Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
HSPG2	3339	broad.mit.edu	37	1	22216521	22216521	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:22216521G>C	uc001bfj.2	-	6	567	c.527C>G	c.(526-528)TCC>TGC	p.S176C	HSPG2_uc009vqd.2_Missense_Mutation_p.S176C|HSPG2_uc009vqe.1_Missense_Mutation_p.P75A	NM_005529	NP_005520	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2 precursor	176	SEA.				angiogenesis|cell adhesion|lipid metabolic process|lipoprotein metabolic process	basement membrane|extracellular space|plasma membrane	protein C-terminus binding			ovary(5)|large_intestine(2)|central_nervous_system(1)|skin(1)	9		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Becaplermin(DB00102)|Palifermin(DB00039)	GGTGACGTAGGAGGCCACAGA	0.577													32	49	---	---	---	---	PASS
KIAA0319L	79932	broad.mit.edu	37	1	35932200	35932200	+	Intron	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:35932200A>C	uc001byx.2	-						KIAA0319L_uc010ohv.1_Intron|KIAA0319L_uc010ohw.1_Intron|KIAA0319L_uc001byz.2_Intron	NM_024874	NP_079150	Q8IZA0	K319L_HUMAN	dyslexia susceptibility 2-like							cytoplasmic vesicle part|integral to membrane	protein binding			skin(2)	2		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				GCCAGGGCTGAAAACATACCT	0.453													21	43	---	---	---	---	PASS
IPO13	9670	broad.mit.edu	37	1	44415579	44415579	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:44415579C>A	uc001ckx.2	+	2	1370	c.575C>A	c.(574-576)ACC>AAC	p.T192N		NM_014652	NP_055467	O94829	IPO13_HUMAN	importin 13	192	HEAT 1.				protein import into nucleus	cytoplasm|nucleus	protein binding|protein transporter activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				CTGGTGCGGACCAGCCTGGCG	0.642													3	23	---	---	---	---	PASS
RPE65	6121	broad.mit.edu	37	1	68910338	68910338	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:68910338C>A	uc001dei.1	-	5	425	c.371G>T	c.(370-372)CGA>CTA	p.R124L		NM_000329	NP_000320	Q16518	RPE65_HUMAN	retinal pigment epithelium-specific protein	124					visual perception	cytoplasm|plasma membrane	all-trans-retinyl-palmitate hydrolase activity|metal ion binding|retinol isomerase activity			ovary(1)	1						CTCTACTCCTCGAAAGTAAGA	0.363													26	41	---	---	---	---	PASS
BRDT	676	broad.mit.edu	37	1	92441989	92441989	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92441989G>T	uc001dok.3	+	5	961	c.612G>T	c.(610-612)GCG>GCT	p.A204A	BRDT_uc001dol.3_Silent_p.A204A|BRDT_uc010osz.1_Silent_p.A208A|BRDT_uc009wdf.2_Silent_p.A131A|BRDT_uc010ota.1_Silent_p.A158A|BRDT_uc010otb.1_Silent_p.A158A|BRDT_uc001dom.3_Silent_p.A204A	NM_207189	NP_997072	Q58F21	BRDT_HUMAN	testis-specific bromodomain protein	204					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein serine/threonine kinase activity|transcription coactivator activity			stomach(2)|ovary(1)|lung(1)	4		all_lung(203;0.00531)|Lung NSC(277;0.0194)		all cancers(265;0.0228)|Epithelial(280;0.133)		CACAAACTGCGGCCCAAGTAA	0.353													21	39	---	---	---	---	PASS
NOTCH2NL	388677	broad.mit.edu	37	1	145281588	145281588	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145281588G>T	uc001emn.3	+	4	888	c.518G>T	c.(517-519)GGC>GTC	p.G173V	NBPF10_uc009wir.2_Intron|NBPF9_uc010oye.1_Intron|NBPF9_uc010oyf.1_Intron|NBPF9_uc010oyg.1_Intron|NBPF10_uc001emp.3_5'UTR|NOTCH2NL_uc001emm.3_Missense_Mutation_p.G173V|NOTCH2NL_uc001emo.2_Missense_Mutation_p.G173V|NOTCH2NL_uc010oyh.1_RNA	NM_203458	NP_982283	Q7Z3S9	NT2NL_HUMAN	Notch homolog 2 N-terminal like protein	173	EGF-like 5; calcium-binding (Potential).				cell differentiation|multicellular organismal development|Notch signaling pathway	cytoplasm|extracellular region	calcium ion binding			ovary(1)	1						TGCCTTCAGGGCTTCACAGGC	0.562													18	203	---	---	---	---	PASS
HFE2	148738	broad.mit.edu	37	1	145415545	145415545	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:145415545C>A	uc001eni.2	+	3	689	c.364C>A	c.(364-366)CAG>AAG	p.Q122K	NBPF10_uc001emp.3_Intron|HFE2_uc001enj.2_Intron|HFE2_uc001enk.2_Missense_Mutation_p.Q9K|HFE2_uc001enl.2_Intron	NM_213653	NP_998818	Q6ZVN8	RGMC_HUMAN	hemojuvelin isoform a precursor	122					axon guidance	anchored to membrane				ovary(1)	1	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CTGCTCCCGCCAGGGCCCTAC	0.602													10	42	---	---	---	---	PASS
TRIM46	80128	broad.mit.edu	37	1	155148600	155148600	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155148600G>A	uc001fhs.1	+	3	645	c.562G>A	c.(562-564)GAG>AAG	p.E188K	RAG1AP1_uc010pey.1_Intron|KRTCAP2_uc001fho.2_5'Flank|KRTCAP2_uc001fhp.1_5'Flank|TRIM46_uc009wpe.1_RNA|TRIM46_uc010pez.1_Missense_Mutation_p.E175K|TRIM46_uc001fhq.2_RNA|TRIM46_uc001fhr.2_Missense_Mutation_p.E188K|TRIM46_uc001fht.1_RNA|TRIM46_uc010pfa.1_Missense_Mutation_p.E62K|TRIM46_uc001fhu.1_Missense_Mutation_p.E165K|TRIM46_uc009wpg.1_Missense_Mutation_p.E175K|TRIM46_uc009wpf.2_3'UTR|TRIM46_uc001fhv.3_Missense_Mutation_p.E175K|TRIM46_uc001fhw.1_RNA	NM_025058	NP_079334	Q7Z4K8	TRI46_HUMAN	tripartite motif-containing 46	188	RING-type 2; degenerate.					intracellular	zinc ion binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GGGCTGCACAGAGTGCCGCGC	0.642													31	89	---	---	---	---	PASS
HCN3	57657	broad.mit.edu	37	1	155252472	155252472	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155252472G>T	uc001fjz.1	+	2	557	c.549G>T	c.(547-549)GTG>GTT	p.V183V	RAG1AP1_uc010pey.1_Intron|HCN3_uc010pfz.1_5'UTR	NM_020897	NP_065948	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic	183	Helical; Name=Segment S3; (Potential).					integral to membrane	cAMP binding|sodium channel activity|voltage-gated potassium channel activity			ovary(1)|breast(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			CTATCCCTGTGGATTACATCT	0.592													18	48	---	---	---	---	PASS
ETV3	2117	broad.mit.edu	37	1	157105292	157105292	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157105292C>T	uc001fqr.2	-	3	544	c.255G>A	c.(253-255)ATG>ATA	p.M85I	ETV3_uc001fqt.2_Missense_Mutation_p.M85I	NM_001145312	NP_001138784	P41162	ETV3_HUMAN	ets variant gene 3 isoform 1	85	ETS.						sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Hepatocellular(266;0.158)	Prostate(1639;0.174)				TGTCATAATTCATCTGTGGTT	0.507													16	68	---	---	---	---	PASS
PYHIN1	149628	broad.mit.edu	37	1	158943500	158943500	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158943500G>T	uc001ftb.2	+	8	1668	c.1423G>T	c.(1423-1425)GTG>TTG	p.V475L	PYHIN1_uc001ftc.2_Missense_Mutation_p.V466L|PYHIN1_uc001ftd.2_Intron|PYHIN1_uc001fte.2_Intron	NM_152501	NP_689714	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1 alpha 1	475					cell cycle	nuclear speck				ovary(3)|pancreas(1)	4	all_hematologic(112;0.0378)					CTCACCAACTGTGGCCCCTCC	0.443													23	75	---	---	---	---	PASS
C1orf111	284680	broad.mit.edu	37	1	162343862	162343862	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:162343862G>T	uc001gbx.2	-	3	826	c.762C>A	c.(760-762)GGC>GGA	p.G254G		NM_182581	NP_872387	Q5T0L3	CA111_HUMAN	hypothetical protein LOC284680	254										ovary(1)	1	all_hematologic(112;0.15)		BRCA - Breast invasive adenocarcinoma(70;0.0938)			AGGCTTCACCGCCAATTTGCC	0.567													67	261	---	---	---	---	PASS
KIFAP3	22920	broad.mit.edu	37	1	169951129	169951129	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:169951129G>A	uc001ggv.2	-	15	2053	c.1782C>T	c.(1780-1782)CTC>CTT	p.L594L	KIFAP3_uc010plx.1_Silent_p.L296L	NM_014970	NP_055785	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	594	ARM 4.				blood coagulation|plus-end-directed vesicle transport along microtubule|protein complex assembly|signal transduction	centrosome|condensed nuclear chromosome|cytosol|endoplasmic reticulum|kinesin II complex|spindle microtubule	kinesin binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GCAATTCAATGAGTGCAGGGA	0.303													11	32	---	---	---	---	PASS
C1orf129	80133	broad.mit.edu	37	1	170940928	170940928	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:170940928G>A	uc001ghg.2	+	8	650	c.520G>A	c.(520-522)GAG>AAG	p.E174K	C1orf129_uc009wvy.2_5'UTR|C1orf129_uc010plz.1_Missense_Mutation_p.E174K	NM_025063	NP_079339	Q5TGP6	CA129_HUMAN	hypothetical protein LOC80133 isoform 2	174							binding			pancreas(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTGGCAGCAGAGCTGTCTCT	0.438													58	241	---	---	---	---	PASS
FMO1	2326	broad.mit.edu	37	1	171244533	171244533	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171244533C>G	uc009wvz.2	+	4	506	c.370C>G	c.(370-372)CAA>GAA	p.Q124E	FMO1_uc010pme.1_Missense_Mutation_p.Q61E|FMO1_uc001ghl.2_Missense_Mutation_p.Q124E|FMO1_uc001ghm.2_Missense_Mutation_p.Q124E|FMO1_uc001ghn.2_Missense_Mutation_p.Q124E	NM_002021	NP_002012	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	124					NADPH oxidation|organic acid metabolic process|toxin metabolic process|xenobiotic metabolic process	endoplasmic reticulum lumen|integral to membrane|intrinsic to endoplasmic reticulum membrane|microsome	flavin adenine dinucleotide binding|flavin-containing monooxygenase activity|NADP binding			skin(1)	1	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGTCTCTGGCCAATGGGAGGT	0.423													21	66	---	---	---	---	PASS
BAT2L2	23215	broad.mit.edu	37	1	171504714	171504714	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171504714C>G	uc010pmg.1	+	13	2281	c.2015C>G	c.(2014-2016)CCT>CGT	p.P672R		NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2	672	Gln-rich.						protein C-terminus binding				0						AAGTCTTTACCTCCACGATTC	0.413													49	176	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564197	176564197	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564197C>A	uc001gkz.2	+	3	2621	c.1457C>A	c.(1456-1458)CCA>CAA	p.P486Q	PAPPA2_uc001gky.1_Missense_Mutation_p.P486Q|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	486	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GGCTTTGAGCCAGAGCCTGAG	0.527													21	68	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176564198	176564198	+	Silent	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176564198A>C	uc001gkz.2	+	3	2622	c.1458A>C	c.(1456-1458)CCA>CCC	p.P486P	PAPPA2_uc001gky.1_Silent_p.P486P|PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	486	Metalloprotease.				cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						GCTTTGAGCCAGAGCCTGAGA	0.527													21	67	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176709227	176709227	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176709227G>C	uc001gkz.2	+	14	5210	c.4046G>C	c.(4045-4047)CGG>CCG	p.R1349P	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1349					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						TCATCCCCACGGGTCGGCATC	0.522													32	118	---	---	---	---	PASS
FAM5B	57795	broad.mit.edu	37	1	177249550	177249550	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177249550C>T	uc001glf.2	+	8	1550	c.1238C>T	c.(1237-1239)TCC>TTC	p.S413F	FAM5B_uc001glg.2_Missense_Mutation_p.S308F	NM_021165	NP_066988	Q9C0B6	FAM5B_HUMAN	family with sequence similarity 5, member B	413						extracellular region				skin(3)|ovary(2)|upper_aerodigestive_tract(1)	6						TCCCCAAGGTCCTTGTCCTAC	0.527													16	102	---	---	---	---	PASS
SEC16B	89866	broad.mit.edu	37	1	177902668	177902668	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:177902668C>A	uc001gli.1	-	21	2765	c.2675G>T	c.(2674-2676)CGA>CTA	p.R892L	SEC16B_uc001glk.1_Missense_Mutation_p.R569L|SEC16B_uc009wwy.1_Missense_Mutation_p.R447L|SEC16B_uc001glh.1_Missense_Mutation_p.R551L|SEC16B_uc009wwz.1_Missense_Mutation_p.R551L|SEC16B_uc001glj.1_Missense_Mutation_p.R893L	NM_033127	NP_149118	Q96JE7	SC16B_HUMAN	leucine zipper transcription regulator 2	892					protein transport|vesicle-mediated transport	endoplasmic reticulum membrane|Golgi membrane				ovary(3)|central_nervous_system(1)	4						GGCAGTATTTCGGGGAGAGTT	0.532													10	37	---	---	---	---	PASS
CEP350	9857	broad.mit.edu	37	1	180017694	180017694	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:180017694A>G	uc001gnt.2	+	22	5029	c.4646A>G	c.(4645-4647)CAA>CGA	p.Q1549R	CEP350_uc009wxl.2_Missense_Mutation_p.Q1548R	NM_014810	NP_055625	Q5VT06	CE350_HUMAN	centrosome-associated protein 350	1549	Ser-rich.					centrosome|nucleus|spindle				ovary(4)	4						AGCAGCCGCCAAGAAAGTCCT	0.358													23	85	---	---	---	---	PASS
SMG7	9887	broad.mit.edu	37	1	183498676	183498676	+	Intron	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:183498676T>A	uc001gqg.2	+						SMG7_uc010pob.1_Intron|SMG7_uc001gqf.2_Intron|SMG7_uc001gqh.2_Intron|SMG7_uc001gqi.2_Intron|SMG7_uc010poc.1_Intron	NM_173156	NP_775179	Q92540	SMG7_HUMAN	SMG-7 homolog isoform 1						mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|regulation of dephosphorylation	cytoplasm|intermediate filament cytoskeleton|nucleus	protein phosphatase 2A binding			upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						AAGGTTAGATTTCAGAAATAG	0.368													9	26	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186056380	186056380	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186056380G>T	uc001grq.1	+	59	9307	c.9078G>T	c.(9076-9078)AAG>AAT	p.K3026N		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3026	Ig-like C2-type 28.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						TTCGGGCCAAGGTATCAGATG	0.383													4	75	---	---	---	---	PASS
HMCN1	83872	broad.mit.edu	37	1	186064593	186064593	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186064593A>G	uc001grq.1	+	68	10742	c.10513A>G	c.(10513-10515)ACC>GCC	p.T3505A		NM_031935	NP_114141	Q96RW7	HMCN1_HUMAN	hemicentin 1 precursor	3505	Ig-like C2-type 33.				response to stimulus|visual perception	basement membrane	calcium ion binding			ovary(22)|skin(1)	23						GGGAAAGTACACCTGCATTGC	0.473													15	63	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186300668	186300668	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186300668G>C	uc001grv.2	-	39	5947	c.5650C>G	c.(5650-5652)CAG>GAG	p.Q1884E		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	1884					carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TTGTATACCTGAGTCTCTACC	0.363			T	NTRK1	papillary thyroid								21	85	---	---	---	---	PASS
CFHR2	3080	broad.mit.edu	37	1	196918772	196918772	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:196918772G>T	uc001gtq.1	+	2	323	c.246G>T	c.(244-246)AAG>AAT	p.K82N	CFHR2_uc001gtr.1_Intron	NM_005666	NP_005657	P36980	FHR2_HUMAN	H factor (complement)-like 3 precursor	82	Sushi 1.					extracellular region				skin(2)|ovary(1)	3						CAACACCAAAGTGTCTCAGTG	0.388													16	48	---	---	---	---	PASS
ZBTB41	360023	broad.mit.edu	37	1	197168544	197168544	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197168544G>C	uc001gtx.1	-	1	1129	c.1060C>G	c.(1060-1062)CAG>GAG	p.Q354E	ZBTB41_uc009wyz.1_RNA|CRB1_uc010poz.1_5'Flank	NM_194314	NP_919290	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	354					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2						TTGCTGTTCTGAATGACCACT	0.363													13	76	---	---	---	---	PASS
