Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MIIP	60672	broad.mit.edu	37	1	12091849	12091849	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12091849C>T	uc001ato.1	+	10	1331	c.1151C>T	c.(1150-1152)CCA>CTA	p.P384L		NM_021933	NP_068752	Q5JXC2	MIIP_HUMAN	invasion inhibitory protein 45	384										ovary(1)	1						CCCCACGTCCCACGGCAGAAG	0.672													34	59	---	---	---	---	PASS
PDPN	10630	broad.mit.edu	37	1	13940914	13940914	+	Intron	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:13940914A>T	uc001avd.2	+						PDPN_uc001avc.2_Intron|PDPN_uc009vob.2_Intron|PDPN_uc009voc.2_Intron|PDPN_uc001ave.2_Intron|PDPN_uc001avf.2_Intron	NM_006474	NP_006465	Q86YL7	PDPN_HUMAN	lung type-I cell membrane-associated						cell morphogenesis|lymphangiogenesis|regulation of cell shape	filopodium membrane|integral to plasma membrane|lamellipodium membrane|microvillus membrane|ruffle membrane				ovary(2)	2	Ovarian(185;0.249)	all_lung(284;2.29e-05)|Lung NSC(185;4.37e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00969)|Colorectal(212;4.48e-06)|COAD - Colon adenocarcinoma(227;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000347)|Kidney(185;0.00087)|KIRC - Kidney renal clear cell carcinoma(229;0.0027)|STAD - Stomach adenocarcinoma(313;0.00802)|READ - Rectum adenocarcinoma(331;0.0678)		CTCGTAAGTAAATAGCTTACA	0.373													30	35	---	---	---	---	PASS
NBPF1	55672	broad.mit.edu	37	1	16892549	16892549	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16892549G>A	uc009vos.1	-						uc001ayw.2_5'Flank	NM_017940	NP_060410	Q3BBV0	NBPF1_HUMAN	hypothetical protein LOC55672							cytoplasm					0				UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		AATTGGCCGGGTGACACACTG	0.363													4	33	---	---	---	---	PASS
PLA2G5	5322	broad.mit.edu	37	1	20412684	20412684	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20412684G>A	uc001bcy.2	+	3	417	c.149G>A	c.(148-150)TGG>TAG	p.W50*	PLA2G5_uc001bcw.2_RNA|PLA2G5_uc001bcx.2_Nonsense_Mutation_p.W81*	NM_000929	NP_000920	P39877	PA2G5_HUMAN	phospholipase A2, group V precursor	50					lipid catabolic process	extracellular region	calcium ion binding|calcium-dependent phospholipase A2 activity			skin(1)	1		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000249)|Lung NSC(340;0.000287)|Breast(348;0.000812)|Ovarian(437;0.00328)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.22e-05)|BRCA - Breast invasive adenocarcinoma(304;8.15e-05)|Kidney(64;0.000184)|GBM - Glioblastoma multiforme(114;0.00089)|KIRC - Kidney renal clear cell carcinoma(64;0.0027)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0652)		TACTGCGGCTGGGGCGGCCGA	0.488													19	33	---	---	---	---	PASS
SNHG12	85028	broad.mit.edu	37	1	28906893	28906893	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:28906893C>T	uc001bqk.2	-						SNHG12_uc001bql.2_Intron|SNHG12_uc001bqm.2_RNA|SNHG12_uc001bqn.2_RNA|SNHG12_uc001bqo.2_Intron|SNHG12_uc001bqp.2_Intron|SNORD99_uc001bqq.1_5'Flank|SNORA61_uc001bqr.2_5'Flank|SNORA44_uc001bqs.2_RNA	NR_024127				Homo sapiens PNAS-123 mRNA, complete cds.												0						GGTCCTGAAACATTATAGGAA	0.378													16	14	---	---	---	---	PASS
C1orf91	56063	broad.mit.edu	37	1	32687602	32687602	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32687602C>T	uc009vub.1	-	2	37	c.34G>A	c.(34-36)GTG>ATG	p.V12M	C1orf91_uc001buo.3_RNA|C1orf91_uc001bup.3_RNA|C1orf91_uc010oha.1_RNA|C1orf91_uc001buq.3_Missense_Mutation_p.V12M|EIF3I_uc001bur.3_5'UTR|EIF3I_uc009vuc.2_5'Flank|EIF3I_uc001bus.2_5'Flank			Q8WY98	TM234_HUMAN	RecName: Full=UPF0546 membrane protein C1orf91;	12	Helical; (Potential).					integral to membrane					0		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCCACCAGCACCAGAGCCAAC	0.697													19	37	---	---	---	---	PASS
GRIK3	2899	broad.mit.edu	37	1	37291414	37291414	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:37291414G>T	uc001caz.2	-	11	1679	c.1544C>A	c.(1543-1545)GCC>GAC	p.A515D	GRIK3_uc001cba.1_Missense_Mutation_p.A515D	NM_000831	NP_000822	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	515	Extracellular (Potential).				negative regulation of synaptic transmission, glutamatergic|regulation of membrane potential|synaptic transmission	cell junction|dendrite cytoplasm|integral to plasma membrane|perikaryon|postsynaptic membrane|terminal button	adenylate cyclase inhibiting metabotropic glutamate receptor activity|extracellular-glutamate-gated ion channel activity|G-protein-coupled receptor binding|kainate selective glutamate receptor activity			ovary(3)|skin(2)|large_intestine(1)|breast(1)	7		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)			L-Glutamic Acid(DB00142)	GGGGGCCACGGCCAGATCTGC	0.522													24	95	---	---	---	---	PASS
MANEAL	149175	broad.mit.edu	37	1	38265828	38265828	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:38265828C>T	uc001cby.2	+	4	1408	c.1327C>T	c.(1327-1329)CGC>TGC	p.R443C	MANEAL_uc001cbx.2_3'UTR|MANEAL_uc001cbz.2_Missense_Mutation_p.R221C	NM_001113482	NP_001106954	Q5VSG8	MANEL_HUMAN	mannosidase, endo-alpha-like isoform 3	443	Lumenal (Potential).					Golgi membrane|integral to membrane	hydrolase activity				0	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				GCTGACACGCCGCTGGGCGGA	0.582													24	75	---	---	---	---	PASS
SCMH1	22955	broad.mit.edu	37	1	41579063	41579063	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:41579063C>G	uc001cgo.2	-	8	918	c.607G>C	c.(607-609)GGG>CGG	p.G203R	SCMH1_uc010ojr.1_Intron|SCMH1_uc001cgp.2_Missense_Mutation_p.G142R|SCMH1_uc001cgr.2_Missense_Mutation_p.G142R|SCMH1_uc001cgs.2_Missense_Mutation_p.G213R|SCMH1_uc001cgt.2_Missense_Mutation_p.G142R|SCMH1_uc001cgq.2_Missense_Mutation_p.G156R|SCMH1_uc010ojs.1_RNA	NM_001031694	NP_001026864	Q96GD3	SCMH1_HUMAN	sex comb on midleg 1 isoform 1	203	MBT 2.				anatomical structure morphogenesis|gene silencing|multicellular organismal development|negative regulation of transcription, DNA-dependent		DNA binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)|Breast(333;0.162)	Myeloproliferative disorder(586;0.0393)				CCTCGCCACCCATCAAAAGTG	0.567													27	96	---	---	---	---	PASS
AGBL4	84871	broad.mit.edu	37	1	49100272	49100272	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:49100272A>T	uc001cru.2	-	9	1002	c.844T>A	c.(844-846)TCT>ACT	p.S282T	AGBL4_uc010omw.1_Missense_Mutation_p.S15T|AGBL4_uc010omx.1_Missense_Mutation_p.S294T|AGBL4_uc001crv.1_Missense_Mutation_p.S135T|AGBL4_uc010omy.1_Missense_Mutation_p.S105T	NM_032785	NP_116174	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	282					C-terminal protein deglutamylation|protein side chain deglutamylation|proteolysis	cytosol	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(1)|breast(1)	2				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CCCATCAGAGAACACCTAGGC	0.448													4	11	---	---	---	---	PASS
C8A	731	broad.mit.edu	37	1	57383376	57383376	+	Missense_Mutation	SNP	C	A	A	rs143726641	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57383376C>A	uc001cyo.2	+	11	1874	c.1742C>A	c.(1741-1743)ACG>AAG	p.T581K		NM_000562	NP_000553	P07357	CO8A_HUMAN	complement component 8, alpha polypeptide	581	TSP type-1 2.				complement activation, alternative pathway|complement activation, classical pathway|cytolysis	extracellular space|membrane attack complex				ovary(1)|central_nervous_system(1)|skin(1)	3						AAAGTACAGACGCAGGCTTGC	0.537													24	49	---	---	---	---	PASS
DNAJC6	9829	broad.mit.edu	37	1	65855118	65855118	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:65855118C>T	uc001dcd.1	+	10	1366	c.1202C>T	c.(1201-1203)ACG>ATG	p.T401M	DNAJC6_uc001dcc.1_Missense_Mutation_p.T432M|DNAJC6_uc010opc.1_Missense_Mutation_p.T388M|DNAJC6_uc001dce.1_Missense_Mutation_p.T458M	NM_014787	NP_055602	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	401					cellular membrane organization|post-Golgi vesicle-mediated transport	cytosol	heat shock protein binding|protein tyrosine phosphatase activity|SH3 domain binding			large_intestine(1)|lung(1)|ovary(1)	3						CATCAAGATACGCTGGCCTTA	0.418													26	79	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66067630	66067630	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66067630T>A	uc001dci.2	+	10	1592	c.1390T>A	c.(1390-1392)TTG>ATG	p.L464M	LEPR_uc001dcg.2_Missense_Mutation_p.L464M|LEPR_uc001dch.2_Missense_Mutation_p.L464M|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Missense_Mutation_p.L464M|LEPR_uc001dck.2_Missense_Mutation_p.L464M	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1	464	Extracellular (Potential).				energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		CACTTTGCAATTGAGGTATCA	0.348													58	141	---	---	---	---	PASS
LEPR	3953	broad.mit.edu	37	1	66091799	66091799	+	Intron	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:66091799T>A	uc001dci.2	+						LEPR_uc001dcg.2_Intron|LEPR_uc001dch.2_Intron|LEPR_uc009waq.2_Intron|LEPR_uc001dcj.2_Intron|LEPR_uc001dck.2_Intron	NM_002303	NP_002294	P48357	LEPR_HUMAN	leptin receptor isoform 1						energy reserve metabolic process|multicellular organismal development	extracellular region|integral to membrane|plasma membrane	cytokine receptor activity			skin(1)	1				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		ATTTTTCCCTTTTCCAGAAAA	0.478													8	32	---	---	---	---	PASS
IL12RB2	3595	broad.mit.edu	37	1	67804309	67804309	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:67804309C>T	uc001ddu.2	+	8	1601	c.961C>T	c.(961-963)CCT>TCT	p.P321S	IL12RB2_uc010oqi.1_Missense_Mutation_p.P321S|IL12RB2_uc010oqj.1_Missense_Mutation_p.P321S|IL12RB2_uc010oqk.1_RNA|IL12RB2_uc010oql.1_Missense_Mutation_p.P321S|IL12RB2_uc010oqm.1_Missense_Mutation_p.P321S|IL12RB2_uc010oqn.1_RNA	NM_001559	NP_001550	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2 precursor	321	Fibronectin type-III 3.|Extracellular (Potential).				positive regulation of cell proliferation|positive regulation of interferon-gamma production	integral to plasma membrane	cytokine receptor activity			ovary(2)|central_nervous_system(1)	3						TGAAACAGAGCCTACTGGGAT	0.348													31	83	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75037023	75037023	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75037023T>A	uc001dgg.2	-	14	4590	c.4371A>T	c.(4369-4371)GCA>GCT	p.A1457A		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	1457	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						TCCCAGTGGCTGCCTCCTGGC	0.592													47	129	---	---	---	---	PASS
C1orf173	127254	broad.mit.edu	37	1	75038490	75038490	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:75038490G>A	uc001dgg.2	-	14	3123	c.2904C>T	c.(2902-2904)GAC>GAT	p.D968D		NM_001002912	NP_001002912	Q5RHP9	CA173_HUMAN	hypothetical protein LOC127254	968	Glu-rich.									ovary(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	5						CTTCAGAACCGTCCTCTCTCT	0.522													50	117	---	---	---	---	PASS
ZNHIT6	54680	broad.mit.edu	37	1	86142970	86142970	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86142970G>A	uc001dlh.2	-	8	1330	c.1196C>T	c.(1195-1197)ACT>ATT	p.T399I	ZNHIT6_uc010osc.1_Missense_Mutation_p.T360I	NM_017953	NP_060423	Q9NWK9	BCD1_HUMAN	zinc finger, HIT type 6	399					box C/D snoRNP assembly|ribosome biogenesis	pre-snoRNP complex	identical protein binding|metal ion binding			large_intestine(1)	1						CTGAACCCCAGTCTGAGAGCG	0.313													31	89	---	---	---	---	PASS
BARHL2	343472	broad.mit.edu	37	1	91177965	91177965	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91177965C>A	uc001dns.2	-	3	1110	c.1068G>T	c.(1066-1068)CTG>CTT	p.L356L		NM_020063	NP_064447	Q9NY43	BARH2_HUMAN	BarH-like homeobox 2	356						nucleus	sequence-specific DNA binding			ovary(1)	1		all_lung(203;0.0263)|Lung SC(238;0.128)		all cancers(265;0.000897)|Epithelial(280;0.00516)|OV - Ovarian serous cystadenocarcinoma(397;0.211)		CACGGGGCACCAGGGGCCGCT	0.677													8	21	---	---	---	---	PASS
TGFBR3	7049	broad.mit.edu	37	1	92182160	92182160	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92182160C>T	uc001doh.2	-	11	2138	c.1672G>A	c.(1672-1674)GAT>AAT	p.D558N	TGFBR3_uc009wde.2_Missense_Mutation_p.D335N|TGFBR3_uc010osy.1_Missense_Mutation_p.D516N|TGFBR3_uc001doi.2_Missense_Mutation_p.D557N|TGFBR3_uc001doj.2_Missense_Mutation_p.D557N	NM_003243	NP_003234	Q03167	TGBR3_HUMAN	transforming growth factor, beta receptor III	558	ZP.|Extracellular (Potential).				BMP signaling pathway|cardiac epithelial to mesenchymal transition|cardiac muscle cell proliferation|cell growth|cell migration|definitive erythrocyte differentiation|heart trabecula formation|immune response|intracellular protein kinase cascade|liver development|negative regulation of cellular component movement|negative regulation of epithelial cell proliferation|palate development|pathway-restricted SMAD protein phosphorylation|response to follicle-stimulating hormone stimulus|response to luteinizing hormone stimulus|response to prostaglandin E stimulus|transforming growth factor beta receptor signaling pathway|ventricular cardiac muscle tissue morphogenesis	external side of plasma membrane|extracellular space|inhibin-betaglycan-ActRII complex|integral to plasma membrane|intracellular membrane-bounded organelle	coreceptor activity|heparin binding|PDZ domain binding|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type III|type II transforming growth factor beta receptor binding			ovary(3)	3		all_lung(203;0.00719)|Lung NSC(277;0.0268)		all cancers(265;0.0108)|Epithelial(280;0.0825)		AGGGAAGCATCTCCTTCATCC	0.468													102	281	---	---	---	---	PASS
HSD3B2	3284	broad.mit.edu	37	1	119962145	119962145	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:119962145T>C	uc001ehs.2	+	2	1020	c.247T>C	c.(247-249)TGT>CGT	p.C83R	HSD3B2_uc001eht.2_Missense_Mutation_p.C83R|HSD3B2_uc001ehu.2_Missense_Mutation_p.C83R	NM_000198	NP_000189	P26439	3BHS2_HUMAN	3 beta-hydroxysteroid dehydrogenase 2	83					androgen biosynthetic process|glucocorticoid biosynthetic process|mineralocorticoid biosynthetic process	integral to membrane|microsome|mitochondrial inner membrane|mitochondrial intermembrane space|smooth endoplasmic reticulum membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding|steroid delta-isomerase activity			ovary(2)	2	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	NADH(DB00157)|Trilostane(DB01108)	CCACACCGCCTGTATCATTGA	0.478													12	22	---	---	---	---	PASS
ZBTB7B	51043	broad.mit.edu	37	1	154988739	154988739	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154988739C>T	uc001fgk.3	+	4	1356	c.1198C>T	c.(1198-1200)CGC>TGC	p.R400C	ZBTB7B_uc009wpa.2_Missense_Mutation_p.R400C|ZBTB7B_uc001fgj.3_Missense_Mutation_p.R434C|ZBTB7B_uc010peq.1_Missense_Mutation_p.R434C|ZBTB7B_uc001fgl.3_Missense_Mutation_p.R400C	NM_015872	NP_056956	O15156	ZBT7B_HUMAN	zinc finger and BTB domain containing 7B	400					cell differentiation|ectoderm development|multicellular organismal development|regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	DNA binding|zinc ion binding				0	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CACGGGAGAGCGCCCCTACTC	0.632													22	192	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155205560	155205560	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155205560G>A	uc001fjh.2	-	9	1450	c.1300C>T	c.(1300-1302)CGT>TGT	p.R434C	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Missense_Mutation_p.R321C|GBA_uc010pfx.1_Missense_Mutation_p.R385C|GBA_uc001fji.2_Missense_Mutation_p.R434C|GBA_uc001fjj.2_Missense_Mutation_p.R434C|GBA_uc001fjk.2_Missense_Mutation_p.R434C|GBA_uc001fjl.2_Missense_Mutation_p.R434C|GBA_uc010pfy.1_Missense_Mutation_p.R347C	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	434					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	ACAAAGTTACGCACCCAATTG	0.532									Gaucher_disease_type_I				10	66	---	---	---	---	PASS
CD1D	912	broad.mit.edu	37	1	158151294	158151294	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158151294C>T	uc001frr.2	+	3	610	c.111C>T	c.(109-111)GCC>GCT	p.A37A	CD1D_uc009wsr.1_Silent_p.A37A|CD1D_uc009wss.2_Silent_p.A37A|CD1D_uc009wst.1_5'UTR	NM_001766	NP_001757	P15813	CD1D_HUMAN	CD1D antigen precursor	37	Extracellular (Potential).				antigen processing and presentation, endogenous lipid antigen via MHC class Ib|detection of bacterium|innate immune response|interspecies interaction between organisms|positive regulation of innate immune response|T cell selection	endosome membrane|integral to plasma membrane|lysosomal membrane	beta-2-microglobulin binding|exogenous lipid antigen binding|histone binding			ovary(1)	1	all_hematologic(112;0.0378)					CGTCCTTCGCCAATAGCAGCT	0.632													54	514	---	---	---	---	PASS
OR10T2	128360	broad.mit.edu	37	1	158368351	158368351	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158368351T>A	uc010pih.1	-	1	906	c.906A>T	c.(904-906)AAA>AAT	p.K302N		NM_001004475	NP_001004475	Q8NGX3	O10T2_HUMAN	olfactory receptor, family 10, subfamily T,	302	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)	3	all_hematologic(112;0.0378)					CAAGAACTCTTTTCAATGCAG	0.368													29	34	---	---	---	---	PASS
OR10R2	343406	broad.mit.edu	37	1	158450191	158450191	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158450191C>A	uc010pik.1	+	1	524	c.524C>A	c.(523-525)GCC>GAC	p.A175D	uc001fso.1_RNA	NM_001004472	NP_001004472	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R,	175	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(2)|skin(1)	3	all_hematologic(112;0.0378)					GGCTTCTTGGCCTCTCTTACA	0.473													20	252	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160264286	160264286	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160264286G>A	uc009wti.2	-	25	3058	c.2664C>T	c.(2662-2664)CTC>CTT	p.L888L	COPA_uc001fvv.3_Silent_p.L897L	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	888					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCTCAGGAGGGAGCTCCAGAT	0.527													92	77	---	---	---	---	PASS
COPA	1314	broad.mit.edu	37	1	160264287	160264287	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160264287A>G	uc009wti.2	-	25	3057	c.2663T>C	c.(2662-2664)CTC>CCC	p.L888P	COPA_uc001fvv.3_Missense_Mutation_p.L897P	NM_004371	NP_004362	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha isoform	888					COPI coating of Golgi vesicle|intracellular protein transport|pancreatic juice secretion|retrograde vesicle-mediated transport, Golgi to ER	COPI vesicle coat|cytosol|extracellular space|microsome|soluble fraction	hormone activity|structural molecule activity			ovary(1)|skin(1)	2	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCAGGAGGGAGCTCCAGATC	0.522													94	77	---	---	---	---	PASS
F11R	50848	broad.mit.edu	37	1	160970099	160970099	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160970099G>A	uc009wtt.2	-	5	698	c.428C>T	c.(427-429)GCC>GTC	p.A143V	F11R_uc010pjv.1_Missense_Mutation_p.A94V|F11R_uc001fxe.3_Missense_Mutation_p.A143V|F11R_uc009wtu.2_Missense_Mutation_p.A143V|F11R_uc010pjw.1_Missense_Mutation_p.A147V|F11R_uc001fxf.3_Missense_Mutation_p.A143V	NM_016946	NP_058642	Q9Y624	JAM1_HUMAN	F11 receptor precursor	143	Ig-like V-type 2.|Extracellular (Potential).				blood coagulation|inflammatory response|interspecies interaction between organisms|leukocyte migration|tight junction assembly	integral to membrane|tight junction				ovary(2)	2	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			CCCAATGGTGGCAGAGGAGGG	0.512													10	153	---	---	---	---	PASS
SELL	6402	broad.mit.edu	37	1	169670785	169670785	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169670785G>T	uc001ggk.2	-	7	1195	c.997C>A	c.(997-999)CCC>ACC	p.P333T	C1orf112_uc001ggj.2_Intron|SELL_uc010pls.1_Missense_Mutation_p.P286T|SELL_uc001ggl.1_Missense_Mutation_p.P346T	NM_000655	NP_000646	P14151	LYAM1_HUMAN	selectin L precursor	333	Helical; (Potential).				blood coagulation|cell adhesion|leukocyte migration|regulation of immune response	integral to plasma membrane	glycosphingolipid binding|heparin binding|protease binding|sugar binding				0	all_hematologic(923;0.208)					ATGAAGAGGGGGTTATAATCA	0.398													4	11	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169985706	169985706	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169985706C>T	uc001ggv.2	-	10	1351	c.1080G>A	c.(1078-1080)CTG>CTA	p.L360L	KIFAP3_uc010plx.1_Silent_p.L62L	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	360	ARM 1.				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGATATTCAGCAGGTCTTCAT	0.398													41	172	---	---	---	---	PASS
FMO3	2328	broad.mit.edu	37	1	171073021	171073021	+	Silent	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171073021T>C	uc001ghi.2	+	3	339	c.228T>C	c.(226-228)GAT>GAC	p.D76D	FMO3_uc001ghh.2_Silent_p.D76D|FMO3_uc010pmb.1_Silent_p.D56D|FMO3_uc010pmc.1_Intron|MIR1295_hsa-mir-1295|MI0006357_5'Flank	NM_001002294	NP_001002294	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	76					xenobiotic metabolic process	integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CATTTCCCGATGACTTCCCCA	0.423													52	175	---	---	---	---	PASS
TNFSF18	8995	broad.mit.edu	37	1	173019911	173019911	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:173019911A>T	uc001giu.2	-	1	193	c.192T>A	c.(190-192)AGT>AGA	p.S64R		NM_005092	NP_005083	Q9UNG2	TNF18_HUMAN	tumor necrosis factor (ligand) superfamily,	64	Helical; Signal-anchor for type II membrane protein; (Potential).				anti-apoptosis|cell-cell signaling|immune response|signal transduction	extracellular space|integral to membrane	cytokine activity|tumor necrosis factor receptor binding			central_nervous_system(1)	1						AGATTAGCCAACTGAAGGAGC	0.363													22	8	---	---	---	---	PASS
GPR52	9293	broad.mit.edu	37	1	174417424	174417424	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:174417424C>T	uc001gka.1	+	1	213	c.175C>T	c.(175-177)CTA>TTA	p.L59L	RABGAP1L_uc001gjw.2_Intron|RABGAP1L_uc001gjx.2_Intron|RABGAP1L_uc001gjy.2_Intron|RABGAP1L_uc001gjz.2_Intron	NM_005684	NP_005675	Q9Y2T5	GPR52_HUMAN	G protein-coupled receptor 52	59	Helical; Name=1; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			skin(1)	1						TGCTGGGAATCTAACAGTTAT	0.428													18	263	---	---	---	---	PASS
SEC16B	89866	broad.mit.edu	37	1	177913779	177913779	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177913779T>C	uc001gli.1	-	15	1888	c.1798A>G	c.(1798-1800)ACA>GCA	p.T600A	SEC16B_uc001glk.1_Missense_Mutation_p.T277A|SEC16B_uc009wwy.1_Missense_Mutation_p.T155A|SEC16B_uc001glh.1_Missense_Mutation_p.T259A|SEC16B_uc009wwz.1_Missense_Mutation_p.T259A|SEC16B_uc001glj.1_Missense_Mutation_p.T601A	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	600					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						GCCTCAGTTGTTGCAAATTTC	0.463													44	114	---	---	---	---	PASS
GLUL	2752	broad.mit.edu	37	1	182355396	182355396	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182355396G>A	uc001gpa.1	-	4	682	c.470C>T	c.(469-471)CCC>CTC	p.P157L	GLUL_uc010pnt.1_5'Flank|GLUL_uc001gpb.1_Missense_Mutation_p.P157L|GLUL_uc001gpc.1_Missense_Mutation_p.P157L|GLUL_uc001gpd.1_Missense_Mutation_p.P157L	NM_001033056	NP_001028228	P15104	GLNA_HUMAN	glutamine synthetase	157					cell proliferation|glutamine biosynthetic process|neurotransmitter uptake	cytosol|Golgi apparatus|mitochondrion	ATP binding|glutamate decarboxylase activity|glutamate-ammonia ligase activity|identical protein binding				0					Asparaginase(DB00023)|L-Glutamic Acid(DB00142)|L-Glutamine(DB00130)|L-Methionine(DB00134)	CTTACCCTGGGGCCCTGGGAA	0.552													64	122	---	---	---	---	PASS
EDEM3	80267	broad.mit.edu	37	1	184663433	184663433	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:184663433C>T	uc010pok.1	-	20	2824	c.2563G>A	c.(2563-2565)GCT>ACT	p.A855T	EDEM3_uc010pol.1_RNA|EDEM3_uc010pom.1_Missense_Mutation_p.A871T	NM_025191	NP_079467	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like	855					post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine|response to unfolded protein	endoplasmic reticulum lumen|endoplasmic reticulum membrane	calcium ion binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity|misfolded protein binding			skin(1)	1						ATGCTTGCAGCATTGTCCATA	0.383													18	61	---	---	---	---	PASS
FAM5C	339479	broad.mit.edu	37	1	190068169	190068169	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:190068169G>T	uc001gse.1	-	8	1512	c.1280C>A	c.(1279-1281)ACG>AAG	p.T427K	FAM5C_uc010pot.1_Missense_Mutation_p.T325K	NM_199051	NP_950252	Q76B58	FAM5C_HUMAN	family with sequence similarity 5, member C	427						extracellular region				lung(2)|ovary(1)|kidney(1)|skin(1)	5	Prostate(682;0.198)					ATTCGGACACGTGCACGAGTG	0.582													11	43	---	---	---	---	PASS
SHISA4	149345	broad.mit.edu	37	1	201860556	201860556	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201860556C>T	uc001gxa.2	+	4	498	c.407C>T	c.(406-408)CCA>CTA	p.P136L		NM_198149	NP_937792	Q96DD7	SHSA4_HUMAN	shisa homolog 4 precursor	136	Cytoplasmic (Potential).|Pro-rich.					integral to membrane					0						ACAGGCATCCCAGTGCAGCCA	0.577													22	88	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216138713	216138713	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216138713T>A	uc001hku.1	-	37	7453	c.7066A>T	c.(7066-7068)AAT>TAT	p.N2356Y		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	2356	Extracellular (Potential).|Fibronectin type-III 10.				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGAGTCCATTAGGGCGAAAA	0.403										HNSCC(13;0.011)			66	130	---	---	---	---	PASS
USH2A	7399	broad.mit.edu	37	1	216258076	216258076	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:216258076C>T	uc001hku.1	-	25	5518	c.5131G>A	c.(5131-5133)GCT>ACT	p.A1711T		NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B	1711	Extracellular (Potential).				maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TTTAATGAAGCGGGACATCCC	0.388										HNSCC(13;0.011)			23	116	---	---	---	---	PASS
RAB3GAP2	25782	broad.mit.edu	37	1	220366599	220366599	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:220366599G>A	uc010puk.1	-	13	1417	c.1253C>T	c.(1252-1254)GCA>GTA	p.A418V	RAB3GAP2_uc001hmf.2_RNA|RAB3GAP2_uc001hmg.2_5'UTR	NM_012414	NP_036546	Q9H2M9	RBGPR_HUMAN	rab3 GTPase-activating protein, non-catalytic	418					intracellular protein transport	cytoplasm|soluble fraction	GTPase activator activity|protein heterodimerization activity			central_nervous_system(1)	1				GBM - Glioblastoma multiforme(131;0.0443)		CATGCGTATTGCAATTCCTCT	0.388													13	60	---	---	---	---	PASS
AIDA	64853	broad.mit.edu	37	1	222885580	222885580	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:222885580T>C	uc001hnn.2	-	1	285	c.80A>G	c.(79-81)CAG>CGG	p.Q27R	AIDA_uc001hno.2_RNA|AIDA_uc010pus.1_Intron|C1orf58_uc001hnp.1_5'Flank|C1orf58_uc001hnq.1_5'Flank|C1orf58_uc010put.1_5'Flank|C1orf58_uc010puu.1_5'Flank|C1orf58_uc010puv.1_5'Flank	NM_022831	NP_073742	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	27	Potential.				dorsal/ventral pattern formation|negative regulation of JNK cascade|negative regulation of JUN kinase activity|regulation of protein homodimerization activity						0						CTCCACCAGCTGGCCCCAAGA	0.652													3	9	---	---	---	---	PASS
LBR	3930	broad.mit.edu	37	1	225598073	225598073	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:225598073C>A	uc001hoy.2	-	10	1377	c.1234G>T	c.(1234-1236)GAC>TAC	p.D412Y	LBR_uc001hoz.2_Missense_Mutation_p.D412Y|LBR_uc001hpa.1_Missense_Mutation_p.D412Y	NM_002296	NP_002287	Q14739	LBR_HUMAN	lamin B receptor	412					cholesterol biosynthetic process	integral to nuclear inner membrane	chromo shadow domain binding|delta14-sterol reductase activity|DNA binding|lamin binding|receptor activity			ovary(1)|skin(1)	2	Breast(184;0.165)			GBM - Glioblastoma multiforme(131;0.117)		ACAGCGCGGTCCTGTATTTTC	0.338													20	136	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228494796	228494796	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228494796G>C	uc009xez.1	+	45	12165	c.12121G>C	c.(12121-12123)GAG>CAG	p.E4041Q	OBSCN_uc001hsn.2_Missense_Mutation_p.E4041Q	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	4041	Ig-like 41.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				ACGCGGAGTGGAGCAGGAGGA	0.642													20	35	---	---	---	---	PASS
SIPA1L2	57568	broad.mit.edu	37	1	232564213	232564213	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:232564213C>G	uc001hvg.2	-	15	4512	c.4354G>C	c.(4354-4356)GAT>CAT	p.D1452H	SIPA1L2_uc001hvf.2_Missense_Mutation_p.D526H	NM_020808	NP_065859	Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like	1452					regulation of small GTPase mediated signal transduction	intracellular	GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)|skin(1)	6		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				TTCAGAAAATCTTCTTTAGAC	0.448													27	70	---	---	---	---	PASS
RGS7	6000	broad.mit.edu	37	1	240979609	240979609	+	Intron	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240979609T>G	uc001hyv.2	-						RGS7_uc010pyh.1_Intron|RGS7_uc010pyj.1_Intron|RGS7_uc001hyu.2_Intron|RGS7_uc009xgn.1_Intron|RGS7_uc001hyw.2_Intron|RGS7_uc001hyt.2_Intron	NM_002924	NP_002915	P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor protein signaling pathway|intracellular signal transduction|negative regulation of signal transduction|regulation of G-protein coupled receptor protein signaling pathway	cytoplasm|heterotrimeric G-protein complex	GTPase activator activity|protein binding|signal transducer activity			ovary(4)|skin(2)|kidney(1)	7		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TCTCATAGGTTGACTCACCTG	0.373													23	152	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769289	247769289	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769289C>A	uc010pyz.1	+	1	402	c.402C>A	c.(400-402)GTC>GTA	p.V134V		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	134	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			ACTATGTAGTCATCATGAACC	0.493													35	163	---	---	---	---	PASS
OR2G3	81469	broad.mit.edu	37	1	247769804	247769804	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247769804C>A	uc010pyz.1	+	1	917	c.917C>A	c.(916-918)TCG>TAG	p.S306*		NM_001001914	NP_001001914	Q8NGZ4	OR2G3_HUMAN	olfactory receptor, family 2, subfamily G,	306	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			AAACTTCTCTCGGGAAAATTG	0.373													49	73	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	247902231	247902231	+	IGR	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247902231G>T								OR6F1 (26174 upstream) : OR1C1 (18535 downstream)																							TGGTACTGCTGGCTGGATCAG	0.552													16	96	---	---	---	---	PASS
OR2M3	127062	broad.mit.edu	37	1	248367217	248367217	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248367217C>T	uc010pzg.1	+	1	848	c.848C>T	c.(847-849)CCC>CTC	p.P283L		NM_001004689	NP_001004689	Q8NG83	OR2M3_HUMAN	olfactory receptor, family 2, subfamily M,	283	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			ATCCTCACTCCCATGTTGAAT	0.483													40	90	---	---	---	---	PASS
APOB	338	broad.mit.edu	37	2	21228378	21228378	+	Missense_Mutation	SNP	C	T	T	rs13306191		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21228378C>T	uc002red.2	-	26	11490	c.11362G>A	c.(11362-11364)GAG>AAG	p.E3788K		NM_000384	NP_000375	P04114	APOB_HUMAN	apolipoprotein B precursor	3788					cholesterol homeostasis|cholesterol metabolic process|leukocyte migration|low-density lipoprotein particle clearance|low-density lipoprotein particle remodeling|platelet activation|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis|response to virus	chylomicron remnant|clathrin-coated endocytic vesicle membrane|endoplasmic reticulum lumen|endoplasmic reticulum membrane|endosome lumen|endosome membrane|intermediate-density lipoprotein particle|low-density lipoprotein particle|mature chylomicron|microsome|plasma membrane|very-low-density lipoprotein particle	cholesterol transporter activity|enzyme binding|heparin binding|low-density lipoprotein particle receptor binding|phospholipid binding|protein heterodimerization activity			ovary(11)|skin(9)|central_nervous_system(3)|large_intestine(2)|upper_aerodigestive_tract(1)|pancreas(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Atorvastatin(DB01076)	AATTTTACCTCGGGGAGTGTT	0.398													52	174	---	---	---	---	PASS
MFSD2B	388931	broad.mit.edu	37	2	24239810	24239810	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24239810T>A	uc002reo.1	+	4	457	c.443T>A	c.(442-444)TTC>TAC	p.F148Y	MFSD2B_uc010exz.1_RNA	NM_001080473	NP_001073942	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing	148					transport	integral to membrane				ovary(2)	2						TACACGACTTTCTACTGCCTG	0.647													27	85	---	---	---	---	PASS
C2orf16	84226	broad.mit.edu	37	2	27804711	27804711	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27804711C>A	uc002rkz.3	+	1	5323	c.5272C>A	c.(5272-5274)CAT>AAT	p.H1758N	ZNF512_uc010ylv.1_5'Flank|ZNF512_uc010ylw.1_5'Flank|ZNF512_uc002rlb.2_5'Flank|ZNF512_uc010ylx.1_5'Flank|ZNF512_uc002rlc.2_5'Flank|ZNF512_uc002rla.2_5'Flank|ZNF512_uc010yly.1_5'Flank|ZNF512_uc010ylz.1_5'Flank	NM_032266	NP_115642	Q68DN1	CB016_HUMAN	hypothetical protein LOC84226	1758	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|16.|Arg-rich.									large_intestine(1)	1	Acute lymphoblastic leukemia(172;0.155)					TGAGAGAAGCCATTGCAGTCC	0.532													44	228	---	---	---	---	PASS
XDH	7498	broad.mit.edu	37	2	31565125	31565125	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:31565125C>A	uc002rnv.1	-	32	3522	c.3443G>T	c.(3442-3444)GGG>GTG	p.G1148V		NM_000379	NP_000370	P47989	XDH_HUMAN	xanthine dehydrogenase	1148					purine nucleotide catabolic process|xanthine catabolic process	cytosol|extracellular region|peroxisome	2 iron, 2 sulfur cluster binding|electron carrier activity|flavin adenine dinucleotide binding|iron ion binding|molybdopterin cofactor binding|protein homodimerization activity|xanthine dehydrogenase activity|xanthine oxidase activity			skin(4)|breast(2)|ovary(1)|central_nervous_system(1)	8	Acute lymphoblastic leukemia(172;0.155)				Allopurinol(DB00437)|Carvedilol(DB01136)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Desflurane(DB01189)|Menadione(DB00170)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|NADH(DB00157)|Nitrofurazone(DB00336)|Papaverine(DB01113)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Rasburicase(DB00049)|Spermine(DB00127)|Trifluoperazine(DB00831)|Vitamin E(DB00163)	GAAGGGGTTCCCTGAGTTAGT	0.463													57	143	---	---	---	---	PASS
ATL2	64225	broad.mit.edu	37	2	38604324	38604324	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:38604324T>G	uc002rqq.2	-	1	109	c.79A>C	c.(79-81)AGC>CGC	p.S27R	ATL2_uc010ynm.1_5'Flank|ATL2_uc010ynn.1_5'Flank|ATL2_uc010yno.1_5'Flank|ATL2_uc002rqs.2_Missense_Mutation_p.S27R|ATL2_uc002rqr.2_5'UTR	NM_001135673	NP_001129145	Q8NHH9	ATLA2_HUMAN	atlastin GTPase 2 isoform 2	27	Cytoplasmic.				endoplasmic reticulum organization|Golgi organization|protein homooligomerization	endoplasmic reticulum membrane|integral to membrane	GTP binding|GTPase activity|identical protein binding			ovary(1)|kidney(1)|skin(1)	3						ACCGCGGCGCTTGGGTCGCTG	0.682													14	30	---	---	---	---	PASS
MTA3	57504	broad.mit.edu	37	2	42936085	42936085	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:42936085A>G	uc002rso.1	+	15	1873	c.1203A>G	c.(1201-1203)CCA>CCG	p.P401P	MTA3_uc002rsp.1_Silent_p.P401P|MTA3_uc002rsq.2_Silent_p.P458P|MTA3_uc002rsr.2_Silent_p.P457P	NM_020744	NP_065795	Q9BTC8	MTA3_HUMAN	metastasis associated 1 family, member 3	458						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2						CTGGGAGTCCAAAGTCTGCAG	0.502													65	143	---	---	---	---	PASS
RHOQ	23433	broad.mit.edu	37	2	46803780	46803780	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46803780G>A	uc002rva.2	+	4	766	c.447G>A	c.(445-447)CAG>CAA	p.Q149Q	uc002rvb.2_Intron	NM_012249	NP_036381	P17081	RHOQ_HUMAN	ras-like protein TC10 precursor	149					cortical actin cytoskeleton organization|insulin receptor signaling pathway|negative regulation of establishment of protein localization in plasma membrane|positive regulation of filopodium assembly|positive regulation of glucose import|positive regulation of transcription from RNA polymerase II promoter|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	actin filament|cytosol|plasma membrane	GBD domain binding|GTP binding|GTPase activity|profilin binding			skin(2)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	LUSC - Lung squamous cell carcinoma(58;0.114)			AACAAGGACAGAAACTAGCAA	0.303													25	55	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915006	48915006	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915006A>C	uc002rwu.3	-	11	2000	c.1930T>G	c.(1930-1932)TGT>GGT	p.C644G	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	644	Cytoplasmic (Potential).			C->G: Loss of palmitoylation.	male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CGACGTTTACAGCAGCCAAAT	0.378									Familial_Male-Limited_Precocious_Puberty				61	143	---	---	---	---	PASS
LHCGR	3973	broad.mit.edu	37	2	48915786	48915786	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:48915786G>T	uc002rwu.3	-	11	1220	c.1150C>A	c.(1150-1152)CTC>ATC	p.L384I	GTF2A1L_uc002rwt.2_Intron	NM_000233	NP_000224	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	384	Helical; Name=1; (Potential).				male genitalia development|male gonad development	endosome|integral to plasma membrane	luteinizing hormone receptor activity			ovary(3)|lung(2)|breast(2)|skin(1)	8		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	CTTGTCAGGAGAACAAAAAGA	0.428									Familial_Male-Limited_Precocious_Puberty				37	75	---	---	---	---	PASS
PSME4	23198	broad.mit.edu	37	2	54112848	54112848	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54112848C>G	uc002rxp.2	-	41	4850	c.4794G>C	c.(4792-4794)CAG>CAC	p.Q1598H	PSME4_uc010yop.1_Missense_Mutation_p.Q1484H|PSME4_uc010yoq.1_RNA|PSME4_uc010fbu.1_Missense_Mutation_p.Q973H|PSME4_uc010fbv.1_Missense_Mutation_p.Q742H|PSME4_uc010fbt.1_Missense_Mutation_p.Q85H	NM_014614	NP_055429	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator	1598					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|M/G1 transition of mitotic cell cycle|mRNA metabolic process|multicellular organismal development|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|spermatogenesis|viral reproduction	nuclear speck|proteasome complex	binding			ovary(2)|breast(2)|pancreas(1)	5			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			AAGGTAGAAGCTGAAGTTGTT	0.368													22	53	---	---	---	---	PASS
BCL11A	53335	broad.mit.edu	37	2	60687991	60687991	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60687991A>C	uc002sae.1	-	4	2284	c.2056T>G	c.(2056-2058)TCC>GCC	p.S686A	BCL11A_uc002sab.2_Missense_Mutation_p.S686A|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Missense_Mutation_p.S355A|BCL11A_uc010ypj.1_Missense_Mutation_p.S652A|BCL11A_uc002sad.1_Missense_Mutation_p.S534A|BCL11A_uc002saf.1_Missense_Mutation_p.S652A	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1	686					negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TCCGACGAGGAGGCAAAAGGC	0.647			T	IGH@	B-CLL								33	144	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61633028	61633028	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61633028C>T	uc002sbe.2	-	3	389	c.367G>A	c.(367-369)GAA>AAA	p.E123K		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	123					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			GATTTTTTTTCTATTGATTTT	0.343													48	195	---	---	---	---	PASS
B3GNT2	10678	broad.mit.edu	37	2	62450499	62450499	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:62450499G>C	uc002sbs.2	+	2	1382	c.1144G>C	c.(1144-1146)GAG>CAG	p.E382Q		NM_006577	NP_006568	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal	382	Lumenal (Potential).					Golgi membrane|integral to membrane	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity			ovary(1)	1	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			AAAACCTCAAGAGATGATTGA	0.333													11	273	---	---	---	---	PASS
DYSF	8291	broad.mit.edu	37	2	71747932	71747932	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71747932C>T	uc002sie.2	+	11	1327	c.951C>T	c.(949-951)CTC>CTT	p.L317L	DYSF_uc010feg.2_Silent_p.L348L|DYSF_uc010feh.2_Silent_p.L317L|DYSF_uc002sig.3_Silent_p.L317L|DYSF_uc010yqx.1_RNA|DYSF_uc010fee.2_Silent_p.L317L|DYSF_uc010fef.2_Silent_p.L348L|DYSF_uc010fei.2_Silent_p.L348L|DYSF_uc010fek.2_Silent_p.L349L|DYSF_uc010fej.2_Silent_p.L318L|DYSF_uc010fel.2_Silent_p.L318L|DYSF_uc010feo.2_Silent_p.L349L|DYSF_uc010fem.2_Silent_p.L318L|DYSF_uc010fen.2_Silent_p.L349L|DYSF_uc002sif.2_Silent_p.L318L	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8	317	Cytoplasmic (Potential).					cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						ACGCCTATCTCAGGAAGTGGC	0.587													22	90	---	---	---	---	PASS
