Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
NBPF1	55672	broad.mit.edu	37	1	16892443	16892443	+	Intron	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892443A>G	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		TATTGCCTTTATGTTGGGATA	0.294													4	37	---	---	---	---	PASS
RAP1GAP	5909	broad.mit.edu	37	1	21934781	21934781	+	Silent	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:21934781G>T	uc001bex.2	-	17	1479	c.1221C>A	c.(1219-1221)TCC>TCA	p.S407S	RAP1GAP_uc001bev.2_Silent_p.S407S|RAP1GAP_uc001bew.2_Silent_p.S471S|RAP1GAP_uc001bey.2_Silent_p.S407S	NM_002885	NP_002876	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein isoform c	407					regulation of Ras GTPase activity|signal transduction	cytosol|Golgi membrane|membrane fraction	GTPase activator activity|GTPase activity|protein homodimerization activity|Ras GTPase binding			breast(2)|ovary(1)	3		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		AGCCCATCATGGACTGGCTGT	0.647													20	57	---	---	---	---	PASS
WDTC1	23038	broad.mit.edu	37	1	27608757	27608757	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:27608757G>T	uc009vst.2	+	4	695	c.160G>T	c.(160-162)GAG>TAG	p.E54*	WDTC1_uc001bno.2_Nonsense_Mutation_p.E54*|WDTC1_uc001bnp.1_RNA	NM_015023	NP_055838	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1	54	WD 1.						protein binding			ovary(1)|central_nervous_system(1)	2		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CAACTGTCTGGAGTGGAATGA	0.522													35	27	---	---	---	---	PASS
EPB41	2035	broad.mit.edu	37	1	29362386	29362386	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:29362386G>T	uc001brm.1	+	9	1421	c.1414G>T	c.(1414-1416)GCA>TCA	p.A472S	EPB41_uc001brg.1_Missense_Mutation_p.A263S|EPB41_uc001brh.1_Missense_Mutation_p.A263S|EPB41_uc001bri.1_Missense_Mutation_p.A437S|EPB41_uc001brj.1_Missense_Mutation_p.A263S|EPB41_uc009vtk.1_Missense_Mutation_p.A437S|EPB41_uc001brk.2_Missense_Mutation_p.A472S|EPB41_uc001brl.1_Missense_Mutation_p.A472S|EPB41_uc009vtl.1_Missense_Mutation_p.A263S|EPB41_uc009vtm.1_Missense_Mutation_p.A105S	NM_203342	NP_976217	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	472	FERM.				blood circulation|cortical actin cytoskeleton organization|positive regulation of protein binding	extrinsic to membrane|Golgi apparatus|nucleus|plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	1-phosphatidylinositol binding|actin binding|spectrin binding|structural constituent of cytoskeleton			ovary(1)	1		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		CAGTTACCGAGCAGCTAAGAA	0.333													16	40	---	---	---	---	PASS
KLF17	128209	broad.mit.edu	37	1	44595677	44595677	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44595677C>A	uc001clp.2	+	2	792	c.734C>A	c.(733-735)TCT>TAT	p.S245Y	KLF17_uc009vxf.1_Missense_Mutation_p.S208Y	NM_173484	NP_775755	Q5JT82	KLF17_HUMAN	zinc finger protein 393	245					regulation of transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Acute lymphoblastic leukemia(166;0.155)					CAGCCAGACTCTCAAGAAGGC	0.567													18	46	---	---	---	---	PASS
FAM159A	348378	broad.mit.edu	37	1	53108671	53108671	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:53108671G>A	uc001cuf.2	+	2	419	c.319G>A	c.(319-321)GCA>ACA	p.A107T	FAM159A_uc001cug.1_RNA|FAM159A_uc001cuh.2_RNA	NM_001042693	NP_001036158	Q6UWV7	F159A_HUMAN	hypothetical protein LOC348378	107						integral to membrane					0						CTTACAGACAGCAGGTAAGGA	0.483													52	36	---	---	---	---	PASS
JAK1	3716	broad.mit.edu	37	1	65332540	65332540	+	Intron	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65332540G>C	uc001dbu.1	-						JAK1_uc009wam.1_Intron	NM_002227	NP_002218	P23458	JAK1_HUMAN	janus kinase 1						interferon-gamma-mediated signaling pathway|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to antibiotic|type I interferon-mediated signaling pathway	cytoskeleton|cytosol|endomembrane system|membrane|nucleus	ATP binding|growth hormone receptor binding|non-membrane spanning protein tyrosine kinase activity			haematopoietic_and_lymphoid_tissue(34)|prostate(7)|soft_tissue(6)|lung(4)|breast(3)|central_nervous_system(2)|liver(2)|large_intestine(1)|stomach(1)|ovary(1)	61				BRCA - Breast invasive adenocarcinoma(111;0.0485)		ACTGCCAACAGCCACTTACAT	0.358			Mis		ALL								44	30	---	---	---	---	PASS
LRRC7	57554	broad.mit.edu	37	1	70486789	70486789	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:70486789G>A	uc001dep.2	+	14	1438	c.1408G>A	c.(1408-1410)GAC>AAC	p.D470N	LRRC7_uc009wbg.2_Missense_Mutation_p.M1I	NM_020794	NP_065845	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7	470						centrosome|focal adhesion|nucleolus	protein binding			ovary(9)|breast(2)|central_nervous_system(2)|liver(1)	14						AAAAGAAGATGACGAAAATGC	0.378													23	21	---	---	---	---	PASS
CLCA2	9635	broad.mit.edu	37	1	86916237	86916237	+	Intron	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86916237T>C	uc001dlr.3	+							NM_006536	NP_006527	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2 precursor						cell adhesion	basal plasma membrane|cell junction|extracellular region|integral to plasma membrane	chloride channel activity			ovary(1)|breast(1)|skin(1)	3		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GTGTTTTTTATATATACAGGT	0.279													14	44	---	---	---	---	PASS
CGN	57530	broad.mit.edu	37	1	151491775	151491775	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:151491775C>A	uc009wmw.2	+	2	924	c.780C>A	c.(778-780)CTC>CTA	p.L260L		NM_020770	NP_065821	Q9P2M7	CING_HUMAN	cingulin	254	Interacts with ZO-2.|Head.					myosin complex|tight junction	actin binding|motor activity			ovary(2)|pancreas(1)	3	Ovarian(49;0.0273)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			TGAGTCCTCTCAGTGGCTTTA	0.582													17	50	---	---	---	---	PASS
FLG	2312	broad.mit.edu	37	1	152285018	152285018	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152285018G>A	uc001ezu.1	-	3	2380	c.2344C>T	c.(2344-2346)CGG>TGG	p.R782W	uc001ezv.2_5'Flank	NM_002016	NP_002007	P20930	FILA_HUMAN	filaggrin	782	Ser-rich.				keratinocyte differentiation	cytoplasmic membrane-bounded vesicle|intermediate filament	calcium ion binding|structural molecule activity			ovary(9)|skin(4)|upper_aerodigestive_tract(3)	16	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCCCTGACCGGTCACGTGCG	0.567									Ichthyosis				128	250	---	---	---	---	PASS
FLG2	388698	broad.mit.edu	37	1	152327320	152327320	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152327320G>T	uc001ezw.3	-	3	3015	c.2942C>A	c.(2941-2943)TCA>TAA	p.S981*	uc001ezv.2_Intron	NM_001014342	NP_001014364	Q5D862	FILA2_HUMAN	filaggrin family member 2	981	Ser-rich.						calcium ion binding|structural molecule activity			ovary(10)|skin(5)|upper_aerodigestive_tract(1)|breast(1)	17	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGATTTTCCTGAGCCTGACTC	0.493													178	107	---	---	---	---	PASS
CCDC19	25790	broad.mit.edu	37	1	159846487	159846487	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:159846487C>T	uc001fui.2	-	10	1229	c.1211G>A	c.(1210-1212)AGA>AAA	p.R404K	CCDC19_uc009wtb.2_RNA|CCDC19_uc001fuj.2_RNA|CCDC19_uc001fuk.2_Missense_Mutation_p.R319K|CCDC19_uc001ful.2_Missense_Mutation_p.R319K|CCDC19_uc009wtc.1_Silent_p.Q403Q	NM_012337	NP_036469	Q9UL16	CCD19_HUMAN	nasopharyngeal epithelium specific protein 1	404	Potential.					mitochondrion|soluble fraction				ovary(1)	1	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			CTTTTCCTTTCTGCGCCACTC	0.552													10	36	---	---	---	---	PASS
ATP1A2	477	broad.mit.edu	37	1	160098527	160098527	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160098527C>T	uc001fvc.2	+	9	1235	c.1103C>T	c.(1102-1104)ACG>ATG	p.T368M	ATP1A2_uc001fvb.2_Missense_Mutation_p.T368M|ATP1A2_uc010piz.1_Missense_Mutation_p.T213M|ATP1A2_uc001fvd.2_Missense_Mutation_p.T104M|ATP1A2_uc009wtg.1_Missense_Mutation_p.T56M	NM_000702	NP_000693	P50993	AT1A2_HUMAN	Na+/K+ -ATPase alpha 2 subunit proprotein	368	Cytoplasmic (Potential).				ATP biosynthetic process		ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			central_nervous_system(3)|ovary(2)|skin(2)	7	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			CTGGGCTCCACGTCCACCATC	0.607													18	76	---	---	---	---	PASS
ADCY10	55811	broad.mit.edu	37	1	167871256	167871256	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:167871256G>A	uc001ger.2	-	4	588	c.290C>T	c.(289-291)GCA>GTA	p.A97V	ADCY10_uc009wvk.2_5'UTR|ADCY10_uc010plj.1_5'UTR|ADCY10_uc009wvl.2_Missense_Mutation_p.A96V|ADCY10_uc009wvm.2_RNA	NM_018417	NP_060887	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10	97	Guanylate cyclase 1.				intracellular signal transduction|spermatogenesis	cytoskeleton|cytosol|perinuclear region of cytoplasm|plasma membrane|soluble fraction	adenylate cyclase activity|ATP binding|magnesium ion binding			central_nervous_system(2)|ovary(1)	3						CCCCATACCTGCAAATTTCAG	0.403													5	281	---	---	---	---	PASS
RASAL2	9462	broad.mit.edu	37	1	178427462	178427462	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:178427462G>A	uc001glr.2	+	12	2737	c.2612G>A	c.(2611-2613)CGA>CAA	p.R871Q	RASAL2_uc001glq.2_Missense_Mutation_p.R1012Q|RASAL2_uc009wxc.2_Missense_Mutation_p.R385Q	NM_004841	NP_004832	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2 isoform 1	871					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity			ovary(2)|breast(2)|large_intestine(1)	5						GCCCAGATCCGAAAAGTGGAC	0.572													11	46	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186024775	186024775	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186024775G>T	uc001grq.1	+	45	7342	c.7113G>T	c.(7111-7113)ATG>ATT	p.M2371I		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	2371	Ig-like C2-type 21.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TAGCAGGAATGACTGACAAAA	0.413													41	36	---	---	---	---	PASS
PRG4	10216	broad.mit.edu	37	1	186276431	186276431	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186276431C>G	uc001gru.3	+	7	1631	c.1580C>G	c.(1579-1581)ACC>AGC	p.T527S	PRG4_uc001grt.3_Missense_Mutation_p.T486S|PRG4_uc009wyl.2_Missense_Mutation_p.T434S|PRG4_uc009wym.2_Missense_Mutation_p.T393S|PRG4_uc010poo.1_Intron	NM_005807	NP_005798	Q92954	PRG4_HUMAN	proteoglycan 4 isoform A	527	59 X 8 AA repeats of K-X-P-X-P-T-T-X.|23.				cell proliferation|immune response	extracellular region	polysaccharide binding|protein binding|scavenger receptor activity			skin(1)	1						CCCACCACCACCAAGTCTGCA	0.637													27	18	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197072366	197072366	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197072366C>A	uc001gtu.2	-	18	6272	c.6015G>T	c.(6013-6015)AGG>AGT	p.R2005S	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Intron	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2005					mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						TACTGTAAGCCCTATAATACT	0.328													27	80	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203689871	203689871	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203689871G>A	uc001gzw.2	+						ATP2B4_uc001gzv.2_Intron|ATP2B4_uc009xaq.2_Intron|ATP2B4_uc001gzx.2_5'Flank|ATP2B4_uc009xar.2_5'Flank	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TCACTCAGGTGAAGGGGGTGT	0.517													32	19	---	---	---	---	PASS
ATP2B4	493	broad.mit.edu	37	1	203693119	203693119	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203693119G>A	uc001gzw.2	+						ATP2B4_uc001gzv.2_Intron|ATP2B4_uc009xaq.2_Intron|ATP2B4_uc001gzx.2_Intron|ATP2B4_uc009xar.2_Intron	NM_001684	NP_001675	P23634	AT2B4_HUMAN	plasma membrane calcium ATPase 4 isoform 4b						ATP biosynthetic process|platelet activation	integral to plasma membrane	ATP binding|calcium-transporting ATPase activity|calmodulin binding|metal ion binding|protein binding			ovary(2)|skin(1)	3	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGGGCCAGGTGAGTACCGGCA	0.552													117	76	---	---	---	---	PASS
NFASC	23114	broad.mit.edu	37	1	204957875	204957875	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204957875G>A	uc001hbj.2	+	23	3036	c.2708G>A	c.(2707-2709)AGG>AAG	p.R903K	NFASC_uc010pra.1_Missense_Mutation_p.R1006K|NFASC_uc001hbi.2_Missense_Mutation_p.R1006K|NFASC_uc010prb.1_Missense_Mutation_p.R1021K|NFASC_uc010prc.1_Missense_Mutation_p.R577K|NFASC_uc001hbk.1_Missense_Mutation_p.R816K|NFASC_uc001hbl.1_Missense_Mutation_p.R153K|NFASC_uc001hbm.1_Missense_Mutation_p.R49K|NFASC_uc001hbn.1_Missense_Mutation_p.R49K	NM_001005388	NP_001005388	O94856	NFASC_HUMAN	neurofascin isoform 1 precursor	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					axon guidance|cell adhesion|myelination|peripheral nervous system development	integral to membrane|node of Ranvier|plasma membrane	protein binding			ovary(3)|breast(1)|central_nervous_system(1)|skin(1)	6	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CTCAGCGCCAGGACGCAGGTG	0.587													50	39	---	---	---	---	PASS
EPRS	2058	broad.mit.edu	37	1	220213588	220213588	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220213588C>A	uc001hly.1	-	2	340	c.70G>T	c.(70-72)GTG>TTG	p.V24L	EPRS_uc010puf.1_5'UTR|EPRS_uc001hlz.1_Missense_Mutation_p.V24L|EPRS_uc009xdt.1_5'UTR	NM_004446	NP_004437	P07814	SYEP_HUMAN	glutamyl-prolyl tRNA synthetase	24					glutamyl-tRNA aminoacylation|prolyl-tRNA aminoacylation|protein complex assembly	cytosol|soluble fraction	ATP binding|glutamate-tRNA ligase activity|proline-tRNA ligase activity|protein binding|RNA binding			ovary(1)|skin(1)	2				GBM - Glioblastoma multiforme(131;0.0735)	L-Glutamic Acid(DB00142)|L-Proline(DB00172)	TCGTCTTTCACGTGTTCTACT	0.323													36	96	---	---	---	---	PASS
KIAA1804	84451	broad.mit.edu	37	1	233507832	233507832	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233507832G>A	uc001hvt.3	+	6	1862	c.1601G>A	c.(1600-1602)CGG>CAG	p.R534Q	KIAA1804_uc001hvs.1_Missense_Mutation_p.R534Q	NM_032435	NP_115811	Q5TCX8	M3KL4_HUMAN	mixed lineage kinase 4	534					activation of JUN kinase activity|protein autophosphorylation		ATP binding|MAP kinase kinase kinase activity|protein homodimerization activity			lung(5)|central_nervous_system(2)|skin(1)	8		all_cancers(173;0.000405)|all_epithelial(177;0.0345)|Prostate(94;0.122)				TTGGACAAACGGCGGAGCCTG	0.547													37	39	---	---	---	---	PASS
IRF2BP2	359948	broad.mit.edu	37	1	234743230	234743230	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234743230C>T	uc001hwg.2	-	2	1448	c.1417G>A	c.(1417-1419)GAG>AAG	p.E473K	IRF2BP2_uc009xfw.2_Missense_Mutation_p.E83K|IRF2BP2_uc001hwf.2_Missense_Mutation_p.E457K	NM_182972	NP_892017	Q7Z5L9	I2BP2_HUMAN	interferon regulatory factor 2 binding protein 2	473					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus					0	Ovarian(103;0.0303)	all_cancers(173;0.0236)|Prostate(94;0.0115)	OV - Ovarian serous cystadenocarcinoma(106;2.86e-05)|Epithelial(3;6.2e-05)			CCCCCCACCTCTCTGGGGCCC	0.622													34	87	---	---	---	---	PASS
GREM2	64388	broad.mit.edu	37	1	240656268	240656268	+	3'UTR	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240656268C>T	uc001hys.2	-	2						NM_022469	NP_071914	Q9H772	GREM2_HUMAN	gremlin 2 precursor						BMP signaling pathway	extracellular space	cytokine activity				0		all_cancers(173;0.0196)	OV - Ovarian serous cystadenocarcinoma(106;0.0123)			CGGCCCGGCGCTCACTGCTTG	0.517													16	20	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769333	247769333	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769333G>T	uc010pyz.1	+	1	446	c.446G>T	c.(445-447)TGG>TTG	p.W149L		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	149	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			TCTATCTCCTGGCTCAGTGGT	0.493													35	97	---	---	---	---	PASS
OR2T34	127068	broad.mit.edu	37	1	248737725	248737725	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248737725G>A	uc001iep.1	-	1	334	c.334C>T	c.(334-336)CTG>TTG	p.L112L		NM_001001821	NP_001001821	Q8NGX1	O2T34_HUMAN	olfactory receptor, family 2, subfamily T,	112	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)	2	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCTCCAGCCAGGGTCAGGTGG	0.557													21	58	---	---	---	---	PASS
SLC8A1	6546	broad.mit.edu	37	2	40657410	40657410	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:40657410A>G	uc002rrx.2	-	1	35	c.11T>C	c.(10-12)ATG>ACG	p.M4T	SLC8A1_uc002rry.2_Missense_Mutation_p.M4T|SLC8A1_uc002rrz.2_Missense_Mutation_p.M4T|SLC8A1_uc002rsa.2_Missense_Mutation_p.M4T|SLC8A1_uc002rsd.3_Missense_Mutation_p.M4T|SLC8A1_uc002rsb.1_Missense_Mutation_p.M4T|SLC8A1_uc010fan.1_Missense_Mutation_p.M4T|SLC8A1_uc002rsc.1_Missense_Mutation_p.M4T	NM_021097	NP_066920	P32418	NAC1_HUMAN	solute carrier family 8 (sodium/calcium	4					cell communication|muscle contraction|platelet activation	integral to plasma membrane	calcium:sodium antiporter activity|calmodulin binding|heat shock protein binding			ovary(1)|kidney(1)|central_nervous_system(1)|skin(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TAATCGCCGCATGTTGTACAT	0.423													8	41	---	---	---	---	PASS
STON1-GTF2A1L	286749	broad.mit.edu	37	2	48848367	48848367	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48848367A>G	uc010yol.1	+	4	2344	c.2297A>G	c.(2296-2298)CAA>CGA	p.Q766R	STON1-GTF2A1L_uc002rwp.1_Missense_Mutation_p.Q766R|GTF2A1L_uc002rws.1_Missense_Mutation_p.Q62R|GTF2A1L_uc010yom.1_Missense_Mutation_p.Q28R|GTF2A1L_uc002rwt.2_Missense_Mutation_p.Q62R	NM_006873	NP_006864	B7ZL16	B7ZL16_HUMAN	stonin 1	766					endocytosis|intracellular protein transport|transcription initiation from RNA polymerase II promoter	clathrin adaptor complex|transcription factor TFIIA complex				ovary(3)|pancreas(1)|skin(1)	5		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AATAGCATCCAATCACCTCTG	0.383													38	23	---	---	---	---	PASS
ANKRD53	79998	broad.mit.edu	37	2	71209097	71209097	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71209097C>A	uc002shl.3	+	4	850	c.649C>A	c.(649-651)CTG>ATG	p.L217M	ANKRD53_uc002shk.3_Missense_Mutation_p.L217M|ANKRD53_uc002shm.3_Intron	NM_001115116	NP_001108588	Q8N9V6	ANR53_HUMAN	ankyrin repeat domain 53 isoform a	217	ANK 3.										0						GCCCCTGCACCTGGCAGCCCG	0.577													10	74	---	---	---	---	PASS
CYP26B1	56603	broad.mit.edu	37	2	72359496	72359496	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:72359496C>A	uc002sih.1	-	6	1399	c.1399G>T	c.(1399-1401)GCC>TCC	p.A467S	CYP26B1_uc010yra.1_Missense_Mutation_p.A450S|CYP26B1_uc010yrb.1_Missense_Mutation_p.A392S	NM_019885	NP_063938	Q9NR63	CP26B_HUMAN	cytochrome P450, family 26, subfamily b,	467					cell fate determination|embryonic limb morphogenesis|male meiosis|negative regulation of retinoic acid receptor signaling pathway|proximal/distal pattern formation|retinoic acid catabolic process|spermatogenesis|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	electron carrier activity|heme binding|retinoic acid 4-hydroxylase activity|retinoic acid binding			skin(2)	2						GTCCGTGTGGCCAGCTCAAAG	0.642													8	28	---	---	---	---	PASS
POU3F3	5455	broad.mit.edu	37	2	105473369	105473369	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:105473369C>A	uc010ywg.1	+	1	1401	c.1401C>A	c.(1399-1401)CCC>CCA	p.P467P		NM_006236	NP_006227	P20264	PO3F3_HUMAN	POU class 3 homeobox 3	467					metanephric ascending thin limb development|metanephric DCT cell differentiation|metanephric macula densa development|metanephric thick ascending limb development|negative regulation of apoptosis|positive regulation of cell proliferation	nucleus	sequence-specific DNA binding			ovary(1)	1						TGACGCCGCCCGGGATCCAAC	0.662													38	15	---	---	---	---	PASS
CCDC93	54520	broad.mit.edu	37	2	118764334	118764334	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:118764334A>G	uc002tlj.2	-	3	341	c.215T>C	c.(214-216)TTG>TCG	p.L72S	CCDC93_uc010fld.1_Missense_Mutation_p.L72S	NM_019044	NP_061917	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	72										large_intestine(1)|ovary(1)	2						TTGAAAGAGCAAATCAACATC	0.318													12	47	---	---	---	---	PASS
RIF1	55183	broad.mit.edu	37	2	152322531	152322531	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152322531A>G	uc002txm.2	+	30	6627	c.6497A>G	c.(6496-6498)CAG>CGG	p.Q2166R	RIF1_uc002txl.2_Missense_Mutation_p.Q2166R|RIF1_uc002txn.2_Missense_Mutation_p.Q2166R|RIF1_uc002txo.2_Missense_Mutation_p.Q2166R|RIF1_uc002txp.2_RNA	NM_018151	NP_060621	Q5UIP0	RIF1_HUMAN	RAP1 interacting factor 1	2166	Interaction with condensed chromosomes in telophase.				cell cycle|response to DNA damage stimulus	chromosome, telomeric region|cytoplasm|nucleus|spindle	binding			ovary(5)|breast(4)|skin(3)|lung(2)|kidney(1)	15				BRCA - Breast invasive adenocarcinoma(221;0.0429)		AGTGGCATGCAGACACGCTGT	0.413													21	56	---	---	---	---	PASS
GALNT13	114805	broad.mit.edu	37	2	155099239	155099239	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:155099239C>T	uc002tyr.3	+	6	1074	c.507C>T	c.(505-507)TAC>TAT	p.Y169Y	GALNT13_uc002tyt.3_Silent_p.Y169Y|GALNT13_uc010foc.1_Translation_Start_Site	NM_052917	NP_443149	Q8IUC8	GLT13_HUMAN	UDP-N-acetyl-alpha-D-galactosamine:polypeptide	169	Lumenal (Potential).|Catalytic subdomain A.					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			ovary(2)|pancreas(2)|central_nervous_system(1)|skin(1)	6						TAGAGAATTACGTGAAAAATT	0.353													13	39	---	---	---	---	PASS
HOXD12	3238	broad.mit.edu	37	2	176964967	176964967	+	Silent	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176964967G>T	uc010zev.1	+	1	438	c.438G>T	c.(436-438)ACG>ACT	p.T146T	HOXD12_uc010zew.1_Silent_p.T146T	NM_021193	NP_067016	P35452	HXD12_HUMAN	homeobox D12	146						nuclear chromosome	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0521)|READ - Rectum adenocarcinoma(9;0.0678)		GTCGTGCCACGCCGGGCTCCA	0.672													43	19	---	---	---	---	PASS
PLEKHA3	65977	broad.mit.edu	37	2	179365898	179365898	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179365898C>G	uc002umn.2	+	7	1168	c.770C>G	c.(769-771)CCA>CGA	p.P257R		NM_019091	NP_061964	Q9HB20	PKHA3_HUMAN	pleckstrin homology domain containing, family A	257						cytoplasm|membrane				ovary(1)|kidney(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.0112)|Epithelial(96;0.0266)|all cancers(119;0.0865)			CTTGAAGACCCAGATAGTAAG	0.403													20	77	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179471836	179471836	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179471836T>A	uc010zfg.1	-	227	46013	c.45789A>T	c.(45787-45789)CAA>CAT	p.Q15263H	uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.Q8958H|TTN_uc010zfi.1_Missense_Mutation_p.Q8891H|TTN_uc010zfj.1_Missense_Mutation_p.Q8766H	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	16190							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTATATTCTTGTCCCTCAA	0.413													53	191	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211471548	211471548	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211471548G>A	uc002vee.3	+	18	2207	c.2075G>A	c.(2074-2076)GGC>GAC	p.G692D	CPS1_uc010fur.2_Missense_Mutation_p.G698D|CPS1_uc010fus.2_Missense_Mutation_p.G241D	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	692	ATP-grasp 1.				carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CGCCACTTGGGCATTGTGGGT	0.473													62	40	---	---	---	---	PASS
MARCH4	57574	broad.mit.edu	37	2	217142400	217142400	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:217142400C>A	uc002vgb.2	-	3	2627	c.860G>T	c.(859-861)TGC>TTC	p.C287F		NM_020814	NP_065865	Q9P2E8	MARH4_HUMAN	membrane-associated ring finger (C3HC4) 4	287	Helical; (Potential).					Golgi membrane|Golgi stack|integral to membrane|trans-Golgi network	ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1		Renal(323;0.0854)		Epithelial(149;2.19e-05)|all cancers(144;0.00121)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0125)		CCCACCTATGCACACCACGTC	0.577													25	55	---	---	---	---	PASS