LMOD1	25802	broad.mit.edu	37	1	201868376	201868376	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201868376G>A	uc001gxb.2	-	2	2013	c.1765C>T	c.(1765-1767)CAG>TAG	p.Q589*	LMOD1_uc010ppu.1_Nonsense_Mutation_p.Q538*	NM_012134	NP_036266	P29536	LMOD1_HUMAN	leiomodin 1 (smooth muscle)	589	WH2.				muscle contraction	cytoskeleton|cytosol|membrane fraction	tropomyosin binding			ovary(1)|pancreas(1)|skin(1)	3						TTCTTGAGCTGCTTGAGGTTG	0.582													5	19	---	---	---	---	PASS
MYBPH	4608	broad.mit.edu	37	1	203143593	203143593	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203143593A>G	uc001gzh.1	-	3	532	c.473T>C	c.(472-474)ATG>ACG	p.M158T	FMOD_uc010pqi.1_Intron	NM_004997	NP_004988	Q13203	MYBPH_HUMAN	myosin binding protein H	158	Fibronectin type-III 1.				cell adhesion|regulation of striated muscle contraction	myosin filament	structural constituent of muscle				0			BRCA - Breast invasive adenocarcinoma(75;0.153)	Colorectal(1306;0.0306)		CTGGTCCAGCATGGCCGGCGG	0.582													11	53	---	---	---	---	PASS
KCNH1	3756	broad.mit.edu	37	1	211093085	211093085	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:211093085C>A	uc001hib.2	-	7	1529	c.1359G>T	c.(1357-1359)TCG>TCT	p.S453S	KCNH1_uc001hic.2_Silent_p.S426S	NM_172362	NP_758872	O95259	KCNH1_HUMAN	potassium voltage-gated channel, subfamily H,	453					myoblast fusion|regulation of transcription, DNA-dependent	voltage-gated potassium channel complex	calmodulin binding|delayed rectifier potassium channel activity|two-component sensor activity			ovary(4)|central_nervous_system(1)	5				OV - Ovarian serous cystadenocarcinoma(81;0.0109)|all cancers(67;0.141)|Epithelial(68;0.185)		TGAAATACAACGAGGAGATGT	0.502													24	96	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213415138	213415138	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213415138C>A	uc010ptr.1	+	11	2478	c.2319C>A	c.(2317-2319)CCC>CCA	p.P773P	RPS6KC1_uc001hkd.2_Silent_p.P761P|RPS6KC1_uc010pts.1_Silent_p.P561P|RPS6KC1_uc010ptt.1_Silent_p.P561P|RPS6KC1_uc010ptu.1_Silent_p.P592P|RPS6KC1_uc010ptv.1_Silent_p.P308P|RPS6KC1_uc001hke.2_Silent_p.P592P	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	773					cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AGGAGGATCCCAGGATGTTAT	0.443													25	106	---	---	---	---	PASS
TMEM63A	9725	broad.mit.edu	37	1	226054858	226054858	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:226054858C>T	uc001hpm.1	-	8	770	c.520G>A	c.(520-522)GAC>AAC	p.D174N	TMEM63A_uc010pvi.1_Missense_Mutation_p.D174N	NM_014698	NP_055513	O94886	TM63A_HUMAN	transmembrane protein 63A	174						integral to membrane|lysosomal membrane	nucleotide binding			ovary(1)|breast(1)	2	Breast(184;0.197)					CTATACGGGTCTTTGTCTGCA	0.527													34	213	---	---	---	---	PASS
OBSCN	84033	broad.mit.edu	37	1	228529140	228529140	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:228529140G>A	uc009xez.1	+	74	17903	c.17859G>A	c.(17857-17859)CTG>CTA	p.L5953L	OBSCN_uc001hsn.2_Silent_p.L5953L|OBSCN_uc001hsr.1_Silent_p.L582L	NM_001098623	NP_001092093	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and	5953	PH.				apoptosis|cell differentiation|induction of apoptosis by extracellular signals|multicellular organismal development|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction	cytosol|M band|Z disc	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity|protein tyrosine kinase activity|Rho guanyl-nucleotide exchange factor activity|structural constituent of muscle|titin binding			stomach(8)|large_intestine(7)|breast(5)|ovary(4)|skin(2)|central_nervous_system(1)|pancreas(1)	28		Prostate(94;0.0405)				ACCCACAGCTGAGCAGCATCG	0.652													4	17	---	---	---	---	PASS
ACTA1	58	broad.mit.edu	37	1	229568328	229568328	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229568328G>C	uc001htm.2	-	3	534	c.429C>G	c.(427-429)TCC>TCG	p.S143S		NM_001100	NP_001091	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	143					muscle filament sliding|skeletal muscle fiber development|skeletal muscle thin filament assembly	actin filament|cytosol|stress fiber|striated muscle thin filament	ADP binding|ATP binding|myosin binding|structural constituent of cytoskeleton				0	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)			Dornase Alfa(DB00003)	AGGCGTAGAGGGACAGCACGG	0.493													16	57	---	---	---	---	PASS
ABCB10	23456	broad.mit.edu	37	1	229675264	229675264	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:229675264C>A	uc001htp.3	-	6	1321	c.1278G>T	c.(1276-1278)ATG>ATT	p.M426I		NM_012089	NP_036221	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B, member 10	426	Mitochondrial intermembrane (Potential).|Helical; (Potential).|ABC transmembrane type-1.					integral to mitochondrial membrane|mitochondrial inner membrane	ATP binding|oligopeptide-transporting ATPase activity			breast(2)	2	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				CACCCACGGTCATGTGGGCAC	0.453													33	100	---	---	---	---	PASS
ZP4	57829	broad.mit.edu	37	1	238053419	238053419	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:238053419C>G	uc001hym.2	-	2	233	c.233G>C	c.(232-234)AGA>ACA	p.R78T	LOC100130331_uc010pyc.1_Intron	NM_021186	NP_067009	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4 preproprotein	78	Extracellular (Potential).				acrosomal vesicle exocytosis|negative regulation of binding of sperm to zona pellucida|positive regulation of acrosome reaction|positive regulation of humoral immune response|positive regulation of protein kinase activity|positive regulation of T cell proliferation|protein kinase A signaling cascade|protein kinase C signaling cascade	integral to membrane|intracellular|plasma membrane|proteinaceous extracellular matrix	acrosin binding|receptor activity			ovary(2)|skin(1)	3	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TGGACCTTTTCTTATCCAGGT	0.557													34	95	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240341368	240341368	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240341368G>T	uc010pyd.1	+	3	2155	c.1930G>T	c.(1930-1932)GAA>TAA	p.E644*	FMN2_uc010pye.1_Nonsense_Mutation_p.E644*	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2	644				E -> EDDGE (in Ref. 2; BAD92390).	actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TGCTGAAACAGGTAACCCTTT	0.413													10	49	---	---	---	---	PASS
FMN2	56776	broad.mit.edu	37	1	240341369	240341369	+	Splice_Site	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:240341369G>T	uc010pyd.1	+	3	2155	c.1930_splice	c.e3+1	p.E644_splice	FMN2_uc010pye.1_Splice_Site_p.E644_splice	NM_020066	NP_064450	Q9NZ56	FMN2_HUMAN	formin 2						actin cytoskeleton organization|establishment of meiotic spindle localization|intracellular signal transduction|meiotic chromosome movement towards spindle pole|meiotic metaphase I|multicellular organismal development|oogenesis|polar body extrusion after meiotic divisions		actin binding			ovary(4)|pancreas(3)|skin(3)|large_intestine(1)|central_nervous_system(1)	12	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			GCTGAAACAGGTAACCCTTTC	0.418													10	48	---	---	---	---	PASS
OR2AK2	391191	broad.mit.edu	37	1	248129375	248129375	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248129375G>T	uc010pzd.1	+	1	742	c.742G>T	c.(742-744)GGA>TGA	p.G248*	OR2L13_uc001ids.2_Intron	NM_001004491	NP_001004491	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK,	248	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|breast(1)	2	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CTCAGGAAAAGGACAGGCAAA	0.483													12	61	---	---	---	---	PASS
OR2T1	26696	broad.mit.edu	37	1	248569835	248569835	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:248569835G>T	uc010pzm.1	+	1	540	c.540G>T	c.(538-540)CTG>CTT	p.L180L		NM_030904	NP_112166	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T,	180	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.L180R(1)		pancreas(1)	1	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GCAACCCTCTGAGATACCCTG	0.547													35	118	---	---	---	---	PASS
PXDN	7837	broad.mit.edu	37	2	1684049	1684049	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:1684049C>A	uc002qxa.2	-	7	710	c.646G>T	c.(646-648)GCG>TCG	p.A216S	PXDN_uc002qxb.1_Missense_Mutation_p.A216S|PXDN_uc002qxc.1_Missense_Mutation_p.A33S	NM_012293	NP_036425	Q92626	PXDN_HUMAN	peroxidasin precursor	216	LRRCT.				extracellular matrix organization|hydrogen peroxide catabolic process|immune response	endoplasmic reticulum|extracellular space|proteinaceous extracellular matrix	extracellular matrix structural constituent|heme binding|interleukin-1 receptor antagonist activity|peroxidase activity			pancreas(6)|ovary(2)	8	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.0845)|Lung NSC(108;0.00641)|all_epithelial(98;0.00716)		all cancers(51;0.0492)|OV - Ovarian serous cystadenocarcinoma(76;0.0973)|Epithelial(75;0.17)|GBM - Glioblastoma multiforme(21;0.228)		GCTGCCTGCGCGTTCCCCGAC	0.582													6	37	---	---	---	---	PASS
DNAJC27	51277	broad.mit.edu	37	2	25180784	25180784	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:25180784C>G	uc002rft.1	-	4	351	c.300G>C	c.(298-300)CAG>CAC	p.Q100H	DNAJC27_uc010ykn.1_Missense_Mutation_p.Q29H|DNAJC27_uc002rfu.1_RNA|DNAJC27_uc010eyg.1_Missense_Mutation_p.Q100H	NM_016544	NP_057628	Q9NZQ0	DJC27_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 27	100					protein folding|small GTPase mediated signal transduction		GTP binding|heat shock protein binding|unfolded protein binding			skin(1)	1						AGGAGTCTTTCTGCCCAACAT	0.413													13	67	---	---	---	---	PASS
CAD	790	broad.mit.edu	37	2	27445786	27445786	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27445786C>T	uc002rji.2	+	6	852	c.690C>T	c.(688-690)CCC>CCT	p.P230P	CAD_uc010eyw.2_Silent_p.P230P	NM_004341	NP_004332	P27708	PYR1_HUMAN	carbamoylphosphate synthetase 2/aspartate	230	Glutamine amidotransferase type-1.|GATase (Glutamine amidotransferase).				'de novo' pyrimidine base biosynthetic process|drug metabolic process|glutamine metabolic process|peptidyl-threonine phosphorylation|protein autophosphorylation|pyrimidine nucleoside biosynthetic process|pyrimidine nucleotide biosynthetic process	cytosol|neuronal cell body|nuclear matrix|terminal button	aspartate binding|aspartate carbamoyltransferase activity|ATP binding|carbamoyl-phosphate synthase (glutamine-hydrolyzing) activity|dihydroorotase activity|enzyme binding|identical protein binding|metal ion binding|protein kinase activity			ovary(4)|large_intestine(2)|kidney(2)|lung(1)|pancreas(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CCTCCTATCCCAGTGTCGTAT	0.498													58	82	---	---	---	---	PASS
NRBP1	29959	broad.mit.edu	37	2	27660216	27660216	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27660216C>G	uc002rko.2	+	11	1724	c.892C>G	c.(892-894)CCA>GCA	p.P298A	NRBP1_uc002rkq.2_Missense_Mutation_p.P298A|NRBP1_uc002rkp.2_Missense_Mutation_p.P298A|NRBP1_uc002rkr.2_Missense_Mutation_p.P89A	NM_013392	NP_037524	Q9UHY1	NRBP_HUMAN	nuclear receptor binding protein	298	Protein kinase.				ER to Golgi vesicle-mediated transport|gene expression|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor	cell cortex|endomembrane system|lamellipodium|membrane|nucleoplasm	ATP binding|protein homodimerization activity|protein kinase activity			ovary(2)|lung(1)	3	Acute lymphoblastic leukemia(172;0.155)					TCTAGAAGACCCATTACAGAG	0.488													14	30	---	---	---	---	PASS
ZFP36L2	678	broad.mit.edu	37	2	43452474	43452474	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:43452474C>G	uc002rsv.3	-	2	760	c.469G>C	c.(469-471)GAG>CAG	p.E157Q	LOC100129726_uc010ynx.1_5'Flank	NM_006887	NP_008818	P47974	TISD_HUMAN	zinc finger protein 36, C3H type-like 2	157	C3H1-type 1.|RNA-binding.				cell proliferation	nucleus	DNA binding|RNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CGGCACAGCTCGGTCTTGTAG	0.652													15	18	---	---	---	---	PASS
TSPYL6	388951	broad.mit.edu	37	2	54482223	54482223	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54482223C>T	uc002rxr.2	-	1	1187	c.1066G>A	c.(1066-1068)GAC>AAC	p.D356N	ACYP2_uc002rxq.3_Intron	NM_001003937	NP_001003937	Q8N831	TSYL6_HUMAN	TSPY-like 6	356					nucleosome assembly	nucleus					0						AGGCTGTGGTCTGAAAACCAG	0.507													14	79	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61417456	61417456	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61417456C>G	uc002sbe.2	-	78	9845	c.9823G>C	c.(9823-9825)GAT>CAT	p.D3275H	USP34_uc002sbd.2_Missense_Mutation_p.D77H	NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	3275					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TTGGAGAAATCAGACTGTAGG	0.403													9	124	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61524017	61524017	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61524017G>C	uc002sbe.2	-	30	4194	c.4172C>G	c.(4171-4173)TCT>TGT	p.S1391C		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	1391					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			GACCCGCCTAGACAGATTTTC	0.378													27	308	---	---	---	---	PASS
SLC1A4	6509	broad.mit.edu	37	2	65243695	65243695	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:65243695C>A	uc010yqa.1	+	5	1244	c.922C>A	c.(922-924)CAT>AAT	p.H308N	SLC1A4_uc010ypy.1_Missense_Mutation_p.H88N|SLC1A4_uc010ypz.1_Intron|SLC1A4_uc010fcv.2_Missense_Mutation_p.H308N|SLC1A4_uc002sdh.2_Missense_Mutation_p.H88N	NM_003038	NP_003029	P43007	SATT_HUMAN	solute carrier family 1, member 4 isoform 1	308	Helical; (Potential).				cellular nitrogen compound metabolic process|cognition|synaptic transmission, glutamatergic	intermediate filament|melanosome	chloride channel activity|L-alanine transmembrane transporter activity|L-cystine transmembrane transporter activity|L-hydroxyproline transmembrane transporter activity|L-proline transmembrane transporter activity|L-serine transmembrane transporter activity|L-threonine transmembrane transporter activity|sodium:dicarboxylate symporter activity			pancreas(1)	1					L-Alanine(DB00160)	CCATGTTATTCATGGAGGAAT	0.453													24	362	---	---	---	---	PASS
TIA1	7072	broad.mit.edu	37	2	70456422	70456422	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:70456422G>C	uc002sgj.3	-	4	468	c.251C>G	c.(250-252)CCT>CGT	p.P84R	TIA1_uc002sgk.3_Missense_Mutation_p.P84R|TIA1_uc002sgl.3_RNA|TIA1_uc002sgm.3_Missense_Mutation_p.P84R|TIA1_uc010yqt.1_Missense_Mutation_p.P84R	NM_022173	NP_071505	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding	84					apoptosis|induction of apoptosis|regulation of nuclear mRNA splicing, via spliceosome	nucleus	nucleotide binding|poly(A) RNA binding|protein binding				0						TTGACTGCTAGGGGTTGTTGC	0.284													7	124	---	---	---	---	PASS