SPR	6697	broad.mit.edu	37	2	73118645	73118645	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73118645C>T	uc002sik.2	+	3	815	c.765C>T	c.(763-765)CAC>CAT	p.H255H		NM_003124	NP_003115	P35270	SPRE_HUMAN	sepiapterin reductase	255					nitric oxide biosynthetic process|tetrahydrobiopterin biosynthetic process	cytoplasm	aldo-keto reductase (NADP) activity|NADP binding|sepiapterin reductase activity			ovary(2)	2						CTGGAGCCCACGTGGACTTCT	0.527													17	49	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385532	79385532	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385532C>A	uc002sod.1	-	3	508	c.253G>T	c.(253-255)GGA>TGA	p.G85*	REG3A_uc002soe.1_Nonsense_Mutation_p.G85*|REG3A_uc002sof.1_Nonsense_Mutation_p.G85*	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	85	C-type lectin.				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						ACGAAGGATCCCTCAGCCCCA	0.572													27	82	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385579	79385579	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385579T>C	uc002sod.1	-	3	461	c.206A>G	c.(205-207)CAG>CGG	p.Q69R	REG3A_uc002soe.1_Missense_Mutation_p.Q69R|REG3A_uc002sof.1_Missense_Mutation_p.Q69R	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	69	C-type lectin.				acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						GGGCCGCTTCTGGCAGGCCAG	0.577													24	74	---	---	---	---	PASS
REG3A	5068	broad.mit.edu	37	2	79385871	79385871	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:79385871G>C	uc002sod.1	-	2	356	c.101C>G	c.(100-102)CCC>CGC	p.P34R	REG3A_uc002soe.1_Missense_Mutation_p.P34R|REG3A_uc002sof.1_Missense_Mutation_p.P34R	NM_138938	NP_620355	Q06141	REG3A_HUMAN	pancreatitis-associated protein precursor	34					acute-phase response|cell proliferation|heterophilic cell-cell adhesion|multicellular organismal development	cytoplasm|extracellular space|soluble fraction	sugar binding			skin(1)	1						CCGTGCAGAGGGCAGTTCCCT	0.547													8	37	---	---	---	---	PASS
THNSL2	55258	broad.mit.edu	37	2	88472876	88472876	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:88472876A>G	uc002ssz.3	+	2	360	c.207A>G	c.(205-207)CCA>CCG	p.P69P	THNSL2_uc002ssv.2_Intron|THNSL2_uc002ssw.3_Silent_p.P69P|THNSL2_uc002ssx.3_Silent_p.P37P|THNSL2_uc002sta.3_Intron|THNSL2_uc002ssy.3_Silent_p.P69P	NM_018271	NP_060741	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2	69					threonine biosynthetic process		threonine synthase activity			ovary(1)	1						AGCTCCTTCCAAAAGATGAAT	0.517													23	43	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89309744	89309744	+	RNA	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89309744G>C	uc010ytr.1	-	74		c.6603C>G			uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		GAAGGATGGAGACTGGGTCAA	0.453													25	246	---	---	---	---	PASS
TEKT4	150483	broad.mit.edu	37	2	95537339	95537339	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95537339G>T	uc002stw.1	+	1	108	c.15G>T	c.(13-15)GTG>GTT	p.V5V	uc002stv.1_Intron|TEKT4_uc010fhr.1_RNA	NM_144705	NP_653306	Q8WW24	TEKT4_HUMAN	tektin 4	5					cell projection organization|microtubule cytoskeleton organization	cilium axoneme|flagellar axoneme|microtubule				ovary(1)|breast(1)|skin(1)	3						CGCAGACAGTGCCGCCCTGCG	0.692													8	27	---	---	---	---	PASS
MRPS5	64969	broad.mit.edu	37	2	95770428	95770428	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:95770428C>A	uc002sub.2	-	7	938	c.720G>T	c.(718-720)TCG>TCT	p.S240S	MRPS5_uc002suc.2_Intron|MRPS5_uc010yud.1_Silent_p.S240S	NM_031902	NP_114108	P82675	RT05_HUMAN	mitochondrial ribosomal protein S5	240	S5 DRBM.				translation	mitochondrion|ribosome	protein binding|RNA binding|structural constituent of ribosome			ovary(2)|central_nervous_system(1)	3						AGACACGGATCGATTTCTTTC	0.478													17	66	---	---	---	---	PASS
FER1L5	90342	broad.mit.edu	37	2	97361286	97361286	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97361286C>A	uc010fia.2	+	34	3863	c.3863C>A	c.(3862-3864)TCC>TAC	p.S1288Y	FER1L5_uc002sws.3_Missense_Mutation_p.S6Y|FER1L5_uc010fib.1_RNA|FER1L5_uc002swt.3_Missense_Mutation_p.S6Y|FER1L5_uc010yus.1_Missense_Mutation_p.S6Y	NM_001113382	NP_001106853	A0AVI2	FR1L5_HUMAN	fer-1-like 5 isoform 2	1288						integral to membrane				ovary(1)	1						AAGGCGAGCTCCCCCCAGCTC	0.592													7	12	---	---	---	---	PASS
NPAS2	4862	broad.mit.edu	37	2	101581391	101581391	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:101581391A>C	uc002tap.1	+	9	1072	c.786A>C	c.(784-786)TTA>TTC	p.L262F	NPAS2_uc010yvt.1_Missense_Mutation_p.L327F	NM_002518	NP_002509	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	262	PAS 2.				central nervous system development|positive regulation of transcription from RNA polymerase II promoter|rhythmic process	transcription factor complex	DNA binding|Hsp90 protein binding|sequence-specific DNA binding transcription factor activity|signal transducer activity			ovary(3)|upper_aerodigestive_tract(1)	4						GGAAATTTTTATTTCTGGATC	0.403													24	81	---	---	---	---	PASS
IL1R1	3554	broad.mit.edu	37	2	102781466	102781466	+	Silent	SNP	A	G	G	rs144946641	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102781466A>G	uc002tbq.2	+	4	612	c.294A>G	c.(292-294)GTA>GTG	p.V98V	IL1R1_uc010fix.2_Silent_p.V98V|IL1R1_uc002tbp.2_Silent_p.V98V|IL1R1_uc002tbr.2_Silent_p.V98V	NM_000877	NP_000868	P14778	IL1R1_HUMAN	interleukin 1 receptor, type I precursor	98	Extracellular (Potential).|Ig-like C2-type 1.				innate immune response	integral to plasma membrane	interleukin-1, Type I, activating receptor activity|platelet-derived growth factor receptor binding			skin(1)	1					Anakinra(DB00026)	ATTGCGTGGTAAGGTAAGAGA	0.358													27	70	---	---	---	---	PASS
ANAPC1	64682	broad.mit.edu	37	2	112541942	112541942	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:112541942C>A	uc002thi.2	-	41	5200	c.4953G>T	c.(4951-4953)TTG>TTT	p.L1651F		NM_022662	NP_073153	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	1651					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell division|mitosis|mitotic cell cycle spindle assembly checkpoint|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein K11-linked ubiquitination	anaphase-promoting complex|cytosol|nucleoplasm				skin(2)	2						TAGGAGCCATCAATTCTTCTT	0.443													15	203	---	---	---	---	PASS
WDR33	55339	broad.mit.edu	37	2	128471306	128471306	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:128471306C>A	uc002tpg.1	-	18	3342	c.3159G>T	c.(3157-3159)CCG>CCT	p.P1053P		NM_018383	NP_060853	Q9C0J8	WDR33_HUMAN	WD repeat domain 33 isoform 1	1053					postreplication repair|spermatogenesis	collagen|nucleus	protein binding				0	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CAGGGGGAAACGGAGGCCCAG	0.652													62	148	---	---	---	---	PASS
GPR148	344561	broad.mit.edu	37	2	131487666	131487666	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:131487666C>T	uc002trv.1	+	1	944	c.942C>T	c.(940-942)GCC>GCT	p.A314A		NM_207364	NP_997247	Q8TDV2	GP148_HUMAN	G protein-coupled receptor 148	314	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			skin(1)	1	Colorectal(110;0.1)					TTCCCCGTGCCATGCTCACAT	0.587													34	63	---	---	---	---	PASS
ARHGAP15	55843	broad.mit.edu	37	2	143913212	143913212	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:143913212G>A	uc002tvm.3	+	2	304	c.153G>A	c.(151-153)AAG>AAA	p.K51K	ARHGAP15_uc010zbl.1_Silent_p.K51K	NM_018460	NP_060930	Q53QZ3	RHG15_HUMAN	ARHGAP15	51					regulation of cell shape|small GTPase mediated signal transduction	cytosol|membrane	protein binding|Rac GTPase activator activity			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(221;0.151)		ATGTCGGGAAGGTCACTGAAC	0.408													24	84	---	---	---	---	PASS
NR4A2	4929	broad.mit.edu	37	2	157182456	157182456	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:157182456T>G	uc002tyz.3	-	8	2019	c.1597A>C	c.(1597-1599)AAT>CAT	p.N533H	NR4A2_uc002tyx.3_Missense_Mutation_p.N470H|NR4A2_uc010zcf.1_Missense_Mutation_p.N533H	NM_006186	NP_006177	P43354	NR4A2_HUMAN	nuclear receptor subfamily 4, group A, member 2	533					cellular response to extracellular stimulus|dopaminergic neuron differentiation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to protein stimulus	nucleoplasm	sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(3)	3						TTGAGACAATTTACAATCTTG	0.438													26	63	---	---	---	---	PASS
BAZ2B	29994	broad.mit.edu	37	2	160335124	160335124	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160335124G>C	uc002uao.2	-	3	459	c.107C>G	c.(106-108)ACT>AGT	p.T36S	BAZ2B_uc002uap.2_Missense_Mutation_p.T36S|BAZ2B_uc002uas.1_Missense_Mutation_p.T36S|BAZ2B_uc002uau.1_Missense_Mutation_p.T36S|BAZ2B_uc002uat.3_Missense_Mutation_p.T36S|BAZ2B_uc010fop.1_Missense_Mutation_p.T36S	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	36					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						AGCAACTCCAGTGGAAAGGCC	0.403													7	171	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163369169	163369169	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163369169A>T	uc002uch.1	-	5	1120	c.908T>A	c.(907-909)GTC>GAC	p.V303D	KCNH7_uc002uci.2_Intron	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	303	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	ATTACCTTTGACATTGCGACC	0.348													20	89	---	---	---	---	PASS
KCNH7	90134	broad.mit.edu	37	2	163693138	163693138	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:163693138G>A	uc002uch.1	-	2	428	c.216C>T	c.(214-216)CCC>CCT	p.P72P	KCNH7_uc002uci.2_Silent_p.P72P	NM_033272	NP_150375	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H,	72	Cytoplasmic (Potential).				regulation of transcription, DNA-dependent	integral to membrane	protein binding|signal transducer activity			ovary(3)|skin(2)	5					Ibutilide(DB00308)	TCTTGGTCTCGGGTCCATGGA	0.483													22	70	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168105878	168105878	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168105878T>G	uc002udx.2	+	8	7994	c.7976T>G	c.(7975-7977)GTT>GGT	p.V2659G	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.V2484G|XIRP2_uc010fpq.2_Missense_Mutation_p.V2437G|XIRP2_uc010fpr.2_Intron|XIRP2_uc010fps.1_Missense_Mutation_p.V5G	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2484					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						AAAAAGGAAGTTTTACAAAGC	0.403													6	110	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168107114	168107114	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168107114A>G	uc002udx.2	+	8	9230	c.9212A>G	c.(9211-9213)GAA>GGA	p.E3071G	XIRP2_uc010fpn.2_Intron|XIRP2_uc010fpo.2_Intron|XIRP2_uc010fpp.2_Intron|XIRP2_uc002udy.2_Missense_Mutation_p.E2896G|XIRP2_uc010fpq.2_Missense_Mutation_p.E2849G|XIRP2_uc010fpr.2_Intron	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1	2896					actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GAACAGAAAGAAAATAAAATT	0.353													27	86	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114392	168114392	+	3'UTR	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114392G>T	uc002udx.2	+	10					XIRP2_uc010fpn.2_Nonsense_Mutation_p.G479*|XIRP2_uc010fpo.2_Nonsense_Mutation_p.G446*|XIRP2_uc010fpp.2_Nonsense_Mutation_p.G446*|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Nonsense_Mutation_p.G224*	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						ATCACTTCATGGACAAATATA	0.328													14	69	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114393	168114393	+	3'UTR	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114393G>T	uc002udx.2	+	10					XIRP2_uc010fpn.2_Missense_Mutation_p.G479V|XIRP2_uc010fpo.2_Missense_Mutation_p.G446V|XIRP2_uc010fpp.2_Missense_Mutation_p.G446V|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Missense_Mutation_p.G224V	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						TCACTTCATGGACAAATATAC	0.328													14	69	---	---	---	---	PASS
XIRP2	129446	broad.mit.edu	37	2	168114796	168114796	+	3'UTR	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:168114796G>T	uc002udx.2	+	10					XIRP2_uc010fpn.2_Silent_p.L613L|XIRP2_uc010fpo.2_Silent_p.L580L|XIRP2_uc010fpp.2_Silent_p.L580L|XIRP2_uc010fpq.2_3'UTR|XIRP2_uc010fpr.2_Silent_p.L358L	NM_152381	NP_689594	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2 isoform 1						actin cytoskeleton organization	cell junction	actin binding			skin(7)|ovary(6)|pancreas(1)	14						GTGAATCTCTGCTAGAAGATG	0.403													30	88	---	---	---	---	PASS
SP5	389058	broad.mit.edu	37	2	171573769	171573769	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:171573769C>A	uc002uge.2	+	2	1218	c.1052C>A	c.(1051-1053)ACG>AAG	p.T351K		NM_001003845	NP_001003845	Q6BEB4	SP5_HUMAN	Sp5 transcription factor	351					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0						CGGACTCACACGGGCGAGAAG	0.632													12	29	---	---	---	---	PASS
HOXD10	3236	broad.mit.edu	37	2	176983792	176983792	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:176983792T>A	uc002ukj.2	+	2	926	c.856T>A	c.(856-858)TTG>ATG	p.L286M		NM_002148	NP_002139	P28358	HXD10_HUMAN	homeobox D10	286	Homeobox.					nucleus	sequence-specific DNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.18)	Colorectal(32;0.0226)|READ - Rectum adenocarcinoma(9;0.0556)		AAAAGAGTTCTTGTTCAATAT	0.483													52	117	---	---	---	---	PASS
HOXD3	3232	broad.mit.edu	37	2	177036654	177036654	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:177036654G>T	uc002ukt.1	+	3	1127	c.951G>T	c.(949-951)GCG>GCT	p.A317A		NM_006898	NP_008829	P31249	HXD3_HUMAN	homeobox D3	317					anterior/posterior pattern formation|cartilage development|cell-matrix adhesion|embryonic skeletal system morphogenesis|Notch signaling pathway|positive regulation of gene expression|positive regulation of neuron differentiation|thyroid gland development		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0			OV - Ovarian serous cystadenocarcinoma(117;0.00569)|Epithelial(96;0.0864)|all cancers(119;0.226)	Colorectal(32;0.247)		CCTACACGGCGCCACTCAGCA	0.692													9	17	---	---	---	---	PASS
NFE2L2	4780	broad.mit.edu	37	2	178098803	178098803	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:178098803C>A	uc002ulh.3	-	2	797	c.242G>T	c.(241-243)GGT>GTT	p.G81V	NFE2L2_uc002ulg.3_Missense_Mutation_p.G65V|NFE2L2_uc010zfa.1_Missense_Mutation_p.G65V|NFE2L2_uc002uli.3_Missense_Mutation_p.G65V|NFE2L2_uc010fra.2_Missense_Mutation_p.G65V|NFE2L2_uc010frb.2_Missense_Mutation_p.G65V	NM_006164	NP_006155	Q16236	NF2L2_HUMAN	nuclear factor erythroid 2-like 2 isoform 1	81					transcription from RNA polymerase II promoter	centrosome|cytosol|nucleus|plasma membrane	protein dimerization activity|protein domain specific binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			central_nervous_system(1)	1			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			GAGAAATTCACCTGTCTCTTC	0.433			Mis		NSCLC|HNSCC					HNSCC(56;0.16)			45	80	---	---	---	---	PASS
OSBPL6	114880	broad.mit.edu	37	2	179253830	179253830	+	Missense_Mutation	SNP	A	T	T	rs150809294		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179253830A>T	uc002ulx.2	+	21	2629	c.2251A>T	c.(2251-2253)ATC>TTC	p.I751F	OSBPL6_uc002uly.2_Missense_Mutation_p.I776F|OSBPL6_uc010zfe.1_Missense_Mutation_p.I720F|OSBPL6_uc002ulz.2_Missense_Mutation_p.I715F|OSBPL6_uc002uma.2_Missense_Mutation_p.I755F	NM_032523	NP_115912	Q9BZF3	OSBL6_HUMAN	oxysterol-binding protein-like protein 6 isoform	751					lipid transport		lipid binding			pancreas(1)	1			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AGAAGTAACCATCAGAAATAC	0.358													31	71	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179615909	179615909	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179615909C>G	uc002unb.2	-	46	11442	c.11218G>C	c.(11218-11220)GAT>CAT	p.D3740H	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	9588							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACAGAATATCTTTATCACTA	0.343													38	89	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179616722	179616722	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179616722G>T	uc002unb.2	-	46	10629	c.10405C>A	c.(10405-10407)CGT>AGT	p.R3469S	TTN_uc010zfg.1_Intron|TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Intron	NM_133379	NP_596870	Q8WZ42	TITIN_HUMAN	titin isoform novex-3	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGGCGTCACGTGTATCCCTT	0.353													98	306	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179623731	179623731	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179623731G>A	uc010zfg.1	-	44	10507	c.10283C>T	c.(10282-10284)ACA>ATA	p.T3428I	TTN_uc010zfh.1_Missense_Mutation_p.T3382I|TTN_uc010zfi.1_Missense_Mutation_p.T3382I|TTN_uc010zfj.1_Missense_Mutation_p.T3382I|TTN_uc002umz.1_Missense_Mutation_p.T89I|TTN_uc002unb.2_Missense_Mutation_p.T3428I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGTTGGCTGTGCTTGATAC	0.378													45	96	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179636016	179636016	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179636016C>A	uc010zfg.1	-	34	8262	c.8038G>T	c.(8038-8040)GCC>TCC	p.A2680S	TTN_uc010zfh.1_Missense_Mutation_p.A2634S|TTN_uc010zfi.1_Missense_Mutation_p.A2634S|TTN_uc010zfj.1_Missense_Mutation_p.A2634S|TTN_uc002unb.2_Missense_Mutation_p.A2680S	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	2680							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTTGGTGGCAGCAATGATA	0.438													23	76	---	---	---	---	PASS
ZNF385B	151126	broad.mit.edu	37	2	180309691	180309691	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:180309691C>T	uc002unn.3	-	9	1713	c.1109G>A	c.(1108-1110)CGA>CAA	p.R370Q	ZNF385B_uc002unj.2_Missense_Mutation_p.R268Q|ZNF385B_uc002unk.2_RNA|ZNF385B_uc002unl.2_Missense_Mutation_p.R267Q|ZNF385B_uc002unm.2_Missense_Mutation_p.R294Q	NM_152520	NP_689733	Q569K4	Z385B_HUMAN	zinc finger protein 385B isoform 1	370	Matrin-type 4.					nucleus	nucleic acid binding|zinc ion binding			ovary(1)	1			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TTTATGCCTTCGGCTAGAAAT	0.418													99	156	---	---	---	---	PASS
COL3A1	1281	broad.mit.edu	37	2	189875023	189875023	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:189875023T>A	uc002uqj.1	+	49	4060	c.3943T>A	c.(3943-3945)TGG>AGG	p.W1315R		NM_000090	NP_000081	P02461	CO3A1_HUMAN	collagen type III alpha 1 preproprotein	1315	Fibrillar collagen NC1.				axon guidance|cell-matrix adhesion|collagen biosynthetic process|collagen fibril organization|fibril organization|heart development|integrin-mediated signaling pathway|negative regulation of immune response|peptide cross-linking|platelet activation|response to cytokine stimulus|response to radiation|skin development|transforming growth factor beta receptor signaling pathway	collagen type III|extracellular space	extracellular matrix structural constituent|integrin binding|platelet-derived growth factor binding			central_nervous_system(7)|ovary(4)|large_intestine(2)	13			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)|Palifermin(DB00039)	ACGGAAACACTGGTGGACAGA	0.398													48	99	---	---	---	---	PASS
PLCL1	5334	broad.mit.edu	37	2	198948716	198948716	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198948716G>T	uc010fsp.2	+	2	766	c.475G>T	c.(475-477)GAT>TAT	p.D159Y	PLCL1_uc002uuv.3_Missense_Mutation_p.D80Y	NM_001114661	NP_001108133	Q15111	PLCL1_HUMAN	RecName: Full=Inactive phospholipase C-like protein 1;          Short=PLC-L1; AltName: Full=Phospholipase C-deleted in lung carcinoma; AltName: Full=Phospholipase C-related but catalytically inactive protein;          Short=PRIP;	159	PH.|Interaction with PPP1C.				intracellular signal transduction|lipid metabolic process	cytoplasm	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(1)|skin(1)	2					Quinacrine(DB01103)	AGCCAAGCTTGATATTTCTGC	0.443													25	74	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200298113	200298113	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200298113C>A	uc002uuy.1	-	3	1111	c.294G>T	c.(292-294)GAG>GAT	p.E98D	SATB2_uc010fsq.1_Missense_Mutation_p.E98D|SATB2_uc002uuz.1_Missense_Mutation_p.E98D|SATB2_uc002uva.1_Missense_Mutation_p.E98D	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	98						cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GGAGCGCAGTCTCCACCAGCT	0.542													28	87	---	---	---	---	PASS
CFLAR	8837	broad.mit.edu	37	2	202027781	202027781	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:202027781G>A	uc002uxb.3	+						CFLAR_uc010zhk.1_Missense_Mutation_p.C360Y|CFLAR_uc002uxc.3_Intron|CFLAR_uc010zhl.1_Intron|CFLAR_uc002uxd.3_Intron|CFLAR_uc002uxf.2_Missense_Mutation_p.C456Y|CFLAR_uc010fsy.2_Intron|CFLAR_uc010fsx.2_Intron|CFLAR_uc010zhm.1_Missense_Mutation_p.C360Y|CFLAR_uc010fsz.2_Missense_Mutation_p.C211Y|CFLAR_uc002uxg.2_Intron	NM_003879	NP_003870	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator isoform						anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|interspecies interaction between organisms|positive regulation of I-kappaB kinase/NF-kappaB cascade|proteolysis		cysteine-type endopeptidase activity|protein binding				0						agcctcggatgcatcttacta	0.000													3	11	---	---	---	---	PASS
ADAM23	8745	broad.mit.edu	37	2	207412165	207412165	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:207412165C>T	uc002vbq.2	+	7	956	c.733C>T	c.(733-735)CGA>TGA	p.R245*	ADAM23_uc010ziv.1_RNA	NM_003812	NP_003803	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23 preproprotein	245					cell adhesion|central nervous system development|proteolysis	extracellular region|integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			skin(2)|ovary(1)	3				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		AAGCACAGGTCGACCACATAT	0.343													14	61	---	---	---	---	PASS
LANCL1	10314	broad.mit.edu	37	2	211299258	211299258	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211299258C>A	uc010zjh.1	-	10	1228	c.1153G>T	c.(1153-1155)GAC>TAC	p.D385Y	LANCL1_uc002ved.2_Missense_Mutation_p.D385Y|LANCL1_uc010fuq.2_Missense_Mutation_p.D385Y	NM_001136574	NP_001130046	O43813	LANC1_HUMAN	lanthionine synthetase C-like protein 1	385						cytoplasm|integral to plasma membrane|microtubule cytoskeleton|nucleus	catalytic activity|G-protein coupled receptor activity|glutathione binding|low-density lipoprotein particle receptor binding|SH3 domain binding|zinc ion binding				0				Epithelial(149;0.00562)|Lung(261;0.0468)|LUSC - Lung squamous cell carcinoma(261;0.0495)|all cancers(144;0.0569)		ACTAGCAGGTCAGCCAGGAAA	0.428													20	54	---	---	---	---	PASS
CPS1	1373	broad.mit.edu	37	2	211464182	211464182	+	Silent	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:211464182C>G	uc002vee.3	+	14	1578	c.1446C>G	c.(1444-1446)GTC>GTG	p.V482V	CPS1_uc010fur.2_Silent_p.V488V|CPS1_uc010fus.2_Silent_p.V31V	NM_001875	NP_001866	P31327	CPSM_HUMAN	carbamoyl-phosphate synthetase 1 isoform b	482					carbamoyl phosphate biosynthetic process|citrulline biosynthetic process|glutamine metabolic process|glycogen catabolic process|nitric oxide metabolic process|positive regulation of vasodilation|response to lipopolysaccharide|triglyceride catabolic process|urea cycle	mitochondrial nucleoid	ATP binding|carbamoyl-phosphate synthase (ammonia) activity			ovary(8)|central_nervous_system(3)|breast(1)|skin(1)	13				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)		CGGATACTGTCTACTTTCTTC	0.463													37	114	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227662963	227662963	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227662963C>A	uc002voh.3	-	1	544	c.492G>T	c.(490-492)TGG>TGT	p.W164C		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	164	IRS-type PTB.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GGATCACTTGCCAGACCTCTT	0.602											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	45	106	---	---	---	---	PASS
IRS1	3667	broad.mit.edu	37	2	227662964	227662964	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227662964C>A	uc002voh.3	-	1	543	c.491G>T	c.(490-492)TGG>TTG	p.W164L		NM_005544	NP_005535	P35568	IRS1_HUMAN	insulin receptor substrate 1	164	IRS-type PTB.				fibroblast growth factor receptor signaling pathway|glucose homeostasis|insulin receptor signaling pathway|negative regulation of insulin receptor signaling pathway|negative regulation of insulin secretion|nerve growth factor receptor signaling pathway|phosphatidylinositol 3-kinase cascade|phosphatidylinositol-mediated signaling|positive regulation of fatty acid beta-oxidation|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of insulin receptor signaling pathway|positive regulation of phosphatidylinositol 3-kinase activity	caveola|cytosol|insulin receptor complex|microsome|nucleus	insulin receptor binding|insulin-like growth factor receptor binding|phosphatidylinositol 3-kinase binding|protein kinase C binding|SH2 domain binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(5)|central_nervous_system(4)|ovary(2)|pancreas(1)	12		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		GATCACTTGCCAGACCTCTTT	0.607											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	46	110	---	---	---	---	PASS
ANKMY1	51281	broad.mit.edu	37	2	241496722	241496722	+	Intron	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:241496722C>G	uc002vyz.1	-						ANKMY1_uc002vza.1_Missense_Mutation_p.E11Q|ANKMY1_uc010fzd.1_Missense_Mutation_p.E11Q|ANKMY1_uc002vzb.1_Missense_Mutation_p.E11Q|ANKMY1_uc002vzc.1_Missense_Mutation_p.E11Q|ANKMY1_uc002vzd.1_Missense_Mutation_p.E11Q|ANKMY1_uc010fze.1_Intron|ANKMY1_uc002vze.2_Intron|ANKMY1_uc002vzf.2_Intron|DUSP28_uc002vzg.2_5'Flank|DUSP28_uc002vzh.2_5'Flank	NM_016552	NP_057636	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1								zinc ion binding			central_nervous_system(1)	1		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		ACTTCGTCCTCTAAGCTAAGG	0.667													20	86	---	---	---	---	PASS
CNTN6	27255	broad.mit.edu	37	3	1269674	1269674	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:1269674G>T	uc003boz.2	+	4	622	c.355G>T	c.(355-357)GCA>TCA	p.A119S	CNTN6_uc010hbo.2_Missense_Mutation_p.A114S|CNTN6_uc011asj.1_Missense_Mutation_p.A47S|CNTN6_uc003bpa.2_Missense_Mutation_p.A119S	NM_014461	NP_055276	Q9UQ52	CNTN6_HUMAN	contactin 6 precursor	119					axon guidance|cell adhesion|central nervous system development|Notch signaling pathway	anchored to membrane|plasma membrane				skin(3)|lung(2)|breast(2)|pancreas(1)	8		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		GCTCCAATTTGCATGTGAGTT	0.378													10	91	---	---	---	---	PASS
TGFBR2	7048	broad.mit.edu	37	3	30713591	30713591	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:30713591C>T	uc003ceo.2	+	4	1298	c.916C>T	c.(916-918)CAG>TAG	p.Q306*	TGFBR2_uc003cen.2_Nonsense_Mutation_p.Q331*	NM_003242	NP_003233	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II	306	Protein kinase.|Cytoplasmic (Potential).				activation of protein kinase activity|brain development|embryonic cranial skeleton morphogenesis|embryonic hemopoiesis|heart development|myeloid dendritic cell differentiation|palate development|pathway-restricted SMAD protein phosphorylation|patterning of blood vessels|peptidyl-serine phosphorylation|peptidyl-threonine phosphorylation|positive regulation of B cell tolerance induction|positive regulation of mesenchymal cell proliferation|positive regulation of NK T cell differentiation|positive regulation of reactive oxygen species metabolic process|positive regulation of T cell tolerance induction|positive regulation of tolerance induction to self antigen|response to cholesterol|response to drug|transforming growth factor beta receptor signaling pathway|transforming growth factor beta receptor signaling pathway|vasculogenesis	caveola|external side of plasma membrane	ATP binding|glycosaminoglycan binding|metal ion binding|protein binding|receptor signaling protein serine/threonine kinase activity|SMAD binding|transforming growth factor beta binding|transforming growth factor beta receptor activity, type II|type I transforming growth factor beta receptor binding|type I transforming growth factor beta receptor binding|type III transforming growth factor beta receptor binding			pancreas(9)|large_intestine(6)|stomach(4)|lung(3)|ovary(3)|central_nervous_system(1)	26						GAACATACTCCAGTTCCTGAC	0.522													33	46	---	---	---	---	PASS
CSRNP1	64651	broad.mit.edu	37	3	39184967	39184967	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39184967G>A	uc003cjg.2	-	5	1563	c.1349C>T	c.(1348-1350)ACA>ATA	p.T450I	CSRNP1_uc003cjh.2_Missense_Mutation_p.T450I	NM_033027	NP_149016	Q96S65	CSRN1_HUMAN	AXIN1 up-regulated 1	450					apoptosis|positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(4)|skin(1)	5						GACGCCTGATGTGAAGCTACA	0.567													33	34	---	---	---	---	PASS
OR5H14	403273	broad.mit.edu	37	3	97868527	97868527	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:97868527C>A	uc003dsg.1	+	1	298	c.298C>A	c.(298-300)CAG>AAG	p.Q100K		NM_001005514	NP_001005514	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H,	100	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1						ATGCAAGATACAGTTGTTTTC	0.393													50	378	---	---	---	---	PASS
OR5K1	26339	broad.mit.edu	37	3	98189243	98189243	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98189243G>A	uc003dsm.2	+	1	823	c.823G>A	c.(823-825)GCA>ACA	p.A275T		NM_001004736	NP_001004736	Q8NHB7	OR5K1_HUMAN	olfactory receptor, family 5, subfamily K,	275	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)	1						TATACCAGCTGCAATTTTATT	0.323													55	87	---	---	---	---	PASS
FILIP1L	11259	broad.mit.edu	37	3	99649846	99649846	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:99649846C>T	uc003dtm.2	-	2	482	c.19G>A	c.(19-21)GAT>AAT	p.D7N	C3orf26_uc003dtk.1_Intron|C3orf26_uc003dtl.2_Intron|FILIP1L_uc003dto.2_Missense_Mutation_p.D7N|uc003dtq.2_5'Flank	NM_182909	NP_878913	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like isoform 1	7						cytoplasm|membrane|myosin complex|nucleus				ovary(1)	1						CCCTCGGTATCACTGCCTCTG	0.408													27	128	---	---	---	---	PASS
GPR128	84873	broad.mit.edu	37	3	100373875	100373875	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100373875T>A	uc003duc.2	+	12	1844	c.1576T>A	c.(1576-1578)TGC>AGC	p.C526S	GPR128_uc011bhc.1_Missense_Mutation_p.C227S|GPR128_uc003dud.2_Missense_Mutation_p.C49S	NM_032787	NP_116176	Q96K78	GP128_HUMAN	G protein-coupled receptor 128 precursor	526	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)|skin(1)	4						GAATCCCATGTGCACTGCGAT	0.428													224	245	---	---	---	---	PASS
ABI3BP	25890	broad.mit.edu	37	3	100570766	100570766	+	Nonsense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100570766G>C	uc003dun.2	-	13	1263	c.1178C>G	c.(1177-1179)TCA>TGA	p.S393*	ABI3BP_uc003duo.2_Nonsense_Mutation_p.S435*	NM_015429	NP_056244	Q7Z7G0	TARSH_HUMAN	ABI gene family, member 3 (NESH) binding protein	393						extracellular space				ovary(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)	4						TGTAGGGCTTGAGAAAACATC	0.348													3	19	---	---	---	---	PASS
RETNLB	84666	broad.mit.edu	37	3	108475936	108475936	+	Nonsense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108475936T>A	uc003dxh.2	-	1	195	c.97A>T	c.(97-99)AAG>TAG	p.K33*		NM_032579	NP_115968	Q9BQ08	RETNB_HUMAN	resistin like beta precursor	33					cell proliferation	extracellular region	hormone activity			skin(1)	1						TTGATCTTCTTATCCATAACG	0.512													7	35	---	---	---	---	PASS
MORC1	27136	broad.mit.edu	37	3	108725881	108725881	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:108725881G>T	uc003dxl.2	-	18	1849	c.1762C>A	c.(1762-1764)CAT>AAT	p.H588N	MORC1_uc011bhn.1_Intron	NM_014429	NP_055244	Q86VD1	MORC1_HUMAN	MORC family CW-type zinc finger 1	588					cell differentiation|multicellular organismal development|spermatogenesis	nucleus	ATP binding|zinc ion binding			ovary(3)|skin(3)|breast(2)	8						CTCACCTTATGTGCTGAAGTT	0.373													6	58	---	---	---	---	PASS
B4GALT4	8702	broad.mit.edu	37	3	118948774	118948774	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:118948774C>A	uc003ecg.2	-	3	814	c.173G>T	c.(172-174)GGG>GTG	p.G58V	B4GALT4_uc003ece.1_Missense_Mutation_p.G58V|B4GALT4_uc003ecf.2_RNA|B4GALT4_uc003ech.2_Missense_Mutation_p.G58V|B4GALT4_uc003eci.2_Missense_Mutation_p.G58V|B4GALT4_uc011biy.1_Intron	NM_212543	NP_997708	O60513	B4GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,4-	58	Lumenal (Potential).				membrane lipid metabolic process|post-translational protein modification|protein N-linked glycosylation via asparagine	Golgi cisterna membrane|integral to membrane	metal ion binding|N-acetyllactosamine synthase activity				0				GBM - Glioblastoma multiforme(114;0.222)	N-Acetyl-D-glucosamine(DB00141)	TTTTCCCTTCCCCAAAATGAG	0.453													16	73	---	---	---	---	PASS
POLQ	10721	broad.mit.edu	37	3	121206414	121206414	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121206414C>A	uc003eee.3	-	16	5493	c.5364G>T	c.(5362-5364)GGG>GGT	p.G1788G	POLQ_uc003eed.2_Silent_p.G960G	NM_199420	NP_955452	O75417	DPOLQ_HUMAN	DNA polymerase theta	1788					DNA repair|DNA replication	nucleoplasm	ATP binding|ATP-dependent helicase activity|damaged DNA binding|DNA-directed DNA polymerase activity|single-stranded DNA-dependent ATPase activity			ovary(4)|breast(3)|lung(2)|upper_aerodigestive_tract(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.0915)		CATTTCTACTCCCTGGACTTA	0.383								DNA_polymerases_(catalytic_subunits)					26	154	---	---	---	---	PASS
MCM2	4171	broad.mit.edu	37	3	127323596	127323596	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:127323596C>T	uc003ejp.2	+	3	439	c.382C>T	c.(382-384)CTG>TTG	p.L128L	MCM2_uc011bkm.1_5'UTR|MCM2_uc010hsl.2_RNA|MCM2_uc011bkn.1_Silent_p.L12L	NM_004526	NP_004517	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	128	Interaction with MYST2 (By similarity).				cell cycle checkpoint|DNA strand elongation involved in DNA replication|DNA-dependent DNA replication initiation|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|S phase of mitotic cell cycle	chromatin|MCM complex	ATP binding|helicase activity|metal ion binding			ovary(3)|skin(1)	4						TGGCCGGGGCCTGGGCCGCAT	0.667													3	19	---	---	---	---	PASS
ACAD11	84129	broad.mit.edu	37	3	132322143	132322143	+	Silent	SNP	C	A	A	rs142478069		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:132322143C>A	uc003eov.3	-	13	1931	c.1551G>T	c.(1549-1551)ACG>ACT	p.T517T	ACAD11_uc011blr.1_Silent_p.T128T	NM_032169	NP_115545	Q709F0	ACD11_HUMAN	putative acyl-CoA dehydrogenase	517						peroxisome	acyl-CoA dehydrogenase activity|flavin adenine dinucleotide binding|transferase activity, transferring phosphorus-containing groups			ovary(1)	1						ATTCAATATTCGTGGCATCAC	0.373													22	130	---	---	---	---	PASS
TOPBP1	11073	broad.mit.edu	37	3	133339143	133339143	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:133339143T>A	uc003eps.2	-	20	3359	c.3227A>T	c.(3226-3228)CAG>CTG	p.Q1076L	TOPBP1_uc003ept.1_Missense_Mutation_p.Q80L	NM_007027	NP_008958	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	1076					DNA repair|response to ionizing radiation	microtubule organizing center|PML body|spindle pole	DNA binding|protein C-terminus binding			ovary(2)|kidney(2)|skin(1)|lung(1)|pancreas(1)	7						CATTATCTCCTGTAACTGCTT	0.423								Other_conserved_DNA_damage_response_genes					8	75	---	---	---	---	PASS
TRPC1	7220	broad.mit.edu	37	3	142499767	142499767	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:142499767C>G	uc003evc.2	+	6	992	c.856C>G	c.(856-858)CTA>GTA	p.L286V	TRPC1_uc003evb.2_Missense_Mutation_p.L252V	NM_003304	NP_003295	P48995	TRPC1_HUMAN	transient receptor potential cation channel,	286	Cytoplasmic (Potential).				axon guidance|cytosolic calcium ion homeostasis|positive regulation of release of sequestered calcium ion into cytosol|response to calcium ion	cytosol|integral to plasma membrane	protein binding|store-operated calcium channel activity			ovary(2)	2						GGAAGTTATTCTAAACCATAC	0.363													24	84	---	---	---	---	PASS
SIAH2	6478	broad.mit.edu	37	3	150460253	150460253	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150460253T>C	uc003eyi.2	-	2	1277	c.650A>G	c.(649-651)GAC>GGC	p.D217G		NM_005067	NP_005058	O43255	SIAH2_HUMAN	seven in absentia homolog 2	217	SBD.				apoptosis|axon guidance|cell cycle|negative regulation of canonical Wnt receptor signaling pathway|small GTPase mediated signal transduction|ubiquitin-dependent protein catabolic process	cytosol|nucleus	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|lung(1)	2			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CATCACCCAGTCGACAGCCCC	0.507													8	165	---	---	---	---	PASS
MME	4311	broad.mit.edu	37	3	154884812	154884812	+	Splice_Site	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:154884812T>A	uc010hvr.1	+	18	1991	c.1780_splice	c.e18+2	p.G594_splice	MME_uc003fab.1_Splice_Site_p.G594_splice|MME_uc003fac.1_Splice_Site_p.G594_splice|MME_uc003fad.1_Splice_Site_p.G594_splice|MME_uc003fae.1_Splice_Site_p.G594_splice	NM_007289	NP_009220	P08473	NEP_HUMAN	membrane metallo-endopeptidase						cell-cell signaling|proteolysis	integral to plasma membrane	metal ion binding|metalloendopeptidase activity|protein binding			ovary(2)|central_nervous_system(1)	3		all_neural(597;0.00391)|Myeloproliferative disorder(1037;0.0122)	LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.135)		Candoxatril(DB00616)	ATGACAATGGTAAAGTGCAGT	0.398													32	164	---	---	---	---	PASS
GFM1	85476	broad.mit.edu	37	3	158409239	158409239	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158409239G>T	uc003fce.2	+	18	2346	c.2239G>T	c.(2239-2241)GGA>TGA	p.G747*	GFM1_uc003fcf.2_RNA|GFM1_uc003fcg.2_Nonsense_Mutation_p.G678*	NM_024996	NP_079272	Q96RP9	EFGM_HUMAN	G elongation factor, mitochondrial 1 precursor	747					mitochondrial translational elongation	mitochondrion	GTP binding|GTPase activity|translation elongation factor activity			ovary(3)|central_nervous_system(1)	4			Lung(72;0.00309)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TGTTAAAAAAGGAAAAGCCAA	0.383													14	221	---	---	---	---	PASS
IQCJ	654502	broad.mit.edu	37	3	158983042	158983042	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:158983042C>A	uc003fcp.1	+	5	435	c.330C>A	c.(328-330)ATC>ATA	p.I110I	SCHIP1_uc003fcq.1_Intron|SCHIP1_uc003fcr.1_Intron|IQCJ_uc010hvy.1_Silent_p.I83I	NM_001042705	NP_001036170	Q1A5X6	IQCJ_HUMAN	IQ motif containing J isoform CaMBPv1	110											0			LUSC - Lung squamous cell carcinoma(72;0.00523)|Lung(72;0.00534)			ATCCTTACATCTCTTGGAGGT	0.468													67	313	---	---	---	---	PASS
BCHE	590	broad.mit.edu	37	3	165547376	165547376	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165547376A>T	uc003fem.3	-	2	1606	c.1446T>A	c.(1444-1446)GAT>GAA	p.D482E	BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor	482					choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	TTGTGTAATTATCTCTTCTTT	0.398													42	184	---	---	---	---	PASS
NLGN1	22871	broad.mit.edu	37	3	173525487	173525487	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:173525487G>C	uc003fio.1	+	4	934	c.511G>C	c.(511-513)GGT>CGT	p.G171R	NLGN1_uc010hww.1_Missense_Mutation_p.G211R|NLGN1_uc003fip.1_Missense_Mutation_p.G171R	NM_014932	NP_055747	Q8N2Q7	NLGN1_HUMAN	neuroligin 1	188	Extracellular (Potential).				calcium-dependent cell-cell adhesion|neuron cell-cell adhesion|neuronal signal transduction|positive regulation of dendritic spine development|positive regulation of excitatory postsynaptic membrane potential|positive regulation of intracellular protein kinase cascade|positive regulation of synaptogenesis|protein targeting|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|regulation of N-methyl-D-aspartate selective glutamate receptor activity|synapse assembly|synaptic vesicle targeting	cell junction|cell surface|dendrite|integral to plasma membrane|postsynaptic density|postsynaptic membrane	cell adhesion molecule binding|neurexin binding|receptor activity			lung(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)|ovary(1)|pancreas(1)	7	Ovarian(172;0.0025)		LUSC - Lung squamous cell carcinoma(14;5.36e-13)|Lung(28;9.49e-13)			GGACAGTGGGGGTCCCAAACC	0.398													22	223	---	---	---	---	PASS