SPEG	10290	broad.mit.edu	37	2	220329246	220329246	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:220329246G>A	uc010fwg.2	+	9	2797	c.2797G>A	c.(2797-2799)GAG>AAG	p.E933K	SPEG_uc002vlm.2_RNA|SPEG_uc010fwh.1_Missense_Mutation_p.E141K|SPEG_uc002vln.1_Missense_Mutation_p.E141K|SPEG_uc002vlp.1_Missense_Mutation_p.E141K|SPEG_uc002vlq.2_Missense_Mutation_p.E84K	NM_005876	NP_005867	Q15772	SPEG_HUMAN	SPEG complex locus	933	Ig-like 3.				muscle organ development|negative regulation of cell proliferation	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(9)|ovary(4)|central_nervous_system(1)	14		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCTGGCTGCAGAGCGTGGCGA	0.637													27	20	---	---	---	---	PASS
PAX3	5077	broad.mit.edu	37	2	223085987	223085987	+	Silent	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:223085987C>G	uc010fwo.2	-	6	1278	c.912G>C	c.(910-912)ACG>ACC	p.T304T	PAX3_uc002vmt.1_Silent_p.T304T|PAX3_uc002vmy.1_Silent_p.T303T|PAX3_uc002vmv.1_Silent_p.T304T|PAX3_uc002vmw.1_Silent_p.T304T|PAX3_uc002vmx.1_Silent_p.T304T	NM_181457	NP_852122	P23760	PAX3_HUMAN	paired box 3 isoform PAX3	304					apoptosis|organ morphogenesis|positive regulation of transcription from RNA polymerase II promoter|sensory perception of sound|transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		PAX3/FOXO1(749)|PAX3/NCOA1(8)|PAX3/NCOA2(4)	soft_tissue(761)|ovary(4)|skin(1)	766		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		ACAGCTGGTACGTTGGCAAGG	0.537			T	FOXO1A|NCOA1	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome						232	87	---	---	---	---	PASS
DOCK10	55619	broad.mit.edu	37	2	225740851	225740851	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:225740851C>T	uc010fwz.1	-	8	1074	c.835G>A	c.(835-837)GAT>AAT	p.D279N	DOCK10_uc002vob.2_Missense_Mutation_p.D273N|DOCK10_uc002vod.1_Missense_Mutation_p.D279N	NM_014689	NP_055504	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	279	PH.						GTP binding			ovary(2)	2		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		ATCCATTCATCCATATCTGAC	0.458													17	55	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	234104059	234104059	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234104059G>T	uc010zmo.1	+	23	2764	c.2611G>T	c.(2611-2613)GAG>TAG	p.E871*	INPP5D_uc010zmp.1_Nonsense_Mutation_p.E870*	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	871					apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGTGAAGACGGAGCGTGATGA	0.493													54	27	---	---	---	---	PASS
SLC22A13	9390	broad.mit.edu	37	3	38307617	38307617	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38307617C>T	uc003chz.3	+	1	320	c.266C>T	c.(265-267)CCC>CTC	p.P89L	SLC22A13_uc011aym.1_RNA|SLC22A13_uc011ayn.1_Missense_Mutation_p.P89L	NM_004256	NP_004247	Q9Y226	S22AD_HUMAN	solute carrier family 22 (organic anion	89	Extracellular (Potential).					integral to plasma membrane	organic cation transmembrane transporter activity			skin(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0533)|Kidney(284;0.067)		TTCCGGCCACCCCCCGCCAAT	0.592													18	5	---	---	---	---	PASS
SETD2	29072	broad.mit.edu	37	3	47144879	47144879	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:47144879C>T	uc003cqs.2	-	7	4927	c.4874G>A	c.(4873-4875)CGT>CAT	p.R1625H	SETD2_uc003cqv.2_Missense_Mutation_p.R1692H	NM_014159	NP_054878	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1625	SET.			R->H: Loss of methyltransferase activity.	regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	DNA binding|histone-lysine N-methyltransferase activity|oxidoreductase activity|transition metal ion binding			kidney(24)|ovary(5)|skin(1)|central_nervous_system(1)|breast(1)	32		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTCATGAAACGAGAGCAATT	0.348			N|F|S|Mis		clear cell renal carcinoma								66	15	---	---	---	---	PASS
DNAH1	25981	broad.mit.edu	37	3	52407054	52407054	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52407054G>A	uc011bef.1	+	44	7231	c.6970G>A	c.(6970-6972)GAC>AAC	p.D2324N		NM_015512	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2324	AAA 3 (By similarity).				ciliary or flagellar motility|microtubule-based movement|response to mechanical stimulus	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			large_intestine(3)	3				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CGGCTGGTACGACCGCAAGAT	0.527													18	15	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	86028400	86028400	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:86028400C>A	uc003dqj.2	+	8	1656	c.1030C>A	c.(1030-1032)CCA>ACA	p.P344T	CADM2_uc003dqk.2_Intron|CADM2_uc003dql.2_Missense_Mutation_p.P346T	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	344	Thr-rich.|Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		AACAACCAGCCCAACCACATC	0.453													167	25	---	---	---	---	PASS
OR5H2	79310	broad.mit.edu	37	3	98002676	98002676	+	Nonstop_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98002676G>C	uc003dsj.1	+	1	945	c.945G>C	c.(943-945)TAG>TAC	p.*315Y		NM_001005482	NP_001005482	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H,	315					sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3						GAAATGTTTAGATTTCATAGT	0.254													9	16	---	---	---	---	PASS
GPR15	2838	broad.mit.edu	37	3	98251616	98251616	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98251616G>A	uc011bgy.1	+	1	739	c.739G>A	c.(739-741)GTG>ATG	p.V247M		NM_005290	NP_005281	P49685	GPR15_HUMAN	G protein-coupled receptor 15	247	Helical; Name=6; (Potential).					integral to plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(1)	1		Lung NSC(201;7.93e-06)|all_neural(597;0.00172)|Hepatocellular(537;0.00825)|Myeloproliferative disorder(1037;0.0255)		Lung(72;0.246)		CTTTATTGTCGTGGCAGCCTT	0.448													19	76	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108818237	108818237	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108818237G>C	uc003dxl.2	-	6	478	c.391C>G	c.(391-393)CAG>GAG	p.Q131E	MORC1_uc011bhn.1_Missense_Mutation_p.Q131E	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	131					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CAGAATGTCTGAGAAAAAAAC	0.358													22	83	---	---	---	---	PASS
TNIK	23043	broad.mit.edu	37	3	170802084	170802084	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:170802084T>C	uc003fhh.2	-	26	3374	c.3029A>G	c.(3028-3030)GAA>GGA	p.E1010G	TNIK_uc003fhi.2_Missense_Mutation_p.E955G|TNIK_uc003fhj.2_Missense_Mutation_p.E981G|TNIK_uc003fhk.2_Missense_Mutation_p.E1002G|TNIK_uc003fhl.2_Missense_Mutation_p.E926G|TNIK_uc003fhm.2_Missense_Mutation_p.E947G|TNIK_uc003fhn.2_Missense_Mutation_p.E973G|TNIK_uc003fho.2_Missense_Mutation_p.E918G|TNIK_uc003fhg.2_Missense_Mutation_p.E188G|TNIK_uc003fhp.2_5'Flank	NM_015028	NP_055843	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase isoform 1	1010	Mediates interaction with NEDD4.				actin cytoskeleton reorganization|activation of JNKK activity|protein autophosphorylation|regulation of dendrite morphogenesis|Wnt receptor signaling pathway	cytoskeleton|nucleus|recycling endosome	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			ovary(4)|large_intestine(1)	5	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			TTTGGCCTGTTCTTGCCTAAG	0.398													125	100	---	---	---	---	PASS
KLHL6	89857	broad.mit.edu	37	3	183209889	183209889	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183209889G>A	uc003flr.2	-	7	1750	c.1692C>T	c.(1690-1692)GGC>GGT	p.G564G	KLHL6_uc003fls.1_RNA|KLHL6_uc003flt.1_3'UTR|KLHL6_uc010hxk.1_RNA	NM_130446	NP_569713	Q8WZ60	KLHL6_HUMAN	kelch-like 6	564	Kelch 6.									haematopoietic_and_lymphoid_tissue(2)|ovary(1)	3	all_cancers(143;9.2e-12)|Ovarian(172;0.0172)		all cancers(12;1.29e-44)|Epithelial(37;1.24e-38)|LUSC - Lung squamous cell carcinoma(7;2.58e-24)|Lung(8;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(80;2.32e-22)			CGTCCCGCCCGCCGGTGATGT	0.677													24	166	---	---	---	---	PASS
CHRD	8646	broad.mit.edu	37	3	184100816	184100816	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:184100816G>T	uc003fov.2	+	10	1324	c.1078G>T	c.(1078-1080)GCT>TCT	p.A360S	CHRD_uc003fow.2_5'UTR|CHRD_uc003fox.2_Missense_Mutation_p.A360S|CHRD_uc003foy.2_5'UTR|CHRD_uc010hyc.2_5'UTR|CHRD_uc011brr.1_5'UTR	NM_003741	NP_003732	Q9H2X0	CHRD_HUMAN	chordin precursor	360	CHRD 2.				BMP signaling pathway involved in spinal cord dorsal/ventral patterning|floor plate development|negative regulation of BMP signaling pathway|negative regulation of cell migration|positive regulation of cell adhesion|skeletal system development	extracellular space	cytokine binding			skin(2)|ovary(1)	3	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			ACCAGGCTTTGCTGAGGTGCT	0.637													5	28	---	---	---	---	PASS
DNAJB11	51726	broad.mit.edu	37	3	186299877	186299877	+	Intron	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186299877G>C	uc003fqi.2	+							NM_016306	NP_057390	Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11						protein folding	endoplasmic reticulum lumen	heat shock protein binding			ovary(1)|lung(1)	2	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		GTGAAATATTGATATTTGATT	0.408													7	25	---	---	---	---	PASS
OCIAD2	132299	broad.mit.edu	37	4	48887563	48887563	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48887563C>A	uc003gyt.2	-	7	606	c.403G>T	c.(403-405)GAG>TAG	p.E135*	OCIAD2_uc003gyu.2_Silent_p.V95V	NM_001014446	NP_001014446	Q56VL3	OCAD2_HUMAN	OCIA domain containing 2 isoform 1	135						endosome					0						TTGCATTCCTCACAGGTAAGG	0.393													87	68	---	---	---	---	PASS
KDR	3791	broad.mit.edu	37	4	55972048	55972048	+	Silent	SNP	C	A	A	rs138803814	byFrequency	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:55972048C>A	uc003has.2	-	12	1898	c.1596G>T	c.(1594-1596)GCG>GCT	p.A532A	KDR_uc003hat.1_Silent_p.A532A|KDR_uc011bzx.1_Silent_p.A532A	NM_002253	NP_002244	P35968	VGFR2_HUMAN	kinase insert domain receptor precursor	532	Ig-like C2-type 5.|Extracellular (Potential).				angiogenesis|cell differentiation|interspecies interaction between organisms|positive regulation of endothelial cell migration|positive regulation of endothelial cell proliferation|positive regulation of focal adhesion assembly|positive regulation of positive chemotaxis|regulation of cell shape	integral to plasma membrane	ATP binding|growth factor binding|Hsp90 protein binding|integrin binding|receptor signaling protein tyrosine kinase activity|vascular endothelial growth factor receptor activity			lung(16)|soft_tissue(4)|central_nervous_system(4)|large_intestine(2)|stomach(2)|skin(2)|ovary(2)|kidney(1)	33	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Sorafenib(DB00398)|Sunitinib(DB01268)	CTTTGTTGACCGCTTCACATT	0.493			Mis		NSCLC|angiosarcoma				Familial_Infantile_Hemangioma	TSP Lung(20;0.16)			57	222	---	---	---	---	PASS
NMU	10874	broad.mit.edu	37	4	56496629	56496629	+	Splice_Site	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:56496629T>A	uc003hbc.2	-	2	219	c.113_splice	c.e2-1	p.G38_splice	NMU_uc003hbd.1_Splice_Site|NMU_uc010igv.1_Splice_Site|NMU_uc010igw.1_Splice_Site|NMU_uc010igx.1_Splice_Site	NM_006681	NP_006672	P48645	NMU_HUMAN	neuromedin U precursor						neuropeptide signaling pathway	extracellular region					0	Lung NSC(11;0.00256)|all_epithelial(27;0.075)|Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.103)	LUSC - Lung squamous cell carcinoma(4;6.72e-08)|Lung(4;6.22e-07)|Epithelial(7;0.00559)	LUSC - Lung squamous cell carcinoma(721;0.0115)		TTGGAGCACCTAAAAATAAAG	0.323													23	41	---	---	---	---	PASS
GRID2	2895	broad.mit.edu	37	4	94376864	94376864	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:94376864G>A	uc011cdt.1	+	11	1855	c.1597G>A	c.(1597-1599)GTG>ATG	p.V533M	GRID2_uc011cdu.1_Missense_Mutation_p.V438M	NM_001510	NP_001501	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	533	Extracellular (Potential).				glutamate signaling pathway	cell junction|integral to plasma membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)	6		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)	L-Glutamic Acid(DB00142)	TCGTGAAAATGTGGTGGACTT	0.418													55	42	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123274300	123274300	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123274300C>G	uc003ieh.2	+	79	14136	c.14091C>G	c.(14089-14091)ATC>ATG	p.I4697M	KIAA1109_uc003iem.2_Missense_Mutation_p.I1053M	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	4697					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						CTCAGAAAATCTGGGAAGATG	0.358													20	35	---	---	---	---	PASS
UCP1	7350	broad.mit.edu	37	4	141489864	141489864	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:141489864G>A	uc011chj.1	-	1	96	c.20C>T	c.(19-21)TCG>TTG	p.S7L	UCP1_uc011chk.1_Missense_Mutation_p.S7L	NM_021833	NP_068605	P25874	UCP1_HUMAN	uncoupling protein 1	7					brown fat cell differentiation|cellular lipid metabolic process|respiratory electron transport chain	integral to membrane|mitochondrial inner membrane	binding			ovary(1)	1	all_hematologic(180;0.162)					GTGTACGTCCGAGGCTGTCAG	0.617													4	11	---	---	---	---	PASS
NR3C2	4306	broad.mit.edu	37	4	149075781	149075781	+	Silent	SNP	G	A	A	rs147478460		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:149075781G>A	uc003ilj.3	-	5	2620	c.2286C>T	c.(2284-2286)GCC>GCT	p.A762A	NR3C2_uc003ilk.3_Intron|NR3C2_uc010iph.2_Intron	NM_000901	NP_000892	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	762	Steroid-binding.				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	endoplasmic reticulum membrane|nucleoplasm	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid binding|steroid hormone receptor activity|zinc ion binding			large_intestine(1)	1	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Desoxycorticosterone Pivalate(DB01134)|Eplerenone(DB00700)|Fludrocortisone(DB00687)|Spironolactone(DB00421)	GCAGATTTTCGGCTGTATCTG	0.483													8	189	---	---	---	---	PASS
FHDC1	85462	broad.mit.edu	37	4	153897750	153897750	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:153897750G>T	uc003inf.2	+	11	3382	c.3307G>T	c.(3307-3309)GAG>TAG	p.E1103*		NM_033393	NP_203751	Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	1103					actin cytoskeleton organization		actin binding			large_intestine(1)|ovary(1)	2	all_hematologic(180;0.093)					AGAGTCTGCGGAGGGTCCCAG	0.687													11	7	---	---	---	---	PASS
FGA	2243	broad.mit.edu	37	4	155507479	155507479	+	Missense_Mutation	SNP	C	T	T	rs139005577		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155507479C>T	uc003iod.1	-	5	1160	c.1102G>A	c.(1102-1104)GGA>AGA	p.G368R	FGA_uc003ioe.1_Missense_Mutation_p.G368R|FGA_uc003iof.1_Intron	NM_000508	NP_000499	P02671	FIBA_HUMAN	fibrinogen, alpha polypeptide isoform alpha-E	368	By similarity.				platelet activation|platelet degranulation|protein polymerization|response to calcium ion|signal transduction	external side of plasma membrane|fibrinogen complex|platelet alpha granule lumen	eukaryotic cell surface binding|protein binding, bridging|receptor binding			ovary(2)|breast(1)	3	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	CCAGCACTTCCGCGTTCAGAG	0.547													52	43	---	---	---	---	PASS
FAT1	2195	broad.mit.edu	37	4	187509794	187509794	+	Silent	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:187509794T>C	uc003izf.2	-	27	13907	c.13719A>G	c.(13717-13719)GAA>GAG	p.E4573E	FAT1_uc010isn.2_Silent_p.E220E|FAT1_uc003ize.2_Silent_p.E464E	NM_005245	NP_005236	Q14517	FAT1_HUMAN	FAT tumor suppressor 1 precursor	4573	Cytoplasmic (Potential).				actin filament organization|anatomical structure morphogenesis|cell migration|cell-cell signaling|establishment or maintenance of cell polarity|homophilic cell adhesion	cell-cell junction|integral to plasma membrane|nucleus|perinuclear region of cytoplasm	calcium ion binding|protein binding			ovary(10)|central_nervous_system(1)|pancreas(1)	12						TCGTCACCTCTTCGAAGTGGC	0.587										HNSCC(5;0.00058)			23	2	---	---	---	---	PASS
TRIML1	339976	broad.mit.edu	37	4	189060895	189060895	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:189060895G>C	uc003izm.1	+	1	298	c.183G>C	c.(181-183)GAG>GAC	p.E61D		NM_178556	NP_848651	Q8N9V2	TRIML_HUMAN	tripartite motif family-like 1	61					multicellular organismal development		ligase activity|zinc ion binding			ovary(1)|pancreas(1)|breast(1)|skin(1)	4		all_cancers(14;1.33e-43)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)|all_hematologic(60;0.062)		OV - Ovarian serous cystadenocarcinoma(60;1.52e-11)|BRCA - Breast invasive adenocarcinoma(30;4.19e-06)|GBM - Glioblastoma multiforme(59;0.000232)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.156)		GGACCTTGGAGGGCCCGCATT	0.607													82	57	---	---	---	---	PASS
PLEKHG4B	153478	broad.mit.edu	37	5	171161	171161	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:171161G>C	uc003jak.2	+	13	2715	c.2665G>C	c.(2665-2667)GAG>CAG	p.E889Q		NM_052909	NP_443141	Q96PX9	PKH4B_HUMAN	pleckstrin homology domain containing, family G	889	DH.				regulation of Rho protein signal transduction	intracellular	Rho guanyl-nucleotide exchange factor activity			skin(2)	2			all cancers(22;0.0253)|Lung(60;0.113)	Kidney(1;0.119)		TTTCCAGGAAGAGCAGTTTGG	0.602													31	117	---	---	---	---	PASS
SEMA5A	9037	broad.mit.edu	37	5	9380059	9380059	+	5'UTR	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:9380059G>T	uc003jek.2	-	3						NM_003966	NP_003957	Q13591	SEM5A_HUMAN	semaphorin 5A precursor						cell adhesion|cell-cell signaling	integral to membrane|plasma membrane				ovary(1)|central_nervous_system(1)	2						TTCCCTTCATGGTGGGCAAGG	0.537													35	164	---	---	---	---	PASS
FAM105A	54491	broad.mit.edu	37	5	14610393	14610393	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:14610393C>T	uc003jfj.2	+	8	1154	c.1041C>T	c.(1039-1041)AAC>AAT	p.N347N		NM_019018	NP_061891	Q9NUU6	F105A_HUMAN	hypothetical protein LOC54491	347										ovary(1)	1	Lung NSC(4;0.00592)					TGACCGAGAACGACCGCCACT	0.532													30	101	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21842439	21842439	+	Splice_Site	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21842439T>A	uc010iuc.2	-	5	1105	c.647_splice	c.e5-1	p.G216_splice	CDH12_uc011cno.1_Splice_Site_p.G176_splice|CDH12_uc003jgk.2_Splice_Site_p.G216_splice	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						TAATAACACCTTAAGGGATAA	0.343										HNSCC(59;0.17)			34	90	---	---	---	---	PASS
FGF10	2255	broad.mit.edu	37	5	44388780	44388780	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44388780C>G	uc003jog.1	-	1	5	c.5G>C	c.(4-6)TGG>TCG	p.W2S		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	2					actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)					TATCCATTTCCACATTGTACT	0.522													16	73	---	---	---	---	PASS
HCN1	348980	broad.mit.edu	37	5	45396653	45396653	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:45396653C>A	uc003jok.2	-	4	1196	c.1171G>T	c.(1171-1173)GGC>TGC	p.G391C		NM_021072	NP_066550	O60741	HCN1_HUMAN	hyperpolarization activated cyclic	391	Helical; Name=Segment S6; (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)	1						GTGGCATGGCCGACAAACATG	0.498													51	35	---	---	---	---	PASS
PJA2	9867	broad.mit.edu	37	5	108714199	108714199	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:108714199T>G	uc003kos.3	-	4	1209	c.989A>C	c.(988-990)GAA>GCA	p.E330A		NM_014819	NP_055634	O43164	PJA2_HUMAN	praja 2, RING-H2 motif containing	330					long-term memory|regulation of protein kinase A signaling cascade	cell junction|endoplasmic reticulum membrane|Golgi membrane|postsynaptic density|postsynaptic membrane	ligase activity|protein kinase A catalytic subunit binding|protein kinase A regulatory subunit binding|zinc ion binding			ovary(1)|skin(1)	2		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		AAAACCTGTTTCTTGGTCCAC	0.408													123	15	---	---	---	---	PASS
COMMD10	51397	broad.mit.edu	37	5	115628151	115628151	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115628151G>A	uc003krt.1	+	7	597	c.574G>A	c.(574-576)GAG>AAG	p.E192K		NM_016144	NP_057228	Q9Y6G5	COMDA_HUMAN	COMM domain containing 10	192	COMM.						protein binding			ovary(1)	1		all_cancers(142;0.0834)|all_epithelial(76;0.00314)|Prostate(80;0.0102)|Ovarian(225;0.232)		OV - Ovarian serous cystadenocarcinoma(64;4.3e-07)|Epithelial(69;8.06e-07)|all cancers(49;4.06e-05)		TAAATAGCTAGAGACTATACA	0.343													48	12	---	---	---	---	PASS
FBN2	2201	broad.mit.edu	37	5	127727716	127727716	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:127727716C>A	uc003kuu.2	-	11	2037	c.1598G>T	c.(1597-1599)TGT>TTT	p.C533F	FBN2_uc003kuv.2_Missense_Mutation_p.C500F	NM_001999	NP_001990	P35556	FBN2_HUMAN	fibrillin 2 precursor	533	EGF-like 6.				bone trabecula formation|negative regulation of transforming growth factor beta receptor signaling pathway by extracellular sequestering of TGFbeta|positive regulation of bone mineralization|positive regulation of osteoblast differentiation	microfibril	calcium ion binding|extracellular matrix structural constituent			ovary(8)|large_intestine(4)|pancreas(1)|kidney(1)|skin(1)	15		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		CTTACCTATACAATCTCCATT	0.328													37	9	---	---	---	---	PASS
FNIP1	96459	broad.mit.edu	37	5	131008549	131008549	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:131008549C>A	uc003kvs.1	-	14	1730	c.1588G>T	c.(1588-1590)GAC>TAC	p.D530Y	RAPGEF6_uc003kvp.1_Intron|FNIP1_uc003kvt.1_Missense_Mutation_p.D502Y|FNIP1_uc010jdm.1_Missense_Mutation_p.D485Y	NM_133372	NP_588613	Q8TF40	FNIP1_HUMAN	folliculin interacting protein 1 isoform 1	530					regulation of protein phosphorylation	cytoplasm	protein binding			pancreas(1)|skin(1)	2		all_cancers(142;0.00347)|Lung NSC(810;0.106)|all_lung(232;0.123)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0665)		TGGACCATGTCTTGTCGTTTG	0.403													43	14	---	---	---	---	PASS
SH3RF2	153769	broad.mit.edu	37	5	145435759	145435759	+	Missense_Mutation	SNP	G	A	A	rs141349885	byFrequency	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145435759G>A	uc003lnt.2	+	8	1776	c.1538G>A	c.(1537-1539)CGG>CAG	p.R513Q	SH3RF2_uc011dbl.1_Missense_Mutation_p.R513Q|SH3RF2_uc011dbm.1_5'UTR|SH3RF2_uc003lnu.2_5'UTR|SH3RF2_uc011dbn.1_5'UTR	NM_152550	NP_689763	Q8TEC5	SH3R2_HUMAN	SH3 domain containing ring finger 2	513							ligase activity|protein phosphatase 1 binding|zinc ion binding			ovary(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CGGAAAGGGCGGAGCAGCATG	0.552													44	9	---	---	---	---	PASS
POU4F3	5459	broad.mit.edu	37	5	145718768	145718768	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145718768G>T	uc003loa.2	+	1	182	c.93G>T	c.(91-93)ATG>ATT	p.M31I		NM_002700	NP_002691	Q15319	PO4F3_HUMAN	POU class 4 homeobox 3	31					sensory perception of sound|visual perception	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CCGAGGCCATGCGCCGAGTCT	0.537													39	10	---	---	---	---	PASS
MRPL22	29093	broad.mit.edu	37	5	154330396	154330396	+	Silent	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154330396A>T	uc003lvy.3	+	3	131	c.93A>T	c.(91-93)TCA>TCT	p.S31S	MRPL22_uc003lvz.3_Intron	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22 isoform a	31					translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TACCTCAATCATATATCCACA	0.393													46	11	---	---	---	---	PASS
DOCK2	1794	broad.mit.edu	37	5	169472827	169472827	+	Missense_Mutation	SNP	A	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:169472827A>C	uc003maf.2	+	39	3964	c.3884A>C	c.(3883-3885)GAA>GCA	p.E1295A	DOCK2_uc011der.1_RNA|DOCK2_uc010jjm.2_Missense_Mutation_p.E787A	NM_004946	NP_004937	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1295	DHR-2.|Interaction with CRKL.				actin cytoskeleton organization|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|endomembrane system|membrane	electron carrier activity|GTP binding|GTPase binding|heme binding|Rac guanyl-nucleotide exchange factor activity|T cell receptor binding			ovary(5)|pancreas(2)	7	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAGATGTGGGAAGAGGCCATA	0.562													42	11	---	---	---	---	PASS