CTNNA2	1496	broad.mit.edu	37	2	80646714	80646714	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:80646714C>G	uc010ysh.1	+	8	1283	c.1278C>G	c.(1276-1278)AAC>AAG	p.N426K	CTNNA2_uc010yse.1_Missense_Mutation_p.N426K|CTNNA2_uc010ysf.1_Missense_Mutation_p.N426K|CTNNA2_uc010ysg.1_Missense_Mutation_p.N426K|CTNNA2_uc010ysi.1_Missense_Mutation_p.N58K	NM_004389	NP_004380	P26232	CTNA2_HUMAN	catenin, alpha 2 isoform 1	426					axonogenesis|brain morphogenesis|cell-cell adhesion|dendrite morphogenesis|muscle cell differentiation|positive regulation of muscle cell differentiation|prepulse inhibition|radial glia guided migration of Purkinje cell|regulation of synapse structural plasticity	actin cytoskeleton|axon|cytosol	cadherin binding|structural constituent of cytoskeleton			pancreas(4)|lung(3)|breast(1)|skin(1)	9						AGCATGCCAACAAACTGGTAG	0.433													25	45	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	89345908	89345908	+	Intron	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:89345908C>T	uc010ytr.1	-						uc002stl.2_Intron					Parts of antibodies, mostly variable regions.																		TCCTTCCTTACCTGGGAGCCA	0.542													49	94	---	---	---	---	PASS
SEPT10	151011	broad.mit.edu	37	2	110310749	110310749	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:110310749C>T	uc002tew.2	-	9	1455	c.1076G>A	c.(1075-1077)CGT>CAT	p.R359H	SEPT10_uc010ywu.1_Missense_Mutation_p.R192H|SEPT10_uc002tex.2_Missense_Mutation_p.R336H|SEPT10_uc002tey.2_Missense_Mutation_p.R359H|SEPT10_uc010ywv.1_Missense_Mutation_p.R225H|SEPT10_uc002tev.1_Missense_Mutation_p.R166H|SEPT10_uc010fjo.2_Intron	NM_144710	NP_653311	Q9P0V9	SEP10_HUMAN	septin 10 isoform 1	359					cell cycle|cell division	septin complex	GTP binding				0						CTTCCTCTGACGTTCACCATG	0.373													23	93	---	---	---	---	PASS
PAX8	7849	broad.mit.edu	37	2	113993011	113993011	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:113993011G>C	uc010yxt.1	-	9	1213	c.1047C>G	c.(1045-1047)GCC>GCG	p.A349A	PAX8_uc010yxu.1_Missense_Mutation_p.P323R|PAX8_uc010yxv.1_Intron|PAX8_uc002tjm.2_Intron|PAX8_uc002tjn.2_Intron|uc002tjp.2_5'Flank|LOC654433_uc002tjq.3_5'Flank|LOC654433_uc010fks.2_5'Flank|LOC654433_uc010fkt.2_5'Flank|LOC654433_uc002tjr.3_5'Flank	NM_003466	NP_003457	Q06710	PAX8_HUMAN	paired box 8 isoform PAX8A	349					branching involved in ureteric bud morphogenesis|cellular response to gonadotropin stimulus|central nervous system development|mesenchymal to epithelial transition involved in metanephros morphogenesis|mesonephros development|metanephric collecting duct development|metanephric comma-shaped body morphogenesis|metanephric distal convoluted tubule development|metanephric nephron tubule formation|metanephric S-shaped body morphogenesis|negative regulation of mesenchymal stem cell apoptosis involved in metanephric nephron morphogenesis|otic vesicle development|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis|positive regulation of metanephric DCT cell differentiation|positive regulation of thyroid hormone generation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|pronephric field specification|regulation of metanephric nephron tubule epithelial cell differentiation|regulation of thyroid-stimulating hormone secretion|thyroid gland development|transcription, DNA-dependent	nucleoplasm	protein binding|RNA polymerase II core promoter sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|thyroid-stimulating hormone receptor activity			ovary(1)|lung(1)	2						CGTACACGGAGGCAGCATGGG	0.642			T	PPARG	follicular thyroid		Thyroid dysgenesis 						4	8	---	---	---	---	PASS
SMPD4	55627	broad.mit.edu	37	2	130912698	130912698	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:130912698T>A	uc002tqq.1	-	15	2061	c.1541A>T	c.(1540-1542)CAG>CTG	p.Q514L	SMPD4_uc002tqo.1_5'UTR|SMPD4_uc002tqp.1_Missense_Mutation_p.Q253L|SMPD4_uc010yzy.1_Missense_Mutation_p.Q263L|SMPD4_uc010yzz.1_Missense_Mutation_p.Q178L|SMPD4_uc002tqr.1_Missense_Mutation_p.Q485L|SMPD4_uc002tqs.1_Missense_Mutation_p.Q382L|SMPD4_uc002tqt.1_Missense_Mutation_p.Q363L|SMPD4_uc010zaa.1_Missense_Mutation_p.Q372L|SMPD4_uc010zab.1_Missense_Mutation_p.Q412L|SMPD4_uc010zac.1_Missense_Mutation_p.Q255L|SMPD4_uc010zad.1_Missense_Mutation_p.Q150L	NM_017951	NP_060421	Q9NXE4	NSMA3_HUMAN	sphingomyelin phosphodiesterase 4 isoform 2	475					sphingomyelin catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|trans-Golgi network	metal ion binding|protein binding|sphingomyelin phosphodiesterase activity|sphingomyelin phosphodiesterase D activity				0	Colorectal(110;0.1)				Phosphatidylserine(DB00144)	CAGGTTGGGCTGGGCAAAGAC	0.607													12	43	---	---	---	---	PASS
YSK4	80122	broad.mit.edu	37	2	135757526	135757526	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:135757526C>T	uc002tue.1	-	4	326	c.295G>A	c.(295-297)GAA>AAA	p.E99K	YSK4_uc010fne.1_Missense_Mutation_p.E71K|YSK4_uc002tuf.1_Missense_Mutation_p.E99K|YSK4_uc010fnc.1_Missense_Mutation_p.E99K|YSK4_uc010fnd.1_Intron|YSK4_uc010zbg.1_Missense_Mutation_p.E99K|YSK4_uc002tui.3_Missense_Mutation_p.E116K	NM_025052	NP_079328	Q56UN5	YSK4_HUMAN	Yeast Sps1/Ste20-related kinase 4 isoform 1	99							ATP binding|protein serine/threonine kinase activity			stomach(2)|urinary_tract(1)|ovary(1)|breast(1)	5				BRCA - Breast invasive adenocarcinoma(221;0.112)		TTTAAGTCTTCTTGGCTCATT	0.348													22	67	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141274476	141274476	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141274476G>T	uc002tvj.1	-	50	9103	c.8131C>A	c.(8131-8133)CGT>AGT	p.R2711S		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	2711	Extracellular (Potential).|LDL-receptor class A 15.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AATTCATCACGTCCATCCTCA	0.328										TSP Lung(27;0.18)			12	56	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152497110	152497110	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152497110G>C	uc010fnx.2	-	61	8635	c.8444C>G	c.(8443-8445)CCC>CGC	p.P2815R	NEB_uc002txu.2_5'Flank	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3	2815	Nebulin 76.				muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		CATCATCTTGGGGTCATCACG	0.488													54	247	---	---	---	---	PASS
CCDC148	130940	broad.mit.edu	37	2	159033122	159033122	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:159033122C>A	uc002tzq.2	-	13	1803	c.1540G>T	c.(1540-1542)GCA>TCA	p.A514S	CCDC148_uc002tzr.2_Missense_Mutation_p.A362S|CCDC148_uc010foh.2_Missense_Mutation_p.A227S	NM_138803	NP_620158	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	514										ovary(2)	2						GCTTTTGATGCCATTGTATCT	0.343													11	31	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593309	179593309	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593309C>A	uc010zfg.1	-	63	15836	c.15612G>T	c.(15610-15612)ATG>ATT	p.M5204I	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.M1865I	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6131							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTCCTGCTTCATTACTGACT	0.408													18	19	---	---	---	---	PASS
SLC39A10	57181	broad.mit.edu	37	2	196548515	196548515	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196548515G>T	uc002utg.3	+	3	1315	c.1101G>T	c.(1099-1101)TTG>TTT	p.L367F	SLC39A10_uc002uth.3_Missense_Mutation_p.L367F|SLC39A10_uc010zgp.1_5'UTR	NM_001127257	NP_001120729	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter),	367					zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			pancreas(1)|skin(1)	2			OV - Ovarian serous cystadenocarcinoma(117;0.221)			GCCCTGCATTGTTATATCAAA	0.363													47	72	---	---	---	---	PASS
DNAH7	56171	broad.mit.edu	37	2	196722277	196722277	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:196722277C>T	uc002utj.3	-	44	8339	c.8238G>A	c.(8236-8238)ATG>ATA	p.M2746I		NM_018897	NP_061720	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2746	Stalk (By similarity).				ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|microtubule motor activity			skin(10)|ovary(2)	12						GCAGAAACCTCATGTCACCAA	0.378													35	60	---	---	---	---	PASS
BZW1	9689	broad.mit.edu	37	2	201681039	201681039	+	Intron	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201681039T>C	uc010zhg.1	+						BZW1_uc002uwc.2_Intron|BZW1_uc010zhh.1_Intron	NM_014670	NP_055485	Q7L1Q6	BZW1_HUMAN	basic leucine zipper and W2 domains 1						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm	protein binding				0						CATTTAATGTTCTTCATAGGT	0.318													13	41	---	---	---	---	PASS
NRP2	8828	broad.mit.edu	37	2	206587416	206587416	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:206587416G>T	uc002vaw.2	+	4	1439	c.648G>T	c.(646-648)TGG>TGT	p.W216C	NRP2_uc002vat.2_Missense_Mutation_p.W216C|NRP2_uc002vau.2_Missense_Mutation_p.W216C|NRP2_uc002vav.2_Missense_Mutation_p.W216C|NRP2_uc002vax.2_Missense_Mutation_p.W216C|NRP2_uc002vay.2_Missense_Mutation_p.W216C|NRP2_uc010fud.2_Missense_Mutation_p.W216C	NM_201266	NP_957718	O60462	NRP2_HUMAN	neuropilin 2 isoform 1 precursor	216	Extracellular (Potential).|CUB 2.				angiogenesis|axon guidance|cell adhesion	integral to membrane|membrane fraction|plasma membrane	heparin binding|metal ion binding|semaphorin receptor activity|vascular endothelial growth factor receptor activity			skin(2)|ovary(1)|central_nervous_system(1)	4						TGGACATCTGGGATGGCATTC	0.478													14	23	---	---	---	---	PASS
INPP5D	3635	broad.mit.edu	37	2	234091109	234091109	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234091109G>C	uc010zmo.1	+	18	2278	c.2125G>C	c.(2125-2127)GAG>CAG	p.E709Q	INPP5D_uc010zmp.1_Missense_Mutation_p.E708Q	NM_001017915	NP_001017915	Q92835	SHIP1_HUMAN	SH2 containing inositol phosphatase isoform a	709					apoptosis|blood coagulation|leukocyte migration|T cell receptor signaling pathway	cytosol	inositol-polyphosphate 5-phosphatase activity|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|SH3 domain binding			ovary(1)|central_nervous_system(1)	2		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0273)|Acute lymphoblastic leukemia(138;0.0328)|Lung NSC(271;0.0843)		Epithelial(121;1.16e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000479)|LUSC - Lung squamous cell carcinoma(224;0.00655)|Lung(119;0.00802)|GBM - Glioblastoma multiforme(43;0.0185)		TGCCACATTTGAGGCAGGAGT	0.512													45	73	---	---	---	---	PASS
HDAC4	9759	broad.mit.edu	37	2	240048140	240048140	+	Intron	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:240048140C>A	uc002vyk.3	-						HDAC4_uc010fyz.1_Intron|HDAC4_uc010zoa.1_Intron|HDAC4_uc010fza.2_Intron|HDAC4_uc010fyy.2_Intron|HDAC4_uc010znz.1_Intron	NM_006037	NP_006028	P56524	HDAC4_HUMAN	histone deacetylase 4						B cell differentiation|cardiac muscle hypertrophy in response to stress|chromatin remodeling|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of glycolysis|negative regulation of myotube differentiation|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|nervous system development|peptidyl-lysine deacetylation|positive regulation of cell proliferation|positive regulation of protein sumoylation|positive regulation of sequence-specific DNA binding transcription factor activity|positive regulation of transcription from RNA polymerase II promoter|regulation of protein binding|response to denervation involved in regulation of muscle adaptation|response to interleukin-1|transcription, DNA-dependent	histone deacetylase complex|transcriptional repressor complex	activating transcription factor binding|histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|potassium ion binding|repressing transcription factor binding|zinc ion binding			breast(3)|skin(2)|ovary(1)	6		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		AGCGCTGAGCCGGCAAACCCA	0.438													20	32	---	---	---	---	PASS
GRM7	2917	broad.mit.edu	37	3	7348196	7348196	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:7348196C>G	uc003bqm.2	+	4	1164	c.890C>G	c.(889-891)GCA>GGA	p.A297G	GRM7_uc011ata.1_RNA|GRM7_uc011atb.1_RNA|GRM7_uc010hcf.2_RNA|GRM7_uc011atc.1_RNA|GRM7_uc010hcg.2_Missense_Mutation_p.A297G|GRM7_uc003bql.2_Missense_Mutation_p.A297G|GRM7_uc003bqn.1_5'UTR	NM_000844	NP_000835	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7 isoform a	297	Extracellular (Potential).				negative regulation of adenylate cyclase activity|negative regulation of cAMP biosynthetic process|negative regulation of glutamate secretion|sensory perception of smell|sensory perception of sound|synaptic transmission	asymmetric synapse|axon|cell cortex|dendritic shaft|integral to plasma membrane|postsynaptic membrane|presynaptic active zone	adenylate cyclase inhibitor activity|calcium ion binding|glutamate binding|group III metabotropic glutamate receptor activity|PDZ domain binding|serine binding			ovary(4)|lung(3)	7					L-Glutamic Acid(DB00142)	CAGATCCTTGCAGCAGCCAAA	0.438													39	80	---	---	---	---	PASS
TTLL3	26140	broad.mit.edu	37	3	9854643	9854643	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:9854643C>T	uc003btg.2	+	3	281	c.65C>T	c.(64-66)ACA>ATA	p.T22I	ARPC4_uc003btc.1_Intron|TTLL3_uc003btd.3_Missense_Mutation_p.T22I|TTLL3_uc003btf.3_5'UTR|TTLL3_uc010hco.1_5'Flank|TTLL3_uc003bth.3_5'Flank	NM_001025930	NP_001021100	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	22					axoneme assembly|cilium assembly|protein polyglycylation	cilium axoneme|cytoplasm|microtubule	protein-glycine ligase activity, initiating|tubulin-tyrosine ligase activity			large_intestine(2)	2	Medulloblastoma(99;0.227)					AAGATCTTTACAATCCAAGGC	0.428													31	48	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19574939	19574939	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19574939T>A	uc003cbk.1	+	16	2867	c.2672T>A	c.(2671-2673)GTG>GAG	p.V891E	KCNH8_uc010hex.1_Missense_Mutation_p.V352E	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	891	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						ATGAGAAATGTGATCCAGCTT	0.458													40	78	---	---	---	---	PASS
KCNH8	131096	broad.mit.edu	37	3	19574965	19574965	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:19574965T>A	uc003cbk.1	+	16	2893	c.2698T>A	c.(2698-2700)TCA>ACA	p.S900T	KCNH8_uc010hex.1_Missense_Mutation_p.S361T	NM_144633	NP_653234	Q96L42	KCNH8_HUMAN	potassium voltage-gated channel, subfamily H,	900	Cytoplasmic (Potential).					integral to membrane	two-component sensor activity			lung(4)|ovary(1)	5						AAACGTTCTGTCACCTCAGCA	0.493													40	73	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38888748	38888748	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38888748C>G	uc011ays.1	-	26	5012	c.4813G>C	c.(4813-4815)GAG>CAG	p.E1605Q		NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1605	IV.				response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	TTGAAGTTCTCTAAAATCACA	0.408													26	58	---	---	---	---	PASS
