (46961 upstream) : None (None downstream)																							AAACCAGGAGAAGTGCCAGGG	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	49967280	49967280	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:49967280delG								SNAI2 (133292 upstream) : C8orf22 (17623 downstream)																							CACAGTGGGAGGAAATTAAAG	0.239													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	53517867	53517867	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53517867delG								FAM150A (39846 upstream) : RB1CC1 (17152 downstream)																							agaccagcctggccaacatga	0.000													4	2	---	---	---	---	
ATP6V1H	51606	broad.mit.edu	37	8	54677959	54677960	+	Intron	INS	-	A	A	rs36191418		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:54677959_54677960insA	uc003xrl.2	-						ATP6V1H_uc003xrk.2_Intron|ATP6V1H_uc003xrm.2_Intron|ATP6V1H_uc003xrn.2_Intron|ATP6V1H_uc011ldv.1_Intron|ATP6V1H_uc010lyd.2_Intron	NM_213620	NP_998785	Q9UI12	VATH_HUMAN	ATPase, H+ transporting, lysosomal 50/57kDa, V1						ATP hydrolysis coupled proton transport|cellular iron ion homeostasis|endocytosis|insulin receptor signaling pathway|interspecies interaction between organisms|regulation of defense response to virus by virus|transferrin transport|vacuolar acidification|viral reproduction	cytosol|plasma membrane|vacuolar proton-transporting V-type ATPase, V1 domain	enzyme regulator activity|protein binding|proton-transporting ATPase activity, rotational mechanism				0		all_epithelial(80;0.0487)|Lung NSC(129;0.109)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;2.79e-06)|Epithelial(17;0.000629)|all cancers(17;0.00359)			gactctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	64204796	64204797	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:64204796_64204797insA								YTHDF3 (79451 upstream) : None (None downstream)																							gactctgtctcaaaaaaaaaga	0.000													4	3	---	---	---	---	
SULF1	23213	broad.mit.edu	37	8	70494208	70494208	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:70494208delA	uc010lza.1	+						SULF1_uc003xyd.2_Intron|SULF1_uc003xye.2_Intron|SULF1_uc003xyf.2_Intron|SULF1_uc003xyg.2_Intron	NM_015170	NP_055985	Q8IWU6	SULF1_HUMAN	sulfatase 1 precursor						apoptosis|bone development|heparan sulfate proteoglycan metabolic process|kidney development|negative regulation of fibroblast growth factor receptor signaling pathway	cell surface|endoplasmic reticulum|extracellular space|Golgi stack	arylsulfatase activity|calcium ion binding			central_nervous_system(3)|ovary(2)|pancreas(1)|skin(1)	7	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			cagagacaccaaaaacctgga	0.139													1	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	74029210	74029211	+	IGR	INS	-	TTTG	TTTG	rs142379148	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:74029210_74029211insTTTG								C8orf84 (23703 upstream) : RPL7 (173664 downstream)																							ttggtttgttttttgtttgttt	0.347													3	3	---	---	---	---	
TPD52	7163	broad.mit.edu	37	8	81033317	81033317	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81033317delA	uc003ybs.1	-						TPD52_uc010lzs.1_Intron|TPD52_uc003ybt.1_Intron	NM_001025253	NP_001020424	P55327	TPD52_HUMAN	tumor protein D52 isoform 2						anatomical structure morphogenesis|B cell differentiation|secretion	endoplasmic reticulum|perinuclear region of cytoplasm	calcium ion binding|protein heterodimerization activity|protein homodimerization activity			ovary(1)	1	all_epithelial(4;1.13e-09)|Lung NSC(7;9.71e-07)|all_lung(9;3.75e-06)	Lung NSC(129;3.55e-06)|all_lung(136;1.53e-05)|Acute lymphoblastic leukemia(644;0.158)	BRCA - Breast invasive adenocarcinoma(6;0.00181)|Epithelial(68;0.0149)|all cancers(69;0.0612)			actctgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	81238865	81238865	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:81238865delG								TPD52 (155029 upstream) : ZBTB10 (158989 downstream)																							cccgggaggcggagactgcag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	95095870	95095877	+	IGR	DEL	TCTTTCTT	-	-	rs147881328		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95095870_95095877delTCTTTCTT								PDP1 (157576 upstream) : CDH17 (43517 downstream)																							cttttcttgctctttctttctttctttc	0.000													4	2	---	---	---	---	
VPS13B	157680	broad.mit.edu	37	8	100501575	100501576	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:100501575_100501576insT	uc003yiv.2	+						VPS13B_uc003yiw.2_Intron|VPS13B_uc003yiu.1_Intron|VPS13B_uc003yix.1_Intron	NM_017890	NP_060360	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13B isoform 5						protein transport					ovary(7)|skin(4)|lung(3)|central_nervous_system(2)|pancreas(2)|breast(1)|kidney(1)	20	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			tttttgttttgttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	115424864	115424865	+	IGR	INS	-	AC	AC	rs151129275	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:115424864_115424865insAC								CSMD3 (975622 upstream) : TRPS1 (995860 downstream)																							gagactctgtTacacacacaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	126664316	126664316	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:126664316delG								TRIB1 (213674 upstream) : FAM84B (900371 downstream)																							cttacctcccggtgttcatgc	0.149													4	2	---	---	---	---	
PVT1	5820	broad.mit.edu	37	8	128959151	128959151	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:128959151delT	uc010mdq.2	+						PVT1_uc003ysl.2_Intron|uc003ysm.1_RNA	NR_003367				Homo sapiens Pvt1 oncogene (non-protein coding), mRNA (cDNA clone IMAGE:5517530), with apparent retained intron.												0						TCTGACATTCTTACCTTGTTT	0.453													4	2	---	---	---	---	
HHLA1	10086	broad.mit.edu	37	8	133112101	133112101	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:133112101delA	uc011liy.1	-							NM_001145095	NP_001138567	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1							extracellular region					0						aactccatctaaaaaaaaaaa	0.139													4	2	---	---	---	---	
ST3GAL1	6482	broad.mit.edu	37	8	134531933	134531933	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:134531933delA	uc003yuk.2	-						ST3GAL1_uc003yum.2_Intron	NM_173344	NP_775479	Q11201	SIA4A_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase						protein glycosylation	extracellular region|Golgi cisterna membrane|integral to Golgi membrane	beta-galactoside alpha-2,3-sialyltransferase activity				0	all_epithelial(106;1.53e-23)|Lung NSC(106;3.15e-07)|all_lung(105;1.26e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.00721)			gcacgcctgtaatcccagcac	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	136063387	136063388	+	IGR	DEL	AA	-	-	rs1480815	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:136063387_136063388delAA								MIR30D (246199 upstream) : LOC286094 (182986 downstream)																							ATAAGAACACAAACACACACAG	0.361													2	4	---	---	---	---	
KCNK9	51305	broad.mit.edu	37	8	140713035	140713036	+	Intron	INS	-	G	G			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:140713035_140713036insG	uc003yvf.1	-						KCNK9_uc003yvg.1_Intron	NM_016601	NP_057685	Q9NPC2	KCNK9_HUMAN	potassium channel, subfamily K, member 9							integral to membrane|membrane fraction	potassium channel activity|voltage-gated ion channel activity			ovary(2)|lung(1)	3	all_cancers(97;3.94e-14)|all_epithelial(106;4.81e-13)|Lung NSC(106;8.18e-05)|all_lung(105;0.00015)|Ovarian(258;0.00235)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;0.134)	BRCA - Breast invasive adenocarcinoma(115;0.0855)			GAATCAACCATGGAAACACACC	0.441													4	2	---	---	---	---	
DENND3	22898	broad.mit.edu	37	8	142200834	142200834	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142200834delC	uc003yvy.2	+						DENND3_uc010mep.2_Intron|DENND3_uc003ywa.1_Intron|DENND3_uc003ywb.2_Intron	NM_014957	NP_055772	A2RUS2	DEND3_HUMAN	DENN/MADD domain containing 3											ovary(1)	1	all_cancers(97;7.36e-15)|all_epithelial(106;2.33e-13)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.105)			GCCCATGTGTCCCCCGGAGTC	0.657													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	142899604	142899604	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142899604delT								MIR1302-7 (31930 upstream) : NCRNA00051 (380113 downstream)																							AAAGGAATCGTTAGGTAAGCA	0.567													4	2	---	---	---	---	
DOCK8	81704	broad.mit.edu	37	9	400617	400619	+	Intron	DEL	CCA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:400617_400619delCCA	uc003zgf.2	+						DOCK8_uc010mgu.2_Intron|DOCK8_uc010mgv.2_Intron|DOCK8_uc010mgw.1_Intron|DOCK8_uc003zgk.2_Intron	NM_203447	NP_982272	Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8						blood coagulation	cytosol	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)|central_nervous_system(3)	6		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		accaccacctccaccaccatcac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	7229186	7229187	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:7229186_7229187delTG								KDM4C (53539 upstream) : C9orf123 (567306 downstream)																							tttgtgtgtttgtgtgtgtgtg	0.307													4	2	---	---	---	---	
ZDHHC21	340481	broad.mit.edu	37	9	14639742	14639742	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14639742delA	uc003zli.2	-						ZDHHC21_uc003zlg.1_Intron	NM_178566	NP_848661	Q8IVQ6	ZDH21_HUMAN	zinc finger, DHHC-type containing 21						nitric oxide metabolic process|regulation of nitric-oxide synthase activity	Golgi membrane|integral to membrane	palmitoyltransferase activity|zinc ion binding				0				GBM - Glioblastoma multiforme(50;4.31e-06)		ACTTGATTATAACTACTTTAA	0.254													4	2	---	---	---	---	
FREM1	158326	broad.mit.edu	37	9	14750527	14750527	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14750527delA	uc003zlm.2	-						FREM1_uc010mic.2_Intron|FREM1_uc003zlk.2_Intron|FREM1_uc003zll.2_Intron	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor						cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		TGCAAGGGATAAAAAAAAAAT	0.338													4	2	---	---	---	---	
CNTLN	54875	broad.mit.edu	37	9	17311030	17311030	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:17311030delT	uc003zmz.2	+						CNTLN_uc003zmy.2_Intron|CNTLN_uc010mio.2_Intron	NM_017738	NP_060208	Q9NXG0	CNTLN_HUMAN	centlein isoform 1							centriole|membrane	two-component sensor activity			pancreas(1)	1				GBM - Glioblastoma multiforme(50;6.14e-10)		aaattacttcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	21159362	21159362	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:21159362delA								IFNW1 (17218 upstream) : IFNA21 (6274 downstream)																							TATACATTGCAATGACCAGAT	0.353													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	25163514	25163515	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:25163514_25163515insA								None (None upstream) : TUSC1 (512879 downstream)																							tacgattagacaaaaaaaagga	0.010													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	26637706	26637706	+	5'Flank	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:26637706delC	uc003zqa.1	-											DQ574229																		TCCCCTTGCTCTCCTTGATCT	0.418													4	2	---	---	---	---	
IFT74	80173	broad.mit.edu	37	9	27036681	27036682	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27036681_27036682insA	uc010mja.2	+						IFT74_uc010mjb.2_Intron|IFT74_uc003zqf.3_3'UTR|IFT74_uc003zqg.3_Intron	NM_001099223	NP_001092693	Q96LB3	IFT74_HUMAN	coiled-coil domain containing 2 isoform a							cytoplasmic membrane-bounded vesicle|intraflagellar transport particle B|microtubule-based flagellum				skin(1)	1		all_neural(11;2.36e-10)		Lung(218;1.4e-05)|LUSC - Lung squamous cell carcinoma(38;0.000114)		TTGCTTCTGTGAAAAAAAAAAG	0.366													5	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33394948	33394948	+	Intron	DEL	T	-	-	rs67055748		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33394948delT	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		TACTTTCCTCTGCTGCTTCCC	0.577													4	2	---	---	---	---	
UBAP2	55833	broad.mit.edu	37	9	34016304	34016305	+	Intron	INS	-	AGA	AGA			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:34016304_34016305insAGA	uc003ztq.1	-						UBAP2_uc011loc.1_Intron|UBAP2_uc011lod.1_Intron|UBAP2_uc011loe.1_Intron|UBAP2_uc011lof.1_Intron|UBAP2_uc011log.1_Intron|UBAP2_uc003ztr.2_Intron	NM_018449	NP_060919	Q5T6F2	UBAP2_HUMAN	ubiquitin associated protein 2											ovary(3)	3			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		agaggaggaagaggaggaagag	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66460838	66460838	+	5'Flank	DEL	T	-	-	rs113014075		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66460838delT	uc004aeb.2	-						uc004aec.2_Intron					Homo sapiens cDNA clone IMAGE:3941306, partial cds.																		ccaccttgagttgatttttgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66469204	66469204	+	RNA	DEL	G	-	-	rs1047837	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66469204delG	uc004aec.2	+	5		c.2771delG								Homo sapiens, clone IMAGE:5213378, mRNA.																		CAATATAATTGCCTTCTTGTA	0.313													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	66823200	66823200	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:66823200delT								LOC442421 (320173 upstream) : AQP7P1 (431067 downstream)																							cagaaacttctttgtgatgtg	0.000													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67308879	67308880	+	IGR	INS	-	TT	TT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67308879_67308880insTT								AQP7P1 (19387 upstream) : FAM27B (484050 downstream)																							TTCATCCTCTATTTTTTTTTTT	0.168													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67340073	67340073	+	IGR	DEL	G	-	-	rs79998190		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67340073delG								AQP7P1 (50581 upstream) : FAM27B (452857 downstream)																							GGGGAGTGGAGCCTGGGCctg	0.373													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68428787	68428787	+	IGR	DEL	T	-	-	rs78281943		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68428787delT								FAM27B (634598 upstream) : MIR1299 (573452 downstream)																							TTTCTAACTCTGGTTCTAATA	0.254													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68997214	68997215	+	IGR	INS	-	TGTT	TGTT	rs112098295		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68997214_68997215insTGTT								None (None upstream) : MIR1299 (5024 downstream)																							gagggtctgaatgtccctcaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	68999220	68999223	+	IGR	DEL	TGTT	-	-	rs145535214		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:68999220_68999223delTGTT								None (None upstream) : MIR1299 (3016 downstream)																							attgtctgaatgtttgtcacacac	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	70940393	70940394	+	IGR	DEL	GA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:70940393_70940394delGA								FOXD4L3 (20393 upstream) : LOC572558 (29717 downstream)																							tgatgataaggagagagtctgc	0.000													6	5	---	---	---	---	
C9orf135	138255	broad.mit.edu	37	9	72460633	72460634	+	Intron	DEL	AC	-	-	rs34208910		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72460633_72460634delAC	uc004ahl.2	+						C9orf135_uc011lrw.1_Intron|C9orf135_uc010moq.2_Intron|C9orf135_uc011lrx.1_Intron|C9orf135_uc010mop.2_Intron	NM_001010940	NP_001010940	Q5VTT2	CI135_HUMAN	hypothetical protein LOC138255							integral to membrane				ovary(1)	1						GCAGGAACTAACACAGCTCTAA	0.475													2	4	---	---	---	---	
NAA35	60560	broad.mit.edu	37	9	88590193	88590193	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88590193delG	uc004aoi.3	+						NAA35_uc004aoj.3_Intron|NAA35_uc004aok.1_Intron	NM_024635	NP_078911	Q5VZE5	NAA35_HUMAN	corneal wound healing-related protein						smooth muscle cell proliferation	cytoplasm|nucleus|plasma membrane				skin(2)|central_nervous_system(1)	3						TTTTTTTTTTGTAATGAATTT	0.244													4	2	---	---	---	---	
C9orf3	84909	broad.mit.edu	37	9	97567451	97567451	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:97567451delT	uc004ava.2	+						C9orf3_uc004aux.1_Intron|C9orf3_uc004auy.2_Intron|C9orf3_uc004auz.1_Intron	NM_032823	NP_116212	Q8N6M6	AMPO_HUMAN	aminopeptidase O						leukotriene biosynthetic process|proteolysis	cytoplasm	aminopeptidase activity|metallopeptidase activity|zinc ion binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		AGAGATCAAATTTTTTTTTTT	0.438													3	3	---	---	---	---	
FANCC	2176	broad.mit.edu	37	9	98009494	98009495	+	Intron	INS	-	GT	GT	rs71498956		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98009494_98009495insGT	uc004avh.2	-						FANCC_uc004avi.3_Intron|FANCC_uc010mrm.1_Intron|FANCC_uc011lul.1_Intron	NM_000136	NP_000127	Q00597	FANCC_HUMAN	Fanconi anemia, complementation group C						protein complex assembly	cytosol|nucleoplasm	protein binding			kidney(1)	1		Acute lymphoblastic leukemia(62;0.138)				tgcgtgcacgcgtgtgtgtgtg	0.292			D|Mis|N|F|S			AML|leukemia		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents|Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	98894896	98894897	+	IGR	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:98894896_98894897delCA								NCRNA00092 (110859 upstream) : HSD17B3 (102692 downstream)																							AACACATGTGCACACACACACA	0.431													4	2	---	---	---	---	
GABBR2	9568	broad.mit.edu	37	9	101278141	101278142	+	Intron	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:101278141_101278142delCA	uc004ays.2	-							NM_005458	NP_005449	O75899	GABR2_HUMAN	G protein-coupled receptor 51 precursor						negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(2)|skin(2)	4		Acute lymphoblastic leukemia(62;0.0527)			Baclofen(DB00181)	aagattaagtcacttgcccaaa	0.129													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	105332342	105332343	+	IGR	DEL	CA	-	-	rs55869879	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:105332342_105332343delCA								GRIN3A (831480 upstream) : CYLC2 (425250 downstream)																							catgtgtgtgcacacacacaca	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	106534690	106534691	+	IGR	INS	-	TA	TA	rs151039910	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:106534690_106534691insTA								CYLC2 (753920 upstream) : SMC2 (321850 downstream)																							agccttttttttatatatatac	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	111486941	111486941	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111486941delT								None (None upstream) : ACTL7B (129930 downstream)																							CCCTGTACCATTTTCTTTAAT	0.428													4	2	---	---	---	---	