MSX2	4488	broad.mit.edu	37	5	174156192	174156192	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:174156192G>T	uc003mcy.2	+	2	498	c.410G>T	c.(409-411)AGG>ATG	p.R137M		NM_002449	NP_002440	P35548	MSX2_HUMAN	msh homeobox 2	137					cranial suture morphogenesis|negative regulation of transcription, DNA-dependent|osteoblast differentiation	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding				0	Renal(175;0.000159)|Lung NSC(126;0.0196)|all_lung(126;0.0303)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGCACCCTGAGGAAACACAAG	0.488													9	18	---	---	---	---	PASS
NSD1	64324	broad.mit.edu	37	5	176684105	176684105	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:176684105G>C	uc003mfr.3	+	13	5057	c.4919G>C	c.(4918-4920)TGT>TCT	p.C1640S	NSD1_uc003mft.3_Missense_Mutation_p.C1371S|NSD1_uc003mfs.1_Missense_Mutation_p.C1537S|NSD1_uc011dfx.1_Missense_Mutation_p.C1288S	NM_022455	NP_071900	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	1640	PHD-type 2.				negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	chromosome|nucleus	androgen receptor binding|chromatin binding|estrogen receptor binding|histone methyltransferase activity (H3-K36 specific)|histone methyltransferase activity (H4-K20 specific)|ligand-dependent nuclear receptor binding|retinoid X receptor binding|thyroid hormone receptor binding|transcription corepressor activity|zinc ion binding			ovary(2)|kidney(1)	3	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		CTCCACATCTGTATAACCTGT	0.443			T	NUP98	AML		Sotos Syndrome		Beckwith-Wiedemann_syndrome|Sotos_syndrome|Weaver_syndrome	HNSCC(47;0.14)			24	7	---	---	---	---	PASS
HIST1H2BC	8347	broad.mit.edu	37	6	26124133	26124133	+	5'UTR	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26124133C>T	uc003ngk.3	-	1					HIST1H2BC_uc003ngl.2_5'Flank|HIST1H2AC_uc003ngm.2_5'Flank|HIST1H2AC_uc003ngn.2_5'Flank|HIST1H2AC_uc003ngo.2_5'Flank|HIST1H2AC_uc003ngp.2_5'Flank	NM_003526	NP_003517	P62807	H2B1C_HUMAN	histone cluster 1, H2bc						defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding			ovary(1)	1						GCTCAGGCATCTTAAAACACC	0.493													52	60	---	---	---	---	PASS
HIST1H3G	8355	broad.mit.edu	37	6	26271447	26271447	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26271447G>A	uc003nhi.2	-	1	166	c.166C>T	c.(166-168)CAG>TAG	p.Q56*	uc003nhj.2_5'Flank|HIST1H2BI_uc003nhk.2_5'Flank	NM_003534	NP_003525	P68431	H31_HUMAN	H3 histone family, member H	56					blood coagulation|nucleosome assembly|regulation of gene silencing|S phase	nucleoplasm|nucleosome	DNA binding|protein binding				0						GTCGACTTCTGATAGCGGCGA	0.607													65	71	---	---	---	---	PASS
OR2J3	442186	broad.mit.edu	37	6	29080187	29080187	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29080187C>A	uc011dll.1	+	1	520	c.520C>A	c.(520-522)CAC>AAC	p.H174N		NM_001005216	NP_001005216	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TCTGTGTGGACACCGCCAAGT	0.498													114	96	---	---	---	---	PASS
PGC	5225	broad.mit.edu	37	6	41708268	41708268	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41708268G>A	uc003ora.1	-	6	777	c.728C>T	c.(727-729)CCT>CTT	p.P243L		NM_002630	NP_002621	P20142	PEPC_HUMAN	progastricsin (pepsinogen C) precursor	243					digestion|proteolysis	extracellular space	aspartic-type endopeptidase activity				0	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;0.000132)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			CTGGGTGACAGGCGCCCAGTA	0.617													76	65	---	---	---	---	PASS
DEFB114	245928	broad.mit.edu	37	6	49928073	49928073	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49928073C>G	uc011dwp.1	-	2	142	c.142G>C	c.(142-144)GAC>CAC	p.D48H		NM_001037499	NP_001032588	Q30KQ6	DB114_HUMAN	beta-defensin 114 precursor	48					defense response to bacterium	extracellular region				ovary(1)	1	Lung NSC(77;0.042)					GAACATATGTCTATTTGCTTT	0.373													34	36	---	---	---	---	PASS
PAQR8	85315	broad.mit.edu	37	6	52268797	52268797	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:52268797C>T	uc003pao.3	+	2	960	c.786C>T	c.(784-786)TTC>TTT	p.F262F		NM_133367	NP_588608	Q8TEZ7	MPRB_HUMAN	progestin and adipoQ receptor family member	262	Helical; Name=5; (Potential).				cell differentiation|multicellular organismal development|oogenesis	integral to membrane|plasma membrane	receptor activity|steroid binding				0	Lung NSC(77;0.0875)					CTTATTTCTTCTCCTGCCCCG	0.577													46	50	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56350253	56350253	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56350253C>T	uc003pdf.2	-	82	14735	c.14707G>A	c.(14707-14709)GAA>AAA	p.E4903K	DST_uc003pcz.3_Missense_Mutation_p.E4725K|DST_uc011dxj.1_Missense_Mutation_p.E4754K|DST_uc011dxk.1_Missense_Mutation_p.E4765K|DST_uc003pcy.3_Missense_Mutation_p.E4399K|DST_uc003pda.3_Missense_Mutation_p.E95K	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	6811	Spectrin 18.				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACAGGGCTTCCTCCAATTTG	0.388													17	30	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56497780	56497780	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56497780C>T	uc003pdf.2	-	27	3606	c.3578G>A	c.(3577-3579)CGT>CAT	p.R1193H	DST_uc003pcz.3_Missense_Mutation_p.R1015H|DST_uc011dxj.1_Missense_Mutation_p.R1044H|DST_uc011dxk.1_Missense_Mutation_p.R1055H|DST_uc003pcy.3_Missense_Mutation_p.R689H|DST_uc003pdb.2_Missense_Mutation_p.R689H|DST_uc003pdc.3_Missense_Mutation_p.R689H|DST_uc003pdd.3_Missense_Mutation_p.R689H	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	1015					cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity	p.R689H(1)|p.R1015H(1)		ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ATCTTCAAAACGAGATTGTAG	0.358													15	108	---	---	---	---	PASS
SLC17A5	26503	broad.mit.edu	37	6	74331542	74331542	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74331542C>T	uc003phn.3	-	7	1091	c.963G>A	c.(961-963)AGG>AGA	p.R321R	SLC17A5_uc010kax.2_Intron|SLC17A5_uc010kay.2_RNA|SLC17A5_uc011dyo.1_Silent_p.R190R	NM_012434	NP_036566	Q9NRA2	S17A5_HUMAN	sialin	321					anion transport	integral to plasma membrane|lysosomal membrane|membrane fraction	sialic acid:hydrogen symporter activity			skin(5)|central_nervous_system(1)	6						GAACATTGAACCTTAGGATCT	0.323													15	29	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79752705	79752705	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79752705G>A	uc003pir.2	-	7	681	c.455C>T	c.(454-456)TCA>TTA	p.S152L	PHIP_uc011dyp.1_Missense_Mutation_p.S152L	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	152					insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CAGCTTCCTTGAAAACAGAGT	0.353													142	140	---	---	---	---	PASS
SIM1	6492	broad.mit.edu	37	6	100898238	100898238	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:100898238G>A	uc003pqj.3	-						SIM1_uc010kcu.2_Intron	NM_005068	NP_005059	P81133	SIM1_HUMAN	single-minded homolog 1						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(4)	4		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		AGGGTCTGGGGAGGCACAAAT	0.512													931	35	---	---	---	---	PASS
LAMA2	3908	broad.mit.edu	37	6	129775399	129775399	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:129775399G>A	uc003qbn.2	+	46	6778	c.6673G>A	c.(6673-6675)GAT>AAT	p.D2225N	LAMA2_uc003qbo.2_Missense_Mutation_p.D2225N	NM_000426	NP_000417	P24043	LAMA2_HUMAN	laminin alpha 2 subunit isoform a precursor	2225	Laminin G-like 1.				cell adhesion|muscle organ development|regulation of cell adhesion|regulation of cell migration|regulation of embryonic development	laminin-1 complex	receptor binding|structural molecule activity			ovary(8)|breast(1)|skin(1)	10				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		TTTGACTATTGATGACTCATA	0.368													26	53	---	---	---	---	PASS
FAM20C	56975	broad.mit.edu	37	7	195587	195587	+	Silent	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:195587C>G	uc003sip.2	+	2	870	c.639C>G	c.(637-639)CTC>CTG	p.L213L		NM_020223	NP_064608	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C	213						extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		CAGAATTCCTCTCCCCCGGGG	0.612													10	16	---	---	---	---	PASS
MAD1L1	8379	broad.mit.edu	37	7	2260523	2260523	+	Intron	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2260523T>A	uc003slh.1	-						MAD1L1_uc003slf.1_Intron|MAD1L1_uc003slg.1_Intron|MAD1L1_uc010ksh.1_Intron|MAD1L1_uc003sli.1_Missense_Mutation_p.H64L|MAD1L1_uc010ksi.1_Intron|MAD1L1_uc010ksj.2_Intron	NM_001013836	NP_001013858	Q9Y6D9	MD1L1_HUMAN	MAD1-like 1 protein						cell division|mitotic anaphase|mitotic cell cycle spindle assembly checkpoint|mitotic metaphase|mitotic prometaphase|mitotic telophase	actin cytoskeleton|centrosome|condensed chromosome kinetochore|cytosol|mitochondrion|nucleus|spindle	protein binding			lung(1)|central_nervous_system(1)	2		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		ACGCACCGTGTGCCAGGGGCA	0.527													14	7	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21584665	21584665	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21584665G>A	uc003svc.2	+	2	424	c.393G>A	c.(391-393)AAG>AAA	p.K131K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	131	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTATTTCCAAGAAGATTACTG	0.343									Kartagener_syndrome				10	5	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21805213	21805213	+	Intron	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21805213C>T	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTGAGGTATGCCGTGTCAGCC	0.393									Kartagener_syndrome				3	11	---	---	---	---	PASS
FAM126A	84668	broad.mit.edu	37	7	23018024	23018024	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:23018024C>A	uc003svm.3	-	4	452	c.197G>T	c.(196-198)AGT>ATT	p.S66I	FAM126A_uc003svn.3_5'UTR|FAM126A_uc011jyr.1_Missense_Mutation_p.S32I	NM_032581	NP_115970	Q9BYI3	HYCCI_HUMAN	family with sequence similarity 126, member A	66						cytoplasm|membrane	signal transducer activity			central_nervous_system(1)	1						CTCCTCTCCACTGCGATAGAA	0.423													26	12	---	---	---	---	PASS
ELMO1	9844	broad.mit.edu	37	7	37264527	37264527	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37264527C>A	uc003tfk.1	-	9	965	c.658G>T	c.(658-660)GCG>TCG	p.A220S	ELMO1_uc011kbc.1_Missense_Mutation_p.A124S|ELMO1_uc010kxg.1_Missense_Mutation_p.A220S	NM_014800	NP_055615	Q92556	ELMO1_HUMAN	engulfment and cell motility 1 isoform 1	220					actin cytoskeleton organization|apoptosis|cellular component movement|phagocytosis, engulfment|Rac protein signal transduction|regulation of defense response to virus by virus|viral reproduction	cytoskeleton|cytosol|plasma membrane	SH3 domain binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)	6						ATCTCCTGCGCCACTTTCTGG	0.527													61	22	---	---	---	---	PASS
RALA	5898	broad.mit.edu	37	7	39729980	39729980	+	Splice_Site	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39729980G>A	uc003thd.2	+	3	415	c.115_splice	c.e3-1	p.F39_splice		NM_005402	NP_005393	P11233	RALA_HUMAN	ras related v-ral simian leukemia viral oncogene						actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity			lung(1)|skin(1)	2						ATCTTTTCTAGTTTGTGGAGG	0.299													52	51	---	---	---	---	PASS
GCK	2645	broad.mit.edu	37	7	44228546	44228546	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:44228546C>A	uc003tkl.2	-	1	477	c.7G>T	c.(7-9)GAC>TAC	p.D3Y		NM_000162	NP_000153	P35557	HXK4_HUMAN	glucokinase isoform 1	3					cellular response to insulin stimulus|cellular response to leptin stimulus|detection of glucose|endocrine pancreas development|glucose homeostasis|glucose transport|glycolysis|negative regulation of gluconeogenesis|positive regulation of glycogen biosynthetic process|positive regulation of insulin secretion|regulation of glucose transport|regulation of glycolysis|transmembrane transport	cytosol|nucleoplasm	ATP binding|glucokinase activity|glucose binding|protein binding			skin(3)|lung(1)	4						GCTCTGTCGTCCAGCATCTGC	0.597													9	27	---	---	---	---	PASS
ZPBP	11055	broad.mit.edu	37	7	50121417	50121417	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:50121417A>T	uc003tou.2	-	3	357	c.287T>A	c.(286-288)ATA>AAA	p.I96K	ZPBP_uc011kci.1_Missense_Mutation_p.I22K|ZPBP_uc010kyw.2_Missense_Mutation_p.I96K	NM_007009	NP_008940	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein isoform 1	96					binding of sperm to zona pellucida	extracellular region					0	Glioma(55;0.08)|all_neural(89;0.245)					TGATGGGTCTATCAGTTCAGC	0.348													28	17	---	---	---	---	PASS
CLIP2	7461	broad.mit.edu	37	7	73774519	73774519	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73774519C>T	uc003uam.2	+	7	1557	c.1230C>T	c.(1228-1230)GCC>GCT	p.A410A	CLIP2_uc003uan.2_Silent_p.A410A	NM_003388	NP_003379	Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	410	Potential.					microtubule associated complex				skin(3)	3						TTGCAGAAGCCGAGGAGAAGC	0.637													7	11	---	---	---	---	PASS
GTF2I	2969	broad.mit.edu	37	7	74103545	74103545	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:74103545C>T	uc003uau.2	+	2	453	c.83C>T	c.(82-84)TCA>TTA	p.S28L	GTF2I_uc003uat.2_Missense_Mutation_p.S28L|GTF2I_uc003uav.2_Missense_Mutation_p.S28L|GTF2I_uc003uaw.2_Missense_Mutation_p.S28L|GTF2I_uc003uay.2_Missense_Mutation_p.S28L|GTF2I_uc003uax.2_Missense_Mutation_p.S28L	NM_032999	NP_127492	P78347	GTF2I_HUMAN	general transcription factor IIi isoform 1	28					negative regulation of angiogenesis|signal transduction|transcription initiation from RNA polymerase II promoter	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0						TTCCTCATGTCAGCTCTCGAG	0.498													10	45	---	---	---	---	PASS
CACNA2D1	781	broad.mit.edu	37	7	81643795	81643795	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:81643795C>A	uc003uhr.1	-	13	1400	c.1144G>T	c.(1144-1146)GTA>TTA	p.V382L	uc003uhs.1_Intron	NM_000722	NP_000713	P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha	382	Extracellular (Potential).|VWFA.					voltage-gated calcium channel complex	metal ion binding			ovary(5)|pancreas(1)	6					Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)	AATACACGTACCTGGATGAAT	0.333													10	33	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82390103	82390103	+	Intron	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82390103G>C	uc003uhx.2	-							NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1						cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						ATATAAATCTGAAAATAAGAA	0.289													8	8	---	---	---	---	PASS
SLC12A9	56996	broad.mit.edu	37	7	100453423	100453423	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100453423G>A	uc003uwp.2	+	4	554	c.412G>A	c.(412-414)GGG>AGG	p.G138R	SLC12A9_uc003uwo.1_Intron|SLC12A9_uc003uwq.2_Intron|SLC12A9_uc011kki.1_Intron|SLC12A9_uc003uwr.2_5'UTR|SLC12A9_uc003uws.2_5'UTR|SLC12A9_uc003uwt.2_5'Flank|SLC12A9_uc003uwv.2_5'Flank	NM_020246	NP_064631	Q9BXP2	S12A9_HUMAN	solute carrier family 12 (potassium/chloride	138	Helical; (Potential).					integral to membrane|plasma membrane	cation:chloride symporter activity				0	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTCCCTCCTGGGGCTGGTGGA	0.617													52	46	---	---	---	---	PASS
VGF	7425	broad.mit.edu	37	7	100807347	100807347	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100807347C>T	uc003uxx.3	-	2	996	c.778G>A	c.(778-780)GAG>AAG	p.E260K		NM_003378	NP_003369	O15240	VGF_HUMAN	VGF nerve growth factor inducible precursor	260					response to cAMP	extracellular space|transport vesicle	growth factor activity				0	Lung NSC(181;0.168)|all_lung(186;0.215)					GCCAATGCCTCGCCTAGGTGT	0.662													10	42	---	---	---	---	PASS
ING3	54556	broad.mit.edu	37	7	120608024	120608024	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:120608024A>G	uc003vjn.2	+	8	727	c.593A>G	c.(592-594)AAT>AGT	p.N198S	ING3_uc003vjo.2_5'UTR|ING3_uc003vjp.2_Missense_Mutation_p.N198S|ING3_uc011kns.1_Missense_Mutation_p.N183S	NM_019071	NP_061944	Q9NXR8	ING3_HUMAN	inhibitor of growth family, member 3 isoform 1	198					histone H2A acetylation|histone H4 acetylation|positive regulation of apoptosis|regulation of growth|regulation of transcription, DNA-dependent|transcription, DNA-dependent	NuA4 histone acetyltransferase complex|Piccolo NuA4 histone acetyltransferase complex	zinc ion binding			ovary(1)	1	all_neural(327;0.117)					TCTTCTAACAATGCCTACAAT	0.398													45	28	---	---	---	---	PASS
PLXNA4	91584	broad.mit.edu	37	7	131883346	131883346	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:131883346C>A	uc003vra.3	-	13	2865	c.2636G>T	c.(2635-2637)CGA>CTA	p.R879L		NM_020911	NP_065962	Q9HCM2	PLXA4_HUMAN	plexin A4 isoform 1	879	IPT/TIG 1.|Extracellular (Potential).					integral to membrane|intracellular|plasma membrane				ovary(1)	1						GTTCTCCCCTCGGATAGTGAC	0.552													3	64	---	---	---	---	PASS
CHRM2	1129	broad.mit.edu	37	7	136700855	136700855	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136700855C>A	uc003vtf.1	+	4	1866	c.1243C>A	c.(1243-1245)CCT>ACT	p.P415T	CHRM2_uc003vtg.1_Missense_Mutation_p.P415T|CHRM2_uc003vtj.1_Missense_Mutation_p.P415T|CHRM2_uc003vtk.1_Missense_Mutation_p.P415T|CHRM2_uc003vtl.1_Missense_Mutation_p.P415T|CHRM2_uc003vtm.1_Missense_Mutation_p.P415T|CHRM2_uc003vti.1_Missense_Mutation_p.P415T|CHRM2_uc003vto.1_Missense_Mutation_p.P415T|CHRM2_uc003vtn.1_Missense_Mutation_p.P415T|uc003vtp.1_Intron	NM_001006630	NP_001006631	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	415	Extracellular (By similarity).				activation of phospholipase C activity by muscarinic acetylcholine receptor signaling pathway|G-protein signaling, coupled to cAMP nucleotide second messenger|nervous system development|regulation of heart contraction|response to virus	cell junction|integral to plasma membrane|postsynaptic membrane	muscarinic acetylcholine receptor activity|protein binding			ovary(4)|central_nervous_system(1)	5					Anisotropine Methylbromide(DB00517)|Atropine(DB00572)|Benzquinamide(DB00767)|Carbachol(DB00411)|Cryptenamine(DB00785)|Cyclizine(DB01176)|Desipramine(DB01151)|Diphenidol(DB01231)|Doxacurium(DB01334)|Doxacurium chloride(DB01135)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Ipratropium(DB00332)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pilocarpine(DB01085)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Rocuronium(DB00728)|Thiethylperazine(DB00372)|Tolterodine(DB01036)|Tridihexethyl(DB00505)|Triflupromazine(DB00508)	CTTTTGTGCACCTTGCATCCC	0.458													86	56	---	---	---	---	PASS
PTN	5764	broad.mit.edu	37	7	136935969	136935969	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:136935969G>A	uc003vtq.2	-						PTN_uc010lmx.2_Intron|PTN_uc003vtr.1_Intron	NM_002825	NP_002816	P21246	PTN_HUMAN	pleiotrophin						nervous system development|positive regulation of cell division|positive regulation of cell proliferation|transmembrane receptor protein tyrosine phosphatase signaling pathway	endoplasmic reticulum|extracellular space	growth factor activity|heparin binding|protein phosphatase inhibitor activity			upper_aerodigestive_tract(1)|pancreas(1)	2						ATAATGGCAAGGACTTACCTT	0.443													87	77	---	---	---	---	PASS
EPHA1	2041	broad.mit.edu	37	7	143095862	143095862	+	Missense_Mutation	SNP	C	T	T	rs145891509		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143095862C>T	uc003wcz.2	-	6	1255	c.1168G>A	c.(1168-1170)GTG>ATG	p.V390M		NM_005232	NP_005223	P21709	EPHA1_HUMAN	ephrin receptor EphA1 precursor	390	Extracellular (Potential).|Fibronectin type-III 1.					integral to plasma membrane	ATP binding|ephrin receptor activity			ovary(3)|lung(1)|breast(1)	5	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GAGAAGTGCACGCCCACCCCA	0.612													19	22	---	---	---	---	PASS
OR2A25	392138	broad.mit.edu	37	7	143772025	143772025	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143772025C>G	uc011ktx.1	+	1	713	c.713C>G	c.(712-714)TCC>TGC	p.S238C		NM_001004488	NP_001004488	A4D2G3	O2A25_HUMAN	olfactory receptor, family 2, subfamily A,	238	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Melanoma(164;0.0783)					AAAGCCTTCTCCATCTGCTCC	0.483													39	89	---	---	---	---	PASS
KRBA1	84626	broad.mit.edu	37	7	149418023	149418023	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149418023C>A	uc003wfz.2	+	4	651	c.252C>A	c.(250-252)GAC>GAA	p.D84E	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	84										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCGCTATGGACAGCCCCGAGA	0.647													22	16	---	---	---	---	PASS
DPP6	1804	broad.mit.edu	37	7	154587594	154587594	+	Splice_Site	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154587594G>T	uc003wlk.2	+	12	1428	c.1299_splice	c.e12+1	p.Q433_splice	DPP6_uc003wli.2_Splice_Site_p.Q369_splice|DPP6_uc003wlm.2_Splice_Site_p.Q371_splice|DPP6_uc011kvq.1_Splice_Site_p.Q326_splice	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			CCACAGACAGGTAACTACTGC	0.463													6	3	---	---	---	---	PASS
ERI1	90459	broad.mit.edu	37	8	8873831	8873831	+	Splice_Site	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:8873831G>T	uc011kwu.1	+	4	759	c.499_splice	c.e4-1	p.E167_splice	ERI1_uc003wsk.2_Splice_Site_p.E167_splice	NM_153332	NP_699163	Q8IV48	ERI1_HUMAN	three prime histone mRNA exonuclease 1						gene silencing by RNA|rRNA 3'-end processing	cytoplasm|histone pre-mRNA 3'end processing complex|nucleolus	3'-5' exonuclease activity|histone pre-mRNA stem-loop binding|metal ion binding|ribosome binding|rRNA binding				0					Adenosine monophosphate(DB00131)	TTCCCTTGCAGGAAGACACGT	0.373													78	96	---	---	---	---	PASS
RP1L1	94137	broad.mit.edu	37	8	10480563	10480563	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:10480563C>T	uc003wtc.2	-	2	378	c.149G>A	c.(148-150)CGC>CAC	p.R50H		NM_178857	NP_849188	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	50					intracellular signal transduction			p.R50H(1)		ovary(4)|breast(3)|central_nervous_system(1)	8				COAD - Colon adenocarcinoma(149;0.0811)		AACGGCCAGGCGGACCCCAGC	0.637													31	42	---	---	---	---	PASS
BLK	640	broad.mit.edu	37	8	11414226	11414226	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11414226C>G	uc003wty.2	+	9	1413	c.832C>G	c.(832-834)CCA>GCA	p.P278A	BLK_uc003wtz.2_Missense_Mutation_p.P207A	NM_001715	NP_001706	P51451	BLK_HUMAN	B lymphoid tyrosine kinase	278	Protein kinase.				intracellular protein kinase cascade|positive regulation of insulin secretion		ATP binding|non-membrane spanning protein tyrosine kinase activity			large_intestine(1)|stomach(1)|ovary(1)	3			STAD - Stomach adenocarcinoma(15;0.00391)	COAD - Colon adenocarcinoma(149;0.207)		AACCATGTCTCCAGAAGCCTT	0.537													40	50	---	---	---	---	PASS
POLR3D	661	broad.mit.edu	37	8	22107639	22107639	+	Nonsense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22107639C>T	uc003xbl.2	+	8	1056	c.973C>T	c.(973-975)CAG>TAG	p.Q325*	POLR3D_uc003xbm.2_Nonsense_Mutation_p.Q325*|POLR3D_uc011kze.1_RNA	NM_001722	NP_001713	P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide	325					innate immune response|positive regulation of innate immune response|positive regulation of interferon-beta production|response to virus|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	DNA-directed RNA polymerase III complex	DNA binding|DNA-directed RNA polymerase activity				0				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		GACAGAGGGTCAGGTTGGCAA	0.562													36	42	---	---	---	---	PASS
ST18	9705	broad.mit.edu	37	8	53092850	53092850	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53092850C>A	uc003xqz.2	-	4	265	c.109G>T	c.(109-111)GCA>TCA	p.A37S	ST18_uc011ldq.1_5'UTR|ST18_uc011ldr.1_Missense_Mutation_p.A2S|ST18_uc011lds.1_5'UTR|ST18_uc003xra.2_Missense_Mutation_p.A37S|ST18_uc003xrb.2_Missense_Mutation_p.A37S|ST18_uc010lyb.2_RNA	NM_014682	NP_055497	O60284	ST18_HUMAN	suppression of tumorigenicity 18	37						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)|skin(1)	5		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				CTCTTCTTTGCCATGGAGCAA	0.418													80	109	---	---	---	---	PASS