PIK3CA	5290	broad.mit.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	A	A	rs104886003		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178936091G>A	uc003fjk.2	+	10	1790	c.1633G>A	c.(1633-1635)GAG>AAG	p.E545K		NM_006218	NP_006209	P42336	PK3CA_HUMAN	phosphoinositide-3-kinase, catalytic, alpha	545	PI3K helical.		E -> G (in KERSEB).|E -> A (in cancer).|E -> K (in KERSEB; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells).		epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|phosphatidylinositol-mediated signaling|platelet activation|T cell costimulation|T cell receptor signaling pathway		1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity	p.E545K(735)|p.E545A(75)|p.E545G(55)|p.E545?(19)|p.E545D(15)|p.E545Q(12)|p.E545V(4)		breast(1564)|large_intestine(776)|endometrium(246)|urinary_tract(195)|ovary(141)|skin(112)|stomach(98)|thyroid(77)|central_nervous_system(69)|lung(65)|upper_aerodigestive_tract(58)|haematopoietic_and_lymphoid_tissue(27)|cervix(25)|biliary_tract(22)|liver(20)|oesophagus(17)|pancreas(11)|penis(8)|pituitary(8)|autonomic_ganglia(4)|prostate(3)|kidney(2)|meninges(1)|eye(1)|NS(1)|soft_tissue(1)|bone(1)	3553	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)			TGAAATCACTGAGCAGGAGAA	0.353	E545K(RERFLCSQ1_LUNG)|E545K(KYSE510_OESOPHAGUS)|E545K(NCIH508_LARGE_INTESTINE)|E545K(HCC202_BREAST)|E545K(BFTC909_KIDNEY)|E545K(HCT15_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(MCF7_BREAST)|E545K(NCIH460_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(BC3C_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		colorectal|gastric|gliobastoma|breast					HNSCC(19;0.045)|TSP Lung(28;0.18)			23	84	---	---	---	---	PASS
CCDC39	339829	broad.mit.edu	37	3	180381711	180381711	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:180381711T>A	uc010hxe.2	-	2	269	c.154A>T	c.(154-156)ATT>TTT	p.I52F	CCDC39_uc003fkn.2_RNA	NM_181426	NP_852091	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	52	Potential.				axonemal dynein complex assembly|ciliary cell motility|cilium movement involved in determination of left/right asymmetry|flagellar cell motility	cilium axoneme|cytoplasm|cytoskeleton				ovary(4)	4	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			ATAGAATTAATTCGCTCTTCA	0.338													65	124	---	---	---	---	PASS
B3GNT5	84002	broad.mit.edu	37	3	182987916	182987916	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182987916G>A	uc003flk.2	+	2	860	c.330G>A	c.(328-330)ACG>ACA	p.T110T	MCF2L2_uc003fli.1_Intron|MCF2L2_uc003flj.1_Intron|MCF2L2_uc011bqr.1_Intron|B3GNT5_uc003fll.2_Silent_p.T110T|B3GNT5_uc003flm.2_Silent_p.T110T	NM_032047	NP_114436	Q9BYG0	B3GN5_HUMAN	UDP-GlcNAc:betaGal	110	Lumenal (Potential).				central nervous system development|glycolipid biosynthetic process|protein glycosylation	Golgi membrane|integral to membrane	beta-galactosyl-N-acetylglucosaminylgalactosylglucosyl-ceramide beta-1,3-acetylglucosaminyltransferase activity|galactosyltransferase activity			ovary(1)	1	all_cancers(143;8.52e-13)|Ovarian(172;0.0355)		all cancers(12;4.52e-44)|Epithelial(37;8.82e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;6.75e-21)			TTAGAAGGACGTGGGGCAATG	0.423													9	160	---	---	---	---	PASS
DGKG	1608	broad.mit.edu	37	3	185986661	185986661	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:185986661C>A	uc003fqa.2	-	12	1582	c.1045G>T	c.(1045-1047)GAC>TAC	p.D349Y	DGKG_uc003fqb.2_Intron|DGKG_uc003fqc.2_Missense_Mutation_p.D349Y|DGKG_uc011brx.1_Intron	NM_001346	NP_001337	P49619	DGKG_HUMAN	diacylglycerol kinase gamma isoform 1	349	Phorbol-ester/DAG-type 2.				activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	cytoplasm|plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			breast(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5	all_cancers(143;3.26e-12)|Ovarian(172;0.0315)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)	GBM - Glioblastoma multiforme(93;0.0657)	Phosphatidylserine(DB00144)	TGGCACCGGTCACACTTGACG	0.632													24	42	---	---	---	---	PASS
HRASLS	57110	broad.mit.edu	37	3	192980981	192980981	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:192980981A>G	uc003fta.2	+	3	767	c.362A>G	c.(361-363)CAT>CGT	p.H121R		NM_020386	NP_065119	Q9HDD0	HRSL1_HUMAN	HRAS-like suppressor	121											0	all_cancers(143;9.1e-09)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000159)		AACTGTGAACATTTTGTGACA	0.403													107	60	---	---	---	---	PASS
FAM43A	131583	broad.mit.edu	37	3	194407853	194407853	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:194407853A>T	uc003fuj.2	+	1	1232	c.298A>T	c.(298-300)AGC>TGC	p.S100C		NM_153690	NP_710157	Q8N2R8	FA43A_HUMAN	hypothetical protein LOC131583	100										central_nervous_system(1)	1	all_cancers(143;2.04e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.147)	OV - Ovarian serous cystadenocarcinoma(49;8.37e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.78e-05)		CTGGAGCAAGAGCGAGGCGGG	0.682													17	114	---	---	---	---	PASS
FGFR3	2261	broad.mit.edu	37	4	1808386	1808386	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1808386A>T	uc003gdr.3	+	16	2400	c.2144A>T	c.(2143-2145)AAG>ATG	p.K715M	FGFR3_uc003gdu.2_Missense_Mutation_p.K717M|FGFR3_uc003gds.3_Missense_Mutation_p.K603M|FGFR3_uc003gdq.3_Missense_Mutation_p.Q692H	NM_000142	NP_000133	P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3 isoform 1	715	Protein kinase.|Cytoplasmic (Potential).				bone maturation|cell growth|insulin receptor signaling pathway|JAK-STAT cascade|MAPKKK cascade|negative regulation of developmental growth|positive regulation of cell proliferation	integral to plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|identical protein binding			urinary_tract(2177)|skin(314)|upper_aerodigestive_tract(57)|haematopoietic_and_lymphoid_tissue(24)|prostate(9)|cervix(6)|central_nervous_system(4)|large_intestine(3)|lung(3)|testis(2)|pancreas(1)	2600		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)	CGCATGGACAAGCCCGCCAAC	0.687		1	Mis|T	IGH@|ETV6	bladder|MM|T-cell lymphoma		Hypochondroplasia|Thanatophoric dysplasia		Muenke_syndrome|Saethre-Chotzen_syndrome				13	39	---	---	---	---	PASS
CRMP1	1400	broad.mit.edu	37	4	5827375	5827375	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5827375C>G	uc003gip.2	-	14	1574	c.1473G>C	c.(1471-1473)TTG>TTC	p.L491F	EVC_uc003gim.1_Intron|CRMP1_uc003gin.1_Missense_Mutation_p.L403F|CRMP1_uc003giq.2_Missense_Mutation_p.L491F|CRMP1_uc003gir.2_Missense_Mutation_p.L486F|CRMP1_uc003gis.2_Missense_Mutation_p.L605F	NM_001313	NP_001304	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1 isoform 2	491					axon guidance|pyrimidine base catabolic process	cytosol|microtubule organizing center|spindle	dihydropyrimidinase activity|protein binding			ovary(2)	2				Colorectal(103;0.0721)		AAACCCCTTGCAATCCAAAAA	0.527													19	52	---	---	---	---	PASS
CC2D2A	57545	broad.mit.edu	37	4	15591297	15591297	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:15591297G>C	uc010idv.2	+	34	4554	c.4309G>C	c.(4309-4311)GAC>CAC	p.D1437H	CC2D2A_uc003gnx.2_Missense_Mutation_p.D1329H|CC2D2A_uc003gnz.1_RNA|CC2D2A_uc003goa.1_RNA	NM_001080522	NP_001073991	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A isoform	1437					cell projection organization	cilium|microtubule basal body				pancreas(2)|ovary(1)	3						AATAGGTCCTGACAATGTAAG	0.303													15	46	---	---	---	---	PASS
BEND4	389206	broad.mit.edu	37	4	42122174	42122174	+	Silent	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:42122174A>T	uc003gwn.2	-	5	1864	c.1284T>A	c.(1282-1284)CTT>CTA	p.L428L	BEND4_uc003gwm.2_Silent_p.L428L|BEND4_uc011byy.1_Silent_p.L428L	NM_207406	NP_997289	Q6ZU67	BEND4_HUMAN	BEN domain containing 4 isoform a	428	BEN.										0						ATGAGTACTTAAGCTCATCGG	0.478													13	59	---	---	---	---	PASS
FRYL	285527	broad.mit.edu	37	4	48622755	48622755	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:48622755G>A	uc003gyh.1	-	6	820	c.215C>T	c.(214-216)CCT>CTT	p.P72L	FRYL_uc003gyk.2_Missense_Mutation_p.P72L|FRYL_uc003gyl.1_Missense_Mutation_p.P123L|FRYL_uc003gym.1_Missense_Mutation_p.P72L	NM_015030	NP_055845	O94915	FRYL_HUMAN	furry-like	72					regulation of transcription, DNA-dependent|transcription, DNA-dependent		protein binding			skin(1)	1						AAGTAAGGAAGGGAGACAGTG	0.413													50	106	---	---	---	---	PASS
CWH43	80157	broad.mit.edu	37	4	49005803	49005803	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49005803T>C	uc003gyv.2	+	7	1036	c.854T>C	c.(853-855)GTG>GCG	p.V285A	CWH43_uc011bzl.1_Missense_Mutation_p.V258A	NM_025087	NP_079363	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog	285	Helical; (Potential).				GPI anchor biosynthetic process	integral to membrane				skin(2)|ovary(1)	3						GCAGCTGCTGTGTCTGGCTGT	0.502													59	104	---	---	---	---	PASS
TMPRSS11F	389208	broad.mit.edu	37	4	68928614	68928614	+	Intron	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:68928614T>C	uc003hdt.1	-						LOC550112_uc003hdl.3_RNA|uc011cak.1_RNA|SYT14L_uc010ihn.2_RNA	NM_207407	NP_997290	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F						proteolysis	extracellular region|integral to plasma membrane	serine-type endopeptidase activity			ovary(1)	1						GGCTGCCTTTTATCACTTCTG	0.428													51	71	---	---	---	---	PASS
HERC5	51191	broad.mit.edu	37	4	89397178	89397178	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89397178C>A	uc003hrt.2	+	12	1732	c.1579C>A	c.(1579-1581)CTG>ATG	p.L527M	HERC5_uc011cdm.1_Missense_Mutation_p.L165M	NM_016323	NP_057407	Q9UII4	HERC5_HUMAN	hect domain and RLD 5	527					innate immune response|ISG15-protein conjugation|negative regulation of type I interferon production|protein ubiquitination involved in ubiquitin-dependent protein catabolic process|regulation of cyclin-dependent protein kinase activity|regulation of defense response to virus|response to virus	cytosol|perinuclear region of cytoplasm	ISG15 ligase activity|protein binding|ubiquitin-protein ligase activity			ovary(4)|lung(3)|skin(2)	9		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000209)		TTCACTGGTTCTGGGTAAGTT	0.383													35	38	---	---	---	---	PASS
RAP1GDS1	5910	broad.mit.edu	37	4	99342483	99342483	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:99342483G>T	uc003htx.3	+	12	1568	c.1378G>T	c.(1378-1380)GCT>TCT	p.A460S	RAP1GDS1_uc003htw.3_Missense_Mutation_p.A461S|RAP1GDS1_uc003htv.3_Missense_Mutation_p.A460S|RAP1GDS1_uc003htz.3_Missense_Mutation_p.A411S|RAP1GDS1_uc003hty.3_Missense_Mutation_p.A412S|RAP1GDS1_uc003hua.3_Missense_Mutation_p.A369S	NM_001100427	NP_001093897	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1 isoform	460							binding|GTPase activator activity			ovary(1)|lung(1)|breast(1)	3				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		CAAAGATCATGCTGGTGTGAT	0.433			T	NUP98	T-ALL								36	30	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126355562	126355562	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126355562C>T	uc003ifj.3	+	7	7181	c.7181C>T	c.(7180-7182)TCA>TTA	p.S2394L	FAT4_uc011cgp.1_Missense_Mutation_p.S692L	NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	2394	Cadherin 23.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GCTGATGCTTCAAAGAATGCA	0.343													33	56	---	---	---	---	PASS
MARCH1	55016	broad.mit.edu	37	4	164534651	164534651	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:164534651G>C	uc003iqs.1	-						MARCH1_uc003iqr.1_Silent_p.T2T	NM_017923	NP_060393	Q8TCQ1	MARH1_HUMAN	membrane-associated RING-CH protein I						antigen processing and presentation of peptide antigen via MHC class II|immune response	cytoplasmic vesicle membrane|early endosome membrane|Golgi apparatus|integral to membrane|late endosome membrane|lysosomal membrane|plasma membrane	MHC protein binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)	2	all_hematologic(180;0.166)	Prostate(90;0.0959)|all_neural(102;0.223)				CGTGGCTGCTGGTCATGTTGC	0.348													13	26	---	---	---	---	PASS
IRX1	79192	broad.mit.edu	37	5	3599417	3599417	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:3599417C>T	uc003jde.2	+	2	407	c.355C>T	c.(355-357)CCC>TCC	p.P119S		NM_024337	NP_077313	P78414	IRX1_HUMAN	iroquois homeobox protein 1	119						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2						GGCTTATTACCCCTACGGCCA	0.652													35	49	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5146263	5146263	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5146263T>A	uc003jdl.2	+	3	334	c.196T>A	c.(196-198)TAC>AAC	p.Y66N	ADAMTS16_uc003jdk.1_Missense_Mutation_p.Y66N|ADAMTS16_uc003jdj.1_Missense_Mutation_p.Y66N	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	66					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						GGTCTCTGCCTACGAGGTTGA	0.478													20	81	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5232470	5232470	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5232470G>C	uc003jdl.2	+						ADAMTS16_uc003jdk.1_Intron|ADAMTS16_uc010itk.1_5'Flank	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1						proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TATTTATGTTGAAAATTTTAG	0.478													29	119	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19473489	19473489	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19473489T>G	uc003jgc.2	-	12	2596	c.2219A>C	c.(2218-2220)TAT>TCT	p.Y740S	CDH18_uc003jgd.2_Missense_Mutation_p.Y740S|CDH18_uc011cnm.1_3'UTR	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	740	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CTGACCCTCATAGGCATAAGT	0.488													54	72	---	---	---	---	PASS
CDH18	1016	broad.mit.edu	37	5	19483469	19483469	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:19483469G>T	uc003jgc.2	-	11	2200	c.1823C>A	c.(1822-1824)TCG>TAG	p.S608*	CDH18_uc003jgd.2_Nonsense_Mutation_p.S608*|CDH18_uc011cnm.1_Silent_p.R572R	NM_004934	NP_004925	Q13634	CAD18_HUMAN	cadherin 18, type 2 preproprotein	608	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|large_intestine(1)|skin(1)	7	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CAAACCAGCCGAGGACAGGAA	0.517													36	29	---	---	---	---	PASS
CDH12	1010	broad.mit.edu	37	5	21752201	21752201	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:21752201G>A	uc010iuc.2	-	12	2488	c.2030C>T	c.(2029-2031)GCT>GTT	p.A677V	CDH12_uc011cno.1_Missense_Mutation_p.A637V|CDH12_uc003jgk.2_Missense_Mutation_p.A677V|uc003jgj.2_Intron	NM_004061	NP_004052	P55289	CAD12_HUMAN	cadherin 12, type 2 preproprotein	677	Cytoplasmic (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(2)	2						GTTTCTCAGAGCCCCGATGTC	0.473										HNSCC(59;0.17)			17	141	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24511481	24511481	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24511481G>T	uc003jgr.1	-	6	1289	c.957C>A	c.(955-957)ATC>ATA	p.I319I	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	319	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		TCTCAGTCACGATGTCAAACA	0.428										HNSCC(23;0.051)			56	212	---	---	---	---	PASS
CDH10	1008	broad.mit.edu	37	5	24511547	24511547	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:24511547G>T	uc003jgr.1	-	6	1223	c.891C>A	c.(889-891)GAC>GAA	p.D297E	CDH10_uc011cnu.1_RNA	NM_006727	NP_006718	Q9Y6N8	CAD10_HUMAN	cadherin 10, type 2 preproprotein	297	Cadherin 3.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|pancreas(4)|breast(2)	12				STAD - Stomach adenocarcinoma(35;0.0556)		TTTTCCCAGTGTCAGCATCAG	0.413										HNSCC(23;0.051)			27	126	---	---	---	---	PASS
CDH9	1007	broad.mit.edu	37	5	26886102	26886102	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:26886102G>T	uc003jgs.1	-	10	1772	c.1603C>A	c.(1603-1605)CCG>ACG	p.P535T	CDH9_uc011cnv.1_Missense_Mutation_p.P128T	NM_016279	NP_057363	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 preproprotein	535	Extracellular (Potential).|Cadherin 5.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(5)|skin(2)|upper_aerodigestive_tract(1)|haematopoietic_and_lymphoid_tissue(1)	9						GTGAAATTCGGATTGAGAGTA	0.318													37	124	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76251699	76251699	+	Intron	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76251699T>C	uc003ker.2	+						CRHBP_uc010izx.2_Intron	NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein						female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		GTAAGTGTTCTCAGTCAAAAG	0.403													13	26	---	---	---	---	PASS
CRHBP	1393	broad.mit.edu	37	5	76251700	76251700	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76251700C>T	uc003ker.2	+						CRHBP_uc010izx.2_Intron	NM_001882	NP_001873	P24387	CRHBP_HUMAN	corticotropin releasing hormone binding protein						female pregnancy|learning or memory|signal transduction	soluble fraction					0		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Ovarian(174;0.0129)|Prostate(461;0.11)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-51)|Epithelial(54;8.79e-46)|all cancers(79;2.49e-41)		TAAGTGTTCTCAGTCAAAAGG	0.398													13	25	---	---	---	---	PASS
PDE8B	8622	broad.mit.edu	37	5	76714083	76714083	+	Silent	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:76714083A>T	uc003kfa.2	+	18	1986	c.1941A>T	c.(1939-1941)GCA>GCT	p.A647A	PDE8B_uc003kfb.2_Silent_p.A627A|PDE8B_uc003kfc.2_Silent_p.A592A|PDE8B_uc003kfd.2_Silent_p.A600A|PDE8B_uc003kfe.2_Silent_p.A550A	NM_003719	NP_003710	O95263	PDE8B_HUMAN	phosphodiesterase 8B isoform 1	647	Catalytic (By similarity).				cyclic nucleotide metabolic process|regulation of transcription, DNA-dependent	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|metal ion binding|two-component response regulator activity				0		all_lung(232;0.00043)|Lung NSC(167;0.00114)|Ovarian(174;0.0107)|Prostate(461;0.0605)		OV - Ovarian serous cystadenocarcinoma(54;2.21e-49)|Epithelial(54;5.82e-43)|all cancers(79;4.06e-38)		ATGAGGTGGCAGCCCTCATTG	0.547													20	57	---	---	---	---	PASS
CCNH	902	broad.mit.edu	37	5	86695249	86695249	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:86695249C>T	uc003kjb.2	-	7	1066	c.834G>A	c.(832-834)GAG>GAA	p.E278E	CCNH_uc003kiy.1_RNA|CCNH_uc003kiz.1_Silent_p.E225E|CCNH_uc003kja.2_Silent_p.E225E	NM_001239	NP_001230	P51946	CCNH_HUMAN	cyclin H	278					G1 phase of mitotic cell cycle|G1/S transition of mitotic cell cycle|G2/M transition of mitotic cell cycle|mRNA capping|nucleotide-excision repair, DNA damage removal|positive regulation of transcription from RNA polymerase II promoter|positive regulation of viral transcription|protein phosphorylation|regulation of cyclin-dependent protein kinase activity|S phase of mitotic cell cycle|termination of RNA polymerase I transcription|transcription elongation from RNA polymerase I promoter|transcription elongation from RNA polymerase II promoter|transcription initiation from RNA polymerase I promoter|transcription initiation from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair|viral reproduction	cyclin-dependent protein kinase activating kinase holoenzyme complex|holo TFIIH complex	protein kinase binding			ovary(2)|kidney(1)	3		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		AATGACATCGCTCCAACTTCT	0.378								Direct_reversal_of_damage|NER					82	143	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89990346	89990346	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89990346A>T	uc003kju.2	+	33	7869	c.7773A>T	c.(7771-7773)GAA>GAT	p.E2591D	GPR98_uc003kjt.2_Missense_Mutation_p.E297D|GPR98_uc003kjv.2_Missense_Mutation_p.E191D	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2591	Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		ATACTTCCGAAGATGGCTTAT	0.458													93	147	---	---	---	---	PASS
GPR98	84059	broad.mit.edu	37	5	89992782	89992782	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:89992782C>A	uc003kju.2	+	34	8070	c.7974C>A	c.(7972-7974)ACC>ACA	p.T2658T	GPR98_uc003kjt.2_Silent_p.T364T|GPR98_uc003kjv.2_Silent_p.T258T	NM_032119	NP_115495	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98 precursor	2658	Calx-beta 18.|Extracellular (Potential).				cell communication|cell-cell adhesion|maintenance of organ identity|neuropeptide signaling pathway|photoreceptor cell maintenance	cell surface|cytoplasm|integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(11)|central_nervous_system(3)|pancreas(2)	16		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TCATTTTAACCATCTTGGATG	0.378													19	32	---	---	---	---	PASS
SLCO6A1	133482	broad.mit.edu	37	5	101755709	101755709	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:101755709T>A	uc003knn.2	-	8	1465	c.1293A>T	c.(1291-1293)CCA>CCT	p.P431P	SLCO6A1_uc003kno.2_Intron|SLCO6A1_uc003knp.2_Silent_p.P431P|SLCO6A1_uc003knq.2_Silent_p.P369P	NM_173488	NP_775759	Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family,	431	Helical; Name=8; (Potential).					integral to membrane|plasma membrane	transporter activity			ovary(3)|skin(3)|central_nervous_system(1)	7		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		GTGCACCTCCTGGAATTAAAA	0.348													19	29	---	---	---	---	PASS
IL9	3578	broad.mit.edu	37	5	135231428	135231428	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:135231428C>T	uc003lbb.1	-	1	89	c.78G>A	c.(76-78)GGG>GGA	p.G26G		NM_000590	NP_000581	P15248	IL9_HUMAN	interleukin 9 precursor	26					immune response|inflammatory response|positive regulation of cell proliferation|positive regulation of interleukin-5 biosynthetic process	extracellular space	cytokine activity|cytokine receptor binding|growth factor activity				0			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGTCCAGGATCCCCGCCAAGG	0.567													36	57	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140595824	140595824	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595824C>A	uc003lja.1	+	1	2316	c.2129C>A	c.(2128-2130)GCG>GAG	p.A710E		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	710	Helical; (Potential).				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTGGCGGTGCGGCTG	0.677													82	122	---	---	---	---	PASS
NDFIP1	80762	broad.mit.edu	37	5	141515288	141515288	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:141515288C>T	uc003lmi.3	+						NDFIP1_uc003lmj.1_Intron	NM_030571	NP_085048	Q9BT67	NFIP1_HUMAN	Nedd4 family interacting protein 1						cellular iron ion homeostasis|negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endosome membrane|extracellular region|Golgi membrane|integral to membrane|perinuclear region of cytoplasm	signal transducer activity				0		all_hematologic(541;0.0999)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTTTCTTTTCATTTAGGATG	0.343													34	68	---	---	---	---	PASS
RBM27	54439	broad.mit.edu	37	5	145649043	145649043	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145649043A>G	uc003lnz.3	+	17	2753	c.2587A>G	c.(2587-2589)ATG>GTG	p.M863V	RBM27_uc003lny.2_Missense_Mutation_p.M808V	NM_018989	NP_061862	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	863	Potential.				mRNA processing	cytoplasm|nuclear speck	nucleotide binding|RNA binding|zinc ion binding			central_nervous_system(2)|pancreas(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGCAAATATAATGAAGACTTT	0.299													8	22	---	---	---	---	PASS
TCERG1	10915	broad.mit.edu	37	5	145872476	145872476	+	Intron	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:145872476A>T	uc003lob.2	+						TCERG1_uc003loc.2_Intron	NM_006706	NP_006697	O14776	TCRG1_HUMAN	transcription elongation regulator 1 isoform 1						regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter	nucleus	protein binding|transcription coactivator activity			ovary(1)|skin(1)	2		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GTTGATTTTTATAATAGGTGT	0.303													11	12	---	---	---	---	PASS
JAKMIP2	9832	broad.mit.edu	37	5	147040947	147040947	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:147040947C>G	uc003loq.1	-	3	573	c.191G>C	c.(190-192)CGC>CCC	p.R64P	JAKMIP2_uc011dbx.1_Missense_Mutation_p.R22P|JAKMIP2_uc003lor.1_Missense_Mutation_p.R64P|uc003lop.1_3'UTR|JAKMIP2_uc010jgo.1_Missense_Mutation_p.R64P	NM_014790	NP_055605	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein	64	Potential.					Golgi apparatus				large_intestine(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGTGTGCTTGCGCTGCTCCAG	0.498													61	116	---	---	---	---	PASS
FAT2	2196	broad.mit.edu	37	5	150925635	150925635	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150925635T>C	uc003lue.3	-	9	5066	c.5053A>G	c.(5053-5055)ATG>GTG	p.M1685V	GM2A_uc011dcs.1_Intron	NM_001447	NP_001438	Q9NYQ8	FAT2_HUMAN	FAT tumor suppressor 2 precursor	1685	Cadherin 15.|Extracellular (Potential).				epithelial cell migration|homophilic cell adhesion	cell-cell adherens junction|integral to membrane|nucleus	calcium ion binding			ovary(4)|upper_aerodigestive_tract(1)|skin(1)	6		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGGGGCTCATAGCAGAGACA	0.438													34	47	---	---	---	---	PASS
BMP6	654	broad.mit.edu	37	6	7862712	7862712	+	Silent	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:7862712G>C	uc003mxu.3	+	4	1363	c.1185G>C	c.(1183-1185)GCG>GCC	p.A395A		NM_001718	NP_001709	P22004	BMP6_HUMAN	bone morphogenetic protein 6 preproprotein	395					BMP signaling pathway|cartilage development|growth|immune response|positive regulation of aldosterone biosynthetic process|positive regulation of bone mineralization|positive regulation of osteoblast differentiation|positive regulation of pathway-restricted SMAD protein phosphorylation|positive regulation of transcription from RNA polymerase II promoter|SMAD protein signal transduction	extracellular space	BMP receptor binding|cytokine activity|growth factor activity|protein heterodimerization activity			large_intestine(2)|ovary(1)	3	Ovarian(93;0.0721)					AGGACGTGGCGCGGGTCTCCA	0.577													14	68	---	---	---	---	PASS
PRL	5617	broad.mit.edu	37	6	22292835	22292835	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:22292835C>A	uc003ndp.2	-	3	763	c.244G>T	c.(244-246)GCC>TCC	p.A82S	PRL_uc003ndo.2_Missense_Mutation_p.A83S|PRL_uc003ndq.2_Missense_Mutation_p.A82S	NM_000948	NP_000939	P01236	PRL_HUMAN	prolactin precursor	82					cell proliferation|cell surface receptor linked signaling pathway|female pregnancy|lactation|positive regulation of JAK-STAT cascade|regulation of multicellular organism growth	cytosol|extracellular region	hormone activity|prolactin receptor binding				0	Ovarian(93;0.163)					CTGTTGATGGCCTTGGTAATG	0.478													20	66	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28227784	28227784	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28227784C>A	uc003nkt.2	+	1	687	c.635C>A	c.(634-636)ACA>AAA	p.T212K	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	212	Lys-rich.									upper_aerodigestive_tract(1)|ovary(1)	2						GAGTCTGACACAAATTCTGAC	0.249													6	61	---	---	---	---	PASS
C6orf25	80739	broad.mit.edu	37	6	31692575	31692575	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:31692575T>A	uc011doc.1	+	5	575	c.575T>A	c.(574-576)GTA>GAA	p.V192E	C6orf25_uc003nwk.2_Missense_Mutation_p.S198R|C6orf25_uc011dod.1_Missense_Mutation_p.V148E|C6orf25_uc011doe.1_Missense_Mutation_p.V168E|C6orf25_uc003nwo.2_Missense_Mutation_p.S154R|C6orf25_uc003nwn.2_Missense_Mutation_p.S198R	NM_138272	NP_612116	O95866	G6B_HUMAN	G6B protein isoform G6b-B precursor	192	Cytoplasmic (Potential).					endoplasmic reticulum|Golgi apparatus|integral to membrane|plasma membrane	heparin binding|receptor activity				0						CAGAGGCCAGTAAAGGAGGAA	0.577													23	59	---	---	---	---	PASS
FKBP5	2289	broad.mit.edu	37	6	35586995	35586995	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35586995G>C	uc011dte.1	-						FKBP5_uc003okx.2_Intron|FKBP5_uc011dtf.1_Intron|FKBP5_uc003oky.2_Intron|FKBP5_uc003okz.2_Intron	NM_001145776	NP_001139248	Q13451	FKBP5_HUMAN	FK506 binding protein 5 isoform 1						protein folding	cytoplasm|membrane|nucleus	FK506 binding|heat shock protein binding|peptidyl-prolyl cis-trans isomerase activity			ovary(1)	1						AATCTAGAAAGAAAAAAGGAA	0.363													16	58	---	---	---	---	PASS
MOCS1	4337	broad.mit.edu	37	6	39881519	39881519	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39881519T>A	uc003opb.2	-	4	782	c.644A>T	c.(643-645)AAG>ATG	p.K215M	MOCS1_uc003opa.2_Missense_Mutation_p.K215M|MOCS1_uc003opc.2_Missense_Mutation_p.K215M|MOCS1_uc003opd.2_Missense_Mutation_p.K215M|MOCS1_uc003ope.2_Missense_Mutation_p.K128M	NM_005942	NP_005933	Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis-step 1 protein	215	Molybdenum cofactor biosynthesis protein A.	GTP (By similarity).			Mo-molybdopterin cofactor biosynthetic process|Mo-molybdopterin cofactor biosynthetic process|water-soluble vitamin metabolic process	cytosol|molybdopterin synthase complex|nucleus	4 iron, 4 sulfur cluster binding|4 iron, 4 sulfur cluster binding|catalytic activity|GTP binding|metal ion binding			ovary(1)|liver(1)|central_nervous_system(1)	3	Ovarian(28;0.0355)|Colorectal(47;0.196)					CGGCCTCACCTTCACAGGGTT	0.617													30	46	---	---	---	---	PASS
NFYA	4800	broad.mit.edu	37	6	41057378	41057378	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:41057378G>A	uc003opo.2	+	5	548	c.370G>A	c.(370-372)GGC>AGC	p.G124S	NFYA_uc003opp.2_Missense_Mutation_p.G95S|NFYA_uc003opq.2_Missense_Mutation_p.G95S	NM_002505	NP_002496	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha isoform 1	124	Gln-rich.				transcription from RNA polymerase II promoter	CCAAT-binding factor complex	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity				0	Ovarian(28;0.0418)|Colorectal(47;0.196)					GCAGGTGCAGGGCCAGCAGGG	0.542													31	89	---	---	---	---	PASS
PTK7	5754	broad.mit.edu	37	6	43111279	43111279	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:43111279C>T	uc003oub.1	+	14	2370	c.2172C>T	c.(2170-2172)TTC>TTT	p.F724F	PTK7_uc003ouc.1_Silent_p.F668F|PTK7_uc003oud.1_Silent_p.F684F|PTK7_uc003oue.1_Silent_p.F594F|PTK7_uc003ouf.1_RNA|PTK7_uc003oug.1_RNA|PTK7_uc011dve.1_Silent_p.F732F|PTK7_uc010jyj.1_Intron	NM_002821	NP_002812	Q13308	PTK7_HUMAN	PTK7 protein tyrosine kinase 7 isoform a	724	Helical; (Potential).				actin cytoskeleton reorganization|canonical Wnt receptor signaling pathway|cell adhesion|cell migration	cell-cell junction|integral to plasma membrane	ATP binding|transmembrane receptor protein tyrosine kinase activity			ovary(2)|large_intestine(1)	3			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GCCTCATGTTCTACTGCAAGA	0.632											OREG0017450	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	36	91	---	---	---	---	PASS
CENPQ	55166	broad.mit.edu	37	6	49439895	49439895	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49439895A>T	uc003ozh.1	+	4	366	c.277A>T	c.(277-279)ATG>TTG	p.M93L		NM_018132	NP_060602	Q7L2Z9	CENPQ_HUMAN	centromere protein Q	93					CenH3-containing nucleosome assembly at centromere|mitotic prometaphase	chromosome, centromeric region|cytosol|nucleoplasm				ovary(2)	2	Lung NSC(77;0.0128)					ATCAGTAATAATGTGAGTATA	0.343													16	78	---	---	---	---	PASS
HMGCLL1	54511	broad.mit.edu	37	6	55441932	55441932	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:55441932G>T	uc003pcn.2	-	2	301	c.142C>A	c.(142-144)CCC>ACC	p.P48T	HMGCLL1_uc003pco.2_Intron|HMGCLL1_uc010jzx.2_Intron|HMGCLL1_uc011dxc.1_Intron|HMGCLL1_uc011dxd.1_Intron|HMGCLL1_uc011dxe.1_Intron|HMGCLL1_uc003pcp.2_Intron	NM_019036	NP_061909	Q8TB92	HMGC2_HUMAN	3-hydroxymethyl-3-methylglutaryl-Coenzyme A	48							hydroxymethylglutaryl-CoA lyase activity|metal ion binding			skin(2)|ovary(1)|pancreas(1)	4	Lung NSC(77;0.0875)		LUSC - Lung squamous cell carcinoma(124;0.23)			gagacatcgggctgaaagcag	0.000													8	14	---	---	---	---	PASS
BAI3	577	broad.mit.edu	37	6	69703705	69703705	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:69703705G>T	uc003pev.3	+	11	2228	c.1780G>T	c.(1780-1782)GGA>TGA	p.G594*	BAI3_uc010kak.2_Nonsense_Mutation_p.G594*	NM_001704	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	594	Extracellular (Potential).				negative regulation of angiogenesis|neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			lung(27)|ovary(8)|skin(6)|pancreas(4)|central_nervous_system(3)|urinary_tract(1)|breast(1)	50		all_lung(197;0.212)				GGCAGGTGATGGAATGTCCCA	0.433													79	252	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76751710	76751710	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76751710T>A	uc003pik.1	-	2	331	c.201A>T	c.(199-201)CGA>CGT	p.R67R		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	67					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				ATCTTTTTGTTCGATGCTTTG	0.368													52	140	---	---	---	---	PASS
MDN1	23195	broad.mit.edu	37	6	90425430	90425430	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:90425430T>A	uc003pnn.1	-	45	6918	c.6802A>T	c.(6802-6804)AGT>TGT	p.S2268C		NM_014611	NP_055426	Q9NU22	MDN1_HUMAN	MDN1, midasin homolog	2268					protein complex assembly|regulation of protein complex assembly	nucleus	ATP binding|ATPase activity|unfolded protein binding			ovary(8)|skin(2)	10		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CCTCTCTCACTAATAGTGAGG	0.458													57	141	---	---	---	---	PASS
KIAA0776	23376	broad.mit.edu	37	6	96999300	96999300	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:96999300C>T	uc003por.2	+						KIAA0776_uc010kck.2_Intron	NM_015323	NP_056138	O94874	UFL1_HUMAN	hypothetical protein LOC23376						negative regulation of NF-kappaB transcription factor activity|negative regulation of protein ubiquitination|protein ufmylation	endoplasmic reticulum|nucleus	protein binding|UFM1 conjugating enzyme activity			ovary(1)	1		all_cancers(76;5.83e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0604)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0934)		TTTTCATTTACCCCTACAGAT	0.299													17	60	---	---	---	---	PASS
C6orf168	84553	broad.mit.edu	37	6	99797249	99797249	+	5'UTR	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99797249G>A	uc003ppj.3	-	1						NM_032511	NP_115900	Q5TGI0	CF168_HUMAN	hypothetical protein LOC84553											ovary(2)|central_nervous_system(1)	3		all_cancers(76;1.63e-06)|Acute lymphoblastic leukemia(125;5.12e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00898)|Colorectal(196;0.0699)|Lung NSC(302;0.198)		BRCA - Breast invasive adenocarcinoma(108;0.073)		CCCAGTGCATGCTGCGCGGCT	0.632													19	63	---	---	---	---	PASS
SLC22A16	85413	broad.mit.edu	37	6	110777877	110777877	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:110777877G>T	uc003puf.2	-	2	464	c.397C>A	c.(397-399)CAG>AAG	p.Q133K	SLC22A16_uc003pue.2_Missense_Mutation_p.Q114K|SLC22A16_uc003pug.2_Missense_Mutation_p.Q133K	NM_033125	NP_149116	Q86VW1	S22AG_HUMAN	solute carrier family 22, member 16	133					acid secretion|cell differentiation|multicellular organismal development|single fertilization|sperm motility|spermatogenesis	integral to membrane	carnitine transporter activity			ovary(1)	1		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)		CATGTGTTCTGGTCATATATG	0.468													41	108	---	---	---	---	PASS
ROS1	6098	broad.mit.edu	37	6	117631248	117631248	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:117631248C>T	uc003pxp.1	-	40	6629	c.6430G>A	c.(6430-6432)GTA>ATA	p.V2144I	ROS1_uc011ebi.1_RNA	NM_002944	NP_002935	P08922	ROS_HUMAN	proto-oncogene c-ros-1 protein precursor	2144	Protein kinase.|Cytoplasmic (Potential).				transmembrane receptor protein tyrosine kinase signaling pathway	membrane fraction|sodium:potassium-exchanging ATPase complex	ATP binding|transmembrane receptor protein tyrosine kinase activity			lung(8)|ovary(6)|central_nervous_system(3)|skin(3)|stomach(2)|breast(2)|large_intestine(1)	25		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ACTTACCATACATCAGATTGA	0.289			T	GOPC|ROS1	glioblastoma|NSCLC								53	165	---	---	---	---	PASS
BCLAF1	9774	broad.mit.edu	37	6	136599627	136599627	+	Missense_Mutation	SNP	C	G	G	rs149799182		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:136599627C>G	uc003qgx.1	-	4	645	c.392G>C	c.(391-393)CGG>CCG	p.R131P	BCLAF1_uc003qgw.1_Missense_Mutation_p.R131P|BCLAF1_uc003qgy.1_Missense_Mutation_p.R129P|BCLAF1_uc011edc.1_RNA|BCLAF1_uc011edd.1_RNA|BCLAF1_uc011ede.1_Missense_Mutation_p.R129P	NM_014739	NP_055554	Q9NYF8	BCLF1_HUMAN	BCL2-associated transcription factor 1 isoform	131					induction of apoptosis|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus	DNA binding|protein binding			ovary(1)	1	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00226)|OV - Ovarian serous cystadenocarcinoma(155;0.00331)		TCTATATGACCGGCGAGATCT	0.448													38	287	---	---	---	---	PASS
ULBP1	80329	broad.mit.edu	37	6	150291168	150291168	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:150291168C>T	uc003qnp.2	+	4	685	c.642C>T	c.(640-642)GCC>GCT	p.A214A		NM_025218	NP_079494	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1 precursor	214					antigen processing and presentation|immune response|natural killer cell activation|regulation of immune response	anchored to membrane|endoplasmic reticulum|MHC class I protein complex	MHC class I receptor activity			pancreas(1)	1		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		CCTCTCTGGCCCCAGGCACAA	0.562													3	29	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152488959	152488959	+	Intron	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152488959C>A	uc010kiw.2	-						SYNE1_uc010kiv.2_Intron|SYNE1_uc003qos.3_Intron|SYNE1_uc003qot.3_Intron|SYNE1_uc003qou.3_Intron|SYNE1_uc003qop.3_Intron|SYNE1_uc011eez.1_Intron|SYNE1_uc003qoq.3_Intron|SYNE1_uc003qor.3_Intron	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTCTCTACTCTAGCCATACT	0.428										HNSCC(10;0.0054)			13	36	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152712636	152712636	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152712636C>A	uc010kiw.2	-	52	8382	c.7780G>T	c.(7780-7782)GAG>TAG	p.E2594*	SYNE1_uc003qot.3_Nonsense_Mutation_p.E2601*|SYNE1_uc003qou.3_Nonsense_Mutation_p.E2594*|SYNE1_uc010kjb.1_Nonsense_Mutation_p.E2577*	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	2594	Cytoplasmic (Potential).|Spectrin 5.				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		AGGCGGCCCTCCTGCCCAGCA	0.488										HNSCC(10;0.0054)			17	74	---	---	---	---	PASS
IGF2R	3482	broad.mit.edu	37	6	160526034	160526034	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160526034G>C	uc003qta.2	+	48	7542	c.7394G>C	c.(7393-7395)AGC>ACC	p.S2465T		NM_000876	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor precursor	2465	Cytoplasmic (Potential).				receptor-mediated endocytosis	cell surface|endocytic vesicle|endosome|integral to plasma membrane|lysosomal membrane|trans-Golgi network transport vesicle	glycoprotein binding|insulin-like growth factor receptor activity|phosphoprotein binding|transporter activity			ovary(3)	3		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)		GGGAAGTCCAGCTCTGCACAG	0.592													24	24	---	---	---	---	PASS
UNC93A	54346	broad.mit.edu	37	6	167708167	167708167	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:167708167G>T	uc003qvq.2	+	2	425	c.250G>T	c.(250-252)GGC>TGC	p.G84C	UNC93A_uc003qvr.2_Missense_Mutation_p.G84C	NM_018974	NP_061847	Q86WB7	UN93A_HUMAN	unc-93 homolog A isoform 1	84	Helical; (Potential).					integral to membrane|plasma membrane					0		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		CTTCTCCGTGGGCAACTTCTT	0.632													54	137	---	---	---	---	PASS
ABCB5	340273	broad.mit.edu	37	7	20739496	20739496	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20739496T>A	uc003suw.3	+	9	1414	c.868T>A	c.(868-870)TAT>AAT	p.Y290N	ABCB5_uc010kuh.2_Missense_Mutation_p.Y735N	NM_178559	NP_848654	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B, member 5	290	Cytoplasmic (Potential).|ABC transmembrane type-1.				regulation of membrane potential	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus	ATP binding|ATPase activity, coupled to transmembrane movement of substances|efflux transmembrane transporter activity			skin(2)|large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|pancreas(1)	6						TGCAGAAATTTATTCCATGAT	0.313													16	52	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21640295	21640295	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21640295A>G	uc003svc.2	+	16	3033	c.3002A>G	c.(3001-3003)AAT>AGT	p.N1001S		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1001	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTCATTTAGAATGATATGGAT	0.388									Kartagener_syndrome				67	217	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21775274	21775274	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21775274C>A	uc003svc.2	+	47	7509	c.7478C>A	c.(7477-7479)ACA>AAA	p.T2493K		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2493	AAA 3 (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						CTCGTTCACACAACAGAGACA	0.289									Kartagener_syndrome				6	13	---	---	---	---	PASS
HOXA1	3198	broad.mit.edu	37	7	27135018	27135018	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27135018C>A	uc003sye.2	-	1	608	c.514G>T	c.(514-516)GCC>TCC	p.A172S	HOXA1_uc003syd.2_Intron|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	172						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						GTAGCCAGGGCCAGGCTCTGG	0.592													47	135	---	---	---	---	PASS