PALM2-AKAP2	445815	broad.mit.edu	37	9	112593731	112593731	+	Intron	DEL	C	-	-	rs66504875		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112593731delC	uc004bei.2	+						PALM2_uc004bef.2_Intron|PALM2_uc004beg.2_Intron|PALM2_uc004beh.3_Intron|PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						TAGGCTACCACCTGTCCTGTT	0.453													2	4	---	---	---	---	
PALM2-AKAP2	445815	broad.mit.edu	37	9	112760405	112760406	+	Intron	DEL	TG	-	-	rs144244914		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112760405_112760406delTG	uc004bei.2	+						PALM2-AKAP2_uc004bek.3_Intron|PALM2-AKAP2_uc004bej.3_Intron|PALM2-AKAP2_uc004bel.1_Intron	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2								enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						CCATTCTTTTTGTTGTGATCAA	0.426													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	117696496	117696497	+	IGR	INS	-	C	C	rs147173166	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:117696496_117696497insC								TNFSF8 (3726 upstream) : TNC (86309 downstream)																							GAGAGTGACCACCCAGCCTCCT	0.490													2	4	---	---	---	---	
DBC1	1620	broad.mit.edu	37	9	122101204	122101204	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:122101204delG	uc004bkc.2	-						DBC1_uc004bkd.2_Intron	NM_014618	NP_055433	O60477	DBC1_HUMAN	deleted in bladder cancer 1 precursor						cell cycle arrest|cell death	cytoplasm	protein binding			skin(3)|ovary(2)|central_nervous_system(2)|large_intestine(1)	8						CAAAAACACAGGGGGGTGGGG	0.164													4	2	---	---	---	---	
DAB2IP	153090	broad.mit.edu	37	9	124505711	124505712	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:124505711_124505712insT	uc004bln.2	+						DAB2IP_uc004blo.2_Intron	NM_032552	NP_115941	Q5VWQ8	DAB2P_HUMAN	disabled homolog 2 interacting protein isoform						activation of JUN kinase activity|apoptosis in response to endoplasmic reticulum stress|cellular response to epidermal growth factor stimulus|cellular response to tumor necrosis factor|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of epidermal growth factor receptor signaling pathway|negative regulation of epithelial cell migration|negative regulation of epithelial cell proliferation|negative regulation of epithelial to mesenchymal transition|negative regulation of fibroblast proliferation|negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of Ras GTPase activity|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter	cytoplasm|intrinsic to internal side of plasma membrane	14-3-3 protein binding|death receptor binding|mitogen-activated protein kinase kinase kinase binding|protein homodimerization activity|protein phosphatase 2A binding|Ras GTPase activator activity|signaling adaptor activity			ovary(1)|central_nervous_system(1)	2						TTCGTTTTTTGTTTTTTTTTTC	0.401													4	2	---	---	---	---	
GOLGA2	2801	broad.mit.edu	37	9	131035170	131035170	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:131035170delA	uc011maw.1	-						GOLGA2_uc010mxw.2_Intron|GOLGA2_uc004bul.1_Intron	NM_004486	NP_004477	Q08379	GOGA2_HUMAN	Golgi autoantigen, golgin subfamily a, 2							Golgi cisterna membrane	protein binding			ovary(1)	1						AGGGAAAAACAAGGGCAGGGG	0.512													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	138510529	138510531	+	IGR	DEL	GAG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138510529_138510531delGAG								PAEP (51907 upstream) : GLT6D1 (4971 downstream)																							GAGCCAAGCAGAGGAGGGCAGGG	0.655													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	139019718	139019720	+	IGR	DEL	GGA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139019718_139019720delGGA								C9orf69 (8987 upstream) : LHX3 (68378 downstream)																							acagagagagggagGAGGAGGAG	0.281													4	2	---	---	---	---	
TRAF2	7186	broad.mit.edu	37	9	139788500	139788500	+	Intron	DEL	T	-	-	rs150394500		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139788500delT	uc010nbu.2	+						TRAF2_uc010nbv.1_Intron|TRAF2_uc004cjv.2_Intron|TRAF2_uc011mek.1_Intron|TRAF2_uc010nbw.2_Intron	NM_021138	NP_066961	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2						activation of caspase activity|activation of NF-kappaB-inducing kinase activity|activation of pro-apoptotic gene products|cellular protein complex assembly|induction of apoptosis by extracellular signals|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of T cell cytokine production|protein autoubiquitination|protein homotrimerization|protein K63-linked ubiquitination|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|internal side of plasma membrane	CD40 receptor binding|enzyme binding|protein binding|signal transducer activity|sphingolipid binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		gcgcctggccttttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	108221	108222	+	IGR	INS	-	C	C	rs112776231	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108221_108222insC								TUBB8 (12717 upstream) : ZMYND11 (72202 downstream)																							atttaaaattatcatgaggctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	3442799	3442799	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:3442799delC	uc001igy.1	+											Homo sapiens cDNA clone IMAGE:5278070.																		TGGTTGGTGTCCGGATGATTT	0.433													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	6732781	6732784	+	IGR	DEL	AAAC	-	-	rs149460364		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:6732781_6732784delAAAC								PRKCQ (110543 upstream) : SFMBT2 (471465 downstream)																							ctcgaaaTTAaaacaaacaaacaa	0.147													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	9000450	9000451	+	IGR	DEL	AC	-	-	rs72357569		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:9000450_9000451delAC								GATA3 (883288 upstream) : None (None downstream)																							tactaaaactacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	13296882	13296882	+	IGR	DEL	A	-	-	rs144218939		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13296882delA								UCMA (20554 upstream) : PHYH (22915 downstream)																							actctgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	20789780	20789780	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:20789780delG								PLXDC2 (220665 upstream) : NEBL (279125 downstream)																							ctaacagacaggaccctcagc	0.000													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	22552072	22552072	+	IGR	DEL	G	-	-	rs137928413	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:22552072delG								DNAJC1 (259422 upstream) : COMMD3 (53227 downstream)																							gagggaggaagggaaggaagg	0.100													4	3	---	---	---	---	
KIAA1217	56243	broad.mit.edu	37	10	24485066	24485067	+	Intron	DEL	AC	-	-	rs139361859		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:24485066_24485067delAC	uc001irs.2	+							NM_001098500	NP_001091970	Q5T5P2	SKT_HUMAN	sickle tail isoform 2						embryonic skeletal system development	cytoplasm				ovary(5)|skin(2)	7						ctgtctcaaaacacacacacac	0.035													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	25385363	25385364	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25385363_25385364insA								ENKUR (34155 upstream) : LOC100128811 (61637 downstream)																							tcttcaagtggaaggaaagggt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42452534	42452535	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42452534_42452535insA								None (None upstream) : LOC441666 (374780 downstream)																							acagtgtttccaactactgaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42619620	42619620	+	IGR	DEL	A	-	-	rs35875633		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42619620delA								None (None upstream) : LOC441666 (207695 downstream)																							atcaaaggttaaaaaaaaaag	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	45334426	45334427	+	Intron	INS	-	TGGATGGA	TGGATGGA	rs139241329	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:45334426_45334427insTGGATGGA	uc001jbk.1	-						uc001jbl.2_Intron					Homo sapiens cDNA FLJ31956 fis, clone NT2RP7007359.																		TCAGGTTTACCtggatggatgg	0.371													3	3	---	---	---	---	
ANXA8	653145	broad.mit.edu	37	10	47065654	47065655	+	Intron	INS	-	T	T	rs151210596	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:47065654_47065655insT	uc001jed.3	-									P13928	ANXA8_HUMAN	Homo sapiens cDNA FLJ58071 complete cds, highly similar to Annexin A8.						blood coagulation		calcium ion binding|calcium-dependent phospholipid binding			central_nervous_system(3)	3						aagaaaactagtaccttgagaa	0.000													5	3	---	---	---	---	
MAPK8	5599	broad.mit.edu	37	10	49551050	49551050	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:49551050delA	uc009xnz.2	+						MAPK8_uc001jgl.2_Intron	NM_139047	NP_620635	P45983	MK08_HUMAN	mitogen-activated protein kinase 8 isoform JNK1						activation of pro-apoptotic gene products|cellular response to mechanical stimulus|induction of apoptosis by intracellular signals|innate immune response|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of apoptosis|negative regulation of protein binding|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of deacetylase activity|regulation of protein localization|regulation of sequence-specific DNA binding transcription factor activity|response to UV|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|nucleoplasm	ATP binding|histone deacetylase binding|histone deacetylase regulator activity|JUN kinase activity|protein binding			central_nervous_system(3)|lung(2)|stomach(1)|ovary(1)|kidney(1)	8		Ovarian(717;0.0221)|Lung SC(717;0.113)|all_neural(218;0.116)		Epithelial(53;3.46e-65)|Lung(62;0.125)		tagaatagtgaatcattaaag	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	57628988	57628988	+	IGR	DEL	C	-	-	rs67115702		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:57628988delC								PCDH15 (241286 upstream) : ZWINT (488211 downstream)																							ttctttctttctttttttttt	0.174													4	2	---	---	---	---	
ANK3	288	broad.mit.edu	37	10	62199360	62199360	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62199360delT	uc010qih.1	-						ANK3_uc001jkz.3_Intron|ANK3_uc001jlb.1_Intron	NM_001149	NP_001140	Q12955	ANK3_HUMAN	ankyrin 3 isoform 2						establishment of protein localization|signal transduction	basolateral plasma membrane|cytoplasm|cytoskeleton	protein binding			skin(9)|ovary(6)|pancreas(2)|central_nervous_system(2)	19						CCATGGGACATTTTAAATTGT	0.343													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	65469174	65469175	+	IGR	DEL	AG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65469174_65469175delAG								REEP3 (87203 upstream) : None (None downstream)																							cctgggtgacagagtaagaacc	0.119													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	65960350	65960355	+	IGR	DEL	ACACAC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:65960350_65960355delACACAC								REEP3 (578379 upstream) : ANXA2P3 (624930 downstream)																							AGACACTGTTacacacacacacacac	0.141													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	71896417	71896417	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:71896417delC								AIFM2 (3727 upstream) : TYSND1 (1318 downstream)																							gcgtgagatacagcacctggt	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	73673334	73673336	+	IGR	DEL	TTG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73673334_73673336delTTG								PSAP (62252 upstream) : CHST3 (50784 downstream)																							GTAAttgtttttgttgttgttgt	0.005													4	2	---	---	---	---	
KCNMA1	3778	broad.mit.edu	37	10	78966500	78966501	+	Intron	INS	-	TGTG	TGTG	rs140932770	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:78966500_78966501insTGTG	uc001jxn.2	-						KCNMA1_uc001jxj.2_Intron|KCNMA1_uc009xrt.1_Intron|KCNMA1_uc001jxo.2_Intron|KCNMA1_uc001jxm.2_Intron|KCNMA1_uc001jxq.2_Intron	NM_001161352	NP_001154824	Q12791	KCMA1_HUMAN	large conductance calcium-activated potassium						cellular potassium ion homeostasis|negative regulation of cell volume|platelet activation|positive regulation of apoptosis|regulation of membrane potential|response to calcium ion|response to carbon monoxide|response to hypoxia|response to osmotic stress|smooth muscle contraction involved in micturition	apical plasma membrane|caveola|integral to membrane|voltage-gated potassium channel complex	actin binding|calcium-activated potassium channel activity|large conductance calcium-activated potassium channel activity|metal ion binding|voltage-gated potassium channel activity			pancreas(2)|ovary(1)	3	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Chlorzoxazone(DB00356)|Cromoglicate(DB01003)|Cyclothiazide(DB00606)|Diazoxide(DB01119)|Enflurane(DB00228)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Quinethazone(DB01325)|Trichlormethiazide(DB01021)	agactaagtactcaataaactt	0.079													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	81308454	81308455	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:81308454_81308455insA								EIF5AL1 (32264 upstream) : SFTPA2 (7154 downstream)																							ctccatctcttaaaaaaaaaaa	0.079													5	3	---	---	---	---	
NRG3	10718	broad.mit.edu	37	10	84165214	84165215	+	Intron	INS	-	T	T	rs28498261	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:84165214_84165215insT	uc001kco.2	+						NRG3_uc010qlz.1_Intron|NRG3_uc001kcp.2_Intron|NRG3_uc001kcq.2_Intron	NM_001010848	NP_001010848	P56975	NRG3_HUMAN	neuregulin 3 isoform 1						regulation of cell growth	extracellular region|integral to plasma membrane	growth factor activity|receptor tyrosine kinase binding|transmembrane receptor protein tyrosine kinase activator activity			lung(5)|breast(1)	6				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		TCAGTAGtttgttttttttttt	0.114													4	2	---	---	---	---	
LIPN	643418	broad.mit.edu	37	10	90521476	90521479	+	Intron	DEL	CTAT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90521476_90521479delCTAT	uc010qmw.1	+							NM_001102469	NP_001095939	Q5VXI9	LIPN_HUMAN	lipase-like, ab-hydrolase domain containing 4						lipid catabolic process	extracellular region	hydrolase activity				0		Colorectal(252;0.0161)		Colorectal(12;4.83e-05)|COAD - Colon adenocarcinoma(12;6.5e-05)		TGCTATTGTGctatctatctatct	0.211													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	90857105	90857106	+	IGR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:90857105_90857106delAC								FAS (81564 upstream) : CH25H (108590 downstream)																							tctctacacaacacacacacac	0.099													4	2	---	---	---	---	
PI4K2A	55361	broad.mit.edu	37	10	99391375	99391376	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:99391375_99391376insA	uc010qoy.1	+						MORN4_uc001kob.3_Intron|MORN4_uc001koc.3_Intron|MORN4_uc001kod.3_Intron|MORN4_uc001koe.2_Intron|MORN4_uc009xvv.1_Intron	NM_018425	NP_060895	Q9BTU6	P4K2A_HUMAN	phosphatidylinositol 4-kinase type 2 alpha						phosphatidylinositol biosynthetic process	cytoplasm|integral to plasma membrane|membrane raft	1-phosphatidylinositol 4-kinase activity|ATP binding|magnesium ion binding			lung(1)|skin(1)	2		Colorectal(252;0.162)		Epithelial(162;1.24e-10)|all cancers(201;1.2e-08)		TTAAGAGGATTAAAAAAAAAAA	0.163													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	105010823	105010831	+	Intron	DEL	CACCACGAT	-	-	rs140015106	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105010823_105010831delCACCACGAT	uc001kwr.2	-											Homo sapiens, clone IMAGE:5199023, mRNA.																		tcaccacctccaccacgatcaccaccacc	0.000													10	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	106259909	106259909	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:106259909delG								CCDC147 (45070 upstream) : SORCS3 (140950 downstream)																							actccaggctgggtgacagag	0.100													4	2	---	---	---	---	
SORCS1	114815	broad.mit.edu	37	10	108925050	108925051	+	5'Flank	INS	-	GT	GT	rs142789907	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:108925050_108925051insGT	uc001kym.2	-						SORCS1_uc001kyl.2_5'Flank|SORCS1_uc009xxs.2_5'Flank|SORCS1_uc001kyn.1_5'Flank|SORCS1_uc001kyo.2_5'Flank	NM_052918	NP_443150	Q8WY21	SORC1_HUMAN	SORCS receptor 1 isoform a							integral to membrane	neuropeptide receptor activity|protein binding			breast(1)|central_nervous_system(1)	2		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTCgtgtgtgagtgtgtgtgtg	0.381													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	110659962	110659963	+	IGR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:110659962_110659963delAC								None (None upstream) : XPNPEP1 (964561 downstream)																							CACTGTACATACACACACACAC	0.307													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	112194815	112194815	+	IGR	DEL	C	-	-	rs113078134		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:112194815delC								SMNDC1 (130108 upstream) : DUSP5 (62810 downstream)																							TTTCCCCCAACCCCAAATCGT	0.249													2	5	---	---	---	---	
ABLIM1	3983	broad.mit.edu	37	10	116476798	116476799	+	Intron	INS	-	TCAT	TCAT	rs147947614	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:116476798_116476799insTCAT	uc001lbz.1	-									O14639	ABLM1_HUMAN	Homo sapiens cDNA FLJ25105 fis, clone CBR01442.						axon guidance|cytoskeleton organization|organ morphogenesis|visual perception	actin cytoskeleton|cytoplasm	actin binding|zinc ion binding			breast(1)	1		Colorectal(252;0.0373)|Breast(234;0.231)		Epithelial(162;0.0132)|all cancers(201;0.0383)		ATCATGGTATCtcattcattca	0.411													4	2	---	---	---	---	
C10orf46	143384	broad.mit.edu	37	10	120500978	120500979	+	Intron	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120500978_120500979delAC	uc001lds.1	-						C10orf46_uc010qst.1_Intron	NM_153810	NP_722517	Q86Y37	CJ046_HUMAN	chromosome 10 open reading frame 46						ubiquitin-dependent protein catabolic process	cullin-RING ubiquitin ligase complex	ubiquitin protein ligase binding				0		Lung NSC(174;0.142)|all_lung(145;0.175)		all cancers(201;0.0131)		AGACAGACAGACACACACACAC	0.450													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	120646719	120646719	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120646719delC								C10orf46 (131961 upstream) : NANOS1 (142509 downstream)																							GAAGCTTGTTCCCTAGGCAGG	0.453													4	2	---	---	---	---	
RGS10	6001	broad.mit.edu	37	10	121278792	121278792	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121278792delC	uc001lee.2	-						RGS10_uc001lef.2_Intron|RGS10_uc001leg.2_Intron	NM_002925	NP_002916	O43665	RGS10_HUMAN	regulator of G-protein signaling 10 isoform b						negative regulation of signal transduction	cytoplasm|plasma membrane	GTPase activator activity|protein binding|signal transducer activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.00105)|GBM - Glioblastoma multiforme(135;0.195)		ctgtgtctgtcccccagctcc	0.254													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	124313612	124313613	+	IGR	INS	-	T	T	rs142677258	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:124313612_124313613insT								HTRA1 (39188 upstream) : DMBT1 (6568 downstream)																							acccggccTGATCCATCTGCTT	0.223													2	4	---	---	---	---	