CHD7	55636	broad.mit.edu	37	8	61655236	61655236	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61655236G>A	uc003xue.2	+	2	1722	c.1245G>A	c.(1243-1245)CCG>CCA	p.P415P		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	415	Pro-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			AAGTCAGGCCGGGAAGTGCTG	0.547													19	105	---	---	---	---	PASS
ARFGEF1	10565	broad.mit.edu	37	8	68178322	68178322	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:68178322G>A	uc003xxo.1	-	14	2432	c.2042C>T	c.(2041-2043)ACA>ATA	p.T681I	ARFGEF1_uc003xxl.1_Missense_Mutation_p.T135I	NM_006421	NP_006412	Q9Y6D6	BIG1_HUMAN	brefeldin A-inhibited guanine	681					exocytosis|regulation of ARF protein signal transduction	cytoplasm	ARF guanyl-nucleotide exchange factor activity|myosin binding			ovary(4)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|kidney(1)	8	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			AGACATCTGTGTACTGTAGCT	0.378													32	50	---	---	---	---	PASS
CDH17	1015	broad.mit.edu	37	8	95189937	95189937	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:95189937G>C	uc003ygh.2	-	4	288	c.163C>G	c.(163-165)CCT>GCT	p.P55A	CDH17_uc011lgo.1_Missense_Mutation_p.P55A|CDH17_uc011lgp.1_Missense_Mutation_p.P55A	NM_004063	NP_004054	Q12864	CAD17_HUMAN	cadherin 17 precursor	55	Extracellular (Potential).|Cadherin 1.					integral to membrane	calcium ion binding			ovary(5)|skin(1)	6	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			ACAGCAGGAGGATTGGCCTTA	0.393													29	31	---	---	---	---	PASS
ENPP2	5168	broad.mit.edu	37	8	120633675	120633675	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120633675G>C	uc003yot.1	-	4	463	c.377C>G	c.(376-378)GCC>GGC	p.A126G	ENPP2_uc003yos.1_Missense_Mutation_p.A126G|ENPP2_uc010mdd.1_Missense_Mutation_p.A126G	NM_001040092	NP_001035181	Q13822	ENPP2_HUMAN	autotaxin isoform 2 preproprotein	126	SMB 2.				cellular component movement|chemotaxis|G-protein coupled receptor protein signaling pathway|immune response|phosphate metabolic process|phosphatidylcholine catabolic process|regulation of cell migration	extracellular space|integral to plasma membrane	alkylglycerophosphoethanolamine phosphodiesterase activity|calcium ion binding|lysophospholipase activity|nucleic acid binding|nucleotide diphosphatase activity|phosphodiesterase I activity|polysaccharide binding|scavenger receptor activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|large_intestine(1)|kidney(1)	7	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GTCTCCCCTGGCCAAGCAGTC	0.468													36	51	---	---	---	---	PASS
NDUFB9	4715	broad.mit.edu	37	8	125562116	125562116	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125562116C>T	uc003yrg.3	+	4	608	c.523C>T	c.(523-525)CGG>TGG	p.R175W	NDUFB9_uc011lim.1_Intron	NM_005005	NP_004996	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta	175					mitochondrial electron transport, NADH to ubiquinone|sensory perception of sound|transport	mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity			ovary(1)|skin(1)	2	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)		NADH(DB00157)	GACCAGACCCCGGGAGCGGCC	0.488													28	35	---	---	---	---	PASS
CPSF1	29894	broad.mit.edu	37	8	145619352	145619352	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145619352T>C	uc003zcj.2	-	34	3910	c.3835A>G	c.(3835-3837)ATG>GTG	p.M1279V		NM_013291	NP_037423	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1,	1279					mRNA cleavage|mRNA export from nucleus|mRNA polyadenylation|nuclear mRNA splicing, via spliceosome|termination of RNA polymerase II transcription	mRNA cleavage and polyadenylation specificity factor complex	mRNA 3'-UTR binding|protein binding			skin(1)	1	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			ATGTACACCATGAGGTTGCGG	0.677													18	23	---	---	---	---	PASS
LRRC24	441381	broad.mit.edu	37	8	145748500	145748500	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145748500C>G	uc003zdm.2	-	5	1033	c.901G>C	c.(901-903)GAG>CAG	p.E301Q	LRRC24_uc003zdn.2_Missense_Mutation_p.E298Q|LRRC14_uc003zdk.1_3'UTR|LRRC14_uc003zdl.1_3'UTR|LRRC14_uc003zdo.2_RNA	NM_001024678	NP_001019849	Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24 precursor	301	Ig-like C2-type.					integral to membrane					0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GGCCGGCCCTCGCGAGGCTGG	0.692													9	16	---	---	---	---	PASS
KIAA1797	54914	broad.mit.edu	37	9	20912887	20912887	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:20912887T>C	uc003zog.1	+	25	3104	c.2741T>C	c.(2740-2742)TTG>TCG	p.L914S	KIAA1797_uc003zoh.1_Missense_Mutation_p.L350S	NM_017794	NP_060264	Q5VW36	K1797_HUMAN	hypothetical protein LOC54914	914						integral to membrane	binding			ovary(8)|breast(1)|kidney(1)	10				GBM - Glioblastoma multiforme(3;2.1e-125)|Lung(42;2.76e-14)|LUSC - Lung squamous cell carcinoma(42;1.99e-11)		GAGCTGGAGTTGCAGTTAAAA	0.418													30	10	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86591925	86591925	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86591925C>G	uc004ang.3	-	5	422	c.198G>C	c.(196-198)AAG>AAC	p.K66N	HNRNPK_uc011lsw.1_5'Flank|HNRNPK_uc004and.3_5'Flank|HNRNPK_uc004ank.3_Missense_Mutation_p.K66N|HNRNPK_uc004anf.3_Missense_Mutation_p.K66N|HNRNPK_uc004anh.3_Missense_Mutation_p.K66N|HNRNPK_uc011lsx.1_Missense_Mutation_p.K66N|HNRNPK_uc004ani.3_Missense_Mutation_p.K66N|HNRNPK_uc004anj.3_Missense_Mutation_p.K66N|HNRNPK_uc004ann.3_Missense_Mutation_p.K66N|HNRNPK_uc004anl.3_Missense_Mutation_p.K66N|HNRNPK_uc004anm.3_Missense_Mutation_p.K66N	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	66	1-1.|2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|KH 1.|Necessary for interaction with DDX1.|Interaction with ASFV p30.				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						TACGGAGAGCCTTAATATTCT	0.343													21	5	---	---	---	---	PASS
HNRNPK	3190	broad.mit.edu	37	9	86591934	86591934	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:86591934C>T	uc004ang.3	-	5	413	c.189G>A	c.(187-189)AAG>AAA	p.K63K	HNRNPK_uc011lsw.1_5'Flank|HNRNPK_uc004and.3_5'Flank|HNRNPK_uc004ank.3_Silent_p.K63K|HNRNPK_uc004anf.3_Silent_p.K63K|HNRNPK_uc004anh.3_Silent_p.K63K|HNRNPK_uc011lsx.1_Silent_p.K63K|HNRNPK_uc004ani.3_Silent_p.K63K|HNRNPK_uc004anj.3_Silent_p.K63K|HNRNPK_uc004ann.3_Silent_p.K63K|HNRNPK_uc004anl.3_Silent_p.K63K|HNRNPK_uc004anm.3_Silent_p.K63K	NM_031262	NP_112552	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	63	1-1.|2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|KH 1.|Necessary for interaction with DDX1.|Interaction with ASFV p30.				interspecies interaction between organisms|positive regulation of low-density lipoprotein particle receptor biosynthetic process|positive regulation of receptor-mediated endocytosis|regulation of lipid transport by positive regulation of transcription from an RNA polymerase II promoter|regulation of low-density lipoprotein particle clearance|signal transduction	catalytic step 2 spliceosome|cytoplasm|heterogeneous nuclear ribonucleoprotein complex|nuclear chromatin|nucleoplasm	protein binding|RNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|single-stranded DNA binding			skin(1)	1						CCTTAATATTCTTGCCTCCTT	0.353													20	6	---	---	---	---	PASS
CEP110	11064	broad.mit.edu	37	9	123908435	123908435	+	Silent	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:123908435A>T	uc004bkx.1	+	21	3391	c.3360A>T	c.(3358-3360)CGA>CGT	p.R1120R	CEP110_uc004bky.1_Silent_p.R724R|CEP110_uc004bla.1_Silent_p.R568R|CEP110_uc010mvo.1_5'UTR	NM_007018	NP_008949	Q7Z7A1	CNTRL_HUMAN	centrosomal protein 110kDa	1120					cell division|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein binding				0						CTGAACTTCGACGTGAAGTTT	0.358													36	2	---	---	---	---	PASS
ZNF79	7633	broad.mit.edu	37	9	130206596	130206596	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130206596C>T	uc004bqw.3	+	5	1031	c.617C>T	c.(616-618)TCT>TTT	p.S206F	ZNF79_uc011maf.1_Missense_Mutation_p.S182F|ZNF79_uc011mag.1_Missense_Mutation_p.S182F	NM_007135	NP_009066	Q15937	ZNF79_HUMAN	zinc finger protein 79	206	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1						AGTTACTGTTCTTCCCTTTCT	0.483													26	37	---	---	---	---	PASS
SH2D3C	10044	broad.mit.edu	37	9	130523883	130523883	+	Intron	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:130523883C>T	uc004bsc.2	-						SH2D3C_uc004brz.3_Intron|SH2D3C_uc011mak.1_Intron|SH2D3C_uc004bsa.2_Intron|SH2D3C_uc004bsb.2_Intron	NM_170600	NP_733745	Q8N5H7	SH2D3_HUMAN	SH2 domain containing 3C isoform a						JNK cascade|small GTPase mediated signal transduction	cytoplasm|membrane	guanyl-nucleotide exchange factor activity|SH3/SH2 adaptor activity			ovary(1)	1						TGGCCAGCCCCTCCTACCTTC	0.607													36	5	---	---	---	---	PASS
ADARB2	105	broad.mit.edu	37	10	1262882	1262882	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:1262882G>A	uc009xhq.2	-							NM_018702	NP_061172	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2						mRNA processing	mitochondrion|nucleus	adenosine deaminase activity|double-stranded RNA binding|metal ion binding|single-stranded RNA binding			large_intestine(2)|central_nervous_system(1)	3		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		AGGAAGCCGTGGGCCTCACCT	0.667													9	9	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50854731	50854731	+	Intron	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50854731C>G	uc001jhz.2	+						CHAT_uc001jhv.1_Intron|CHAT_uc001jhx.1_Intron|CHAT_uc001jhy.1_Intron|CHAT_uc001jia.2_Intron|CHAT_uc010qgs.1_Intron	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2						neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	GTAAGCCGTCCAGGTGGCCCT	0.652													9	20	---	---	---	---	PASS
MSMB	4477	broad.mit.edu	37	10	51562373	51562373	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:51562373C>A	uc001jiq.2	+	4	350	c.318C>A	c.(316-318)ACC>ACA	p.T106T	PARG_uc001jih.2_Intron|uc010qha.1_Intron|uc001jin.2_Intron|uc010qhb.1_Intron|uc010qhc.1_Intron|MSMB_uc001jir.2_Missense_Mutation_p.P71H|NCOA4_uc009xon.2_5'Flank|NCOA4_uc010qhd.1_5'Flank|NCOA4_uc001jis.3_5'Flank|NCOA4_uc010qhe.1_5'Flank|NCOA4_uc010qhf.1_5'Flank	NM_002443	NP_002434	P08118	MSMB_HUMAN	beta-microseminoprotein isoform a precursor	106						extracellular space|nucleus				ovary(2)	2						CAAAAAAGACCTGTTCTGTCA	0.458									Hereditary_Prostate_Cancer				66	77	---	---	---	---	PASS
LRRTM3	347731	broad.mit.edu	37	10	68686704	68686704	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:68686704C>T	uc001jmz.1	+	2	580	c.30C>T	c.(28-30)AGC>AGT	p.S10S	CTNNA3_uc009xpn.1_Intron|CTNNA3_uc001jmw.2_Intron|CTNNA3_uc001jmx.3_Intron|CTNNA3_uc009xpo.1_Intron|LRRTM3_uc001jmy.2_Silent_p.S10S	NM_178011	NP_821079	Q86VH5	LRRT3_HUMAN	leucine rich repeat transmembrane neuronal 3	10						integral to membrane				upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3						GGCTACTGAGCGGATCAGCTG	0.413													14	58	---	---	---	---	PASS
PRF1	5551	broad.mit.edu	37	10	72358173	72358173	+	Missense_Mutation	SNP	G	T	T	rs28933376		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:72358173G>T	uc009xqg.2	-	3	1465	c.1304C>A	c.(1303-1305)ACG>AAG	p.T435K	PRF1_uc001jrf.3_Missense_Mutation_p.T435K	NM_001083116	NP_001076585	P14222	PERF_HUMAN	perforin 1 precursor	435	C2.				apoptosis|cellular defense response|cytolysis|defense response to tumor cell|defense response to virus|immune response to tumor cell|protein homooligomerization	cytolytic granule|endosome lumen|extracellular region|integral to membrane|plasma membrane	calcium ion binding|protein binding|wide pore channel activity			large_intestine(1)|ovary(1)|central_nervous_system(1)	3						ATAGGCATCCGTGGCAGTGAA	0.617			M			various leukaemia|lymphoma	Type 2 familial hemophagocytic lymphohistiocytosis		Familial_Hemophagocytic_Lymphohistiocytosis				3	63	---	---	---	---	PASS
DNMBP	23268	broad.mit.edu	37	10	101716838	101716838	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101716838C>A	uc001kqj.2	-	4	485	c.393G>T	c.(391-393)CGG>CGT	p.R131R	NCRNA00093_uc001kqk.1_RNA	NM_015221	NP_056036	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	131					intracellular signal transduction|regulation of Rho protein signal transduction	cell junction|cytoskeleton|Golgi stack|synapse	protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(5)|skin(1)	6		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		AGTGCCACTGCCGGCTCTGTG	0.622													17	20	---	---	---	---	PASS
ELOVL3	83401	broad.mit.edu	37	10	103988611	103988611	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103988611C>T	uc001kut.2	+	4	578	c.415C>T	c.(415-417)CGG>TGG	p.R139W		NM_152310	NP_689523	Q9HB03	ELOV3_HUMAN	elongation of very long chain fatty acids like	139					fatty acid elongation, monounsaturated fatty acid|fatty acid elongation, polyunsaturated fatty acid|fatty acid elongation, saturated fatty acid|long-chain fatty-acyl-CoA biosynthetic process|triglyceride biosynthetic process|very long-chain fatty acid biosynthetic process	endoplasmic reticulum membrane|integral to membrane	fatty acid elongase activity|protein binding			ovary(2)	2		Colorectal(252;0.207)		Epithelial(162;4.47e-08)|all cancers(201;7.96e-07)		CCTGCGTAAGCGGCCACTCAT	0.537													66	115	---	---	---	---	PASS
PITX3	5309	broad.mit.edu	37	10	103990395	103990395	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103990395G>T	uc001kuu.1	-	4	939	c.785C>A	c.(784-786)TCG>TAG	p.S262*		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	262	OAR.				dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		GGCCAGGCTCGAGTTACACGG	0.562													3	17	---	---	---	---	PASS
PITX3	5309	broad.mit.edu	37	10	103990840	103990840	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103990840G>T	uc001kuu.1	-	4	494	c.340C>A	c.(340-342)CGC>AGC	p.R114S		NM_005029	NP_005020	O75364	PITX3_HUMAN	paired-like homeodomain 3	114	Homeobox.				dopaminergic neuron differentiation|lens morphogenesis in camera-type eye|midbrain development|positive regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0		Colorectal(252;0.00957)		Epithelial(162;4.97e-08)|all cancers(201;8.99e-07)		CATTTGGCGCGCCGGTTCTTG	0.731													3	15	---	---	---	---	PASS
C10orf119	79892	broad.mit.edu	37	10	121618678	121618678	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:121618678C>T	uc001ler.2	-	3	458	c.160G>A	c.(160-162)GAA>AAA	p.E54K	C10orf119_uc001les.1_5'UTR	NM_024834	NP_079110	Q9BTE3	MCMBP_HUMAN	chromosome 10 open reading frame 119	54					cell division|DNA-dependent DNA replication|mitosis|S phase of mitotic cell cycle|sister chromatid cohesion	nucleus	chromatin binding				0		Lung NSC(174;0.109)|all_lung(145;0.142)		all cancers(201;0.0044)		AGGGGAACTTCGTTCAGTGAT	0.328													20	23	---	---	---	---	PASS
OR51E2	81285	broad.mit.edu	37	11	4703724	4703724	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4703724G>A	uc001lzk.2	-	2	462	c.218C>T	c.(217-219)TCC>TTC	p.S73F		NM_030774	NP_110401	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E,	73	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			lung(3)|ovary(2)	5		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		GGTGGATGTGGATAAGGCCAG	0.507													54	39	---	---	---	---	PASS
OR52A5	390054	broad.mit.edu	37	11	5153137	5153137	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5153137C>T	uc010qyx.1	-	1	736	c.736G>A	c.(736-738)GCC>ACC	p.A246T		NM_001005160	NP_001005160	Q9H2C5	O52A5_HUMAN	olfactory receptor, family 52, subfamily A,	246	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)|lung(1)|central_nervous_system(1)	4		Medulloblastoma(188;0.0049)|all_neural(188;0.0442)|Breast(177;0.0675)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.2)		CAAATGTGGGCAATGCATGTA	0.398													40	40	---	---	---	---	PASS
TRIM5	85363	broad.mit.edu	37	11	5701330	5701330	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5701330C>T	uc001mbm.1	-	2	335	c.78G>A	c.(76-78)CTG>CTA	p.L26L	TRIM5_uc001mbq.1_Silent_p.L26L|TRIM5_uc001mbl.1_RNA|TRIM5_uc001mbn.2_Silent_p.L26L|TRIM5_uc001mbo.2_Silent_p.L26L|TRIM5_uc001mbp.2_Silent_p.L26L	NM_033034	NP_149023	Q9C035	TRIM5_HUMAN	tripartite motif protein TRIM5 isoform alpha	26	RING-type.				interspecies interaction between organisms|protein trimerization|response to virus	cytoplasm|cytoplasmic mRNA processing body	ligase activity|protein binding|protein homodimerization activity|zinc ion binding			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		AGTCCAGGCTCAGGGGTTGTG	0.552													57	79	---	---	---	---	PASS
ABCC8	6833	broad.mit.edu	37	11	17474672	17474672	+	Silent	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17474672T>C	uc001mnc.2	-	7	1296	c.1170A>G	c.(1168-1170)GCA>GCG	p.A390A	ABCC8_uc010rcy.1_Silent_p.A389A	NM_000352	NP_000343	Q09428	ABCC8_HUMAN	ATP-binding cassette, sub-family C, member 8	390	Cytoplasmic (By similarity).|ABC transmembrane type-1 1.				carbohydrate metabolic process|energy reserve metabolic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium ion transmembrane transporter activity|sulfonylurea receptor activity			ovary(1)	1				READ - Rectum adenocarcinoma(2;0.0325)|Colorectal(2;0.1)	Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)|Gliclazide(DB01120)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Repaglinide(DB00912)	GTACCTGTATTGCTCCTCTCA	0.393													21	105	---	---	---	---	PASS
PDHX	8050	broad.mit.edu	37	11	34938280	34938280	+	Silent	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:34938280A>G	uc001mvt.2	+	1	604	c.78A>G	c.(76-78)GTA>GTG	p.V26V	PDHX_uc010rep.1_Intron|PDHX_uc010req.1_Silent_p.V26V|APIP_uc010reo.1_5'Flank|APIP_uc001mvs.2_5'Flank	NM_003477	NP_003468	O00330	ODPX_HUMAN	pyruvate dehydrogenase complex, component X	26					pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	acyltransferase activity			kidney(1)	1	all_epithelial(35;0.115)|Lung NSC(22;0.218)|all_lung(20;0.242)	all_hematologic(20;0.124)	STAD - Stomach adenocarcinoma(6;0.00113)			GCCGAAGCGTAGGGCTGGTGA	0.652													14	26	---	---	---	---	PASS
OR4C15	81309	broad.mit.edu	37	11	55322751	55322751	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55322751G>A	uc010rig.1	+	1	969	c.969G>A	c.(967-969)ATG>ATA	p.M323I		NM_001001920	NP_001001920	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C,	269	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						TTGACAAAATGGCGGCAATAT	0.383										HNSCC(20;0.049)			42	108	---	---	---	---	PASS
OR4C16	219428	broad.mit.edu	37	11	55340262	55340262	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55340262T>C	uc010rih.1	+	1	659	c.659T>C	c.(658-660)TTG>TCG	p.L220S		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				GTCATCTTCTTGCATTCTCTG	0.418													15	48	---	---	---	---	PASS
OR4C16	219428	broad.mit.edu	37	11	55340263	55340263	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55340263G>A	uc010rih.1	+	1	660	c.660G>A	c.(658-660)TTG>TTA	p.L220L		NM_001004701	NP_001004701	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C,	220	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		all_epithelial(135;0.0748)				TCATCTTCTTGCATTCTCTGA	0.418													15	48	---	---	---	---	PASS
MRPL16	54948	broad.mit.edu	37	11	59574276	59574276	+	Silent	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59574276G>T	uc001noh.2	-	4	514	c.300C>A	c.(298-300)GGC>GGA	p.G100G		NM_017840	NP_060310	Q9NX20	RM16_HUMAN	mitochondrial ribosomal protein L16 precursor	100							rRNA binding			central_nervous_system(1)	1						TTTCAAAGTGGCCCCAATGCA	0.488													59	42	---	---	---	---	PASS
MS4A1	931	broad.mit.edu	37	11	60235940	60235940	+	Nonstop_Mutation	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:60235940A>T	uc001npp.2	+	8	1309	c.893A>T	c.(892-894)TAA>TTA	p.*298L	MS4A1_uc001npq.2_Nonstop_Mutation_p.*298L|MS4A1_uc009yna.2_Nonstop_Mutation_p.*298L|MS4A1_uc009ymz.2_Nonstop_Mutation_p.*285L|MS4A1_uc010rlc.1_Nonstop_Mutation_p.*131L	NM_152866	NP_690605	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member	298					B cell activation|immune response	integral to plasma membrane				ovary(3)|lung(2)	5					Ibritumomab(DB00078)|Rituximab(DB00073)|Tositumomab(DB00081)	AGCTCTCCTTAAGTGATTTCT	0.393													6	20	---	---	---	---	PASS
SNX32	254122	broad.mit.edu	37	11	65617738	65617738	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65617738G>A	uc001ofr.2	+	4	497	c.370G>A	c.(370-372)GAA>AAA	p.E124K	SNX32_uc010rop.1_3'UTR	NM_152760	NP_689973	Q86XE0	SNX32_HUMAN	sorting nexin 6B	124	PX.				cell communication|protein transport		phosphatidylinositol binding				0				READ - Rectum adenocarcinoma(159;0.171)		GCAGGAGCTGGAAGCGTGAGT	0.562													14	35	---	---	---	---	PASS
RCE1	9986	broad.mit.edu	37	11	66611788	66611788	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:66611788C>T	uc001ojk.1	+	4	448	c.404C>T	c.(403-405)TCT>TTT	p.S135F	RCE1_uc001ojl.1_Missense_Mutation_p.S31F	NM_005133	NP_005124	Q9Y256	FACE2_HUMAN	prenyl protein peptidase RCE1 isoform 1	135					proteolysis	endoplasmic reticulum membrane|integral to plasma membrane	metalloendopeptidase activity			ovary(1)|breast(1)	2						ATGCAGCTCTCTATGGATTGC	0.532													64	65	---	---	---	---	PASS
GAB2	9846	broad.mit.edu	37	11	78128682	78128682	+	Intron	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78128682C>A	uc001ozh.2	-							NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			gcggccgcgcccgcACTCACA	0.318													7	9	---	---	---	---	PASS
GAB2	9846	broad.mit.edu	37	11	78128683	78128683	+	Intron	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:78128683C>A	uc001ozh.2	-							NM_080491	NP_536739	Q9UQC2	GAB2_HUMAN	GRB2-associated binding protein 2 isoform a						osteoclast differentiation|phosphatidylinositol-mediated signaling|positive regulation of cell proliferation|positive regulation of mast cell degranulation	cytosol|plasma membrane	phosphatidylinositol-3,4,5-trisphosphate binding|phosphatidylinositol-3,4-bisphosphate binding|transmembrane receptor protein tyrosine kinase adaptor activity			ovary(5)|lung(1)	6	all_cancers(14;3.31e-18)|all_epithelial(13;5.3e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.58e-23)			cggccgcgcccgcACTCACAT	0.323													8	10	---	---	---	---	PASS
GRM5	2915	broad.mit.edu	37	11	88300267	88300267	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:88300267G>T	uc001pcq.2	-	7	2784	c.2584C>A	c.(2584-2586)CTA>ATA	p.L862I	GRM5_uc009yvm.2_Missense_Mutation_p.L862I	NM_001143831	NP_001137303	P41594	GRM5_HUMAN	glutamate receptor, metabotropic 5 isoform a	862	Cytoplasmic (Potential).				activation of phospholipase C activity by metabotropic glutamate receptor signaling pathway|synaptic transmission	integral to plasma membrane	G-protein coupled receptor activity|glutamate receptor activity			central_nervous_system(4)|ovary(2)|lung(2)|breast(1)	9		Acute lymphoblastic leukemia(157;2.54e-05)|all_hematologic(158;0.00834)			Acamprosate(DB00659)	AGGTTGACTAGGCTGCTGGAT	0.572													19	55	---	---	---	---	PASS
CEP57	9702	broad.mit.edu	37	11	95546720	95546720	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:95546720C>T	uc001pfp.1	+	4	692	c.471C>T	c.(469-471)GCC>GCT	p.A157A	CEP57_uc001pfo.1_Silent_p.A157A|CEP57_uc010ruh.1_Silent_p.A148A|CEP57_uc010rui.1_Silent_p.A157A|CEP57_uc009ywn.1_Silent_p.A5A|CEP57_uc001pfq.1_Silent_p.A157A|CEP57_uc001pfr.1_Silent_p.A5A	NM_014679	NP_055494	Q86XR8	CEP57_HUMAN	translokin	157	Potential.|centrosome localization domain (CLD) (By similarity).				fibroblast growth factor receptor signaling pathway|G2/M transition of mitotic cell cycle|protein import into nucleus, translocation|spermatid development	centrosome|cytosol|Golgi apparatus|microtubule|nucleus	fibroblast growth factor binding|protein homodimerization activity			ovary(1)	1		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TAAAGCATGCCGAAATGGAGA	0.333									Mosaic_Variegated_Aneuploidy_Syndrome				11	24	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107920638	107920638	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107920638G>A	uc001pjv.2	+	4	923	c.256G>A	c.(256-258)GAT>AAT	p.D86N	CUL5_uc001pju.2_RNA	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing	86					cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CCATCAAGATGATACGGCTTT	0.308													13	37	---	---	---	---	PASS