SCN11A	11280	broad.mit.edu	37	3	38904708	38904708	+	Missense_Mutation	SNP	T	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:38904708T>G	uc011ays.1	-	24	4233	c.4034A>C	c.(4033-4035)CAA>CCA	p.Q1345P	SCN11A_uc003cis.1_Missense_Mutation_p.Q10P	NM_014139	NP_054858	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha	1345					response to drug	voltage-gated sodium channel complex	voltage-gated sodium channel activity			skin(6)|ovary(1)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	9				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)	AATGGGTTTTTGAGGTTTTTT	0.368													13	30	---	---	---	---	PASS
MYRIP	25924	broad.mit.edu	37	3	40192641	40192641	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:40192641C>A	uc003cka.2	+	4	570	c.435C>A	c.(433-435)CAC>CAA	p.H145Q	MYRIP_uc010hhu.2_RNA|MYRIP_uc010hhv.2_Missense_Mutation_p.H145Q|MYRIP_uc010hhw.2_Intron|MYRIP_uc010hhx.1_Missense_Mutation_p.H145Q|MYRIP_uc011ayz.1_5'UTR	NM_015460	NP_056275	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	145	Myosin-binding.				intracellular protein transport		actin binding|zinc ion binding			ovary(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		ACAGGAAGCACCGGCTGGAGA	0.557													8	24	---	---	---	---	PASS
CCDC72	51372	broad.mit.edu	37	3	48481715	48481715	+	Silent	SNP	C	T	T	rs1058384		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48481715C>T	uc003cte.1	+	1	30	c.9C>T	c.(7-9)GGC>GGT	p.G3G	CCDC51_uc003csz.2_5'Flank|CCDC51_uc003cta.2_5'Flank|CCDC51_uc003ctb.2_5'Flank|CCDC51_uc003ctc.2_5'Flank|CCDC51_uc003ctd.2_5'Flank	NM_015933	NP_057017	Q9Y2S6	CCD72_HUMAN	coiled-coil domain containing 72	3											0				BRCA - Breast invasive adenocarcinoma(193;0.000286)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00605)		CCATGTCCGGCCGCGAAGGTA	0.716													20	55	---	---	---	---	PASS
CACNA1D	776	broad.mit.edu	37	3	53844043	53844043	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53844043G>A	uc003dgv.3	+	47	6073	c.5910G>A	c.(5908-5910)CAG>CAA	p.Q1970Q	CACNA1D_uc003dgu.3_Silent_p.Q1990Q|CACNA1D_uc003dgy.3_Silent_p.Q1946Q|CACNA1D_uc003dgw.3_Silent_p.Q1637Q|CACNA1D_uc011bes.1_RNA	NM_001128840	NP_001122312	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type,	1970	Cytoplasmic (Potential).				axon guidance|energy reserve metabolic process|regulation of insulin secretion	voltage-gated calcium channel complex	voltage-gated calcium channel activity			ovary(6)|upper_aerodigestive_tract(2)|liver(1)|central_nervous_system(1)|skin(1)	11				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Verapamil(DB00661)	GTAAAGCCCAGAAGTACTCAC	0.602													31	59	---	---	---	---	PASS
ACOX2	8309	broad.mit.edu	37	3	58502934	58502934	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:58502934G>A	uc003dkl.2	-	13	2024	c.1849C>T	c.(1849-1851)CGG>TGG	p.R617W		NM_003500	NP_003491	Q99424	ACOX2_HUMAN	acyl-Coenzyme A oxidase 2	617					bile acid biosynthetic process|fatty acid beta-oxidation using acyl-CoA oxidase	peroxisomal matrix	3alpha,7alpha,12alpha-trihydroxy-5beta-cholestanoyl-CoA 24-hydroxylase activity|acyl-CoA dehydrogenase activity|pristanoyl-CoA oxidase activity				0				BRCA - Breast invasive adenocarcinoma(55;0.000194)|Kidney(10;0.00255)|KIRC - Kidney renal clear cell carcinoma(10;0.00268)|OV - Ovarian serous cystadenocarcinoma(275;0.156)		GCCACTCACCGGATCAGGCGG	0.512													21	47	---	---	---	---	PASS
FRMD4B	23150	broad.mit.edu	37	3	69230202	69230202	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:69230202C>A	uc003dnv.2	-	21	2989	c.2699G>T	c.(2698-2700)CGT>CTT	p.R900L	FRMD4B_uc003dnw.2_RNA|FRMD4B_uc003dnu.2_Missense_Mutation_p.R552L|FRMD4B_uc011bga.1_Missense_Mutation_p.R744L	NM_015123	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	900						cytoplasm|cytoskeleton	binding			ovary(3)|central_nervous_system(1)	4		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		GTACCAGCCACGCAAGTGCTC	0.572													9	33	---	---	---	---	PASS
WDR5B	54554	broad.mit.edu	37	3	122134320	122134320	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:122134320G>A	uc003efa.1	-	1	563	c.56C>T	c.(55-57)GCC>GTC	p.A19V		NM_019069	NP_061942	Q86VZ2	WDR5B_HUMAN	WD repeat domain 5B	19										ovary(3)	3				GBM - Glioblastoma multiforme(114;0.0704)		GCTCTGATTGGCCGATGAGGA	0.498													35	95	---	---	---	---	PASS
COL29A1	256076	broad.mit.edu	37	3	130159471	130159471	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:130159471G>T	uc010htj.1	+	35	6783	c.6289G>T	c.(6289-6291)GTA>TTA	p.V2097L	COL29A1_uc010hti.1_RNA|COL29A1_uc010htk.1_Missense_Mutation_p.V136L	NM_153264	NP_694996	A8TX70	CO6A5_HUMAN	collagen, type XXIX, alpha 1	2097	VWFA 9.|Nonhelical region.				axon guidance|cell adhesion	collagen					0						AAAAGAATTTGTAAAAATGAT	0.408													7	40	---	---	---	---	PASS
ZBTB38	253461	broad.mit.edu	37	3	141161660	141161660	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141161660G>A	uc003etw.2	+	8	1412	c.430G>A	c.(430-432)GTT>ATT	p.V144I	ZBTB38_uc010hun.2_Missense_Mutation_p.V141I|ZBTB38_uc010huo.2_Missense_Mutation_p.V144I|ZBTB38_uc003ety.2_Missense_Mutation_p.V144I|ZBTB38_uc010hup.2_Missense_Mutation_p.V145I	NM_001080412	NP_001073881	Q8NAP3	ZBT38_HUMAN	zinc finger and BTB domain containing 38	144					positive regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(3)	3						AAAGGGAGTGGTTAAAGAAGA	0.388													12	54	---	---	---	---	PASS
GRK7	131890	broad.mit.edu	37	3	141526658	141526658	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:141526658C>G	uc011bnd.1	+	3	1306	c.1222C>G	c.(1222-1224)CTG>GTG	p.L408V		NM_139209	NP_631948	Q8WTQ7	GRK7_HUMAN	G-protein-coupled receptor kinase 7 precursor	408	Protein kinase.				visual perception	membrane	ATP binding|G-protein coupled receptor kinase activity|signal transducer activity			lung(2)|stomach(1)|ovary(1)|skin(1)	5						GCAAAGAACTCTGCAAGACGA	0.428													3	49	---	---	---	---	PASS
P2RY14	9934	broad.mit.edu	37	3	150931162	150931162	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:150931162T>C	uc003eyr.1	-	3	1421	c.943A>G	c.(943-945)AAA>GAA	p.K315E	MED12L_uc011bnz.1_Intron|MED12L_uc003eyp.2_Intron|P2RY14_uc003eys.1_Missense_Mutation_p.K315E	NM_001081455	NP_001074924	Q15391	P2Y14_HUMAN	P2Y14 receptor	315	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled|UDP-activated nucleotide receptor activity			large_intestine(2)|ovary(1)|lung(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTCTGAGCTTTTAATGGAATG	0.373													17	125	---	---	---	---	PASS
KNG1	3827	broad.mit.edu	37	3	186440248	186440248	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:186440248C>T	uc011bsa.1	+	3	541	c.329C>T	c.(328-330)ACC>ATC	p.T110I	KNG1_uc003fqr.2_Missense_Mutation_p.T110I	NM_001102416	NP_001095886	P01042	KNG1_HUMAN	kininogen 1 isoform 1	110	Cystatin 1.				blood coagulation, intrinsic pathway|elevation of cytosolic calcium ion concentration|inflammatory response|negative regulation of blood coagulation|negative regulation of cell adhesion|platelet activation|platelet degranulation|positive regulation of apoptosis|positive regulation of renal sodium excretion|positive regulation of urine volume|smooth muscle contraction|vasodilation	extracellular space|plasma membrane|platelet alpha granule lumen	cysteine-type endopeptidase inhibitor activity|heparin binding|receptor binding|zinc ion binding			skin(1)	1	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)	Ouabain(DB01092)	TGCACGGCAACCGTGGGGAAG	0.478													12	32	---	---	---	---	PASS
RTP4	64108	broad.mit.edu	37	3	187086299	187086299	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:187086299A>T	uc003frm.2	+	1	132	c.70A>T	c.(70-72)ACA>TCA	p.T24S		NM_022147	NP_071430	Q96DX8	RTP4_HUMAN	28kD interferon responsive protein	24	Cytoplasmic (Potential).				detection of chemical stimulus involved in sensory perception of bitter taste|protein targeting to membrane	cytoplasm|integral to membrane	protein binding				0	all_cancers(143;4.66e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		ACCCCGGGCCACATGGACGCT	0.493													21	112	---	---	---	---	PASS
LRRC33	375387	broad.mit.edu	37	3	196381479	196381479	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196381479C>T	uc003fwv.2	+	2	173	c.69C>T	c.(67-69)AGC>AGT	p.S23S		NM_198565	NP_940967	Q86YC3	LRC33_HUMAN	leucine rich repeat containing 33 precursor	23	Extracellular (Potential).					integral to membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;8.88e-09)|Ovarian(172;0.0634)|Breast(254;0.135)		Epithelial(36;1.9e-23)|all cancers(36;1.76e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.5e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00326)		GGAACAGAAGCGGAACAGCCA	0.577													10	105	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197410238	197410238	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197410238C>A	uc003fyc.2	-	13	2103	c.1920G>T	c.(1918-1920)ATG>ATT	p.M640I	KIAA0226_uc003fyd.3_Missense_Mutation_p.M595I|KIAA0226_uc003fye.1_Missense_Mutation_p.M372I	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.	640					autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		CTGGAAGCTGCATCCCCTCAA	0.617													17	55	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72634119	72634119	+	Missense_Mutation	SNP	T	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72634119T>G	uc003hge.2	-	3	313	c.160A>C	c.(160-162)AGT>CGT	p.S54R	GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Missense_Mutation_p.S54R|GC_uc010iif.2_Missense_Mutation_p.S73R	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	54	Albumin 1.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	AACGTGCCACTGGGAAATTTT	0.413													4	34	---	---	---	---	PASS
GC	2638	broad.mit.edu	37	4	72634120	72634120	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:72634120G>T	uc003hge.2	-	3	312	c.159C>A	c.(157-159)CCC>CCA	p.P53P	GC_uc003hgd.2_5'UTR|GC_uc010iie.2_Silent_p.P53P|GC_uc010iif.2_Silent_p.P72P	NM_000583	NP_000574	P02774	VTDB_HUMAN	vitamin D-binding protein precursor	53	Albumin 1.				hormone biosynthetic process|vitamin D metabolic process	cytosol|lysosomal lumen	actin binding|vitamin D binding|vitamin transporter activity			ovary(2)|upper_aerodigestive_tract(1)	3		all_hematologic(202;0.107)	Lung(101;0.148)		Cholecalciferol(DB00169)	ACGTGCCACTGGGAAATTTTC	0.408													4	35	---	---	---	---	PASS
NPFFR2	10886	broad.mit.edu	37	4	73013088	73013088	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:73013088G>C	uc003hgg.2	+	4	1226	c.1128G>C	c.(1126-1128)AAG>AAC	p.K376N	NPFFR2_uc010iig.1_Missense_Mutation_p.K158N|NPFFR2_uc003hgi.2_Missense_Mutation_p.K277N|NPFFR2_uc003hgh.2_Missense_Mutation_p.K274N|NPFFR2_uc003hgj.2_RNA	NM_004885	NP_004876	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2 isoform 1	376	Cytoplasmic (Potential).				detection of abiotic stimulus	actin cytoskeleton|integral to plasma membrane	neuropeptide receptor activity			ovary(2)|central_nervous_system(1)	3			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			AGATCATTAAGATGCTCCTGA	0.502													23	64	---	---	---	---	PASS
FAM13A	10144	broad.mit.edu	37	4	89859339	89859339	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:89859339A>G	uc003hse.1	-	5	867	c.659T>C	c.(658-660)ATG>ACG	p.M220T	FAM13A_uc003hsf.1_Missense_Mutation_p.M11T|FAM13A_uc003hsh.1_Missense_Mutation_p.M34T	NM_014883	NP_055698	O94988	FA13A_HUMAN	family with sequence similarity 13, member A1	220	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity			ovary(1)|liver(1)	2						AATTTTAGCCATTATCTTGTT	0.378													23	57	---	---	---	---	PASS
ANK2	287	broad.mit.edu	37	4	114278337	114278337	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114278337G>C	uc003ibe.3	+	38	8663	c.8563G>C	c.(8563-8565)GTA>CTA	p.V2855L	ANK2_uc003ibd.3_Intron|ANK2_uc003ibf.3_Intron|ANK2_uc011cgc.1_Intron|ANK2_uc003ibg.3_Intron|ANK2_uc003ibh.3_Intron|ANK2_uc011cgd.1_Missense_Mutation_p.V157L|ANK2_uc011cgb.1_Missense_Mutation_p.V2870L	NM_001148	NP_001139	Q01484	ANK2_HUMAN	ankyrin 2 isoform 1	2822					axon guidance|signal transduction	apical plasma membrane|basolateral plasma membrane|cytoskeleton|cytosol|sarcomere	protein binding|protein binding			central_nervous_system(7)|ovary(3)|large_intestine(2)|breast(1)|skin(1)	14		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TCATTGTTTGGTATCTGAAGG	0.388													27	63	---	---	---	---	PASS
CAMK2D	817	broad.mit.edu	37	4	114375662	114375662	+	3'UTR	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:114375662T>A	uc003ibi.2	-	19					CAMK2D_uc003ibj.2_3'UTR|CAMK2D_uc003ibk.2_3'UTR|CAMK2D_uc003ibo.3_3'UTR	NM_001221	NP_001212	Q13557	KCC2D_HUMAN	calcium/calmodulin-dependent protein kinase II						interferon-gamma-mediated signaling pathway|regulation of cell growth|synaptic transmission	calcium- and calmodulin-dependent protein kinase complex|cytosol|endocytic vesicle membrane|nucleoplasm|plasma membrane	ATP binding|calmodulin binding|calmodulin-dependent protein kinase activity			ovary(1)	1		Ovarian(17;0.00369)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000271)		GTGGCACTGTTGAAATTTAGC	0.423													34	54	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158224787	158224787	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158224787G>T	uc003ipm.3	+	3	772	c.313G>T	c.(313-315)GGA>TGA	p.G105*	GRIA2_uc011cit.1_Nonsense_Mutation_p.G58*|GRIA2_uc003ipl.3_Nonsense_Mutation_p.G105*|GRIA2_uc003ipk.3_Nonsense_Mutation_p.G58*|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	105	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	ATCATTTTGCGGAACACTCCA	0.438													72	154	---	---	---	---	PASS
DDX60L	91351	broad.mit.edu	37	4	169348231	169348231	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:169348231G>C	uc003irq.3	-	14	2141	c.1920C>G	c.(1918-1920)TGC>TGG	p.C640W	DDX60L_uc003irr.1_Missense_Mutation_p.C640W|DDX60L_uc003irs.1_Missense_Mutation_p.C367W	NM_001012967	NP_001012985	Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	640							ATP binding|ATP-dependent helicase activity|RNA binding			ovary(1)	1		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		CTTCACCTCGGCAATGTTTTT	0.284													10	13	---	---	---	---	PASS
NEIL3	55247	broad.mit.edu	37	4	178272639	178272639	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:178272639G>T	uc003iut.2	+	7	1092	c.975G>T	c.(973-975)GTG>GTT	p.V325V	NEIL3_uc010irs.2_Intron	NM_018248	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3	325	RanBP2-type.				base-excision repair|nucleotide-excision repair	nucleus	bubble DNA binding|damaged DNA binding|DNA N-glycosylase activity|DNA-(apurinic or apyrimidinic site) lyase activity|double-stranded DNA binding|single-stranded DNA binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		CCTGTGTGGTGTGTACTTTAA	0.428								BER_DNA_glycosylases					52	102	---	---	---	---	PASS