DHX32	55760	broad.mit.edu	37	10	127578794	127578795	+	Intron	DEL	AT	-	-	rs5788723		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:127578794_127578795delAT	uc001ljg.1	-							NM_018180	NP_060650	Q7L7V1	DHX32_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32							mitochondrion|nucleus	ATP binding|helicase activity			breast(2)|ovary(1)|lung(1)	4		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TTTGAAAAACATATTTCTAACA	0.297													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	134737904	134737904	+	Intron	DEL	C	-	-	rs11331265		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:134737904delC	uc010qux.1	-							NM_017609	NP_060079			Homo sapiens cDNA, FLJ17989.																		CCACAACCAGCCCCCCACTCC	0.667													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	2455674	2455675	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2455674_2455675delTG								TRPM5 (11399 upstream) : KCNQ1 (10546 downstream)																							TGTGTCCGGCtgtgtgtgtgtg	0.104													4	2	---	---	---	---	
TRIM78P	117852	broad.mit.edu	37	11	5677586	5677587	+	Intron	DEL	TT	-	-	rs142112342		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5677586_5677587delTT	uc009yer.2	+							NR_002777				Homo sapiens TRIpartite motif protein pseudogene mRNA sequence.												0						gaacagacactttttttttttt	0.000													4	2	---	---	---	---	
SYT9	143425	broad.mit.edu	37	11	7420190	7420190	+	Intron	DEL	A	-	-	rs141282251		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7420190delA	uc001mfe.2	+						SYT9_uc001mfd.2_Intron|SYT9_uc009yfi.2_Intron	NM_175733	NP_783860	Q86SS6	SYT9_HUMAN	synaptotagmin IX							cell junction|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|large_intestine(1)	3				Epithelial(150;1.34e-07)|LUSC - Lung squamous cell carcinoma(625;0.0949)		tagacacaccaaacagcaggt	0.000													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	10975977	10975977	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10975977delT								ZBED5 (96357 upstream) : GALNTL4 (316444 downstream)																							aatgtgtttgttgcagcattt	0.000													4	2	---	---	---	---	
TEAD1	7003	broad.mit.edu	37	11	12729167	12729168	+	Intron	DEL	AG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:12729167_12729168delAG	uc001mkj.3	+							NM_021961	NP_068780	P28347	TEAD1_HUMAN	TEA domain family member 1						hippo signaling cascade		DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0				Epithelial(150;0.00223)|BRCA - Breast invasive adenocarcinoma(625;0.236)		GGTGTCTGCTAGAGAGAGAGAG	0.396													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	13099665	13099665	+	IGR	DEL	A	-	-	rs11285688		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:13099665delA								RASSF10 (67018 upstream) : ARNTL (199660 downstream)																							AAAAGGAAGGAAAAAAAAAAA	0.413													6	5	---	---	---	---	
SPON1	10418	broad.mit.edu	37	11	14252331	14252334	+	Intron	DEL	TTCA	-	-	rs62745561		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14252331_14252334delTTCA	uc001mle.2	+							NM_006108	NP_006099	Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion	extracellular space|proteinaceous extracellular matrix	protein binding				0				Epithelial(150;0.00898)		ccttccttccttcattttttcGTG	0.142													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	15529907	15529908	+	IGR	INS	-	TT	TT	rs71894919		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:15529907_15529908insTT								INSC (261155 upstream) : SOX6 (458088 downstream)																							TCCttttatccttttttttttt	0.193													4	2	---	---	---	---	
ZDHHC13	54503	broad.mit.edu	37	11	19169872	19169872	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19169872delG	uc001mpi.2	+						ZDHHC13_uc001mpj.2_Intron	NM_019028	NP_061901	Q8IUH4	ZDH13_HUMAN	zinc finger, DHHC domain containing 13 isoform						positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|palmitoyltransferase activity|signal transducer activity|zinc ion binding				0						TCAAGGAGTTGAATCTTTTCT	0.368													4	2	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	20961739	20961740	+	Intron	DEL	CT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20961739_20961740delCT	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						ccctccgtccctctctctctct	0.277													4	2	---	---	---	---	
NELL1	4745	broad.mit.edu	37	11	21166041	21166042	+	Intron	INS	-	AG	AG			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:21166041_21166042insAG	uc001mqe.2	+						NELL1_uc001mqf.2_Intron|NELL1_uc009yid.2_Intron|NELL1_uc010rdo.1_Intron|NELL1_uc010rdp.1_Intron	NM_006157	NP_006148	Q92832	NELL1_HUMAN	nel-like 1 isoform 1 precursor						cell adhesion|nervous system development	extracellular region	calcium ion binding|structural molecule activity			ovary(2)|large_intestine(1)	3						TTGTCCGTAATAGAGAGAGAGA	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	26830382	26830385	+	IGR	DEL	GTGT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26830382_26830385delGTGT								SLC5A12 (85408 upstream) : FIBIN (185243 downstream)																							GTACAAGAAAgtgtgtgtgtgtgt	0.279													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	26904087	26904087	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26904087delC								SLC5A12 (159113 upstream) : FIBIN (111541 downstream)																							ctcggtaggtcccacacccac	0.000													4	2	---	---	---	---	
KIF18A	81930	broad.mit.edu	37	11	28116025	28116025	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28116025delA	uc001msc.2	-							NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						ttgccaaagtaaaaaAAAAAA	0.095													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	33478703	33478704	+	IGR	DEL	CT	-	-	rs140506324		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:33478703_33478704delCT								HIPK3 (102764 upstream) : C11orf41 (85173 downstream)																							GGGTAGTCCCCTGTCCAGAAGA	0.520													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	34753313	34753313	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34753313delG								EHF (70232 upstream) : APIP (143401 downstream)																							TTGCCCTGGTGTGATCTGGGC	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	37977082	37977082	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:37977082delT								None (None upstream) : None (None downstream)																							TAGGTACACATTTATTTCTAC	0.294													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	39481732	39481766	+	IGR	DEL	TGCTTTTTGCTTGCAGTGCTCATTTATAAGATCTT	-	-	rs77552655		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:39481732_39481766delTGCTTTTTGCTTGCAGTGCTCATTTATAAGATCTT								None (None upstream) : LRRC4C (653987 downstream)																							gtacttcctgtgctttttgcttgcagtgctcATTTATAAGATCTTTACAAATTAA	0.064													3	3	---	---	---	---	
ALX4	60529	broad.mit.edu	37	11	44299817	44299818	+	Intron	INS	-	T	T	rs147206352	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:44299817_44299818insT	uc001myb.2	-							NM_021926	NP_068745	Q9H161	ALX4_HUMAN	aristaless-like homeobox 4						hair follicle development						0						taactggggggaaactgaggcc	0.337													3	3	---	---	---	---	
ARFGAP2	84364	broad.mit.edu	37	11	47189416	47189417	+	Intron	INS	-	A	A	rs34204386		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47189416_47189417insA	uc001ndt.2	-						ARFGAP2_uc010rha.1_Intron|ARFGAP2_uc010rhb.1_Intron|ARFGAP2_uc001ndu.2_Intron|ARFGAP2_uc010rhc.1_Intron	NM_032389	NP_115765	Q8N6H7	ARFG2_HUMAN	ADP-ribosylation factor GTPase activating						protein transport|regulation of ARF GTPase activity|vesicle-mediated transport	Golgi membrane|nucleolus|plasma membrane	ARF GTPase activator activity|zinc ion binding			ovary(1)	1						TCAGCTTGTTTaaaaaaaaaaa	0.243													6	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	49460725	49460725	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49460725delT								FOLH1 (230503 upstream) : LOC440040 (119355 downstream)																							aatcttcttcttttttttttt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	50697631	50697631	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:50697631delT								LOC646813 (317828 upstream) : OR4A5 (713817 downstream)																							tctgagaaaatttttgtgatg	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	54993627	54993627	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:54993627delA								None (None upstream) : TRIM48 (36031 downstream)																							cagattctacaaaaagagtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	56249493	56249497	+	IGR	DEL	GAAAG	-	-	rs72391334		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56249493_56249497delGAAAG								OR5M3 (11520 upstream) : OR5M8 (8414 downstream)																							ggaaaggaaagaaaggaaaggaaag	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	61751030	61751031	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:61751030_61751031delTG								FTH1 (15898 upstream) : INCENP (140414 downstream)																							GATGGTGATTTGTGTGTGTGTC	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	63539455	63539456	+	IGR	INS	-	AGG	AGG	rs140059095	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63539455_63539456insAGG								C11orf95 (3342 upstream) : C11orf84 (41467 downstream)																							ggaggaggagaaggaggaggag	0.069													3	4	---	---	---	---	
MACROD1	28992	broad.mit.edu	37	11	63810930	63810930	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63810930delA	uc001nyh.2	-							NM_014067	NP_054786	Q9BQ69	MACD1_HUMAN	MACRO domain containing 1												0						TGGTTGTGACAAAAGGGCAAG	0.612													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	69858983	69858983	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69858983delT								FGF3 (224791 upstream) : ANO1 (65425 downstream)																							catcctttcattcaCAGTGAG	0.090													5	3	---	---	---	---	
ACER3	55331	broad.mit.edu	37	11	76704228	76704228	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76704228delC	uc009yum.1	+						ACER3_uc010rsg.1_Intron|ACER3_uc009yul.1_Intron|ACER3_uc001oxu.2_Intron|ACER3_uc009yun.1_Intron|ACER3_uc009yuo.1_Intron|ACER3_uc010rsh.1_Intron|ACER3_uc010rsi.1_Intron|ACER3_uc010rsj.1_Intron	NM_018367	NP_060837	Q9NUN7	ACER3_HUMAN	phytoceramidase, alkaline						ceramide metabolic process|phytosphingosine biosynthetic process|positive regulation of cell proliferation|sphingosine biosynthetic process	integral to endoplasmic reticulum membrane|integral to Golgi membrane	phytoceramidase activity				0						ccTGaacaaaccctttttaag	0.005													4	2	---	---	---	---	
DLG2	1740	broad.mit.edu	37	11	83246399	83246400	+	Intron	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:83246399_83246400delCA	uc001paj.2	-						DLG2_uc001pai.2_Intron|DLG2_uc010rsy.1_Intron|DLG2_uc010rsz.1_Intron|DLG2_uc010rta.1_Intron|DLG2_uc001pak.2_Intron|DLG2_uc010rtb.1_Intron|DLG2_uc010rsw.1_Intron|DLG2_uc010rsx.1_Intron	NM_001364	NP_001355	Q15700	DLG2_HUMAN	chapsyn-110 isoform 2							cell junction|postsynaptic density|postsynaptic membrane	guanylate kinase activity|protein binding|protein binding			ovary(3)|pancreas(2)|skin(1)	6		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CCACAGAACTCACACAGGTTCC	0.426													4	2	---	---	---	---	
FAT3	120114	broad.mit.edu	37	11	92438994	92438995	+	Intron	INS	-	GT	GT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92438994_92438995insGT	uc001pdj.3	+							NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3						homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				tgatggtggtggtgatggtggt	0.000										TCGA Ovarian(4;0.039)			4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	107144474	107144475	+	IGR	INS	-	GT	GT	rs34495900		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107144474_107144475insGT								GUCY1A2 (255303 upstream) : CWF19L2 (52599 downstream)																							CTAAGTATGAAGAAAAGTGGAA	0.337													4	2	---	---	---	---	
EXPH5	23086	broad.mit.edu	37	11	108459802	108459802	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108459802delT	uc001pkk.2	-							NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a						intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTGTTGTCCCTTTTCCAGGCC	0.388													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	113389628	113389628	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:113389628delC								DRD2 (43215 upstream) : TMPRSS5 (168641 downstream)																							gtcttatcttccccgtgatct	0.139													4	2	---	---	---	---	
SCN2B	6327	broad.mit.edu	37	11	118038359	118038359	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118038359delC	uc001psf.2	-							NM_004588	NP_004579	O60939	SCN2B_HUMAN	sodium channel, voltage-gated, type II, beta						synaptic transmission	voltage-gated sodium channel complex	voltage-gated sodium channel activity				0	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.19e-05)|Epithelial(105;0.00117)		gcagcctctacctgctgggct	0.045													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	122327877	122327896	+	IGR	DEL	AAGAAAGAAAGAAAGAAAGA	-	-	rs140751842	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:122327877_122327896delAAGAAAGAAAGAAAGAAAGA								LOC399959 (89410 upstream) : UBASH3B (198502 downstream)																							tgaaagaaagaagaaagaaagaaagaaagaaagaaagaaa	0.050													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	126223379	126223379	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:126223379delA	uc001qdq.1	-						uc001qdr.1_Intron|ST3GAL4_uc001qds.2_5'Flank|ST3GAL4_uc001qdt.2_5'Flank|ST3GAL4_uc009zcc.2_5'Flank|ST3GAL4_uc009zcd.2_5'Flank|ST3GAL4_uc001qdu.2_5'Flank|ST3GAL4_uc001qdv.2_5'Flank					Homo sapiens cDNA FLJ39051 fis, clone NT2RP7011452.																		AACTGGAGGGAAAAGATCATC	0.507													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127325699	127325699	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127325699delT								KIRREL3 (452344 upstream) : None (None downstream)																							tctttgtttgttttttttttt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	127838249	127838249	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:127838249delC								KIRREL3 (964894 upstream) : ETS1 (490407 downstream)																							GTGCTGGTGGCCCCATGGTCC	0.498													4	2	---	---	---	---	
ST14	6768	broad.mit.edu	37	11	130050281	130050281	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130050281delT	uc001qfw.2	+							NM_021978	NP_068813	Q9Y5Y6	ST14_HUMAN	matriptase						proteolysis	integral to plasma membrane	serine-type endopeptidase activity			ovary(2)|skin(2)|central_nervous_system(1)	5	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	AGGAACGATCTTTAGAAAGGG	0.502													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	2130021	2130021	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2130021delA								DCP1B (16344 upstream) : CACNA1C (32395 downstream)																							cttggccatgaagaactcatt	0.000													4	2	---	---	---	---	
CACNA1C	775	broad.mit.edu	37	12	2656822	2656823	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2656822_2656823delTG	uc009zdu.1	+						CACNA1C_uc009zdv.1_Intron|CACNA1C_uc001qkb.2_Intron|CACNA1C_uc001qkc.2_Intron|CACNA1C_uc001qke.2_Intron|CACNA1C_uc001qkf.2_Intron|CACNA1C_uc001qjz.2_Intron|CACNA1C_uc001qkd.2_Intron|CACNA1C_uc001qkg.2_Intron|CACNA1C_uc009zdw.1_Intron|CACNA1C_uc001qkh.2_Intron|CACNA1C_uc001qkl.2_Intron|CACNA1C_uc001qkn.2_Intron|CACNA1C_uc001qko.2_Intron|CACNA1C_uc001qkp.2_Intron|CACNA1C_uc001qkr.2_Intron|CACNA1C_uc001qku.2_Intron|CACNA1C_uc001qkq.2_Intron|CACNA1C_uc001qks.2_Intron|CACNA1C_uc001qkt.2_Intron|CACNA1C_uc001qka.1_Intron|CACNA1C_uc001qki.1_Intron|CACNA1C_uc001qkj.1_Intron|CACNA1C_uc001qkk.1_Intron|CACNA1C_uc001qkm.1_Intron|CACNA1C_uc009zdy.1_Intron|CACNA1C_uc001qkv.1_Intron	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,						axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	gtatatatgttgtgtgtgtgtg	0.366													8	4	---	---	---	---	
TSPAN9	10867	broad.mit.edu	37	12	3208371	3208372	+	Intron	INS	-	TGT	TGT	rs148853092	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:3208371_3208372insTGT	uc001qlp.2	+							NM_006675	NP_006666	O75954	TSN9_HUMAN	tetraspanin 9							integral to plasma membrane|membrane fraction				ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.00153)|COAD - Colon adenocarcinoma(12;0.0831)			taggttgctgatgttatttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	4117763	4117763	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4117763delT								PARP11 (135155 upstream) : CCND2 (265139 downstream)																							aacctatccattttttttttc	0.070													4	2	---	---	---	---	
ETV6	2120	broad.mit.edu	37	12	11891105	11891112	+	Intron	DEL	TTGCTTGC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11891105_11891112delTTGCTTGC	uc001qzz.2	+							NM_001987	NP_001978	P41212	ETV6_HUMAN	ets variant 6							cytoplasm|nucleolus	protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		ETV6/NTRK3(234)|ETV6/JAK2(11)	soft_tissue(85)|kidney(66)|breast(55)|salivary_gland(26)|haematopoietic_and_lymphoid_tissue(13)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)|pancreas(1)	250		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CTCTGCTAGTttgcttgcttgcttgctt	0.212			T	NTRK3|RUNX1|PDGFRB|ABL1|MN1|ABL2|FACL6|CHIC2|ARNT|JAK2|EVI1|CDX2|STL|HLXB9|MDS2|PER1|SYK|TTL|FGFR3|PAX5	congenital fibrosarcoma|multiple leukemia and lymphoma| secretory breast|MDS|ALL								4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	19028292	19028292	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19028292delT								CAPZA3 (136171 upstream) : PLEKHA5 (254356 downstream)																							GCTTTGTAGCTTTGTAGGCAA	0.398													4	2	---	---	---	---	
RASSF8	11228	broad.mit.edu	37	12	26123030	26123031	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:26123030_26123031insT	uc001rgx.2	+						RASSF8_uc001rgy.2_Intron|RASSF8_uc001rgz.2_Intron|RASSF8_uc001rgw.1_Intron	NM_007211	NP_009142	Q8NHQ8	RASF8_HUMAN	Ras association (RalGDS/AF-6) domain family						signal transduction						0	Colorectal(261;0.0847)					TACGACCCCACTTTTTTTTTTT	0.401													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	31928470	31928473	+	IGR	DEL	TCTC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31928470_31928473delTCTC								AMN1 (46362 upstream) : H3F3C (15648 downstream)																							tttctttctttctctctctctctc	0.049													2	4	---	---	---	---	