CUL5	8065	broad.mit.edu	37	11	107920721	107920721	+	Silent	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107920721A>G	uc001pjv.2	+	4	1006	c.339A>G	c.(337-339)CAA>CAG	p.Q113Q	CUL5_uc001pju.2_RNA	NM_003478	NP_003469	Q93034	CUL5_HUMAN	Vasopressin-activated calcium-mobilizing	113					cell cycle arrest|cell proliferation|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|ubiquitin-dependent protein catabolic process|viral reproduction	cullin-RING ubiquitin ligase complex|cytosol	calcium channel activity|receptor activity|ubiquitin protein ligase binding			ovary(1)	1		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CTTTTTGTCAACTAGAGATTA	0.338													44	26	---	---	---	---	PASS
ATM	472	broad.mit.edu	37	11	108202603	108202603	+	Intron	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108202603C>A	uc001pkb.1	+						ATM_uc009yxr.1_Intron|C11orf65_uc010rvx.1_Intron|C11orf65_uc009yxu.1_Intron|ATM_uc001pke.1_Intron|ATM_uc001pkg.1_Intron	NM_000051	NP_000042	Q13315	ATM_HUMAN	ataxia telangiectasia mutated isoform 1						cell cycle arrest|cellular response to gamma radiation|DNA damage induced protein phosphorylation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|double-strand break repair via homologous recombination|G2/M transition DNA damage checkpoint|histone mRNA catabolic process|mitotic cell cycle spindle assembly checkpoint|negative regulation of B cell proliferation|peptidyl-serine phosphorylation|positive regulation of DNA damage response, signal transduction by p53 class mediator|pre-B cell allelic exclusion|protein autophosphorylation|reciprocal meiotic recombination|replicative senescence	cytoplasmic membrane-bounded vesicle|nucleoplasm	1-phosphatidylinositol-3-kinase activity|ATP binding|DNA binding|DNA-dependent protein kinase activity|identical protein binding|protein complex binding|protein dimerization activity|protein N-terminus binding			haematopoietic_and_lymphoid_tissue(174)|lung(25)|breast(15)|large_intestine(9)|ovary(5)|kidney(5)|central_nervous_system(4)|upper_aerodigestive_tract(1)|stomach(1)|NS(1)	240		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)		TCTTTTCTTACAGCTAATCTC	0.294			D|Mis|N|F|S		T-PLL	leukemia|lymphoma|medulloblastoma|glioma		Genes_defective_in_diseases_associated_with_sensitivity_to_DNA_damaging_agents	Ataxia_Telangiectasia	TSP Lung(14;0.12)			16	58	---	---	---	---	PASS
EXPH5	23086	broad.mit.edu	37	11	108385055	108385055	+	Silent	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108385055T>A	uc001pkk.2	-	6	1290	c.1179A>T	c.(1177-1179)TCA>TCT	p.S393S	EXPH5_uc010rvy.1_Silent_p.S205S|EXPH5_uc010rvz.1_Silent_p.S237S|EXPH5_uc010rwa.1_Silent_p.S317S	NM_015065	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5 isoform a	393					intracellular protein transport		Rab GTPase binding			skin(3)|ovary(2)	5		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		TTTCCATTGGTGATGGTGCCC	0.443													126	96	---	---	---	---	PASS
CBL	867	broad.mit.edu	37	11	119149399	119149399	+	Missense_Mutation	SNP	G	A	A	rs138277394		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119149399G>A	uc001pwe.2	+	9	1545	c.1407G>A	c.(1405-1407)ATG>ATA	p.M469I		NM_005188	NP_005179	P22681	CBL_HUMAN	Cas-Br-M (murine) ecotropic retroviral	469	Asp/Glu-rich (acidic).				epidermal growth factor receptor signaling pathway|negative regulation of apoptosis|negative regulation of epidermal growth factor receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase cascade|positive regulation of receptor-mediated endocytosis	cytosol|nucleus	calcium ion binding|sequence-specific DNA binding transcription factor activity|SH3 domain binding|signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding	p.E366_K477del(1)		haematopoietic_and_lymphoid_tissue(135)|lung(10)|central_nervous_system(2)|ovary(1)|breast(1)	149		Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.92e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.000784)		CTCTCTTCATGATGAAGGAAT	0.463									CBL_gene-associated_Juvenile_Myelomonocytic_Leukemia_and_Developmental_Anomalies|Noonan_syndrome				37	34	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135773	124135773	+	IGR	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135773C>A								OR8G2 (39463 upstream) : OR8D1 (43964 downstream)																							AACAGAAGTACAATGAAAAAG	0.383													10	8	---	---	---	---	PASS
CCDC15	80071	broad.mit.edu	37	11	124875041	124875041	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124875041A>G	uc001qbm.3	+	13	2603	c.2344A>G	c.(2344-2346)ATG>GTG	p.M782V		NM_025004	NP_079280	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	782	Potential.					centrosome				ovary(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		acgacttttcatggatattGA	0.164													8	2	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	132205049	132205049	+	3'UTR	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:132205049C>T	uc001qgp.2	+	7					NTM_uc001qgm.2_3'UTR|NTM_uc010sch.1_3'UTR|NTM_uc010sci.1_3'UTR|NTM_uc010scj.1_3'UTR|NTM_uc001qgq.2_3'UTR|NTM_uc001qgr.2_3'UTR	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1						cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						GATGTGAGTGCCACTTCCCCA	0.552													36	19	---	---	---	---	PASS
CACNA1C	775	broad.mit.edu	37	12	2224635	2224635	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2224635C>T	uc009zdu.1	+	2	608	c.295C>T	c.(295-297)CGC>TGC	p.R99C	CACNA1C_uc009zdv.1_Missense_Mutation_p.R99C|CACNA1C_uc001qkb.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkc.2_Missense_Mutation_p.R99C|CACNA1C_uc001qke.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkf.2_Missense_Mutation_p.R99C|CACNA1C_uc001qjz.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkd.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkg.2_Missense_Mutation_p.R99C|CACNA1C_uc009zdw.1_Missense_Mutation_p.R99C|CACNA1C_uc001qkh.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkl.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkn.2_Missense_Mutation_p.R99C|CACNA1C_uc001qko.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkp.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkr.2_Missense_Mutation_p.R99C|CACNA1C_uc001qku.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkq.2_Missense_Mutation_p.R99C|CACNA1C_uc001qks.2_Missense_Mutation_p.R99C|CACNA1C_uc001qkt.2_Missense_Mutation_p.R99C	NM_199460	NP_955630	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type,	99	Cytoplasmic (Potential).				axon guidance|calcium ion transport into cytosol|energy reserve metabolic process|regulation of insulin secretion	cytoplasm|postsynaptic density|voltage-gated calcium channel complex	calmodulin binding|voltage-gated calcium channel activity			ovary(10)|central_nervous_system(1)	11			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Mibefradil(DB01388)|Nicardipine(DB00622)|Verapamil(DB00661)	CACGGCCACACGCCCGCCCCG	0.627													46	55	---	---	---	---	PASS
NDUFA9	4704	broad.mit.edu	37	12	4763618	4763618	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4763618C>T	uc001qnc.2	+	2	220	c.210C>T	c.(208-210)GTC>GTT	p.V70V	NDUFA9_uc009zei.1_Silent_p.V70V	NM_005002	NP_004993	Q16795	NDUA9_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha	70					mitochondrial electron transport, NADH to ubiquinone|sodium ion transport	mitochondrial matrix|mitochondrial respiratory chain complex I	NADH dehydrogenase (ubiquinone) activity|protein binding			ovary(1)	1					NADH(DB00157)	GATATGTTGTCAACCACCTTG	0.458													43	94	---	---	---	---	PASS
PFKM	5213	broad.mit.edu	37	12	48531536	48531536	+	Silent	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48531536A>G	uc001rrc.2	+	11	1139	c.969A>G	c.(967-969)GCA>GCG	p.A323A	PFKM_uc001rra.1_Silent_p.A8A|PFKM_uc001rrb.1_Silent_p.A394A|PFKM_uc001rrd.2_Silent_p.A8A|PFKM_uc001rre.1_Silent_p.A323A|PFKM_uc001rrg.1_Silent_p.A292A	NM_000289	NP_000280	P08237	K6PF_HUMAN	phosphofructokinase, muscle	323					fructose 6-phosphate metabolic process|glycolysis|muscle cell homeostasis	6-phosphofructokinase complex|apical plasma membrane	6-phosphofructokinase activity|ATP binding|identical protein binding|kinase binding|metal ion binding|protein C-terminus binding			ovary(2)|upper_aerodigestive_tract(1)|kidney(1)	4						CAGTGATGGCACTTTTGGAGG	0.587													35	91	---	---	---	---	PASS
ACCN2	41	broad.mit.edu	37	12	50471078	50471078	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:50471078C>T	uc001rvw.2	+	4	870	c.641C>T	c.(640-642)ACG>ATG	p.T214M	ACCN2_uc001rvv.2_Missense_Mutation_p.T214M|ACCN2_uc009zln.2_Missense_Mutation_p.T5M|ACCN2_uc009zlo.2_Missense_Mutation_p.T214M	NM_001095	NP_001086	P78348	ACCN2_HUMAN	amiloride-sensitive cation channel 2, neuronal	214	Extracellular (By similarity).				calcium ion transport|response to pH|signal transduction	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(1)	1					Amiloride(DB00594)	AAGGGTGGGACGGGCAATGGG	0.617													34	48	---	---	---	---	PASS
TBK1	29110	broad.mit.edu	37	12	64891754	64891754	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:64891754G>C	uc001ssc.1	+	20	2135	c.2073G>C	c.(2071-2073)AAG>AAC	p.K691N		NM_013254	NP_037386	Q9UHD2	TBK1_HUMAN	TANK-binding kinase 1	691	Potential.				I-kappaB kinase/NF-kappaB cascade|innate immune response|interspecies interaction between organisms|MyD88-independent toll-like receptor signaling pathway|negative regulation of type I interferon production|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interferon-alpha production|positive regulation of interferon-beta production|positive regulation of transcription from RNA polymerase II promoter|response to virus|Toll signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	cytosol|endosome membrane|plasma membrane	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(2)|ovary(1)|large_intestine(1)|breast(1)	5				GBM - Glioblastoma multiforme(28;0.0386)		TTAGTATGAAGAAATTAAAGG	0.289													40	52	---	---	---	---	PASS
CAPS2	84698	broad.mit.edu	37	12	75687147	75687147	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:75687147C>T	uc001sxk.3	-	13	1299	c.1102G>A	c.(1102-1104)GGT>AGT	p.G368S	CAPS2_uc001sxm.3_Missense_Mutation_p.G136S|CAPS2_uc009zsa.2_5'UTR|CAPS2_uc001sxi.3_Missense_Mutation_p.G104S|CAPS2_uc001sxj.3_Missense_Mutation_p.G279S|CAPS2_uc001sxl.3_Missense_Mutation_p.G349S	NM_032606	NP_115995	Q9BXY5	CAYP2_HUMAN	calcyphosine 2	368							calcium ion binding			ovary(2)	2						AAGGTTGCACCCTAAACAAAA	0.303													27	11	---	---	---	---	PASS
CCDC38	120935	broad.mit.edu	37	12	96266040	96266040	+	Missense_Mutation	SNP	G	A	A	rs142050445		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96266040G>A	uc001tek.1	-	14	1711	c.1477C>T	c.(1477-1479)CGG>TGG	p.R493W		NM_182496	NP_872302	Q502W7	CCD38_HUMAN	coiled-coil domain containing 38	493										skin(1)	1						TACTTTTGCCGCCATTCTTTC	0.398													108	90	---	---	---	---	PASS
ANKS1B	56899	broad.mit.edu	37	12	99837544	99837544	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:99837544G>T	uc001tge.1	-	11	1899	c.1482C>A	c.(1480-1482)AAC>AAA	p.N494K	ANKS1B_uc001tgf.1_Missense_Mutation_p.N74K|ANKS1B_uc009ztt.1_Missense_Mutation_p.N460K	NM_152788	NP_690001	Q7Z6G8	ANS1B_HUMAN	cajalin 2 isoform a	494						Cajal body|cell junction|cytoplasm|dendritic spine|postsynaptic density|postsynaptic membrane					0		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		TGTTTCTATGGTTACTAGTTC	0.418													58	77	---	---	---	---	PASS
ANO4	121601	broad.mit.edu	37	12	101505455	101505455	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101505455G>T	uc010svm.1	+	24	2989	c.2417G>T	c.(2416-2418)GGA>GTA	p.G806V	ANO4_uc001thw.2_Missense_Mutation_p.G771V|ANO4_uc001thx.2_Missense_Mutation_p.G806V|ANO4_uc001thy.2_Missense_Mutation_p.G326V	NM_178826	NP_849148	Q32M45	ANO4_HUMAN	anoctamin 4	806	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(4)|skin(2)	6						TATAAGTATGGACCTTGTGCA	0.398										HNSCC(74;0.22)			40	44	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104144435	104144435	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104144435C>A	uc001tjw.2	+	60	6703	c.6517C>A	c.(6517-6519)CGC>AGC	p.R2173S	STAB2_uc009zug.2_RNA	NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	2173	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GCCCATTGACCGCTGCTTACA	0.567													40	29	---	---	---	---	PASS
VPS29	51699	broad.mit.edu	37	12	110929836	110929836	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:110929836C>T	uc001tqy.2	-	4	583	c.523G>A	c.(523-525)GAA>AAA	p.E175K	VPS29_uc001tqw.2_RNA|VPS29_uc001tqx.2_Missense_Mutation_p.E179K|VPS29_uc001tqz.2_RNA	NM_016226	NP_057310	Q9UBQ0	VPS29_HUMAN	vacuolar protein sorting 29 isoform 1	175					protein transport	endosome membrane	metal ion binding|phosphoserine phosphatase activity				0						TCGATTCGTTCTACTTTCACA	0.343													22	30	---	---	---	---	PASS
SPPL3	121665	broad.mit.edu	37	12	121229358	121229358	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121229358G>T	uc001tzd.2	-	3	585	c.104C>A	c.(103-105)TCC>TAC	p.S35Y	SPPL3_uc009zwz.2_Missense_Mutation_p.S35Y	NM_139015	NP_620584	Q8TCT6	PSL4_HUMAN	signal peptide peptidase 3	35						integral to membrane	aspartic-type endopeptidase activity				0	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CATATTAAGGGACCTGTGGAA	0.308													36	63	---	---	---	---	PASS
HNF1A	6927	broad.mit.edu	37	12	121416877	121416877	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:121416877C>A	uc001tzg.2	+	1	329	c.306C>A	c.(304-306)GCC>GCA	p.A102A	HNF1A_uc001tze.1_Silent_p.A102A|HNF1A_uc001tzf.2_Silent_p.A102A|HNF1A_uc010szn.1_Silent_p.A102A	NM_000545	NP_000536	P20823	HNF1A_HUMAN	hepatic nuclear factor-1-alpha	102					glucose homeostasis|glucose import|insulin secretion|positive regulation of transcription initiation from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|renal glucose absorption	cytoplasm|nucleus|protein complex	DNA binding|protein dimerization activity|protein heterodimerization activity|protein homodimerization activity|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding			liver(92)|large_intestine(15)|endometrium(6)|breast(2)|lung(1)	116	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ACCAGAAAGCCGTGGTGGAGA	0.657									Hepatic_Adenoma_Familial_Clustering_of				3	0	---	---	---	---	PASS
MLXIP	22877	broad.mit.edu	37	12	122618406	122618406	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122618406G>T	uc001ubq.2	+	9	1604	c.1604G>T	c.(1603-1605)CGG>CTG	p.R535L	MLXIP_uc001ubr.2_Missense_Mutation_p.R286L|MLXIP_uc001ubs.1_Missense_Mutation_p.R142L|MLXIP_uc001ubt.2_Missense_Mutation_p.R142L	NM_014938	NP_055753	Q9HAP2	MLXIP_HUMAN	MLX interacting protein	535					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrial outer membrane|nucleus	DNA binding			ovary(2)	2	all_neural(191;0.0837)|Medulloblastoma(191;0.163)	Lung NSC(355;0.0659)		OV - Ovarian serous cystadenocarcinoma(86;0.000599)|Epithelial(86;0.00102)|BRCA - Breast invasive adenocarcinoma(302;0.233)		CCCCAGCCACGGTTAACTTTT	0.617													6	1	---	---	---	---	PASS
ABCB9	23457	broad.mit.edu	37	12	123425541	123425541	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123425541G>T	uc001udm.3	-	8	1692	c.1382C>A	c.(1381-1383)TCC>TAC	p.S461Y	ABCB9_uc010tai.1_Missense_Mutation_p.S68Y|ABCB9_uc009zxr.2_Intron|ABCB9_uc001udo.3_Missense_Mutation_p.S418Y|ABCB9_uc010taj.1_Intron|ABCB9_uc001udp.2_Missense_Mutation_p.S461Y|ABCB9_uc001udq.2_Intron|ABCB9_uc001udr.2_Missense_Mutation_p.S461Y	NM_019625	NP_062571	Q9NP78	ABCB9_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	461	ABC transmembrane type-1.				positive regulation of T cell mediated cytotoxicity|protein transport	lysosomal membrane|plasma membrane|TAP complex	ATP binding|MHC class I protein binding|oligopeptide-transporting ATPase activity|peptide antigen binding|protein homodimerization activity|TAP1 binding|TAP2 binding|tapasin binding				0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.84e-05)|Epithelial(86;0.000152)|BRCA - Breast invasive adenocarcinoma(302;0.111)		GGAGCCCACGGACTGGGGAGA	0.622													5	2	---	---	---	---	PASS
EP400	57634	broad.mit.edu	37	12	132529905	132529905	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132529905G>T	uc001ujn.2	+	37	6861	c.6826G>T	c.(6826-6828)GTC>TTC	p.V2276F	EP400_uc001ujl.2_Missense_Mutation_p.V2275F|EP400_uc001ujm.2_Missense_Mutation_p.V2195F	NM_015409	NP_056224	Q96L91	EP400_HUMAN	E1A binding protein p400	2312					histone H2A acetylation|histone H4 acetylation|regulation of transcription, DNA-dependent	NuA4 histone acetyltransferase complex|nuclear speck	ATP binding|DNA binding|helicase activity			central_nervous_system(4)|ovary(3)|breast(3)|skin(2)	12	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		GGAGGCGGTCGTCCCTCCTCG	0.562													17	46	---	---	---	---	PASS
TPTE2	93492	broad.mit.edu	37	13	20067042	20067042	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:20067042G>A	uc001umd.2	-	4	278	c.67C>T	c.(67-69)CCA>TCA	p.P23S	TPTE2_uc009zzk.2_RNA|TPTE2_uc009zzl.2_Missense_Mutation_p.P23S|TPTE2_uc001ume.2_Missense_Mutation_p.P23S|TPTE2_uc009zzm.2_5'UTR|TPTE2_uc010tcm.1_RNA	NM_199254	NP_954863	Q6XPS3	TPTE2_HUMAN	TPTE and PTEN homologous inositol lipid	23						endoplasmic reticulum membrane|integral to membrane	ion channel activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity				0		all_cancers(29;1.23e-20)|all_lung(29;1.97e-20)|all_epithelial(30;5.86e-20)|Lung NSC(5;3.36e-17)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;1.73e-05)|Epithelial(112;7.42e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000785)|Lung(94;0.0176)|LUSC - Lung squamous cell carcinoma(192;0.089)		CTTGTGTGTGGGCTAGAGGAT	0.353													15	86	---	---	---	---	PASS
NBEA	26960	broad.mit.edu	37	13	36141107	36141107	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36141107G>A	uc001uvb.2	+	45	7194	c.6988G>A	c.(6988-6990)GAA>AAA	p.E2330K	NBEA_uc010abi.2_Missense_Mutation_p.E986K|NBEA_uc010tee.1_Missense_Mutation_p.E123K|NBEA_uc010tef.1_Missense_Mutation_p.E123K|NBEA_uc010teg.1_Missense_Mutation_p.E123K	NM_015678	NP_056493	Q8NFP9	NBEA_HUMAN	neurobeachin	2330	BEACH.					cytosol|endomembrane system|plasma membrane|trans-Golgi network	protein binding			ovary(9)|large_intestine(2)	11		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		CTATGAATCAGAAGAGTTGGA	0.348													61	74	---	---	---	---	PASS
DCLK1	9201	broad.mit.edu	37	13	36686298	36686298	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:36686298T>C	uc001uvf.2	-	3	664	c.431A>G	c.(430-432)AAG>AGG	p.K144R		NM_004734	NP_004725	O15075	DCLK1_HUMAN	doublecortin-like kinase 1	144					cell differentiation|central nervous system development|endosome transport|intracellular signal transduction|response to virus	integral to plasma membrane	ATP binding|protein serine/threonine kinase activity|receptor signaling protein activity			stomach(6)|ovary(2)|skin(1)	9		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GTTCACATTCTTGGTGTACTC	0.463													56	61	---	---	---	---	PASS
SCEL	8796	broad.mit.edu	37	13	78191805	78191805	+	Intron	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78191805A>T	uc001vki.2	+						SCEL_uc001vkj.2_Intron|SCEL_uc010thx.1_Intron	NM_144777	NP_659001	O95171	SCEL_HUMAN	sciellin isoform 1						embryo development|keratinocyte differentiation	cornified envelope|cytoplasm|membrane	protein binding|zinc ion binding			ovary(4)|breast(1)	5		Acute lymphoblastic leukemia(28;0.0282)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0233)		TAATAAAACTATGTTGTTTTA	0.259													24	37	---	---	---	---	PASS
MYO16	23026	broad.mit.edu	37	13	109793152	109793152	+	Nonsense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:109793152C>A	uc001vqt.1	+	32	4652	c.4526C>A	c.(4525-4527)TCG>TAG	p.S1509*	MYO16_uc010agk.1_Nonsense_Mutation_p.S1531*	NM_015011	NP_055826	Q9Y6X6	MYO16_HUMAN	myosin heavy chain Myr 8	1509	Pro-rich.				cerebellum development|negative regulation of cell proliferation|negative regulation of S phase of mitotic cell cycle	myosin complex|nucleoplasm|perinuclear region of cytoplasm|plasma membrane	actin filament binding|ATP binding|motor activity			ovary(6)|large_intestine(1)|kidney(1)|breast(1)|central_nervous_system(1)	10	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TCCGACGAGTCGCCCCTGACA	0.711													5	8	---	---	---	---	PASS
CDC16	8881	broad.mit.edu	37	13	115030719	115030719	+	Intron	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:115030719A>T	uc001vuk.1	+						CDC16_uc001vul.1_Intron|CDC16_uc001vum.1_Intron|CDC16_uc001vun.1_Intron|CDC16_uc001vuo.1_Intron	NM_003903	NP_003894	Q13042	CDC16_HUMAN	anaphase-promoting complex, subunit 6						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|cell proliferation|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|centrosome|cytosol|nucleoplasm|spindle microtubule	binding				0	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			TATATTGGTAAGATAATCGTT	0.368													62	66	---	---	---	---	PASS
TEP1	7011	broad.mit.edu	37	14	20849731	20849731	+	Silent	SNP	C	A	A	rs140821977		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20849731C>A	uc001vxe.2	-	31	4579	c.4539G>T	c.(4537-4539)ACG>ACT	p.T1513T	TEP1_uc010ahk.2_Silent_p.T856T|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Silent_p.T1405T|TEP1_uc010tlh.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1	1513					telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		GGATGTGTGCCGTGTCCTCTA	0.637													58	9	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42357019	42357019	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42357019C>T	uc001wvm.2	+	3	2389	c.1191C>T	c.(1189-1191)ATC>ATT	p.I397I	LRFN5_uc010ana.2_Silent_p.I397I	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	397	Extracellular (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CTTCAGATATCTCAACTTCTA	0.383										HNSCC(30;0.082)			16	7	---	---	---	---	PASS
LRFN5	145581	broad.mit.edu	37	14	42361132	42361132	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:42361132G>T	uc001wvm.2	+	4	3263	c.2065G>T	c.(2065-2067)GGG>TGG	p.G689W	LRFN5_uc010ana.2_Intron	NM_152447	NP_689660	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III	689	Cytoplasmic (Potential).					integral to membrane				ovary(5)|pancreas(2)|central_nervous_system(1)	8			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		TGTCACAGAGGGGCCCACGTC	0.468										HNSCC(30;0.082)			30	10	---	---	---	---	PASS
SOS2	6655	broad.mit.edu	37	14	50623738	50623738	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50623738T>A	uc001wxs.3	-	12	2134	c.2036A>T	c.(2035-2037)TAT>TTT	p.Y679F	SOS2_uc010tql.1_Missense_Mutation_p.Y646F|SOS2_uc010tqm.1_RNA|SOS2_uc001wxt.2_Missense_Mutation_p.Y367F	NM_006939	NP_008870	Q07890	SOS2_HUMAN	son of sevenless homolog 2	679	N-terminal Ras-GEF.				apoptosis|axon guidance|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	DNA binding|protein binding|Rho guanyl-nucleotide exchange factor activity			ovary(2)	2	all_epithelial(31;0.000822)|Breast(41;0.0065)					TGGTTGGACATATTCCTTGCG	0.338													13	1	---	---	---	---	PASS