IL7R	3575	broad.mit.edu	37	5	35861032	35861032	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:35861032C>T	uc003jjs.2	+	2	250	c.161C>T	c.(160-162)TCA>TTA	p.S54L	IL7R_uc011coo.1_Missense_Mutation_p.S54L|IL7R_uc011cop.1_RNA	NM_002185	NP_002176	P16871	IL7RA_HUMAN	interleukin 7 receptor precursor	54	Extracellular (Potential).				immune response|regulation of DNA recombination	extracellular region|integral to membrane	antigen binding|interleukin-7 receptor activity			ovary(3)|breast(1)|skin(1)	5	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TCGCAGCACTCACTGACCTGT	0.458													35	178	---	---	---	---	PASS
SLC30A5	64924	broad.mit.edu	37	5	68423946	68423946	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:68423946G>C	uc003jvh.2	+	15	2315	c.2114G>C	c.(2113-2115)AGA>ACA	p.R705T	SLC30A5_uc003jvj.2_RNA|SLC30A5_uc003jvk.2_Intron	NM_022902	NP_075053	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter),	705	Cytoplasmic (Potential).				cellular zinc ion homeostasis|cobalt ion transport|regulation of proton transport|response to zinc ion	apical plasma membrane|Golgi apparatus|integral to plasma membrane|membrane fraction|secretory granule membrane	zinc ion binding|zinc ion transmembrane transporter activity			central_nervous_system(1)	1		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		CTAGAACAAAGAATAGTACAG	0.353													29	74	---	---	---	---	PASS
RGMB	285704	broad.mit.edu	37	5	98129295	98129295	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:98129295T>A	uc003knc.2	+	5	1677	c.1275T>A	c.(1273-1275)TTT>TTA	p.F425L		NM_001012761	NP_001012779	Q6NW40	RGMB_HUMAN	RGM domain family, member B	384					axon guidance|BMP signaling pathway|cell adhesion|positive regulation of transcription, DNA-dependent	anchored to plasma membrane|ER-Golgi intermediate compartment|membrane raft	identical protein binding				0		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		ATGCCAACTTTACTGCCGCAG	0.562													24	27	---	---	---	---	PASS
YTHDC2	64848	broad.mit.edu	37	5	112878128	112878128	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:112878128G>T	uc003kqn.2	+	10	1606	c.1423G>T	c.(1423-1425)GAT>TAT	p.D475Y	YTHDC2_uc010jce.1_Missense_Mutation_p.D475Y|YTHDC2_uc010jcf.1_Missense_Mutation_p.D175Y	NM_022828	NP_073739	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	475							ATP binding|ATP-dependent helicase activity|nucleic acid binding			skin(2)|central_nervous_system(1)	3		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		TTGCCTTTCTGATATATGGCT	0.274													74	89	---	---	---	---	PASS
SEMA6A	57556	broad.mit.edu	37	5	115782854	115782854	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:115782854G>A	uc010jck.2	-	19	3257	c.2548C>T	c.(2548-2550)CTG>TTG	p.L850L	SEMA6A_uc003krx.3_Silent_p.L867L|SEMA6A_uc011cwe.1_Silent_p.L229L|SEMA6A_uc003krv.3_Silent_p.L277L|SEMA6A_uc003krw.3_Silent_p.L327L|SEMA6A_uc010jcj.2_Silent_p.L394L	NM_020796	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and	850	Cytoplasmic (Potential).				apoptosis|axon guidance|cell surface receptor linked signaling pathway|cytoskeleton organization|organ morphogenesis	axon|integral to membrane|plasma membrane	receptor activity			ovary(2)	2		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		TTATACTCCAGTGTGGCGGCC	0.592													16	324	---	---	---	---	PASS
PRR16	51334	broad.mit.edu	37	5	120021833	120021833	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:120021833C>T	uc003ksq.2	+	2	507	c.344C>T	c.(343-345)ACG>ATG	p.T115M	PRR16_uc003ksp.2_Missense_Mutation_p.T92M|PRR16_uc003ksr.2_Missense_Mutation_p.T45M	NM_016644	NP_057728	Q569H4	PRR16_HUMAN	proline rich 16	115	Pro-rich.									pancreas(2)|ovary(1)	3		all_cancers(142;0.0464)|Prostate(80;0.00446)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.000126)|Epithelial(69;0.000331)|all cancers(49;0.00169)		GCTATCCTCACGGTCCTGAGA	0.522													36	65	---	---	---	---	PASS
PCDHA7	56141	broad.mit.edu	37	5	140216019	140216019	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140216019T>C	uc003lhq.2	+	1	2051	c.2051T>C	c.(2050-2052)TTG>TCG	p.L684S	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc011dac.1_Missense_Mutation_p.L684S	NM_018910	NP_061733	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7 isoform 1 precursor	684	Extracellular (Potential).				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding|protein binding			ovary(2)|skin(2)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGGCATCGTTGGGCATTGCA	0.637													42	50	---	---	---	---	PASS
PCDHA9	9752	broad.mit.edu	37	5	140228176	140228176	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140228176C>A	uc003lhu.2	+	1	820	c.96C>A	c.(94-96)CAC>CAA	p.H32Q	PCDHA1_uc003lha.2_Intron|PCDHA1_uc003lhb.2_Intron|PCDHA2_uc003lhd.2_Intron|PCDHA3_uc003lhf.2_Intron|PCDHA4_uc003lhi.2_Intron|PCDHA4_uc003lhh.1_Intron|PCDHA5_uc003lhk.1_Intron|PCDHA5_uc003lhl.2_Intron|PCDHA6_uc003lhn.2_Intron|PCDHA6_uc003lho.2_Intron|PCDHA7_uc003lhq.2_Intron|PCDHA8_uc003lhs.2_Intron|PCDHA9_uc003lht.1_Missense_Mutation_p.H32Q	NM_031857	NP_114063	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9 isoform 1 precursor	32	Cadherin 1.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding|protein binding			large_intestine(2)|ovary(2)|skin(1)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCAGCTCCACTACTCCGTCC	0.627													45	70	---	---	---	---	PASS
PCDHB12	56124	broad.mit.edu	37	5	140590115	140590115	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140590115C>A	uc003liz.2	+	1	1825	c.1636C>A	c.(1636-1638)CTG>ATG	p.L546M	PCDHB12_uc011dak.1_Missense_Mutation_p.L209M	NM_018932	NP_061755	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12 precursor	546	Extracellular (Potential).|Cadherin 5.				homophilic cell adhesion|nervous system development	integral to plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CAGCGAGGCGCTGGTGCGCGT	0.697													25	40	---	---	---	---	PASS
PCDHB13	56123	broad.mit.edu	37	5	140595204	140595204	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140595204G>T	uc003lja.1	+	1	1696	c.1509G>T	c.(1507-1509)CTG>CTT	p.L503L		NM_018933	NP_061756	Q9Y5F0	PCDBD_HUMAN	protocadherin beta 13 precursor	503	Extracellular (Potential).|Cadherin 5.				calcium-dependent cell-cell adhesion|homophilic cell adhesion|synapse assembly|synaptic transmission	integral to membrane|plasma membrane	calcium ion binding			skin(2)|ovary(1)	3			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCACATCCCTGGTCTCCATCA	0.662													60	93	---	---	---	---	PASS
HAND1	9421	broad.mit.edu	37	5	153857226	153857226	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:153857226C>A	uc003lvn.2	-	1	599	c.343G>T	c.(343-345)GCG>TCG	p.A115S		NM_004821	NP_004812	O96004	HAND1_HUMAN	basic helix-loop-helix transcription factor	115	Helix-loop-helix motif.				angiogenesis|cardiac left ventricle formation|cardiac right ventricle formation|cardiac septum morphogenesis|heart looping|negative regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|transcription from RNA polymerase II promoter|trophectodermal cell differentiation|ventricular cardiac muscle tissue morphogenesis	cytoplasm|nucleolus|nucleoplasm	bHLH transcription factor binding|DNA binding|protein homodimerization activity|transcription coactivator activity				0	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			CGCAACTCCGCGAATGCGCTG	0.642													7	48	---	---	---	---	PASS
RMND5B	64777	broad.mit.edu	37	5	177570966	177570966	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:177570966G>A	uc003mim.2	+	7	731	c.551G>A	c.(550-552)CGC>CAC	p.R184H	RMND5B_uc003min.2_Missense_Mutation_p.R184H|RMND5B_uc003mio.2_Missense_Mutation_p.R171H|RMND5B_uc003mip.2_Missense_Mutation_p.R184H|RMND5B_uc011dgf.1_Missense_Mutation_p.R225H|RMND5B_uc003miq.2_Missense_Mutation_p.R124H	NM_022762	NP_073599	Q96G75	RMD5B_HUMAN	required for meiotic nuclear division 5 homolog	184	CTLH.									ovary(1)|skin(1)	2	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACAGGCAGCGCCTGCTGGAA	0.642													5	80	---	---	---	---	PASS
ZNF454	285676	broad.mit.edu	37	5	178392396	178392396	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:178392396A>C	uc003mjo.1	+	5	1262	c.991A>C	c.(991-993)AAT>CAT	p.N331H	ZNF454_uc010jkz.1_Missense_Mutation_p.N331H	NM_182594	NP_872400	Q8N9F8	ZN454_HUMAN	zinc finger protein 454	331	C2H2-type 6.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|lung(1)	3	all_cancers(89;0.000904)|Renal(175;0.000159)|all_epithelial(37;0.000167)|Lung NSC(126;0.00199)|all_lung(126;0.00351)	all_cancers(40;0.225)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.234)		CTATAAATGCAATGAATGTGG	0.398													17	27	---	---	---	---	PASS
BTNL3	10917	broad.mit.edu	37	5	180420135	180420135	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180420135G>A	uc003mmr.2	+	2	500	c.372G>A	c.(370-372)GAG>GAA	p.E124E		NM_197975	NP_932079	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3 precursor	124	Extracellular (Potential).				lipid metabolic process	integral to membrane					0	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			ACGATGAGGAGGCCACCTGGG	0.483													4	2	---	---	---	---	PASS
SERPINB9	5272	broad.mit.edu	37	6	2896288	2896288	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:2896288G>A	uc003mug.2	-	3	426	c.305C>T	c.(304-306)TCA>TTA	p.S102L	uc003mue.2_Intron	NM_004155	NP_004146	P50453	SPB9_HUMAN	serpin peptidase inhibitor, clade B, member 9	102					anti-apoptosis|cellular response to estrogen stimulus|immune response|mast cell mediated immunity|regulation of proteolysis	cytosol|extracellular space|nucleus	caspase inhibitor activity|protease binding|serine-type endopeptidase inhibitor activity				0	Ovarian(93;0.0412)	all_hematologic(90;0.108)				TCAACTTACTGAGAGGAACTG	0.418													6	59	---	---	---	---	PASS
HIST1H4B	8366	broad.mit.edu	37	6	26027273	26027273	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26027273C>A	uc003nfr.2	-	1	208	c.208G>T	c.(208-210)GCC>TCC	p.A70S		NM_003544	NP_003535	P62805	H4_HUMAN	histone cluster 1, H4b	70					CenH3-containing nucleosome assembly at centromere|negative regulation of megakaryocyte differentiation|phosphatidylinositol-mediated signaling|telomere maintenance	nucleoplasm|nucleosome	DNA binding|protein binding			ovary(2)	2						TAGGTCACGGCGTCCCGGATC	0.577											OREG0017238	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	63	---	---	---	---	PASS
HIST1H2BF	8343	broad.mit.edu	37	6	26200113	26200113	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26200113G>C	uc003ngx.2	+	1	327	c.327G>C	c.(325-327)AAG>AAC	p.K109N	HIST1H3D_uc003ngv.2_5'Flank|HIST1H2AD_uc003ngw.2_5'Flank	NM_003522	NP_003513	P62807	H2B1C_HUMAN	histone cluster 1, H2bf	109					defense response to bacterium|nucleosome assembly	nucleosome|nucleus	DNA binding|protein binding				0		all_hematologic(11;0.196)				AGCTGGCTAAGCACGCCGTGT	0.587													13	74	---	---	---	---	PASS
MDC1	9656	broad.mit.edu	37	6	30668371	30668371	+	Silent	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:30668371A>C	uc003nrg.3	-	15	6581	c.6141T>G	c.(6139-6141)CCT>CCG	p.P2047P	MDC1_uc003nrf.3_Silent_p.P678P	NM_014641	NP_055456	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	2047	Required for nuclear localization (NLS2).|BRCT 2.				cell cycle|double-strand break repair via homologous recombination|intra-S DNA damage checkpoint	focal adhesion|nucleoplasm	FHA domain binding|protein C-terminus binding			breast(2)|ovary(1)|kidney(1)	4						TGGAGCAATGAGGGAAGTCCT	0.542								Other_conserved_DNA_damage_response_genes					7	101	---	---	---	---	PASS
TNXB	7148	broad.mit.edu	37	6	32014025	32014025	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32014025C>G	uc003nzl.2	-	31	10729	c.10527G>C	c.(10525-10527)AAG>AAC	p.K3509N	TNXB_uc003nzg.1_5'Flank|TNXB_uc003nzh.1_5'UTR	NM_019105	NP_061978	P22105	TENX_HUMAN	tenascin XB isoform 1 precursor	3556	Fibronectin type-III 27.				actin cytoskeleton organization|cell adhesion|collagen metabolic process|elastic fiber assembly|signal transduction	extracellular space|intracellular|proteinaceous extracellular matrix	heparin binding|integrin binding				0						ACTTGTATTTCTTGCCAGGCT	0.632													21	58	---	---	---	---	PASS
NOTCH4	4855	broad.mit.edu	37	6	32188918	32188918	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32188918A>T	uc003obb.2	-	4	775	c.636T>A	c.(634-636)CAT>CAA	p.H212Q	NOTCH4_uc011dpu.1_RNA|NOTCH4_uc011dpv.1_RNA|NOTCH4_uc003obc.2_Missense_Mutation_p.H212Q	NM_004557	NP_004548	Q99466	NOTC4_HUMAN	notch4 preproprotein	212	EGF-like 5; calcium-binding (Potential).|Extracellular (Potential).				cell fate determination|embryo development|hemopoiesis|mammary gland development|negative regulation of endothelial cell differentiation|Notch receptor processing|Notch signaling pathway|patterning of blood vessels|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cell surface|cytosol|endoplasmic reticulum lumen|extracellular region|Golgi lumen|integral to plasma membrane|nucleoplasm	calcium ion binding|protein heterodimerization activity|receptor activity			lung(8)|ovary(5)|breast(4)|central_nervous_system(3)|upper_aerodigestive_tract(1)|skin(1)	22						CCAGGGTGTTATGGCAGGAGG	0.647													8	50	---	---	---	---	PASS
COL11A2	1302	broad.mit.edu	37	6	33147224	33147224	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:33147224C>A	uc003ocx.1	-	14	1715	c.1487G>T	c.(1486-1488)GGG>GTG	p.G496V	COL11A2_uc010jul.1_5'Flank|COL11A2_uc003ocy.1_Missense_Mutation_p.G410V|COL11A2_uc003ocz.1_Missense_Mutation_p.G389V	NM_080680	NP_542411	P13942	COBA2_HUMAN	collagen, type XI, alpha 2 isoform 1	496	Triple-helical region.				cartilage development|cell adhesion|collagen fibril organization|sensory perception of sound|soft palate development	collagen type XI	extracellular matrix structural constituent conferring tensile strength|protein binding, bridging			ovary(3)|skin(2)	5						TCCAGGGCGCCCTGTGTATCC	0.637													4	8	---	---	---	---	PASS
TBCC	6903	broad.mit.edu	37	6	42713446	42713446	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:42713446C>A	uc003osl.2	-	1	439	c.366G>T	c.(364-366)GCG>GCT	p.A122A		NM_003192	NP_003183	Q15814	TBCC_HUMAN	beta-tubulin cofactor C	122					'de novo' posttranslational protein folding|post-chaperonin tubulin folding pathway	cytoplasm|microtubule|photoreceptor connecting cilium	chaperone binding|GTPase activity				0	Colorectal(47;0.196)		all cancers(41;0.00122)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.125)			CGGCCAAGGCCGCCTGCAGCC	0.627													6	56	---	---	---	---	PASS
ENPP4	22875	broad.mit.edu	37	6	46107655	46107655	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:46107655G>C	uc003oxy.2	+	2	594	c.335G>C	c.(334-336)TGG>TCG	p.W112S		NM_014936	NP_055751	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase	112	Extracellular (Potential).					integral to membrane	hydrolase activity			ovary(3)|skin(1)	4						GATCCTTTTTGGTGGAATGAG	0.438													16	109	---	---	---	---	PASS