BICD1	636	broad.mit.edu	37	12	32520461	32520461	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:32520461delA	uc001rku.2	+						BICD1_uc001rkv.2_Intron|BICD1_uc010skd.1_Intron	NM_001714	NP_001705	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 isoform 1						anatomical structure morphogenesis|intracellular mRNA localization|microtubule anchoring at microtubule organizing center|minus-end-directed organelle transport along microtubule|positive regulation of receptor-mediated endocytosis|protein localization to organelle|RNA processing|stress granule assembly|viral reproduction	cytoplasmic vesicle|cytoskeleton|cytosol|host cell viral assembly compartment|membrane|perinuclear region of cytoplasm|trans-Golgi network	cytoskeletal adaptor activity|dynactin binding|dynein binding|proteinase activated receptor binding|Rab GTPase binding|structural constituent of cytoskeleton			large_intestine(1)|central_nervous_system(1)	2	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ATTCAAGAAGAAAAAAAAAAA	0.343													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	45317664	45317664	+	IGR	DEL	T	-	-	rs11342828		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:45317664delT								NELL2 (9953 upstream) : DBX2 (90875 downstream)																							ctgggtgatcttttttttttt	0.000													2	4	---	---	---	---	
LIMA1	51474	broad.mit.edu	37	12	50667463	50667463	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50667463delA	uc001rwj.3	-						LIMA1_uc001rwk.3_Intron|LIMA1_uc010smr.1_Intron|LIMA1_uc010sms.1_Intron	NM_016357	NP_057441	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1 isoform b						actin filament bundle assembly|negative regulation of actin filament depolymerization|ruffle organization	cytoplasm|focal adhesion|stress fiber	actin filament binding|actin monomer binding|zinc ion binding			ovary(1)	1						GCTGTTGCTGAAAATCTTTCT	0.279													4	2	---	---	---	---	
FLJ12825	440101	broad.mit.edu	37	12	54477618	54477619	+	Intron	DEL	AG	-	-	rs35892658		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54477618_54477619delAG	uc001sey.2	+						LOC100240735_uc010sor.1_5'Flank	NR_026655				Homo sapiens cDNA FLJ12825 fis, clone NT2RP2002800.												0						TCagagagacagagagagagag	0.327													4	3	---	---	---	---	
DCD	117159	broad.mit.edu	37	12	55038409	55038412	+	3'UTR	DEL	TTTT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55038409_55038412delTTTT	uc001sgj.2	-	5					DCD_uc009znt.2_3'UTR|DCD_uc009znu.2_RNA	NM_053283	NP_444513	P81605	DCD_HUMAN	dermcidin preproprotein						defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular region	protein binding			ovary(1)	1		Myeloproliferative disorder(1001;0.0255)				CTGTTTTAAAtttttttttttttt	0.373													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	55196318	55196319	+	IGR	INS	-	C	C	rs149977995	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:55196318_55196319insC								DCD (154169 upstream) : MUCL1 (51980 downstream)																							CCCCAACTCTGCCACTGAAAAG	0.411													2	5	---	---	---	---	
NXPH4	11247	broad.mit.edu	37	12	57618616	57618616	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57618616delG	uc010srf.1	+						NXPH4_uc009zpj.2_Intron	NM_007224	NP_009155	O95158	NXPH4_HUMAN	neurexophilin 4 precursor						neuropeptide signaling pathway	extracellular region					0						GCAGGATGGCGGGGGACAACC	0.617													4	2	---	---	---	---	
MSRB3	253827	broad.mit.edu	37	12	65762704	65762704	+	Intron	DEL	C	-	-	rs67548266		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:65762704delC	uc001ssn.2	+						MSRB3_uc001ssm.2_Intron|MSRB3_uc009zqp.2_Intron	NM_198080	NP_932346	Q8IXL7	MSRB3_HUMAN	methionine sulfoxide reductase B3 isoform 1						protein repair	endoplasmic reticulum|mitochondrion	peptide-methionine-(S)-S-oxide reductase activity|protein-methionine-R-oxide reductase activity|zinc ion binding			central_nervous_system(1)|skin(1)	2			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.131)		CCCAACCACACCCCCCCCCCC	0.333													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	80632597	80632598	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80632597_80632598delTG								PPP1R12A (303362 upstream) : PTPRQ (205528 downstream)																							TACACCTATTtgtgtgtgtgtg	0.302													4	2	---	---	---	---	
PTPRQ	374462	broad.mit.edu	37	12	81001927	81001927	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81001927delA	uc001sze.2	+							NM_001145026	NP_001138498			protein tyrosine phosphatase, receptor type, Q												0						gtaggaagagaaaaaaaatag	0.085													4	2	---	---	---	---	
PPFIA2	8499	broad.mit.edu	37	12	81671208	81671208	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81671208delA	uc001szo.1	-						PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_Intron|PPFIA2_uc010suh.1_Intron|PPFIA2_uc010sui.1_Intron|PPFIA2_uc010suj.1_Intron|PPFIA2_uc009zsi.1_Intron|PPFIA2_uc010suf.1_Intron|PPFIA2_uc009zsh.2_Intron	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2											ovary(3)|lung(2)|pancreas(1)	6						tttttttattaaaaaaaaaaa	0.338													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	88627406	88627406	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88627406delA								TMTC3 (33743 upstream) : KITLG (259163 downstream)																							TTGCTTCACCAAAATTGGACA	0.398													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	90379015	90379015	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90379015delG								LOC338758 (273287 upstream) : C12orf12 (966978 downstream)																							TTGACCATTTGGCCACTGACA	0.517													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	90404968	90404968	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:90404968delT								LOC338758 (299240 upstream) : C12orf12 (941025 downstream)																							ATCCTATGTATTGCTGTGAAG	0.289													3	3	---	---	---	---	
BTG1	694	broad.mit.edu	37	12	92509682	92509684	+	Intron	DEL	ATG	-	-	rs112446800		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:92509682_92509684delATG	uc001tbv.1	-						BTG1_uc001tbw.1_Intron|BTG1_uc001tbx.1_Intron|BTG1_uc009zss.1_Intron			P62324	BTG1_HUMAN	Homo sapiens full length insert cDNA clone YW25A12.						cell migration|negative regulation of cell growth|negative regulation of cell proliferation|positive regulation of angiogenesis|positive regulation of endothelial cell differentiation|positive regulation of myoblast differentiation|regulation of apoptosis|regulation of transcription, DNA-dependent	cytoplasm|nucleus	kinase binding|transcription cofactor activity				0		Acute lymphoblastic leukemia(6;3.02e-13)|all_hematologic(6;4.32e-09)				tcatatgaacatgatgtttctcc	0.079			T	MYC	BCLL								0	6	---	---	---	---	
LTA4H	4048	broad.mit.edu	37	12	96429438	96429438	+	5'Flank	DEL	T	-	-	rs17525488		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96429438delT	uc001ten.1	-						LTA4H_uc010suy.1_Intron|LTA4H_uc010suz.1_Intron|LTA4H_uc010sva.1_5'Flank	NM_000895	NP_000886	P09960	LKHA4_HUMAN	leukotriene A4 hydrolase						hormone biosynthetic process|inflammatory response|leukotriene biosynthetic process|peptide catabolic process|prostanoid metabolic process|proteolysis	cytosol|nucleus	aminopeptidase activity|epoxide hydrolase activity|leukotriene-A4 hydrolase activity|metallopeptidase activity|protein binding|zinc ion binding			haematopoietic_and_lymphoid_tissue(1)	1						AGGAAGTTTCTTAAAGTCAGA	0.582													4	7	---	---	---	---	
ALDH1L2	160428	broad.mit.edu	37	12	105432052	105432057	+	Intron	DEL	ACACAA	-	-	rs61938824		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105432052_105432057delACACAA	uc001tlc.2	-						ALDH1L2_uc009zuo.2_Intron|ALDH1L2_uc009zup.2_Intron	NM_001034173	NP_001029345	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2						10-formyltetrahydrofolate catabolic process|biosynthetic process	mitochondrion	acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity|phosphopantetheine binding			skin(1)	1						acacacacacacacaaacacacacac	0.204													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	110099308	110099311	+	IGR	DEL	ATTA	-	-	rs146364635		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110099308_110099311delATTA								MVK (64238 upstream) : C12orf34 (52879 downstream)																							cactattactattaattatcacca	0.000													4	3	---	---	---	---	
TMEM116	89894	broad.mit.edu	37	12	112374330	112374330	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112374330delA	uc001ttc.1	-						TMEM116_uc001ttd.1_Intron|TMEM116_uc001tte.1_Intron|TMEM116_uc001ttf.1_Intron|TMEM116_uc001ttg.1_Intron|TMEM116_uc001tth.1_Intron|TMEM116_uc001tti.1_3'UTR	NM_138341	NP_612350	Q8NCL8	TM116_HUMAN	transmembrane protein 116							integral to membrane				ovary(1)	1						GGGGAAGTGCAAAAGTCTGAG	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116054223	116054223	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116054223delC								TBX3 (932254 upstream) : MED13L (342160 downstream)																							gacgtgagcaccaggcccatc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	116354482	116354482	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116354482delT								None (None upstream) : MED13L (41901 downstream)																							taccacaacattttaaaaaaC	0.184													4	2	---	---	---	---	
C12orf49	79794	broad.mit.edu	37	12	117175337	117175345	+	Intron	DEL	GAGGAAGGT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117175337_117175345delGAGGAAGGT	uc001tvz.1	-						RNFT2_uc009zwn.2_5'Flank|RNFT2_uc001twb.3_5'Flank|RNFT2_uc001twa.3_5'Flank|C12orf49_uc009zwm.1_Intron	NM_024738	NP_079014	Q9H741	CL049_HUMAN	hypothetical protein LOC79794 precursor							extracellular region				ovary(1)	1	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0281)		aaggaaggaggaggaaggtgaggaaggta	0.000													1	8	---	---	---	---	
DHX37	57647	broad.mit.edu	37	12	125457956	125457957	+	Intron	INS	-	A	A	rs76855333		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125457956_125457957insA	uc001ugy.2	-							NM_032656	NP_116045	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37								ATP binding|ATP-dependent helicase activity|nucleic acid binding|protein binding			skin(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		tctcaaaaaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	126986389	126986389	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:126986389delA								LOC100128554 (29059 upstream) : None (None downstream)																							TGTCTGGTGCAATTGGCACAC	0.433													4	2	---	---	---	---	
ZDHHC20	253832	broad.mit.edu	37	13	21951414	21951415	+	Intron	DEL	CT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:21951414_21951415delCT	uc001uob.2	-						ZDHHC20_uc001uod.2_Intron|ZDHHC20_uc001uoc.2_Intron|ZDHHC20_uc001uoe.2_Intron|ZDHHC20_uc010tcs.1_Intron|uc001uoa.1_5'Flank	NM_153251	NP_694983	Q5W0Z9	ZDH20_HUMAN	zinc finger, DHHC-type containing 20							integral to membrane	acyltransferase activity|zinc ion binding			ovary(1)	1		all_cancers(29;8.1e-16)|all_epithelial(30;3.63e-14)|all_lung(29;2.04e-13)|Lung SC(185;0.0367)		all cancers(112;0.000268)|Epithelial(112;0.000735)|OV - Ovarian serous cystadenocarcinoma(117;0.00517)|Lung(94;0.171)		TGCGATCTGACTCTGCCCGACG	0.639													4	2	---	---	---	---	
LOC374491	374491	broad.mit.edu	37	13	25169014	25169015	+	Intron	INS	-	TAG	TAG			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:25169014_25169015insTAG	uc001upm.2	+						LOC374491_uc001upn.2_Intron|LOC374491_uc001upo.2_Intron					Homo sapiens mRNA; cDNA DKFZp434J0717 (from clone DKFZp434J0717).												0						actgactggaaagagagttagg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27639436	27639438	+	IGR	DEL	TTA	-	-	rs71748225		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27639436_27639438delTTA								GPR12 (304514 upstream) : USP12 (3000 downstream)																							ACAGATGCAGTTATTATAGAAAA	0.340													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	27875069	27875072	+	IGR	DEL	CAAA	-	-	rs71766056		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:27875069_27875072delCAAA								RASL11A (27242 upstream) : GTF3A (123609 downstream)																							gactccatctcaaacaaacaaaca	0.186													2	4	---	---	---	---	
MTUS2	23281	broad.mit.edu	37	13	29756782	29756782	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29756782delT	uc001usl.3	+							NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a							cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						tcaagtttactttctagcaga	0.000													4	2	---	---	---	---	
FRY	10129	broad.mit.edu	37	13	32737046	32737046	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:32737046delA	uc001utx.2	+						FRY_uc010tdw.1_Intron	NM_023037	NP_075463	Q5TBA9	FRY_HUMAN	furry homolog						regulation of transcription, DNA-dependent|transcription, DNA-dependent	integral to membrane				ovary(5)|large_intestine(1)|skin(1)	7		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		ATCCTGGATCAAAAAGGGCTT	0.453													4	2	---	---	---	---	
LOC646982	646982	broad.mit.edu	37	13	40958610	40958612	+	Intron	DEL	TTG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:40958610_40958612delTTG	uc010tfa.1	-						LOC646982_uc001uxj.3_Intron	NR_024507				Homo sapiens cDNA, FLJ17553.												0						CCATCttgttttgttgttgttgt	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55874960	55874961	+	IGR	INS	-	GTGT	GTGT	rs150756854	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55874960_55874961insGTGT								MIR1297 (988777 upstream) : None (None downstream)																							cttctgtgtgagtgtgtgtgtg	0.144													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	63602940	63602944	+	IGR	DEL	GTTGT	-	-	rs77627658		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:63602940_63602944delGTTGT								None (None upstream) : OR7E156P (708624 downstream)																							TGTAAACTTGGTTGTAATGACTGCA	0.332													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66413548	66413548	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66413548delA								None (None upstream) : PCDH9 (463419 downstream)																							CTAATCATCTAGTCGTACTGA	0.358													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	66551534	66551534	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:66551534delG								None (None upstream) : PCDH9 (325433 downstream)																							atctggcacaggaaatttcta	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	78754987	78754987	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78754987delA	uc001vks.2	+						uc001vku.1_Intron					Homo sapiens cDNA FLJ38460 fis, clone FEBRA2020801.																		aattatagggagacaacaagg	0.000													4	2	---	---	---	---	
PCCA	5095	broad.mit.edu	37	13	100743246	100743247	+	Intron	INS	-	GAG	GAG	rs144611797	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:100743246_100743247insGAG	uc001voo.2	+						PCCA_uc010aga.2_Intron|PCCA_uc010tiz.1_Intron	NM_000282	NP_000273	P05165	PCCA_HUMAN	propionyl-Coenzyme A carboxylase, alpha						fatty acid beta-oxidation	mitochondrial matrix	ATP binding|biotin binding|biotin carboxylase activity|enzyme binding|metal ion binding|propionyl-CoA carboxylase activity			skin(2)	2	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	tctaacaaacagagatgaatgt	0.010													2	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	20243038	20243038	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20243038delT								OR4Q3 (26512 upstream) : OR4M1 (5444 downstream)																							tcagctgtggttagaatgaag	0.015													4	2	---	---	---	---	
RPGRIP1	57096	broad.mit.edu	37	14	21780852	21780852	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21780852delT	uc001wag.2	+							NM_020366	NP_065099	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator						response to stimulus|visual perception	cilium				ovary(4)|breast(2)|pancreas(1)	7	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		gcatatcctCttttttttttt	0.005													4	2	---	---	---	---	
REM2	161253	broad.mit.edu	37	14	23353108	23353109	+	Intron	INS	-	CA	CA	rs140602886	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23353108_23353109insCA	uc001whf.1	+						REM2_uc010tnd.1_Intron	NM_173527	NP_775798	Q8IYK8	REM2_HUMAN	rad and gem related GTP binding protein 2						regulation of transcription, DNA-dependent|small GTPase mediated signal transduction	intracellular|plasma membrane	ATP binding|GTP binding|transcription factor binding			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;4.69e-05)			GBM - Glioblastoma multiforme(265;0.012)		TCCCTTTCGCTcacacacacac	0.446													2	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	25730402	25730403	+	IGR	DEL	AC	-	-	rs71449245		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:25730402_25730403delAC								STXBP6 (211231 upstream) : None (None downstream)																							ccccatctcaacacacacacac	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	26790836	26790836	+	IGR	DEL	T	-	-	rs113846976		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:26790836delT								None (None upstream) : NOVA1 (124254 downstream)																							TCTTATTTTGTTCTTATTTCA	0.209													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	28169732	28169733	+	IGR	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:28169732_28169733delCA								None (None upstream) : None (None downstream)																							cgtgcacgcgcacacacacaca	0.000													6	3	---	---	---	---	
AKAP6	9472	broad.mit.edu	37	14	32877458	32877458	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:32877458delA	uc001wrq.2	+						AKAP6_uc010aml.2_Intron	NM_004274	NP_004265	Q13023	AKAP6_HUMAN	A-kinase anchor protein 6						protein targeting	calcium channel complex|nuclear membrane|sarcoplasmic reticulum	protein kinase A binding|receptor binding			breast(6)|ovary(5)|lung(4)|skin(3)|large_intestine(2)|pancreas(1)	21	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		GAAGGAGGGGAAAAGAACAAA	0.408													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	36522046	36522047	+	IGR	INS	-	G	G	rs146180762	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:36522046_36522047insG								BRMS1L (180878 upstream) : MBIP (245717 downstream)																							AAAGGCAGAGCGGTGAACACAC	0.351													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	45338608	45338609	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:45338608_45338609delTG								FSCB (362109 upstream) : C14orf28 (27898 downstream)																							tgtgtgtgtatgtgtgtgtgtg	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	48161119	48161127	+	IGR	DEL	TTTCTCTTT	-	-	rs57327577		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:48161119_48161127delTTTCTCTTT								MDGA2 (17131 upstream) : None (None downstream)																							tttttctttctttctcttttctttctttc	0.081													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	49920916	49920916	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:49920916delC								None (None upstream) : SDCCAG1 (112111 downstream)																							CCCCTTTACTCCACTCCTATC	0.448													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	52754676	52754677	+	IGR	DEL	AA	-	-	rs71444753		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:52754676_52754677delAA								PTGDR (11235 upstream) : PTGER2 (26339 downstream)																							ATGTTAAGCCaaaaaaaaaaaa	0.307													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	60411550	60411550	+	Intron	DEL	T	-	-	rs35724288		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:60411550delT	uc001xep.1	+											Homo sapiens cDNA FLJ46156 fis, clone TESTI4001569.																		AAATTATGTATATacacacat	0.219													4	2	---	---	---	---	