MAPK1IP1L	93487	broad.mit.edu	37	14	55529998	55529998	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55529998G>A	uc001xbq.1	+	3	845	c.681G>A	c.(679-681)GTG>GTA	p.V227V		NM_144578	NP_653179	Q8NDC0	MISSL_HUMAN	MAPK-interacting and spindle-stabilizing	227	Pro-rich.										0						CTTTCCAAGTGCCTTCAGGAC	0.502													4	58	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76906001	76906001	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76906001T>C	uc001xsq.1	+	2	372	c.305T>C	c.(304-306)CTG>CCG	p.L102P	ESRRB_uc001xsr.2_Missense_Mutation_p.L102P|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	102						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		CCCAAGCGCCTGTGCCTCGTG	0.622													25	1	---	---	---	---	PASS
SEL1L	6400	broad.mit.edu	37	14	81950624	81950624	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:81950624G>A	uc010tvv.1	-	19	2108	c.1991C>T	c.(1990-1992)GCA>GTA	p.A664V		NM_005065	NP_005056	Q9UBV2	SE1L1_HUMAN	sel-1 suppressor of lin-12-like precursor	664	Lumenal (Potential).|Interaction with ERLEC1, OS9 and SYVN1.|Sel1-like 11.				Notch signaling pathway	endoplasmic reticulum membrane|integral to membrane	protein binding			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.0299)		CATAGCTTGTGCACTGTGTTG	0.413													199	37	---	---	---	---	PASS
GPR68	8111	broad.mit.edu	37	14	91700917	91700917	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91700917C>T	uc001xzg.2	-	2	819	c.478G>A	c.(478-480)GAG>AAG	p.E160K	GPR68_uc001xzh.2_Missense_Mutation_p.E170K	NM_003485	NP_003476	Q15743	OGR1_HUMAN	G protein-coupled receptor 68	160	Extracellular (Potential).				inflammatory response	integral to plasma membrane	G-protein coupled receptor activity			kidney(1)	1		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		ATGACCTCCTCGTGCATCAGG	0.622													12	2	---	---	---	---	PASS
TRAF3	7187	broad.mit.edu	37	14	103371855	103371855	+	Nonsense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:103371855G>T	uc001ymc.1	+	12	1794	c.1441G>T	c.(1441-1443)GAA>TAA	p.E481*	TRAF3_uc001yme.1_Nonsense_Mutation_p.E456*|TRAF3_uc001ymd.1_Nonsense_Mutation_p.E481*|TRAF3_uc010txy.1_Nonsense_Mutation_p.E398*	NM_145725	NP_663777	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3 isoform 1	481	MATH.				apoptosis|induction of apoptosis|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|regulation of defense response to virus|regulation of interferon-beta production|regulation of proteolysis|toll-like receptor signaling pathway|tumor necrosis factor-mediated signaling pathway	CD40 receptor complex|cytosol|endosome|internal side of plasma membrane|mitochondrion	signal transducer activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		CATGCGTGGAGAATATGATGC	0.517													76	17	---	---	---	---	PASS
OR4M2	390538	broad.mit.edu	37	15	22369024	22369024	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22369024G>T	uc010tzu.1	+	1	449	c.449G>T	c.(448-450)AGG>ATG	p.R150M	LOC727924_uc001yua.2_RNA|LOC727924_uc001yub.1_Intron|OR4N4_uc001yuc.1_Intron	NM_001004719	NP_001004719	Q8NGB6	OR4M2_HUMAN	olfactory receptor, family 4, subfamily M,	150	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CTCTCCTGGAGGGGGGGCTTC	0.502													35	212	---	---	---	---	PASS
SNORD116-4	100033416	broad.mit.edu	37	15	25332892	25332892	+	Intron	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25332892C>T	uc001yxh.1	+						SNORD116-4_uc001yxm.1_Intron|IPW_uc001yxn.3_Intron|SNORD116-28_uc001yxy.2_Intron|IPW_uc001yyb.3_Intron|uc001yyd.2_Intron|SNORD116-20_uc001yyf.2_RNA|SNORD116-22_uc001yyg.1_5'Flank					Homo sapiens clone kid4 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.												0						CCTCGTCGAACTGAGGTCCAG	0.443													28	72	---	---	---	---	PASS
OCA2	4948	broad.mit.edu	37	15	28116290	28116290	+	Intron	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28116290T>A	uc001zbh.3	-						OCA2_uc010ayv.2_Intron	NM_000275	NP_000266	Q04671	P_HUMAN	oculocutaneous albinism II						eye pigment biosynthetic process	endoplasmic reticulum membrane|endosome membrane|integral to membrane|lysosomal membrane|melanosome membrane	arsenite transmembrane transporter activity|citrate transmembrane transporter activity|L-tyrosine transmembrane transporter activity|protein binding			ovary(3)|breast(1)|pancreas(1)	5		all_lung(180;2.93e-12)|Breast(32;0.000315)|Colorectal(260;0.234)		all cancers(64;5.03e-07)|Epithelial(43;2.13e-06)|BRCA - Breast invasive adenocarcinoma(123;0.045)		CATGGACATGTGCAACTCACC	0.592									Oculocutaneous_Albinism				20	23	---	---	---	---	PASS
ALDH1A2	8854	broad.mit.edu	37	15	58285190	58285190	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:58285190C>G	uc002aex.2	-	6	695	c.637G>C	c.(637-639)GAG>CAG	p.E213Q	ALDH1A2_uc002aey.2_Missense_Mutation_p.E213Q|ALDH1A2_uc010ugv.1_Missense_Mutation_p.E192Q|ALDH1A2_uc010ugw.1_Missense_Mutation_p.E184Q|ALDH1A2_uc002aew.2_Missense_Mutation_p.E117Q	NM_003888	NP_003879	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1A2 isoform 1	213					negative regulation of cell proliferation|neural tube development|response to cytokine stimulus	nucleus	3-chloroallyl aldehyde dehydrogenase activity|retinal binding|retinal dehydrogenase activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	NADH(DB00157)|Tretinoin(DB00755)|Vitamin A(DB00162)	GGTGTTTGCTCTGCTGGCTTA	0.493													42	64	---	---	---	---	PASS
FAM63B	54629	broad.mit.edu	37	15	59063709	59063709	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:59063709G>C	uc002afj.2	+	1	317	c.115G>C	c.(115-117)GAT>CAT	p.D39H	FAM63B_uc002afi.2_Missense_Mutation_p.D39H|FAM63B_uc002afk.2_RNA|FAM63B_uc002afl.2_RNA	NM_001040450	NP_001035540	Q8NBR6	FA63B_HUMAN	hypothetical protein LOC54629 isoform a	39										central_nervous_system(1)	1						CGCCGCTGGTGATGGTCCTGG	0.726													15	26	---	---	---	---	PASS
IGDCC3	9543	broad.mit.edu	37	15	65623939	65623939	+	Nonsense_Mutation	SNP	C	A	A	rs145612224	byFrequency	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:65623939C>A	uc002aos.2	-	8	1459	c.1207G>T	c.(1207-1209)GAG>TAG	p.E403*	IGDCC3_uc002aor.1_5'Flank	NM_004884	NP_004875	Q8IVU1	IGDC3_HUMAN	putative neuronal cell adhesion molecule	403	Extracellular (Potential).|Ig-like C2-type 4.									ovary(3)	3						GCACTGTTCTCGGCCACACAC	0.617													9	12	---	---	---	---	PASS
AKAP13	11214	broad.mit.edu	37	15	86122698	86122698	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:86122698G>A	uc002blv.1	+	7	1569	c.1399G>A	c.(1399-1401)GGC>AGC	p.G467S	AKAP13_uc002blt.1_Missense_Mutation_p.G467S|AKAP13_uc002blu.1_Missense_Mutation_p.G467S	NM_007200	NP_009131	Q12802	AKP13_HUMAN	A-kinase anchor protein 13 isoform 2	467					apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|membrane|membrane fraction|nucleus	cAMP-dependent protein kinase activity|metal ion binding|protein binding|Rho guanyl-nucleotide exchange factor activity|signal transducer activity			central_nervous_system(3)|kidney(2)|urinary_tract(1)|liver(1)|skin(1)|ovary(1)	9						TGAACTGGGAGGCATTTCAAC	0.532													15	80	---	---	---	---	PASS
C15orf51	196968	broad.mit.edu	37	15	100339913	100339913	+	RNA	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:100339913A>T	uc010urx.1	-	4		c.1014T>A			C15orf51_uc010ury.1_RNA|uc002bvp.2_5'Flank|C15orf51_uc010urz.1_RNA|uc002bvq.2_5'Flank|uc002bvt.1_5'Flank	NR_003260				Homo sapiens cDNA FLJ43799 fis, clone TESTI4000288.												0						TGATGCTGAGAGCCTCTTTCA	0.642													8	34	---	---	---	---	PASS
TPSG1	25823	broad.mit.edu	37	16	1272258	1272258	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:1272258G>T	uc002ckw.2	-	5	597	c.595C>A	c.(595-597)CCC>ACC	p.P199T		NM_012467	NP_036599	Q9NRR2	TRYG1_HUMAN	transmembrane tryptase preproprotein	199	Peptidase S1.				proteolysis	integral to plasma membrane	serine-type endopeptidase activity				0		Hepatocellular(780;0.00369)				CTGCCCCCGGGGCCGGGATAG	0.706													41	42	---	---	---	---	PASS
SRL	6345	broad.mit.edu	37	16	4242878	4242878	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:4242878C>T	uc002cvz.3	-	6	711	c.698G>A	c.(697-699)GGT>GAT	p.G233D	SRL_uc002cvy.3_RNA	NM_001098814	NP_001092284	Q86TD4	SRCA_HUMAN	sarcalumenin	692						sarcoplasmic reticulum lumen	GTP binding|GTPase activity			ovary(3)|skin(2)	5						CAGCTCTAGACCCACATCCAG	0.527													29	33	---	---	---	---	PASS
GRIN2A	2903	broad.mit.edu	37	16	9858401	9858401	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:9858401C>T	uc002czo.3	-	13	3548	c.3000G>A	c.(2998-3000)GTG>GTA	p.V1000V	GRIN2A_uc010uym.1_Silent_p.V1000V|GRIN2A_uc010uyn.1_Silent_p.V843V|GRIN2A_uc002czr.3_Silent_p.V1000V	NM_001134407	NP_001127879	Q12879	NMDE1_HUMAN	N-methyl-D-aspartate receptor subunit 2A isoform	1000	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			skin(32)|NS(5)|ovary(4)|large_intestine(1)|lung(1)|breast(1)|kidney(1)	45					Felbamate(DB00949)|Glycine(DB00145)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	ATTCTGTGCTCACGGCCACCT	0.512													53	57	---	---	---	---	PASS
MYH11	4629	broad.mit.edu	37	16	15813504	15813504	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:15813504T>C	uc002ddy.2	-	35	5127	c.5020A>G	c.(5020-5022)ACA>GCA	p.T1674A	MYH11_uc002ddv.2_Missense_Mutation_p.T1681A|MYH11_uc002ddw.2_Missense_Mutation_p.T1674A|MYH11_uc002ddx.2_Missense_Mutation_p.T1681A|MYH11_uc010bvg.2_Missense_Mutation_p.T1506A|NDE1_uc010uzy.1_Intron|NDE1_uc002dds.2_Intron|MYH11_uc010bvh.2_Missense_Mutation_p.T380A|NDE1_uc002ddz.1_5'Flank	NM_002474	NP_002465	P35749	MYH11_HUMAN	smooth muscle myosin heavy chain 11 isoform	1674	Potential.				axon guidance|cardiac muscle fiber development|elastic fiber assembly|skeletal muscle myosin thick filament assembly|smooth muscle contraction	cytosol|melanosome|muscle myosin complex|myosin filament	actin binding|ATP binding|calmodulin binding|motor activity|structural constituent of muscle			ovary(6)|skin(3)|lung(2)|breast(2)|upper_aerodigestive_tract(1)|pancreas(1)	15						TCTTTGGCTGTGGCAAAGATC	0.522			T	CBFB	AML								78	103	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16208928	16208928	+	Missense_Mutation	SNP	G	A	A	rs74985930		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16208928G>A	uc010bvi.2	+	23	3560	c.3385G>A	c.(3385-3387)GTC>ATC	p.V1129I	ABCC1_uc010bvj.2_Missense_Mutation_p.V1070I|ABCC1_uc010bvk.2_Missense_Mutation_p.V1073I|ABCC1_uc010bvl.2_Missense_Mutation_p.V1129I|ABCC1_uc010bvm.2_Missense_Mutation_p.V1014I|ABCC1_uc002del.3_Missense_Mutation_p.V1023I	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1129	Helical; Name=15.|ABC transmembrane type-1 2.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	CTACTTCTTCGTCCAGGTAAG	0.532													34	37	---	---	---	---	PASS
EARS2	124454	broad.mit.edu	37	16	23535757	23535757	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:23535757C>G	uc002dlt.3	-	9	1539	c.1507G>C	c.(1507-1509)GAG>CAG	p.E503Q	EARS2_uc002dlr.3_RNA|EARS2_uc002dls.3_RNA	NM_001083614	NP_001077083	Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2 precursor	503					glutamyl-tRNA aminoacylation	mitochondrial matrix	ATP binding|glutamate-tRNA ligase activity|RNA binding				0				GBM - Glioblastoma multiforme(48;0.0353)	L-Glutamic Acid(DB00142)	AACATCATCTCAGCTACAGGA	0.473													81	108	---	---	---	---	PASS
AQP8	343	broad.mit.edu	37	16	25235842	25235842	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25235842G>T	uc002doc.2	+	4	629	c.547G>T	c.(547-549)GGC>TGC	p.G183C		NM_001169	NP_001160	O94778	AQP8_HUMAN	aquaporin 8	183	Cytoplasmic (Potential).				cellular response to cAMP	integral to plasma membrane	water channel activity			upper_aerodigestive_tract(1)|breast(1)|pancreas(1)	3				GBM - Glioblastoma multiforme(48;0.044)		GAAGACAAAGGGCCCTCTGGC	0.622													23	33	---	---	---	---	PASS
ZKSCAN2	342357	broad.mit.edu	37	16	25266716	25266716	+	Intron	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:25266716G>A	uc002dod.3	-						ZKSCAN2_uc010vcl.1_Intron|ZKSCAN2_uc002doe.2_Intron	NM_001012981	NP_001012999	Q63HK3	ZKSC2_HUMAN	zinc finger with KRAB and SCAN domains 2						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)|breast(1)	4				GBM - Glioblastoma multiforme(48;0.0378)		CTGCTGACCTGAGAAATGAAG	0.547													21	16	---	---	---	---	PASS
GOT2	2806	broad.mit.edu	37	16	58743377	58743377	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:58743377G>T	uc002eof.1	-	9	1228	c.1114C>A	c.(1114-1116)CAA>AAA	p.Q372K	GOT2_uc010vim.1_Missense_Mutation_p.Q329K	NM_002080	NP_002071	P00505	AATM_HUMAN	aspartate aminotransferase 2 precursor	372					aspartate catabolic process|fatty acid transport|gluconeogenesis|response to ethanol	mitochondrial matrix|plasma membrane	L-aspartate:2-oxoglutarate aminotransferase activity|protein binding|pyridoxal phosphate binding			central_nervous_system(1)|skin(1)	2					L-Aspartic Acid(DB00128)|L-Glutamic Acid(DB00142)|Pyridoxal Phosphate(DB00114)	GTGATGTGTTGCCAATTGTGG	0.498													52	76	---	---	---	---	PASS
HYDIN	54768	broad.mit.edu	37	16	70867983	70867983	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70867983G>A	uc002ezr.2	-	79	13611	c.13483C>T	c.(13483-13485)CGT>TGT	p.R4495C	HYDIN_uc010cfy.2_RNA	NM_032821	NP_116210	Q4G0P3	HYDIN_HUMAN	hydrocephalus inducing isoform a	4496										ovary(1)|skin(1)	2		Ovarian(137;0.0654)				GGAGGGACACGCTTCTTCGGG	0.552													21	5	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89930203	89930203	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89930203T>C	uc002foz.1	+	12	1764	c.1712T>C	c.(1711-1713)ATT>ACT	p.I571T	SPIRE2_uc010ciw.1_Missense_Mutation_p.I571T|SPIRE2_uc002fpa.1_Missense_Mutation_p.I523T|SPIRE2_uc010cix.1_Missense_Mutation_p.I438T	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	571					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TCCTGACAGATTTGCTGCTGC	0.607													43	9	---	---	---	---	PASS
C16orf3	750	broad.mit.edu	37	16	90095558	90095558	+	Missense_Mutation	SNP	C	T	T	rs76646627		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:90095558C>T	uc002fqk.1	-	1	752	c.193G>A	c.(193-195)GGC>AGC	p.G65S	GAS8_uc010vps.1_Intron|GAS8_uc002fqh.2_Intron|GAS8_uc010vpt.1_Intron|GAS8_uc010vpu.1_Intron|GAS8_uc010vpv.1_Intron|GAS8_uc010cjc.1_Intron|GAS8_uc002fqi.1_Intron|GAS8_uc010vpw.1_Intron|GAS8_uc002fqj.1_Intron	NM_001214	NP_001205	O95177	CP003_HUMAN	hypothetical protein LOC750	73											0		all_cancers(9;9.01e-08)|Hepatocellular(780;0.000325)|Lung NSC(15;0.0104)|all_lung(18;0.0239)		BRCA - Breast invasive adenocarcinoma(80;0.0272)		acggggcagcctacggggcag	0.363													3	9	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10233701	10233701	+	Intron	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10233701C>T	uc002gmk.1	-							NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle						muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						GGGTCTGTGTCACCTCCTCTC	0.527													11	20	---	---	---	---	PASS
ANKRD13B	124930	broad.mit.edu	37	17	27935921	27935921	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27935921C>T	uc002hei.2	+	5	587	c.474C>T	c.(472-474)AGC>AGT	p.S158S	ANKRD13B_uc002heh.2_Silent_p.S26S|ANKRD13B_uc002hej.2_RNA	NM_152345	NP_689558	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	158											0						TGTGGAAGAGCGGCCAGAACC	0.592													21	20	---	---	---	---	PASS
SLC6A4	6532	broad.mit.edu	37	17	28543219	28543219	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:28543219C>T	uc002hey.3	-	7	1397	c.853G>A	c.(853-855)GCC>ACC	p.A285T		NM_001045	NP_001036	P31645	SC6A4_HUMAN	solute carrier family 6 member 4	285	Helical; Name=5; (Potential).				response to toxin|serotonin uptake|thalamus development	cytosol|endomembrane system|endosome membrane|membrane raft	actin filament binding|Rab GTPase binding|serotonin transmembrane transporter activity|serotonin:sodium symporter activity			skin(3)|ovary(1)	4					Amineptine(DB04836)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Desipramine(DB01151)|Dexfenfluramine(DB01191)|Dextromethorphan(DB00514)|Doxepin(DB01142)|Duloxetine(DB00476)|Escitalopram(DB01175)|Fluoxetine(DB00472)|Fluvoxamine(DB00176)|Imipramine(DB00458)|Methylphenidate(DB00422)|Milnacipran(DB04896)|Minaprine(DB00805)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Paroxetine(DB00715)|Phentermine(DB00191)|Protriptyline(DB00344)|Sertraline(DB01104)|Sibutramine(DB01105)|Tegaserod(DB01079)|Tramadol(DB00193)|Trazodone(DB00656)|Trimipramine(DB00726)|Venlafaxine(DB00285)|Zimelidine(DB04832)	GGGAAGGTGGCTGTCACCCAC	0.403													18	57	---	---	---	---	PASS
UNC45B	146862	broad.mit.edu	37	17	33491078	33491078	+	Silent	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:33491078T>A	uc002hja.2	+	9	1141	c.1044T>A	c.(1042-1044)ACT>ACA	p.T348T	UNC45B_uc002hjb.2_Silent_p.T348T|UNC45B_uc002hjc.2_Silent_p.T348T|UNC45B_uc010cto.2_Silent_p.T348T	NM_173167	NP_775259	Q8IWX7	UN45B_HUMAN	cardiomyopathy associated 4 isoform 1	348					cell differentiation|muscle organ development	cytosol	binding			ovary(3)|central_nervous_system(2)|breast(1)	6		Ovarian(249;0.17)				TGCCCCTGACTGACAACACCC	0.562													161	139	---	---	---	---	PASS
AOC2	314	broad.mit.edu	37	17	40997994	40997994	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40997994A>G	uc002ibu.2	+	1	1386	c.1351A>G	c.(1351-1353)AGC>GGC	p.S451G	AOC2_uc002ibt.2_Missense_Mutation_p.S451G	NM_009590	NP_033720	O75106	AOC2_HUMAN	amine oxidase, copper containing 2 isoform b	451					catecholamine metabolic process|visual perception	cytoplasm|plasma membrane	aliphatic-amine oxidase activity|aminoacetone:oxygen oxidoreductase(deaminating) activity|copper ion binding|electron carrier activity|phenethylamine:oxygen oxidoreductase (deaminating) activity|primary amine oxidase activity|quinone binding|tryptamine:oxygen oxidoreductase (deaminating) activity			ovary(2)	2		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TGGTTTGGCCAGCTCAGCCCT	0.522													42	87	---	---	---	---	PASS
HOXB9	3219	broad.mit.edu	37	17	46703633	46703633	+	5'UTR	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:46703633C>T	uc002inx.2	-	1						NM_024017	NP_076922	P17482	HXB9_HUMAN	homeobox B9						canonical Wnt receptor signaling pathway|cell chemotaxis	mitochondrion|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0						AATGGACATTCTCAGACATTA	0.602													34	52	---	---	---	---	PASS
SDK2	54549	broad.mit.edu	37	17	71346876	71346876	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71346876G>A	uc010dfm.2	-	42	5812	c.5812C>T	c.(5812-5814)CTG>TTG	p.L1938L	SDK2_uc002jjt.3_Silent_p.L1078L	NM_001144952	NP_001138424	Q58EX2	SDK2_HUMAN	sidekick 2	1938	Helical; (Potential).				cell adhesion	integral to membrane				ovary(2)	2						AGGCCGACCAGGGCAATGACC	0.567													52	51	---	---	---	---	PASS
KIF19	124602	broad.mit.edu	37	17	72350424	72350424	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:72350424C>G	uc002jkm.3	+	18	2570	c.2432C>G	c.(2431-2433)TCC>TGC	p.S811C		NM_153209	NP_694941	Q2TAC6	KIF19_HUMAN	kinesin family member 19	811					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity				0						AGCAGCCTGTCCCTGCACTCA	0.716													20	31	---	---	---	---	PASS
TBC1D16	125058	broad.mit.edu	37	17	77914763	77914763	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77914763C>T	uc002jxj.2	-	12	2315	c.2199G>A	c.(2197-2199)GAG>GAA	p.E733E	uc002jxg.1_5'Flank|TBC1D16_uc002jxh.2_Silent_p.E371E|TBC1D16_uc002jxi.2_Silent_p.E358E	NM_019020	NP_061893	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	733						intracellular	Rab GTPase activator activity				0	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			AGGGACAGCTCTCCGAGCCGG	0.672													10	7	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32455309	32455309	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32455309C>T	uc010dmn.1	+	17	1770	c.1769C>T	c.(1768-1770)CCG>CTG	p.P590L	DTNA_uc002kxw.2_Missense_Mutation_p.P533L|DTNA_uc010dmj.2_Missense_Mutation_p.P530L|DTNA_uc002kxz.2_Missense_Mutation_p.P537L|DTNA_uc002kxy.2_Missense_Mutation_p.P530L|DTNA_uc010xby.1_Missense_Mutation_p.P280L|DTNA_uc010xbz.1_Missense_Mutation_p.P299L|DTNA_uc010xca.1_Missense_Mutation_p.P242L|DTNA_uc002kye.2_Missense_Mutation_p.P238L	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	590					neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						ACGCACACGCCGCAGGACTCC	0.572													40	21	---	---	---	---	PASS
SETBP1	26040	broad.mit.edu	37	18	42531485	42531485	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42531485G>T	uc010dni.2	+	4	2476	c.2180G>T	c.(2179-2181)CGG>CTG	p.R727L		NM_015559	NP_056374	Q9Y6X0	SETBP_HUMAN	SET binding protein 1 isoform a	727						nucleus	DNA binding			upper_aerodigestive_tract(2)|large_intestine(1)	3				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		GGCAAGAAGCGGGGCAGGAAG	0.582									Schinzel-Giedion_syndrome				11	40	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67795714	67795714	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67795714G>C	uc002lkp.2	-	24	3091	c.3023C>G	c.(3022-3024)TCT>TGT	p.S1008C	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_Missense_Mutation_p.S96C	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	1008							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				ACAATCAGCAGATAAGGGCAA	0.403													16	58	---	---	---	---	PASS
MBP	4155	broad.mit.edu	37	18	74696745	74696745	+	Missense_Mutation	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74696745T>C	uc010xfd.1	-	8	1120	c.856A>G	c.(856-858)AAA>GAA	p.K286E	MBP_uc002lml.2_Missense_Mutation_p.K179E|MBP_uc002lmn.2_Missense_Mutation_p.K168E|MBP_uc002lmp.2_Missense_Mutation_p.K142E|MBP_uc010xfe.1_3'UTR|MBP_uc010dqz.2_RNA	NM_001025101	NP_001020272	P02686	MBP_HUMAN	Golli-mbp isoform 1	286					central nervous system development|immune response|synaptic transmission	plasma membrane	structural constituent of myelin sheath			haematopoietic_and_lymphoid_tissue(1)	1		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)		TTAAAAATTTTGGAAAGCGTG	0.557													26	69	---	---	---	---	PASS
GRIN3B	116444	broad.mit.edu	37	19	1003150	1003150	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1003150C>T	uc002lqo.1	+	2	448	c.448C>T	c.(448-450)CAC>TAC	p.H150Y		NM_138690	NP_619635	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic,	150	Extracellular (Potential).				ionotropic glutamate receptor signaling pathway|protein insertion into membrane|regulation of calcium ion transport	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|neuronal cell body|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|glycine binding|ionotropic glutamate receptor activity|neurotransmitter receptor activity				0		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Glycine(DB00145)|L-Glutamic Acid(DB00142)|Orphenadrine(DB01173)	CCTGCAGCTGCACTGGGCCAG	0.677													18	8	---	---	---	---	PASS
OR1M1	125963	broad.mit.edu	37	19	9204149	9204149	+	Missense_Mutation	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9204149A>G	uc010xkj.1	+	1	229	c.229A>G	c.(229-231)ACC>GCC	p.T77A		NM_001004456	NP_001004456	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M,	77	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)	3						GGCCACCAACACCATCCCTAA	0.532													21	100	---	---	---	---	PASS
ZNF700	90592	broad.mit.edu	37	19	12058351	12058351	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12058351C>T	uc002msu.2	+	3	339	c.213C>T	c.(211-213)AAC>AAT	p.N71N	ZNF700_uc010xme.1_Silent_p.N89N|ZNF763_uc010xmf.1_Intron	NM_144566	NP_653167	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	71	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						GTGACCAGAACATTGAATATG	0.343													87	43	---	---	---	---	PASS
ZNF44	51710	broad.mit.edu	37	19	12383498	12383498	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12383498C>A	uc010xmj.1	-	5	1921	c.1716G>T	c.(1714-1716)AGG>AGT	p.R572S	ZNF44_uc002mtl.2_Intron|ZNF44_uc010dyr.1_Intron|ZNF44_uc010xmi.1_RNA|ZNF44_uc002mtn.3_RNA|ZNF44_uc010dys.2_Missense_Mutation_p.R524S	NM_001164276	NP_001157748	P15621	ZNF44_HUMAN	zinc finger protein 44 isoform 1	572	C2H2-type 14.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|microtubule cytoskeleton|nucleus	DNA binding|protein binding|zinc ion binding			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CCGTGTGAGTCCTTTCATGAG	0.408													8	63	---	---	---	---	PASS