TFAP2D	83741	broad.mit.edu	37	6	50697018	50697018	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:50697018G>T	uc003paf.2	+	5	1388	c.876G>T	c.(874-876)TTG>TTT	p.L292F	TFAP2D_uc011dwt.1_RNA	NM_172238	NP_758438	Q7Z6R9	AP2D_HUMAN	transcription factor AP-2 beta-like 1	292	H-S-H (helix-span-helix), dimerization.						DNA binding|sequence-specific DNA binding transcription factor activity	p.L292F(1)		ovary(6)|breast(1)	7	Lung NSC(77;0.0334)					TTACTTCCTTGGTTGAAGGTA	0.423													23	168	---	---	---	---	PASS
FAM83B	222584	broad.mit.edu	37	6	54804947	54804947	+	Missense_Mutation	SNP	A	G	G	rs28592584		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:54804947A>G	uc003pck.2	+	5	1294	c.1178A>G	c.(1177-1179)CAG>CGG	p.Q393R		NM_001010872	NP_001010872	Q5T0W9	FA83B_HUMAN	hypothetical protein LOC222584	393										ovary(6)	6	Lung NSC(77;0.0178)|Renal(3;0.122)					GCTGGGGAACAGCCAGAAACA	0.418													11	117	---	---	---	---	PASS
POPDC3	64208	broad.mit.edu	37	6	105609428	105609428	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:105609428C>T	uc003prb.2	-	2	759	c.357G>A	c.(355-357)CTG>CTA	p.L119L	uc003pqz.2_Intron|POPDC3_uc003pra.2_Intron	NM_022361	NP_071756	Q9HBV1	POPD3_HUMAN	popeye protein 3	119						integral to membrane				skin(3)|ovary(2)	5		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				AAGAGATCCCCAGGGGCTGGA	0.448													20	137	---	---	---	---	PASS
RWDD1	51389	broad.mit.edu	37	6	116906012	116906012	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:116906012G>C	uc003pxd.2	+	3	425	c.262G>C	c.(262-264)GCA>CCA	p.A88P	RWDD1_uc003pxb.2_5'UTR|RWDD1_uc003pxc.2_5'UTR	NM_015952	NP_057036	Q9H446	RWDD1_HUMAN	RWD domain containing 1 isoform a	88	RWD.						protein binding			ovary(2)|central_nervous_system(1)	3		all_cancers(87;0.0314)|all_epithelial(87;0.0216)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.026)|all cancers(137;0.0312)|OV - Ovarian serous cystadenocarcinoma(136;0.0689)|Epithelial(106;0.161)		AAAATTACTAGCATTACAGGT	0.284													4	38	---	---	---	---	PASS
PNLDC1	154197	broad.mit.edu	37	6	160240058	160240058	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160240058G>C	uc003qsx.1	+	17	1476	c.1305G>C	c.(1303-1305)GAG>GAC	p.E435D	PNLDC1_uc003qsy.1_Missense_Mutation_p.E446D	NM_173516	NP_775787	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain	435	Cytoplasmic (Potential).					integral to membrane|nucleus	nucleic acid binding				0		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		GGGTCAGCGAGCAGCAAGTCT	0.468													17	94	---	---	---	---	PASS
THSD7A	221981	broad.mit.edu	37	7	11441494	11441494	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:11441494G>T	uc003ssf.3	-	22	4591	c.4339C>A	c.(4339-4341)CCG>ACG	p.P1447T		NM_015204	NP_056019	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1447	Extracellular (Potential).|TSP type-1 15.					integral to membrane				ovary(3)	3				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		ATAATCACCGGTCTGGATCTG	0.448										HNSCC(18;0.044)			22	72	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13946086	13946086	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13946086C>A	uc011jxq.1	-	12	1818	c.1079G>T	c.(1078-1080)GGC>GTC	p.G360V	ETV1_uc011jxn.1_Missense_Mutation_p.G320V|ETV1_uc011jxo.1_Missense_Mutation_p.G257V|ETV1_uc011jxp.1_Missense_Mutation_p.G302V|ETV1_uc003ssw.3_Missense_Mutation_p.G337V|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.G342V|ETV1_uc011jxs.1_Missense_Mutation_p.G342V|ETV1_uc010ktv.2_3'UTR	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	360	ETS.				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						AAATTCCATGCCTCGACCAGT	0.398			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								10	25	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13946087	13946087	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13946087C>A	uc011jxq.1	-	12	1817	c.1078G>T	c.(1078-1080)GGC>TGC	p.G360C	ETV1_uc011jxn.1_Missense_Mutation_p.G320C|ETV1_uc011jxo.1_Missense_Mutation_p.G257C|ETV1_uc011jxp.1_Missense_Mutation_p.G302C|ETV1_uc003ssw.3_Missense_Mutation_p.G337C|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Missense_Mutation_p.G342C|ETV1_uc011jxs.1_Missense_Mutation_p.G342C|ETV1_uc010ktv.2_3'UTR	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	360	ETS.				transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						AATTCCATGCCTCGACCAGTC	0.398			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								9	25	---	---	---	---	PASS
MACC1	346389	broad.mit.edu	37	7	20199737	20199737	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:20199737G>T	uc003sus.3	-	5	556	c.247C>A	c.(247-249)CAA>AAA	p.Q83K	MACC1_uc010kug.2_Missense_Mutation_p.Q83K	NM_182762	NP_877439	Q6ZN28	MACC1_HUMAN	putative binding protein 7a5	83					positive regulation of cell division|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	growth factor activity			ovary(2)|skin(1)	3						TTTCTTAGTTGAGTTATGTCA	0.353													7	59	---	---	---	---	PASS
SP4	6671	broad.mit.edu	37	7	21469531	21469531	+	Nonsense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21469531C>T	uc003sva.2	+	3	929	c.748C>T	c.(748-750)CAG>TAG	p.Q250*	SP4_uc003svb.2_5'UTR	NM_003112	NP_003103	Q02446	SP4_HUMAN	Sp4 transcription factor	250					regulation of transcription from RNA polymerase II promoter	nucleus	DNA binding|transcription coactivator activity|zinc ion binding			ovary(3)|skin(2)	5						TCCTGGTACTCAGGCTCAAGT	0.478													13	63	---	---	---	---	PASS
CDCA7L	55536	broad.mit.edu	37	7	21951383	21951383	+	Intron	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21951383G>C	uc010kuk.2	-						CDCA7L_uc003sve.3_Intron|CDCA7L_uc010kul.2_Intron|CDCA7L_uc003svf.3_Intron|CDCA7L_uc011jyk.1_Intron	NM_018719	NP_061189	Q96GN5	CDA7L_HUMAN	cell division cycle associated 7-like isoform 1						positive regulation of cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleolus					0						CTAAATTAAAGACAcacatac	0.194													15	31	---	---	---	---	PASS
CRHR2	1395	broad.mit.edu	37	7	30695252	30695252	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30695252C>T	uc003tbn.2	-	10	1241	c.997G>A	c.(997-999)GAC>AAC	p.D333N	CRHR2_uc010kvw.1_Missense_Mutation_p.D333N|CRHR2_uc010kvx.1_Missense_Mutation_p.D332N|CRHR2_uc010kvy.1_Missense_Mutation_p.D169N|CRHR2_uc003tbo.2_Missense_Mutation_p.D319N|CRHR2_uc003tbp.2_Missense_Mutation_p.D360N	NM_001883	NP_001874	Q13324	CRFR2_HUMAN	corticotropin releasing hormone receptor 2	333	Extracellular (Potential).				G-protein signaling, coupled to cAMP nucleotide second messenger	integral to plasma membrane	corticotrophin-releasing factor receptor activity|protein binding			lung(2)|ovary(1)|skin(1)	4						GACAGGTCGTCCTCCCCGGGA	0.597													26	164	---	---	---	---	PASS
CCDC129	223075	broad.mit.edu	37	7	31683478	31683478	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31683478T>C	uc003tcj.1	+	11	3487	c.2494T>C	c.(2494-2496)TGC>CGC	p.C832R	CCDC129_uc011kad.1_Missense_Mutation_p.C842R|CCDC129_uc003tci.1_Missense_Mutation_p.C683R|CCDC129_uc011kae.1_Missense_Mutation_p.C858R|CCDC129_uc003tck.1_Missense_Mutation_p.C740R	NM_194300	NP_919276	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	832	Cys-rich.										0						CTGTAGGCACTGCCTGTGTTC	0.552													33	60	---	---	---	---	PASS
HECW1	23072	broad.mit.edu	37	7	43594272	43594272	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:43594272T>A	uc003tid.1	+	29	5197	c.4592T>A	c.(4591-4593)CTG>CAG	p.L1531Q	HECW1_uc011kbi.1_Missense_Mutation_p.L1497Q	NM_015052	NP_055867	Q76N89	HECW1_HUMAN	NEDD4-like ubiquitin-protein ligase 1	1531	HECT.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	ubiquitin-protein ligase activity			ovary(8)|lung(6)|breast(4)|skin(4)|pancreas(1)	23						CTGAGATTACTGCAGTTTGTC	0.552													6	31	---	---	---	---	PASS
SEPT14	346288	broad.mit.edu	37	7	55912272	55912272	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:55912272C>G	uc003tqz.2	-	4	432	c.315G>C	c.(313-315)TTG>TTC	p.L105F		NM_207366	NP_997249	Q6ZU15	SEP14_HUMAN	septin 14	105					cell cycle|cell division	septin complex	GTP binding|protein binding				0	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CAGTCAATTTCAACTGAACAT	0.313													531	241	---	---	---	---	PASS
TYW1	55253	broad.mit.edu	37	7	66489962	66489962	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:66489962G>A	uc003tvn.2	+	7	1086	c.937G>A	c.(937-939)GAT>AAT	p.D313N	TYW1_uc010lai.2_RNA	NM_018264	NP_060734	Q9NV66	TYW1_HUMAN	radical S-adenosyl methionine and flavodoxin	313					tRNA processing		4 iron, 4 sulfur cluster binding|FMN binding|iron ion binding|oxidoreductase activity			skin(1)	1		Lung NSC(55;0.0846)|all_lung(88;0.183)				TTCCATTGTTGATGTTGAAGA	0.418													32	657	---	---	---	---	PASS
ZNF804B	219578	broad.mit.edu	37	7	88966163	88966163	+	Silent	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:88966163A>T	uc011khi.1	+	4	4405	c.3867A>T	c.(3865-3867)ACA>ACT	p.T1289T		NM_181646	NP_857597	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	1289						intracellular	zinc ion binding			ovary(5)|skin(3)|pancreas(2)|upper_aerodigestive_tract(1)	11	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			TGCCCCCTACAGCATTTATTC	0.463										HNSCC(36;0.09)			40	171	---	---	---	---	PASS
TAC1	6863	broad.mit.edu	37	7	97362024	97362024	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:97362024T>A	uc003uop.3	+	2	346	c.100T>A	c.(100-102)TGG>AGG	p.W34R	TAC1_uc003uoq.3_Missense_Mutation_p.W34R|TAC1_uc003uor.3_Missense_Mutation_p.W34R|TAC1_uc003uos.3_Missense_Mutation_p.W34R	NM_003182	NP_003173	P20366	TKN1_HUMAN	tachykinin 1 isoform beta precursor	34					detection of abiotic stimulus|elevation of cytosolic calcium ion concentration|insemination|neuropeptide signaling pathway|synaptic transmission|tachykinin receptor signaling pathway	extracellular space					0	all_cancers(62;3.95e-09)|all_epithelial(64;1.1e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0358)|all_lung(186;0.0384)				Bacitracin(DB00626)	CTGGTCCGACTGGTACGACAG	0.552													21	104	---	---	---	---	PASS
ZNF789	285989	broad.mit.edu	37	7	99084537	99084537	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99084537G>C	uc003uqq.1	+	5	923	c.704G>C	c.(703-705)GGG>GCG	p.G235A	ZNF789_uc010lfw.1_Missense_Mutation_p.G140A|ZNF789_uc003uqr.1_Missense_Mutation_p.G177A	NM_213603	NP_998768	Q5FWF6	ZN789_HUMAN	zinc finger protein 789 isoform 1	235	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					AAGGTCTGTGGGCAAGCCTTC	0.438													26	197	---	---	---	---	PASS
ZAN	7455	broad.mit.edu	37	7	100389710	100389710	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100389710C>A	uc003uwj.2	+	42	7817	c.7652C>A	c.(7651-7653)GCA>GAA	p.A2551E	ZAN_uc003uwk.2_Missense_Mutation_p.A2551E|ZAN_uc003uwl.2_RNA|ZAN_uc010lhh.2_RNA|ZAN_uc010lhi.2_RNA|ZAN_uc011kke.1_Missense_Mutation_p.Q544K	NM_003386	NP_003377	Q9Y493	ZAN_HUMAN	zonadhesin isoform 3	2551	Extracellular (Potential).				binding of sperm to zona pellucida|cell-cell adhesion	integral to membrane|plasma membrane				ovary(4)|large_intestine(3)|central_nervous_system(2)|pancreas(2)	11	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			AGGGTGCTGGCAGACCCCCAG	0.672													6	18	---	---	---	---	PASS
PLOD3	8985	broad.mit.edu	37	7	100854987	100854987	+	Missense_Mutation	SNP	C	A	A	rs144508814		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100854987C>A	uc003uyd.2	-	12	1699	c.1243G>T	c.(1243-1245)GCC>TCC	p.A415S	PLOD3_uc010lhs.2_5'UTR	NM_001084	NP_001075	O60568	PLOD3_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase	415					protein modification process	rough endoplasmic reticulum membrane	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|procollagen-lysine 5-dioxygenase activity|protein binding			ovary(1)|skin(1)	2	Lung NSC(181;0.168)|all_lung(186;0.215)				Succinic acid(DB00139)|Vitamin C(DB00126)	AGCATGGGGGCGATCACCTTC	0.701													5	7	---	---	---	---	PASS
FAM3C	10447	broad.mit.edu	37	7	121000093	121000093	+	Intron	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121000093A>G	uc003vjx.2	-						FAM3C_uc010lkm.2_Intron	NM_014888	NP_055703	Q92520	FAM3C_HUMAN	family with sequence similarity 3, member C						multicellular organismal development	cytoplasmic membrane-bounded vesicle|extracellular region	cytokine activity				0	all_neural(327;0.117)					TAAAGTTTACATACTTGGTTG	0.289													14	52	---	---	---	---	PASS
TRPV6	55503	broad.mit.edu	37	7	142572280	142572280	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142572280G>C	uc003wbx.1	-	11	1632	c.1416C>G	c.(1414-1416)TTC>TTG	p.F472L	TRPV6_uc003wbw.1_Missense_Mutation_p.F258L|TRPV6_uc010lou.1_Missense_Mutation_p.F343L	NM_018646	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel,	472	Cytoplasmic (Potential).				regulation of calcium ion-dependent exocytosis	integral to plasma membrane	calcium channel activity|calmodulin binding			ovary(2)	2	Melanoma(164;0.059)					CTAGCATCTGGAATCCTCGGG	0.537													37	78	---	---	---	---	PASS
OR6V1	346517	broad.mit.edu	37	7	142749511	142749511	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142749511T>A	uc011ksv.1	+	1	74	c.74T>A	c.(73-75)CTG>CAG	p.L25Q		NM_001001667	NP_001001667	Q8N148	OR6V1_HUMAN	olfactory receptor, family 6, subfamily V,	25	Helical; Name=1; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1	Melanoma(164;0.059)					CAGGCCCTTCTGTATGGCCCC	0.517													59	134	---	---	---	---	PASS
CNTNAP2	26047	broad.mit.edu	37	7	147336310	147336310	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:147336310C>A	uc003weu.1	+	13	2526	c.2010C>A	c.(2008-2010)GAC>GAA	p.D670E		NM_014141	NP_054860	Q9UHC6	CNTP2_HUMAN	cell recognition molecule Caspr2 precursor	670	Extracellular (Potential).|Fibrinogen C-terminal.				behavior|cell adhesion|clustering of voltage-gated potassium channels|limbic system development|neuron recognition|signal transduction|striatum development|superior temporal gyrus development|thalamus development|transmission of nerve impulse	axolemma|cell body fiber|dendrite|juxtaparanode region of axon|voltage-gated potassium channel complex	receptor binding			ovary(9)|central_nervous_system(1)|pancreas(1)	11	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CCTCCATGGACCAGATAAGTG	0.502										HNSCC(39;0.1)			11	48	---	---	---	---	PASS
DEFA4	1669	broad.mit.edu	37	8	6794261	6794261	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:6794261A>G	uc003wqu.1	-	2	212	c.161T>C	c.(160-162)CTT>CCT	p.L54P		NM_001925	NP_001916	P12838	DEF4_HUMAN	defensin, alpha 4 preproprotein	54					defense response to bacterium|defense response to fungus|killing of cells of other organism	extracellular space				large_intestine(1)	1				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		TGAAACCTGAAGAGCAGAGCT	0.348													21	78	---	---	---	---	PASS
AMAC1L2	83650	broad.mit.edu	37	8	11189510	11189510	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:11189510T>C	uc003wtp.1	+	1	1016	c.895T>C	c.(895-897)TAT>CAT	p.Y299H		NM_054028	NP_473369	Q96KT7	AMCL2_HUMAN	acyl-malonyl condensing enzyme	299	DUF6 2.|Helical; (Potential).					integral to membrane					0			STAD - Stomach adenocarcinoma(15;0.00676)	COAD - Colon adenocarcinoma(149;0.0563)		ACTGCAGTATTATATGCTCCA	0.567													7	148	---	---	---	---	PASS