KCNH5	27133	broad.mit.edu	37	14	63531138	63531139	+	Intron	INS	-	AGG	AGG	rs67842381		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:63531138_63531139insAGG	uc001xfz.1	-						KCNH5_uc001xga.2_Intron	NM_172376	NP_758964	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H,						regulation of transcription, DNA-dependent	integral to membrane	calmodulin binding|two-component sensor activity|voltage-gated potassium channel activity			ovary(4)|skin(4)|central_nervous_system(1)	9				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		gtggggaaggaagaagagacag	0.109													5	5	---	---	---	---	
LOC645431	645431	broad.mit.edu	37	14	65877835	65877835	+	3'UTR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65877835delT	uc001xim.3	-	1					FUT8_uc001xin.2_5'Flank|FUT8_uc001xio.2_5'Flank|FUT8_uc010tsp.1_5'Flank|FUT8_uc001xir.3_5'Flank|FUT8_uc001xip.2_5'Flank|FUT8_uc001xiq.2_5'Flank	NR_024334				SubName: Full=HCG2028511; SubName: Full=Full-length cDNA clone CS0DC006YG08 of Neuroblastoma of Homo sapiens (human);												0						TTTGTCCTGCTTATACGTTTA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	78127578	78127579	+	IGR	INS	-	G	G	rs143809804	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:78127578_78127579insG								SPTLC2 (44468 upstream) : ALKBH1 (11170 downstream)																							TTTTGTTTGTTGGGGGGGGGTG	0.564													6	3	---	---	---	---	
NRXN3	9369	broad.mit.edu	37	14	79142431	79142431	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:79142431delT	uc001xun.2	+						NRXN3_uc001xum.1_Intron|NRXN3_uc010asv.1_Intron	NM_004796	NP_004787	Q9Y4C0	NRX3A_HUMAN	neurexin 3 isoform 1 precursor						axon guidance|cell adhesion	integral to plasma membrane	metal ion binding|receptor activity			ovary(3)|upper_aerodigestive_tract(2)|pancreas(2)|central_nervous_system(1)|breast(1)|skin(1)	10		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ggtttccctattctctttgat	0.000													4	2	---	---	---	---	
TSHR	7253	broad.mit.edu	37	14	81572069	81572069	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81572069delA	uc001xvd.1	+						TSHR_uc001xvb.1_Intron|TSHR_uc001xvc.2_Intron|TSHR_uc010tvs.1_Intron	NM_000369	NP_000360	P16473	TSHR_HUMAN	thyroid stimulating hormone receptor isoform 1						cell-cell signaling|positive regulation of cell proliferation	integral to plasma membrane	protein binding|thyroid-stimulating hormone receptor activity			thyroid(289)|ovary(5)|lung(3)|kidney(1)|skin(1)	299				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	AATAATTTCTAATGATTAGAA	0.353			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism 						4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	86456323	86456324	+	IGR	INS	-	AGTT	AGTT	rs150791873	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:86456323_86456324insAGTT								FLRT2 (362054 upstream) : None (None downstream)																							ATTCTGTAGTCGGTGTTTATTT	0.396													4	5	---	---	---	---	
TTC7B	145567	broad.mit.edu	37	14	91103313	91103314	+	Intron	INS	-	A	A	rs74799200		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91103313_91103314insA	uc001xyp.2	-						TTC7B_uc001xyo.2_Intron|TTC7B_uc010ats.2_Intron	NM_001010854	NP_001010854	Q86TV6	TTC7B_HUMAN	tetratricopeptide repeat domain 7B								binding			ovary(2)	2		Melanoma(154;0.222)				aagagattaagaaaaaaaaaaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	93368729	93368730	+	IGR	DEL	CT	-	-	rs111421122	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93368729_93368730delCT								GOLGA5 (62425 upstream) : CHGA (20715 downstream)																							cctcttcctcctctcctcctcc	0.144													4	3	---	---	---	---	
DDX24	57062	broad.mit.edu	37	14	94544972	94544972	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94544972delC	uc001ycj.2	-						DDX24_uc010twq.1_Intron|DDX24_uc010twr.1_Intron|IFI27L1_uc001ycl.2_5'Flank|IFI27L1_uc001yck.2_5'Flank	NM_020414	NP_065147	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 24						RNA metabolic process	cytoplasm|nucleolus|nucleolus	ATP binding|ATP-dependent RNA helicase activity|protein binding|RNA binding			ovary(2)|kidney(1)|skin(1)	4		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		atctacctctccaaagggctg	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	99039617	99039618	+	IGR	DEL	AC	-	-	rs34261867		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:99039617_99039618delAC								C14orf64 (595156 upstream) : C14orf177 (138332 downstream)																							GTGGCATATGacacacacacac	0.406													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20437049	20437050	+	IGR	DEL	AC	-	-	rs9744130		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20437049_20437050delAC								None (None upstream) : GOLGA6L6 (300044 downstream)																							ccctctctctacacacacacac	0.079													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20584369	20584369	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20584369delT								None (None upstream) : GOLGA6L6 (152725 downstream)																							CTTCCTACTGTTTTTTTTCCC	0.234													4	5	---	---	---	---	
SNORD116-4	100033416	broad.mit.edu	37	15	25327405	25327406	+	Intron	INS	-	T	T	rs145873311	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25327405_25327406insT	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|SNORD116-16_uc001yya.2_5'Flank|IPW_uc001yyb.3_5'Flank|SNORD116-19_uc001yyc.2_5'Flank|uc001yyd.2_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CACAGGAAGAGTTTTTTTTTTC	0.421													3	3	---	---	---	---	
UBE3A	7337	broad.mit.edu	37	15	25586222	25586222	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25586222delT	uc001zaq.2	-						uc001zae.2_Intron|UBE3A_uc001zar.2_Intron|UBE3A_uc001zas.2_Intron|UBE3A_uc001zat.2_Intron	NM_000462	NP_000453	Q05086	UBE3A_HUMAN	ubiquitin protein ligase E3A isoform 2						brain development|interspecies interaction between organisms|protein K48-linked ubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus|proteasome complex	protein binding|ubiquitin-protein ligase activity			upper_aerodigestive_tract(1)|ovary(1)|breast(1)	3		all_cancers(20;3.47e-21)|Breast(32;0.00123)		all cancers(64;2.78e-08)|Epithelial(43;8.85e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0155)|Lung(196;0.0616)		GCTAAATAAAttttttttttt	0.129													4	2	---	---	---	---	
OCA2	4948	broad.mit.edu	37	15	28016075	28016077	+	Intron	DEL	TCC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28016075_28016077delTCC	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ctccctcttttcctttcttcctt	0.000									Oculocutaneous_Albinism				6	3	---	---	---	---	
OCA2	4948	broad.mit.edu	37	15	28138603	28138603	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28138603delA	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		ggggtcaggcaaaaagagcca	0.000									Oculocutaneous_Albinism				4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	36122155	36122155	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:36122155delA	uc001zjc.2	+											Homo sapiens, Similar to LOC161538, clone IMAGE:5199550, mRNA.																		caagagagagaggggaggcgc	0.000													4	2	---	---	---	---	
INO80	54617	broad.mit.edu	37	15	41323761	41323761	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41323761delA	uc001zni.2	-						INO80_uc010ucu.1_Intron	NM_017553	NP_060023	Q9ULG1	INO80_HUMAN	INO80 complex homolog 1						cell division|cellular response to ionizing radiation|cellular response to UV|chromatin remodeling|double-strand break repair via homologous recombination|mitotic sister chromatid segregation|positive regulation of cell growth|positive regulation of DNA replication involved in S phase|positive regulation of transcription from RNA polymerase II promoter|regulation of G1/S transition of mitotic cell cycle|spindle assembly|UV-damage excision repair	Ino80 complex|microtubule	actin binding|alpha-tubulin binding|ATP binding|ATPase activity|DNA binding|DNA helicase activity			ovary(2)|pancreas(1)|skin(1)	4						ggaagggaggaagggaggaag	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	45689634	45689634	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:45689634delA	uc001zvd.2	-											Homo sapiens cDNA clone IMAGE:5298801.																		ctacgtgatgaaggccccata	0.000													4	2	---	---	---	---	
MYEF2	50804	broad.mit.edu	37	15	48449997	48449998	+	Intron	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:48449997_48449998insA	uc001zwi.3	-						MYEF2_uc001zwj.3_Intron|MYEF2_uc001zwl.2_Intron	NM_016132	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2						transcription, DNA-dependent	Golgi apparatus|nucleus	DNA binding|nucleotide binding|RNA binding			lung(2)|ovary(1)	3		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TTACCAAAGAGAAAAAAAAAAT	0.267													4	2	---	---	---	---	
TMOD3	29766	broad.mit.edu	37	15	52203196	52203197	+	Intron	INS	-	C	C	rs143104174	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52203196_52203197insC	uc010bfc.1	+						TMOD3_uc002abn.2_RNA	NM_014547		Q9NYL9	TMOD3_HUMAN	tropomodulin 3 (ubiquitous)							cytoplasm|cytoskeleton	actin binding|tropomyosin binding			ovary(1)	1				all cancers(107;0.00194)		tctttttttTTCCCCGCATATG	0.243													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	56906497	56906497	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56906497delA	uc002ads.2	-											Homo sapiens cDNA clone IMAGE:5275275.																		GAGGCAAAGGAAAAAAAATAC	0.388													4	2	---	---	---	---	
TIPIN	54962	broad.mit.edu	37	15	66629667	66629667	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66629667delT	uc002apr.2	-						TIPIN_uc010ujn.1_Intron|TIPIN_uc010ujo.1_Intron	NM_017858	NP_060328	Q9BVW5	TIPIN_HUMAN	TIMELESS interacting protein						cell division|DNA replication checkpoint|intra-S DNA damage checkpoint|mitosis|positive regulation of cell proliferation|regulation of DNA replication involved in S phase|replication fork protection	cytoplasm|nuclear chromatin	protein binding			ovary(1)	1						TAAATATATCttttttttttt	0.149													4	2	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66695214	66695216	+	Intron	DEL	CAG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66695214_66695216delCAG	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						GCGTTGCTCTCAGTAGCAGTTCT	0.394									Cardiofaciocutaneous_syndrome				4	2	---	---	---	---	
MAP2K1	5604	broad.mit.edu	37	15	66707120	66707120	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66707120delT	uc010bhq.2	+						MAP2K1_uc010ujp.1_Intron	NM_002755	NP_002746	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1						activation of MAPK activity|activation of MAPKK activity|axon guidance|cell cycle arrest|cellular senescence|epidermal growth factor receptor signaling pathway|innate immune response|insulin receptor signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of cell proliferation|nerve growth factor receptor signaling pathway|Ras protein signal transduction|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|plasma membrane	ATP binding|MAP kinase kinase activity|protein serine/threonine kinase activity|protein tyrosine kinase activity				0						atcctgTGTCTTTTTTTTTTT	0.194									Cardiofaciocutaneous_syndrome				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	69182115	69182116	+	IGR	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69182115_69182116insT								ANP32A (68854 upstream) : NOX5 (40748 downstream)																							ttttttttttcttttttttgag	0.000													4	2	---	---	---	---	
NOX5	79400	broad.mit.edu	37	15	69287913	69287914	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69287913_69287914delTG	uc002arp.1	+						NOX5_uc002arq.1_Intron|NOX5_uc010bid.1_Intron|NOX5_uc002aro.2_Intron	NM_024505	NP_078781	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5						angiogenesis|angiogenesis|cytokine secretion|cytokinesis|electron transport chain|endothelial cell proliferation|induction of apoptosis|positive regulation of reactive oxygen species metabolic process|regulation of fusion of sperm to egg plasma membrane|regulation of proton transport|superoxide anion generation	endoplasmic reticulum|endoplasmic reticulum|integral to membrane	calcium ion binding|electron carrier activity|flavin adenine dinucleotide binding|heme binding|hydrogen ion channel activity|NADP binding|superoxide-generating NADPH oxidase activity			breast(1)|pancreas(1)	2						AGTGTACTCCtgtgtgtgtgtg	0.327													4	2	---	---	---	---	
PAQR5	54852	broad.mit.edu	37	15	69676544	69676545	+	Intron	INS	-	G	G			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:69676544_69676545insG	uc002arz.2	+						PAQR5_uc002asa.2_Intron	NM_017705	NP_060175	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V						cell differentiation|multicellular organismal development|oogenesis	integral to membrane	receptor activity|steroid binding			ovary(2)	2						GGAGGGTGAGCGGGGGCCCTCC	0.653													4	2	---	---	---	---	
THSD4	79875	broad.mit.edu	37	15	72027419	72027420	+	Intron	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72027419_72027420delAC	uc002atb.1	+						THSD4_uc010ukg.1_Intron|THSD4_uc002ate.2_Intron	NM_024817	NP_079093	Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4							proteinaceous extracellular matrix	metalloendopeptidase activity			ovary(2)	2						cttgggggttacacacacacac	0.000													4	2	---	---	---	---	
MYO9A	4649	broad.mit.edu	37	15	72286295	72286296	+	Intron	INS	-	A	A	rs34602189		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:72286295_72286296insA	uc002atl.3	-						MYO9A_uc010biq.2_Intron|MYO9A_uc002ato.2_Intron|MYO9A_uc002atn.1_Intron	NM_006901	NP_008832	B2RTY4	MYO9A_HUMAN	myosin IXA						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction|visual perception	cytosol|integral to membrane|unconventional myosin complex	actin binding|ATP binding|GTPase activator activity|metal ion binding|motor activity			ovary(1)|pancreas(1)|skin(1)	3						gacaccgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75702784	75702784	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75702784delA	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						TCAAGTTGAGAAAAAAAAAAA	0.289													4	2	---	---	---	---	
IL16	3603	broad.mit.edu	37	15	81520663	81520664	+	Intron	INS	-	T	T	rs112923774		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:81520663_81520664insT	uc002bgh.3	+						IL16_uc002bgc.2_Intron|IL16_uc010blq.1_Intron|IL16_uc002bge.3_Intron|IL16_uc010unp.1_Intron|IL16_uc002bgg.2_Intron	NM_172217	NP_757366	Q14005	IL16_HUMAN	interleukin 16 isoform 2						immune response|interspecies interaction between organisms|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|extracellular space|nucleus|plasma membrane	cytokine activity			ovary(2)|lung(1)|skin(1)	4						TGTACAACACAttttttttttt	0.257													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	85137326	85137327	+	IGR	INS	-	G	G	rs138586806	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85137326_85137327insG								UBE2Q2P1 (23300 upstream) : ZSCAN2 (6922 downstream)																							GCCTAAACTCTGGGCTGTGTGT	0.470													4	2	---	---	---	---	
AKAP13	11214	broad.mit.edu	37	15	86228693	86228696	+	Intron	DEL	GTGT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86228693_86228696delGTGT	uc002blv.1	+						AKAP13_uc002blu.1_Intron|AKAP13_uc010bnf.1_Intron|AKAP13_uc002blw.1_Intron|AKAP13_uc002blx.1_Intron	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TGTTTAAACCgtgtgtgtgtgtgt	0.118													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	87740233	87740234	+	IGR	INS	-	ATG	ATG	rs77056534		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:87740233_87740234insATG								AGBL1 (167950 upstream) : NCRNA00052 (379926 downstream)																							TCATCAGTCTTATATTAGCCCC	0.490													2	4	---	---	---	---	
SLCO3A1	28232	broad.mit.edu	37	15	92601397	92601398	+	Intron	DEL	GT	-	-	rs71942012		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:92601397_92601398delGT	uc002bqx.2	+						SLCO3A1_uc002bqy.2_Intron|SLCO3A1_uc010boc.1_Intron|SLCO3A1_uc002bqz.1_Intron	NM_013272	NP_037404	Q9UIG8	SO3A1_HUMAN	solute carrier organic anion transporter family,						sodium-independent organic anion transport	integral to membrane|plasma membrane	sodium-independent organic anion transmembrane transporter activity			skin(1)	1	Lung NSC(78;0.0158)|all_lung(78;0.0255)		BRCA - Breast invasive adenocarcinoma(143;0.0841)			GAgtgtgtgagtgtgtgtgtgt	0.262													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	95754658	95754659	+	IGR	INS	-	T	T	rs145789751	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:95754658_95754659insT								MCTP2 (727478 upstream) : LOC145820 (221663 downstream)																							CTCACCTCCACTTTTTTCATAC	0.238													5	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	96505197	96505198	+	IGR	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:96505197_96505198delGT								LOC145820 (454123 upstream) : NR2F2 (363959 downstream)																							TATATATATGgtgtgtgtgtgt	0.158													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	97540836	97540837	+	IGR	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:97540836_97540837delGT								SPATA8 (211992 upstream) : LOC91948 (745009 downstream)																							CTCAAGTTCCgtgtgtgtgtgt	0.332													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	98776505	98776506	+	IGR	INS	-	TG	TG	rs139776669	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:98776505_98776506insTG								ARRDC4 (259438 upstream) : FAM169B (203885 downstream)																							gagagcccagctgtgtgtgtgt	0.000													6	3	---	---	---	---	
ITFG3	83986	broad.mit.edu	37	16	291274	291275	+	Intron	INS	-	AA	AA	rs3074556		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:291274_291275insAA	uc002cgf.2	+						ITFG3_uc010bqr.2_Intron|ITFG3_uc002cgg.2_Intron|ITFG3_uc010uud.1_Intron	NM_032039	NP_114428	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3							integral to membrane				central_nervous_system(1)	1		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				CAAAAAGAAAGAAAAAAAAAAA	0.124													3	3	---	---	---	---	