HOXA1	3198	broad.mit.edu	37	7	27135019	27135019	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27135019C>A	uc003sye.2	-	1	607	c.513G>T	c.(511-513)CTG>CTT	p.L171L	HOXA1_uc003syd.2_Intron|uc003syg.2_5'Flank	NM_005522	NP_005513	P49639	HXA1_HUMAN	homeobox A1 isoform a	171						nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)	3						TAGCCAGGGCCAGGCTCTGGT	0.597													47	139	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28844106	28844106	+	Silent	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28844106A>T	uc003szq.2	+	8	1383	c.993A>T	c.(991-993)CCA>CCT	p.P331P	CREB5_uc003szo.2_Silent_p.P298P|CREB5_uc003szr.2_Silent_p.P324P|CREB5_uc003szs.2_Silent_p.P192P	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	331					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						AGACCTCGCCACATCCGCCCC	0.318													53	185	---	---	---	---	PASS
CREB5	9586	broad.mit.edu	37	7	28848876	28848876	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:28848876C>G	uc003szq.2	+	9	1489	c.1099C>G	c.(1099-1101)CGA>GGA	p.R367G	CREB5_uc003szo.2_Missense_Mutation_p.R334G|CREB5_uc003szr.2_Missense_Mutation_p.R360G|CREB5_uc003szs.2_Missense_Mutation_p.R228G	NM_182898	NP_878901	Q02930	CREB5_HUMAN	cAMP responsive element binding protein 5	367					positive regulation of transcription, DNA-dependent|transcription from RNA polymerase II promoter		protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			skin(2)	2						GGGGCGCCGGCGAAGGGTGGT	0.627													24	56	---	---	---	---	PASS
GPR141	353345	broad.mit.edu	37	7	37780665	37780665	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37780665C>T	uc003tfm.1	+	1	670	c.670C>T	c.(670-672)CAG>TAG	p.Q224*	uc003tfl.2_Intron	NM_181791	NP_861456	Q7Z602	GP141_HUMAN	G protein-coupled receptor 141	224	Cytoplasmic (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(3)	3						GTTCTGGGCTCAGCTGAAAAA	0.438													62	156	---	---	---	---	PASS
RALA	5898	broad.mit.edu	37	7	39736308	39736308	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:39736308A>T	uc003thd.2	+	4	648	c.348A>T	c.(346-348)GAA>GAT	p.E116D		NM_005402	NP_005393	P11233	RALA_HUMAN	ras related v-ral simian leukemia viral oncogene	116					actin cytoskeleton reorganization|cell cycle|chemotaxis|cytokinesis|exocytosis|interspecies interaction between organisms|membrane raft localization|nerve growth factor receptor signaling pathway|positive regulation of filopodium assembly|Ras protein signal transduction|regulation of exocytosis	cell surface|cleavage furrow|cytosol|midbody|plasma membrane	Edg-2 lysophosphatidic acid receptor binding|GTP binding|GTPase activity			lung(1)|skin(1)	2						GAGTAAAAGAAGATGAGAATG	0.264													19	50	---	---	---	---	PASS
GLI3	2737	broad.mit.edu	37	7	42006047	42006047	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:42006047C>A	uc011kbh.1	-	15	2715	c.2624G>T	c.(2623-2625)CGC>CTC	p.R875L	GLI3_uc011kbg.1_Missense_Mutation_p.R816L	NM_000168	NP_000159	P10071	GLI3_HUMAN	GLI-Kruppel family member GLI3	875					negative regulation of alpha-beta T cell differentiation|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of smoothened signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative thymic T cell selection|positive regulation of alpha-beta T cell differentiation|positive regulation of transcription from RNA polymerase II promoter|thymocyte apoptosis	cilium|cytosol|nucleolus	beta-catenin binding|histone acetyltransferase binding|histone deacetylase binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(11)|ovary(3)|large_intestine(2)|central_nervous_system(1)|kidney(1)|pancreas(1)	19						CTCGCTGGAGCGGCGGCTGGA	0.687									Greig_Cephalopolysyndactyly|Pallister-Hall_syndrome				10	18	---	---	---	---	PASS
BAZ1B	9031	broad.mit.edu	37	7	72907247	72907247	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:72907247G>A	uc003tyc.2	-	5	921	c.576C>T	c.(574-576)GAC>GAT	p.D192D		NM_032408	NP_115784	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	192	Mediates the tyrosine-protein kinase activity.				ATP-dependent chromatin remodeling|chromatin-mediated maintenance of transcription|DNA replication-dependent nucleosome disassembly|double-strand break repair|heart morphogenesis|transcription, DNA-dependent	WINAC complex	ATP binding|chromatin binding|histone acetyl-lysine binding|histone kinase activity|non-membrane spanning protein tyrosine kinase activity|protein complex scaffold|vitamin D receptor activator activity|vitamin D receptor binding|zinc ion binding			ovary(4)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	7		Lung NSC(55;0.0659)|all_lung(88;0.152)				TACGTGCTCTGTCATCTAGTC	0.269													12	50	---	---	---	---	PASS
PCLO	27445	broad.mit.edu	37	7	82585984	82585984	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:82585984C>T	uc003uhx.2	-	5	4574	c.4285G>A	c.(4285-4287)GAT>AAT	p.D1429N	PCLO_uc003uhv.2_Missense_Mutation_p.D1429N	NM_033026	NP_149015	Q9Y6V0	PCLO_HUMAN	piccolo isoform 1	1360					cytoskeleton organization|synaptic vesicle exocytosis	cell junction|cytoskeleton|synaptic vesicle	calcium ion binding|calcium-dependent phospholipid binding|profilin binding|transporter activity			ovary(7)	7						GACTTTTCATCAGCAAGTGTA	0.403													38	98	---	---	---	---	PASS
KIAA1324L	222223	broad.mit.edu	37	7	86522259	86522259	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:86522259T>A	uc011kha.1	-	20	3028	c.2843A>T	c.(2842-2844)TAC>TTC	p.Y948F	KIAA1324L_uc003uif.1_Missense_Mutation_p.Y708F|KIAA1324L_uc011kgz.1_Missense_Mutation_p.Y834F|KIAA1324L_uc003uie.2_Missense_Mutation_p.Y781F	NM_001142749	NP_001136221	A8MWY0	K132L_HUMAN	hypothetical protein LOC222223 isoform 1	948	Helical; (Potential).					integral to membrane				ovary(6)|skin(1)	7	Esophageal squamous(14;0.0058)					TTTCCAGAAGTAGCAGGTCAG	0.443													43	91	---	---	---	---	PASS
PDK4	5166	broad.mit.edu	37	7	95222082	95222082	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95222082C>A	uc003uoa.2	-	4	839	c.519G>T	c.(517-519)ATG>ATT	p.M173I	PDK4_uc003unz.2_5'Flank	NM_002612	NP_002603	Q16654	PDK4_HUMAN	pyruvate dehydrogenase kinase 4 precursor	173	Histidine kinase.				glucose metabolic process|peptidyl-histidine phosphorylation|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	ATP binding|pyruvate dehydrogenase (acetyl-transferring) kinase activity|two-component sensor activity				0	all_cancers(62;1.06e-10)|all_epithelial(64;1.04e-09)|Lung NSC(181;0.128)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0151)			TGTGCTGGTTCATCAGCATCC	0.383													28	92	---	---	---	---	PASS
ARPC1A	10552	broad.mit.edu	37	7	98957174	98957174	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:98957174G>A	uc003upx.1	+	8	943	c.796G>A	c.(796-798)GAC>AAC	p.D266N	ARPC1A_uc010lfu.1_RNA|ARPC1A_uc003upy.1_Missense_Mutation_p.D252N|ARPC1A_uc011kit.1_RNA	NM_006409	NP_006400	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex subunit 1A	266	WD 5.				actin cytoskeleton organization|regulation of actin filament polymerization	actin cytoskeleton|cytoplasm	actin binding			ovary(1)	1	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			TCAGGGCCATGACTGCTGCCC	0.532													12	32	---	---	---	---	PASS
LRRN3	54674	broad.mit.edu	37	7	110763987	110763987	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:110763987C>T	uc003vft.3	+	4	2205	c.1159C>T	c.(1159-1161)CGA>TGA	p.R387*	IMMP2L_uc003vfq.1_Intron|IMMP2L_uc010ljr.1_Intron|IMMP2L_uc003vfr.2_Intron|LRRN3_uc003vfu.3_Nonsense_Mutation_p.R387*|LRRN3_uc003vfs.3_Nonsense_Mutation_p.R387*	NM_001099660	NP_001093130	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3 precursor	387	Extracellular (Potential).|LRRCT.					integral to membrane				skin(3)|ovary(2)|pancreas(2)|central_nervous_system(1)	8				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		AACCAACATTCGATTCATGGA	0.453													26	67	---	---	---	---	PASS
DOCK4	9732	broad.mit.edu	37	7	111509672	111509672	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:111509672G>T	uc003vfx.2	-	21	2336	c.2067C>A	c.(2065-2067)ATC>ATA	p.I689I	DOCK4_uc003vfw.2_Silent_p.I130I|DOCK4_uc003vfy.2_Silent_p.I689I|DOCK4_uc003vga.1_Silent_p.I294I	NM_014705	NP_055520	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	689					cell chemotaxis	cytosol|endomembrane system|membrane|stereocilium	GTP binding|guanyl-nucleotide exchange factor activity|PDZ domain binding|Rac GTPase activator activity|Rac GTPase binding|receptor tyrosine kinase binding|SH3 domain binding			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)	4		Acute lymphoblastic leukemia(1;0.0441)				CTGCTTCTGTGATCCGGTCCA	0.423													19	50	---	---	---	---	PASS
KCND2	3751	broad.mit.edu	37	7	119915291	119915291	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:119915291A>T	uc003vjj.1	+	1	1570	c.605A>T	c.(604-606)AAT>ATT	p.N202I		NM_012281	NP_036413	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related	202	Helical; Name=Segment S1; (Potential).				regulation of action potential|synaptic transmission	cell surface|dendritic spine	metal ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5	all_neural(327;0.117)					GTCATCGCGAATGTGGTGGAA	0.572													26	85	---	---	---	---	PASS
ZNF800	168850	broad.mit.edu	37	7	127026190	127026190	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:127026190T>A	uc003vlx.1	-	3	344	c.81A>T	c.(79-81)GGA>GGT	p.G27G	ZNF800_uc003vlw.1_5'UTR|ZNF800_uc003vly.1_Silent_p.G27G|ZNF800_uc010lla.2_Silent_p.G27G	NM_176814	NP_789784	Q2TB10	ZN800_HUMAN	zinc finger protein 800	27					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAGGAGGATCTCCAGGTTCCA	0.353													40	104	---	---	---	---	PASS
OR6B1	135946	broad.mit.edu	37	7	143701707	143701707	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143701707C>T	uc003wdt.1	+	1	618	c.618C>T	c.(616-618)ATC>ATT	p.I206I		NM_001005281	NP_001005281	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B,	206	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.0783)					CACTGGTCATCTTCCTATTCC	0.458													54	169	---	---	---	---	PASS
OR2A5	393046	broad.mit.edu	37	7	143747840	143747840	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:143747840G>C	uc011ktw.1	+	1	346	c.346G>C	c.(346-348)GTA>CTA	p.V116L		NM_012365	NP_036497	Q96R48	OR2A5_HUMAN	olfactory receptor, family 2, subfamily A,	116	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Melanoma(164;0.0783)					TCTCATCTTGGTAATGATGTC	0.453													100	233	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	144708090	144708090	+	IGR	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:144708090C>A								TPK1 (174944 upstream) : None (None downstream)																							GGACCTTTAACATTTAGATCA	0.373													29	60	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	146997380	146997380	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:146997380G>C	uc003weu.1	+	9	2012	c.1496G>C	c.(1495-1497)GGA>GCA	p.G499A		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	499	Extracellular (Potential).|Laminin G-like 2.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TACTTTTTTGGAGGTAAGAAT	0.348										HNSCC(39;0.1)			34	67	---	---	---	---	PASS
MIR153-2	406945	broad.mit.edu	37	7	157367056	157367056	+	RNA	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:157367056T>C	hsa-mir-153-2|MI0000464	-			c.59T>C			PTPRN2_uc003wno.2_Intron|PTPRN2_uc003wnp.2_Intron|PTPRN2_uc003wnq.2_Intron|PTPRN2_uc003wnr.2_Intron|PTPRN2_uc011kwa.1_Intron|uc011kwb.1_RNA																	0						CTTTTGTGACTATGCAACTGG	0.488													45	98	---	---	---	---	PASS
MYOM2	9172	broad.mit.edu	37	8	2050546	2050546	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2050546G>T	uc003wpx.3	+	21	2847	c.2709G>T	c.(2707-2709)GAG>GAT	p.E903D	MYOM2_uc011kwi.1_Missense_Mutation_p.E328D	NM_003970	NP_003961	P54296	MYOM2_HUMAN	myomesin 2	903	Fibronectin type-III 5.				muscle contraction	myosin filament	structural constituent of muscle			ovary(4)|central_nervous_system(1)|skin(1)	6		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		ACACGTCGGAGCCTGTGCTGG	0.498													23	40	---	---	---	---	PASS
CSMD1	64478	broad.mit.edu	37	8	2966117	2966117	+	Intron	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:2966117C>G	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc010lrg.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAGTGAAAATCAACTGACCGT	0.483													4	20	---	---	---	---	PASS
MSR1	4481	broad.mit.edu	37	8	16026114	16026114	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:16026114G>T	uc003wwz.2	-	4	681	c.483C>A	c.(481-483)ACC>ACA	p.T161T	MSR1_uc010lsu.2_Silent_p.T179T|MSR1_uc003wxa.2_Silent_p.T161T|MSR1_uc003wxb.2_Silent_p.T161T|MSR1_uc011kxz.1_Intron	NM_138715	NP_619729	P21757	MSRE_HUMAN	macrophage scavenger receptor 1 isoform type 1	161	Extracellular (Potential).				cholesterol transport|plasma lipoprotein particle clearance|positive regulation of cholesterol storage|positive regulation of macrophage derived foam cell differentiation|receptor-mediated endocytosis	collagen|integral to plasma membrane|low-density lipoprotein particle	low-density lipoprotein particle binding|protein binding|scavenger receptor activity			ovary(1)	1				Colorectal(111;0.00475)|COAD - Colon adenocarcinoma(73;0.0164)		AGGAAAACAAGGTACTTAGCT	0.388													41	145	---	---	---	---	PASS
LZTS1	11178	broad.mit.edu	37	8	20112616	20112616	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:20112616C>T	uc003wzr.2	-	1	188	c.77G>A	c.(76-78)CGC>CAC	p.R26H	LZTS1_uc010ltg.1_Missense_Mutation_p.R26H	NM_021020	NP_066300	Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	26					cell cycle|termination of RNA polymerase III transcription|transcription elongation from RNA polymerase III promoter	cell junction|dendritic spine|Golgi apparatus|nucleolus|nucleoplasm|postsynaptic density|postsynaptic membrane	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGAGGACTTGCGCAGCTTGTA	0.612													7	100	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25323754	25323754	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25323754G>T	uc003xep.1	+	5	930	c.451G>T	c.(451-453)GCT>TCT	p.A151S	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.A151S|CDCA2_uc003xeq.1_Missense_Mutation_p.A136S|CDCA2_uc003xer.1_5'Flank	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	151					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		CTTCCAGTCAGCTTTTCACTC	0.408													9	74	---	---	---	---	PASS
CDCA2	157313	broad.mit.edu	37	8	25323755	25323755	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25323755C>A	uc003xep.1	+	5	931	c.452C>A	c.(451-453)GCT>GAT	p.A151D	PPP2R2A_uc003xek.2_Intron|CDCA2_uc011lae.1_Missense_Mutation_p.A151D|CDCA2_uc003xeq.1_Missense_Mutation_p.A136D|CDCA2_uc003xer.1_5'Flank	NM_152562	NP_689775	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	151					cell division|mitosis	cytoplasm|nucleus					0		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		TTCCAGTCAGCTTTTCACTCC	0.403													8	75	---	---	---	---	PASS
C8orf41	80185	broad.mit.edu	37	8	33371000	33371000	+	5'Flank	SNP	T	A	A	rs11785910		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:33371000T>A	uc003xjl.3	-						C8orf41_uc003xjk.3_5'Flank|C8orf41_uc010lvv.2_5'Flank|C8orf41_uc003xjm.3_5'Flank|C8orf41_uc003xjn.1_5'Flank	NM_025115	NP_079391	Q6NXR4	CH041_HUMAN	hypothetical protein LOC80185								binding				0				KIRC - Kidney renal clear cell carcinoma(67;0.0923)|Kidney(114;0.111)		ATgatccttttgtagttcatg	0.179													34	112	---	---	---	---	PASS
ANK1	286	broad.mit.edu	37	8	41555549	41555549	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41555549G>C	uc003xok.2	-						NKX6-3_uc010lxa.1_Intron|ANK1_uc003xoh.2_Intron|ANK1_uc003xoi.2_Intron|ANK1_uc003xoj.2_Intron|ANK1_uc003xol.2_Intron|ANK1_uc003xom.2_Intron	NM_020476	NP_065209	P16157	ANK1_HUMAN	ankyrin 1 isoform 1						axon guidance|cytoskeleton organization|exocytosis|maintenance of epithelial cell apical/basal polarity|signal transduction	basolateral plasma membrane|cytosol|sarcomere|sarcoplasmic reticulum|spectrin-associated cytoskeleton	cytoskeletal adaptor activity|enzyme binding|protein binding|spectrin binding|structural constituent of cytoskeleton			ovary(3)|central_nervous_system(3)|lung(2)|breast(1)	9	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCACAGAGAAGGAGCTTCTCA	0.552													13	51	---	---	---	---	PASS
POTEA	340441	broad.mit.edu	37	8	43197382	43197382	+	Nonsense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:43197382C>G	uc003xpz.1	+	11	1314	c.1271C>G	c.(1270-1272)TCA>TGA	p.S424*	POTEA_uc003xqa.1_Nonsense_Mutation_p.S378*	NM_001005365	NP_001005365	Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A isoform 2	424										ovary(1)	1						ACATGGCCATCAGAAATAGCG	0.338													28	85	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321288	52321288	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321288C>A	uc003xqu.3	-	17	2997	c.2896G>T	c.(2896-2898)GCT>TCT	p.A966S	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	966					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GCGGCCAGAGCCAGATGCTCG	0.642													4	17	---	---	---	---	PASS
NPBWR1	2831	broad.mit.edu	37	8	53852521	53852521	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:53852521C>A	uc011ldu.1	+	1	54	c.54C>A	c.(52-54)GAC>GAA	p.D18E		NM_005285	NP_005276	P48145	NPBW1_HUMAN	G protein-coupled receptor 7	18	Extracellular (Potential).				synaptic transmission	plasma membrane	opioid receptor activity|protein binding			ovary(2)|breast(1)	3		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				CGGGCCCGGACCCGGCGCTGA	0.716													16	25	---	---	---	---	PASS
RUNX1T1	862	broad.mit.edu	37	8	93003903	93003903	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:93003903T>A	uc003yfd.2	-	6	1039	c.955A>T	c.(955-957)AGC>TGC	p.S319C	RUNX1T1_uc003yfc.1_Missense_Mutation_p.S292C|RUNX1T1_uc003yfe.1_Missense_Mutation_p.S282C|RUNX1T1_uc010mao.2_Missense_Mutation_p.S292C|RUNX1T1_uc011lgi.1_Missense_Mutation_p.S330C|RUNX1T1_uc010man.1_5'UTR|RUNX1T1_uc003yfb.1_Missense_Mutation_p.S282C	NM_175634	NP_783552	Q06455	MTG8_HUMAN	acute myelogenous leukemia 1 translocation 1	319					generation of precursor metabolites and energy	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			lung(9)|large_intestine(3)|breast(2)|central_nervous_system(1)|pancreas(1)	16			BRCA - Breast invasive adenocarcinoma(11;0.0141)			TCCCTGTGGCTGGGGTGTCGA	0.537													48	121	---	---	---	---	PASS
POP1	10940	broad.mit.edu	37	8	99170282	99170282	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99170282C>T	uc003yij.3	+	16	2958	c.2858C>T	c.(2857-2859)CCG>CTG	p.P953L	POP1_uc011lgv.1_Missense_Mutation_p.P953L|POP1_uc003yik.2_Missense_Mutation_p.P953L	NM_001145860	NP_001139332	Q99575	POP1_HUMAN	processing of precursor 1	953					tRNA 5'-leader removal|tRNA catabolic process	nucleolar ribonuclease P complex|ribonuclease MRP complex	identical protein binding|ribonuclease MRP activity|ribonuclease P activity			ovary(1)|breast(1)	2	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GGCCCTCTGCCGCGTGTGACG	0.582													81	177	---	---	---	---	PASS
PABPC1	26986	broad.mit.edu	37	8	101733610	101733610	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101733610G>A	uc003yjs.1	-						PABPC1_uc011lhc.1_Intron|PABPC1_uc011lhd.1_Intron|PABPC1_uc003yjt.1_Intron|PABPC1_uc003yju.2_Intron	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1						mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			cgcGGAGCCCGGCGCTCACCG	0.368													5	9	---	---	---	---	PASS
DPYS	1807	broad.mit.edu	37	8	105405140	105405140	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:105405140C>T	uc003yly.3	-	8	1444	c.1315G>A	c.(1315-1317)GTG>ATG	p.V439M	DPYS_uc010mcf.1_Missense_Mutation_p.V9M	NM_001385	NP_001376	Q14117	DPYS_HUMAN	dihydropyrimidinase	439					protein homotetramerization|pyrimidine nucleoside catabolic process|thymine catabolic process|uracil catabolic process	cytosol	dihydropyrimidinase activity|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)	2			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAAATAGTCACAAGGGGCACC	0.428													58	126	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109241376	109241376	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109241376C>A	uc003ymu.2	-	6	548	c.520G>T	c.(520-522)GCC>TCC	p.A174S	EIF3E_uc003ymt.2_Missense_Mutation_p.A125S|EIF3E_uc003ymv.2_Missense_Mutation_p.A81S|EIF3E_uc010mci.1_Missense_Mutation_p.A174S	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	174	Sufficient for interaction with TRIM27.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			ATTTCAGAGGCCAGCTTTCCC	0.358													27	104	---	---	---	---	PASS
EIF3E	3646	broad.mit.edu	37	8	109241378	109241378	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109241378A>G	uc003ymu.2	-	6	546	c.518T>C	c.(517-519)CTG>CCG	p.L173P	EIF3E_uc003ymt.2_Missense_Mutation_p.L124P|EIF3E_uc003ymv.2_Missense_Mutation_p.L80P|EIF3E_uc010mci.1_Missense_Mutation_p.L173P	NM_001568	NP_001559	P60228	EIF3E_HUMAN	eukaryotic translation initiation factor 3,	173	Sufficient for interaction with TRIM27.				negative regulation of translational initiation|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	cytosol|eukaryotic translation initiation factor 3 complex|PML body	protein N-terminus binding			ovary(2)|kidney(1)	3			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			TTCAGAGGCCAGCTTTCCCCA	0.358													28	104	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113277673	113277673	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113277673C>A	uc003ynu.2	-	60	9814	c.9655G>T	c.(9655-9657)GGC>TGC	p.G3219C	CSMD3_uc003yns.2_Missense_Mutation_p.G2421C|CSMD3_uc003ynt.2_Missense_Mutation_p.G3179C|CSMD3_uc011lhx.1_Missense_Mutation_p.G3050C	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3219	Extracellular (Potential).|Sushi 24.					integral to membrane|plasma membrane		p.T3214_W3221del(1)		ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTCCATGTGCCATTAATTGTA	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			47	116	---	---	---	---	PASS
SLC30A8	169026	broad.mit.edu	37	8	118173999	118173999	+	Nonsense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:118173999A>T	uc003yoh.2	+	5	825	c.595A>T	c.(595-597)AGA>TGA	p.R199*	SLC30A8_uc010mcz.2_Nonsense_Mutation_p.R150*|SLC30A8_uc011lia.1_Nonsense_Mutation_p.R150*|SLC30A8_uc003yog.2_Nonsense_Mutation_p.R150*	NM_173851	NP_776250	Q8IWU4	ZNT8_HUMAN	solute carrier family 30 member 8	199	HXXXXX[HY]NH-motif.|Cytoplasmic (Potential).				insulin secretion|positive regulation of insulin secretion|regulation of sequestering of zinc ion|regulation of vesicle-mediated transport|response to glucose stimulus|sequestering of zinc ion	integral to membrane|plasma membrane|secretory granule membrane|transport vesicle membrane	protein homodimerization activity|zinc ion transmembrane transporter activity			ovary(2)|skin(2)	4	all_cancers(13;2.11e-22)|Lung NSC(37;6.08e-05)|Ovarian(258;0.0173)		STAD - Stomach adenocarcinoma(47;0.203)			TTTGCACCAGAGATGCCTTGG	0.458													24	78	---	---	---	---	PASS
ATAD2	29028	broad.mit.edu	37	8	124382061	124382061	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:124382061T>G	uc003yqh.3	-	7	1039	c.931A>C	c.(931-933)AAA>CAA	p.K311Q	ATAD2_uc011lii.1_Missense_Mutation_p.K102Q|ATAD2_uc003yqi.3_RNA|ATAD2_uc003yqj.2_Missense_Mutation_p.K311Q	NM_014109	NP_054828	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	311					regulation of transcription, DNA-dependent|transcription, DNA-dependent	mitochondrion|nucleus	ATP binding|ATPase activity			ovary(2)	2	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			TAGCACTTACTTTCCAATGGA	0.254													26	70	---	---	---	---	PASS
FER1L6	654463	broad.mit.edu	37	8	125076747	125076747	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125076747C>T	uc003yqw.2	+	26	3694	c.3488C>T	c.(3487-3489)TCA>TTA	p.S1163L	uc003yqy.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6	1163	Cytoplasmic (Potential).					integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			GTCCCTGACTCATCCCCGATG	0.552													39	56	---	---	---	---	PASS
TSNARE1	203062	broad.mit.edu	37	8	143381929	143381929	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143381929T>A	uc003ywk.2	-	10	1326	c.1208A>T	c.(1207-1209)CAG>CTG	p.Q403L	TSNARE1_uc011lju.1_Missense_Mutation_p.Q402L|TSNARE1_uc003ywj.2_Missense_Mutation_p.Q404L|TSNARE1_uc003ywl.3_Missense_Mutation_p.Q184L	NM_145003	NP_659440	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	403					vesicle-mediated transport	integral to membrane					0	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					CGCCTGCTCCTGGCCCTGCCA	0.617													28	78	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143558872	143558872	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143558872A>T	uc003ywm.2	+	5	1532	c.1349A>T	c.(1348-1350)GAG>GTG	p.E450V		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	450	Extracellular (Potential).|TSP type-1 3.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GAGGGCCCTGAGAAGCAAACC	0.652													27	67	---	---	---	---	PASS
CYP11B1	1584	broad.mit.edu	37	8	143960537	143960537	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143960537C>A	uc003yxi.2	-	2	313	c.306G>T	c.(304-306)CAG>CAT	p.Q102H	CYP11B1_uc003yxh.2_5'Flank|CYP11B1_uc003yxj.2_Missense_Mutation_p.Q102H|CYP11B1_uc010mey.2_Missense_Mutation_p.Q147H	NM_000497	NP_000488	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B,	102					aldosterone biosynthetic process|cellular response to hormone stimulus|cellular response to potassium ion|cortisol biosynthetic process|glucose homeostasis|immune response|regulation of blood pressure|response to stress|xenobiotic metabolic process	mitochondrial inner membrane	electron carrier activity|steroid 11-beta-monooxygenase activity			ovary(3)	3	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Mitotane(DB00648)	GGCTGTCCACCTGTTGCAGCT	0.617									Familial_Hyperaldosteronism_type_I				35	57	---	---	---	---	PASS
OPLAH	26873	broad.mit.edu	37	8	145106851	145106851	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145106851G>A	uc003zar.3	-	26	3670	c.3588C>T	c.(3586-3588)ACC>ACT	p.T1196T		NM_017570	NP_060040	O14841	OPLA_HUMAN	5-oxoprolinase (ATP-hydrolysing)	1196							5-oxoprolinase (ATP-hydrolyzing) activity|ATP binding				0	all_cancers(97;1.06e-10)|all_epithelial(106;1.5e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;6.79e-41)|Epithelial(56;1.02e-39)|all cancers(56;2.24e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)		L-Glutamic Acid(DB00142)	CGCGGCGCTCGGTCAGCACTG	0.642													3	5	---	---	---	---	PASS
FREM1	158326	broad.mit.edu	37	9	14841455	14841455	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:14841455G>A	uc003zlm.2	-	10	2461	c.1871C>T	c.(1870-1872)TCA>TTA	p.S624L	FREM1_uc010mic.2_RNA	NM_144966	NP_659403	Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1 precursor	624	CSPG 4.				cell communication|multicellular organismal development	basement membrane|integral to membrane	metal ion binding|sugar binding			ovary(2)|breast(2)|pancreas(1)	5				GBM - Glioblastoma multiforme(50;3.53e-06)		CTGTGGCACTGAAAGATTTGG	0.249													23	26	---	---	---	---	PASS
VCP	7415	broad.mit.edu	37	9	35066808	35066808	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35066808C>T	uc003zvy.2	-	4	698	c.309G>A	c.(307-309)CAG>CAA	p.Q103Q	VCP_uc003zvz.2_RNA|VCP_uc010mkh.1_5'UTR|VCP_uc010mki.1_Silent_p.Q58Q	NM_007126	NP_009057	P55072	TERA_HUMAN	valosin-containing protein	103					activation of caspase activity|double-strand break repair|endoplasmic reticulum unfolded protein response|ER-associated protein catabolic process|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|protein ubiquitination|retrograde protein transport, ER to cytosol	cytosol|endoplasmic reticulum|microsome|nucleus|proteasome complex	ATP binding|ATPase activity|lipid binding|polyubiquitin binding|protein domain specific binding|protein phosphatase binding			upper_aerodigestive_tract(1)	1			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			CAGGGCATGGCTGGATGCTGA	0.502													12	122	---	---	---	---	PASS
OR13J1	392309	broad.mit.edu	37	9	35870090	35870090	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35870090C>T	uc011lph.1	-	1	309	c.309G>A	c.(307-309)CTG>CTA	p.L103L		NM_001004487	NP_001004487	Q8NGT2	O13J1_HUMAN	olfactory receptor, family 13, subfamily J,	103	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1	all_epithelial(49;0.169)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00494)|STAD - Stomach adenocarcinoma(86;0.194)			TGGACAGGCTCAGACACATCT	0.592													28	69	---	---	---	---	PASS
FAM74A3	728495	broad.mit.edu	37	9	40716206	40716206	+	RNA	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40716206A>T	uc010mmk.2	+	1		c.683A>T				NR_026801				Homo sapiens family with sequence similarity 74, member A3 (FAM74A3), non-coding RNA.											skin(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GAGAGTTCAGAGGCTGTCGTT	0.453													11	32	---	---	---	---	PASS
ZNF658	26149	broad.mit.edu	37	9	40774448	40774448	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:40774448C>A	uc004abs.2	-	5	979	c.827G>T	c.(826-828)GGG>GTG	p.G276V	ZNF658_uc010mmm.1_Missense_Mutation_p.G276V|ZNF658_uc010mmn.1_Missense_Mutation_p.G276V	NM_033160	NP_149350	Q5TYW1	ZN658_HUMAN	zinc finger protein 658	276					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		ACAGGATGTCCCATATTCATT	0.358													126	263	---	---	---	---	PASS
GDA	9615	broad.mit.edu	37	9	74828885	74828885	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:74828885G>A	uc004aiq.2	+	5	739	c.556G>A	c.(556-558)GAA>AAA	p.E186K	GDA_uc011lse.1_Missense_Mutation_p.E112K|GDA_uc011lsf.1_Missense_Mutation_p.E112K|GDA_uc004air.2_Missense_Mutation_p.E186K|GDA_uc010mow.1_RNA|GDA_uc004ais.2_Missense_Mutation_p.E144K|GDA_uc004ait.1_Missense_Mutation_p.E112K	NM_004293	NP_004284	Q9Y2T3	GUAD_HUMAN	guanine deaminase	186					nervous system development|purine base metabolic process|purine nucleotide catabolic process	cytosol	guanine deaminase activity|zinc ion binding			ovary(2)|central_nervous_system(2)|skin(1)	5		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		GACCACTGAGGAATCGATCAA	0.413													12	81	---	---	---	---	PASS
GCNT1	2650	broad.mit.edu	37	9	79118046	79118046	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79118046A>G	uc010mpf.2	+	3	1090	c.749A>G	c.(748-750)CAT>CGT	p.H250R	GCNT1_uc010mpg.2_Missense_Mutation_p.H250R|GCNT1_uc010mph.2_Missense_Mutation_p.H250R|GCNT1_uc004akf.3_Missense_Mutation_p.H250R|GCNT1_uc010mpi.2_Missense_Mutation_p.H250R|GCNT1_uc004akh.3_Missense_Mutation_p.H250R	NM_001490	NP_001481	Q02742	GCNT1_HUMAN	beta-1,3-galactosyl-O-glycosyl-glycoprotein	250	Lumenal (Potential).|Catalytic (By similarity).				protein O-linked glycosylation	Golgi membrane|integral to membrane	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity				0						ATGCCATCCCATAAAGAAGAA	0.433													32	79	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79319739	79319739	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79319739T>C	uc010mpk.2	-	8	7575	c.7451A>G	c.(7450-7452)GAC>GGC	p.D2484G	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	2484					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						TACTTCCCAGTCAACGTTTGA	0.468											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	6	13	---	---	---	---	PASS
AGTPBP1	23287	broad.mit.edu	37	9	88247953	88247953	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:88247953C>A	uc011ltd.1	-	13	1672	c.1639G>T	c.(1639-1641)GCC>TCC	p.A547S	AGTPBP1_uc004aod.3_Missense_Mutation_p.A173S|AGTPBP1_uc011ltc.1_Missense_Mutation_p.A445S|AGTPBP1_uc010mqc.2_Missense_Mutation_p.A507S|AGTPBP1_uc011lte.1_Missense_Mutation_p.A559S	NM_015239	NP_056054	Q9UPW5	CBPC1_HUMAN	ATP/GTP binding protein 1	547					C-terminal protein deglutamylation|cerebellar Purkinje cell differentiation|eye photoreceptor cell differentiation|mitochondrion organization|neuromuscular process|olfactory bulb development|protein side chain deglutamylation|proteolysis	cytosol|mitochondrion|nucleus	metallocarboxypeptidase activity|tubulin binding|zinc ion binding			ovary(4)|large_intestine(2)|skin(1)	7						AAACCTGGGGCTGTTTGAGAA	0.403													42	124	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90499498	90499498	+	Intron	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90499498A>T	uc004app.3	+						C9orf79_uc004apo.1_Intron	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79							integral to membrane				ovary(3)	3						CTGTCTCCTGATTTCCAGCTT	0.572													37	71	---	---	---	---	PASS
SHC3	53358	broad.mit.edu	37	9	91653064	91653064	+	Nonsense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:91653064G>C	uc004aqg.2	-	11	1807	c.1500C>G	c.(1498-1500)TAC>TAG	p.Y500*		NM_016848	NP_058544	Q92529	SHC3_HUMAN	src homology 2 domain-containing transforming	500	SH2.				central nervous system development|epidermal growth factor receptor signaling pathway|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|Ras protein signal transduction	cytosol	protein binding|signal transducer activity			lung(3)|skin(1)	4						TCTCTCCTTGGTACCAAGTCT	0.587													51	434	---	---	---	---	PASS
NR4A3	8013	broad.mit.edu	37	9	102607053	102607053	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:102607053T>A	uc004baf.1	+	6	2106	c.1377T>A	c.(1375-1377)ACT>ACA	p.T459T	NR4A3_uc004bag.1_Silent_p.T459T|NR4A3_uc004bai.2_Silent_p.T470T	NM_006981	NP_008912	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	459	Ligand-binding (Potential).				regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor		steroid hormone receptor activity|thyroid hormone receptor activity|zinc ion binding		EWSR1/NR4A3(140)|TAF15/NR4A3(33)	bone(173)	173		Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CGGGATTTACTGATCTCCCCA	0.428			T	EWSR1	extraskeletal myxoid chondrosarcoma								30	64	---	---	---	---	PASS
OR13F1	138805	broad.mit.edu	37	9	107267168	107267168	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:107267168A>T	uc011lvm.1	+	1	625	c.625A>T	c.(625-627)ATG>TTG	p.M209L		NM_001004485	NP_001004485	Q8NGS4	O13F1_HUMAN	olfactory receptor, family 13, subfamily F,	209	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|ovary(1)|skin(1)	3						TCTTCTCCCCATGCCAATGCT	0.443													131	317	---	---	---	---	PASS
ACTL7B	10880	broad.mit.edu	37	9	111617356	111617356	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111617356G>T	uc004bdi.2	-	1	920	c.855C>A	c.(853-855)GAC>GAA	p.D285E		NM_006686	NP_006677	Q9Y614	ACL7B_HUMAN	actin-like 7B	285						actin cytoskeleton|cytoplasm	structural constituent of cytoskeleton			pancreas(1)	1						TGAGTTTGCCGTCCGGGAGCT	0.642													46	114	---	---	---	---	PASS
C9orf4	23732	broad.mit.edu	37	9	111903868	111903868	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:111903868C>A	uc004bdw.1	-	4	617	c.617G>T	c.(616-618)GGT>GTT	p.G206V		NM_014334	NP_055149	Q9P0K9	CI004_HUMAN	hypothetical protein LOC23732	206	DOMON.					integral to membrane					0						ATCATCACCACCCTAACATGA	0.413													37	78	---	---	---	---	PASS
KIAA0368	23392	broad.mit.edu	37	9	114173302	114173302	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:114173302G>A	uc004bfe.1	-	23	2869	c.2869C>T	c.(2869-2871)CCT>TCT	p.P957S		NM_001080398	NP_001073867			KIAA0368 protein												0						TCTTGATCAGGGAGGGTGTCA	0.388													161	267	---	---	---	---	PASS
COL27A1	85301	broad.mit.edu	37	9	116925043	116925043	+	Silent	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:116925043C>G	uc011lxl.1	+	2	111	c.111C>G	c.(109-111)GCC>GCG	p.A37A		NM_032888	NP_116277	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1 precursor	37					cell adhesion		extracellular matrix structural constituent			ovary(3)|skin(1)	4						GTCACCTGGCCTCCACCCAAG	0.562													89	166	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119568076	119568076	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119568076G>A	uc004bjs.1	-	13	2332	c.2231C>T	c.(2230-2232)GCT>GTT	p.A744V	ASTN2_uc004bjr.1_Missense_Mutation_p.A740V|ASTN2_uc004bjt.1_Missense_Mutation_p.A693V	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	744	Extracellular (Potential).|EGF-like 3.					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						TCCATCAGGAGCCAGTTTGTA	0.483													97	180	---	---	---	---	PASS
ASTN2	23245	broad.mit.edu	37	9	119903693	119903693	+	Silent	SNP	G	C	C	rs115011238	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:119903693G>C	uc004bjs.1	-	4	1181	c.1080C>G	c.(1078-1080)CGC>CGG	p.R360R	ASTN2_uc004bjr.1_Silent_p.R360R|ASTN2_uc004bjt.1_Intron	NM_198187	NP_937830	O75129	ASTN2_HUMAN	astrotactin 2 isoform c	360	Cytoplasmic (Potential).					integral to membrane				skin(4)|ovary(3)|breast(1)|kidney(1)	9						GCGTGTTAGCGCGGAAACTCT	0.587													36	115	---	---	---	---	PASS
GAPVD1	26130	broad.mit.edu	37	9	128113072	128113072	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:128113072C>G	uc010mwx.2	+	23	3870	c.3544C>G	c.(3544-3546)CAA>GAA	p.Q1182E	GAPVD1_uc004bpp.2_Missense_Mutation_p.Q1191E|GAPVD1_uc004bpq.2_Missense_Mutation_p.Q1164E|GAPVD1_uc004bpr.2_Missense_Mutation_p.Q1143E|GAPVD1_uc004bps.2_Missense_Mutation_p.Q1137E|GAPVD1_uc004bpt.2_Missense_Mutation_p.Q197E	NM_015635	NP_056450	Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	1182					endocytosis|regulation of protein transport|regulation of small GTPase mediated signal transduction|signal transduction	cytosol|endosome|membrane	GTPase activating protein binding|GTPase activator activity|guanyl-nucleotide exchange factor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GGCTCAACTTCAAGAAACAAT	0.358													17	159	---	---	---	---	PASS
TSC1	7248	broad.mit.edu	37	9	135778003	135778003	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:135778003G>A	uc004cca.2	-	18	2614	c.2380C>T	c.(2380-2382)CAG>TAG	p.Q794*	TSC1_uc004ccb.3_Nonsense_Mutation_p.Q793*|TSC1_uc011mcq.1_Nonsense_Mutation_p.Q743*|TSC1_uc011mcr.1_Intron	NM_000368	NP_000359	Q92574	TSC1_HUMAN	tuberous sclerosis 1 protein isoform 1	794	Potential.				activation of Rho GTPase activity|cell cycle arrest|cell-matrix adhesion|insulin receptor signaling pathway|negative regulation of cell proliferation|negative regulation of protein ubiquitination|negative regulation of TOR signaling cascade|negative regulation of translation|positive regulation of focal adhesion assembly|regulation of phosphoprotein phosphatase activity|regulation of stress fiber assembly|rRNA export from nucleus	cell cortex|lamellipodium|membrane|TSC1-TSC2 complex	chaperone binding|protein N-terminus binding	p.?(1)		lung(4)|central_nervous_system(3)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)|skin(1)|ovary(1)|bone(1)	14				OV - Ovarian serous cystadenocarcinoma(145;4.32e-08)|Epithelial(140;2.72e-06)		TGTAATTCCTGGCTCTGGTTG	0.537			D|Mis|N|F|S			hamartoma|renal cell			Tuberous_Sclerosis		OREG0019577	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	18	244	---	---	---	---	PASS
NOTCH1	4851	broad.mit.edu	37	9	139391110	139391110	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139391110G>A	uc004chz.2	-	34	7081	c.7081C>T	c.(7081-7083)CAG>TAG	p.Q2361*		NM_017617	NP_060087	P46531	NOTC1_HUMAN	notch1 preproprotein	2361	Cytoplasmic (Potential).				aortic valve morphogenesis|immune response|negative regulation of BMP signaling pathway|negative regulation of cell-substrate adhesion|negative regulation of myoblast differentiation|negative regulation of osteoblast differentiation|negative regulation of transcription, DNA-dependent|Notch receptor processing	cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to membrane|nucleoplasm|plasma membrane	calcium ion binding|protein binding|receptor activity			haematopoietic_and_lymphoid_tissue(791)|upper_aerodigestive_tract(29)|lung(13)|central_nervous_system(10)|breast(9)|large_intestine(1)|skin(1)|oesophagus(1)|pancreas(1)	856	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		CTCATCATCTGGGACAGGGCG	0.662			T|Mis|O	TRB@	T-ALL					HNSCC(8;0.001)			32	171	---	---	---	---	PASS
LCN8	138307	broad.mit.edu	37	9	139649578	139649578	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139649578C>T	uc004cjb.1	-						LCN8_uc004cja.2_Intron	NM_178469	NP_848564	Q6JVE9	LCN8_HUMAN	lipocalin 8						transport	extracellular region	binding			pancreas(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		GGTCGGGGGTCAGGCTCACCT	0.726													11	26	---	---	---	---	PASS
ABCA2	20	broad.mit.edu	37	9	139915885	139915885	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139915885C>T	uc011mem.1	-	7	1001	c.853G>A	c.(853-855)GAG>AAG	p.E285K	ABCA2_uc011mel.1_Missense_Mutation_p.E286K|ABCA2_uc004ckl.1_Missense_Mutation_p.E216K|ABCA2_uc004ckm.1_Missense_Mutation_p.E316K|ABCA2_uc004cko.1_Missense_Mutation_p.E62K|ABCA2_uc010nca.2_Missense_Mutation_p.E216K	NM_001606	NP_001597	Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A, member 2	285					cholesterol homeostasis|lipid metabolic process|regulation of intracellular cholesterol transport|regulation of transcription from RNA polymerase II promoter|response to drug|response to steroid hormone stimulus	ATP-binding cassette (ABC) transporter complex|cytoplasmic membrane-bounded vesicle|endosome|integral to membrane|microtubule organizing center	ATP binding|ATPase activity, coupled to transmembrane movement of substances				0	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TTCCGGAGCTCAGCAGACAGC	0.672													8	67	---	---	---	---	PASS