GCDH	2639	broad.mit.edu	37	19	13002940	13002940	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13002940G>A	uc002mvq.2	+	5	359	c.282G>A	c.(280-282)CGG>CGA	p.R94R	GCDH_uc010xms.1_Intron|GCDH_uc002mvp.2_Silent_p.R94R|GCDH_uc010xmt.1_5'UTR|GCDH_uc010xmu.1_Intron	NM_000159	NP_000150	Q92947	GCDH_HUMAN	glutaryl-Coenzyme A dehydrogenase isoform a	94			R -> L (in GA1).		lysine catabolic process	mitochondrial matrix	flavin adenine dinucleotide binding|glutaryl-CoA dehydrogenase activity|protein binding				0						TTTTTCATCGGGAGATCATTT	0.572													26	95	---	---	---	---	PASS
FARSA	2193	broad.mit.edu	37	19	13039467	13039467	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13039467G>A	uc002mvs.2	-	6	655	c.607C>T	c.(607-609)CGG>TGG	p.R203W	FARSA_uc002mvt.2_RNA|FARSA_uc010xmv.1_Missense_Mutation_p.R172W|FARSA_uc010dyy.1_Missense_Mutation_p.R124W	NM_004461	NP_004452	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	203					phenylalanyl-tRNA aminoacylation	cytosol|soluble fraction	ATP binding|phenylalanine-tRNA ligase activity|protein binding|tRNA binding			ovary(1)	1					L-Phenylalanine(DB00120)	GGCCGGTCCCGCCAAGAGCCA	0.687													24	13	---	---	---	---	PASS
RASAL3	64926	broad.mit.edu	37	19	15565328	15565328	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15565328C>T	uc002nbe.2	-	13	2090	c.2004G>A	c.(2002-2004)CTG>CTA	p.L668L	RASAL3_uc002nbd.2_Silent_p.L8L|RASAL3_uc010eaa.1_Silent_p.L156L	NM_022904	NP_075055	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	668					negative regulation of Ras protein signal transduction|signal transduction	cytoplasm|intrinsic to internal side of plasma membrane	Ras GTPase activator activity				0						CATGTTCCTCCAGGAAGCTAT	0.607											OREG0025322	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	17	182	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22156530	22156530	+	Missense_Mutation	SNP	A	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22156530A>T	uc002nqp.2	-	4	1455	c.1306T>A	c.(1306-1308)TGG>AGG	p.W436R	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTTGAGGACCAGTTGAAAGCT	0.388													26	115	---	---	---	---	PASS
FAM187B	148109	broad.mit.edu	37	19	35719356	35719356	+	Silent	SNP	G	A	A	rs146665895		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719356G>A	uc002nyk.1	-	1	273	c.228C>T	c.(226-228)CCC>CCT	p.P76P		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	76	Extracellular (Potential).					integral to membrane				ovary(2)	2						GGCTGCCCTCGGGCATTATTT	0.507													46	39	---	---	---	---	PASS
FAM187B	148109	broad.mit.edu	37	19	35719440	35719440	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35719440C>A	uc002nyk.1	-	1	189	c.144G>T	c.(142-144)GGG>GGT	p.G48G		NM_152481	NP_689694	Q17R55	F187B_HUMAN	family with sequence similarity 187, member B	48	Extracellular (Potential).					integral to membrane				ovary(2)	2						ACCAGTGCGCCCCCGAGGAGT	0.512													35	40	---	---	---	---	PASS
ZFP30	22835	broad.mit.edu	37	19	38127106	38127106	+	Silent	SNP	A	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38127106A>G	uc002ogv.1	-	6	852	c.336T>C	c.(334-336)TGT>TGC	p.C112C	ZFP30_uc002ogw.1_Silent_p.C112C|ZFP30_uc002ogx.1_Silent_p.C112C|ZFP30_uc010xtt.1_Silent_p.C111C	NM_014898	NP_055713	Q9Y2G7	ZFP30_HUMAN	zinc finger protein 30 homolog	112					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTCAAGTCCACAGCTTTTAA	0.353													14	44	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	38996436	38996436	+	Intron	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38996436T>C	uc002oit.2	+						RYR1_uc002oiu.2_Intron|RYR1_uc002oiv.1_Intron	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1						muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CACCCTCCTGTCCACCCCAGG	0.577													10	74	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43575978	43575978	+	Nonsense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43575978G>A	uc002ovr.2	-	4	931	c.838C>T	c.(838-840)CAG>TAG	p.Q280*	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Nonsense_Mutation_p.Q280*|PSG2_uc010eiq.1_Nonsense_Mutation_p.Q280*|PSG2_uc002ovs.3_Nonsense_Mutation_p.Q280*|PSG2_uc002ovt.3_Nonsense_Mutation_p.Q280*	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	280	Ig-like C2-type 2.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				CCTGATTGCTGAAACTTCCCA	0.448													106	70	---	---	---	---	PASS
PSG2	5670	broad.mit.edu	37	19	43576022	43576022	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43576022G>C	uc002ovr.2	-	4	887	c.794C>G	c.(793-795)TCT>TGT	p.S265C	PSG6_uc002ovi.2_Intron|PSG6_uc010xwk.1_Intron|PSG2_uc002ovq.3_Missense_Mutation_p.S265C|PSG2_uc010eiq.1_Missense_Mutation_p.S265C|PSG2_uc002ovs.3_Missense_Mutation_p.S265C|PSG2_uc002ovt.3_Missense_Mutation_p.S265C	NM_031246	NP_112536	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	265	Ig-like C2-type 2.				cell migration|female pregnancy	extracellular region					0		Prostate(69;0.00682)				CGGTGGGTTAGAGTTCGCGAA	0.453													98	79	---	---	---	---	PASS
PPP1R13L	10848	broad.mit.edu	37	19	45885788	45885788	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45885788G>A	uc002pbn.2	-	12	2522	c.2445C>T	c.(2443-2445)TTC>TTT	p.F815F	PPP1R13L_uc002pbm.2_Silent_p.F394F|PPP1R13L_uc002pbo.2_Silent_p.F815F	NM_006663	NP_006654	Q8WUF5	IASPP_HUMAN	protein phosphatase 1, regulatory subunit 13	815	SH3.				apoptosis|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	transcription corepressor activity|transcription factor binding			skin(1)	1		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0182)		GGCTCACCCCGAAGTAGTTCC	0.657													42	24	---	---	---	---	PASS
SPIB	6689	broad.mit.edu	37	19	50926910	50926910	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50926910G>C	uc002psd.2	+	5	413	c.388G>C	c.(388-390)GAG>CAG	p.E130Q	SPIB_uc002pse.2_Missense_Mutation_p.E130Q|SPIB_uc010ycc.1_Missense_Mutation_p.E39Q	NM_003121	NP_003112	Q01892	SPIB_HUMAN	Spi-B transcription factor (Spi-1/PU.1 related)	130					regulation of transcription from RNA polymerase II promoter	cytoplasm|microtubule cytoskeleton|nucleus	sequence-specific DNA binding			lung(1)|kidney(1)	2		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		TGTGCTATCAGAGGAGGAAGA	0.657													7	17	---	---	---	---	PASS
LILRA5	353514	broad.mit.edu	37	19	54822833	54822833	+	Missense_Mutation	SNP	T	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54822833T>A	uc002qfe.2	-	5	683	c.563A>T	c.(562-564)CAG>CTG	p.Q188L	LILRA5_uc002qff.2_Missense_Mutation_p.Q176L|LILRA5_uc010yev.1_Missense_Mutation_p.Q188L|LILRA5_uc010yew.1_Missense_Mutation_p.Q176L|LILRA5_uc002qfh.1_Missense_Mutation_p.Q176L|LILRA5_uc002qfg.1_Missense_Mutation_p.Q188L	NM_021250	NP_067073	A6NI73	LIRA5_HUMAN	leukocyte immunoglobulin-like receptor subfamily	188	Extracellular (Potential).|Ig-like C2-type 2.				innate immune response	extracellular region|integral to membrane	receptor activity			upper_aerodigestive_tract(1)	1	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GGGGGTCAGCTGTGAGTCCAA	0.597													34	22	---	---	---	---	PASS
LILRA4	23547	broad.mit.edu	37	19	54845234	54845234	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54845234C>T	uc002qfj.2	-	7	1315	c.1258G>A	c.(1258-1260)GCA>ACA	p.A420T	LILRA4_uc002qfi.2_Missense_Mutation_p.A354T	NM_012276	NP_036408	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor subfamily	420	Extracellular (Potential).					integral to membrane	receptor activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		GTCTCAGTTGCTCCTAAGAAT	0.488													43	25	---	---	---	---	PASS
LENG8	114823	broad.mit.edu	37	19	54963343	54963343	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54963343G>A	uc002qfv.1	+	3	256	c.112G>A	c.(112-114)GAG>AAG	p.E38K	LENG8_uc002qfw.2_Missense_Mutation_p.E38K			Q96PV6	LENG8_HUMAN	RecName: Full=Leukocyte receptor cluster member 8;	38							protein binding			central_nervous_system(1)|pancreas(1)	2	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CGAGAACCCGGAGTGGGAGAA	0.627													20	57	---	---	---	---	PASS
RDH13	112724	broad.mit.edu	37	19	55558804	55558804	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55558804C>A	uc002qio.3	-	6	896	c.711G>T	c.(709-711)CTG>CTT	p.L237L	RDH13_uc002qip.2_Silent_p.L166L|RDH13_uc010esr.1_RNA	NM_001145971	NP_001139443	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 isoform 1	237							binding|oxidoreductase activity			large_intestine(1)|ovary(1)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	TGTGTCTGCCCAGCTCTGTCC	0.647													19	13	---	---	---	---	PASS
ZNF776	284309	broad.mit.edu	37	19	58266005	58266005	+	Missense_Mutation	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58266005C>G	uc002qpx.2	+	3	1730	c.1507C>G	c.(1507-1509)CTC>GTC	p.L503V	ZNF587_uc002qqb.2_Intron|ZNF776_uc002qqa.2_Missense_Mutation_p.L503V	NM_173632	NP_775903	Q68DI1	ZN776_HUMAN	zinc finger protein 776	503	C2H2-type 11.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0256)		AAAGGGAAACCTCATTAAACA	0.423													31	35	---	---	---	---	PASS
ZSCAN18	65982	broad.mit.edu	37	19	58596227	58596227	+	Missense_Mutation	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:58596227C>A	uc002qri.2	-	7	1667	c.1358G>T	c.(1357-1359)AGC>ATC	p.S453I	ZSCAN18_uc002qrj.3_Missense_Mutation_p.S452I|ZSCAN18_uc010yhs.1_Missense_Mutation_p.S317I|ZSCAN18_uc002qrh.2_Missense_Mutation_p.S453I|ZSCAN18_uc010yht.1_Missense_Mutation_p.S509I|ZSCAN18_uc002qrk.1_3'UTR|ZSCAN18_uc002qrl.2_3'UTR	NM_001145543	NP_001139015	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	453	C2H2-type 2.				viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TAGGGCCAGGCTGAAGTGGAA	0.687													6	6	---	---	---	---	PASS
PROKR2	128674	broad.mit.edu	37	20	5294818	5294818	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5294818G>A	uc010zqw.1	-	1	198	c.198C>T	c.(196-198)GTC>GTT	p.V66V	PROKR2_uc010zqx.1_Silent_p.V66V|PROKR2_uc010zqy.1_Silent_p.V66V|uc002wly.1_5'Flank	NM_144773	NP_658986	Q8NFJ6	PKR2_HUMAN	prokineticin receptor 2	66	Helical; Name=1; (Potential).					integral to membrane|plasma membrane	neuropeptide Y receptor activity			ovary(3)|central_nervous_system(1)|pancreas(1)	5						CGATGCCGCAGACCAGCATGA	0.537										HNSCC(71;0.22)			69	54	---	---	---	---	PASS
PHF20	51230	broad.mit.edu	37	20	34501238	34501238	+	Silent	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:34501238G>A	uc002xek.1	+	11	1740	c.1629G>A	c.(1627-1629)AAG>AAA	p.K543K	PHF20_uc002xei.1_Silent_p.K543K|PHF20_uc010gfo.1_Silent_p.K543K|PHF20_uc002xej.1_Silent_p.K427K	NM_016436	NP_057520	Q9BVI0	PHF20_HUMAN	PHD finger protein 20	543	Lys-rich.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	MLL1 complex	DNA binding|zinc ion binding			ovary(1)	1	Breast(12;0.00631)|all_lung(11;0.0145)					agccaaagaagaaaaagaaaa	0.224													16	15	---	---	---	---	PASS
SALL4	57167	broad.mit.edu	37	20	50400992	50400992	+	Missense_Mutation	SNP	T	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50400992T>G	uc002xwh.3	-	4	3075	c.2974A>C	c.(2974-2976)AGT>CGT	p.S992R	SALL4_uc010gii.2_Missense_Mutation_p.S555R|SALL4_uc002xwi.3_Missense_Mutation_p.S215R	NM_020436	NP_065169	Q9UJQ4	SALL4_HUMAN	sal-like 4	992					transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						ACCCCCCCACTCTGGATCACA	0.577													61	51	---	---	---	---	PASS
COL9A3	1299	broad.mit.edu	37	20	61461951	61461951	+	Intron	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61461951C>T	uc002ydm.2	+							NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					GTAAGTGGCCCTCTCAGCAGG	0.572													10	7	---	---	---	---	PASS
RTEL1	51750	broad.mit.edu	37	20	62322277	62322277	+	Missense_Mutation	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62322277G>T	uc002yfu.1	+	27	2876	c.2533G>T	c.(2533-2535)GCG>TCG	p.A845S	RTEL1_uc011abc.1_RNA|RTEL1_uc002yft.1_Missense_Mutation_p.A845S|RTEL1_uc011abd.1_Missense_Mutation_p.A869S|RTEL1_uc011abe.1_Missense_Mutation_p.A622S|RTEL1_uc002yfw.2_RNA|RTEL1_uc002yfx.1_Missense_Mutation_p.A90S	NM_016434	NP_057518	Q9NZ71	RTEL1_HUMAN	regulator of telomere elongation helicase 1	845				A -> V (in Ref. 4; BAG63785).	DNA repair|regulation of double-strand break repair via homologous recombination|telomere maintenance	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding|iron-sulfur cluster binding|metal ion binding				0	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CGAACAGCGGGCGGGGAGCCC	0.682													4	6	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10969127	10969127	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10969127G>A	uc002yip.1	-	7	489	c.121C>T	c.(121-123)CCA>TCA	p.P41S	TPTE_uc002yis.1_Intron|TPTE_uc002yiq.1_Intron|TPTE_uc002yir.1_Intron|TPTE_uc010gkv.1_Intron	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	41					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CTTGTGTGTGGGCTAGAGGAT	0.269													13	146	---	---	---	---	PASS
PCNT	5116	broad.mit.edu	37	21	47775361	47775361	+	Intron	SNP	C	G	G			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47775361C>G	uc002zji.3	+						PCNT_uc002zjj.2_Intron	NM_006031	NP_006022	O95613	PCNT_HUMAN	pericentrin						cilium assembly|G2/M transition of mitotic cell cycle	cytosol|microtubule	calmodulin binding			ovary(4)|breast(2)|pancreas(2)	8	Breast(49;0.112)					CGTGGTTTCTCTGTAGGAGAG	0.557													17	45	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30886088	30886088	+	3'UTR	SNP	G	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30886088G>T	uc003aid.2	-	12					SEC14L4_uc011akz.1_Intron|SEC14L4_uc003aie.2_3'UTR|SEC14L4_uc003aif.2_3'UTR	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a							integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	GAGGTGGCTGGGGTCTTCACT	0.622													22	9	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46930324	46930324	+	Missense_Mutation	SNP	G	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46930324G>C	uc003bhw.1	-	1	2744	c.2744C>G	c.(2743-2745)TCT>TGT	p.S915C		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	915	Extracellular (Potential).|Cadherin 7.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GTCCGTGGCAGAGACCTGGAG	0.597													15	12	---	---	---	---	PASS
CELSR1	9620	broad.mit.edu	37	22	46930352	46930352	+	Missense_Mutation	SNP	G	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46930352G>A	uc003bhw.1	-	1	2716	c.2716C>T	c.(2716-2718)CCA>TCA	p.P906S		NM_014246	NP_055061	Q9NYQ6	CELR1_HUMAN	cadherin EGF LAG seven-pass G-type receptor 1	906	Extracellular (Potential).|Cadherin 7.				central nervous system development|homophilic cell adhesion|neural tube closure|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity|protein dimerization activity			lung(4)|breast(4)|pancreas(2)|skin(1)	11		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GTCGAGGGTGGAGCATCCTCA	0.587													8	14	---	---	---	---	PASS
OFD1	8481	broad.mit.edu	37	X	13778539	13778539	+	Missense_Mutation	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13778539C>T	uc004cvp.3	+	16	2319	c.1960C>T	c.(1960-1962)CGG>TGG	p.R654W	OFD1_uc004cvr.3_Missense_Mutation_p.R221W|OFD1_uc011mil.1_Missense_Mutation_p.R221W|OFD1_uc004cvq.3_Missense_Mutation_p.R514W|OFD1_uc010nen.2_Missense_Mutation_p.R653W|OFD1_uc004cvs.3_RNA|OFD1_uc004cvu.3_Missense_Mutation_p.R613W|OFD1_uc004cvv.3_Missense_Mutation_p.R613W	NM_003611	NP_003602	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	654	Potential.|Mediates the interaction with SDCCAG8.|Mediates homooligomerization.				cilium movement involved in determination of left/right asymmetry|G2/M transition of mitotic cell cycle	centriole|cilium|cytosol|microtubule basal body|nuclear membrane	alpha-tubulin binding|gamma-tubulin binding				0						AAGTTACCATCGGAGAGTCAT	0.478													34	5	---	---	---	---	PASS
MED14	9282	broad.mit.edu	37	X	40551537	40551537	+	Silent	SNP	C	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:40551537C>T	uc004dex.3	-	15	2018	c.1878G>A	c.(1876-1878)AAG>AAA	p.K626K		NM_004229	NP_004220	O60244	MED14_HUMAN	mediator complex subunit 14	626	Interaction with SREBF1.				androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			breast(2)|kidney(1)|skin(1)	4						GTTTTGTTTTCTTGGATTCTA	0.353													24	1	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50341344	50341344	+	Silent	SNP	C	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50341344C>A	uc004dpe.2	-	8	4160	c.4134G>T	c.(4132-4134)CTG>CTT	p.L1378L	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	1378	ASD2.				actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					GTGACAGCAACAGGTTGACCA	0.522													33	1	---	---	---	---	PASS
FLNA	2316	broad.mit.edu	37	X	153594531	153594531	+	Silent	SNP	T	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153594531T>C	uc004fkk.2	-	9	1539	c.1290A>G	c.(1288-1290)GTA>GTG	p.V430V	FLNA_uc010nuu.1_Silent_p.V430V	NM_001110556	NP_001104026	P21333	FLNA_HUMAN	filamin A, alpha isoform 2	430	Filamin 2.				actin crosslink formation|actin cytoskeleton reorganization|cell junction assembly|cytoplasmic sequestering of protein|establishment of protein localization|inhibition of adenylate cyclase activity by dopamine receptor signaling pathway|negative regulation of protein catabolic process|negative regulation of sequence-specific DNA binding transcription factor activity|platelet activation|platelet degranulation|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of transcription factor import into nucleus|protein localization at cell surface|protein stabilization|receptor clustering	cell cortex|cytosol|extracellular region|nucleus|plasma membrane	actin filament binding|Fc-gamma receptor I complex binding|glycoprotein binding|GTP-Ral binding|protein homodimerization activity|Rac GTPase binding|signal transducer activity|transcription factor binding			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GCTGAGGCTCTACCGTGCCCT	0.682													34	3	---	---	---	---	PASS
DFFA	1676	broad.mit.edu	37	1	10527572	10527572	+	Intron	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10527572delT	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		TCttctttcattttttttttt	0.189													4	2	---	---	---	---	
GRHL3	57822	broad.mit.edu	37	1	24671531	24671532	+	Intron	INS	-	CCCCTCCACACCTGTG	CCCCTCCACACCTGTG	rs11306425		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:24671531_24671532insCCCCTCCACACCTGTG	uc001biy.2	+						GRHL3_uc001bix.2_Intron|GRHL3_uc001biz.2_Intron	NM_021180	NP_067003	Q8TE85	GRHL3_HUMAN	sister-of-mammalian grainyhead protein isoform						regulation of actin cytoskeleton organization|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.00171)|all_lung(284;0.00226)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;8.72e-25)|Colorectal(126;4.38e-08)|COAD - Colon adenocarcinoma(152;1.84e-06)|GBM - Glioblastoma multiforme(114;0.000132)|BRCA - Breast invasive adenocarcinoma(304;0.00105)|STAD - Stomach adenocarcinoma(196;0.00151)|KIRC - Kidney renal clear cell carcinoma(1967;0.00377)|READ - Rectum adenocarcinoma(331;0.0656)|Lung(427;0.143)		TACACCTGTGCCCCCTCCACAC	0.663													5	4	---	---	---	---	
SLC35D1	23169	broad.mit.edu	37	1	67487074	67487075	+	Intron	INS	-	A	A	rs11208991	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67487074_67487075insA	uc001ddk.2	-						SLC35D1_uc010oph.1_Intron	NM_015139	NP_055954	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-glucuronic						chondroitin sulfate biosynthetic process|UDP-glucuronate biosynthetic process|xenobiotic metabolic process	integral to endoplasmic reticulum membrane	UDP-glucuronic acid transmembrane transporter activity|UDP-N-acetylgalactosamine transmembrane transporter activity				0					Lorazepam(DB00186)	TCCCAAGAGCTATGAAACCACC	0.386													6	5	---	---	---	---	
GATAD2B	57459	broad.mit.edu	37	1	153790785	153790786	+	Intron	INS	-	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:153790785_153790786insT	uc001fdb.3	-							NM_020699	NP_065750	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B							nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGGAGTCAAGGttttctttttt	0.198													3	4	---	---	---	---	
FCRL1	115350	broad.mit.edu	37	1	157774036	157774037	+	Intron	INS	-	C	C	rs138927105	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157774036_157774037insC	uc001frg.2	-						FCRL1_uc001frf.2_5'Flank|FCRL1_uc001frh.2_Intron|FCRL1_uc001fri.2_Intron|FCRL1_uc001frj.2_Intron	NM_052938	NP_443170	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1 isoform 1 precursor							integral to membrane|plasma membrane	receptor activity			skin(4)|ovary(3)	7	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			ACATGTCTCCACCCCCCCCCCA	0.530													3	4	---	---	---	---	
PBX1	5087	broad.mit.edu	37	1	164761842	164761850	+	In_Frame_Del	DEL	CGGCGGCAG	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:164761842_164761850delCGGCGGCAG	uc001gct.2	+	3	635_643	c.377_385delCGGCGGCAG	c.(376-387)TCGGCGGCAGCG>TCG	p.AAA133del	PBX1_uc010pku.1_In_Frame_Del_p.AAA133del|PBX1_uc010pkv.1_In_Frame_Del_p.AAA50del|PBX1_uc001gcs.2_In_Frame_Del_p.AAA133del|PBX1_uc010pkw.1_In_Frame_Del_p.AAA23del	NM_002585	NP_002576	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	133_135	Poly-Ala.				negative regulation of sequence-specific DNA binding transcription factor activity|sex differentiation|steroid biosynthetic process	cytoplasm|nucleus	sequence-specific DNA binding transcription factor activity|transcription factor binding		EWSR1/PBX1(3)	soft_tissue(3)|lung(1)|skin(1)	5						GGCGGAGGGTcggcggcagcggcggcagc	0.502			T	TCF3|EWSR1	pre B-ALL|myoepithelioma								39	29	---	---	---	---	
NBAS	51594	broad.mit.edu	37	2	15415949	15415950	+	Intron	INS	-	A	A	rs79591002		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15415949_15415950insA	uc002rcc.1	-						NBAS_uc010exl.1_Intron|NBAS_uc002rcd.1_Intron	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein											ovary(2)|liver(1)|skin(1)	4						AGACCTAGCAGAAAAAAAAAGA	0.356													37	36	---	---	---	---	
OXER1	165140	broad.mit.edu	37	2	42991386	42991386	+	5'UTR	DEL	G	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42991386delG	uc002rss.2	-	1						NM_148962	NP_683765	Q8TDS5	OXER1_HUMAN	G-protein coupled receptor TG1019						regulation of cAMP biosynthetic process	integral to membrane|plasma membrane	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding|G-protein coupled receptor activity			breast(1)	1						TGCAGGCCAAGGGGAACCCTG	0.597													33	15	---	---	---	---	
TACR1	6869	broad.mit.edu	37	2	75278458	75278459	+	Frame_Shift_Ins	INS	-	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75278458_75278459insT	uc002sng.2	-	4	1436_1437	c.851_852insA	c.(850-852)CAGfs	p.Q284fs	TACR1_uc002snh.2_Frame_Shift_Ins_p.Q284fs	NM_001058	NP_001049	P25103	NK1R_HUMAN	tachykinin receptor 1 isoform long	284	Helical; Name=7; (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|detection of abiotic stimulus|mechanosensory behavior	integral to plasma membrane	protein binding			ovary(1)	1					Aprepitant(DB00673)|Ketamine(DB01221)|Vapreotide(DB04894)	GGTAGACCTGCTGGATAAACTT	0.540													65	112	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219352921	219352921	+	Intron	DEL	G	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219352921delG	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		aaaaaaaaaagaaaagaaAAG	0.104													6	4	---	---	---	---	
EDEM1	9695	broad.mit.edu	37	3	5241200	5241200	+	Intron	DEL	G	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:5241200delG	uc003bqi.2	+						EDEM1_uc011asz.1_Intron|EDEM1_uc003bqh.2_Intron	NM_014674	NP_055489	Q92611	EDEM1_HUMAN	ER degradation enhancer, mannosidase alpha-like						ER-associated protein catabolic process|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	integral to endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			ovary(2)|breast(1)	3				Epithelial(13;0.0588)|OV - Ovarian serous cystadenocarcinoma(96;0.0682)		TTTAGGTGACGTGACTGGGCT	0.408													1	9	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				4	2	---	---	---	---	