UNKL	64718	broad.mit.edu	37	16	1413290	1413290	+	3'UTR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1413290delA	uc010brn.1	-	9					GNPTG_uc002clm.2_3'UTR|UNKL_uc002cln.2_3'UTR|UNKL_uc002clo.2_3'UTR|UNKL_uc002clp.2_3'UTR			Q9H9P5	UNKL_HUMAN	SubName: Full=Putative ubiquitin-protein ligase;          EC=6.3.2.19; Flags: Fragment;							cytoplasm|nucleus	ligase activity|nucleic acid binding|zinc ion binding				0		Hepatocellular(780;0.0893)				GCTATAGTGTAAAAAAATTTA	0.274											OREG0023545	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	4	2	---	---	---	---	
C16orf73	254528	broad.mit.edu	37	16	1932617	1932617	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1932617delT	uc010uvr.1	-							NM_001163560	NP_001157032	Q8N635	CP073_HUMAN	hypothetical protein LOC254528 isoform 1						meiosis	cytoplasm					0						ccactgaaacttttttttttt	0.005													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	9499547	9499552	+	IGR	DEL	ACACAA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9499547_9499552delACACAA								C16orf72 (286002 upstream) : GRIN2A (347715 downstream)																							TTACACAtatacacaaacacacatat	0.087													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	14387148	14387151	+	IGR	DEL	TGTG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14387148_14387151delTGTG								MKL2 (26519 upstream) : MIR193B (10673 downstream)																							CTCCCTTCTTtgtgtgtgtgtgtg	0.304													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	18651294	18651295	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18651294_18651295insA								ABCC6P1 (41689 upstream) : RPS15A (142982 downstream)																							aacttcgtctcaaaaaaaaaaa	0.045													4	2	---	---	---	---	
C16orf62	57020	broad.mit.edu	37	16	19585923	19585923	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19585923delT	uc002dgn.1	+						C16orf62_uc002dgo.1_Intron|C16orf62_uc010vas.1_Intron|C16orf62_uc002dgm.1_Intron	NM_020314	NP_064710	Q7Z3J2	CP062_HUMAN	hypothetical protein LOC57020							integral to membrane				ovary(1)	1						aaattgagtcttttttttttt	0.134													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	22698763	22698763	+	IGR	DEL	A	-	-	rs11358720		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:22698763delA								LOC653786 (110577 upstream) : HS3ST2 (127097 downstream)																							cATTCACCCTAAAAAACATAT	0.194													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	24584780	24584781	+	IGR	INS	-	T	T	rs145865989	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:24584780_24584781insT								RBBP6 (599 upstream) : TNRC6A (156268 downstream)																							TTGAGATAATCTTTTTTTTTCT	0.262													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	25509461	25509462	+	IGR	INS	-	T	T	rs138844474	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25509461_25509462insT								ZKSCAN2 (240606 upstream) : HS3ST4 (193885 downstream)																							TTTAGCAAGGGTTACACCTAAA	0.361													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	26812421	26812422	+	IGR	DEL	TG	-	-	rs1403133		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:26812421_26812422delTG								HS3ST4 (663413 upstream) : C16orf82 (265797 downstream)																							GACTGCAgtatgtgtgtgtgtg	0.124													4	2	---	---	---	---	
SEZ6L2	26470	broad.mit.edu	37	16	29898789	29898789	+	Intron	DEL	T	-	-	rs34805858		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:29898789delT	uc002duq.3	-						uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|SEZ6L2_uc002dup.3_Intron|SEZ6L2_uc002dur.3_Intron|SEZ6L2_uc002dus.3_Intron|SEZ6L2_uc010vec.1_Intron|SEZ6L2_uc010ved.1_Intron	NM_201575	NP_963869	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2 isoform							endoplasmic reticulum membrane|integral to membrane|plasma membrane				ovary(1)|skin(1)	2						gcccggctaattttttttttt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32094099	32094099	+	IGR	DEL	T	-	-	rs147968620		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32094099delT								ZNF267 (165473 upstream) : HERC2P4 (68511 downstream)																							TAAATGACAATGAATTTTTTT	0.388													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32547182	32547182	+	IGR	DEL	A	-	-	rs113245414		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32547182delA								HERC2P4 (383308 upstream) : TP53TG3B (137659 downstream)																							ctgctgaatgaaaaaaaagtt	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32558547	32558547	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32558547delT								HERC2P4 (394673 upstream) : TP53TG3B (126294 downstream)																							agagttaaacttttttttgat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	32817180	32817184	+	IGR	DEL	TCATT	-	-	rs150203838		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:32817180_32817184delTCATT								TP53TG3B (128302 upstream) : SLC6A10P (71613 downstream)																							tcttttcatctcatttcatcatttc	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33518168	33518168	+	IGR	DEL	A	-	-	rs112671678		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33518168delA								SLC6A10P (621705 upstream) : MIR1826 (447340 downstream)																							catttacactaaaagccacaa	0.030													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33867865	33867865	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33867865delT								SLC6A10P (971402 upstream) : MIR1826 (97643 downstream)																							attgtgccactgtgctacaac	0.010													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33955520	33955525	+	IGR	DEL	TCTCTA	-	-	rs144884855		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33955520_33955525delTCTCTA								None (None upstream) : MIR1826 (9983 downstream)																							tctctctctctctctatctctcactc	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	50448391	50448398	+	IGR	DEL	TTTTTTTC	-	-	rs144311752		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:50448391_50448398delTTTTTTTC								BRD7 (45562 upstream) : NKD1 (133843 downstream)																							tttttttttttttttttccaaagaaatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54279977	54279980	+	IGR	DEL	GTGT	-	-	rs139856529		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54279977_54279980delGTGT								FTO (131599 upstream) : IRX3 (37232 downstream)																							gtgtgagacagtgtgtaagtatcc	0.181													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	54971945	54971945	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:54971945delC								IRX5 (3552 upstream) : IRX6 (386526 downstream)																							GTCTTAAGAGCTTTTGGCCTG	0.488											OREG0023803	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	57908934	57908934	+	IGR	DEL	T	-	-	rs80120466		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57908934delT								KIFC3 (12201 upstream) : CNGB1 (7310 downstream)																							tttttttttctttttttttta	0.134													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	64908333	64908336	+	IGR	DEL	TTTC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:64908333_64908336delTTTC								None (None upstream) : CDH11 (72349 downstream)																							ttcctttctttttctttctttctt	0.083													4	2	---	---	---	---	
PMFBP1	83449	broad.mit.edu	37	16	72163921	72163921	+	Intron	DEL	T	-	-	rs67023960		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72163921delT	uc002fcc.3	-						PMFBP1_uc002fcd.2_Intron|PMFBP1_uc002fce.2_Intron|PMFBP1_uc002fcf.2_Intron|PMFBP1_uc010cgo.1_5'Flank	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1											ovary(2)	2		Ovarian(137;0.179)				aatgtttgtattttttttttt	0.000													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	74298035	74298035	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74298035delA								None (None upstream) : PSMD7 (32646 downstream)																							CATCGACCTTAAAAAGGACAA	0.323													4	2	---	---	---	---	
CNTNAP4	85445	broad.mit.edu	37	16	76427584	76427585	+	Intron	INS	-	A	A	rs74368492		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76427584_76427585insA	uc002feu.1	+						CNTNAP4_uc002fev.1_Intron|CNTNAP4_uc010chb.1_Intron|CNTNAP4_uc002fex.1_Intron|CNTNAP4_uc002few.2_Intron	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1						cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						ATTCCTGGCAGAAAAAAAAAAA	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	79663723	79663724	+	IGR	DEL	CA	-	-	rs71760472		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:79663723_79663724delCA								MAF (29101 upstream) : DYNLRB2 (911130 downstream)																							CTCTCTCTTGcacacacacaca	0.342													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	80291120	80291121	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:80291120_80291121delTG								MAF (656498 upstream) : DYNLRB2 (283733 downstream)																							tgtgtgtgtctgtgtgtgtgtg	0.149													4	2	---	---	---	---	
OSGIN1	29948	broad.mit.edu	37	16	83985365	83985368	+	Intron	DEL	TCCA	-	-	rs112848396	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83985365_83985368delTCCA	uc002fha.2	+						OSGIN1_uc002fhb.2_Intron|OSGIN1_uc002fhc.2_5'Flank	NM_013370	NP_037502	Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1						cell differentiation|multicellular organismal development|negative regulation of cell growth		growth factor activity				0						ctccctgccttccaccctccttcc	0.216													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	85438299	85438299	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85438299delC								FAM92B (292185 upstream) : KIAA0182 (206730 downstream)																							TACACTCAGGCCCCCCGGATA	0.592													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	86154419	86154420	+	IGR	INS	-	CC	CC	rs59055658		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:86154419_86154420insCC								IRF8 (198210 upstream) : LOC732275 (211036 downstream)																							ctcctcctcctcttcctcctcc	0.168													4	2	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2934618	2934619	+	Intron	INS	-	T	T	rs138961407	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2934618_2934619insT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						AGGTGGGAAGGGCTGGTTCCTG	0.624													3	3	---	---	---	---	
ALOX15	246	broad.mit.edu	37	17	4540715	4540715	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4540715delA	uc002fyh.2	-						ALOX15_uc010vsd.1_Intron|ALOX15_uc010vse.1_Intron	NM_001140	NP_001131	P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase						inflammatory response|leukotriene biosynthetic process	nucleus	arachidonate 15-lipoxygenase activity|iron ion binding|lipoxygenase activity			skin(3)|ovary(1)|lung(1)	5				READ - Rectum adenocarcinoma(115;0.0327)	Ciclopirox(DB01188)|Masoprocol(DB00179)|Zileuton(DB00744)	ttttttttttaatcagggtct	0.055													4	2	---	---	---	---	
STX8	9482	broad.mit.edu	37	17	9282136	9282137	+	Intron	INS	-	A	A	rs139246965	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:9282136_9282137insA	uc002glx.2	-							NM_004853	NP_004844	Q9UNK0	STX8_HUMAN	syntaxin 8						transport	endoplasmic reticulum|integral to plasma membrane				central_nervous_system(1)	1						ATTGTAAAAGGAAAAAAAAAAG	0.228													4	2	---	---	---	---	
SCO1	6341	broad.mit.edu	37	17	10595558	10595558	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10595558delC	uc002gmr.3	-						SCO1_uc002gms.3_Intron	NM_004589	NP_004580	O75880	SCO1_HUMAN	cytochrome oxidase deficient homolog 1						cellular copper ion homeostasis|copper ion transport|generation of precursor metabolites and energy|respiratory chain complex IV assembly	mitochondrial inner membrane	copper ion binding				0						AAATGTTCTTCCCCTGGATAA	0.403													4	2	---	---	---	---	
COX10	1352	broad.mit.edu	37	17	14027251	14027251	+	Intron	DEL	T	-	-	rs3837821		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:14027251delT	uc002gof.3	+						COX10_uc010vvs.1_Intron|COX10_uc010vvt.1_Intron	NM_001303	NP_001294	Q12887	COX10_HUMAN	heme A:farnesyltransferase precursor						heme a biosynthetic process|heme O biosynthetic process|respiratory chain complex IV assembly	integral to membrane|mitochondrial membrane	protoheme IX farnesyltransferase activity				0		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		GTATCAAGTATTTTTTTTTCC	0.318													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	21241974	21241974	+	IGR	DEL	C	-	-	rs112465033		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21241974delC								MAP2K3 (23425 upstream) : KCNJ12 (37725 downstream)																							AGTGAGTTCGCTTGTTCGGCT	0.333													5	5	---	---	---	---	
KCNJ12	3768	broad.mit.edu	37	17	21311149	21311150	+	Intron	INS	-	C	C	rs139435686		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:21311149_21311150insC	uc002gyv.1	+							NM_021012	NP_066292	Q14500	IRK12_HUMAN	potassium inwardly-rectifying channel, subfamily						blood circulation|muscle contraction|regulation of heart contraction|synaptic transmission	integral to membrane	inward rectifier potassium channel activity|ion channel inhibitor activity|potassium channel regulator activity			ovary(3)|skin(1)	4				Colorectal(15;0.0183)|COAD - Colon adenocarcinoma(3;0.0732)	Dofetilide(DB00204)	tcatccatccttcctccataca	0.000										Prostate(3;0.18)			6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25269114	25269114	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25269114delA								None (None upstream) : WSB1 (351992 downstream)																							TAGGTCTGTGAAAAAAATGAG	0.264													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	25291422	25291422	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:25291422delC								None (None upstream) : WSB1 (329684 downstream)																							acataaaatacactaatgcta	0.060													9	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	27204585	27204585	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27204585delT								MIR144 (15949 upstream) : FLOT2 (1773 downstream)																							tgtttttttcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	36835462	36835462	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36835462delT								C17orf96 (4275 upstream) : MLLT6 (26411 downstream)																							tttctttttcttttttttttg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	44980157	44980159	+	IGR	DEL	TGA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:44980157_44980159delTGA								WNT9B (16061 upstream) : GOSR2 (20327 downstream)																							gccctggttttgatcagataccc	0.064													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	46791072	46791072	+	IGR	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46791072delA								MIR196A1 (81151 upstream) : PRAC (8020 downstream)																							actccttctcaaaaaaaaaaa	0.224													6	3	---	---	---	---	
EPX	8288	broad.mit.edu	37	17	56281883	56281883	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56281883delA	uc002ivq.2	+							NM_000502	NP_000493	P11678	PERE_HUMAN	eosinophil peroxidase preproprotein						hydrogen peroxide catabolic process		heme binding|peroxidase activity|protein binding			ovary(2)	2						TTAGGTCTCTAAGCAGAGAAA	0.537													4	2	---	---	---	---	
HSF5	124535	broad.mit.edu	37	17	56509697	56509697	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56509697delC	uc002iwi.1	-							NM_001080439	NP_001073908	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Medulloblastoma(34;0.127)|all_neural(34;0.237)					agaagaaaaacaaagaagaat	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	59746081	59746082	+	IGR	INS	-	TG	TG	rs35571293		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:59746081_59746082insTG								NACA2 (77518 upstream) : BRIP1 (13903 downstream)																							acacccaactttgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	60971338	60971338	+	IGR	DEL	G	-	-	rs66792634		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60971338delG								MARCH10 (85633 upstream) : MIR633 (50238 downstream)																							AGGTAGGGATGGGGGAGGCGG	0.542													4	3	---	---	---	---	
SMCHD1	23347	broad.mit.edu	37	18	2751166	2751167	+	Intron	INS	-	AT	AT	rs148373283	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:2751166_2751167insAT	uc002klm.3	+						SMCHD1_uc002klk.3_Intron|SMCHD1_uc002kll.3_Intron	NM_015295	NP_056110	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible						chromosome organization		ATP binding				0						ATTTAAATAACGTGTGCTTTAA	0.267													3	3	---	---	---	---	
ZFP161	7541	broad.mit.edu	37	18	5295047	5295047	+	Intron	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5295047delG	uc002kmq.2	-						ZFP161_uc002kmr.2_Intron|ZFP161_uc010dkp.2_Intron	NM_003409	NP_003400	O43829	ZF161_HUMAN	zinc finger protein 161 homolog						negative regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						GGTGGTGAAAGGGCCACTTTC	0.537													4	2	---	---	---	---	
L3MBTL4	91133	broad.mit.edu	37	18	5991986	5991989	+	Intron	DEL	CATC	-	-	rs143779417		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5991986_5991989delCATC	uc002kmz.3	-						L3MBTL4_uc010dkt.2_Intron|L3MBTL4_uc002kmy.3_Intron	NM_173464	NP_775735	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4						chromatin modification	nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)|pancreas(1)	3		Colorectal(10;0.0249)				ccatccagtgcatccatccatcca	0.324													3	3	---	---	---	---	
PTPRM	5797	broad.mit.edu	37	18	7897698	7897698	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7897698delA	uc002knn.3	+						PTPRM_uc010dkv.2_Intron	NM_002845	NP_002836	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M						homophilic cell adhesion|negative regulation of angiogenesis|negative regulation of endothelial cell migration|negative regulation of endothelial cell proliferation|response to drug|retina layer formation|retinal ganglion cell axon guidance	cell-cell adherens junction|integral to plasma membrane|lamellipodium|perinuclear region of cytoplasm	cadherin binding|transmembrane receptor protein tyrosine phosphatase activity			lung(3)|ovary(2)|central_nervous_system(1)	6		Colorectal(10;0.234)				GATAAAGGATAAGTACTTCTA	0.328													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	8462615	8462616	+	IGR	INS	-	GTTT	GTTT	rs148693665	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:8462615_8462616insGTTT								PTPRM (55757 upstream) : RAB12 (146819 downstream)																							CCAGCATCAGGGTTTGGGGATG	0.525													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	12749213	12749213	+	IGR	DEL	G	-	-	rs141456252		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12749213delG								PSMG2 (23476 upstream) : PTPN2 (36268 downstream)																							ACTCCCCTCAGGCCTGGTTCT	0.587													5	8	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13262093	13262094	+	Intron	INS	-	TG	TG	rs67929995		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13262093_13262094insTG	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CCGTGTGGCTCTGTGTGTGGAA	0.639													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15208409	15208412	+	IGR	DEL	CTTG	-	-	rs28528249	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15208409_15208412delCTTG								ANKRD30B (355672 upstream) : LOC644669 (105143 downstream)																							ttcttgtgttcttgctttcttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	15404673	15404674	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:15404673_15404674delTG								LOC644669 (78755 upstream) : None (None downstream)																							ttcaaaacactgtttttgtagt	0.000													5	6	---	---	---	---	