EXD3	54932	broad.mit.edu	37	9	140245774	140245774	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140245774C>T	uc004cmp.2	-	13	1576	c.1380G>A	c.(1378-1380)AAG>AAA	p.K460K	C9orf167_uc011mew.1_Intron|EXD3_uc010ncf.1_Silent_p.K140K|EXD3_uc004cmq.1_RNA	NM_017820	NP_060290	Q8N9H8	MUT7_HUMAN	exonuclease 3'-5' domain containing 3	460					nucleobase, nucleoside, nucleotide and nucleic acid metabolic process	intracellular	3'-5' exonuclease activity|nucleic acid binding				0						ACTCACCCAGCTTGGTGATAG	0.677													16	26	---	---	---	---	PASS
ENTPD8	377841	broad.mit.edu	37	9	140332424	140332424	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140332424A>C	uc004cmw.2	-	3	423	c.239T>G	c.(238-240)GTG>GGG	p.V80G	C9orf167_uc011mew.1_Intron|ENTPD8_uc004cmx.2_Missense_Mutation_p.V80G|ENTPD8_uc004cmy.2_Missense_Mutation_p.V80G	NM_001033113	NP_001028285	Q5MY95	ENTP8_HUMAN	ectonucleoside triphosphate diphosphohydrolase 8	80	Extracellular (Potential).					integral to membrane|plasma membrane	ATP binding			skin(1)	1	all_cancers(76;0.0926)			OV - Ovarian serous cystadenocarcinoma(145;0.000224)|Epithelial(140;0.000898)		CTAACCTTCCACCTGGCAGGC	0.557													21	118	---	---	---	---	PASS
EHMT1	79813	broad.mit.edu	37	9	140712552	140712552	+	Nonsense_Mutation	SNP	C	T	T	rs121918301		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140712552C>T	uc011mfc.1	+	25	3539	c.3502C>T	c.(3502-3504)CGA>TGA	p.R1168*	EHMT1_uc004coe.2_Nonsense_Mutation_p.R73*	NM_024757	NP_079033	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1168	Interaction with histone H3.|SET.				DNA methylation|embryo development|peptidyl-lysine dimethylation|peptidyl-lysine monomethylation	chromosome|nucleus	histone methyltransferase activity (H3-K27 specific)|histone methyltransferase activity (H3-K9 specific)|p53 binding|zinc ion binding			breast(2)|pancreas(1)	3	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		AGCCGACGTTCGAGAGGAAGA	0.517													68	131	---	---	---	---	PASS
GPR158	57512	broad.mit.edu	37	10	25464821	25464821	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:25464821C>A	uc001isj.2	+	1	532	c.472C>A	c.(472-474)CAG>AAG	p.Q158K	LOC100128811_uc010qde.1_Missense_Mutation_p.W44L	NM_020752	NP_065803	Q5T848	GP158_HUMAN	G protein-coupled receptor 158 precursor	158	Extracellular (Potential).					integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(4)|large_intestine(2)|pancreas(1)|skin(1)	8						GGATTGGTACCAGGCGCTGGT	0.627													45	116	---	---	---	---	PASS
KIAA1462	57608	broad.mit.edu	37	10	30316850	30316850	+	Nonsense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:30316850G>A	uc001iux.2	-	2	2286	c.2227C>T	c.(2227-2229)CAG>TAG	p.Q743*	KIAA1462_uc001iuy.2_Intron|KIAA1462_uc001iuz.2_Nonsense_Mutation_p.Q605*|KIAA1462_uc009xle.1_Nonsense_Mutation_p.Q743*	NM_020848	NP_065899	Q9P266	K1462_HUMAN	hypothetical protein LOC57608	743										ovary(4)	4						CTTGGCCTCTGTTTGTGATCA	0.582													34	75	---	---	---	---	PASS
ZEB1	6935	broad.mit.edu	37	10	31809552	31809552	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:31809552A>T	uc001ivs.3	+	7	1352	c.1289A>T	c.(1288-1290)GAG>GTG	p.E430V	ZEB1_uc001ivr.3_Missense_Mutation_p.E212V|ZEB1_uc010qee.1_Missense_Mutation_p.E212V|ZEB1_uc010qef.1_Missense_Mutation_p.E212V|ZEB1_uc009xlj.1_Missense_Mutation_p.E356V|ZEB1_uc010qeg.1_Missense_Mutation_p.E289V|ZEB1_uc009xlk.1_Missense_Mutation_p.E212V|ZEB1_uc001ivt.3_Missense_Mutation_p.E212V|ZEB1_uc001ivu.3_Missense_Mutation_p.E431V|ZEB1_uc001ivv.3_Missense_Mutation_p.E410V|ZEB1_uc010qeh.1_Missense_Mutation_p.E363V|ZEB1_uc009xlo.1_Missense_Mutation_p.E413V|ZEB1_uc009xlp.2_Missense_Mutation_p.E414V	NM_030751	NP_110378	P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1 isoform b	430					cell proliferation|immune response|negative regulation of transcription from RNA polymerase II promoter|positive regulation of neuron differentiation	cytoplasm	E-box binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(3)|central_nervous_system(2)	5		Prostate(175;0.0156)				CAAGTGTTGGAGAATAATCAA	0.388													27	38	---	---	---	---	PASS
RHOBTB1	9886	broad.mit.edu	37	10	62648494	62648494	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:62648494C>A	uc001jli.2	-	7	1370	c.932G>T	c.(931-933)TGT>TTT	p.C311F	RHOBTB1_uc001jlh.2_Missense_Mutation_p.C311F|RHOBTB1_uc001jlj.2_Missense_Mutation_p.C311F|RHOBTB1_uc001jlk.2_Missense_Mutation_p.C311F|RHOBTB1_uc009xpe.1_Missense_Mutation_p.C249F|RHOBTB1_uc001jll.2_Missense_Mutation_p.C61F	NM_014836	NP_055651	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	311	BTB 1.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|plasma membrane	GTP binding			upper_aerodigestive_tract(1)	1	Prostate(12;0.0112)					CTCTTTCTCACAGGCTCCTTC	0.483													37	71	---	---	---	---	PASS
PLCE1	51196	broad.mit.edu	37	10	95892039	95892039	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:95892039G>T	uc001kjk.2	+	3	1949	c.1315G>T	c.(1315-1317)GGT>TGT	p.G439C	PLCE1_uc010qnx.1_Missense_Mutation_p.G439C|PLCE1_uc001kjm.2_Missense_Mutation_p.G131C	NM_016341	NP_057425	Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1 isoform 1	439					activation of MAPK activity|activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|calcium-mediated signaling|cell proliferation|cytoskeleton organization|diacylglycerol biosynthetic process|elevation of cytosolic calcium ion concentration|epidermal growth factor receptor signaling pathway|glomerulus development|heart development|lipid catabolic process|Ras protein signal transduction|regulation of cell growth|regulation of G-protein coupled receptor protein signaling pathway|regulation of Ras protein signal transduction|regulation of smooth muscle contraction	cytosol|Golgi membrane|membrane fraction|plasma membrane	calcium ion binding|guanyl-nucleotide exchange factor activity|phosphatidylinositol phospholipase C activity|Ras GTPase binding|receptor signaling protein activity			ovary(2)|skin(1)	3		Colorectal(252;0.0458)				GATAAGCGTTGGTCCATGCTT	0.488													36	66	---	---	---	---	PASS
LOXL4	84171	broad.mit.edu	37	10	100015331	100015331	+	Intron	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:100015331C>G	uc001kpa.1	-							NM_032211	NP_115587	Q96JB6	LOXL4_HUMAN	lysyl oxidase-like 4 precursor							extracellular space|membrane	copper ion binding|protein binding|scavenger receptor activity			ovary(3)|breast(1)|skin(1)	5		Colorectal(252;0.234)		Epithelial(162;2.14e-11)|all cancers(201;2.49e-09)		CTCCGTCACTCACTGTCCATG	0.682													51	47	---	---	---	---	PASS
PNLIPRP2	5408	broad.mit.edu	37	10	118401632	118401632	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118401632C>A	uc001lcq.2	+	15	1211	c.1188C>A	c.(1186-1188)TCC>TCA	p.S396S		NM_005396	NP_005387	P54317	LIPR2_HUMAN	pancreatic lipase-related protein 2	395	PLAT.				galactolipid catabolic process|lipid digestion|phospholipid catabolic process|triglyceride metabolic process	extracellular space	acylglycerol lipase activity|calcium ion binding|galactolipase activity|phospholipase activity|triglyceride lipase activity			large_intestine(1)	1				all cancers(201;0.015)		TCAGAGGATCCCTCAAACCAG	0.343													5	6	---	---	---	---	PASS
KCNQ1	3784	broad.mit.edu	37	11	2591910	2591910	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:2591910C>A	uc001lwn.2	+	3	638	c.530C>A	c.(529-531)TCC>TAC	p.S177Y	KCNQ1_uc009ydp.1_Intron|KCNQ1_uc001lwo.2_Missense_Mutation_p.S50Y	NM_000218	NP_000209	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like	177	Cytoplasmic (Potential).				blood circulation|membrane depolarization|muscle contraction|sensory perception of sound		delayed rectifier potassium channel activity|protein binding			ovary(1)	1		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CGCCTCTGGTCCGCCGGCTGC	0.657													11	33	---	---	---	---	PASS
OR52B4	143496	broad.mit.edu	37	11	4389418	4389418	+	Silent	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4389418G>C	uc010qye.1	-	1	108	c.108C>G	c.(106-108)TCC>TCG	p.S36S		NM_001005161	NP_001005161	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B,	36	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		CGGTGACATAGGAAATGAAGA	0.522													25	43	---	---	---	---	PASS
OR51F1	256892	broad.mit.edu	37	11	4790942	4790942	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:4790942G>T	uc010qyl.1	-	1	206	c.206C>A	c.(205-207)TCA>TAA	p.S69*		NM_001004752	NP_001004752	A6NLW9	A6NLW9_HUMAN	olfactory receptor, family 51, subfamily F,	69						integral to membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.0778)		Epithelial(150;5.87e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0045)|LUSC - Lung squamous cell carcinoma(625;0.192)		ATCAGTGGCTGATAGCCTGAA	0.448													7	33	---	---	---	---	PASS
HBD	3045	broad.mit.edu	37	11	5255610	5255610	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5255610T>G	uc001maf.1	-	1	249	c.54A>C	c.(52-54)AAA>AAC	p.K18N		NM_000519	NP_000510	P02042	HBD_HUMAN	delta globin	18					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity			ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CCACGTTCACTTTGCCCCACA	0.502													35	145	---	---	---	---	PASS
OR52E6	390078	broad.mit.edu	37	11	5862608	5862608	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5862608G>A	uc010qzq.1	-	1	520	c.520C>T	c.(520-522)CGT>TGT	p.R174C	TRIM5_uc001mbq.1_Intron	NM_001005167	NP_001005167	Q96RD3	O52E6_HUMAN	olfactory receptor, family 52, subfamily E,	174	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;2.55e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGATGATACGATGTCCACAG	0.478													58	134	---	---	---	---	PASS
RIC3	79608	broad.mit.edu	37	11	8161675	8161675	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:8161675C>T	uc001mgd.2	-	2	244	c.190G>A	c.(190-192)GGG>AGG	p.G64R	RIC3_uc001mgb.2_5'Flank|RIC3_uc001mgc.2_Missense_Mutation_p.G64R|RIC3_uc001mge.2_Intron|RIC3_uc010rbl.1_Missense_Mutation_p.G14R|RIC3_uc010rbm.1_Missense_Mutation_p.G64R|RIC3_uc009yfm.2_Missense_Mutation_p.G64R|RIC3_uc009yfn.2_Intron|RIC3_uc001mgf.3_Missense_Mutation_p.G64R	NM_024557	NP_078833	Q7Z5B4	RIC3_HUMAN	resistance to inhibitors of cholinesterase 3	64	Lumenal (Potential).					endoplasmic reticulum membrane|Golgi membrane|integral to membrane				large_intestine(1)|ovary(1)|pancreas(1)	3				Epithelial(150;2.89e-07)|BRCA - Breast invasive adenocarcinoma(625;0.204)		AAACGAGCCCCAGGAGTCTGG	0.507													32	91	---	---	---	---	PASS
DENND5A	23258	broad.mit.edu	37	11	9228258	9228258	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:9228258C>A	uc001mhl.2	-	3	508	c.253G>T	c.(253-255)GTA>TTA	p.V85L	DENND5A_uc010rbw.1_Missense_Mutation_p.V85L|DENND5A_uc010rbx.1_RNA	NM_015213	NP_056028	Q6IQ26	DEN5A_HUMAN	RAB6 interacting protein 1	85	UDENN.									liver(1)	1						TTCCATTCTACGTTCTCAGGA	0.348													60	179	---	---	---	---	PASS
PDE3B	5140	broad.mit.edu	37	11	14793481	14793481	+	Splice_Site	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:14793481A>G	uc001mln.2	+	2	1332	c.979_splice	c.e2-2	p.M327_splice	PDE3B_uc001mlm.2_Splice_Site_p.M327_splice|PDE3B_uc010rcr.1_Splice_Site_p.M327_splice	NM_000922	NP_000913	Q13370	PDE3B_HUMAN	phosphodiesterase 3B						cAMP catabolic process|insulin receptor signaling pathway|negative regulation of lipid catabolic process|platelet activation	cytosol|endoplasmic reticulum|Golgi apparatus|guanyl-nucleotide exchange factor complex|integral to membrane|microsome	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding|protein kinase B binding				0						TTTTTTTTCTAGATGATTCTT	0.244													20	57	---	---	---	---	PASS
MYOD1	4654	broad.mit.edu	37	11	17741695	17741695	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:17741695G>A	uc001mni.2	+	1	586	c.366G>A	c.(364-366)CTG>CTA	p.L122L		NM_002478	NP_002469	P15172	MYOD1_HUMAN	myogenic differentiation 1	122	Helix-loop-helix motif.				muscle cell fate commitment|positive regulation of muscle cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|skeletal muscle tissue development	nuclear chromatin|transcription factor complex	E-box binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|transcription coactivator activity			breast(2)|ovary(1)	3						GGCGCCGCCTGAGCAAAGTAA	0.652													6	25	---	---	---	---	PASS
IGSF22	283284	broad.mit.edu	37	11	18735591	18735591	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:18735591G>T	uc009yht.2	-	14	2093	c.1903C>A	c.(1903-1905)CCA>ACA	p.P635T	IGSF22_uc001mpa.2_RNA	NM_173588	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	635	Ig-like 4.									ovary(4)|large_intestine(2)|kidney(1)	7						TTGGGCAGTGGTTTTCCCCGG	0.602													8	163	---	---	---	---	PASS
E2F8	79733	broad.mit.edu	37	11	19252207	19252207	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19252207G>A	uc001mpm.2	-	8	1763	c.1241C>T	c.(1240-1242)GCG>GTG	p.A414V	E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Missense_Mutation_p.A414V	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8	414					cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						GCTACTGGGCGCAGAATTTAT	0.398													31	138	---	---	---	---	PASS
QSER1	79832	broad.mit.edu	37	11	32956442	32956442	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:32956442A>G	uc001mty.2	+	4	3518	c.3251A>G	c.(3250-3252)GAG>GGG	p.E1084G	QSER1_uc001mtz.1_Missense_Mutation_p.E845G|QSER1_uc001mua.2_Missense_Mutation_p.E589G	NM_001076786	NP_001070254	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1084										ovary(3)|central_nervous_system(2)|skin(1)	6	Breast(20;0.158)					CAAGTTAAAGAGGAAGACAAC	0.408													38	104	---	---	---	---	PASS
TRAF6	7189	broad.mit.edu	37	11	36512059	36512059	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36512059G>T	uc001mwr.1	-	8	1238	c.898C>A	c.(898-900)CAC>AAC	p.H300N	TRAF6_uc001mws.1_Missense_Mutation_p.H300N	NM_145803	NP_665802	Q9Y4K3	TRAF6_HUMAN	TNF receptor-associated factor 6	300	Potential.|Interaction with TAX1BP1.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|apoptosis|induction of apoptosis by extracellular signals|innate immune response|JNK cascade|membrane protein intracellular domain proteolysis|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|ossification|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of interleukin-2 production|positive regulation of JUN kinase activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of osteoclast differentiation|positive regulation of T cell cytokine production|protein autoubiquitination|protein K63-linked ubiquitination|response to interleukin-1|stress-activated MAPK cascade|T cell receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway	CD40 receptor complex|cell cortex|cytosol|endosome membrane|internal side of plasma membrane|nuclear membrane	histone deacetylase binding|mitogen-activated protein kinase kinase kinase binding|protein kinase B binding|protein N-terminus binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)	1	all_lung(20;0.211)	all_hematologic(20;0.107)				TCTAACTGGTGAATAGTTTCC	0.463													174	247	---	---	---	---	PASS
RAG1	5896	broad.mit.edu	37	11	36596776	36596776	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:36596776T>G	uc001mwu.3	+	2	2046	c.1922T>G	c.(1921-1923)GTG>GGG	p.V641G	RAG1_uc001mwt.2_RNA	NM_000448	NP_000439	P15918	RAG1_HUMAN	recombination activating gene 1	641					histone monoubiquitination|immune response|pre-B cell allelic exclusion|protein autoubiquitination|T cell differentiation in thymus|V(D)J recombination	nucleus	endonuclease activity|histone binding|protein homodimerization activity|sequence-specific DNA binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(1)|pancreas(1)|lung(1)|kidney(1)|skin(1)	5	all_lung(20;0.226)	all_hematologic(20;0.107)				TCTCAGAATGTGAAAGTATTT	0.463									Familial_Hemophagocytic_Lymphohistiocytosis				17	108	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40136341	40136341	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40136341G>T	uc001mxa.1	-	2	3466	c.1502C>A	c.(1501-1503)ACA>AAA	p.T501K	LRRC4C_uc001mxc.1_Missense_Mutation_p.T497K|LRRC4C_uc001mxd.1_Missense_Mutation_p.T497K|LRRC4C_uc001mxb.1_Missense_Mutation_p.T497K	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	501					regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				GGTTTTCTCTGTCGACCTTGT	0.498													25	78	---	---	---	---	PASS
LRRC4C	57689	broad.mit.edu	37	11	40137090	40137090	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:40137090T>C	uc001mxa.1	-	2	2717	c.753A>G	c.(751-753)ATA>ATG	p.I251M	LRRC4C_uc001mxc.1_Missense_Mutation_p.I247M|LRRC4C_uc001mxd.1_Missense_Mutation_p.I247M|LRRC4C_uc001mxb.1_Missense_Mutation_p.I247M	NM_020929	NP_065980	Q9HCJ2	LRC4C_HUMAN	netrin-G1 ligand precursor	251	LRR 8.				regulation of axonogenesis	integral to membrane	protein binding			ovary(4)|skin(3)|central_nervous_system(1)	8		all_lung(304;0.0575)|Lung NSC(402;0.138)				TCTGGGACTGTATCATCCACA	0.433													42	123	---	---	---	---	PASS
OR4X1	390113	broad.mit.edu	37	11	48286057	48286057	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48286057C>A	uc010rht.1	+	1	645	c.645C>A	c.(643-645)TCC>TCA	p.S215S		NM_001004726	NP_001004726	Q8NH49	OR4X1_HUMAN	olfactory receptor, family 4, subfamily X,	215	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|pancreas(1)|skin(1)	3						TGATGGCTTCCTACCTGATCA	0.552													16	33	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	48328705	48328705	+	IGR	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48328705C>T								OR4S1 (2 upstream) : OR4C3 (17788 downstream)																							GGAGAAGTGACATTCCAGAGA	0.423													11	18	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681515	55681515	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681515G>T	uc010rir.1	-	1	544	c.544C>A	c.(544-546)CCT>ACT	p.P182T		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	182	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						AAGAGAGGAGGGATATCACAG	0.403													14	67	---	---	---	---	PASS
OR5W2	390148	broad.mit.edu	37	11	55681783	55681783	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55681783T>A	uc010rir.1	-	1	276	c.276A>T	c.(274-276)ATA>ATT	p.I92I		NM_001001960	NP_001001960	Q8NH69	OR5W2_HUMAN	olfactory receptor, family 5, subfamily W,	92	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CATAGAAGGGTATTGACTTGT	0.453													8	45	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468174	56468174	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468174C>T	uc010rjn.1	+	1	311	c.311C>T	c.(310-312)GCA>GTA	p.A104V		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	104	Helical; Name=3; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TTCTTCTCTGCAGGGCTGGCC	0.532													27	88	---	---	---	---	PASS
PRG2	5553	broad.mit.edu	37	11	57156084	57156084	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57156084C>A	uc001njz.2	-	3	491	c.464G>T	c.(463-465)GGT>GTT	p.G155V	PRG2_uc001njw.1_RNA|PRG2_uc001njx.1_RNA|PRG2_uc001njy.1_RNA|PRG2_uc001nka.2_Missense_Mutation_p.G155V|PRG2_uc001nkb.2_Missense_Mutation_p.G155V|PRG2_uc001nkd.2_Missense_Mutation_p.G144V|PRG2_uc001nkc.2_Missense_Mutation_p.G155V|PRG2_uc001nke.2_Missense_Mutation_p.G435V	NM_002728	NP_002719	P13727	PRG2_HUMAN	proteoglycan 2 preproprotein	155	C-type lectin.				defense response to bacterium|immune response	extracellular region|transport vesicle	heparin binding|sugar binding			central_nervous_system(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	CCAGACTTGACCCTGGTTGAG	0.502													33	161	---	---	---	---	PASS
OR5A2	219981	broad.mit.edu	37	11	59190428	59190428	+	5'Flank	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:59190428G>T	uc010rkt.1	-							NM_001001954	NP_001001954	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						TACAGCCATAGGCCTGCTTCC	0.373													47	121	---	---	---	---	PASS
C11orf48	79081	broad.mit.edu	37	11	62432947	62432947	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62432947G>A	uc001nue.2	-						C11orf48_uc001nuf.2_Intron|METTL12_uc001nug.1_Intron|METTL12_uc001nuh.2_Intron|SNORA57_uc009yoa.1_RNA|METTL12_uc010rmc.1_5'Flank	NM_024099	NP_077004	Q9BQE6	CK048_HUMAN	hypothetical protein LOC79081												0						GTAATGTACGGAGGAAGAGGG	0.652													3	12	---	---	---	---	PASS
ATG2A	23130	broad.mit.edu	37	11	64674992	64674992	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64674992C>T	uc001obx.2	-							NM_015104	NP_055919	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A								protein binding			ovary(1)|central_nervous_system(1)	2						TAGCACCTCTCATACCCAGCT	0.647													11	25	---	---	---	---	PASS
GAL3ST3	89792	broad.mit.edu	37	11	65811127	65811127	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65811127C>G	uc001ogv.2	-	2	307	c.147G>C	c.(145-147)TTG>TTC	p.L49F	GAL3ST3_uc001ogw.2_Missense_Mutation_p.L49F	NM_033036	NP_149025	Q96A11	G3ST3_HUMAN	galactose-3-O-sulfotransferase 3	49	Lumenal (Potential).				monosaccharide metabolic process|oligosaccharide metabolic process|poly-N-acetyllactosamine metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane	3'-phosphoadenosine 5'-phosphosulfate binding|carbohydrate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(1)	1						GAGGGCAGCTCAAGGGGAACA	0.652													13	18	---	---	---	---	PASS
TBX10	347853	broad.mit.edu	37	11	67402568	67402568	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:67402568C>T	uc001omp.2	-	2	262	c.174G>A	c.(172-174)AAG>AAA	p.K58K		NM_005995	NP_005986	O75333	TBX10_HUMAN	T-box 10	58					anatomical structure morphogenesis|regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity				0						CACGTGGGTTCTTGGGGCCCT	0.627													33	84	---	---	---	---	PASS
SLCO2B1	11309	broad.mit.edu	37	11	74904316	74904316	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:74904316G>T	uc001owb.2	+	9	1516	c.1129G>T	c.(1129-1131)GTC>TTC	p.V377F	SLCO2B1_uc010rrq.1_Missense_Mutation_p.V122F|SLCO2B1_uc010rrr.1_Missense_Mutation_p.V233F|SLCO2B1_uc010rrs.1_Missense_Mutation_p.V261F|SLCO2B1_uc001owc.2_Missense_Mutation_p.V150F|SLCO2B1_uc001owd.2_Missense_Mutation_p.V355F	NM_007256	NP_009187	O94956	SO2B1_HUMAN	solute carrier organic anion transporter family,	377	Helical; Name=7; (Potential).				sodium-independent organic anion transport	integral to membrane	sodium-independent organic anion transmembrane transporter activity			ovary(1)|breast(1)	2					Ergoloid mesylate(DB01049)	CCTGCTGGTGGTCCTGTCCCA	0.627													11	125	---	---	---	---	PASS
RAB38	23682	broad.mit.edu	37	11	87847211	87847211	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:87847211T>C	uc001pcj.1	-	3	628	c.581A>G	c.(580-582)AAG>AGG	p.K194R		NM_022337	NP_071732	P57729	RAB38_HUMAN	RAB38	194					protein transport|small GTPase mediated signal transduction	melanosome|plasma membrane	GTP binding|GTPase activity			upper_aerodigestive_tract(1)|large_intestine(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GAGATGGGGCTTCACGACGTC	0.478													65	124	---	---	---	---	PASS
TYR	7299	broad.mit.edu	37	11	89028313	89028313	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89028313C>A	uc001pcs.2	+	5	1451	c.1369C>A	c.(1369-1371)CCA>ACA	p.P457T		NM_000372	NP_000363	P14679	TYRO_HUMAN	tyrosinase precursor	457	Lumenal, melanosome (Potential).				eye pigment biosynthetic process|melanin biosynthetic process from tyrosine|visual perception	Golgi-associated vesicle|integral to membrane|lysosome|melanosome membrane|perinuclear region of cytoplasm	copper ion binding|monophenol monooxygenase activity|protein heterodimerization activity|protein homodimerization activity			ovary(2)|central_nervous_system(1)	3		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|NADH(DB00157)	TATTTCAGACCCAGACTCTTT	0.418									Oculocutaneous_Albinism				30	38	---	---	---	---	PASS
NOX4	50507	broad.mit.edu	37	11	89177344	89177344	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89177344C>T	uc001pct.2	-	5	645	c.406G>A	c.(406-408)GAA>AAA	p.E136K	NOX4_uc009yvr.2_Missense_Mutation_p.E111K|NOX4_uc001pcu.2_Missense_Mutation_p.E62K|NOX4_uc001pcw.2_Intron|NOX4_uc001pcx.2_Intron|NOX4_uc001pcv.2_Missense_Mutation_p.E136K|NOX4_uc009yvo.2_RNA|NOX4_uc010rtu.1_Intron|NOX4_uc009yvp.2_Missense_Mutation_p.E136K|NOX4_uc010rtv.1_Missense_Mutation_p.E112K|NOX4_uc009yvq.2_Missense_Mutation_p.E112K|NOX4_uc009yvs.1_RNA	NM_016931	NP_058627	Q9NPH5	NOX4_HUMAN	NADPH oxidase 4 isoform a	136	Extracellular (Potential).|Ferric oxidoreductase.				cell aging|cell morphogenesis|inflammatory response|negative regulation of cell proliferation|superoxide anion generation	endoplasmic reticulum membrane|focal adhesion|integral to membrane|nucleus	electron carrier activity|flavin adenine dinucleotide binding|heme binding|NAD(P)H oxidase activity|nucleotide binding|oxygen sensor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.011)				ACAAAGTCTTCACTGTAATTC	0.448													44	56	---	---	---	---	PASS
FOLH1B	219595	broad.mit.edu	37	11	89413808	89413808	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89413808A>G	uc001pda.2	+	8	1006	c.480A>G	c.(478-480)CCA>CCG	p.P160P		NM_153696	NP_710163	Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B	160					proteolysis	cytoplasm	dipeptidase activity|metal ion binding|metallopeptidase activity			ovary(3)|skin(2)|central_nervous_system(1)	6						ATTGTACACCACTGATGTACA	0.294													5	36	---	---	---	---	PASS
C11orf65	160140	broad.mit.edu	37	11	108277675	108277675	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:108277675C>T	uc001pkh.2	-	5	314	c.244G>A	c.(244-246)GAT>AAT	p.D82N	C11orf65_uc010rvx.1_Missense_Mutation_p.D33N|C11orf65_uc009yxu.1_RNA	NM_152587	NP_689800	Q8NCR3	CK065_HUMAN	hypothetical protein LOC160140	82										ovary(1)	1		all_cancers(61;1.38e-11)|all_epithelial(67;3.16e-07)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;8.21e-06)|BRCA - Breast invasive adenocarcinoma(274;1.01e-05)|all cancers(92;0.000189)|Colorectal(284;0.114)|OV - Ovarian serous cystadenocarcinoma(223;0.144)		TAGTATATATCAGGTGGAAAT	0.303													32	51	---	---	---	---	PASS
OR10S1	219873	broad.mit.edu	37	11	123847781	123847781	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123847781G>T	uc001pzm.1	-	1	618	c.618C>A	c.(616-618)ACC>ACA	p.T206T		NM_001004474	NP_001004474	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S,	206	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		CATTAATGGTGGTGTCTGTAC	0.537													27	40	---	---	---	---	PASS
ROBO4	54538	broad.mit.edu	37	11	124761204	124761204	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124761204T>G	uc001qbg.2	-	12	2079	c.1939A>C	c.(1939-1941)AAG>CAG	p.K647Q	ROBO4_uc010sas.1_Missense_Mutation_p.K502Q|ROBO4_uc001qbh.2_Missense_Mutation_p.K537Q|ROBO4_uc001qbi.2_Missense_Mutation_p.K205Q|ROBO4_uc010sat.1_Missense_Mutation_p.K205Q	NM_019055	NP_061928	Q8WZ75	ROBO4_HUMAN	roundabout homolog 4, magic roundabout	647					angiogenesis|cell differentiation	integral to membrane	receptor activity			ovary(1)|skin(1)	2	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		CCCTGCTTCTTTTTGGCCTTC	0.597													22	32	---	---	---	---	PASS
GLB1L2	89944	broad.mit.edu	37	11	134229019	134229019	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:134229019G>A	uc001qhp.2	+	7	905	c.717G>A	c.(715-717)AAG>AAA	p.K239K	GLB1L2_uc009zdg.1_RNA	NM_138342	NP_612351	Q8IW92	GLBL2_HUMAN	galactosidase, beta 1-like 2 precursor	239					carbohydrate metabolic process	extracellular region	cation binding|hydrolase activity, hydrolyzing O-glycosyl compounds			ovary(1)|pancreas(1)|skin(1)	3	all_hematologic(175;0.127)	all_cancers(12;2.85e-18)|all_epithelial(12;1.21e-12)|all_lung(97;0.000276)|Lung NSC(97;0.000518)|Breast(109;0.00122)|Medulloblastoma(222;0.0399)|all_neural(223;0.0412)|Esophageal squamous(93;0.0844)		Epithelial(10;1.37e-11)|all cancers(11;2.2e-10)|BRCA - Breast invasive adenocarcinoma(10;3.09e-10)|OV - Ovarian serous cystadenocarcinoma(99;0.000885)|Lung(977;0.223)		GGCTGAGCAAGGGGATTGTCC	0.632													66	131	---	---	---	---	PASS
CD163	9332	broad.mit.edu	37	12	7640565	7640565	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:7640565G>A	uc001qsz.3	-	7	1667	c.1539C>T	c.(1537-1539)AGC>AGT	p.S513S	CD163_uc001qta.3_Silent_p.S513S|CD163_uc009zfw.2_Silent_p.S513S	NM_004244	NP_004235	Q86VB7	C163A_HUMAN	CD163 antigen isoform a	513	SRCR 5.|Extracellular (Potential).				acute-phase response	extracellular region|integral to plasma membrane	protein binding|scavenger receptor activity			ovary(6)|pancreas(1)|skin(1)	8						TGCATAGAACGCTGGCAGCTT	0.527													17	72	---	---	---	---	PASS
TAS2R7	50837	broad.mit.edu	37	12	10954981	10954981	+	Silent	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:10954981T>C	uc001qyv.2	-	1	246	c.189A>G	c.(187-189)CTA>CTG	p.L63L		NM_023919	NP_076408	Q9NYW3	TA2R7_HUMAN	taste receptor, type 2, member 7	63	Helical; Name=2; (Potential).				sensory perception of taste	integral to membrane	taste receptor activity			skin(1)	1						AACAATCTAATAGTATTACGC	0.363													66	129	---	---	---	---	PASS
LST-3TM12	338821	broad.mit.edu	37	12	21200045	21200045	+	Silent	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21200045T>A	uc010sin.1	+	7	888	c.888T>A	c.(886-888)ATT>ATA	p.I296I	SLCO1B3_uc010sil.1_Intron|LST-3TM12_uc010sim.1_Silent_p.I343I	NM_001009562	NP_001009562	Q71QF0	Q71QF0_HUMAN	liver-specific organic anion transporter 3TM12	296						membrane	transporter activity				0						TATTTGTAATTTTTACATTGT	0.313													13	35	---	---	---	---	PASS
ABCC9	10060	broad.mit.edu	37	12	21970196	21970196	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:21970196C>T	uc001rfi.1	-	31	3837	c.3817G>A	c.(3817-3819)GAG>AAG	p.E1273K	ABCC9_uc001rfh.2_Missense_Mutation_p.E1273K|ABCC9_uc001rfj.1_Missense_Mutation_p.E1237K	NM_005691	NP_005682	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C, member 9	1273	Cytoplasmic (Potential).|ABC transmembrane type-1 2.				defense response to virus|potassium ion import	ATP-sensitive potassium channel complex	ATP binding|ATPase activity, coupled to transmembrane movement of substances|potassium channel regulator activity|sulfonylurea receptor activity			ovary(4)|skin(2)	6					Adenosine triphosphate(DB00171)|Glibenclamide(DB01016)	ATCTGGACCTCCAGGTCAGCC	0.373													63	189	---	---	---	---	PASS
KLHDC5	57542	broad.mit.edu	37	12	27933843	27933843	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:27933843C>T	uc001rij.2	+	1	657	c.580C>T	c.(580-582)CCT>TCT	p.P194S	KLHDC5_uc009zjj.2_RNA	NM_020782	NP_065833	Q9P2K6	KLDC5_HUMAN	kelch domain containing 5	194	Kelch 1.									ovary(1)|central_nervous_system(1)	2	Lung SC(9;0.0873)					GACTGGGACTCCTGTCCTCGT	0.672													21	40	---	---	---	---	PASS
COL2A1	1280	broad.mit.edu	37	12	48380931	48380931	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380931C>A	uc001rqu.2	-	21	1476	c.1295G>T	c.(1294-1296)GGC>GTC	p.G432V	COL2A1_uc009zkw.2_RNA|COL2A1_uc001rqv.2_Missense_Mutation_p.G363V	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor	432	Triple-helical region.				axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	CCCAGGGAAGCCAGGAGCACC	0.637													41	114	---	---	---	---	PASS
SLC4A8	9498	broad.mit.edu	37	12	51865250	51865250	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:51865250T>A	uc001rys.1	+	14	2016	c.1838T>A	c.(1837-1839)CTG>CAG	p.L613Q	SLC4A8_uc010sni.1_Missense_Mutation_p.L560Q|SLC4A8_uc001rym.2_Missense_Mutation_p.L560Q|SLC4A8_uc001ryn.2_Missense_Mutation_p.L560Q|SLC4A8_uc001ryo.2_Missense_Mutation_p.L560Q|SLC4A8_uc010snj.1_Missense_Mutation_p.L640Q|SLC4A8_uc001ryq.3_Missense_Mutation_p.L613Q|SLC4A8_uc001ryr.2_Missense_Mutation_p.L613Q|SLC4A8_uc010snk.1_Missense_Mutation_p.L560Q	NM_001039960	NP_001035049	Q2Y0W8	S4A8_HUMAN	solute carrier family 4, sodium bicarbonate	613	Helical; (Potential).				bicarbonate transport|sodium ion transport	integral to membrane|plasma membrane	inorganic anion exchanger activity			ovary(3)|pancreas(1)|skin(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.15)		ATAGAAAAACTGATTCACCTG	0.418													34	118	---	---	---	---	PASS
RARG	5916	broad.mit.edu	37	12	53606961	53606961	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53606961C>T	uc001sce.2	-	9	1570	c.1085G>A	c.(1084-1086)AGG>AAG	p.R362K	RARG_uc001scd.2_Missense_Mutation_p.R351K|RARG_uc010sob.1_Missense_Mutation_p.R340K|RARG_uc001scf.2_Missense_Mutation_p.R362K|RARG_uc001scg.2_Missense_Mutation_p.R290K|RARG_uc010soc.1_Missense_Mutation_p.R241K	NM_000966	NP_000957	P13631	RARG_HUMAN	retinoic acid receptor, gamma isoform 1	362	Ligand-binding.				canonical Wnt receptor signaling pathway|embryonic eye morphogenesis|embryonic hindlimb morphogenesis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|positive regulation of transcription from RNA polymerase II promoter|regulation of cell size|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to retinoic acid	integral to membrane|transcription factor complex	retinoic acid receptor activity|retinoid X receptor binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			breast(2)|ovary(1)|lung(1)	4					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Tazarotene(DB00799)|Tretinoin(DB00755)	GGCGTACAGCCTCAGGGCTTC	0.597											OREG0021862	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	53	---	---	---	---	PASS
BAZ2A	11176	broad.mit.edu	37	12	56994532	56994532	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56994532T>A	uc001slq.1	-	23	4735	c.4541A>T	c.(4540-4542)GAC>GTC	p.D1514V	BAZ2A_uc001slp.1_Missense_Mutation_p.D1512V|BAZ2A_uc001slo.1_Missense_Mutation_p.D320V|BAZ2A_uc009zov.1_Missense_Mutation_p.D480V|BAZ2A_uc009zow.1_Missense_Mutation_p.D1482V	NM_013449	NP_038477	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A	1514					chromatin silencing at rDNA|DNA methylation|transcription, DNA-dependent	chromatin silencing complex|nucleolus|rDNA heterochromatin	DNA binding|histone acetyl-lysine binding|ligand-dependent nuclear receptor binding|RNA binding|zinc ion binding				0						CACTGCTAGGTCTGTCTCGTA	0.522													76	214	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57538835	57538835	+	Missense_Mutation	SNP	G	A	A	rs75873762		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57538835G>A	uc001snd.2	+	5	995	c.529G>A	c.(529-531)GAA>AAA	p.E177K	LRP1_uc010sre.1_Missense_Mutation_p.E177K|LRP1_uc001snb.2_Missense_Mutation_p.E177K|LRP1_uc001snc.1_Missense_Mutation_p.E177K	NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	177	EGF-like 2; calcium-binding (Potential).|Extracellular (Potential).				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGGCTGTGTTGAAGGATACCT	0.562													21	60	---	---	---	---	PASS
LRP1	4035	broad.mit.edu	37	12	57599412	57599412	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57599412A>T	uc001snd.2	+	75	12008	c.11542A>T	c.(11542-11544)AGC>TGC	p.S3848C		NM_002332	NP_002323	Q07954	LRP1_HUMAN	low density lipoprotein-related protein 1	3848	Extracellular (Potential).|EGF-like 15.				aorta morphogenesis|apoptotic cell clearance|negative regulation of platelet-derived growth factor receptor-beta signaling pathway|negative regulation of smooth muscle cell migration|negative regulation of Wnt receptor signaling pathway|positive regulation of cholesterol efflux|regulation of actin cytoskeleton organization|regulation of phospholipase A2 activity	coated pit|integral to plasma membrane|nucleus	apolipoprotein E binding|calcium ion binding|lipoprotein transporter activity|protein complex binding|receptor activity			ovary(8)|lung(3)|breast(3)|large_intestine(2)|central_nervous_system(2)|skin(2)|pancreas(2)	22				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Becaplermin(DB00102)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CCACCTCTGCAGCTGCGCTCG	0.622													32	68	---	---	---	---	PASS
XRCC6BP1	91419	broad.mit.edu	37	12	58340811	58340811	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58340811A>G	uc001sqp.2	+	3	307	c.267A>G	c.(265-267)GAA>GAG	p.E89E		NM_033276	NP_150592	Q9Y6H3	ATP23_HUMAN	XRCC6 binding protein 1	89					double-strand break repair via nonhomologous end joining	DNA-dependent protein kinase-DNA ligase 4 complex	DNA-dependent protein kinase activity|metal ion binding|metalloendopeptidase activity			ovary(1)	1						TTTCTTGCGAAGACTGTAATG	0.308													63	139	---	---	---	---	PASS
IRAK3	11213	broad.mit.edu	37	12	66597554	66597554	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66597554A>G	uc001sth.2	+	2	299	c.197A>G	c.(196-198)AAA>AGA	p.K66R	IRAK3_uc010ssy.1_Intron	NM_007199	NP_009130	Q9Y616	IRAK3_HUMAN	interleukin-1 receptor-associated kinase 3	66	Death.				interleukin-1-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|negative regulation of innate immune response|negative regulation of interleukin-12 production|negative regulation of interleukin-6 production|negative regulation of macrophage cytokine production|negative regulation of MAP kinase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of protein catabolic process|negative regulation of protein complex disassembly|negative regulation of toll-like receptor signaling pathway|negative regulation of tumor necrosis factor production|positive regulation of macrophage tolerance induction|positive regulation of NF-kappaB transcription factor activity|response to exogenous dsRNA|response to lipopolysaccharide|response to peptidoglycan	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein heterodimerization activity|protein homodimerization activity|protein serine/threonine kinase activity			lung(3)|ovary(2)|breast(2)|central_nervous_system(1)	8				GBM - Glioblastoma multiforme(28;0.0203)		GACCAAGGTAAAAGTGGAACA	0.418													23	88	---	---	---	---	PASS
GRIP1	23426	broad.mit.edu	37	12	66932885	66932885	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:66932885C>G	uc001stk.2	-	4	632	c.391G>C	c.(391-393)GAA>CAA	p.E131Q	GRIP1_uc010sta.1_Missense_Mutation_p.E75Q|GRIP1_uc001stl.1_Missense_Mutation_p.E75Q|GRIP1_uc001stm.2_Missense_Mutation_p.E131Q	NM_021150	NP_066973	Q9Y3R0	GRIP1_HUMAN	glutamate receptor interacting protein 1	131	PDZ 1.				androgen receptor signaling pathway|intracellular signal transduction|positive regulation of transcription, DNA-dependent|synaptic transmission	cell junction|cytoplasmic membrane-bounded vesicle|cytosol|endoplasmic reticulum|postsynaptic membrane	androgen receptor binding|beta-catenin binding|protein C-terminus binding|receptor signaling complex scaffold activity|transcription coactivator activity			ovary(2)	2			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TACTCTACTTCAAGAACCACT	0.318													60	120	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	12	80722884	80722884	+	IGR	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:80722884G>C								PPP1R12A (393649 upstream) : PTPRQ (115242 downstream)																							TAAGCCAACTGTGCCCATGTT	0.338													7	19	---	---	---	---	PASS
UTP20	27340	broad.mit.edu	37	12	101738501	101738501	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:101738501G>C	uc001tia.1	+	36	4734	c.4578G>C	c.(4576-4578)TTG>TTC	p.L1526F		NM_014503	NP_055318	O75691	UTP20_HUMAN	down-regulated in metastasis	1526					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|negative regulation of cell proliferation	90S preribosome|cytoplasm|nucleolus|nucleoplasm|preribosome, small subunit precursor|small-subunit processome	protein binding			ovary(2)|breast(2)	4						TGGAGAAATTGAGAAAAGGTC	0.423													43	105	---	---	---	---	PASS
NT5DC3	51559	broad.mit.edu	37	12	104171701	104171701	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104171701G>A	uc010swe.1	-	14	1594	c.1553C>T	c.(1552-1554)CCC>CTC	p.P518L	NT5DC3_uc010swd.1_5'Flank	NM_001031701	NP_001026871	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	518							hydrolase activity|metal ion binding			ovary(2)|skin(1)	3						AGTCCTCCGGGGGTAGAAAGT	0.612													41	87	---	---	---	---	PASS
CUX2	23316	broad.mit.edu	37	12	111729337	111729337	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111729337C>T	uc001tsa.1	+	5	570	c.417C>T	c.(415-417)CCC>CCT	p.P139P	CUX2_uc001tsb.1_Silent_p.P194P	NM_015267	NP_056082	O14529	CUX2_HUMAN	cut-like 2	139						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(3)|skin(2)|breast(1)	6						AGAGGAACCCCGAGCTCCTCA	0.592													19	52	---	---	---	---	PASS