KIF13B	23303	broad.mit.edu	37	8	29003964	29003964	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:29003964C>T	uc003xhh.3	-	18	2177	c.2118G>A	c.(2116-2118)GAG>GAA	p.E706E	KIF13B_uc003xhj.2_Silent_p.E603E	NM_015254	NP_056069	Q9NQT8	KI13B_HUMAN	kinesin family member 13B	706	Potential.				microtubule-based movement|protein targeting|signal transduction|T cell activation	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein kinase binding				0		Ovarian(32;0.000536)		KIRC - Kidney renal clear cell carcinoma(542;0.152)|Kidney(114;0.181)		TTTTATCCAGCTCCTCAGCAA	0.428													13	44	---	---	---	---	PASS
MYST3	7994	broad.mit.edu	37	8	41791206	41791206	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:41791206T>A	uc010lxb.2	-	18	5076	c.4532A>T	c.(4531-4533)CAG>CTG	p.Q1511L	MYST3_uc010lxc.2_Missense_Mutation_p.Q1511L|MYST3_uc003xon.3_Missense_Mutation_p.Q1511L	NM_001099412	NP_001092882	Q92794	MYST3_HUMAN	MYST histone acetyltransferase (monocytic	1511					histone H3 acetylation|myeloid cell differentiation|negative regulation of transcription, DNA-dependent|nucleosome assembly|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	MOZ/MORF histone acetyltransferase complex|nucleosome	DNA binding|histone acetyltransferase activity|transcription coactivator activity|transcription factor binding|zinc ion binding			ovary(4)|pancreas(1)|central_nervous_system(1)|skin(1)	7	all_epithelial(6;1.12e-27)|all_lung(13;3.94e-12)|Lung NSC(13;6.54e-11)|Ovarian(28;0.00744)|Prostate(17;0.0119)|Colorectal(14;0.0221)|Lung SC(25;0.211)	all_lung(54;0.000294)|Lung NSC(58;0.00105)|Hepatocellular(245;0.0524)|Esophageal squamous(32;0.0954)|Renal(179;0.0983)	Epithelial(1;2.82e-19)|all cancers(1;1.15e-16)|BRCA - Breast invasive adenocarcinoma(8;9.17e-11)|OV - Ovarian serous cystadenocarcinoma(14;9.4e-05)|Colorectal(10;0.000728)|Lung(22;0.00153)|LUSC - Lung squamous cell carcinoma(45;0.00741)|COAD - Colon adenocarcinoma(11;0.0171)			TGGGCTGATCTGGGTGTAGCC	0.567													13	110	---	---	---	---	PASS
PXDNL	137902	broad.mit.edu	37	8	52321593	52321593	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:52321593C>A	uc003xqu.3	-	17	2692	c.2591G>T	c.(2590-2592)CGC>CTC	p.R864L	PXDNL_uc003xqt.3_RNA	NM_144651	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog-like precursor	864					hydrogen peroxide catabolic process	extracellular space	heme binding|peroxidase activity			ovary(1)|pancreas(1)	2		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GGGGCTGGAGCGCGCGAAGAG	0.662													6	35	---	---	---	---	PASS
CNGB3	54714	broad.mit.edu	37	8	87755727	87755727	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:87755727C>A	uc003ydx.2	-	1	175	c.129G>T	c.(127-129)CAG>CAT	p.Q43H		NM_019098	NP_061971	Q9NQW8	CNGB3_HUMAN	cyclic nucleotide gated channel beta 3	43	Cytoplasmic (Potential).				signal transduction|visual perception	integral to membrane	cGMP binding			ovary(2)|pancreas(1)	3						GAGGACATACCTGTGCTGTGG	0.388													41	62	---	---	---	---	PASS
STK3	6788	broad.mit.edu	37	8	99779606	99779606	+	Intron	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:99779606G>C	uc003yip.2	-						STK3_uc003yio.2_Intron|STK3_uc010mbm.1_Intron	NM_006281	NP_006272	Q13188	STK3_HUMAN	serine/threonine kinase 3						apoptosis|hippo signaling cascade|intracellular protein kinase cascade|negative regulation of canonical Wnt receptor signaling pathway|positive regulation of apoptosis	cytoplasm|nucleus	ATP binding|magnesium ion binding|protein dimerization activity|protein serine/threonine kinase activator activity|protein serine/threonine kinase activity			lung(3)|ovary(1)	4	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		AGACCTAAAAGAAACCAAGAC	0.313													10	19	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113275901	113275901	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113275901C>T	uc003ynu.2	-	61	9988	c.9829G>A	c.(9829-9831)GGT>AGT	p.G3277S	CSMD3_uc003yns.2_Missense_Mutation_p.G2479S|CSMD3_uc003ynt.2_Missense_Mutation_p.G3237S|CSMD3_uc011lhx.1_Missense_Mutation_p.G3108S	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	3277	Sushi 25.|Extracellular (Potential).					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						CTCCAGGTACCATTCCCTACA	0.403										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			17	25	---	---	---	---	PASS
TAF2	6873	broad.mit.edu	37	8	120774748	120774748	+	Nonsense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:120774748A>T	uc003you.2	-	19	2735	c.2465T>A	c.(2464-2466)TTA>TAA	p.L822*		NM_003184	NP_003175	Q6P1X5	TAF2_HUMAN	TBP-associated factor 2	822					G2/M transition of mitotic cell cycle|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	transcription factor TFIID complex|transcription factor TFTC complex	metallopeptidase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(2)|ovary(2)|kidney(1)|skin(1)	6	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			ATCAGGATTTAAGTTATCCAA	0.378													7	53	---	---	---	---	PASS
FAM135B	51059	broad.mit.edu	37	8	139164354	139164354	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:139164354G>C	uc003yuy.2	-	13	2535	c.2364C>G	c.(2362-2364)ACC>ACG	p.T788T	FAM135B_uc003yux.2_Silent_p.T689T|FAM135B_uc003yuz.2_RNA|FAM135B_uc003yva.2_Silent_p.T350T|FAM135B_uc003yvb.2_Silent_p.T350T	NM_015912	NP_056996	Q49AJ0	F135B_HUMAN	hypothetical protein LOC51059	788										ovary(7)|skin(2)	9	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			CTTGCTGCTTGGTGTCCGCAT	0.522										HNSCC(54;0.14)			10	92	---	---	---	---	PASS
GPR20	2843	broad.mit.edu	37	8	142367828	142367828	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:142367828C>A	uc003ywf.2	-	2	285	c.196G>T	c.(196-198)GCA>TCA	p.A66S		NM_005293	NP_005284	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	66	Helical; Name=1; (Potential).					integral to plasma membrane	G-protein coupled receptor activity			upper_aerodigestive_tract(1)	1	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			ACCAGCCCTGCCAGGAAGATG	0.652													8	34	---	---	---	---	PASS
LRRC14	9684	broad.mit.edu	37	8	145745721	145745721	+	Silent	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:145745721A>G	uc003zdk.1	+	3	575	c.429A>G	c.(427-429)GTA>GTG	p.V143V	RECQL4_uc003zdj.2_5'Flank|LRRC14_uc003zdl.1_Silent_p.V143V|LRRC14_uc003zdo.2_5'Flank	NM_014665	NP_055480	Q15048	LRC14_HUMAN	leucine rich repeat containing 14	143											0	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CTGCTGCCGTAGCTCGCACAT	0.662													9	88	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79328470	79328470	+	Intron	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79328470G>A	uc010mpk.2	-							NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2						apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						GGTCAGAGGAGGGGCTCACCT	0.532													5	14	---	---	---	---	PASS
ADAMTS13	11093	broad.mit.edu	37	9	136307599	136307599	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:136307599G>C	uc004cdv.3	+	17	2492	c.2048G>C	c.(2047-2049)CGG>CCG	p.R683P	ADAMTS13_uc004cdp.3_Intron|ADAMTS13_uc004cdt.1_Missense_Mutation_p.R683P|ADAMTS13_uc004cdu.1_Missense_Mutation_p.R652P|ADAMTS13_uc004cdw.3_Missense_Mutation_p.R683P|ADAMTS13_uc004cdx.3_Missense_Mutation_p.R652P|ADAMTS13_uc004cdy.1_Intron|ADAMTS13_uc004cdz.3_Missense_Mutation_p.R353P|ADAMTS13_uc004cds.1_Missense_Mutation_p.R208P|ADAMTS13_uc004cdr.1_Intron	NM_139025	NP_620594	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1	683	Spacer.|TSP type-1 2.				cell-matrix adhesion|glycoprotein metabolic process|integrin-mediated signaling pathway|peptide catabolic process|platelet activation|protein processing|proteolysis	cell surface|proteinaceous extracellular matrix	calcium ion binding|integrin binding|metalloendopeptidase activity|zinc ion binding			central_nervous_system(2)|skin(2)|ovary(1)|kidney(1)	6				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CCTAAGCCACGGCAGGCCTGG	0.637													22	60	---	---	---	---	PASS
USP6NL	9712	broad.mit.edu	37	10	11505690	11505690	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:11505690C>A	uc001ikt.3	-	15	1558	c.1237G>T	c.(1237-1239)GAG>TAG	p.E413*	USP6NL_uc001iks.1_Nonsense_Mutation_p.E430*	NM_014688	NP_055503	Q92738	US6NL_HUMAN	USP6 N-terminal like isoform 1	413						intracellular	Rab GTPase activator activity				0						GGGGAGTGCTCGTGCCTCCTG	0.672													11	27	---	---	---	---	PASS
FAM188A	80013	broad.mit.edu	37	10	15880243	15880243	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:15880243A>G	uc001iod.1	-	5	666	c.445T>C	c.(445-447)TTT>CTT	p.F149L	FAM188A_uc001ioe.1_Intron|FAM188A_uc001iof.1_Missense_Mutation_p.F149L	NM_024948	NP_079224	Q9H8M7	F188A_HUMAN	chromosome 10 open reading frame 97	149					apoptosis	nucleus	calcium ion binding			ovary(1)	1						AATGCATGAAATCGCTCAAAG	0.378													6	56	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17156040	17156040	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17156040C>T	uc001ioo.2	-	8	921	c.869G>A	c.(868-870)GGG>GAG	p.G290E		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	290	EGF-like 3; calcium-binding (Potential).				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGGACAGGCCCCACAGTAGAA	0.552													3	12	---	---	---	---	PASS
ANKRD30A	91074	broad.mit.edu	37	10	37419161	37419161	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:37419161C>A	uc001iza.1	+	3	296	c.197C>A	c.(196-198)GCA>GAA	p.A66E		NM_052997	NP_443723	Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	122	ANK 2.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity			ovary(7)|breast(1)|skin(1)	9						GAGGCTTGTGCAAATATTCTG	0.323													5	35	---	---	---	---	PASS
FAM178A	55719	broad.mit.edu	37	10	102689090	102689090	+	Nonsense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:102689090A>T	uc001krt.3	+	7	2601	c.2059A>T	c.(2059-2061)AAG>TAG	p.K687*	FAM178A_uc001krs.2_Nonsense_Mutation_p.K687*	NM_018121	NP_060591	Q8IX21	F178A_HUMAN	hypothetical protein LOC55719 isoform 1	687											0						TGAACTGCAGAAGCAACTACA	0.358													7	22	---	---	---	---	PASS
MGEA5	10724	broad.mit.edu	37	10	103569992	103569992	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103569992G>C	uc001ktv.2	-	4	872	c.429C>G	c.(427-429)ATC>ATG	p.I143M	MGEA5_uc010qqe.1_Missense_Mutation_p.I143M|MGEA5_uc009xws.2_Missense_Mutation_p.I143M|MGEA5_uc001ktw.2_Missense_Mutation_p.I143M|MGEA5_uc009xwt.2_Intron|MGEA5_uc010qqf.1_Intron	NM_012215	NP_036347	O60502	NCOAT_HUMAN	meningioma expressed antigen 5 (hyaluronidase)	143					glycoprotein catabolic process	cytoplasm|nucleus	histone acetyltransferase activity|hyalurononglucosaminidase activity			ovary(2)|skin(1)	3		Colorectal(252;0.207)		Epithelial(162;4.67e-09)|all cancers(201;2.54e-07)		TAGAAAAAGTGATATCCAATC	0.373													42	97	---	---	---	---	PASS
DCLRE1A	9937	broad.mit.edu	37	10	115601242	115601242	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:115601242C>G	uc001law.2	-	7	3661	c.2743G>C	c.(2743-2745)GAA>CAA	p.E915Q		NM_014881	NP_055696	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	915					cell division|mitosis	nucleus	hydrolase activity			skin(2)	2				Epithelial(162;0.0157)|all cancers(201;0.0171)		GAATTAATTTCTGGTATATTG	0.363								Direct_reversal_of_damage|Other_identified_genes_with_known_or_suspected_DNA_repair_function					19	112	---	---	---	---	PASS
PNLIPRP3	119548	broad.mit.edu	37	10	118196342	118196342	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:118196342C>T	uc001lcl.3	+	2	270	c.169C>T	c.(169-171)CTG>TTG	p.L57L		NM_001011709	NP_001011709	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3 precursor	57					lipid catabolic process	extracellular region	triglyceride lipase activity			ovary(1)	1				all cancers(201;0.0131)		CACTCGTTTCCTGCTCTACAC	0.408													23	104	---	---	---	---	PASS
EIF3A	8661	broad.mit.edu	37	10	120801982	120801982	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:120801982G>T	uc001ldu.2	-	19	3196	c.3050C>A	c.(3049-3051)CCA>CAA	p.P1017Q	EIF3A_uc010qsu.1_Missense_Mutation_p.P983Q|EIF3A_uc009xzg.1_Missense_Mutation_p.P56Q	NM_003750	NP_003741	Q14152	EIF3A_HUMAN	eukaryotic translation initiation factor 3,	1017	Asp-rich.|10.|25 X 10 AA approximate tandem repeats of [DE]-[DE]-[DE]-R-[SEVGFPILV]-[HPSN]- [RSW]-[RL]-[DRGTIHN]-[EPMANLGDT].				formation of translation initiation complex	cytosol|eukaryotic translation initiation factor 3 complex	protein binding|structural molecule activity|translation initiation factor activity				0		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		TCGTCTAGGTGGTCTGTCATC	0.582													30	182	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1016874	1016874	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1016874C>A	uc001lsw.2	-	31	5978	c.5927G>T	c.(5926-5928)AGT>ATT	p.S1976I		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1976	Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AGAGAAGGGACTGCTCCCTGT	0.587													24	562	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1018760	1018760	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1018760G>T	uc001lsw.2	-	31	4092	c.4041C>A	c.(4039-4041)ACC>ACA	p.T1347T		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1347	Pro-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTTCCTGATTGGTCGATTTTG	0.542													26	69	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1018761	1018761	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1018761G>A	uc001lsw.2	-	31	4091	c.4040C>T	c.(4039-4041)ACC>ATC	p.T1347I		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	1347	Pro-rich.|Thr-rich.				maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TTCCTGATTGGTCGATTTTGC	0.542													26	72	---	---	---	---	PASS
CARS	833	broad.mit.edu	37	11	3026612	3026612	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3026612C>G	uc001lxh.2	-	19	2026	c.1952G>C	c.(1951-1953)AGA>ACA	p.R651T	CARS_uc009ydu.2_RNA|CARS_uc001lxe.2_Missense_Mutation_p.R641T|CARS_uc001lxf.2_Missense_Mutation_p.R734T|CARS_uc001lxg.2_Missense_Mutation_p.R651T|CARS_uc010qxo.1_Missense_Mutation_p.R734T|CARS_uc010qxp.1_Missense_Mutation_p.R664T	NM_001751	NP_001742	P49589	SYCC_HUMAN	cysteinyl-tRNA synthetase isoform b	651					cysteinyl-tRNA aminoacylation	cytoplasm|cytosol	ATP binding|cysteine-tRNA ligase activity|metal ion binding|protein homodimerization activity|protein homodimerization activity|tRNA binding|tRNA binding		CARS/ALK(5)	soft_tissue(5)|ovary(2)	7		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00317)|LUSC - Lung squamous cell carcinoma(625;0.218)	L-Cysteine(DB00151)	CTTTTCTTCTCTCTCTTTTAA	0.398			T	ALK	ALCL								23	58	---	---	---	---	PASS