KLHL14	57565	broad.mit.edu	37	18	30300648	30300649	+	Intron	INS	-	A	A	rs148395361	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30300648_30300649insA	uc002kxm.1	-						KLHL14_uc010dmd.1_Intron	NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14							cytosol|endoplasmic reticulum membrane				ovary(1)	1						GTAACTAGAATAAAAAAGGCAT	0.431													2	5	---	---	---	---	
DTNA	1837	broad.mit.edu	37	18	32129083	32129084	+	Intron	DEL	TC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32129083_32129084delTC	uc002kxw.2	+						DTNA_uc002kxu.2_Intron|DTNA_uc010xbx.1_Intron|DTNA_uc002kxv.3_Intron	NM_032975	NP_116757	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 2						neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						TCTTTccctttctctctctctg	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	37664984	37664984	+	Intron	DEL	T	-	-	rs75160857		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:37664984delT	uc002lam.2	+											Homo sapiens cDNA clone IMAGE:4831311.																		tttttcacgattttttttttt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	49814969	49814969	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:49814969delG								None (None upstream) : DCC (51602 downstream)																							GCCCACTTGTGGGCATGCGTA	0.483													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	55560941	55560942	+	IGR	DEL	AG	-	-	rs147241699		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:55560941_55560942delAG								ATP8B1 (161902 upstream) : NEDD4L (150677 downstream)																							ggtgccaaacagagagtgttat	0.000													3	3	---	---	---	---	
CPLX4	339302	broad.mit.edu	37	18	56975774	56975774	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56975774delT	uc002lhy.2	-							NM_181654	NP_857637	Q7Z7G2	CPLX4_HUMAN	complexin 4 precursor						exocytosis|neurotransmitter transport	cell junction|synapse	syntaxin binding			ovary(1)	1		Colorectal(73;0.175)				CTATCAAGACttttttttttt	0.393											OREG0025018	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	2	4	---	---	---	---	
CYB5A	1528	broad.mit.edu	37	18	71931446	71931448	+	Intron	DEL	AAA	-	-	rs66816891		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:71931446_71931448delAAA	uc002lli.2	-						CYB5A_uc002llh.2_Intron	NM_148923	NP_683725	P00167	CYB5_HUMAN	cytochrome b-5 isoform 1						electron transport chain|water-soluble vitamin metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome|mitochondrial outer membrane	aldo-keto reductase (NADP) activity|cytochrome-c oxidase activity|enzyme binding|heme binding				0		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)			Methoxyflurane(DB01028)	actctgtctcaaaaaaaaaaaaa	0.182													3	3	---	---	---	---	
ZNF236	7776	broad.mit.edu	37	18	74679518	74679519	+	Intron	INS	-	GGT	GGT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74679518_74679519insGGT	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		ttggtgttggaggtggtgtgat	0.025													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	76579705	76579706	+	IGR	INS	-	G	G			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76579705_76579706insG								None (None upstream) : SALL3 (160569 downstream)																							GACGGGGAGGAGGGGACCCTCT	0.688													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	77393730	77393732	+	IGR	DEL	GAC	-	-	rs149066391	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77393730_77393732delGAC								NFATC1 (104408 upstream) : CTDP1 (46069 downstream)																							tggtggtgatgacggtggtgatg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3332577	3332579	+	IGR	DEL	CCT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3332577_3332579delCCT								CELF5 (35506 upstream) : NFIC (27037 downstream)																							tccttccttccctccttccttcc	0.000													4	2	---	---	---	---	
PIAS4	51588	broad.mit.edu	37	19	4036771	4036772	+	Intron	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4036771_4036772delCA	uc002lzg.2	+							NM_015897	NP_056981	Q8N2W9	PIAS4_HUMAN	protein inhibitor of activated STAT, 4						positive regulation of protein sumoylation|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|PML body	DNA binding|SUMO ligase activity|ubiquitin protein ligase binding|zinc ion binding			pancreas(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		tctacaccgtcacacacacaca	0.005													3	3	---	---	---	---	
RGL3	57139	broad.mit.edu	37	19	11493983	11493983	+	3'UTR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11493983delC	uc002mrn.2	-	19					EPOR_uc002mrh.2_5'Flank|EPOR_uc002mri.2_Intron|EPOR_uc002mrk.1_Intron|EPOR_uc002mrl.1_Intron|EPOR_uc002mrj.1_Intron|EPOR_uc010xlx.1_Intron|EPOR_uc010xly.1_Intron|RGL3_uc002mrm.2_3'UTR			Q3MIN7	RGL3_HUMAN	SubName: Full=FLJ00153 protein; Flags: Fragment;						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	intracellular				ovary(1)	1						CCTCTTCCCTCCCGCAGCCTG	0.687													4	2	---	---	---	---	
PRDX2	7001	broad.mit.edu	37	19	12908143	12908143	+	Intron	DEL	T	-	-	rs112459805		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12908143delT	uc002mvd.2	-							NM_005809	NP_005800	P32119	PRDX2_HUMAN	peroxiredoxin 2 isoform a						anti-apoptosis|cell redox homeostasis|hydrogen peroxide catabolic process|removal of superoxide radicals		thioredoxin peroxidase activity				0						GTAttttttcttttttttttt	0.224													4	2	---	---	---	---	
CLEC17A	388512	broad.mit.edu	37	19	14693027	14693028	+	5'Flank	INS	-	T	T	rs145956998		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14693027_14693028insT	uc010dzn.1	+						CLEC17A_uc002mzh.1_5'Flank|CLEC17A_uc010xnt.1_5'Flank|CLEC17A_uc010xnu.1_5'Flank|CLEC17A_uc010dzo.1_5'Flank			Q6ZS10	CL17A_HUMAN	SubName: Full=CLEC17A protein;							cell surface|integral to membrane	fucose binding|mannose binding|metal ion binding|receptor activity				0						ttgtaatgccattttttttttt	0.000													3	3	---	---	---	---	
C19orf44	84167	broad.mit.edu	37	19	16617636	16617636	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:16617636delT	uc002neh.1	+						MED26_uc002nee.2_Intron|C19orf44_uc002nef.1_Intron|C19orf44_uc002neg.2_Intron|C19orf44_uc010eai.1_Intron	NM_032207	NP_115583	Q9H6X5	CS044_HUMAN	hypothetical protein LOC84167												0						GGCTTCAACAttttttttttt	0.214													4	3	---	---	---	---	
CPAMD8	27151	broad.mit.edu	37	19	17039580	17039581	+	Intron	DEL	TT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17039580_17039581delTT	uc002nfb.2	-							NM_015692	NP_056507	Q8IZJ3	CPMD8_HUMAN	C3 and PZP-like, alpha-2-macroglobulin domain							extracellular space|plasma membrane	serine-type endopeptidase inhibitor activity			ovary(4)|breast(4)|large_intestine(3)|pancreas(1)|skin(1)	13						TTGCTACATGTTTTTTTTTTTT	0.490													4	3	---	---	---	---	
ZNF738	148203	broad.mit.edu	37	19	21540696	21540698	+	5'Flank	DEL	TTA	-	-	rs2928209	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:21540696_21540698delTTA	uc002nps.3	+						ZNF738_uc002npt.3_5'Flank	NR_027130				SubName: Full=cDNA FLJ14673 fis, clone NT2RP2003714, moderately similar to Zinc finger protein 430;												0						ctgttccttgttattgttgttgt	0.010													4	2	---	---	---	---	
ZNF43	7594	broad.mit.edu	37	19	22015420	22015421	+	Intron	INS	-	CATGCCTGTAATCCCAG	CATGCCTGTAATCCCAG	rs71309636		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22015420_22015421insCATGCCTGTAATCCCAG	uc002nqj.2	-						ZNF43_uc010ecv.2_Intron|ZNF43_uc002nql.2_Intron|ZNF43_uc002nqm.2_Intron|ZNF43_uc002nqk.2_Intron	NM_003423	NP_003414	P17038	ZNF43_HUMAN	zinc finger protein 43						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)	2		Renal(1328;0.000219)|Hepatocellular(1079;0.121)		GBM - Glioblastoma multiforme(1328;5.97e-05)|STAD - Stomach adenocarcinoma(1328;0.0127)		gcgcagtggctcactttaggag	0.020													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27761042	27761042	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27761042delT								None (None upstream) : LOC148189 (520360 downstream)																							tgaaccttccttttgatagag	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	27845351	27845352	+	IGR	DEL	AA	-	-	rs71221284		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:27845351_27845352delAA								None (None upstream) : LOC148189 (436050 downstream)																							cagattctacaaaaagactgtt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	28683285	28683285	+	IGR	DEL	A	-	-	rs79627090		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:28683285delA								LOC148189 (398437 upstream) : LOC148145 (772755 downstream)																							ttaacctaggaaaaaaaaaaa	0.109													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	30725652	30725653	+	IGR	DEL	AC	-	-	rs111232052		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30725652_30725653delAC								C19orf2 (219041 upstream) : ZNF536 (137675 downstream)																							TTACTAAATTacacacacacac	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	31191250	31191250	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:31191250delC								ZNF536 (142285 upstream) : DKFZp566F0947 (449533 downstream)																							ctccctccctcccccctcctt	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	32245874	32245874	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:32245874delT								TSHZ3 (405684 upstream) : ZNF507 (590640 downstream)																							GGGAAAACTATTTTTTTTTAC	0.274													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	34547766	34547767	+	IGR	INS	-	C	C	rs146683167	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34547766_34547767insC								KCTD15 (241101 upstream) : LSM14A (115585 downstream)																							attggaggtatagtgtgactca	0.035													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	35963328	35963328	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35963328delC								FFAR2 (20661 upstream) : KRTDAP (14902 downstream)																							tcttcttcctccatatctaat	0.025													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	43754073	43754073	+	IGR	DEL	A	-	-	rs35939117		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43754073delA								PSG4 (44283 upstream) : PSG9 (3363 downstream)																							actctgtctcaaaaaaaaaaa	0.000													3	3	---	---	---	---	
ZFP112	7771	broad.mit.edu	37	19	44873312	44873313	+	Intron	INS	-	CA	CA	rs139749666	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44873312_44873313insCA	uc010xwz.1	-						ZFP112_uc010xwy.1_5'Flank	NM_013380	NP_037512	Q9UJU3	ZF112_HUMAN	zinc finger protein 228 isoform 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(2)	5						CCTCAATCATGCACAAATGTCC	0.376													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	45740967	45740968	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45740967_45740968insA								EXOC3L2 (3498 upstream) : MARK4 (13874 downstream)																							cgtccccccagaaaaaaaaaag	0.193													6	3	---	---	---	---	
NPAS1	4861	broad.mit.edu	37	19	47528174	47528176	+	Intron	DEL	CTC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47528174_47528176delCTC	uc002pfw.2	+						NPAS1_uc002pfx.2_Intron|NPAS1_uc002pfy.2_Intron	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		tcaagcaattctcctgactcagc	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	47891038	47891040	+	IGR	DEL	GTT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47891038_47891040delGTT								DHX34 (5077 upstream) : MEIS3 (15342 downstream)																							cggagcagaagttgttgttgttg	0.015													4	2	---	---	---	---	
HSPBP1	23640	broad.mit.edu	37	19	55788861	55788862	+	Intron	INS	-	G	G	rs147038820	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55788861_55788862insG	uc002qjx.2	-						HSPBP1_uc002qjy.2_Intron|HSPBP1_uc002qkb.2_Intron|HSPBP1_uc002qka.2_Intron|HSPBP1_uc002qkd.2_Intron|HSPBP1_uc002qkc.2_Intron	NM_012267	NP_036399	Q9NZL4	HPBP1_HUMAN	hsp70-interacting protein						positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein ubiquitination|protein folding		enzyme inhibitor activity|protein binding				0			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		GGCAGAGCCTTGCTCCTTATGG	0.594													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6190124	6190125	+	IGR	INS	-	TT	TT	rs11471939		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6190124_6190125insTT								FERMT1 (85933 upstream) : BMP2 (558620 downstream)																							tcctgcctctctctttcctccc	0.040													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	6837636	6837636	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:6837636delT								BMP2 (76726 upstream) : None (None downstream)																							TGCATATCGAttttttctttt	0.164													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	11694588	11694588	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:11694588delT								None (None upstream) : BTBD3 (176889 downstream)																							CATATGCttcttttttttttg	0.224													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	24223629	24223630	+	IGR	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:24223629_24223630delCA								GGTLC1 (254213 upstream) : TMEM90B (226205 downstream)																							catgcacaggcacacacacaca	0.094													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25142741	25142742	+	IGR	INS	-	C	C			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25142741_25142742insC								LOC284798 (13315 upstream) : ENTPD6 (33597 downstream)																							CCTCACATGTGCCCCCATGTCC	0.540													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	25863383	25863384	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:25863383_25863384delTG								FAM182B (14597 upstream) : LOC100134868 (127051 downstream)																							CACCGATACATGTGTGAATATA	0.178													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26107789	26107790	+	IGR	INS	-	T	T	rs138056023	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26107789_26107790insT								C20orf191 (13112 upstream) : MIR663 (81032 downstream)																							agctgtttgtacaagtacacaa	0.084													1	6	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26207034	26207037	+	IGR	DEL	AGAG	-	-	rs148152409		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26207034_26207037delAGAG								MIR663 (18120 upstream) : None (None downstream)																							AGGCAAAGACAGAGAGAGAGAGGG	0.363													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	26242164	26242165	+	IGR	DEL	TT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:26242164_26242165delTT								MIR663 (53250 upstream) : None (None downstream)																							atttaaagtgtttttttttttc	0.000													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	29462348	29462349	+	IGR	INS	-	AA	AA	rs140899401	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:29462348_29462349insAA								None (None upstream) : FRG1B (149530 downstream)																							CCTCAGGCAAGAAAAAAACATT	0.366													4	2	---	---	---	---	
HCK	3055	broad.mit.edu	37	20	30680922	30680923	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30680922_30680923insT	uc002wxh.2	+						HCK_uc010gdy.2_Intron|HCK_uc002wxi.2_Intron	NM_002110	NP_002101	P08631	HCK_HUMAN	hemopoietic cell kinase isoform p61HCK						interspecies interaction between organisms|mesoderm development|regulation of defense response to virus by virus|viral reproduction	caveola|cytosol	ATP binding|non-membrane spanning protein tyrosine kinase activity|protein binding			lung(4)|ovary(2)|central_nervous_system(2)|pancreas(1)	9			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			ttctttttgtatttttagtaga	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	36062203	36062203	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36062203delT								SRC (28384 upstream) : BLCAP (83617 downstream)																							CATTCTTCTATTTTTTTTTTA	0.219													3	3	---	---	---	---	
PTPRT	11122	broad.mit.edu	37	20	40989541	40989541	+	Intron	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:40989541delC	uc002xkg.2	-						PTPRT_uc010ggj.2_Intron	NM_007050	NP_008981	O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T						homophilic cell adhesion|transmembrane receptor protein tyrosine kinase signaling pathway	cell surface|integral to membrane|plasma membrane	alpha-catenin binding|beta-catenin binding|cadherin binding|delta-catenin binding|gamma-catenin binding|protein tyrosine phosphatase activity|receptor activity			skin(8)|ovary(7)|lung(5)	20		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				TTGCCAAGCACCCAGCTTGGC	0.348													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	48998082	48998083	+	IGR	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:48998082_48998083delTG								CEBPB (188870 upstream) : PTPN1 (128808 downstream)																							tctgtgtgtctgtgtgtgtgtg	0.114													4	2	---	---	---	---	
ADNP	23394	broad.mit.edu	37	20	49524291	49524292	+	Intron	DEL	TG	-	-	rs113254299		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49524291_49524292delTG	uc002xvt.1	-						ADNP_uc002xvu.1_Intron	NM_015339	NP_056154	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector							nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						ggctatattttgtgtgtgtgtg	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	56469609	56469609	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56469609delG								PMEPA1 (183068 upstream) : C20orf85 (256374 downstream)																							aagggaggaagggaaggaagg	0.119													4	4	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	59964056	59964056	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:59964056delA	uc002ybn.1	+							NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			tattttaagtaagagaagcat	0.065													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60476253	60476254	+	Intron	INS	-	GAGCAG	GAGCAG	rs139248812	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60476253_60476254insGAGCAG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GGTATTGCAGTgagcaggagca	0.332													3	3	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60495357	60495358	+	Intron	INS	-	GCG	GCG	rs143520267	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60495357_60495358insGCG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AGCATGGTATCGTGATTGTGTG	0.520													4	2	---	---	---	---	