PTPN11	5781	broad.mit.edu	37	12	112888210	112888210	+	Missense_Mutation	SNP	G	A	A	rs121918464		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:112888210G>A	uc001ttx.2	+	3	606	c.226G>A	c.(226-228)GAG>AAG	p.E76K	PTPN11_uc001ttw.1_Missense_Mutation_p.E76K	NM_002834	NP_002825	Q06124	PTN11_HUMAN	protein tyrosine phosphatase, non-receptor type	76	SH2 1.		E -> D (in NS1).|E -> V (in JMML).|E -> A (in JMML; also in myelodysplastic syndrome).|E -> G (in JMML).		axon guidance|cell junction assembly|ephrin receptor signaling pathway|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|interferon-gamma-mediated signaling pathway|leukocyte migration|platelet activation|regulation of cell adhesion mediated by integrin|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|T cell costimulation|type I interferon-mediated signaling pathway	cytosol	non-membrane spanning protein tyrosine phosphatase activity|protein binding	p.E76K(68)|p.E76G(31)|p.E76Q(11)|p.E76V(10)|p.E76A(7)|p.E76M(1)		haematopoietic_and_lymphoid_tissue(375)|lung(6)|autonomic_ganglia(2)|soft_tissue(2)|central_nervous_system(2)|large_intestine(1)|skin(1)|ovary(1)|NS(1)|kidney(1)	392						CACTTTGGCTGAGTTGGTCCA	0.423			Mis		JMML|AML|MDS		Noonan Syndrome		Noonan_syndrome				47	145	---	---	---	---	PASS
LRRC43	254050	broad.mit.edu	37	12	122676112	122676112	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122676112G>A	uc009zxm.2	+	6	1112	c.1087G>A	c.(1087-1089)GAG>AAG	p.E363K	LRRC43_uc001ubw.3_Missense_Mutation_p.E178K|LRRC43_uc009zxn.2_Missense_Mutation_p.E124K	NM_001098519	NP_001091989	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43 isoform 1	363	Glu-rich.										0	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CGTCCTGGCCGAGGTGTGCCC	0.483											OREG0022219	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	29	91	---	---	---	---	PASS
CDK8	1024	broad.mit.edu	37	13	26923311	26923311	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:26923311G>A	uc001uqr.1	+	3	333	c.307G>A	c.(307-309)GAC>AAC	p.D103N	CDK8_uc001uqs.1_Missense_Mutation_p.D103N|CDK8_uc001uqt.1_5'UTR	NM_001260	NP_001251	P49336	CDK8_HUMAN	cyclin-dependent kinase 8	103	Protein kinase.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	mediator complex	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			lung(2)|large_intestine(1)|ovary(1)|skin(1)	5	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0384)|Epithelial(112;0.142)|OV - Ovarian serous cystadenocarcinoma(117;0.188)		TGCTGAACATGACCTCTGGGT	0.413													48	82	---	---	---	---	PASS
CDX2	1045	broad.mit.edu	37	13	28542963	28542963	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:28542963G>A	uc001urv.2	-	1	355	c.181C>T	c.(181-183)CCG>TCG	p.P61S		NM_001265	NP_001256	Q99626	CDX2_HUMAN	caudal type homeobox 2	61					organ morphogenesis|transcription from RNA polymerase II promoter		sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			lung(1)	1	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		GATGGCCCCGGGGACTGCGCG	0.602			T	ETV6	AML								4	5	---	---	---	---	PASS
NEK5	341676	broad.mit.edu	37	13	52639728	52639728	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:52639728C>A	uc001vge.2	-	22	2082	c.1942G>T	c.(1942-1944)GTA>TTA	p.V648L		NM_199289	NP_954983	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	648							ATP binding|metal ion binding|protein serine/threonine kinase activity			upper_aerodigestive_tract(1)	1		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		ACAGCAGCTACAGTCTGCGTG	0.527													23	34	---	---	---	---	PASS
PCDH9	5101	broad.mit.edu	37	13	67205442	67205442	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:67205442G>T	uc001vik.2	-	4	3932	c.3240C>A	c.(3238-3240)ATC>ATA	p.I1080I	PCDH9_uc010aei.2_RNA|PCDH9_uc001vil.2_Silent_p.I1046I|PCDH9_uc010thl.1_Intron	NM_203487	NP_982354	Q9HC56	PCDH9_HUMAN	protocadherin 9 isoform 1 precursor	1080	Cytoplasmic (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)|skin(1)	6		Hepatocellular(98;0.0906)|Breast(118;0.107)		GBM - Glioblastoma multiforme(99;0.00819)		GAGGGTGTGAGATCAGGGTTC	0.562													42	51	---	---	---	---	PASS
KLHL1	57626	broad.mit.edu	37	13	70293566	70293566	+	Nonsense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:70293566A>C	uc001vip.2	-	9	2744	c.1950T>G	c.(1948-1950)TAT>TAG	p.Y650*	KLHL1_uc010thm.1_Nonsense_Mutation_p.Y589*	NM_020866	NP_065917	Q9NR64	KLHL1_HUMAN	kelch-like 1 protein	650	Kelch 5.				actin cytoskeleton organization	cytoplasm|cytoskeleton	actin binding				0		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTCCTACTGCATAAAGAAAAC	0.463													41	69	---	---	---	---	PASS
EDNRB	1910	broad.mit.edu	37	13	78492548	78492548	+	Nonsense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:78492548C>T	uc001vko.2	-	1	419	c.161G>A	c.(160-162)TGG>TAG	p.W54*	uc001vks.2_5'Flank|EDNRB_uc001vkq.1_Nonsense_Mutation_p.W54*|EDNRB_uc010aez.1_Nonsense_Mutation_p.W54*|EDNRB_uc001vkp.1_Nonsense_Mutation_p.W137*|EDNRB_uc010afa.1_Nonsense_Mutation_p.W54*	NM_001122659	NP_001116131	P24530	EDNRB_HUMAN	endothelin receptor type B isoform 1 precursor	54	Extracellular (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|enteric nervous system development|enteric smooth muscle cell differentiation|macrophage chemotaxis|negative regulation of adenylate cyclase activity|negative regulation of cellular protein metabolic process|negative regulation of neuron maturation|negative regulation of transcription from RNA polymerase II promoter|vein smooth muscle contraction	integral to plasma membrane	endothelin-B receptor activity|peptide hormone binding				0		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)	ACCCTTGGGCCATAAGGTCTT	0.622													36	56	---	---	---	---	PASS
MBNL2	10150	broad.mit.edu	37	13	97995296	97995296	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:97995296A>G	uc010aft.2	+	4	1182	c.366A>G	c.(364-366)ATA>ATG	p.I122M	MBNL2_uc001vmz.2_Missense_Mutation_p.I122M|MBNL2_uc001vna.2_Missense_Mutation_p.I122M|MBNL2_uc001vnb.2_RNA|MBNL2_uc010tij.1_Intron	NM_144778	NP_659002	Q5VZF2	MBNL2_HUMAN	muscleblind-like 2 isoform 1	122					mRNA processing|regulation of RNA splicing|RNA splicing	cytoplasm|nucleus	RNA binding|zinc ion binding				0	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.218)			GTCCCGCGATAGGGACAAATA	0.443													19	51	---	---	---	---	PASS
OR4N2	390429	broad.mit.edu	37	14	20295656	20295656	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20295656C>A	uc010tkv.1	+	1	49	c.49C>A	c.(49-51)CTG>ATG	p.L17M		NM_001004723	NP_001004723	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N,	17	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CCTCCTTGGTCTGACCCAGTC	0.378													44	183	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528917	20528917	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528917C>A	uc001vwn.1	+	1	714	c.714C>A	c.(712-714)TCC>TCA	p.S238S		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	238	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		AGGCGCTGTCCACATTGTCTG	0.423													32	123	---	---	---	---	PASS
OR4L1	122742	broad.mit.edu	37	14	20528919	20528919	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20528919C>A	uc001vwn.1	+	1	716	c.716C>A	c.(715-717)ACA>AAA	p.T239K		NM_001004717	NP_001004717	Q8NH43	OR4L1_HUMAN	olfactory receptor, family 4, subfamily L,	239	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|pancreas(1)|central_nervous_system(1)|skin(1)	5	all_cancers(95;0.00108)		Epithelial(56;4.65e-07)|all cancers(55;2.9e-06)	GBM - Glioblastoma multiforme(265;0.0064)		GCGCTGTCCACATTGTCTGCC	0.428													28	124	---	---	---	---	PASS
CHD8	57680	broad.mit.edu	37	14	21860938	21860938	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21860938C>A	uc001was.1	-	34	5756	c.5662G>T	c.(5662-5664)GTC>TTC	p.V1888F	CHD8_uc001war.1_Missense_Mutation_p.V1784F|SNORD9_uc001wat.1_5'Flank	NM_020920	NP_065971	Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	2167					ATP-dependent chromatin remodeling|canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase III promoter|transcription, DNA-dependent	MLL1 complex	ATP binding|beta-catenin binding|DNA binding|DNA helicase activity|DNA-dependent ATPase activity|methylated histone residue binding|p53 binding			ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|breast(1)|skin(1)	10	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GCCTGGCAGACGAGGTCAATA	0.483													39	97	---	---	---	---	PASS
MYH7	4625	broad.mit.edu	37	14	23902340	23902340	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23902340C>A	uc001wjx.2	-	4	404	c.298G>T	c.(298-300)GCG>TCG	p.A100S		NM_000257	NP_000248	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	100	Myosin head-like.				adult heart development|muscle filament sliding|regulation of heart rate|ventricular cardiac muscle tissue morphogenesis	focal adhesion|muscle myosin complex|myosin filament|nucleus|sarcomere	actin binding|actin-dependent ATPase activity|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(3)|skin(1)	4	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TAGAGCACCGCGGGCTCATGC	0.567													35	78	---	---	---	---	PASS
PRKD1	5587	broad.mit.edu	37	14	30135294	30135294	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:30135294A>T	uc001wqh.2	-	3	705	c.524T>A	c.(523-525)CTT>CAT	p.L175H		NM_002742	NP_002733	Q15139	KPCD1_HUMAN	protein kinase D1	175	Phorbol-ester/DAG-type 1.				cell proliferation|intracellular signal transduction|sphingolipid metabolic process	cytosol|integral to plasma membrane	ATP binding|metal ion binding|protein binding|protein kinase C activity			lung(3)|large_intestine(2)|ovary(2)|skin(1)	8	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TTCACATTTAAGACCTTGACG	0.323													27	134	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47324238	47324238	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47324238T>C	uc001wwj.3	-	15	2861	c.2665A>G	c.(2665-2667)ACT>GCT	p.T889A	MDGA2_uc001wwh.3_Missense_Mutation_p.T91A|MDGA2_uc001wwi.3_Missense_Mutation_p.T660A	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	889	MAM.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						TGAAATGAAGTAATTGGGTAT	0.323													21	87	---	---	---	---	PASS
CDKL1	8814	broad.mit.edu	37	14	50856878	50856878	+	Silent	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:50856878T>C	uc010anu.1	-	7	939	c.939A>G	c.(937-939)CAA>CAG	p.Q313Q	CDKL1_uc001wxz.2_Intron	NM_004196	NP_004187	Q00532	CDKL1_HUMAN	cyclin-dependent kinase-like 1	Error:Variant_position_missing_in_Q00532_after_alignment						cytoplasm|nucleus	ATP binding|cyclin-dependent protein kinase activity			ovary(1)|stomach(1)	2	all_epithelial(31;0.000746)|Breast(41;0.0102)					TTCCTTCTCTTTGTCTCACTT	0.418													54	127	---	---	---	---	PASS
DDHD1	80821	broad.mit.edu	37	14	53619407	53619407	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:53619407C>G	uc001xai.2	-	1	640	c.410G>C	c.(409-411)GGA>GCA	p.G137A	DDHD1_uc001xaj.2_Missense_Mutation_p.G137A|DDHD1_uc001xah.2_Missense_Mutation_p.G137A	NM_001160148	NP_001153620	Q8NEL9	DDHD1_HUMAN	DDHD domain containing 1 isoform c	137					lipid catabolic process	cytoplasm	hydrolase activity|metal ion binding			ovary(2)	2	Breast(41;0.037)					GGGGGACCCTCCTGTCGCGCC	0.746													4	24	---	---	---	---	PASS
DLGAP5	9787	broad.mit.edu	37	14	55655860	55655860	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55655860T>A	uc001xbs.2	-	2	255	c.38A>T	c.(37-39)GAT>GTT	p.D13V	DLGAP5_uc001xbt.2_Missense_Mutation_p.D13V	NM_014750	NP_055565	Q15398	DLGP5_HUMAN	discs large homolog 7 isoform a	13					cell proliferation|cell-cell signaling|mitotic chromosome movement towards spindle pole|positive regulation of mitotic metaphase/anaphase transition	nucleus|spindle pole centrosome	phosphoprotein phosphatase activity|protein binding			ovary(1)|skin(1)	2						AGTACTTATATCCTTCCTGTG	0.323													13	63	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65262276	65262276	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65262276C>A	uc001xht.2	-	11	1477	c.1423G>T	c.(1423-1425)GAG>TAG	p.E475*	SPTB_uc001xhr.2_Nonsense_Mutation_p.E475*|SPTB_uc001xhs.2_Nonsense_Mutation_p.E475*|SPTB_uc001xhu.2_Nonsense_Mutation_p.E475*	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	475	Spectrin 2.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		ACCCGCTCCTCGTAGGCAGCC	0.592													16	71	---	---	---	---	PASS
C14orf174	161394	broad.mit.edu	37	14	77857344	77857344	+	Intron	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:77857344G>T	uc001xtq.1	+							NM_001010860	NP_001010860	Q9P1V8	SAM15_HUMAN	hypothetical protein LOC161394												0			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0278)		TTATCCTTGCGTTTCAGGCAA	0.363													30	84	---	---	---	---	PASS
SLC24A4	123041	broad.mit.edu	37	14	92922883	92922883	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:92922883C>G	uc001yak.2	+	12	1159	c.1135C>G	c.(1135-1137)CCG>GCG	p.P379A	SLC24A4_uc001yai.2_Missense_Mutation_p.P332A|SLC24A4_uc010twm.1_Missense_Mutation_p.P377A|SLC24A4_uc001yaj.2_Missense_Mutation_p.P360A|SLC24A4_uc010auj.2_Missense_Mutation_p.P268A|SLC24A4_uc010twn.1_Missense_Mutation_p.P152A|SLC24A4_uc001yan.2_Missense_Mutation_p.P90A	NM_153646	NP_705932	Q8NFF2	NCKX4_HUMAN	solute carrier family 24 member 4 isoform 1	396	Extracellular (Potential).|Poly-Pro.					integral to membrane|plasma membrane	calcium, potassium:sodium antiporter activity|symporter activity			breast(2)|ovary(1)	3		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GCAGCAGCCGCCGCCACAGCC	0.617											OREG0022876	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	10	31	---	---	---	---	PASS
IFI27	3429	broad.mit.edu	37	14	94582791	94582791	+	Silent	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94582791T>G	uc010tws.1	+	5	475	c.354T>G	c.(352-354)ACT>ACG	p.T118T	IFI27_uc001yco.2_Missense_Mutation_p.L99R	NM_005532	NP_005523	P40305	IFI27_HUMAN	interferon, alpha-inducible protein 27 isoform	Error:Variant_position_missing_in_P40305_after_alignment					activation of caspase activity|activation of pro-apoptotic gene products|induction of apoptosis by extracellular signals|type I interferon-mediated signaling pathway	integral to membrane|mitochondrion					0				Epithelial(152;0.112)|all cancers(159;0.187)|COAD - Colon adenocarcinoma(157;0.206)		GCAACTGGACTCTCCGGATTG	0.597													9	24	---	---	---	---	PASS
GLRX5	51218	broad.mit.edu	37	14	96010432	96010432	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:96010432A>T	uc001yem.1	+	2	548	c.444A>T	c.(442-444)TTA>TTT	p.L148F		NM_016417	NP_057501	Q86SX6	GLRX5_HUMAN	glutaredoxin 5	148					cell redox homeostasis|hemopoiesis	mitochondrion	2 iron, 2 sulfur cluster binding|electron carrier activity|metal ion binding|protein disulfide oxidoreductase activity				0		all_cancers(154;0.135)		Epithelial(152;0.133)|COAD - Colon adenocarcinoma(157;0.21)|all cancers(159;0.212)		CCGCCCTTTTAGATGAAAAGA	0.522													28	35	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106877769	106877769	+	RNA	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106877769C>T	uc010tyt.1	-	277		c.11330G>A			uc010tyu.1_Nonsense_Mutation_p.W61*					Parts of antibodies, mostly variable regions.												0						TACTCCCAATCCACTCCAGCC	0.557													22	139	---	---	---	---	PASS
OR4N4	283694	broad.mit.edu	37	15	22382682	22382682	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:22382682T>A	uc001yuc.1	+	7	1191	c.210T>A	c.(208-210)GAT>GAA	p.D70E	LOC727924_uc001yub.1_RNA|OR4N4_uc010tzv.1_Missense_Mutation_p.D70E	NM_001005241	NP_001005241	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N,	70	Helical; Name=2; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(4)|skin(1)	5		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		CCTTCCTGGATGCATCCTACT	0.478													73	280	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	15	25494433	25494433	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25494433G>C	uc001zae.2	+						SNORD115-44_uc001zam.1_5'Flank					Homo sapiens clone Rt-16 SNURF-SNRPN mRNA, downstream untranslated exons, alternatively spliced.																		GCCCAGGCTAGGTGAGAATTT	0.488													44	101	---	---	---	---	PASS
GABRG3	2567	broad.mit.edu	37	15	27572176	27572176	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:27572176G>T	uc001zbg.1	+	4	657	c.491G>T	c.(490-492)AGG>ATG	p.R164M	GABRG3_uc001zbf.2_Missense_Mutation_p.R164M	NM_033223	NP_150092	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma	164	Extracellular (Probable).				gamma-aminobutyric acid signaling pathway|synaptic transmission	cell junction|chloride channel complex|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity				0		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)		TACACTTTGAGGTAAGATGCT	0.423													6	13	---	---	---	---	PASS
GOLGA8G	283768	broad.mit.edu	37	15	28769090	28769090	+	Missense_Mutation	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28769090A>C	uc001zbu.2	-	14	1753	c.764T>G	c.(763-765)ATG>AGG	p.M255R	GOLGA8G_uc001zbt.3_Missense_Mutation_p.M251R|GOLGA8G_uc001zbv.2_Intron	NM_001012420	NP_001012420			golgi autoantigen, golgin subfamily a, 8G												0		all_lung(180;1.98e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;4.69e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0201)|GBM - Glioblastoma multiforme(186;0.0503)|Lung(196;0.171)		CAGGCTTACCATGGCCTCCCT	0.587													36	90	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33822813	33822813	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33822813C>A	uc001zhi.2	+	4	370	c.300C>A	c.(298-300)CAC>CAA	p.H100Q	RYR3_uc010bar.2_Missense_Mutation_p.H100Q	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	100	Cytoplasmic (By similarity).|MIR 1.				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GAGGTGGCCACAGGACCCTGT	0.522													15	23	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	34049713	34049713	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:34049713A>T	uc001zhi.2	+	60	8691	c.8621A>T	c.(8620-8622)CAT>CTT	p.H2874L	RYR3_uc010bar.2_Missense_Mutation_p.H2874L	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	2874	Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TTCACCAGTCATTGCCTCTAC	0.483													9	4	---	---	---	---	PASS
MYO5C	55930	broad.mit.edu	37	15	52521323	52521323	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:52521323G>A	uc010bff.2	-						MYO5C_uc010uga.1_Intron	NM_018728	NP_061198	Q9NQX4	MYO5C_HUMAN	myosin VC							myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(7)|central_nervous_system(3)|large_intestine(2)|skin(2)	14				all cancers(107;0.0137)		CGTGAGAGCCGCTCTACCTTG	0.542													97	170	---	---	---	---	PASS
WDR72	256764	broad.mit.edu	37	15	54007484	54007484	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:54007484A>G	uc002acj.2	-	5	462	c.420T>C	c.(418-420)GAT>GAC	p.D140D	WDR72_uc010bfi.1_Silent_p.D140D	NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	140										lung(1)|skin(1)	2				all cancers(107;0.0511)		AAGTTTTGGCATCAATTATAA	0.403													24	66	---	---	---	---	PASS
PRTG	283659	broad.mit.edu	37	15	55974607	55974607	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:55974607C>T	uc002adg.2	-	4	679	c.631G>A	c.(631-633)GCC>ACC	p.A211T		NM_173814	NP_776175	Q2VWP7	PRTG_HUMAN	protogenin precursor	211	Ig-like 2.				multicellular organismal development	integral to membrane				large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		CGTCGGTGGGCTACAGTGGCA	0.448													21	44	---	---	---	---	PASS
PPIB	5479	broad.mit.edu	37	15	64455064	64455064	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:64455064T>A	uc002and.2	-	1	291	c.122A>T	c.(121-123)AAA>ATA	p.K41I	PPIB_uc010bgx.1_Missense_Mutation_p.K33I	NM_000942	NP_000933	P23284	PPIB_HUMAN	peptidylprolyl isomerase B precursor	41					protein folding	endoplasmic reticulum lumen|melanosome	peptide binding|peptidyl-prolyl cis-trans isomerase activity|unfolded protein binding				0					L-Proline(DB00172)	GACGGTGACTTTGGGCCCCTT	0.672													6	19	---	---	---	---	PASS
RPL4	6124	broad.mit.edu	37	15	66792511	66792511	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66792511C>T	uc002apv.2	-	9	977	c.921G>A	c.(919-921)AAG>AAA	p.K307K	SNAPC5_uc002apu.1_5'Flank|RPL4_uc010bhr.2_Silent_p.K213K|RPL4_uc002apw.2_Silent_p.K213K|RPL4_uc002apx.2_Silent_p.K213K	NM_000968	NP_000959	P36578	RL4_HUMAN	ribosomal protein L4	307					endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleolus	protein binding|RNA binding|structural constituent of ribosome				0						GATGGATCTTCTTGCTATAAA	0.373													39	87	---	---	---	---	PASS
C15orf39	56905	broad.mit.edu	37	15	75500622	75500622	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75500622C>A	uc002azp.3	+	2	2553	c.2233C>A	c.(2233-2235)CCA>ACA	p.P745T	C15orf39_uc002azq.3_Missense_Mutation_p.P745T|C15orf39_uc002azr.3_Missense_Mutation_p.P143T	NM_015492	NP_056307	Q6ZRI6	CO039_HUMAN	hypothetical protein LOC56905	745											0						agctccagctccagctccagt	0.209													6	10	---	---	---	---	PASS
IREB2	3658	broad.mit.edu	37	15	78764103	78764103	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78764103G>A	uc002bdr.2	+	7	882	c.720G>A	c.(718-720)AAG>AAA	p.K240K	IREB2_uc010unb.1_5'UTR|IREB2_uc002bdq.2_Silent_p.K240K	NM_004136	NP_004127	P48200	IREB2_HUMAN	iron-responsive element binding protein 2	240							4 iron, 4 sulfur cluster binding|metal ion binding|protein binding				0				UCEC - Uterine corpus endometrioid carcinoma (272;0.232)		GAGTTTTTAAGAATGTGGCAG	0.318													19	40	---	---	---	---	PASS
EFTUD1	79631	broad.mit.edu	37	15	82431031	82431031	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:82431031C>G	uc002bgt.1	-	19	3311	c.3142G>C	c.(3142-3144)GCC>CCC	p.A1048P	EFTUD1_uc002bgs.1_Missense_Mutation_p.A419P|EFTUD1_uc002bgu.1_Missense_Mutation_p.A997P	NM_024580	NP_078856	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain	1048					mature ribosome assembly		GTP binding|GTPase activity|ribosome binding|translation elongation factor activity			ovary(1)	1						TGTGGGCTGGCCAGGCCACTT	0.463													54	116	---	---	---	---	PASS
DET1	55070	broad.mit.edu	37	15	89074069	89074069	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:89074069G>A	uc002bmr.2	-	2	1020	c.868C>T	c.(868-870)CCT>TCT	p.P290S	DET1_uc002bmp.3_RNA|DET1_uc010bnk.2_RNA|DET1_uc002bmq.2_Missense_Mutation_p.P301S	NM_001144074	NP_001137546	Q7L5Y6	DET1_HUMAN	de-etiolated 1 isoform 2	290						nucleus				lung(1)|pancreas(1)	2	Lung NSC(78;0.105)|all_lung(78;0.182)		BRCA - Breast invasive adenocarcinoma(143;0.188)			TTGATGAAAGGATCCCTAAAG	0.522													8	40	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2158623	2158623	+	Missense_Mutation	SNP	T	C	C	rs147685291	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2158623T>C	uc002cos.1	-	15	6754	c.6545A>G	c.(6544-6546)CAG>CGG	p.Q2182R	PKD1_uc002cot.1_Missense_Mutation_p.Q2182R	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2182	Extracellular (Potential).|REJ.				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						GTACTCAGTCTGGTAGGTGAC	0.706													4	0	---	---	---	---	PASS
TMC7	79905	broad.mit.edu	37	16	19027774	19027774	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:19027774A>G	uc002dfq.2	+	3	444	c.314A>G	c.(313-315)GAC>GGC	p.D105G	TMC7_uc010vao.1_Missense_Mutation_p.D105G|TMC7_uc002dfp.2_Missense_Mutation_p.D105G|TMC7_uc010vap.1_5'UTR	NM_024847	NP_079123	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7 isoform a	105	Extracellular (Potential).					integral to membrane				skin(2)|ovary(1)	3						CCATGCAGGGACATTCAAGAG	0.383													14	36	---	---	---	---	PASS
GP2	2813	broad.mit.edu	37	16	20335293	20335293	+	Missense_Mutation	SNP	G	T	T	rs144565957		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20335293G>T	uc002dgv.2	-	3	463	c.380C>A	c.(379-381)GCC>GAC	p.A127D	GP2_uc002dgw.2_Missense_Mutation_p.A127D|GP2_uc002dgx.2_Intron|GP2_uc002dgy.2_Intron	NM_001007240	NP_001007241	P55259	GP2_HUMAN	zymogen granule membrane glycoprotein 2 isoform	127						anchored to membrane|extracellular region|plasma membrane				ovary(3)|skin(1)	4						ATCCCCAAGGGCAGGGTGGGT	0.602													28	98	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20442370	20442370	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20442370A>T	uc002dhe.2	+	9	1328	c.1181A>T	c.(1180-1182)AAG>ATG	p.K394M		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	394					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						TCCATGGGGAAGGCGTCCCCA	0.552													77	255	---	---	---	---	PASS
CDH8	1006	broad.mit.edu	37	16	61854938	61854938	+	Silent	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:61854938A>T	uc002eog.1	-	6	1167	c.915T>A	c.(913-915)ATT>ATA	p.I305I	CDH8_uc002eoh.2_Silent_p.I74I	NM_001796	NP_001787	P55286	CADH8_HUMAN	cadherin 8, type 2 preproprotein	305	Extracellular (Potential).|Cadherin 3.				adherens junction organization|cell junction assembly|homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(6)|skin(2)|breast(1)	9		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		CATTTTCACCAATATCCTGAT	0.438													29	69	---	---	---	---	PASS
SMPD3	55512	broad.mit.edu	37	16	68398689	68398689	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68398689A>G	uc002ewa.2	-	5	1942	c.1520T>C	c.(1519-1521)GTC>GCC	p.V507A	SMPD3_uc010cfe.2_Missense_Mutation_p.V507A|SMPD3_uc010vlh.1_Missense_Mutation_p.V507A	NM_018667	NP_061137	Q9NY59	NSMA2_HUMAN	neutral sphingomyelin phosphodiesterase 3	507	Lumenal (Potential).				cell cycle|multicellular organismal development|sphingomyelin catabolic process	Golgi membrane|integral to membrane|plasma membrane	metal ion binding|sphingomyelin phosphodiesterase activity			skin(1)	1		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0184)|Epithelial(162;0.0785)	Phosphatidylserine(DB00144)	ATCTCCACAGACGACGTCAAA	0.597													26	85	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89351302	89351302	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89351302T>C	uc002fmx.1	-	9	2109	c.1648A>G	c.(1648-1650)AAT>GAT	p.N550D	ANKRD11_uc002fmy.1_Missense_Mutation_p.N550D|ANKRD11_uc002fnc.1_Missense_Mutation_p.N550D|ANKRD11_uc002fnb.1_Missense_Mutation_p.N507D	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	550	Ser-rich.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		GTTTTCCAATTGTCTGTCCGC	0.572													31	39	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89920893	89920893	+	Splice_Site	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89920893A>T	uc002foz.1	+	5	779	c.727_splice	c.e5-2	p.A243_splice	SPIRE2_uc010civ.1_Splice_Site_p.A158_splice|SPIRE2_uc010ciw.1_Splice_Site_p.A243_splice|SPIRE2_uc002fpa.1_Splice_Site_p.A195_splice|SPIRE2_uc010cix.1_Splice_Site_p.A112_splice	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2						transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		CCTGGGGCCCAGGCCCGACTG	0.672													18	35	---	---	---	---	PASS
SPIRE2	84501	broad.mit.edu	37	16	89920895	89920895	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89920895G>T	uc002foz.1	+	5	779	c.727G>T	c.(727-729)GCC>TCC	p.A243S	SPIRE2_uc010civ.1_Missense_Mutation_p.A158S|SPIRE2_uc010ciw.1_Missense_Mutation_p.A243S|SPIRE2_uc002fpa.1_Missense_Mutation_p.A195S|SPIRE2_uc010cix.1_Missense_Mutation_p.A112S	NM_032451	NP_115827	Q8WWL2	SPIR2_HUMAN	spire homolog 2	243					transport	cytoplasm|cytoskeleton	actin binding			central_nervous_system(1)	1		Lung NSC(15;5.15e-06)|all_lung(18;8.38e-06)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0286)		TGGGGCCCAGGCCCGACTGTG	0.672													17	36	---	---	---	---	PASS
TUBB3	10381	broad.mit.edu	37	16	89985821	89985821	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89985821G>A	uc002fpf.2	+	1	563	c.155G>A	c.(154-156)AGC>AAC	p.S52N	MC1R_uc002fpe.3_Missense_Mutation_p.S52N|TUBB3_uc010ciz.1_5'Flank	NM_006086	NP_006077	Q13509	TBB3_HUMAN	tubulin, beta, 4	Error:Variant_position_missing_in_Q13509_after_alignment					'de novo' posttranslational protein folding|axon guidance|microtubule-based movement|protein polymerization	cytoplasm|microtubule	GTP binding|GTPase activity|structural molecule activity			ovary(2)|pancreas(1)	3		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		GGGCTGGTGAGCTTGGTGGAG	0.642													34	55	---	---	---	---	PASS
RAI1	10743	broad.mit.edu	37	17	17699777	17699777	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:17699777G>T	uc002grm.2	+	3	3984	c.3515G>T	c.(3514-3516)CGT>CTT	p.R1172L	RAI1_uc002grn.1_Missense_Mutation_p.R1172L	NM_030665	NP_109590	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	1172	Nuclear localization signal (Potential).					cytoplasm|nucleus	zinc ion binding			central_nervous_system(1)|skin(1)	2				READ - Rectum adenocarcinoma(1115;0.0276)		CCCAACTGCCGTGCCACCAAG	0.642													17	51	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18046882	18046882	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18046882G>A	uc010vxh.1	+	25	6251	c.5913G>A	c.(5911-5913)CTG>CTA	p.L1971L		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	1971	IQ 3.|Neck or regulatory domain.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					TTCTGAAGCTGAGGGCAGAGT	0.667													7	9	---	---	---	---	PASS
SUPT6H	6830	broad.mit.edu	37	17	27009987	27009987	+	Silent	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:27009987A>G	uc002hby.2	+	15	1845	c.1755A>G	c.(1753-1755)CTA>CTG	p.L585L	SUPT6H_uc010crt.2_Silent_p.L585L	NM_003170	NP_003161	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog	585					chromatin remodeling|regulation of transcription elongation, DNA-dependent|regulation of transcription from RNA polymerase II promoter	nucleus	hydrolase activity, acting on ester bonds|RNA binding|sequence-specific DNA binding transcription factor activity			ovary(2)|skin(1)	3	Lung NSC(42;0.00431)					AAGCTGTGCTAGAAGGCGCCC	0.577													10	37	---	---	---	---	PASS
AP2B1	163	broad.mit.edu	37	17	34009759	34009759	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34009759G>A	uc002hjr.2	+	17	2517	c.2328G>A	c.(2326-2328)CTG>CTA	p.L776L	AP2B1_uc002hjq.2_Silent_p.L790L|AP2B1_uc010wci.1_Silent_p.L752L|AP2B1_uc002hjs.2_Silent_p.L719L|AP2B1_uc002hjt.2_Silent_p.L790L|AP2B1_uc010ctv.2_Silent_p.L790L|AP2B1_uc010wcj.1_Silent_p.L527L	NM_001282	NP_001273	P63010	AP2B1_HUMAN	adaptor-related protein complex 2, beta 1	776					axon guidance|epidermal growth factor receptor signaling pathway|intracellular protein transport|negative regulation of epidermal growth factor receptor signaling pathway|nerve growth factor receptor signaling pathway|regulation of defense response to virus by virus|synaptic transmission|vesicle-mediated transport|viral reproduction	clathrin adaptor complex|coated pit|cytosol|endocytic vesicle membrane|plasma membrane	clathrin binding|protein transporter activity			ovary(1)	1		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		ATACACCACTGATGCCAAACC	0.458													20	51	---	---	---	---	PASS
CDK12	51755	broad.mit.edu	37	17	37672056	37672056	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:37672056G>A	uc010cvv.2	+	9	3427	c.2841G>A	c.(2839-2841)CTG>CTA	p.L947L	CDK12_uc010wef.1_Silent_p.L946L|CDK12_uc002hrw.3_Silent_p.L947L	NM_016507	NP_057591	Q9NYV4	CDK12_HUMAN	Cdc2-related kinase, arginine/serine-rich	947	Protein kinase.				mRNA processing|phosphorylation of RNA polymerase II C-terminal domain|protein autophosphorylation|regulation of MAP kinase activity|RNA splicing	nuclear cyclin-dependent protein kinase holoenzyme complex|nuclear speck|nucleolus	ATP binding|cyclin-dependent protein kinase activity|protein binding|RNA polymerase II carboxy-terminal domain kinase activity			ovary(10)|lung(4)|breast(2)|skin(2)|large_intestine(1)	19						AGCTAGAACTGATCAGGTACA	0.408										TCGA Ovarian(9;0.13)			24	84	---	---	---	---	PASS
KIF2B	84643	broad.mit.edu	37	17	51901549	51901549	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:51901549A>T	uc002iua.2	+	1	1311	c.1155A>T	c.(1153-1155)CAA>CAT	p.Q385H	uc010wna.1_RNA	NM_032559	NP_115948	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	385	Kinesin-motor.				blood coagulation|cell division|microtubule depolymerization|microtubule-based movement|mitotic prometaphase|regulation of chromosome segregation	condensed chromosome kinetochore|cytosol|microtubule|microtubule organizing center|nucleolus|spindle	ATP binding|microtubule motor activity			ovary(5)|skin(3)	8						AGCAAATCCAAGTGGTCGGGC	0.478													25	61	---	---	---	---	PASS
TMEM100	55273	broad.mit.edu	37	17	53798145	53798145	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:53798145C>A	uc002iuj.3	-	2	598	c.287G>T	c.(286-288)GGA>GTA	p.G96V	TMEM100_uc002iuk.3_Missense_Mutation_p.G96V	NM_018286	NP_060756	Q9NV29	TM100_HUMAN	transmembrane protein 100	96	Helical; (Potential).					integral to membrane					0						TAAAAAAAGTCCAGATGACAG	0.502													33	105	---	---	---	---	PASS
CD79B	974	broad.mit.edu	37	17	62008692	62008692	+	Intron	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62008692G>A	uc002jdq.1	-						CD79B_uc002jdo.1_5'Flank|CD79B_uc002jdp.1_Intron|CD79B_uc002jdr.1_Intron	NM_000626	NP_000617	P40259	CD79B_HUMAN	CD79B antigen isoform 1 precursor						cell surface receptor linked signaling pathway|immune response	Golgi apparatus|integral to plasma membrane|nucleus	transmembrane receptor activity				0						CGAGGCTACTGACCTTTGGGA	0.647			Mis|O		DLBCL								10	37	---	---	---	---	PASS
SCN4A	6329	broad.mit.edu	37	17	62028792	62028792	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:62028792C>A	uc002jds.1	-	14	2922	c.2845G>T	c.(2845-2847)GAT>TAT	p.D949Y		NM_000334	NP_000325	P35499	SCN4A_HUMAN	voltage-gated sodium channel type 4 alpha	949					muscle contraction	voltage-gated sodium channel complex	voltage-gated sodium channel activity			ovary(1)|pancreas(1)|skin(1)	3					Lamotrigine(DB00555)	ACCTTGCTATCCTCAGGCTCT	0.323													15	49	---	---	---	---	PASS
COLEC12	81035	broad.mit.edu	37	18	480715	480715	+	Missense_Mutation	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:480715T>A	uc002kkm.2	-	2	265	c.50A>T	c.(49-51)AAG>ATG	p.K17M		NM_130386	NP_569057	Q5KU26	COL12_HUMAN	collectin sub-family member 12	17	Cytoplasmic (Potential).				carbohydrate mediated signaling|innate immune response|phagocytosis, recognition|protein homooligomerization	collagen|integral to membrane	galactose binding|low-density lipoprotein particle binding|metal ion binding|pattern recognition receptor activity|scavenger receptor activity			ovary(1)|pancreas(1)	2		all_cancers(4;0.0442)|Myeloproliferative disorder(11;0.0426)				ACCAAACCGCTTGTAACCGAA	0.552													19	50	---	---	---	---	PASS
EPB41L3	23136	broad.mit.edu	37	18	5428365	5428365	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:5428365G>C	uc002kmt.1	-	9	1098	c.1012C>G	c.(1012-1014)CTA>GTA	p.L338V	EPB41L3_uc010wzh.1_Missense_Mutation_p.L338V|EPB41L3_uc002kmu.1_Missense_Mutation_p.L338V|EPB41L3_uc010dkq.1_Missense_Mutation_p.L229V|EPB41L3_uc010dks.1_Missense_Mutation_p.L360V	NM_012307	NP_036439	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	338	FERM.				cortical actin cytoskeleton organization	cell-cell junction|cytoplasm|cytoskeleton|extrinsic to membrane	actin binding|structural molecule activity			ovary(5)	5						GAAATCTTTAGAACCTTGGGC	0.458													56	109	---	---	---	---	PASS
CEP76	79959	broad.mit.edu	37	18	12691384	12691384	+	Missense_Mutation	SNP	A	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:12691384A>G	uc002kri.2	-	7	1063	c.907T>C	c.(907-909)TCA>CCA	p.S303P	PSMG2_uc002krg.2_Intron|CEP76_uc002krh.3_Missense_Mutation_p.S125P|CEP76_uc010wzz.1_Missense_Mutation_p.S228P|CEP76_uc010xaa.1_Missense_Mutation_p.S125P	NM_024899	NP_079175	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	303					G2/M transition of mitotic cell cycle|regulation of centriole replication	centriole|cytosol	protein binding				0						ACCAGTCGTGAGTTGTGTGAG	0.333													16	67	---	---	---	---	PASS
C18orf1	753	broad.mit.edu	37	18	13645499	13645499	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13645499A>T	uc002ksa.2	+	7	1432	c.764A>T	c.(763-765)TAC>TTC	p.Y255F	C18orf1_uc002ksb.2_Missense_Mutation_p.Y237F|C18orf1_uc002kse.2_Missense_Mutation_p.Y218F|C18orf1_uc002ksf.2_Missense_Mutation_p.Y200F|C18orf1_uc002ksg.1_Missense_Mutation_p.Y178F|C18orf1_uc002ksh.1_Missense_Mutation_p.Y197F|C18orf1_uc002ksi.1_Missense_Mutation_p.Y179F	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1	255	Cytoplasmic (Potential).					integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CCCCCCACATACAGCGAGGTG	0.617													37	76	---	---	---	---	PASS
ALPK2	115701	broad.mit.edu	37	18	56246930	56246930	+	Missense_Mutation	SNP	C	T	T	rs140973320	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:56246930C>T	uc002lhj.3	-	4	1292	c.1078G>A	c.(1078-1080)GAT>AAT	p.D360N		NM_052947	NP_443179	Q86TB3	ALPK2_HUMAN	heart alpha-kinase	360							ATP binding|protein serine/threonine kinase activity			ovary(7)|skin(5)|lung(1)|central_nervous_system(1)	14						TCTTCGTCATCGCTTTCTAAT	0.502											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	43	43	---	---	---	---	PASS
ZNF236	7776	broad.mit.edu	37	18	74616326	74616326	+	Intron	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:74616326T>C	uc002lmi.2	+						ZNF236_uc002lmj.2_Intron	NM_007345	NP_031371	Q9UL36	ZN236_HUMAN	zinc finger protein 236						cellular response to glucose stimulus	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(4)	4		Prostate(75;0.0405)|Esophageal squamous(42;0.129)|Melanoma(33;0.132)		OV - Ovarian serous cystadenocarcinoma(15;4.36e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0686)		GCTTTTCTTTTGCTTTGTAGG	0.333													36	41	---	---	---	---	PASS
ABCA7	10347	broad.mit.edu	37	19	1058927	1058927	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:1058927G>A	uc002lqw.3	+	39	5619	c.5388G>A	c.(5386-5388)AGG>AGA	p.R1796R	ABCA7_uc002lqy.2_Silent_p.R249R|ABCA7_uc010dsc.2_RNA	NM_019112	NP_061985	Q8IZY2	ABCA7_HUMAN	ATP-binding cassette, sub-family A, member 7	1796	ABC transporter 2.				phagocytosis|transmembrane transport	ATP-binding cassette (ABC) transporter complex|endosome membrane|Golgi membrane|integral to membrane|plasma membrane	ATP binding|ATPase activity|transporter activity			pancreas(7)|ovary(1)|central_nervous_system(1)	9		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGTGCTGAGGAACTTGACCA	0.612													30	64	---	---	---	---	PASS
DAPK3	1613	broad.mit.edu	37	19	3959147	3959147	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3959147G>A	uc002lzc.1	-	8	1410	c.1317C>T	c.(1315-1317)CGC>CGT	p.R439R	DAPK3_uc002lzb.1_Silent_p.R176R|DAPK3_uc002lzd.1_Silent_p.R439R	NM_001348	NP_001339	O43293	DAPK3_HUMAN	death-associated protein kinase 3	439	Interaction with CDC5L (By similarity).				apoptosis|chromatin modification|induction of apoptosis|intracellular protein kinase cascade	cytoplasm|PML body	ATP binding|leucine zipper domain binding|protein serine/threonine kinase activity			central_nervous_system(3)|lung(2)|ovary(1)|large_intestine(1)	7		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		GCTCCAGGGCGCGCACGAGGT	0.716													6	10	---	---	---	---	PASS
KDM4B	23030	broad.mit.edu	37	19	5077469	5077469	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:5077469C>T	uc002mbq.3	+	8	994	c.768C>T	c.(766-768)ATC>ATT	p.I256I	KDM4B_uc010xil.1_Silent_p.I256I|KDM4B_uc010xim.1_Silent_p.I256I|KDM4B_uc002mbr.3_Silent_p.I14I	NM_015015	NP_055830	O94953	KDM4B_HUMAN	jumonji domain containing 2B	256	JmjC.				chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|zinc ion binding			lung(1)	1						AGTACGGGATCCCCTTCAGCC	0.647													85	135	---	---	---	---	PASS
ZNF557	79230	broad.mit.edu	37	19	7076407	7076407	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7076407G>C	uc002mgb.2	+	5	600	c.115G>C	c.(115-117)GAG>CAG	p.E39Q	ZNF557_uc002mga.2_Missense_Mutation_p.E46Q|ZNF557_uc002mgc.2_Missense_Mutation_p.E46Q	NM_001044388	NP_001037853	Q8N988	ZN557_HUMAN	zinc finger protein 557 isoform b	39	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|pancreas(1)	2				Lung(535;0.179)		GGTGACCTTTGAGGATGTGGC	0.577													42	61	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8154510	8154510	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8154510C>A	uc002mjf.2	-	50	6316	c.6295G>T	c.(6295-6297)GTC>TTC	p.V2099F	FBN3_uc002mje.2_5'UTR	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor	2099	EGF-like 33; calcium-binding.					proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						TTGACACAGACGCCGTTAGTG	0.582													50	134	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9024995	9024995	+	Silent	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9024995G>C	uc002mkp.2	-	16	37071	c.36867C>G	c.(36865-36867)CCC>CCG	p.P12289P		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12291	SEA 2.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATCTTTCTCGGGCCTGGGGA	0.542													13	42	---	---	---	---	PASS