HYAL1	3373	broad.mit.edu	37	3	50339382	50339382	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:50339382delA	uc003czp.2	-						HYAL3_uc003czd.1_5'Flank|HYAL3_uc003cze.1_5'Flank|HYAL3_uc003czf.1_5'Flank|HYAL3_uc003czg.1_5'Flank|NAT6_uc003czj.2_5'Flank|NAT6_uc003czk.3_5'Flank|NAT6_uc003czl.1_5'Flank|HYAL1_uc003czm.2_Intron|HYAL1_uc003czo.2_Intron|HYAL1_uc003czq.2_Intron|HYAL1_uc003czr.2_Intron|HYAL1_uc003czn.2_Intron|HYAL1_uc003czs.2_Intron|HYAL1_uc003czt.2_Intron	NM_033159	NP_149349	Q12794	HYAL1_HUMAN	hyaluronoglucosaminidase 1 isoform 1							extracellular space|lysosome	hyalurononglucosaminidase activity			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000272)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00607)	Hyaluronidase(DB00070)	actctgtctcaaaaaaaaaaa	0.194													8	4	---	---	---	---	
TMCC1	23023	broad.mit.edu	37	3	129370755	129370755	+	Intron	DEL	G	-	-	rs112117397		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:129370755delG	uc003emz.3	-						TMCC1_uc003emy.3_Intron|TMCC1_uc011blc.1_Intron|TMCC1_uc010htg.2_Intron	NM_001017395	NP_001017395	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1							integral to membrane				skin(1)	1						TTATAAATATGCTGGAGCCTT	0.433													4	3	---	---	---	---	
NMD3	51068	broad.mit.edu	37	3	160953121	160953121	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:160953121delA	uc003feb.1	+						NMD3_uc003fec.2_Intron|NMD3_uc003fed.1_Intron|NMD3_uc010hwh.2_Intron	NM_015938	NP_057022	Q96D46	NMD3_HUMAN	NMD3 homolog						protein transport	cytoplasm|nucleolus|nucleoplasm				ovary(1)	1			Lung(72;0.00111)|LUSC - Lung squamous cell carcinoma(72;0.00156)			ttctgttaggaaaaaaaaaaa	0.075													5	4	---	---	---	---	
MUC20	200958	broad.mit.edu	37	3	195452664	195452664	+	Frame_Shift_Del	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195452664delC	uc010hzo.2	+	3	803	c.677delC	c.(676-678)ACCfs	p.T226fs	MUC20_uc010hzp.2_Frame_Shift_Del_p.T191fs|MUC20_uc011bte.1_RNA	NM_152673	NP_689886	Q8N307	MUC20_HUMAN	mucin 20 isoform L	397	12 X 20 AA approximate tandem repeats of S-S-E-S-S-A-S-S-D-S-P-H-P-V-I-T-P-S-R-A.|12; approximate.				protein homooligomerization	apical plasma membrane|basal plasma membrane|extracellular region|microvillus membrane					0	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CCAGTCATCACCCCCTCATGG	0.587													3	3	---	---	---	---	
CENPE	1062	broad.mit.edu	37	4	104057283	104057284	+	Intron	INS	-	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:104057283_104057284insA	uc003hxb.1	-						CENPE_uc003hxc.1_Intron	NM_001813	NP_001804	Q02224	CENPE_HUMAN	centromere protein E						blood coagulation|cell division|kinetochore assembly|microtubule-based movement|mitotic chromosome movement towards spindle pole|mitotic metaphase|mitotic metaphase plate congression|mitotic prometaphase|multicellular organismal development|positive regulation of protein kinase activity	condensed chromosome kinetochore|cytosol|microtubule|nucleus|spindle	ATP binding|kinetochore binding|microtubule motor activity			ovary(5)|breast(4)	9				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AGGATATTACTAAAAAAGATGG	0.312													58	25	---	---	---	---	
TMEM144	55314	broad.mit.edu	37	4	159161693	159161694	+	Intron	DEL	TG	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159161693_159161694delTG	uc003ipx.2	+						TMEM144_uc010iqi.2_Intron	NM_018342	NP_060812	Q7Z5S9	TM144_HUMAN	transmembrane protein 144							integral to membrane					0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		gtgtgtgtgttgtgtgtgtgtg	0.252													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	75206234	75206235	+	IGR	INS	-	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:75206234_75206235insT								POC5 (192921 upstream) : SV2C (173070 downstream)																							GATTTCCTGCAGGGTTTCTGAT	0.465													7	30	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25279840	25279841	+	5'UTR	DEL	TT	-	-	rs72361376		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25279840_25279841delTT	uc011djw.1	+	1					LRRC16A_uc010jpx.2_5'UTR|LRRC16A_uc010jpy.2_5'UTR	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						TTTGCAACTCTTTTTTTTTTTT	0.530													4	2	---	---	---	---	
PGM3	5238	broad.mit.edu	37	6	83900377	83900377	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:83900377delA	uc003pjv.2	-						PGM3_uc003pjw.2_Intron|PGM3_uc011dyz.1_Intron|RWDD2A_uc003pjx.3_5'Flank|RWDD2A_uc011dza.1_5'Flank	NM_015599	NP_056414	O95394	AGM1_HUMAN	phosphoglucomutase 3						dolichol-linked oligosaccharide biosynthetic process|embryo development ending in birth or egg hatching|glucose 1-phosphate metabolic process|hemopoiesis|post-translational protein modification|protein N-linked glycosylation via asparagine|UDP-N-acetylglucosamine biosynthetic process	cytosol	magnesium ion binding|phosphoacetylglucosamine mutase activity|phosphoglucomutase activity				0		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TCATGCTCTTAAAAAAAAAAA	0.333													4	2	---	---	---	---	
SNX3	8724	broad.mit.edu	37	6	108533548	108533549	+	Intron	INS	-	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:108533548_108533549insT	uc003psh.2	-						SNX3_uc003psi.2_Intron|SNX3_uc010kdi.2_Intron	NM_003795	NP_003786	O60493	SNX3_HUMAN	sorting nexin 3 isoform a						cell communication|endocytosis|protein transport	early endosome|endosome membrane	phosphatidylinositol-3-phosphate binding|protein phosphatase binding				0		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0136)|Epithelial(106;0.0564)|OV - Ovarian serous cystadenocarcinoma(136;0.0717)|all cancers(137;0.0743)		AGCATGTATAAttttttttttt	0.158													4	2	---	---	---	---	
PDAP1	11333	broad.mit.edu	37	7	98994127	98994127	+	3'UTR	DEL	C	-	-	rs113663373		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98994127delC	uc003uqe.2	-	6						NM_014891	NP_055706	Q13442	HAP28_HUMAN	PDGFA associated protein 1						cell proliferation|signal transduction						0	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)		Becaplermin(DB00102)	CTCCCCCAGTCCCCCCCCCCA	0.542													2	4	---	---	---	---	
ZNF703	80139	broad.mit.edu	37	8	37553580	37553580	+	Frame_Shift_Del	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:37553580delC	uc003xjy.1	+	1	280	c.83delC	c.(82-84)GCGfs	p.A28fs		NM_025069	NP_079345	Q9H7S9	ZN703_HUMAN	zinc finger protein 703	28					adherens junction assembly|mammary gland epithelial cell differentiation|negative regulation of homotypic cell-cell adhesion|negative regulation of transcription, DNA-dependent|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of mammary gland epithelial cell proliferation|regulation of canonical Wnt receptor signaling pathway|regulation of cell cycle|regulation of transforming growth factor beta receptor signaling pathway|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein binding|zinc ion binding			breast(1)|pancreas(1)	2			BRCA - Breast invasive adenocarcinoma(5;7.93e-25)|LUSC - Lung squamous cell carcinoma(8;1.05e-09)			AAGAGGCCGGCGGTGCCGGCA	0.582													4	2	---	---	---	---	
NR4A3	8013	broad.mit.edu	37	9	102589219	102589220	+	Intron	INS	-	T	T	rs142732047	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102589219_102589220insT	uc004baf.1	+						NR4A3_uc004bae.2_Intron|NR4A3_uc004bag.1_Intron|NR4A3_uc004bai.2_Intron	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				AAAAACCGCCGTTTTTTACCAT	0.386			T	EWSR1	extraskeletal myxoid chondrosarcoma								4	2	---	---	---	---	
EHMT1	79813	broad.mit.edu	37	9	140637804	140637805	+	Intron	INS	-	T	T	rs34385417		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140637804_140637805insT	uc011mfc.1	+						EHMT1_uc004coa.2_Intron|EHMT1_uc004cob.1_Intron|EHMT1_uc010ncn.1_Intron	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1						DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		ccccttttgacttttttttttt	0.272													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	42383711	42383712	+	IGR	INS	-	C	C			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:42383711_42383712insC								None (None upstream) : LOC441666 (443603 downstream)																							tcaaatggaatcaaaataacca	0.000													3	3	---	---	---	---	
LRIT2	340745	broad.mit.edu	37	10	85981876	85981876	+	Frame_Shift_Del	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:85981876delC	uc001kcy.2	-	3	1461	c.1453delG	c.(1453-1455)GCAfs	p.A485fs	LRIT2_uc010qmc.1_Frame_Shift_Del_p.A495fs	NM_001017924	NP_001017924	A6NDA9	LRIT2_HUMAN	leucine rich repeat containing 22 precursor	485	Helical; (Potential).					integral to membrane				ovary(2)	2						CCCTGGGCTGCCCAGGCATAG	0.657													44	28	---	---	---	---	
PPP1R3C	5507	broad.mit.edu	37	10	93390010	93390011	+	Frame_Shift_Ins	INS	-	A	A			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93390010_93390011insA	uc001kho.2	-	2	759_760	c.627_628insT	c.(625-630)GGTGGCfs	p.G209fs		NM_005398	NP_005389	Q9UQK1	PPR3C_HUMAN	protein phosphatase 1, regulatory (inhibitor)	209_210	Interaction with EPM2A.|CBM21.						protein serine/threonine phosphatase activity			breast(1)	1		Colorectal(252;0.235)				CTATCTGTGCCACCATACACAT	0.391													62	62	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135097228	135097228	+	Intron	DEL	G	-	-	rs67681147		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135097228delG	uc001lmg.1	-						TUBGCP2_uc001lmf.1_Intron|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		tgcctctcccgcactccctgc	0.055													6	4	---	---	---	---	
TUBGCP2	10844	broad.mit.edu	37	10	135103634	135103640	+	Intron	DEL	CTGTGGG	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135103634_135103640delCTGTGGG	uc001lmg.1	-						TUBGCP2_uc001lmf.1_5'UTR|TUBGCP2_uc010qvc.1_Intron|TUBGCP2_uc009ybk.1_Intron|TUBGCP2_uc010qvd.1_Intron|TUBGCP2_uc001lmh.1_Intron	NM_006659	NP_006650	Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle|microtubule nucleation|protein complex assembly	centrosome|cytoplasmic microtubule|cytosol|spindle pole	protein binding				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TACTTCTCAACTGTGGGCTAAAACGAA	0.377													3	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	11	11158570	11158570	+	IGR	DEL	A	-	-	rs10574607		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:11158570delA								ZBED5 (278950 upstream) : GALNTL4 (133851 downstream)																							actctgtctcaaaaaaaaaaa	0.114													4	3	---	---	---	---	
KBTBD4	55709	broad.mit.edu	37	11	47597411	47597412	+	Intron	INS	-	T	T	rs35653820		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:47597411_47597412insT	uc001nfx.2	-						NDUFS3_uc001nft.3_Intron|KBTBD4_uc001nfw.1_Intron|KBTBD4_uc001nfz.2_Intron|KBTBD4_uc001nfy.2_Intron	NM_016506	NP_057590	Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4											ovary(1)|central_nervous_system(1)	2						CCTAAAATTGCttttttttttt	0.173													4	4	---	---	---	---	
RTN4RL2	349667	broad.mit.edu	37	11	57234851	57234851	+	Intron	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57234851delT	uc010rjt.1	+							NM_178570	NP_848665	Q86UN3	R4RL2_HUMAN	reticulon 4 receptor-like 2 precursor						axon regeneration	anchored to plasma membrane	receptor activity				0						gcctggctaattttttttttt	0.000													4	4	---	---	---	---	
ARRB1	408	broad.mit.edu	37	11	74980343	74980343	+	Intron	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74980343delC	uc001owe.1	-						ARRB1_uc001owf.1_Intron	NM_004041	NP_004032	P49407	ARRB1_HUMAN	arrestin beta 1 isoform A						G-protein coupled receptor internalization|histone H4 acetylation|negative regulation of interleukin-6 production|negative regulation of interleukin-8 production|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|platelet activation|positive regulation of ERK1 and ERK2 cascade|positive regulation of histone acetylation|positive regulation of Rho protein signal transduction|positive regulation of transcription from RNA polymerase II promoter|post-Golgi vesicle-mediated transport|proteasomal ubiquitin-dependent protein catabolic process|protein transport|protein ubiquitination|signal transduction|stress fiber assembly|transcription from RNA polymerase II promoter	chromatin|coated pit|cytoplasmic vesicle membrane|cytosol|Golgi membrane|lysosomal membrane|membrane fraction|nucleus|plasma membrane|pseudopodium|soluble fraction	angiotensin receptor binding|enzyme inhibitor activity|GTPase activator activity|insulin-like growth factor receptor binding|transcription factor binding|transcription regulatory region DNA binding|ubiquitin protein ligase binding			breast(2)	2						TGCCCTGGGACCCCCCCCCAC	0.682													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	9555195	9555196	+	IGR	INS	-	C	C	rs140281398	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:9555195_9555196insC								LOC642846 (88511 upstream) : DDX12 (15092 downstream)																							AAGCCCCTCTTCCCCCCCTGGC	0.584													22	14	---	---	---	---	
SLC17A8	246213	broad.mit.edu	37	12	100774908	100774915	+	Intron	DEL	CATCTCAG	-	-	rs68046331		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:100774908_100774915delCATCTCAG	uc010svi.1	+						SLC17A8_uc009ztx.2_Intron	NM_139319	NP_647480	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (sodium-dependent						neurotransmitter transport|sensory perception of sound|sodium ion transport	cell junction|integral to membrane|synaptic vesicle membrane|synaptosome	L-glutamate transmembrane transporter activity|symporter activity			ovary(3)	3						TAGCTCCTCCcatctcagcatctcagca	0.221													4	2	---	---	---	---	
KIAA1033	23325	broad.mit.edu	37	12	105558325	105558327	+	Intron	DEL	AAT	-	-	rs150550745		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:105558325_105558327delAAT	uc001tld.2	+						KIAA1033_uc010swr.1_Intron|KIAA1033_uc010sws.1_Intron	NM_015275	NP_056090	Q2M389	WAHS7_HUMAN	hypothetical protein LOC23325						endosome transport	WASH complex				kidney(1)|central_nervous_system(1)	2						AGCTTTTAAAAATAATAATAAGA	0.256													3	5	---	---	---	---	
MED13L	23389	broad.mit.edu	37	12	116420917	116420917	+	Intron	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:116420917delC	uc001tvw.2	-							NM_015335	NP_056150	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent					skin(4)|ovary(2)|upper_aerodigestive_tract(1)|lung(1)	8	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		TAGTGAATAACATACCTCTCT	0.483													80	52	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	19532389	19532389	+	IGR	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19532389delT								LOC284232 (86280 upstream) : LOC348021 (50010 downstream)																							TTTGGGAGCCTTTTTTTTTTG	0.542													4	2	---	---	---	---	
TBC1D4	9882	broad.mit.edu	37	13	75923091	75923094	+	Intron	DEL	GTGT	-	-	rs151307196		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:75923091_75923094delGTGT	uc001vjl.1	-						TBC1D4_uc010aer.2_Intron|TBC1D4_uc010aes.2_Intron	NM_014832	NP_055647	O60343	TBCD4_HUMAN	TBC1 domain family, member 4							cytoplasm	Rab GTPase activator activity			ovary(4)|central_nervous_system(1)|skin(1)	6		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		gagagagagagtgtgtgtgtgtgt	0.181													4	2	---	---	---	---	
HERC2P2	400322	broad.mit.edu	37	15	23312036	23312036	+	3'UTR	DEL	C	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:23312036delC	uc001yvr.2	-	19					HERC2P2_uc001yvq.2_5'Flank|HERC2P2_uc001yvo.3_5'Flank|HERC2P2_uc001yvp.3_Splice_Site					RecName: Full=Putative HERC2-like protein 3;												0						CGGCCACCCACCTCTGAGTGA	0.637													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	28900331	28900331	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28900331delA	uc010uan.1	+						uc010azc.2_Intron|uc010uao.1_5'Flank					Homo sapiens cDNA FLJ55955 complete cds, highly similar to HECT domain and RCC1-like domain-containing protein 2.																		actctgtctcaaaaaaaaaaa	0.114													5	3	---	---	---	---	
UBR1	197131	broad.mit.edu	37	15	43378119	43378119	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:43378119delA	uc001zqq.2	-						UBR1_uc010udk.1_Intron	NM_174916	NP_777576	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin						cellular response to leucine|negative regulation of TOR signaling cascade	cytosol	leucine binding|zinc ion binding			lung(1)	1		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		actctgtttcaaaaaaaaaaa	0.124													8	4	---	---	---	---	
AP3B2	8120	broad.mit.edu	37	15	83360356	83360356	+	Intron	DEL	A	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83360356delA	uc010uoh.1	-						AP3B2_uc010uoi.1_Intron|AP3B2_uc010uoj.1_Intron|AP3B2_uc010uok.1_Intron	NM_004644	NP_004635	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2						endocytosis|intracellular protein transport|post-Golgi vesicle-mediated transport	clathrin coated vesicle membrane|COPI-coated vesicle|membrane coat	binding|protein transporter activity			ovary(3)|breast(1)|pancreas(1)	5			BRCA - Breast invasive adenocarcinoma(143;0.229)			TTTCTTCtttaaaaaaaaaaa	0.303													9	6	---	---	---	---	
ZC3H18	124245	broad.mit.edu	37	16	88690882	88690883	+	Intron	INS	-	AGC	AGC	rs143096278	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:88690882_88690883insAGC	uc002fky.2	+						ZC3H18_uc010voz.1_Intron|ZC3H18_uc010chw.2_Intron|ZC3H18_uc002fkz.2_5'Flank	NM_144604	NP_653205	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18							nucleus	nucleic acid binding|zinc ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GTCCAGGCACGAGCGTGCTCAC	0.653													2	4	---	---	---	---	
TXNDC17	84817	broad.mit.edu	37	17	6546173	6546174	+	Intron	DEL	TC	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6546173_6546174delTC	uc002gdf.3	+						KIAA0753_uc002gde.3_5'Flank|KIAA0753_uc010vte.1_5'Flank	NM_032731	NP_116120	Q9BRA2	TXD17_HUMAN	thioredoxin-like 5						tumor necrosis factor-mediated signaling pathway	cytosol	electron carrier activity|peroxidase activity|protein binding|protein-disulfide reductase activity			ovary(1)	1						TTGCGTAATTTCTGTGTTCAAA	0.332													1	14	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7577519	7577527	+	In_Frame_Del	DEL	GATGGTGAG	-	-	rs121912653		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577519_7577527delGATGGTGAG	uc002gim.2	-	7	948_956	c.754_762delCTCACCATC	c.(754-762)CTCACCATCdel	p.LTI252del	TP53_uc002gig.1_In_Frame_Del_p.LTI252del|TP53_uc002gih.2_In_Frame_Del_p.LTI252del|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_In_Frame_Del_p.LTI120del|TP53_uc010cng.1_In_Frame_Del_p.LTI120del|TP53_uc002gii.1_In_Frame_Del_p.LTI120del|TP53_uc010cnh.1_In_Frame_Del_p.LTI252del|TP53_uc010cni.1_In_Frame_Del_p.LTI252del|TP53_uc002gij.2_In_Frame_Del_p.LTI252del|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_In_Frame_Del_p.LTI159del|TP53_uc002gio.2_In_Frame_Del_p.LTI120del	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	252_254	|Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		I -> L (in a sporadic cancer; somatic mutation).|I -> D (in sporadic cancers; somatic mutation; requires 2 nucleotide substitutions).|I -> F (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation).|I -> V (in sporadic cancers; somatic mutation).|I -> M (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.L252F(9)|p.I254F(7)|p.L252P(7)|p.0?(7)|p.L252fs*93(6)|p.I254S(5)|p.T253S(5)|p.L252del(5)|p.I254fs*10(5)|p.I254V(4)|p.I251_T253delILT(4)|p.L252_I254delLTI(3)|p.T253I(3)|p.T253A(3)|p.I254T(3)|p.I254N(3)|p.I255fs*90(3)|p.I254D(3)|p.I255fs*9(3)|p.T253P(3)|p.P250_L252delPIL(2)|p.T253_I255del(2)|p.T253T(2)|p.T253fs*91(2)|p.I254del(2)|p.T253fs*11(2)|p.L252H(2)|p.L252_T253delLT(1)|p.T253N(1)|p.P250_T253delPILT(1)|p.I254I(1)|p.T253fs*92(1)|p.?(1)|p.I254fs*7(1)|p.I251_L252insX(1)|p.T253del(1)|p.L252fs*12(1)|p.L252fs*13(1)|p.R249_T256delRPILTIIT(1)|p.I254fs*91(1)|p.L252fs*92(1)|p.L252L(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		CCAGTGTGATGATGGTGAGGATGGGCCTC	0.589		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			19	34	---	---	---	---	
CTDP1	9150	broad.mit.edu	37	18	77472899	77472899	+	Intron	DEL	G	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:77472899delG	uc002lnh.1	+						CTDP1_uc002lni.1_Intron|CTDP1_uc010drd.1_Intron	NM_004715	NP_004706	Q9Y5B0	CTDP1_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II,						positive regulation of viral transcription|protein dephosphorylation|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	CTD phosphatase activity|DNA-directed RNA polymerase activity				0		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;5.2e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0277)		ATCTTAAACTGTTACGCTTGG	0.393													12	7	---	---	---	---	
KCNN4	3783	broad.mit.edu	37	19	44280870	44280870	+	Intron	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44280870delT	uc002oxl.2	-						KCNN4_uc010eiz.2_5'Flank|KCNN4_uc010eja.1_Intron	NM_002250	NP_002241	O15554	KCNN4_HUMAN	intermediate conductance calcium-activated						defense response	voltage-gated potassium channel complex	calcium-activated potassium channel activity|calmodulin binding			ovary(2)	2		Prostate(69;0.0352)			Clotrimazole(DB00257)|Halothane(DB01159)|Quinine(DB00468)	AAAACCACCATTTTTTTTTTT	0.507													7	4	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37154320	37154320	+	Intron	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37154320delT	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron|RALGAPB_uc002xja.1_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						TGACTTGTGATTTTTTTTTTT	0.294													3	3	---	---	---	---	
RALGAPB	57148	broad.mit.edu	37	20	37168728	37168728	+	Intron	DEL	T	-	-			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37168728delT	uc002xiw.2	+						RALGAPB_uc002xix.2_Intron|RALGAPB_uc002xiy.1_Intron|RALGAPB_uc002xiz.2_Intron|RALGAPB_uc002xja.1_Intron	NM_020336	NP_065069	Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit						activation of Ral GTPase activity	intracellular	protein heterodimerization activity|Ral GTPase activator activity			pancreas(1)|skin(1)	2						ACTTGTTAGATTACAGTGGAA	0.284													4	2	---	---	---	---	
DNMT3L	29947	broad.mit.edu	37	21	45674711	45674713	+	Intron	DEL	TTG	-	-	rs137985892		TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45674711_45674713delTTG	uc002zeg.1	-						DNMT3L_uc002zeh.1_Intron	NM_175867	NP_787063	Q9UJW3	DNM3L_HUMAN	cytosine-5-methyltransferase 3-like protein						DNA methylation|negative regulation of transcription, DNA-dependent|regulation of gene expression by genetic imprinting|spermatogenesis	cytosol	enzyme activator activity|enzyme binding|metal ion binding			skin(2)	2				Colorectal(79;0.0165)|READ - Rectum adenocarcinoma(84;0.0781)		CTGTATAtttttgttgttgttgt	0.271													4	2	---	---	---	---	
MED15	51586	broad.mit.edu	37	22	20929655	20929656	+	Intron	INS	-	T	T			TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:20929655_20929656insT	uc002zsp.2	+						MED15_uc002zsq.2_Intron|MED15_uc010gso.2_Intron|MED15_uc002zsr.2_Intron|MED15_uc011ahs.1_Intron|MED15_uc002zss.2_Intron|MED15_uc011ahu.1_Intron|MED15_uc002zst.2_Intron	NM_001003891	NP_001003891	Q96RN5	MED15_HUMAN	mediator complex subunit 15 isoform a						regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|mediator complex	protein binding			skin(1)	1	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			CCCACAGTCCCTTTTTTTTTTT	0.436													4	2	---	---	---	---	
YPEL1	29799	broad.mit.edu	37	22	22057997	22057998	+	Intron	INS	-	G	G	rs147967901	by1000genomes	TCGA-46-6026-01	TCGA-46-6026-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22057997_22057998insG	uc002zvl.2	-						YPEL1_uc002zvm.2_Intron	NM_013313	NP_037445	O60688	YPEL1_HUMAN	yippee-like 1							nucleus					0	Colorectal(54;0.105)					CAGAAACTCCCGGCGGGGGGAT	0.624													4	4	---	---	---	---	