CDH4	1002	broad.mit.edu	37	20	60495363	60495364	+	Intron	DEL	TG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60495363_60495364delTG	uc002ybn.1	+						CDH4_uc002ybp.1_Intron	NM_001794	NP_001785	P55283	CADH4_HUMAN	cadherin 4, type 1 preproprotein						adherens junction organization|cell junction assembly		calcium ion binding			lung(3)|ovary(2)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			GTATCGTGATTGTGTGGAAGCG	0.520													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10562561	10562561	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10562561delT	uc011abv.1	-											Homo sapiens cDNA, FLJ18615.																		ttatatattgttttatcaatt	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10753613	10753614	+	IGR	DEL	CT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10753613_10753614delCT								None (None upstream) : TPTE (153129 downstream)																							agagttaaaactttcttttgat	0.000													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10777658	10777662	+	IGR	DEL	TGGAA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10777658_10777662delTGGAA								None (None upstream) : TPTE (129081 downstream)																							tggtgtgaagtggaatggaatggaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	10844148	10844156	+	IGR	DEL	CTTGAAAGA	-	-	rs139886213		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10844148_10844156delCTTGAAAGA								None (None upstream) : TPTE (62587 downstream)																							aatggaatggcttgaaagaaatggattgg	0.000													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11060026	11060026	+	Intron	DEL	G	-	-	rs146956675		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11060026delG	uc002yit.1	-						BAGE_uc002yiw.1_5'Flank|BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TAGAAACACAGAAAAAATATT	0.259													4	2	---	---	---	---	
BAGE2	85319	broad.mit.edu	37	21	11063160	11063161	+	Intron	INS	-	A	A	rs149756348		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11063160_11063161insA	uc002yit.1	-						BAGE_uc002yix.2_Intron	NM_182482	NP_872288			B melanoma antigen family, member 2 precursor												0			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		aaacgctatccaaaaaatgcag	0.035													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11112605	11112606	+	IGR	DEL	AT	-	-	rs141194664		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11112605_11112606delAT								BAGE (13668 upstream) : None (None downstream)																							CTATTCTACCATATGTGTTGAA	0.351													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	11158942	11158943	+	IGR	INS	-	A	A	rs4041579		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:11158942_11158943insA								BAGE (60005 upstream) : None (None downstream)																							aaatggaaaacaaaaaaaaaac	0.000													4	3	---	---	---	---	
LCA5L	150082	broad.mit.edu	37	21	40784527	40784528	+	Intron	DEL	CA	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40784527_40784528delCA	uc002yxu.2	-						LCA5L_uc002yxv.2_Intron	NM_152505	NP_689718	O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like												0		Prostate(19;1.2e-06)				CGTGCATGTGCACACACACACA	0.520													6	4	---	---	---	---	
TRAPPC10	7109	broad.mit.edu	37	21	45460652	45460652	+	Intron	DEL	T	-	-	rs67984141		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45460652delT	uc002zea.2	+						TRAPPC10_uc010gpo.2_Intron|TRAPPC10_uc002zdz.2_Intron	NM_003274	NP_003265	P48553	TPC10_HUMAN	trafficking protein particle complex 10						vesicle-mediated transport	Golgi apparatus|integral to membrane	binding|sodium ion transmembrane transporter activity			ovary(1)|skin(1)	2						cacgcctgccttttttttttt	0.000													3	4	---	---	---	---	
TRPM2	7226	broad.mit.edu	37	21	45839549	45839551	+	Intron	DEL	TGA	-	-	rs149049149		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45839549_45839551delTGA	uc002zet.1	+						TRPM2_uc002zeu.1_Intron|TRPM2_uc002zew.1_Intron|TRPM2_uc010gpt.1_Intron|TRPM2_uc002zex.1_Intron|TRPM2_uc002zey.1_Intron|uc011afe.1_Intron	NM_003307	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel,							integral to plasma membrane	ADP-ribose diphosphatase activity|calcium channel activity|sodium channel activity			ovary(1)|central_nervous_system(1)|pancreas(1)	3						gtagtgatggtgatgatgatggt	0.000													3	4	---	---	---	---	
COL6A2	1292	broad.mit.edu	37	21	47515614	47515614	+	5'Flank	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47515614delA	uc002zia.1	+						COL6A2_uc002zhy.1_5'Flank|COL6A2_uc002zhz.1_5'Flank|COL6A2_uc002zib.1_5'Flank	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		ccccctggataaagcaccctg	0.000													4	2	---	---	---	---	
LOC96610	96610	broad.mit.edu	37	22	23082679	23082686	+	Intron	DEL	GCGCGCGC	-	-	rs12171258	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23082679_23082686delGCGCGCGC	uc011aim.1	+											Parts of antibodies, mostly variable regions.												0						ACTCCAAAGAGCGCGCGCGcacgcgcgc	0.087													4	2	---	---	---	---	
RTDR1	27156	broad.mit.edu	37	22	23403863	23403864	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23403863_23403864insT	uc002zwt.2	-							NM_014433	NP_055248	Q9UHP6	RTDR1_HUMAN	rhabdoid tumor deletion region protein 1								binding			ovary(1)	1	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		CCAAGGGGAGGTTTTTTTTTTT	0.550													11	5	---	---	---	---	
BCR	613	broad.mit.edu	37	22	23582490	23582491	+	Intron	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23582490_23582491delGT	uc002zww.2	+						BCR_uc002zwx.2_Intron|BCR_uc011aiy.1_Intron	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1						regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity		BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						CTGGCTGATCgtgtgtgtgtgt	0.084			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								4	2	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28935624	28935624	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28935624delA	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						acactgtctcaaaaaaaaaaa	0.000													4	2	---	---	---	---	
TTC28	23331	broad.mit.edu	37	22	28992212	28992212	+	Intron	DEL	A	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:28992212delA	uc003adp.3	-							NM_001145418	NP_001138890	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28								binding				0						tgtcaagtacaaaagaaccaa	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	34851665	34851665	+	IGR	DEL	A	-	-	rs35504497		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:34851665delA								LARGE (533081 upstream) : ISX (610464 downstream)																							ttttcctgctaattcccagcc	0.045													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	36607134	36607135	+	IGR	INS	-	AAA	AAA	rs147067314	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36607134_36607135insAAA								APOL4 (6255 upstream) : APOL2 (15121 downstream)																							agtgaattttgaaaaaaaaaca	0.000													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	43762437	43762437	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43762437delG								SCUBE1 (23082 upstream) : MPPED1 (45583 downstream)																							gatgagctgaggagcttgtgg	0.149													4	2	---	---	---	---	
ATXN10	25814	broad.mit.edu	37	22	46142552	46142553	+	Intron	INS	-	T	T	rs143235453	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46142552_46142553insT	uc003bgm.1	+						ATXN10_uc011aqt.1_Intron|ATXN10_uc003bgn.1_Intron	NM_013236	NP_037368	Q9UBB4	ATX10_HUMAN	ataxin 10						cell death|neuron projection development	dendrite|neuronal cell body|perinuclear region of cytoplasm				ovary(1)|kidney(1)	2		Ovarian(80;0.00973)|all_neural(38;0.0417)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0223)		AACCTTCATACTTTCCCTGAGT	0.505													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49664834	49664834	+	IGR	DEL	C	-	-	rs34627196		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49664834delC								FAM19A5 (517092 upstream) : C22orf34 (143342 downstream)																							TTTTCTGATTCCTTTGTTTGT	0.378													4	2	---	---	---	---	
ALG12	79087	broad.mit.edu	37	22	50305866	50305867	+	Intron	INS	-	G	G	rs140366863	by1000genomes	TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50305866_50305867insG	uc003biy.2	-							NM_024105	NP_077010	Q9BV10	ALG12_HUMAN	alpha-1,6-mannosyltransferase ALG12						dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane					0		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		BRCA - Breast invasive adenocarcinoma(115;0.199)|LUAD - Lung adenocarcinoma(64;0.247)		tggcaggggctggggggggcac	0.173													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	951447	951448	+	IGR	INS	-	TCAT	TCAT			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:951447_951448insTCAT								SHOX (331302 upstream) : CRLF2 (363439 downstream)																							GTGTGTGtctgtctttctgtct	0.267													4	2	---	---	---	---	
IL3RA	3563	broad.mit.edu	37	X	1479250	1479251	+	Intron	DEL	TC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1479250_1479251delTC	uc004cps.2	+						IL3RA_uc011mhd.1_Intron	NM_002183	NP_002174	P26951	IL3RA_HUMAN	interleukin 3 receptor, alpha precursor							integral to membrane|plasma membrane	interleukin-3 receptor activity			skin(2)|lung(1)	3		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Sargramostim(DB00020)	cctctctttatctctctctctc	0.045													4	4	---	---	---	---	
P2RY8	286530	broad.mit.edu	37	X	1635192	1635192	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1635192delT	uc004cpz.2	-							NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8							integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				tcttcACCCCTCTCCcacaaa	0.114			T	CRLF2	B-ALL|Downs associated ALL								5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	2053973	2053974	+	IGR	INS	-	GGAG	GGAG			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:2053973_2053974insGGAG								ASMT (292000 upstream) : DHRSX (83583 downstream)																							gaaagaagggaggagggaggaa	0.069													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	8434663	8434665	+	IGR	DEL	GAG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:8434663_8434665delGAG								VCX3B (113 upstream) : KAL1 (62251 downstream)																							gagggaggaagaggaggtgtgtg	0.044													4	2	---	---	---	---	
GEMIN8	54960	broad.mit.edu	37	X	14038772	14038773	+	Intron	INS	-	T	T	rs148621900		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:14038772_14038773insT	uc004cwb.2	-						GEMIN8_uc004cwc.2_Intron|GEMIN8_uc004cwd.2_Intron	NM_017856	NP_060326	Q9NWZ8	GEMI8_HUMAN	gem (nuclear organelle) associated protein 8						spliceosomal snRNP assembly	Cajal body|cytoplasm|SMN complex|spliceosomal complex	protein binding				0						TAAATACCTACCTACATGAGGA	0.421													2	5	---	---	---	---	
ASB9	140462	broad.mit.edu	37	X	15288204	15288205	+	5'UTR	DEL	AC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15288204_15288205delAC	uc004cwl.2	-	1					ASB9_uc004cwk.2_5'Flank|ASB9_uc004cwm.2_5'UTR|ASB9_uc010ner.2_Intron|ASB9_uc004cwn.2_5'Flank	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform						intracellular signal transduction						0	Hepatocellular(33;0.183)					GCGCTCGTGTacacacacacac	0.475													4	2	---	---	---	---	
PHEX	5251	broad.mit.edu	37	X	22193830	22193831	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:22193830_22193831insT	uc004dah.2	+						PHEX_uc011mjr.1_Intron|PHEX_uc011mjs.1_Intron	NM_000444	NP_000435	P78562	PHEX_HUMAN	phosphate-regulating neutral endopeptidase						biomineral tissue development|cell-cell signaling|protein modification process|proteolysis|skeletal system development	integral to plasma membrane	aminopeptidase activity|metalloendopeptidase activity|zinc ion binding			ovary(2)|lung(1)	3						ATATCAAGGGATTTTTTTTTTT	0.228													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	24304870	24304870	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24304870delT								ZFX (72243 upstream) : FAM48B2 (24110 downstream)																							GAGAATCCACTTGCAGGAGGA	0.532													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	42206102	42206103	+	IGR	DEL	GT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:42206102_42206103delGT								CASK (423815 upstream) : PPP1R2P9 (430516 downstream)																							tactgtgtacgtgtgtgtgtgt	0.000													4	2	---	---	---	---	
GAGE1	2543	broad.mit.edu	37	X	49355488	49355489	+	Intron	INS	-	T	T			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49355488_49355489insT	uc004doj.2	+						GAGE1_uc011mnu.1_Intron|GAGE2A_uc004doi.3_Intron	NM_012196	NP_036328	Q13065	GAGE1_HUMAN	G antigen 8						cellular defense response						0	Ovarian(276;0.236)					ATTCTGGAGGATTTTTTTTTTC	0.386													4	2	---	---	---	---	
NUDT11	55190	broad.mit.edu	37	X	51239296	51239309	+	Translation_Start_Site	DEL	TCCTCGAGGCAGCC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:51239296_51239309delTCCTCGAGGCAGCC	uc010njt.2	-	1						NM_018159	NP_060629	Q96G61	NUD11_HUMAN	nudix-type motif 11							cytoplasm	diphosphoinositol-polyphosphate diphosphatase activity|metal ion binding				0	Ovarian(276;0.236)					TTGCACTTCATCCTCGAGGCAGCCTCCTCGAGGC	0.584										HNSCC(48;0.14)			5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	63916275	63916275	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:63916275delC								MTMR8 (300964 upstream) : ZC4H2 (219987 downstream)																							TTTCATACTTCAGAAGCAGAA	0.313													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	74860379	74860379	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74860379delT								ZDHHC15 (117042 upstream) : MAGEE2 (142444 downstream)																							TATCAGGACGTTTTTTTTTTT	0.403													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	97544964	97544966	+	IGR	DEL	TTT	-	-	rs150803448		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:97544964_97544966delTTT								DIAPH2 (689368 upstream) : None (None downstream)																							ctcaggtgtcttttttttttttt	0.000													4	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093049	101093049	+	Intron	DEL	A	-	-	rs66689050		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093049delA	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						ACCTGTGGGGAAAGCAGTGAG	0.577													2	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	108315523	108315523	+	IGR	DEL	G	-	-	rs34133391		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:108315523delG								IRS4 (335916 upstream) : GUCY2F (300613 downstream)																							cttcgtggctgctttgtttac	0.000													3	3	---	---	---	---	
PAK3	5063	broad.mit.edu	37	X	110416183	110416184	+	Intron	DEL	TC	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110416183_110416184delTC	uc004epa.2	+						PAK3_uc010npt.1_Intron|PAK3_uc010npu.1_Intron|PAK3_uc004eoy.1_Intron|PAK3_uc004eoz.2_Intron|PAK3_uc011mst.1_Intron|PAK3_uc010npv.1_Intron|PAK3_uc010npw.1_Intron	NM_001128173	NP_001121645	O75914	PAK3_HUMAN	p21-activated kinase 3 isoform d						multicellular organismal development		ATP binding|metal ion binding|protein serine/threonine kinase activity|SH3 domain binding			lung(6)|ovary(3)|large_intestine(1)	10						AATTTCTATTtctctctctctc	0.322										TSP Lung(19;0.15)			6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	116560918	116560918	+	IGR	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:116560918delT								CXorf61 (966781 upstream) : KLHL13 (470859 downstream)																							GTGCAACAAGTTACTGAAGAA	0.378													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	126582497	126582498	+	IGR	INS	-	AC	AC	rs66528685		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:126582497_126582498insAC								CXorf64 (626731 upstream) : ACTRT1 (602445 downstream)																							TGGTGATacaaacacacacaca	0.292													4	2	---	---	---	---	
FAM122B	159090	broad.mit.edu	37	X	133915761	133915761	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:133915761delT	uc004exr.2	-						FAM122B_uc004exq.2_Intron|FAM122B_uc004exs.2_Intron|FAM122B_uc004ext.2_Intron|FAM122B_uc004exu.2_Intron|FAM122B_uc011mvp.1_Intron|FAM122B_uc004exv.2_Intron	NM_145284	NP_660327	Q7Z309	F122B_HUMAN	hypothetical protein LOC159090												0	Acute lymphoblastic leukemia(192;0.000127)					caaaaaaaaatattttaaatt	0.209													3	6	---	---	---	---	
MAMLD1	10046	broad.mit.edu	37	X	149574403	149574404	+	Intron	DEL	CT	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149574403_149574404delCT	uc011mxu.1	+						MAMLD1_uc011mxt.1_Intron			Q13495	MAMD1_HUMAN	RecName: Full=Mastermind-like domain-containing protein 1;          Short=Protein CG1; AltName: Full=F18;						male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					TTAGCAAGTGCTCTCTCTCTCT	0.421													4	2	---	---	---	---	
MAMLD1	10046	broad.mit.edu	37	X	149585284	149585284	+	Intron	DEL	T	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149585284delT	uc011mxu.1	+						MAMLD1_uc011mxt.1_Intron			Q13495	MAMD1_HUMAN	RecName: Full=Mastermind-like domain-containing protein 1;          Short=Protein CG1; AltName: Full=F18;						male gonad development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Acute lymphoblastic leukemia(192;6.56e-05)					ccacaATGACtttttttttta	0.010													4	2	---	---	---	---	
CD99L2	83692	broad.mit.edu	37	X	149992596	149992598	+	Intron	DEL	AGG	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:149992596_149992598delAGG	uc004fel.2	-						CD99L2_uc004fem.2_Intron|CD99L2_uc004fen.2_Intron|CD99L2_uc004feo.2_Intron|CD99L2_uc011myb.1_Intron	NM_031462	NP_113650	Q8TCZ2	C99L2_HUMAN	CD99 antigen-like 2 isoform E3'-E4'-E3-E4						cell adhesion	cell junction|integral to membrane				large_intestine(2)|ovary(1)	3	Acute lymphoblastic leukemia(192;6.56e-05)					ggaagaaggaaggaggaggagga	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9944872	9944872	+	IGR	DEL	G	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9944872delG								TTTY22 (294018 upstream) : None (None downstream)																							taccaaggcagtacctctatg	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	9981809	9981809	+	IGR	DEL	C	-	-			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:9981809delC								TTTY22 (330955 upstream) : None (None downstream)																							TGATCTCAGACCAAAATATAG	0.408													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	10019366	10019367	+	IGR	INS	-	A	A			TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:10019366_10019367insA								TTTY22 (368512 upstream) : None (None downstream)																							tctgcacactgaacacccccgt	0.015													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	Y	13447257	13447261	+	IGR	DEL	AATTT	-	-	rs112762949		TCGA-46-3766-01	TCGA-46-3766-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrY:13447257_13447261delAATTT								None (None upstream) : None (None downstream)																							cattccactcaatttcactccactc	0.000													4	2	---	---	---	---	