ZNF441	126068	broad.mit.edu	37	19	11892417	11892417	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11892417G>T	uc010dyj.2	+	4	1972	c.1778G>T	c.(1777-1779)GGG>GTG	p.G593V	ZNF441_uc002msn.3_Missense_Mutation_p.G549V	NM_152355	NP_689568	Q8N8Z8	ZN441_HUMAN	zinc finger protein 441	593	C2H2-type 16.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1						AAGATATGTGGGAAAGGCTTT	0.408													17	41	---	---	---	---	PASS
PKN1	5585	broad.mit.edu	37	19	14561819	14561819	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14561819G>A	uc002myp.2	+	6	1036	c.868G>A	c.(868-870)GAA>AAA	p.E290K	PKN1_uc002myq.2_Missense_Mutation_p.E296K	NM_002741	NP_002732	Q16512	PKN1_HUMAN	protein kinase N1 isoform 2	290	REM 3.				activation of JUN kinase activity|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|transcription, DNA-dependent	endosome|nucleus|plasma membrane	androgen receptor binding|ATP binding|chromatin binding|GTP-Rho binding|histone binding|histone deacetylase binding|histone kinase activity (H3-T11 specific)|ligand-dependent nuclear receptor transcription coactivator activity|protein kinase C activity|protein kinase C binding|Rac GTPase binding			ovary(2)|breast(2)|skin(2)|large_intestine(1)|central_nervous_system(1)	8						GCTGCTGCGAGAAGAGCTCGC	0.692													6	8	---	---	---	---	PASS
USHBP1	83878	broad.mit.edu	37	19	17370752	17370752	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:17370752C>A	uc002nfs.1	-	5	835	c.722G>T	c.(721-723)AGT>ATT	p.S241I	USHBP1_uc002nfr.1_5'Flank|USHBP1_uc002nft.1_RNA|USHBP1_uc010xpk.1_Missense_Mutation_p.S177I|USHBP1_uc010eam.1_Missense_Mutation_p.S169I	NM_031941	NP_114147	Q8N6Y0	USBP1_HUMAN	Usher syndrome 1C binding protein 1	241							PDZ domain binding			ovary(1)	1						GCTAGAACCACTGCCTGAGCC	0.567													28	75	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19339269	19339269	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19339269G>C	uc002nlz.2	+	8	2939	c.2840G>C	c.(2839-2841)GGG>GCG	p.G947A	NCAN_uc010ecc.1_Missense_Mutation_p.G511A	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	947					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			GTTTCCTCAGGGGAGCCTACG	0.642													77	204	---	---	---	---	PASS
ZNF208	7757	broad.mit.edu	37	19	22157058	22157058	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22157058C>T	uc002nqp.2	-	4	927	c.778G>A	c.(778-780)GAA>AAA	p.E260K	ZNF208_uc002nqo.1_Intron|ZNF208_uc010ecw.1_5'Flank	NM_007153	NP_009084			zinc finger protein 208											ovary(5)|skin(2)	7		all_lung(12;0.0961)|Lung NSC(12;0.103)				CCACATTCTTCACATTTGTAG	0.363													14	41	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22941148	22941148	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22941148G>A	uc010xrh.1	-	5	1290	c.1290C>T	c.(1288-1290)TTC>TTT	p.F430F		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TAAGGGCTGAGAAATGCTTAA	0.348													12	48	---	---	---	---	PASS
ZNF536	9745	broad.mit.edu	37	19	30934949	30934949	+	Nonsense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:30934949C>A	uc002nsu.1	+	2	618	c.480C>A	c.(478-480)TGC>TGA	p.C160*	ZNF536_uc010edd.1_Nonsense_Mutation_p.C160*	NM_014717	NP_055532	O15090	ZN536_HUMAN	zinc finger protein 536	160	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	zinc ion binding			ovary(7)|large_intestine(2)|skin(2)	11	Esophageal squamous(110;0.0834)					CCTTCAAGTGCCCGTACTGCG	0.657													23	60	---	---	---	---	PASS
GPI	2821	broad.mit.edu	37	19	34890129	34890129	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:34890129C>T	uc002nvg.1	+	15	1390	c.1287C>T	c.(1285-1287)TTC>TTT	p.F429F	GPI_uc002nvf.2_Silent_p.F468F|GPI_uc010xrv.1_Silent_p.F440F|GPI_uc010xrw.1_Silent_p.F401F|GPI_uc010edl.1_Silent_p.F429F|GPI_uc002nvi.1_Silent_p.F92F	NM_000175	NP_000166	P06744	G6PI_HUMAN	glucose phosphate isomerase	429					angiogenesis|gluconeogenesis|glycolysis|hemostasis|humoral immune response	cytosol|extracellular space|nucleus|plasma membrane	cytokine activity|glucose-6-phosphate isomerase activity|growth factor activity			ovary(1)|kidney(1)	2	Esophageal squamous(110;0.162)					TGGCCAACTTCTTGGCCCAGA	0.587													14	53	---	---	---	---	PASS
ARHGAP33	115703	broad.mit.edu	37	19	36279138	36279138	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36279138G>A	uc002obs.1	+	21	3273	c.3188G>A	c.(3187-3189)GGT>GAT	p.G1063D	ARHGAP33_uc002obt.1_Missense_Mutation_p.G1060D|ARHGAP33_uc010eel.2_Intron|ARHGAP33_uc002obv.1_Missense_Mutation_p.G812D	NM_052948	NP_443180	O14559	RHG33_HUMAN	sorting nexin 26	1224					cell communication|protein transport|signal transduction	intracellular	GTPase activator activity|phosphatidylinositol binding|protein binding			skin(2)|ovary(1)|pancreas(1)	4						AGGGTGCCGGGTCCCTGGGGC	0.692													15	28	---	---	---	---	PASS
ZNF567	163081	broad.mit.edu	37	19	37211000	37211000	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37211000C>T	uc010xtl.1	+	6	1596	c.1374C>T	c.(1372-1374)TTC>TTT	p.F458F	ZNF567_uc002oeo.1_Silent_p.F458F|ZNF567_uc010xtk.1_Silent_p.F458F|ZNF567_uc002oep.3_Silent_p.F427F|ZNF567_uc002oeq.1_Silent_p.F427F	NM_152603	NP_689816	Q8N184	ZN567_HUMAN	zinc finger protein 567	458	C2H2-type 9.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			GAAAGTCCTTCCGCCAGAAGA	0.433													47	100	---	---	---	---	PASS
FBL	2091	broad.mit.edu	37	19	40331140	40331140	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40331140G>C	uc002omn.2	-	3	311	c.197C>G	c.(196-198)TCT>TGT	p.S66C	FBL_uc002omm.1_5'UTR|FBL_uc002omo.2_Missense_Mutation_p.S65C|FBL_uc010egr.2_Missense_Mutation_p.S66C	NM_001436	NP_001427	P22087	FBRL_HUMAN	fibrillarin	66	DMA/Gly-rich.				rRNA processing|tRNA processing	box C/D snoRNP complex|Cajal body	methyltransferase activity|protein binding|RNA binding			ovary(1)	1	all_cancers(60;5.79e-06)|all_lung(34;5.2e-08)|Lung NSC(34;6.14e-08)|Ovarian(47;0.06)	Renal(1328;0.000518)|Hepatocellular(1079;0.0893)	Epithelial(26;5.74e-25)|OV - Ovarian serous cystadenocarcinoma(5;3.13e-24)|all cancers(26;8.59e-23)	GBM - Glioblastoma multiforme(1328;0.000826)|STAD - Stomach adenocarcinoma(1328;0.138)		GTTGCCACCAGAATGGAAGCC	0.572													72	223	---	---	---	---	PASS
ZNF780A	284323	broad.mit.edu	37	19	40581487	40581487	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40581487G>A	uc002omy.2	-	6	1087	c.862C>T	c.(862-864)CGT>TGT	p.R288C	ZNF780A_uc002omw.3_Intron|ZNF780A_uc002omz.2_Missense_Mutation_p.R288C|ZNF780A_uc010xvh.1_Missense_Mutation_p.R289C	NM_001010880	NP_001010880	O75290	Z780A_HUMAN	zinc finger protein 780A isoform b	288	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGTGCACCACGATTAAAGCCT	0.388													76	261	---	---	---	---	PASS
BLVRB	645	broad.mit.edu	37	19	40964289	40964289	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40964289G>A	uc002onw.2	-	2	373	c.243C>T	c.(241-243)CTC>CTT	p.L81L	BLVRB_uc010egw.1_RNA	NM_000713	NP_000704	P30043	BLVRB_HUMAN	biliverdin reductase B (flavin reductase	81					heme catabolic process	cytosol	biliverdin reductase activity|binding|flavin reductase activity				0			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)		NADH(DB00157)|Riboflavin(DB00140)	GCTCAGTACTGAGGTCATTGC	0.473													3	5	---	---	---	---	PASS
CYP2F1	1572	broad.mit.edu	37	19	41627463	41627463	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41627463G>T	uc002opu.1	+	5	641	c.585G>T	c.(583-585)CTG>CTT	p.L195L	CYP2F1_uc010xvw.1_Intron|CYP2F1_uc010xvv.1_Silent_p.L195L|CYP2F1_uc002opv.1_RNA	NM_000774	NP_000765	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F,	195					naphthalene metabolic process|xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|electron carrier activity|heme binding|oxygen binding				0						ATGAGCGTCTGCTCACCATTA	0.567													48	117	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46334680	46334680	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46334680C>A	uc002pdn.2	-	12	1805	c.1560G>T	c.(1558-1560)AAG>AAT	p.K520N	SYMPK_uc002pdo.1_Missense_Mutation_p.K520N|SYMPK_uc002pdp.1_Missense_Mutation_p.K520N|SYMPK_uc002pdq.1_Missense_Mutation_p.K520N	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	520					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CTGGCCTCCTCTTGGCCTGCG	0.637													6	25	---	---	---	---	PASS
SEPW1	6415	broad.mit.edu	37	19	48283985	48283985	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48283985C>T	uc010xyw.1	+	2	234	c.33C>T	c.(31-33)GGC>GGT	p.G11G	SEPW1_uc002pho.1_5'Flank	NM_003009	NP_003000	P63302	SELW_HUMAN	selenoprotein W, 1	11					cell redox homeostasis	cytoplasm	selenium binding				0		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		all cancers(93;0.000291)|OV - Ovarian serous cystadenocarcinoma(262;0.000305)|Epithelial(262;0.0146)|GBM - Glioblastoma multiforme(486;0.0273)		CTACCAGTGGCGCTTGAGGCT	0.627													5	4	---	---	---	---	PASS
NTN5	126147	broad.mit.edu	37	19	49173844	49173844	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49173844C>A	uc002pkb.2	-	2	496	c.400G>T	c.(400-402)GCG>TCG	p.A134S	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|NTN5_uc002pkc.2_Missense_Mutation_p.A134S	NM_145807	NP_665806	Q8WTR8	NET5_HUMAN	netrin 5 precursor	134						extracellular region				large_intestine(1)|pancreas(1)	2						TGGCTGGCCGCCACAGTGGCC	0.701													5	8	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52723448	52723448	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52723448G>A	uc002pyp.2	+	11	1468	c.1309G>A	c.(1309-1311)GAG>AAG	p.E437K	PPP2R1A_uc010ydk.1_Missense_Mutation_p.E382K|PPP2R1A_uc002pyq.2_Missense_Mutation_p.E258K	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	437	HEAT 11.|PP2A subunit C binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GTAGGGAGTGGAGTTCTTTGA	0.527			Mis		clear cell ovarian carcinoma								51	145	---	---	---	---	PASS
NLRP12	91662	broad.mit.edu	37	19	54312869	54312869	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54312869C>T	uc002qch.3	-	3	2264	c.2044G>A	c.(2044-2046)GCA>ACA	p.A682T	NLRP12_uc010eqw.2_5'Flank|NLRP12_uc002qci.3_Missense_Mutation_p.A682T|NLRP12_uc002qcj.3_Missense_Mutation_p.A682T|NLRP12_uc002qck.3_RNA|NLRP12_uc010eqx.2_Missense_Mutation_p.A682T	NM_144687	NP_653288	P59046	NAL12_HUMAN	NLR family, pyrin domain containing 12 isoform	682					negative regulation of I-kappaB kinase/NF-kappaB cascade|negative regulation of interleukin-1 secretion|negative regulation of interleukin-6 biosynthetic process|negative regulation of protein autophosphorylation|negative regulation of Toll signaling pathway|positive regulation of inflammatory response|positive regulation of interleukin-1 beta secretion|regulation of interleukin-18 biosynthetic process|release of cytoplasmic sequestered NF-kappaB	cytoplasm	ATP binding|caspase activator activity|protein binding			ovary(4)|upper_aerodigestive_tract(2)|lung(1)	7	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.026)		TGCGCTCCTGCGGAGCACCTC	0.557													20	53	---	---	---	---	PASS
TSEN34	79042	broad.mit.edu	37	19	54696028	54696028	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54696028C>A	uc002qdu.2	+	4	658	c.549C>A	c.(547-549)CTC>CTA	p.L183L	MBOAT7_uc002qdq.2_5'Flank|MBOAT7_uc002qdr.2_5'Flank|MBOAT7_uc002qds.2_5'Flank|MBOAT7_uc010yen.1_5'Flank|MBOAT7_uc002qdt.3_5'Flank|TSEN34_uc010yeo.1_Silent_p.L183L|TSEN34_uc002qdv.2_Silent_p.L183L|TSEN34_uc002qdw.2_Silent_p.L183L	NM_024075	NP_076980	Q9BSV6	SEN34_HUMAN	tRNA-intron endonuclease 34	183					mRNA processing|tRNA-type intron splice site recognition and cleavage	nucleolus|tRNA-intron endonuclease complex	nucleic acid binding|tRNA-intron endonuclease activity				0	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GATCTGCTCTCCTTGTCCAGC	0.637													54	156	---	---	---	---	PASS
LILRA6	79168	broad.mit.edu	37	19	54742961	54742961	+	Silent	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54742961T>C	uc002qeu.1	-	8	1438	c.1314A>G	c.(1312-1314)TCA>TCG	p.S438S	LILRB3_uc002qeh.1_Intron|LILRB3_uc002qeg.1_Intron|LILRB3_uc002qei.1_Intron|LILRA6_uc002qek.1_Intron|LILRB3_uc010erh.1_Intron|LILRB3_uc002qej.1_Intron|LILRA6_uc002qel.1_Intron|LILRA6_uc002qem.1_Intron|LILRB3_uc002qen.1_Intron|LILRB3_uc002qeo.1_Intron|LILRB3_uc002qep.1_Intron|LILRB3_uc002qeq.1_Intron|LILRB3_uc002qer.1_Intron|LILRB3_uc002qes.1_Intron|LILRA6_uc010yep.1_Intron|LILRA6_uc010yeq.1_Intron|LILRA6_uc002qet.3_RNA|LILRA6_uc002qev.1_Silent_p.S282S	NM_024318	NP_077294	Q6PI73	LIRA6_HUMAN	leukocyte immunoglobulin-like receptor,	438	Extracellular (Potential).					integral to membrane	receptor activity			skin(2)	2	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTTGGCGTGTGAGGCTGGGG	0.597													7	56	---	---	---	---	PASS
LENG9	94059	broad.mit.edu	37	19	54974005	54974005	+	Silent	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54974005G>A	uc010yez.1	-	1	890	c.771C>T	c.(769-771)GCC>GCT	p.A257A		NM_198988	NP_945339	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	257					RNA metabolic process	intracellular	catalytic activity|nucleic acid binding|zinc ion binding				0	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		CAGTCACTCCGGCGAGGCGTC	0.677													37	79	---	---	---	---	PASS
KIR3DX1	90011	broad.mit.edu	37	19	55048391	55048391	+	Intron	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55048391C>A	uc010erm.2	+						KIR3DX1_uc010yfa.1_Intron|KIR3DX1_uc010yfb.1_Intron|KIR3DX1_uc010yfc.1_Intron|KIR3DX1_uc010yfd.1_Intron					Homo sapiens killer cell immunoglobulin-like receptor, three domains, X1, mRNA (cDNA clone IMAGE:4849085).											ovary(1)	1				GBM - Glioblastoma multiforme(193;0.099)		GGTGAGGAGCCCATGCCTGCT	0.572													33	78	---	---	---	---	PASS
KIR3DL1	3811	broad.mit.edu	37	19	55350877	55350877	+	Intron	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55350877T>G	uc002qhl.3	+						KIR2DS4_uc010yfj.1_Intron|KIR2DS4_uc010yfk.1_Intron|KIR2DS4_uc010esg.1_Intron|KIR2DS4_uc002qhm.1_Intron|KIR2DS4_uc002qhn.1_Intron			P43629	KI3L1_HUMAN	SubName: Full=KIR3DS1;						immune response|regulation of immune response	integral to plasma membrane	HLA-B specific inhibitory MHC class I receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	5				GBM - Glioblastoma multiforme(193;0.0192)		CCCCTTCTCCTTCCAGGTCTA	0.552													20	168	---	---	---	---	PASS
PTPRH	5794	broad.mit.edu	37	19	55711650	55711650	+	Missense_Mutation	SNP	T	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55711650T>G	uc002qjq.2	-	7	1447	c.1374A>C	c.(1372-1374)GAA>GAC	p.E458D	PTPRH_uc010esv.2_Missense_Mutation_p.E280D|PTPRH_uc002qjs.2_Missense_Mutation_p.E465D	NM_002842	NP_002833	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	458	Extracellular (Potential).|Fibronectin type-III 5.				apoptosis	cytoplasm|integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			ovary(2)|large_intestine(1)|skin(1)	4		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTCCATTTTTTTCTGCCCATA	0.522													38	87	---	---	---	---	PASS
FIZ1	84922	broad.mit.edu	37	19	56109044	56109044	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56109044C>A	uc002qli.3	-	2	278	c.188G>T	c.(187-189)AGC>ATC	p.S63I	FIZ1_uc002qlj.3_Missense_Mutation_p.S63I|ZNF524_uc002qlk.1_5'Flank	NM_032836	NP_116225	Q96SL8	FIZ1_HUMAN	FLT3-interacting zinc finger 1	63	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	nucleic acid binding|protein kinase binding|receptor binding|zinc ion binding				0			BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		TAGGTTGAAGCTGTGCTTGAA	0.677													43	82	---	---	---	---	PASS
USP29	57663	broad.mit.edu	37	19	57640425	57640425	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57640425G>T	uc002qny.2	+	4	738	c.382G>T	c.(382-384)GAA>TAA	p.E128*		NM_020903	NP_065954	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	128					protein modification process|ubiquitin-dependent protein catabolic process		cysteine-type peptidase activity|protein binding|ubiquitin thiolesterase activity			lung(6)|ovary(2)|breast(2)|pancreas(1)	11		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TATGCTGAAGGAAATTGACAA	0.363													22	73	---	---	---	---	PASS
ZNF17	7565	broad.mit.edu	37	19	57932017	57932017	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57932017A>T	uc002qoo.1	+	3	1388	c.1157A>T	c.(1156-1158)TAT>TTT	p.Y386F	ZNF547_uc002qpm.3_Intron|ZNF17_uc002qop.1_Missense_Mutation_p.Y388F	NM_006959	NP_008890	P17021	ZNF17_HUMAN	zinc finger protein 17	386	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			central_nervous_system(1)	1		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		GAAAAACCTTATGAATGCAAC	0.393													42	126	---	---	---	---	PASS
SLC4A11	83959	broad.mit.edu	37	20	3215403	3215403	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3215403G>C	uc002wig.2	-	2	322	c.274C>G	c.(274-276)CAG>GAG	p.Q92E	SLC4A11_uc010zqe.1_Missense_Mutation_p.Q119E|SLC4A11_uc002wih.2_RNA|SLC4A11_uc010zqf.1_Missense_Mutation_p.Q76E	NM_032034	NP_114423	Q8NBS3	S4A11_HUMAN	solute carrier family 4 member 11	92	Cytoplasmic (Potential).				cellular cation homeostasis|fluid transport|phosphoenolpyruvate-dependent sugar phosphotransferase system	basolateral plasma membrane|integral to membrane	bicarbonate transmembrane transporter activity|borate transmembrane transporter activity|hydrogen ion channel activity|inorganic anion exchanger activity|sodium channel activity|sugar:hydrogen symporter activity			ovary(1)	1						TTGGTGGCCTGCATCTCAAGG	0.577													29	82	---	---	---	---	PASS
CSRP2BP	57325	broad.mit.edu	37	20	18139799	18139799	+	Missense_Mutation	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18139799C>T	uc002wqj.2	+	5	1194	c.572C>T	c.(571-573)TCA>TTA	p.S191L	CSRP2BP_uc002wqk.2_Missense_Mutation_p.S63L|CSRP2BP_uc010zru.1_Missense_Mutation_p.S63L	NM_020536	NP_065397	Q9H8E8	CSR2B_HUMAN	CSRP2 binding protein	191					histone H3 acetylation	Ada2/Gcn5/Ada3 transcription activator complex|cytoplasm	LIM domain binding|N-acetyltransferase activity			lung(3)|ovary(2)|skin(1)	6						TACTTCCGTTCAGGTGCTCAG	0.478													27	84	---	---	---	---	PASS
HM13	81502	broad.mit.edu	37	20	30156010	30156010	+	Intron	SNP	G	C	C	rs148608370		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30156010G>C	uc002wwe.2	+						HM13_uc002wwc.2_Silent_p.P388P|HM13_uc002wwd.2_Silent_p.P388P|HM13_uc002wwf.2_Silent_p.P264P|HM13_uc010gdu.2_Intron	NM_030789	NP_110416	Q8TCT9	HM13_HUMAN	minor histocompatibility antigen 13 isoform 1						membrane protein proteolysis	cell surface|endoplasmic reticulum membrane|integral to membrane|plasma membrane	aspartic-type endopeptidase activity|protein binding			breast(1)	1	all_cancers(5;3.44e-05)|Lung NSC(7;4.38e-06)|all_lung(7;7.65e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		all cancers(5;0.000479)|Colorectal(19;0.00202)|COAD - Colon adenocarcinoma(19;0.0264)			GCCGGCGCCCGCAGAATCCCA	0.697													22	31	---	---	---	---	PASS
IFT52	51098	broad.mit.edu	37	20	42225085	42225085	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:42225085G>A	uc002xkw.2	+	3	252	c.130G>A	c.(130-132)GAA>AAA	p.E44K	IFT52_uc010zwi.1_RNA|IFT52_uc002xky.2_Missense_Mutation_p.E44K|IFT52_uc002xkx.2_RNA|IFT52_uc010ggn.2_Missense_Mutation_p.E44K|IFT52_uc002xkz.2_Missense_Mutation_p.E44K	NM_016004	NP_057088	Q9Y366	IFT52_HUMAN	intraflagellar transport 52 homolog	44						intraflagellar transport particle B|microtubule-based flagellum	protein C-terminus binding			ovary(2)	2		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			CTTAAAAGATGAAATCACATC	0.313													31	71	---	---	---	---	PASS
PABPC1L	80336	broad.mit.edu	37	20	43545460	43545460	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43545460G>T	uc010ggv.1	+	3	533	c.451G>T	c.(451-453)GCA>TCA	p.A151S	PABPC1L_uc010zwq.1_RNA	NM_001124756	NP_001118228	Q4VXU2	PAP1L_HUMAN	poly(A)-binding protein, cytoplasmic 1-like	151	RRM 2.						nucleotide binding|RNA binding			ovary(1)	1						CCATGAGGCCGCACAGCAGGC	0.612													66	175	---	---	---	---	PASS
KCNS1	3787	broad.mit.edu	37	20	43726500	43726500	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43726500G>A	uc002xnc.2	-	4	1310	c.913C>T	c.(913-915)CTC>TTC	p.L305F	KCNS1_uc002xnd.2_Missense_Mutation_p.L305F	NM_002251	NP_002242	Q96KK3	KCNS1_HUMAN	potassium voltage-gated channel	305	Cytoplasmic (Potential).					voltage-gated potassium channel complex	delayed rectifier potassium channel activity|potassium channel regulator activity|protein binding				0		Myeloproliferative disorder(115;0.0122)				ATGAGGTTGAGCGGGTGGCAG	0.637													10	20	---	---	---	---	PASS
ACOT8	10005	broad.mit.edu	37	20	44483888	44483888	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44483888G>C	uc002xqa.1	-	2	253	c.172C>G	c.(172-174)CAG>GAG	p.Q58E	ACOT8_uc010zxe.1_Missense_Mutation_p.Q58E|ACOT8_uc002xqc.1_Intron|ACOT8_uc010zxf.1_Intron|ZSWIM3_uc002xqd.2_5'Flank|ZSWIM3_uc010zxg.1_5'Flank	NM_005469	NP_005460	O14734	ACOT8_HUMAN	peroxisomal acyl-CoA thioesterase 1 isoform a	58					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase|interspecies interaction between organisms|peroxisome organization	peroxisomal matrix	acetyl-CoA hydrolase activity|acyl-CoA thioesterase activity|carboxylesterase activity|choloyl-CoA hydrolase activity|protein binding			skin(1)	1		Myeloproliferative disorder(115;0.0122)				CCCACGATCTGACCACCAAAC	0.577													34	117	---	---	---	---	PASS
ATP9A	10079	broad.mit.edu	37	20	50273590	50273590	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:50273590G>C	uc002xwg.1	-	14	1393	c.1393C>G	c.(1393-1395)CTC>GTC	p.L465V	ATP9A_uc010gih.1_Missense_Mutation_p.L329V|ATP9A_uc002xwf.1_Intron	NM_006045	NP_006036	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	465	Cytoplasmic (Potential).				ATP biosynthetic process	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(4)	4						TTGTGGCAGAGCGCGATGGCC	0.622													13	55	---	---	---	---	PASS
ZNF831	128611	broad.mit.edu	37	20	57766527	57766527	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57766527C>A	uc002yan.2	+	1	453	c.453C>A	c.(451-453)CGC>CGA	p.R151R		NM_178457	NP_848552	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	151	C2H2-type 1.					intracellular	nucleic acid binding|zinc ion binding			skin(13)|ovary(1)	14	all_lung(29;0.0085)					ACTGTGGTCGCGACTGCCTGA	0.657													53	156	---	---	---	---	PASS
SAMSN1	64092	broad.mit.edu	37	21	15884785	15884785	+	Missense_Mutation	SNP	T	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:15884785T>C	uc002yju.1	-	4	471	c.389A>G	c.(388-390)TAC>TGC	p.Y130C	SAMSN1_uc010gky.1_Intron|SAMSN1_uc002yjv.1_Missense_Mutation_p.Y198C	NM_022136	NP_071419	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization	130					negative regulation of adaptive immune response|negative regulation of B cell activation|negative regulation of peptidyl-tyrosine phosphorylation	cytoplasm|nucleus|ruffle	phosphotyrosine binding			ovary(3)|pancreas(1)	4				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CTGTCCACTGTAGAGACTATC	0.453													82	214	---	---	---	---	PASS
KRTAP13-4	284827	broad.mit.edu	37	21	31802948	31802948	+	Missense_Mutation	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:31802948G>C	uc011acw.1	+	1	355	c.355G>C	c.(355-357)GGC>CGC	p.G119R		NM_181600	NP_853631	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	119						intermediate filament					0						GAAATATGGAGGCTGTGGTTT	0.522													13	34	---	---	---	---	PASS
SOD1	6647	broad.mit.edu	37	21	33032075	33032075	+	5'UTR	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33032075A>T	uc002ypa.2	+	1					uc002yoz.1_5'Flank|SOD1_uc002ypb.2_5'UTR|SOD1_uc002ypc.2_RNA	NM_000454	NP_000445	P00441	SODC_HUMAN	superoxide dismutase 1, soluble						activation of MAPK activity|auditory receptor cell stereocilium organization|cell aging|cellular iron ion homeostasis|DNA fragmentation involved in apoptotic nuclear change|double-strand break repair|embryo implantation|glutathione metabolic process|heart contraction|hydrogen peroxide biosynthetic process|locomotory behavior|muscle cell homeostasis|myeloid cell homeostasis|negative regulation of cholesterol biosynthetic process|negative regulation of neuron apoptosis|neurofilament cytoskeleton organization|ovarian follicle development|peripheral nervous system myelin maintenance|placenta development|platelet activation|platelet degranulation|positive regulation of cytokine production|regulation of blood pressure|regulation of mitochondrial membrane potential|regulation of multicellular organism growth|regulation of organ growth|regulation of T cell differentiation in thymus|relaxation of vascular smooth muscle|removal of superoxide radicals|response to axon injury|response to drug|response to ethanol|response to heat|response to hydrogen peroxide|retina homeostasis|sensory perception of sound|spermatogenesis|thymus development	cytoplasmic vesicle|cytosol|dendrite cytoplasm|extracellular matrix|extracellular space|mitochondrial matrix|neuronal cell body|nucleus|peroxisome|protein complex	chaperone binding|copper ion binding|protein homodimerization activity|protein phosphatase 2B binding|superoxide dismutase activity|zinc ion binding				0						GGCGTGGCCTAGCGAGTTATG	0.622													24	46	---	---	---	---	PASS
TMPRSS2	7113	broad.mit.edu	37	21	42866439	42866439	+	Missense_Mutation	SNP	C	A	A	rs61735791	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:42866439C>A	uc002yzj.2	-	3	216	c.82G>T	c.(82-84)GCA>TCA	p.A28S	TMPRSS2_uc010gor.2_Missense_Mutation_p.A65S|TMPRSS2_uc010gos.1_Missense_Mutation_p.A28S	NM_005656	NP_005647	O15393	TMPS2_HUMAN	transmembrane protease, serine 2 isoform 2	28	Cytoplasmic (Potential).				proteolysis	cytoplasm|extracellular region|integral to plasma membrane	scavenger receptor activity|serine-type endopeptidase activity		TMPRSS2/ERG(2499)|TMPRSS2/ETV1(24)	prostate(2523)|central_nervous_system(1)	2524		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GTGGGCTGTGCGGGATAGGGG	0.537			T	ERG|ETV1|ETV4|ETV5	prostate 								32	80	---	---	---	---	PASS
KRTAP10-6	386674	broad.mit.edu	37	21	46011633	46011633	+	Missense_Mutation	SNP	C	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:46011633C>G	uc002zfm.2	-	1	754	c.733G>C	c.(733-735)GAG>CAG	p.E245Q	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198688	NP_941961	P60371	KR106_HUMAN	keratin associated protein 10-6	245	29 X 5 AA repeats of C-C-X(3).					keratin filament					0						GAGGAATCCTCAGAGCAGGTG	0.662													52	157	---	---	---	---	PASS
YPEL1	29799	broad.mit.edu	37	22	22064998	22064998	+	Silent	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22064998C>T	uc002zvl.2	-	2	368	c.36G>A	c.(34-36)GCG>GCA	p.A12A	YPEL1_uc002zvm.2_RNA	NM_013313	NP_037445	O60688	YPEL1_HUMAN	yippee-like 1	12						nucleus					0	Colorectal(54;0.105)					TCGGCAGATACGCTTGGAAAG	0.532													55	221	---	---	---	---	PASS
BCR	613	broad.mit.edu	37	22	23524423	23524423	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:23524423G>T	uc002zww.2	+	1	1872	c.1276G>T	c.(1276-1278)GCA>TCA	p.A426S	BCR_uc002zwx.2_Missense_Mutation_p.A426S	NM_004327	NP_004318	P11274	BCR_HUMAN	breakpoint cluster region isoform 1	426	Kinase.	Breakpoint for translocation to form BCR- ABL oncogene.			regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol	ATP binding|GTPase activator activity|protein serine/threonine kinase activity|Rho guanyl-nucleotide exchange factor activity	p.A426E(1)	BCR/JAK2(6)	haematopoietic_and_lymphoid_tissue(6)|central_nervous_system(3)|urinary_tract(1)|lung(1)|skin(1)	12						CCATGGAGACGCAGGTGAGTT	0.637			T	ABL1| FGFR1|JAK2 	CML|ALL|AML								11	14	---	---	---	---	PASS
SF3A1	10291	broad.mit.edu	37	22	30738786	30738786	+	Intron	SNP	C	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30738786C>T	uc003ahl.2	-							NM_005877	NP_005868	Q15459	SF3A1_HUMAN	splicing factor 3a, subunit 1, 120kDa isoform 1						nuclear mRNA 3'-splice site recognition	catalytic step 2 spliceosome|nucleoplasm|U2-type spliceosomal complex	protein binding|RNA binding			ovary(3)|large_intestine(1)|pancreas(1)	5						AAATGCTATTCAGTTTACCTG	0.413													22	86	---	---	---	---	PASS
RASD2	23551	broad.mit.edu	37	22	35943073	35943073	+	Missense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:35943073G>T	uc003anx.2	+	2	422	c.217G>T	c.(217-219)GAT>TAT	p.D73Y	RASD2_uc003any.2_Missense_Mutation_p.D73Y	NM_014310	NP_055125	Q96D21	RHES_HUMAN	RASD family, member 2 precursor	73	GTP (By similarity).				locomotory behavior|positive regulation of protein kinase B signaling cascade|positive regulation of protein sumoylation|regulation of cAMP-mediated signaling	intracellular|plasma membrane	G-protein beta-subunit binding|GTP binding|GTPase activity			lung(2)|skin(1)	3						CGACATCCTGGATACCTCTGG	0.627													23	87	---	---	---	---	PASS
RBM9	23543	broad.mit.edu	37	22	36164352	36164352	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36164352C>A	uc003aon.3	-	6	820	c.708G>T	c.(706-708)AGG>AGT	p.R236S	RBM9_uc003aog.3_Missense_Mutation_p.R146S|RBM9_uc003aol.3_Missense_Mutation_p.R165S|RBM9_uc003aoj.3_Missense_Mutation_p.R165S|RBM9_uc003aok.3_Missense_Mutation_p.R166S|RBM9_uc003aoh.3_Missense_Mutation_p.R165S|RBM9_uc003aom.3_Missense_Mutation_p.R147S|RBM9_uc010gwu.2_Missense_Mutation_p.R145S|RBM9_uc003aoo.3_Missense_Mutation_p.R235S	NM_001082578	NP_001076047	O43251	RFOX2_HUMAN	RNA binding motif protein 9 isoform 5	175	RRM.				estrogen receptor signaling pathway|mRNA processing|negative regulation of transcription, DNA-dependent|regulation of cell proliferation|RNA splicing	cytoplasm|nucleus	nucleotide binding|RNA binding|transcription corepressor activity|transcription factor binding				0						TCTCCCTGGCCCTGTCTGCAT	0.428													78	198	---	---	---	---	PASS
ZC3H7B	23264	broad.mit.edu	37	22	41753294	41753294	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41753294A>T	uc003azw.2	+	23	3011	c.2795A>T	c.(2794-2796)AAG>ATG	p.K932M	ZC3H7B_uc010gyl.1_Intron	NM_017590	NP_060060	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	948	Potential.				interspecies interaction between organisms	nucleus	nucleic acid binding|protein binding|zinc ion binding			central_nervous_system(1)	1						AAGTTGGCCAAGGCTCGCAAG	0.622													22	97	---	---	---	---	PASS
ARSF	416	broad.mit.edu	37	X	3002640	3002640	+	Nonsense_Mutation	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:3002640G>T	uc004cre.1	+	6	984	c.763G>T	c.(763-765)GAG>TAG	p.E255*	ARSF_uc004crf.1_Nonsense_Mutation_p.E255*	NM_004042	NP_004033	P54793	ARSF_HUMAN	arylsulfatase F precursor	255						extracellular region	arylsulfatase activity|metal ion binding			ovary(2)	2		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				CGAGATCACGGAGCAGCCCAT	0.463													15	54	---	---	---	---	PASS
WWC3	55841	broad.mit.edu	37	X	10046918	10046918	+	Intron	SNP	G	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:10046918G>C	uc004csx.3	+						WWC3_uc010nds.2_Intron|WWC3_uc010ndt.2_5'Flank	NM_015691	NP_056506	Q9ULE0	WWC3_HUMAN	WWC family member 3											ovary(4)	4						GGGATAGGGTGAGTAAAACCG	0.448													22	71	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17750515	17750515	+	Silent	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17750515C>A	uc004cxx.2	+	8	5162	c.4824C>A	c.(4822-4824)ATC>ATA	p.I1608I	NHS_uc011mix.1_Silent_p.I1629I|NHS_uc004cxy.2_Silent_p.I1452I|NHS_uc004cxz.2_Silent_p.I1431I|NHS_uc004cya.2_Silent_p.I1331I	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1608						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TGCAGGCAATCTCCGAGGGAG	0.607													29	108	---	---	---	---	PASS
MAGEB4	4115	broad.mit.edu	37	X	30261046	30261046	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30261046C>A	uc004dcb.2	+	1	878	c.794C>A	c.(793-795)CCC>CAC	p.P265H	MAGEB1_uc004dcc.2_5'Flank|MAGEB1_uc004dcd.2_5'Flank	NM_002367	NP_002358	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	265	MAGE.									ovary(1)	1						AACAGTGATCCCCCACGCTAT	0.502													19	37	---	---	---	---	PASS
SYTL5	94122	broad.mit.edu	37	X	37953621	37953621	+	Missense_Mutation	SNP	G	C	C	rs150600953	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37953621G>C	uc004ddu.2	+	9	1439	c.905G>C	c.(904-906)CGC>CCC	p.R302P	SYTL5_uc004ddv.2_Missense_Mutation_p.R302P|SYTL5_uc004ddx.2_Missense_Mutation_p.R302P	NM_001163335	NP_001156807	Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5 isoform 1	302					intracellular protein transport	membrane	metal ion binding|Rab GTPase binding			skin(1)	1						AAGAGTCACCGCAGAAACACT	0.418													8	46	---	---	---	---	PASS
MAGED2	10916	broad.mit.edu	37	X	54837356	54837356	+	Missense_Mutation	SNP	G	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54837356G>A	uc004dtk.1	+	4	734	c.640G>A	c.(640-642)GCC>ACC	p.A214T	MAGED2_uc004dtl.1_Missense_Mutation_p.A214T|MAGED2_uc004dtm.1_Intron|MAGED2_uc010nkc.1_Missense_Mutation_p.A214T|MAGED2_uc004dtn.1_Missense_Mutation_p.A214T|MAGED2_uc004dto.1_Missense_Mutation_p.A188T	NM_177433	NP_803182	Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2	214										ovary(2)|breast(1)	3						GGCCTCAATGGCCCGCAGGGC	0.607													11	14	---	---	---	---	PASS
OTUD6A	139562	broad.mit.edu	37	X	69282373	69282373	+	5'UTR	SNP	T	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69282373T>A	uc004dxu.1	+	1						NM_207320	NP_997203	Q7L8S5	OTU6A_HUMAN	OTU domain containing 6A											lung(1)|skin(1)	2						CCATTCAACATCATGGATGAT	0.547													10	8	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	85906111	85906111	+	Missense_Mutation	SNP	A	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:85906111A>T	uc004eew.2	+	4	883	c.713A>T	c.(712-714)CAG>CTG	p.Q238L	DACH2_uc004eex.2_Missense_Mutation_p.Q225L|DACH2_uc010nmq.2_Missense_Mutation_p.Q104L|DACH2_uc011mra.1_Missense_Mutation_p.Q71L|DACH2_uc010nmr.2_Missense_Mutation_p.Q19L	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	238					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						AACACTCTTCAGGGAAATGGA	0.428													11	18	---	---	---	---	PASS
NXF5	55998	broad.mit.edu	37	X	101096492	101096492	+	Silent	SNP	A	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101096492A>C	uc011mrk.1	-	6	639	c.279T>G	c.(277-279)TCT>TCG	p.S93S	NXF5_uc004eih.1_RNA|NXF5_uc004eii.1_RNA|NXF5_uc004eij.1_RNA|NXF5_uc004eik.1_RNA|NXF5_uc004eil.1_RNA	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	93					mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						TATTCTTCACAGAGTAGGGCG	0.473													46	52	---	---	---	---	PASS
GPR112	139378	broad.mit.edu	37	X	135405370	135405370	+	Missense_Mutation	SNP	C	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135405370C>A	uc004ezu.1	+	5	795	c.504C>A	c.(502-504)AGC>AGA	p.S168R	GPR112_uc010nsb.1_Intron	NM_153834	NP_722576	Q8IZF6	GP112_HUMAN	G-protein coupled receptor 112	168	Extracellular (Potential).				neuropeptide signaling pathway	integral to membrane|plasma membrane	G-protein coupled receptor activity			ovary(5)|large_intestine(2)|skin(2)|lung(1)|breast(1)|pancreas(1)	12	Acute lymphoblastic leukemia(192;0.000127)					AGAATGAGAGCAGCGAGGTTA	0.448													63	121	---	---	---	---	PASS
PLXNA3	55558	broad.mit.edu	37	X	153688715	153688715	+	Silent	SNP	G	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153688715G>T	uc004flm.2	+	2	365	c.192G>T	c.(190-192)CGG>CGT	p.R64R		NM_017514	NP_059984	P51805	PLXA3_HUMAN	plexin A3 precursor	64	Sema.|Extracellular (Potential).				axon guidance	integral to membrane|intracellular|plasma membrane	transmembrane receptor activity			upper_aerodigestive_tract(1)|ovary(1)|central_nervous_system(1)	3	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CTGAGCTGCGGGCCCATGTCA	0.672													18	29	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19423486	19423486	+	Intron	DEL	C	-	-	rs143460900		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19423486delC	uc001bbi.2	-						UBR4_uc010ocv.1_Intron|UBR4_uc009vph.2_Intron|UBR4_uc010ocw.1_Intron|UBR4_uc001bbg.2_Intron|UBR4_uc001bbh.2_Intron	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600						interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TGCTGGTATTCTTTTTTTTTT	0.383													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	25301653	25301654	+	IGR	INS	-	GGAA	GGAA	rs7547501	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:25301653_25301654insGGAA								RUNX3 (10041 upstream) : SYF2 (247113 downstream)																							tagaAGCAGATggaaggaagga	0.015													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	81546180	81546181	+	IGR	INS	-	AC	AC	rs5775589		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:81546180_81546181insAC								None (None upstream) : LPHN2 (225664 downstream)																							TAGTCATGTTAacacacacaca	0.168													3	4	---	---	---	---	
COL11A1	1301	broad.mit.edu	37	1	103573560	103573560	+	Intron	DEL	G	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:103573560delG	uc001dul.2	-						COL11A1_uc001dum.2_Intron|COL11A1_uc001dun.2_Intron|COL11A1_uc009weh.2_Intron	NM_001854	NP_001845	P12107	COBA1_HUMAN	alpha 1 type XI collagen isoform A						collagen fibril organization|detection of mechanical stimulus involved in sensory perception of sound|visual perception	collagen type XI	extracellular matrix binding|extracellular matrix structural constituent|protein binding, bridging			ovary(6)|breast(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)|pancreas(1)	12		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		AGGGTAAAGTGGGGGGAGGGG	0.478													6	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	143181181	143181181	+	Intron	DEL	C	-	-	rs71237956		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:143181181delC	uc001eiw.1	+											Homo sapiens PNAS-130 mRNA, complete cds.																		atgacccaagctgtacctgtg	0.000													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	146706734	146706741	+	IGR	DEL	TGTGTGTG	-	-	rs72059521		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:146706734_146706741delTGTGTGTG								FMO5 (9504 upstream) : CHD1L (7550 downstream)																							TATCCCACACtgtgtgtgtgtgtgtgtg	0.308													4	2	---	---	---	---	
VANGL2	57216	broad.mit.edu	37	1	160388726	160388726	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:160388726delT	uc001fwb.1	+						VANGL2_uc001fwc.1_Intron	NM_020335	NP_065068	Q9ULK5	VANG2_HUMAN	vang-like 2						apical protein localization|heart looping|nonmotile primary cilium assembly	apical plasma membrane|integral to membrane				ovary(1)	1	all_cancers(52;1.08e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ctttctcctgtttccctcctc	0.229													29	51	---	---	---	---	
FCGR2A	2212	broad.mit.edu	37	1	161483495	161483495	+	Intron	DEL	T	-	-	rs5778209		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161483495delT	uc001gan.2	+						FCGR2A_uc001gam.2_Intron|FCGR2A_uc001gao.2_Intron	NM_001136219	NP_001129691	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor							integral to membrane|plasma membrane	IgG binding|receptor activity			ovary(1)	1	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Immune globulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TGGGGAAGGCTTGTGGCTGGG	0.542													4	2	---	---	---	---	
CEP170	9859	broad.mit.edu	37	1	243327510	243327510	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243327510delT	uc001hzs.2	-						CEP170_uc001hzt.2_Intron|CEP170_uc001hzu.2_Intron|CEP170_uc001hzv.1_Intron	NM_014812	NP_055627	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa isoform alpha							centriole|microtubule|spindle				ovary(1)|haematopoietic_and_lymphoid_tissue(1)	2	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			AGAACCTTACtttttttttta	0.378													4	3	---	---	---	---	
ZNF670	93474	broad.mit.edu	37	1	247202362	247202363	+	Intron	INS	-	T	T	rs66500189		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247202362_247202363insT	uc001icd.1	-						ZNF695_uc001ica.2_Intron|ZNF695_uc001icb.1_Intron	NM_033213	NP_149990	Q9BS34	ZN670_HUMAN	zinc finger protein 670						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ttctttctttcttttttttttt	0.144													4	3	---	---	---	---	
OR2T1	26696	broad.mit.edu	37	1	248570379	248570379	+	Frame_Shift_Del	DEL	C	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248570379delC	uc010pzm.1	+	1	1084	c.1084delC	c.(1084-1086)CAAfs	p.Q362fs		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	362	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CAAGGGTCCTCAAAGGGTGTC	0.512													180	94	---	---	---	---	
MYT1L	23040	broad.mit.edu	37	2	2335481	2335482	+	5'Flank	INS	-	ACAC	ACAC	rs58220055		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:2335481_2335482insACAC	uc002qxe.2	-						MYT1L_uc002qxd.2_5'Flank	NM_015025	NP_055840	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like						cell differentiation|nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(5)|central_nervous_system(1)	6	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		AGGTAAATAGTacacacacaca	0.327													4	2	---	---	---	---	
ABCG8	64241	broad.mit.edu	37	2	44101865	44101866	+	Intron	INS	-	A	A	rs142666542	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44101865_44101866insA	uc002rtq.2	+						ABCG8_uc010yoa.1_Intron	NM_022437	NP_071882	Q9H221	ABCG8_HUMAN	ATP-binding cassette sub-family G member 8						cholesterol efflux|cholesterol homeostasis|excretion|lipid metabolic process|negative regulation of intestinal cholesterol absorption|negative regulation of intestinal phytosterol absorption	apical plasma membrane|integral to membrane	ATP binding|ATPase activity|protein heterodimerization activity			skin(3)|ovary(1)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGAAGGAATCTAAAAAAAAGAA	0.381													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	64603286	64603288	+	IGR	DEL	CAC	-	-	rs141929982		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64603286_64603288delCAC								PELI1 (231681 upstream) : HSPC159 (78039 downstream)																							ccaccaccatcaccaccatcacc	0.000													7	4	---	---	---	---	
DYSF	8291	broad.mit.edu	37	2	71845697	71845698	+	Intron	DEL	TT	-	-	rs142924504		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:71845697_71845698delTT	uc002sie.2	+						DYSF_uc010feg.2_Intron|DYSF_uc010feh.2_Intron|DYSF_uc002sig.3_Intron|DYSF_uc010yqx.1_Intron|DYSF_uc010fee.2_Intron|DYSF_uc010fef.2_Intron|DYSF_uc010fei.2_Intron|DYSF_uc010fek.2_Intron|DYSF_uc010fej.2_Intron|DYSF_uc010fel.2_Intron|DYSF_uc010feo.2_Intron|DYSF_uc010fem.2_Intron|DYSF_uc010fen.2_Intron|DYSF_uc002sif.2_Intron|DYSF_uc010yqy.1_Intron|DYSF_uc010yqz.1_Intron	NM_003494	NP_003485	O75923	DYSF_HUMAN	dysferlin isoform 8							cytoplasmic vesicle membrane|integral to membrane|sarcolemma	calcium-dependent phospholipid binding			ovary(3)|breast(2)|pancreas(1)|skin(1)	7						ggagtgtgtgtttgtgtggggt	0.183													9	5	---	---	---	---	
C2orf3	6936	broad.mit.edu	37	2	75907137	75907137	+	Intron	DEL	T	-	-	rs76432157		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:75907137delT	uc002sno.2	-						C2orf3_uc010ffs.2_Intron|C2orf3_uc002snn.2_Intron|C2orf3_uc010fft.2_Intron	NM_003203	NP_003194	P16383	GCF_HUMAN	hypothetical protein LOC6936						negative regulation of transcription, DNA-dependent	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)	2						GTTTAAAAAATTTTTTTTTCA	0.289													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	81428353	81428354	+	IGR	INS	-	A	A	rs71386341		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:81428353_81428354insA								CTNNA2 (552449 upstream) : None (None downstream)																							AGATATATGGTAAAAAAAATAA	0.312													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	90473560	90473560	+	IGR	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90473560delT								None (None upstream) : None (None downstream)																							acttttgtactttttttttaa	0.000													1	8	---	---	---	---	
TTN	7273	broad.mit.edu	37	2	179589011	179589011	+	Frame_Shift_Del	DEL	A	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179589011delA	uc010zfg.1	-	69	17583	c.17359delT	c.(17359-17361)TGCfs	p.C5787fs	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Frame_Shift_Del_p.C2448fs	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6714							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGCTGTGCAGCTGCTTTTC	0.388													39	22	---	---	---	---	
UBE2E3	10477	broad.mit.edu	37	2	181886359	181886360	+	Intron	INS	-	TTCC	TTCC	rs56152201		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:181886359_181886360insTTCC	uc002unq.1	+						UBE2E3_uc002unr.1_Intron|UBE2E3_uc010fri.1_Intron	NM_182678	NP_872619	Q969T4	UB2E3_HUMAN	ubiquitin-conjugating enzyme E2E 3						protein K11-linked ubiquitination|protein K48-linked ubiquitination|protein K63-linked ubiquitination|regulation of growth	cytoplasm|nucleolus	ATP binding|protein binding|ubiquitin-protein ligase activity			ovary(1)	1						ccctcccttttttccttccttc	0.089													4	2	---	---	---	---	
PDE1A	5136	broad.mit.edu	37	2	183386832	183386833	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:183386832_183386833insA	uc002uos.2	-						PDE1A_uc010zfp.1_Intron|PDE1A_uc002uoq.1_Intron|PDE1A_uc010zfq.1_Intron|PDE1A_uc002uov.1_Intron	NM_001003683	NP_001003683	P54750	PDE1A_HUMAN	phosphodiesterase 1A isoform 2						activation of phospholipase C activity|nerve growth factor receptor signaling pathway|platelet activation	cytosol	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|calmodulin binding|calmodulin-dependent cyclic-nucleotide phosphodiesterase activity|metal ion binding			skin(2)|ovary(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.061)			TGTGCAAGTACAAAAAATCATT	0.347													4	3	---	---	---	---	
STAT1	6772	broad.mit.edu	37	2	191857519	191857520	+	Intron	INS	-	T	T	rs112075173		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:191857519_191857520insT	uc002usj.2	-						STAT1_uc010fse.1_Intron|STAT1_uc002usk.2_Intron|STAT1_uc002usl.2_Intron|STAT1_uc010fsf.1_Intron	NM_007315	NP_009330	P42224	STAT1_HUMAN	signal transducer and activator of transcription						activation of caspase activity|I-kappaB kinase/NF-kappaB cascade|interferon-gamma-mediated signaling pathway|interspecies interaction between organisms|regulation of interferon-gamma-mediated signaling pathway|regulation of type I interferon-mediated signaling pathway|response to virus|type I interferon-mediated signaling pathway|tyrosine phosphorylation of STAT protein	cytosol|nucleolus|nucleoplasm	calcium ion binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity|signal transducer activity			lung(3)|breast(3)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	10			OV - Ovarian serous cystadenocarcinoma(117;0.00434)|Epithelial(96;0.0555)|all cancers(119;0.141)		Fludarabine(DB01073)	TGCAttctttcttttttttttt	0.223													3	3	---	---	---	---	
COQ10B	80219	broad.mit.edu	37	2	198324472	198324473	+	Intron	INS	-	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198324472_198324473insT	uc002uuh.1	+						COQ10B_uc010fsl.1_Intron	NM_025147	NP_079423	Q9H8M1	CQ10B_HUMAN	coenzyme Q10 homolog B precursor							mitochondrial inner membrane					0			Epithelial(96;0.231)|OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGTTATTTTTGTTTTTTTTTTT	0.366													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	55196970	55196973	+	IGR	DEL	CTTT	-	-	rs4955938	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:55196970_55196973delCTTT								CACNA2D3 (88388 upstream) : WNT5A (302771 downstream)																							cccttccttcctttcttccttcct	0.172													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	64343666	64343667	+	IGR	INS	-	GTGT	GTGT	rs78760733	byFrequency	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:64343666_64343667insGTGT								PRICKLE2 (132535 upstream) : ADAMTS9 (157666 downstream)																							GCAAATTTGGGgtgtgtgtgtg	0.307													3	3	---	---	---	---	
ALDH1L1	10840	broad.mit.edu	37	3	125878066	125878067	+	Intron	DEL	CA	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125878066_125878067delCA	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Intron|ALDH1L1_uc003eip.1_5'Flank|ALDH1L1_uc011bkj.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	cacatgcgtgcacacacacaca	0.000													3	3	---	---	---	---	
ARMC8	25852	broad.mit.edu	37	3	137954115	137954115	+	Intron	DEL	A	-	-	rs142092254		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:137954115delA	uc003esa.1	+						ARMC8_uc003erw.2_Intron|ARMC8_uc003erx.2_Intron|ARMC8_uc003ery.2_Intron|ARMC8_uc003erz.2_Intron|ARMC8_uc011bmf.1_Intron|ARMC8_uc011bmg.1_Intron|ARMC8_uc011bmh.1_Intron|ARMC8_uc003esb.1_Intron|ARMC8_uc003esc.1_5'Flank	NM_015396	NP_056211	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8 isoform 2								binding				0						AATGCTCTTTAAAAAAAAAAA	0.279													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	163792662	163792663	+	IGR	INS	-	TGTG	TGTG	rs145291892	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:163792662_163792663insTGTG								None (None upstream) : MIR1263 (96596 downstream)																							agcttttcatatgtgtgtgtgt	0.000													4	2	---	---	---	---	
GOLIM4	27333	broad.mit.edu	37	3	167814037	167814038	+	5'Flank	INS	-	GTGT	GTGT	rs143158405	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:167814037_167814038insGTGT	uc003ffe.2	-						GOLIM4_uc011bpe.1_5'Flank|GOLIM4_uc011bpf.1_5'Flank|GOLIM4_uc011bpg.1_5'Flank	NM_014498	NP_055313	O00461	GOLI4_HUMAN	golgi integral membrane protein 4						transport	cis-Golgi network|endocytic vesicle|endosome membrane|Golgi cisterna membrane|Golgi lumen|integral to membrane|nucleus				breast(4)|skin(1)	5						TCGGTGAACACgtgtgtgtgtg	0.510													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	181036377	181036378	+	IGR	DEL	AC	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:181036377_181036378delAC								DNAJC19 (328847 upstream) : SOX2OT (245131 downstream)																							agacacacagacacacacacat	0.069													3	5	---	---	---	---	
ABCC5	10057	broad.mit.edu	37	3	183707380	183707381	+	Intron	INS	-	TT	TT	rs67364438		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:183707380_183707381insTT	uc003fmg.2	-						ABCC5_uc011bqt.1_Intron|ABCC5_uc010hxl.2_Intron|ABCC5_uc003fmh.2_Intron|ABCC5_uc010hxm.2_Intron|ABCC5_uc010hxn.2_Intron|ABCC5_uc010hxo.2_Intron	NM_005688	NP_005679	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C, member 5							integral to plasma membrane|membrane fraction	ATP binding|ATPase activity, coupled to transmembrane movement of substances|organic anion transmembrane transporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)	4	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			AAACAGTTTTCTTttttttttt	0.163													8	4	---	---	---	---	
BDH1	622	broad.mit.edu	37	3	197255175	197255178	+	Intron	DEL	GTGT	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197255175_197255178delGTGT	uc003fxr.2	-						BDH1_uc003fxs.2_Intron|BDH1_uc003fxt.2_Intron|BDH1_uc003fxu.2_Intron	NM_203314	NP_976059	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1						cellular lipid metabolic process|ketone body biosynthetic process|ketone body catabolic process	mitochondrial matrix	3-hydroxybutyrate dehydrogenase activity			ovary(1)	1	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)	NADH(DB00157)	gagtgagtgagtgtgtgtgtgtgt	0.240													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	3595626	3595627	+	IGR	INS	-	GTGT	GTGT			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:3595626_3595627insGTGT								LRPAP1 (61402 upstream) : ADRA2C (172448 downstream)																							ttgtgtgtggggtgtgtgtggt	0.005													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	38735141	38735143	+	IGR	DEL	TGT	-	-	rs60307444		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:38735141_38735143delTGT								KLF3 (32013 upstream) : TLR10 (39120 downstream)																							gtggtggtggtgttggtgttggt	0.000													4	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	49109964	49109965	+	IGR	INS	-	C	C	rs137874086		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:49109964_49109965insC								CWH43 (45871 upstream) : None (None downstream)																							tccattcctttcaatccattcc	0.000													5	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	53066157	53066158	+	IGR	DEL	TG	-	-	rs112036456		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:53066157_53066158delTG								SPATA18 (102700 upstream) : USP46 (390971 downstream)																							ctgtgtgtgttgtgtgtgtgtg	0.114													2	5	---	---	---	---	
ISOC1	51015	broad.mit.edu	37	5	128440485	128440485	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:128440485delT	uc003kva.2	+							NM_016048	NP_057132	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1							peroxisome	catalytic activity				0		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		tctttttgagttttttttttt	0.030													4	2	---	---	---	---	
BNIP1	662	broad.mit.edu	37	5	172587243	172587243	+	Intron	DEL	T	-	-	rs10693152		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:172587243delT	uc003mcj.3	+						BNIP1_uc003mci.3_Intron|BNIP1_uc003mck.3_Intron|BNIP1_uc003mcl.3_Intron	NM_001205	NP_001196	Q12981	SEC20_HUMAN	BCL2/adenovirus E1B 19kD interacting protein 1						anti-apoptosis|apoptosis|endoplasmic reticulum membrane fusion|endoplasmic reticulum organization|induction of apoptosis|vesicle-mediated transport	integral to endoplasmic reticulum membrane|nuclear envelope|SNARE complex	protein binding			ovary(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTAtttctcttttttttttt	0.244													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	2907981	2907982	+	IGR	INS	-	TG	TG			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2907981_2907982insTG								SERPINB9 (4436 upstream) : SERPINB6 (40412 downstream)																							tgtgtcgaggttgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	155028499	155028500	+	IGR	DEL	AA	-	-	rs147940473		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:155028499_155028500delAA								CNKSR3 (196746 upstream) : RBM16 (26012 downstream)																							gactccatctaaaaaaaaaaaa	0.168													5	4	---	---	---	---	
LPA	4018	broad.mit.edu	37	6	161036384	161036385	+	Intron	INS	-	TG	TG	rs62441719		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:161036384_161036385insTG	uc003qtl.2	-							NM_005577	NP_005568	P08519	APOA_HUMAN	lipoprotein Lp(a) precursor						blood circulation|lipid metabolic process|lipid transport|lipoprotein metabolic process|proteolysis|receptor-mediated endocytosis	plasma lipoprotein particle	apolipoprotein binding|endopeptidase inhibitor activity|fibronectin binding|heparin binding|serine-type endopeptidase activity			ovary(3)|skin(2)|pancreas(1)	6		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	tgttttcagtttgtgtgtgtgt	0.178													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	6	169772056	169772058	+	IGR	DEL	AAC	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:169772056_169772058delAAC								THBS2 (117919 upstream) : WDR27 (85249 downstream)																							acacacaccaaacaccacacaca	0.000													3	4	---	---	---	---	
ZAN	7455	broad.mit.edu	37	7	100347715	100347716	+	Intron	INS	-	CACACACACT	CACACACACT	rs113074658		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100347715_100347716insCACACACACT	uc003uwj.2	+						ZAN_uc003uwk.2_Intron|ZAN_uc003uwl.2_Intron|ZAN_uc010lhh.2_Intron|ZAN_uc010lhi.2_Intron	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3						binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			acacacacacacacacacGACA	0.059													6	3	---	---	---	---	
PTPRZ1	5803	broad.mit.edu	37	7	121513404	121513405	+	5'UTR	DEL	AA	-	-	rs3069073		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121513404_121513405delAA	uc003vjy.2	+	1					PTPRZ1_uc003vjz.2_5'UTR	NM_002851	NP_002842	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type,						central nervous system development	integral to plasma membrane	protein binding|protein tyrosine/threonine phosphatase activity|transmembrane receptor protein tyrosine phosphatase activity			ovary(3)|large_intestine(2)|lung(2)|central_nervous_system(1)|kidney(1)	9						acacacacacaaacacacatac	0.223													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	148348489	148348490	+	IGR	INS	-	TGTA	TGTA	rs139295790	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148348489_148348490insTGTA								C7orf33 (35538 upstream) : CUL1 (46516 downstream)																							gtgcgtgtgtgtgtgtgtgtgt	0.193													3	3	---	---	---	---	
DPP6	1804	broad.mit.edu	37	7	154570725	154570726	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:154570725_154570726insA	uc003wlk.2	+						DPP6_uc003wli.2_Intron|DPP6_uc003wlm.2_Intron|DPP6_uc011kvq.1_Intron	NM_130797	NP_570629	P42658	DPP6_HUMAN	dipeptidyl-peptidase 6 isoform 1						cell death|proteolysis	integral to membrane	dipeptidyl-peptidase activity|serine-type peptidase activity			pancreas(3)|breast(1)	4	all_neural(206;0.181)	all_hematologic(28;0.0044)|all_lung(21;0.0176)|Lung NSC(21;0.0204)	OV - Ovarian serous cystadenocarcinoma(82;0.0562)			ccaccagcaccccaccatcacc	0.000													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739562	155739565	+	IGR	DEL	CTCT	-	-	rs5000070	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739562_155739565delCTCT								SHH (134595 upstream) : C7orf4 (593620 downstream)																							ccctccctccctctctctctctct	0.000													4	3	---	---	---	---	
PIWIL2	55124	broad.mit.edu	37	8	22173988	22173988	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22173988delT	uc003xbn.2	+						PIWIL2_uc011kzf.1_Intron|PIWIL2_uc010ltv.2_Intron	NM_018068	NP_060538	Q8TC59	PIWL2_HUMAN	piwi-like 2						DNA methylation involved in gamete generation|gene silencing by RNA|germ-line stem cell maintenance|multicellular organismal development|oogenesis|piRNA metabolic process|positive regulation of translation|RNA 5'-end processing|spermatogenesis	chromatoid body|pi-body	piRNA binding			skin(1)	1				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		TTCATGTGAATTTTTTTTTTC	0.189													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	125273306	125273309	+	IGR	DEL	AAGG	-	-	rs111244219		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125273306_125273309delAAGG								FER1L6 (141005 upstream) : TMEM65 (49852 downstream)																							tcaagaaagaaaggaaggaaggaa	0.000													4	4	---	---	---	---	
PTK2	5747	broad.mit.edu	37	8	141843274	141843275	+	Intron	INS	-	A	A	rs141534503		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:141843274_141843275insA	uc003yvu.2	-						PTK2_uc003yvq.2_Intron|PTK2_uc003yvr.2_Intron|PTK2_uc003yvs.2_Intron|PTK2_uc003yvt.2_Intron|PTK2_uc003yvv.2_Intron|PTK2_uc011ljr.1_Intron	NM_153831	NP_722560	Q05397	FAK1_HUMAN	PTK2 protein tyrosine kinase 2 isoform a						axon guidance|blood coagulation|cellular component disassembly involved in apoptosis|ephrin receptor signaling pathway|growth hormone receptor signaling pathway|integrin-mediated signaling pathway|peptidyl-tyrosine phosphorylation|protein autophosphorylation|regulation of cell adhesion mediated by integrin|signal complex assembly	cytoskeleton|cytosol|focal adhesion	ATP binding|JUN kinase binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|signal transducer activity			ovary(2)|lung(2)|central_nervous_system(1)|skin(1)	6	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			ACAACTCCATTAAAAAAAAAAG	0.208													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	67791244	67791244	+	5'Flank	DEL	G	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:67791244delG	uc004aes.1	+											Homo sapiens cDNA FLJ36039 fis, clone TESTI2017311.																		aagagagaatgggagacacac	0.065													6	3	---	---	---	---	
PRPF18	8559	broad.mit.edu	37	10	13653882	13653882	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13653882delT	uc001imp.2	+						PRPF18_uc001imq.2_Intron	NM_003675	NP_003666	Q99633	PRP18_HUMAN	PRP18 pre-mRNA processing factor 18 homolog						mRNA processing|RNA splicing	nuclear speck|spliceosomal complex				central_nervous_system(1)	1						TTCTTGTGGCttttttttttt	0.164													3	3	---	---	---	---	
NMT2	9397	broad.mit.edu	37	10	15171907	15171908	+	Intron	DEL	AA	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15171907_15171908delAA	uc001inz.1	-						NMT2_uc001ioa.1_Intron|NMT2_uc009xjo.1_Intron|NMT2_uc010qbz.1_Intron	NM_004808	NP_004799	O60551	NMT2_HUMAN	N-myristoyltransferase 2						N-terminal protein myristoylation|protein lipoylation	Golgi apparatus|plasma membrane	glycylpeptide N-tetradecanoyltransferase activity			ovary(1)	1						agtctgcctcaaaaaaaaaaaa	0.124													4	2	---	---	---	---	
RBMXL2	27288	broad.mit.edu	37	11	7111477	7111477	+	Frame_Shift_Del	DEL	G	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:7111477delG	uc001mfc.2	+	1	1313	c.1126delG	c.(1126-1128)GGAfs	p.G376fs		NM_014469	NP_055284	O75526	HNRGT_HUMAN	testes-specific heterogenous nuclear	376	Arg/Gly/Pro-rich.					nucleus|ribonucleoprotein complex	nucleotide binding|RNA binding				0				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		GCCCAGGGGCGGAGGCCGTCT	0.597													19	12	---	---	---	---	
OR4A47	403253	broad.mit.edu	37	11	48510847	48510848	+	Frame_Shift_Ins	INS	-	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:48510847_48510848insC	uc010rhx.1	+	1	503_504	c.503_504insC	c.(502-504)GGCfs	p.G168fs		NM_001005512	NP_001005512	Q6IF82	O4A47_HUMAN	olfactory receptor, family 4, subfamily A,	168	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CCATTCTGTGGCCCCAATGTCA	0.460													143	82	---	---	---	---	
MYO7A	4647	broad.mit.edu	37	11	76901193	76901194	+	Intron	DEL	GT	-	-	rs111033252		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:76901193_76901194delGT	uc001oyb.2	+						MYO7A_uc010rsm.1_Intron|MYO7A_uc001oyc.2_Intron|MYO7A_uc009yus.1_Intron|MYO7A_uc009yut.1_Intron	NM_000260	NP_000251	Q13402	MYO7A_HUMAN	myosin VIIA isoform 1						actin filament-based movement|equilibrioception|lysosome organization|sensory perception of sound|visual perception	cytosol|lysosomal membrane|myosin complex|photoreceptor inner segment|photoreceptor outer segment|synapse	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(3)|breast(1)	4						AGGTTCgtgcgtgtgtatgcac	0.421													4	5	---	---	---	---	
NRIP2	83714	broad.mit.edu	37	12	2944356	2944357	+	5'Flank	INS	-	GA	GA	rs146562376	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:2944356_2944357insGA	uc001qlc.2	-						NRIP2_uc010sed.1_5'Flank|uc009zdz.1_5'Flank	NM_031474	NP_113662	Q9BQI9	NRIP2_HUMAN	nuclear receptor interacting protein 2						proteolysis|transcription, DNA-dependent	cytoplasm|nucleus	aspartic-type endopeptidase activity			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			tgtgtgtgtgtgagagagagag	0.446													1	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	59213391	59213392	+	IGR	INS	-	GGCCT	GGCCT	rs140022030	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:59213391_59213392insGGCCT								XRCC6BP1 (862340 upstream) : LRIG3 (52546 downstream)																							ggctgccgcagggcctgcacgg	0.000													3	3	---	---	---	---	
METAP2	10988	broad.mit.edu	37	12	95906823	95906824	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:95906823_95906824insA	uc001tec.2	+						METAP2_uc010suv.1_Intron|METAP2_uc009ztd.2_Intron|METAP2_uc001ted.2_Intron|METAP2_uc001tef.2_Intron|METAP2_uc001tee.2_Intron	NM_006838	NP_006829	P50579	AMPM2_HUMAN	methionyl aminopeptidase 2						N-terminal protein amino acid modification|peptidyl-methionine modification|protein processing|proteolysis	cytoplasm	aminopeptidase activity|metal ion binding|metalloexopeptidase activity				0					L-Methionine(DB00134)	CCAACAATAAGAAAAAAAAATA	0.233													4	2	---	---	---	---	
VSIG10	54621	broad.mit.edu	37	12	118533729	118533729	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:118533729delT	uc001tws.2	-							NM_019086	NP_061959	Q8N0Z9	VSI10_HUMAN	V-set and immunoglobulin domain containing 10							integral to membrane					0						GTATATGttcttttttttttt	0.164													3	3	---	---	---	---	
NDFIP2	54602	broad.mit.edu	37	13	80122252	80122252	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:80122252delT	uc001vlf.2	+						NDFIP2_uc010tib.1_Intron|NDFIP2_uc001vlg.2_Intron	NM_019080	NP_061953	Q9NV92	NFIP2_HUMAN	Nedd4 family interacting protein 2 isoform 1						negative regulation of gene expression|negative regulation of protein transport|negative regulation of transporter activity|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of protein ubiquitination	endoplasmic reticulum|Golgi membrane|integral to membrane|mitochondrion|multivesicular body membrane|perinuclear region of cytoplasm	signal transducer activity|WW domain binding			ovary(1)	1		Acute lymphoblastic leukemia(28;0.205)		GBM - Glioblastoma multiforme(99;0.0196)		AATACTCCAATTTTTTTTTTG	0.289													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	21631147	21631148	+	IGR	DEL	AG	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21631147_21631148delAG								OR5AU1 (6963 upstream) : HNRNPC (46150 downstream)																							GAAAGTCGACAGAGACAGTCTT	0.386													23	14	---	---	---	---	
SNAPC1	6617	broad.mit.edu	37	14	62243178	62243179	+	Intron	INS	-	T	T	rs146279910	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:62243178_62243179insT	uc001xft.2	+							NM_003082	NP_003073	Q16533	SNPC1_HUMAN	small nuclear RNA activating complex,						regulation of transcription, DNA-dependent|transcription from RNA polymerase III promoter	nucleoplasm	DNA binding				0				OV - Ovarian serous cystadenocarcinoma(108;0.0639)|BRCA - Breast invasive adenocarcinoma(234;0.186)		TATGTATTTTCTTTTTTTTTTG	0.248													4	3	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106833527	106833528	+	Intron	INS	-	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106833527_106833528insT	uc010tyt.1	-						uc001ysx.1_RNA					Parts of antibodies, mostly variable regions.												0						GCTGCAGGGAGTGGGCACCTGT	0.564													37	16	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106881532	106881533	+	Intron	INS	-	TAGA	TAGA	rs149406887	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106881532_106881533insTAGA	uc010tyt.1	-						uc010tyu.1_Intron					Parts of antibodies, mostly variable regions.												0						tgattgacacttagattatttg	0.089													15	7	---	---	---	---	
ARHGAP11A	9824	broad.mit.edu	37	15	32922142	32922143	+	Intron	INS	-	GT	GT			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:32922142_32922143insGT	uc001zgy.1	+						ARHGAP11A_uc010ubw.1_Intron|ARHGAP11A_uc001zgw.2_Intron|ARHGAP11A_uc001zgx.2_Intron|ARHGAP11A_uc010ubx.1_Intron	NM_014783	NP_055598	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A isoform 1						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			skin(3)|breast(2)|urinary_tract(1)	6		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GTTTCAATATAgtgtgtgtgtg	0.277													2	4	---	---	---	---	
WDR72	256764	broad.mit.edu	37	15	53906143	53906144	+	Intron	INS	-	TTAT	TTAT	rs138717914	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:53906143_53906144insTTAT	uc002acj.2	-							NM_182758	NP_877435	Q3MJ13	WDR72_HUMAN	WD repeat domain 72											lung(1)|skin(1)	2				all cancers(107;0.0511)		CACCTAAAATCTTATTTATTTA	0.307													4	2	---	---	---	---	
SIN3A	25942	broad.mit.edu	37	15	75676395	75676395	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:75676395delT	uc002bai.2	-						SIN3A_uc002baj.2_Intron|SIN3A_uc010uml.1_Intron	NM_015477	NP_056292	Q96ST3	SIN3A_HUMAN	transcriptional co-repressor Sin3A						blood coagulation|cellular lipid metabolic process|negative regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleolus|Sin3 complex	protein binding			skin(3)|ovary(1)|lung(1)	5						ATATAACTAGTTTTTTTTTTT	0.279													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	78271437	78271437	+	IGR	DEL	A	-	-	rs66482923		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78271437delA								LOC645752 (52249 upstream) : LOC91450 (14139 downstream)																							TGCGAGCAGGAAGGCCCAGTC	0.642													6	3	---	---	---	---	
WDR61	80349	broad.mit.edu	37	15	78585309	78585309	+	Intron	DEL	T	-	-	rs71947790		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:78585309delT	uc002bdn.2	-						WDR61_uc002bdo.2_Intron|WDR61_uc010umz.1_Intron|WDR61_uc010una.1_Intron	NM_025234	NP_079510	Q9GZS3	WDR61_HUMAN	WD repeat domain 61								protein binding			ovary(1)|skin(1)	2						GACTTTAAGATTTTTTTTTTT	0.333													4	2	---	---	---	---	
CHTF18	63922	broad.mit.edu	37	16	843154	843155	+	Frame_Shift_Ins	INS	-	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:843154_843155insC	uc002cke.3	+	14	1745_1746	c.1682_1683insC	c.(1681-1683)AGCfs	p.S561fs	CHTF18_uc010bre.1_RNA|CHTF18_uc002ckf.3_Frame_Shift_Ins_p.S589fs|CHTF18_uc010brf.2_Frame_Shift_Ins_p.S143fs|CHTF18_uc002ckg.3_Frame_Shift_Ins_p.S79fs	NM_022092	NP_071375	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor	561					cell cycle|DNA replication	nucleus	ATP binding|DNA binding|nucleoside-triphosphatase activity			kidney(1)	1		Hepatocellular(780;0.00335)				TTCCTGTACAGCCGGGGCCAGC	0.698													21	12	---	---	---	---	
SLC5A2	6524	broad.mit.edu	37	16	31495752	31495753	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:31495752_31495753insA	uc002ecf.3	+						SLC5A2_uc010car.2_Intron	NM_003041	NP_003032	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose						carbohydrate metabolic process	integral to membrane	low-affinity glucose:sodium symporter activity			ovary(1)	1						caaaaaatgagaaaaaaaaaaa	0.183													5	3	---	---	---	---	
KIAA0174	9798	broad.mit.edu	37	16	71958914	71958915	+	Intron	INS	-	T	T			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71958914_71958915insT	uc002fbj.1	+						KIAA0174_uc010cgh.1_Intron|KIAA0174_uc002fbk.1_Intron|KIAA0174_uc002fbm.1_Intron|KIAA0174_uc002fbl.1_Intron|KIAA0174_uc002fbn.1_Intron|KIAA0174_uc010cgi.1_Intron|KIAA0174_uc010cgj.1_Intron|KIAA0174_uc010vml.1_Intron			P53990	IST1_HUMAN	SubName: Full=cDNA FLJ32696 fis, clone TESTI2000358; SubName: Full=cDNA FLJ77725;						cell cycle|cell division	cytoplasmic membrane-bounded vesicle|ER-Golgi intermediate compartment	protein binding			ovary(1)	1						TAGCTCAGTGAttttttttttt	0.208													4	2	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2921210	2921211	+	Intron	INS	-	GT	GT	rs142119866	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2921210_2921211insGT	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						CCTCTGTGACCgtgtgtgtgtg	0.475													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	17	6464640	6464641	+	IGR	INS	-	CTC	CTC	rs143155894	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:6464640_6464641insCTC								PITPNM3 (4763 upstream) : KIAA0753 (17005 downstream)																							tcttcctccttctcttctttct	0.000													4	2	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7579545	7579545	+	Frame_Shift_Del	DEL	C	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579545delC	uc002gim.2	-	4	336	c.142delG	c.(142-144)GACfs	p.D48fs	TP53_uc002gig.1_Frame_Shift_Del_p.D48fs|TP53_uc002gih.2_Frame_Shift_Del_p.D48fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Frame_Shift_Del_p.D48fs|TP53_uc010cni.1_Frame_Shift_Del_p.D48fs|TP53_uc002gij.2_Frame_Shift_Del_p.D48fs|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_Frame_Shift_Del_p.D9fs|TP53_uc010cnk.1_Frame_Shift_Del_p.D63fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	48	TADII.|Interaction with HRMT1L2.		D -> G (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.D48fs*55(1)|p.D48D(1)|p.P13fs*18(1)|p.S46_D49delSPDD(1)|p.S33fs*23(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		TCAATATCGTCCGGGGACAGC	0.527		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			168	204	---	---	---	---	
PIK3R5	23533	broad.mit.edu	37	17	8812614	8812614	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:8812614delT	uc002glt.2	-						PIK3R5_uc010vuz.1_Intron|PIK3R5_uc002glu.3_Intron|PIK3R5_uc010coa.1_Intron|PIK3R5_uc010cob.1_Intron	NM_014308	NP_055123	Q8WYR1	PI3R5_HUMAN	phosphoinositide-3-kinase, regulatory subunit 5						platelet activation	cytosol|membrane|nucleus				breast(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5						TGGAACACTCttttttttttt	0.249													9	4	---	---	---	---	
NARF	26502	broad.mit.edu	37	17	80417742	80417742	+	Intron	DEL	A	-	-	rs72353556		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80417742delA	uc002kfg.3	+						NARF_uc002kff.3_Intron|NARF_uc010wvo.1_Intron|NARF_uc010wvp.1_Intron|NARF_uc010dit.2_Intron|NARF_uc002kfj.3_Intron|NARF_uc002kfi.3_Intron|NARF_uc002kfh.3_Intron	NM_012336	NP_036468	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor isoform a							lamin filament	lamin binding			skin(1)	1	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			gactccgtctaaaaaaataaa	0.129													1	5	---	---	---	---	
C18orf1	753	broad.mit.edu	37	18	13612545	13612545	+	Intron	DEL	C	-	-	rs11311417		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:13612545delC	uc002ksa.2	+						C18orf1_uc002ksb.2_Intron|C18orf1_uc002kse.2_5'UTR|C18orf1_uc002ksf.2_5'UTR|C18orf1_uc002ksg.1_Intron	NM_181481	NP_852146	O15165	CR001_HUMAN	hypothetical protein LOC753 isoform alpha 1							integral to membrane|plasma membrane				ovary(2)|skin(1)	3				READ - Rectum adenocarcinoma(73;0.0642)		CAGAAACACACCCCCCCCCCC	0.597													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	18	42156055	42156056	+	IGR	INS	-	TGTG	TGTG	rs34570392		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:42156055_42156056insTGTG								None (None upstream) : SETBP1 (104082 downstream)																							gTCTCtgtgtttgtgtgtgtgt	0.010													4	2	---	---	---	---	
PAPL	390928	broad.mit.edu	37	19	39590657	39590657	+	Intron	DEL	T	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39590657delT	uc002oki.2	+						PAPL_uc010egl.2_Intron	NM_001004318	NP_001004318	Q6ZNF0	PAPL_HUMAN	iron/zinc purple acid phosphatase-like protein							extracellular region	acid phosphatase activity|metal ion binding				0						aaaaaaaaaGTGCCCATCTTg	0.030													4	2	---	---	---	---	
MACROD2	140733	broad.mit.edu	37	20	15843206	15843207	+	Intron	DEL	CA	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:15843206_15843207delCA	uc002wou.2	+						MACROD2_uc002wot.2_Intron|MACROD2_uc002woz.2_Intron|MACROD2_uc002wpb.2_Intron	NM_080676	NP_542407	A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2 isoform 1												0		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				Tacacacacgcacacacacaca	0.287													7	4	---	---	---	---	
CDK5RAP1	51654	broad.mit.edu	37	20	31980269	31980271	+	Intron	DEL	TTT	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:31980269_31980271delTTT	uc010gek.2	-						CDK5RAP1_uc002wyy.2_Intron|CDK5RAP1_uc002wyz.2_Intron|CDK5RAP1_uc002wza.2_Intron|CDK5RAP1_uc010gel.2_Intron|CDK5RAP1_uc010gem.2_Intron|CDK5RAP1_uc002wzc.1_Intron|CDK5RAP1_uc010gen.2_Intron	NM_016408	NP_057492	Q96SZ6	CK5P1_HUMAN	CDK5 regulatory subunit associated protein 1						brain development|negative regulation of cyclin-dependent protein kinase activity|regulation of neuron differentiation|tRNA modification	cytoplasm	4 iron, 4 sulfur cluster binding|metal ion binding|neuronal Cdc2-like kinase binding|transferase activity			ovary(2)|skin(2)|lung(1)	5						ttgggggggattttttttttttt	0.000													4	2	---	---	---	---	
ACSS2	55902	broad.mit.edu	37	20	33470425	33470426	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:33470425_33470426insA	uc002xbd.2	+						ACSS2_uc002xbc.2_Intron|ACSS2_uc010zum.1_Intron|ACSS2_uc010gey.2_Intron|ACSS2_uc002xbe.2_Intron|ACSS2_uc002xbf.2_Intron	NM_018677	NP_061147	Q9NR19	ACSA_HUMAN	acyl-CoA synthetase short-chain family member 2						ethanol oxidation|lipid biosynthetic process|xenobiotic metabolic process	cytosol|nucleus	acetate-CoA ligase activity|ATP binding|protein binding				0					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	cctccatctccaaaaaaaaaaa	0.213													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	37281941	37281941	+	IGR	DEL	G	-	-	rs111938814		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:37281941delG								ADIG (64837 upstream) : SLC32A1 (71164 downstream)																							ttatgatggtggtgttggtgg	0.010													3	3	---	---	---	---	
TH1L	51497	broad.mit.edu	37	20	57567904	57567904	+	Intron	DEL	A	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:57567904delA	uc002yag.2	+						TH1L_uc002yaf.1_Intron|TH1L_uc002yah.2_Intron	NM_198976	NP_945327	Q8IXH7	NELFD_HUMAN	TH1-like protein						negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	nucleoplasm	protein binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3	all_lung(29;0.00711)		Colorectal(105;0.109)			accctgtctcaaaaaaaaaaa	0.159													4	4	---	---	---	---	
CABLES2	81928	broad.mit.edu	37	20	60973128	60973133	+	Intron	DEL	GGTGGT	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:60973128_60973133delGGTGGT	uc002ycv.2	-							NM_031215	NP_112492	Q9BTV7	CABL2_HUMAN	Cdk5 and Abl enzyme substrate 2						cell cycle|cell division|regulation of cell cycle|regulation of cell division		cyclin-dependent protein kinase regulator activity			pancreas(1)	1	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			tggtggtgacggtggtggtggtggtg	0.000													9	4	---	---	---	---	
PRPF6	24148	broad.mit.edu	37	20	62663026	62663026	+	Intron	DEL	A	-	-	rs72442281		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62663026delA	uc002yho.2	+						PRPF6_uc002yhp.2_Intron|NCRNA00176_uc002yhq.2_5'Flank|NCRNA00176_uc011abq.1_5'Flank	NM_012469	NP_036601	O94906	PRP6_HUMAN	PRP6 pre-mRNA processing factor 6 homolog						assembly of spliceosomal tri-snRNP|positive regulation of transcription from RNA polymerase II promoter|spliceosome assembly	catalytic step 2 spliceosome|nucleoplasm|U4/U6 snRNP|U4/U6 x U5 tri-snRNP complex|U5 snRNP	androgen receptor binding|ribonucleoprotein binding|transcription coactivator activity			ovary(2)	2	all_cancers(38;6.47e-12)|all_epithelial(29;1.26e-13)|Lung NSC(23;9.37e-10)|all_lung(23;3.23e-09)					actccttctcaaaaaaaaaaa	0.154													3	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	9829999	9830000	+	IGR	INS	-	G	G			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:9829999_9830000insG								None (None upstream) : None (None downstream)																							AGAGACCCACAGTCTCGGGAGA	0.317													6	3	---	---	---	---	
DSCR4	10281	broad.mit.edu	37	21	39493079	39493080	+	Intron	DEL	AC	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:39493079_39493080delAC	uc002ywp.2	-						DSCR8_uc002ywt.3_5'Flank|DSCR8_uc010gnp.2_5'Flank|DSCR8_uc010gnq.2_5'Flank|DSCR8_uc010gnr.2_5'Flank|DSCR8_uc010gns.2_5'Flank	NM_005867	NP_005858	P56555	DSCR4_HUMAN	Down syndrome critical region protein 4											ovary(1)	1						CAACATTAAAACACACACACAC	0.163													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	21	40497885	40497890	+	IGR	DEL	ACACAT	-	-	rs59776542		TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:40497885_40497890delACACAT								ETS2 (301009 upstream) : PSMG1 (49500 downstream)																							acacacacacacacaTGCATTTGTCA	0.306											OREG0026218	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	3	4	---	---	---	---	
ZNRF3	84133	broad.mit.edu	37	22	29438754	29438755	+	Intron	INS	-	G	G	rs144703972	by1000genomes	TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29438754_29438755insG	uc003aeg.2	+						ZNRF3_uc003aeh.1_Intron	NM_032173	NP_115549	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3							integral to membrane	zinc ion binding			ovary(1)	1						ATTGGGGCACAGGGGGCAtttt	0.267													3	3	---	---	---	---	
L3MBTL2	83746	broad.mit.edu	37	22	41606147	41606147	+	Intron	DEL	C	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:41606147delC	uc003azo.2	+						L3MBTL2_uc010gyi.1_Intron|L3MBTL2_uc003azn.2_Intron|uc003azp.1_Intron	NM_031488	NP_113676	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2						chromatin modification|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	methylated histone residue binding|transcription corepressor activity|zinc ion binding			ovary(2)|central_nervous_system(1)	3						AGTCTAAtttctttttttttt	0.214													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	22	49467030	49467030	+	IGR	DEL	C	-	-			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:49467030delC								FAM19A5 (319288 upstream) : C22orf34 (341146 downstream)																							ttccttccttcccttccttcc	0.035													4	3	---	---	---	---	
GPM6B	2824	broad.mit.edu	37	X	13794618	13794619	+	Intron	INS	-	C	C			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:13794618_13794619insC	uc004cvz.2	-						GPM6B_uc004cvx.2_Intron|GPM6B_uc011min.1_Intron|GPM6B_uc004cwa.2_Intron|GPM6B_uc004cvw.2_Intron|GPM6B_uc011mim.1_Intron|GPM6B_uc004cvy.2_Intron	NM_005278	NP_005269	Q13491	GPM6B_HUMAN	glycoprotein M6B isoform 3						cell differentiation|nervous system development	integral to membrane					0						tgcccagactgccccccaaatc	0.124													4	2	---	---	---	---	
PCYT1B	9468	broad.mit.edu	37	X	24597238	24597239	+	Intron	INS	-	A	A			TCGA-51-4079-01	TCGA-51-4079-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:24597238_24597239insA	uc004dbi.2	-						PCYT1B_uc004dbk.3_Intron|PCYT1B_uc004dbj.2_Intron	NM_004845	NP_004836	Q9Y5K3	PCY1B_HUMAN	choline phosphate cytidylyltransferase 1 beta							endoplasmic reticulum	choline-phosphate cytidylyltransferase activity				0					Choline(DB00122)	gaccctgtctcaaaaaaaaaaa	0.124													6	3	---	---	---	---	