OR51I1	390063	broad.mit.edu	37	11	5461847	5461847	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5461847C>A	uc010qze.1	-	1	898	c.898G>T	c.(898-900)GAG>TAG	p.E300*	HBG2_uc001mak.1_Intron|HBE1_uc001mam.1_Intron|OR51B5_uc001maq.1_Intron	NM_001005288	NP_001005288	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I,	300	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTGCGGATCTCCTTGGTTTTC	0.473													37	78	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43418950	43418950	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43418950A>T	uc001mxi.2	+	7	841	c.827A>T	c.(826-828)CAC>CTC	p.H276L	TTC17_uc001mxh.2_Missense_Mutation_p.H276L|TTC17_uc010rfj.1_Missense_Mutation_p.H219L|TTC17_uc001mxj.2_Missense_Mutation_p.H46L	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	276							binding			ovary(5)	5						CACAGAGCACACTTCTCTGCT	0.448													39	134	---	---	---	---	PASS
TTC17	55761	broad.mit.edu	37	11	43427351	43427351	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:43427351C>A	uc001mxi.2	+	13	1625	c.1611C>A	c.(1609-1611)AGC>AGA	p.S537R	TTC17_uc001mxh.2_Missense_Mutation_p.S537R|TTC17_uc010rfj.1_Missense_Mutation_p.S480R|TTC17_uc001mxj.2_Missense_Mutation_p.S307R	NM_018259	NP_060729	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	537							binding			ovary(5)	5						ACGAACTCAGCAGTGATGATT	0.398													28	105	---	---	---	---	PASS
OR4C13	283092	broad.mit.edu	37	11	49974362	49974362	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:49974362T>A	uc010rhz.1	+	1	388	c.388T>A	c.(388-390)TAT>AAT	p.Y130N		NM_001001955	NP_001001955	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C,	130	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(3)|ovary(1)	4						GCCCTTGCACTATACCACCGT	0.468													24	75	---	---	---	---	PASS
OR4A15	81328	broad.mit.edu	37	11	55135383	55135383	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55135383C>T	uc010rif.1	+	1	24	c.24C>T	c.(22-24)CTC>CTT	p.L8L		NM_001005275	NP_001005275	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A,	8	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)|skin(1)	2						CAAATAATCTCAAATTTATCA	0.413													9	26	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468238	56468238	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468238C>A	uc010rjn.1	+	1	375	c.375C>A	c.(373-375)ATC>ATA	p.I125I		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	125	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ACGTGGCCATCTCCAAGCCCC	0.522													11	153	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468590	56468590	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468590C>A	uc010rjn.1	+	1	727	c.727C>A	c.(727-729)CAC>AAC	p.H243N		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	243	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATGCTCCTCCCACCTGACCTC	0.473													47	245	---	---	---	---	PASS
OR9G9	504191	broad.mit.edu	37	11	56468598	56468598	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56468598C>A	uc010rjn.1	+	1	735	c.735C>A	c.(733-735)ACC>ACA	p.T245T		NM_001013358	NP_001013376	P0C7N8	OR9G9_HUMAN	olfactory receptor, family 9, subfamily G,	245	Helical; Name=6; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						CCCACCTGACCTCTGTCACTT	0.458													26	287	---	---	---	---	PASS
OR5B2	390190	broad.mit.edu	37	11	58190455	58190455	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58190455C>A	uc010rkg.1	-	1	280	c.280G>T	c.(280-282)GCA>TCA	p.A94S		NM_001005566	NP_001005566	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B,	94	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(3)	3	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				ACAGCACATGCATTGTAGGAG	0.502													29	84	---	---	---	---	PASS
NAA40	79829	broad.mit.edu	37	11	63713361	63713361	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:63713361G>C	uc009yoz.2	+	2	183	c.56G>C	c.(55-57)CGA>CCA	p.R19P	NAA40_uc010rmw.1_5'UTR|NAA40_uc010rmx.1_5'UTR	NM_024771	NP_079047	Q86UY6	NAA40_HUMAN	N-acetyltransferase 11	19							N-acetyltransferase activity				0						TTGGAGGAGCGAGCAGCCATG	0.532											OREG0021041	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	7	79	---	---	---	---	PASS
KCNK7	10089	broad.mit.edu	37	11	65360632	65360632	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65360632G>A	uc001oes.2	-	3	992	c.768C>T	c.(766-768)TTC>TTT	p.F256F	KCNK7_uc001oeq.2_3'UTR|KCNK7_uc001oer.2_3'UTR|KCNK7_uc001oeu.2_3'UTR	NM_033347	NP_203133	Q9Y2U2	KCNK7_HUMAN	potassium channel, subfamily K, member 7 isoform	256	Cytoplasmic (Potential).					integral to membrane	potassium channel activity|voltage-gated ion channel activity				0						GCAGCTCAGAGAAGGTCTCCA	0.607													5	17	---	---	---	---	PASS
KCTD21	283219	broad.mit.edu	37	11	77885471	77885471	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:77885471G>A	uc001ozb.2	-	2	205	c.130C>T	c.(130-132)CAG>TAG	p.Q44*		NM_001029859	NP_001025030	Q4G0X4	KCD21_HUMAN	potassium channel tetramerisation domain	44	BTB.					voltage-gated potassium channel complex	voltage-gated potassium channel activity			pancreas(1)	1	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.46e-24)			CAGTTGCCCTGGCTGTCCCTC	0.577													9	36	---	---	---	---	PASS
NAALAD2	10003	broad.mit.edu	37	11	89891312	89891312	+	Splice_Site	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:89891312G>A	uc001pdf.3	+	7	906	c.797_splice	c.e7-1	p.E266_splice	NAALAD2_uc009yvx.2_Splice_Site_p.E266_splice|NAALAD2_uc009yvy.2_Intron|NAALAD2_uc001pdd.2_Splice_Site_p.E266_splice|NAALAD2_uc001pde.2_Intron	NM_005467	NP_005458	Q9Y3Q0	NALD2_HUMAN	N-acetylated alpha-linked acidic dipeptidase 2						proteolysis	integral to membrane	carboxypeptidase activity|dipeptidase activity|dipeptidyl-peptidase activity|metal ion binding|metallopeptidase activity|serine-type peptidase activity			pancreas(1)|skin(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GATTTTTTTAGAATACACTTT	0.219													31	104	---	---	---	---	PASS
FAT3	120114	broad.mit.edu	37	11	92085823	92085823	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92085823C>A	uc001pdj.3	+	1	562	c.545C>A	c.(544-546)GCA>GAA	p.A182E		NM_001008781	NP_001008781	Q8TDW7	FAT3_HUMAN	FAT tumor suppressor homolog 3	182	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion|multicellular organismal development	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|pancreas(1)	5		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				CAGGTGACTGCAACAGACGCA	0.408										TCGA Ovarian(4;0.039)			21	80	---	---	---	---	PASS
ALKBH8	91801	broad.mit.edu	37	11	107424703	107424703	+	Silent	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107424703C>G	uc010rvr.1	-	4	444	c.369G>C	c.(367-369)GTG>GTC	p.V123V	ALKBH8_uc001pjk.2_5'Flank|ALKBH8_uc010rvq.1_Intron|ALKBH8_uc009yxp.2_Silent_p.V123V|ALKBH8_uc001pjl.2_RNA	NM_138775	NP_620130	Q96BT7	ALKB8_HUMAN	alkB, alkylation repair homolog 8	123					response to DNA damage stimulus	cytosol|nucleus	metal ion binding|nucleotide binding|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors|protein binding|RNA binding|tRNA (uracil) methyltransferase activity				0		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00512)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.53e-05)|Epithelial(105;0.00029)|all cancers(92;0.00518)		CCTTCCACTGCACTATGGGAA	0.368													11	41	---	---	---	---	PASS
RDX	5962	broad.mit.edu	37	11	110134937	110134937	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:110134937T>A	uc001pku.2	-	5	525	c.215A>T	c.(214-216)AAA>ATA	p.K72I	RDX_uc009yxx.1_RNA|RDX_uc009yxy.2_Missense_Mutation_p.K72I|RDX_uc009yxz.2_Intron|RDX_uc009yya.2_Missense_Mutation_p.K40I|RDX_uc010rwe.1_Intron	NM_002906	NP_002897	P35241	RADI_HUMAN	radixin	72	FERM.				actin filament capping	cleavage furrow|cytoskeleton|extrinsic to membrane|Golgi apparatus|nucleolus|plasma membrane	actin binding				0		all_cancers(61;7.18e-13)|all_epithelial(67;2.61e-07)|Melanoma(852;1.46e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Breast(348;0.0544)		Epithelial(105;1.13e-06)|BRCA - Breast invasive adenocarcinoma(274;9.75e-06)|all cancers(92;5.9e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0248)		AGGATTCTCTTTTTTAACATC	0.299													9	28	---	---	---	---	PASS
MFRP	83552	broad.mit.edu	37	11	119210227	119210227	+	3'UTR	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:119210227G>A	uc001pwj.2	-	15					MFRP_uc010rzf.1_Intron	NM_031433	NP_113621	Q9BXJ0	C1QT5_HUMAN	membrane frizzled-related protein							collagen					0		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		GCCACCCCCCGAAAAACTGGA	0.607													19	37	---	---	---	---	PASS
GRIK4	2900	broad.mit.edu	37	11	120811049	120811049	+	Intron	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:120811049T>C	uc001pxn.2	+						GRIK4_uc009zav.1_Intron|GRIK4_uc009zaw.1_Intron|GRIK4_uc009zax.1_Intron	NM_014619	NP_055434	Q16099	GRIK4_HUMAN	glutamate receptor KA1 precursor						glutamate signaling pathway|synaptic transmission	cell junction|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			ovary(2)|central_nervous_system(1)	3		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)	L-Glutamic Acid(DB00142)	GTCTCTGTTCTTTTCAGAAAG	0.517													12	48	---	---	---	---	PASS
SCN3B	55800	broad.mit.edu	37	11	123516385	123516385	+	Silent	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:123516385C>G	uc001pza.1	-	3	536	c.129G>C	c.(127-129)CTG>CTC	p.L43L	SCN3B_uc001pzb.1_Silent_p.L43L	NM_001040151	NP_001035241	Q9NY72	SCN3B_HUMAN	voltage-gated sodium channel beta-3 subunit	43	Ig-like C2-type.|Extracellular (Potential).				axon guidance	integral to membrane|plasma membrane	voltage-gated sodium channel activity			large_intestine(2)|ovary(2)|central_nervous_system(1)|skin(1)	6		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)		AGATGCAGCGCAGCTTCATGG	0.577													24	94	---	---	---	---	PASS
NTM	50863	broad.mit.edu	37	11	131781460	131781460	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:131781460G>T	uc001qgp.2	+	1	749	c.85G>T	c.(85-87)GTG>TTG	p.V29L	NTM_uc001qgm.2_Missense_Mutation_p.V29L|NTM_uc010sch.1_Missense_Mutation_p.V20L|NTM_uc010sci.1_Missense_Mutation_p.V29L|NTM_uc010scj.1_5'UTR|NTM_uc001qgo.2_Missense_Mutation_p.V29L|NTM_uc001qgq.2_Missense_Mutation_p.V29L	NM_016522	NP_057606	Q9P121	NTRI_HUMAN	neurotrimin isoform 1	29					cell adhesion|neuron recognition	anchored to membrane|plasma membrane				ovary(4)|central_nervous_system(1)|skin(1)	6						ACCCACAGGAGTGCCCGTGCG	0.617											OREG0021537	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	22	79	---	---	---	---	PASS
KCNA6	3742	broad.mit.edu	37	12	4919972	4919972	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4919972G>T	uc001qng.2	+	1	1631	c.765G>T	c.(763-765)GGG>GGT	p.G255G		NM_002235	NP_002226	P17658	KCNA6_HUMAN	potassium voltage-gated channel, shaker-related	255						voltage-gated potassium channel complex	voltage-gated potassium channel activity			skin(2)|ovary(1)	3						GTACTCTTGGGGGCTCCTTCT	0.557										HNSCC(72;0.22)			28	92	---	---	---	---	PASS
VWF	7450	broad.mit.edu	37	12	6131150	6131150	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6131150G>T	uc001qnn.1	-	27	3840	c.3590C>A	c.(3589-3591)CCA>CAA	p.P1197Q	VWF_uc010set.1_Intron	NM_000552	NP_000543	P04275	VWF_HUMAN	von Willebrand factor preproprotein	1197					blood coagulation, intrinsic pathway|cell-substrate adhesion|platelet activation|platelet degranulation|protein homooligomerization	endoplasmic reticulum|platelet alpha granule lumen|proteinaceous extracellular matrix|Weibel-Palade body	chaperone binding|collagen binding|glycoprotein binding|immunoglobulin binding|integrin binding|protease binding|protein homodimerization activity|protein N-terminus binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|breast(1)	12					Antihemophilic Factor(DB00025)	CTCACACACTGGACAGTCTTC	0.512													47	167	---	---	---	---	PASS
EPS8	2059	broad.mit.edu	37	12	15813567	15813567	+	Silent	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:15813567A>G	uc009zif.2	-	10	1012	c.918T>C	c.(916-918)GGT>GGC	p.G306G	EPS8_uc001rdb.2_Silent_p.G306G|EPS8_uc009zig.2_Silent_p.G46G|EPS8_uc010shv.1_Silent_p.G46G	NM_004447	NP_004438	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway	306					cell proliferation|epidermal growth factor receptor signaling pathway		SH3/SH2 adaptor activity			ovary(2)|upper_aerodigestive_tract(1)|skin(1)	4		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CTTTCCTTTTACCTTTCTTGT	0.294													22	81	---	---	---	---	PASS
PDE3A	5139	broad.mit.edu	37	12	20801620	20801620	+	Splice_Site	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:20801620A>T	uc001reh.1	+	13	2588	c.2566_splice	c.e13-2	p.A856_splice		NM_000921	NP_000912	Q14432	PDE3A_HUMAN	phosphodiesterase 3A						lipid metabolic process|platelet activation|signal transduction	cytosol|integral to membrane	3',5'-cyclic-AMP phosphodiesterase activity|3',5'-cyclic-GMP phosphodiesterase activity|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity|metal ion binding			ovary(3)|upper_aerodigestive_tract(1)	4	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Cilostazol(DB01166)|Enoximone(DB04880)|Milrinone(DB00235)|Theophylline(DB00277)	TTATTTGCCTAGGCGGTGCTA	0.348													19	82	---	---	---	---	PASS
CAPRIN2	65981	broad.mit.edu	37	12	30873820	30873820	+	Silent	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:30873820T>C	uc001rji.1	-	12	2824	c.2073A>G	c.(2071-2073)TCA>TCG	p.S691S	CAPRIN2_uc001rjf.1_Silent_p.S488S|CAPRIN2_uc001rjg.1_Silent_p.S358S|CAPRIN2_uc001rjh.1_Silent_p.S691S|CAPRIN2_uc001rjj.1_Silent_p.S358S|CAPRIN2_uc001rjk.3_Silent_p.S691S|CAPRIN2_uc001rjl.3_Intron|CAPRIN2_uc001rjm.1_Intron	NM_001002259	NP_001002259	Q6IMN6	CAPR2_HUMAN	C1q domain containing 1 isoform 1	691					negative regulation of cell growth|negative regulation of translation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of dendrite morphogenesis|positive regulation of dendritic spine morphogenesis|positive regulation of peptidyl-serine phosphorylation|positive regulation of protein binding|positive regulation of transcription from RNA polymerase II promoter	mitochondrion|receptor complex	receptor binding|RNA binding			ovary(1)|central_nervous_system(1)	2	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					AGCAAGCATTTGAGCTACAAG	0.398													33	100	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826519	43826519	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826519C>A	uc010skx.1	-	20	2816	c.2816G>T	c.(2815-2817)GGA>GTA	p.G939V	ADAMTS20_uc001rno.1_Missense_Mutation_p.G93V|ADAMTS20_uc001rnp.1_Missense_Mutation_p.G93V	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	939	TSP type-1 3.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AACAGTCTGTCCTTCATGAAT	0.423													30	130	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43826520	43826520	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43826520C>A	uc010skx.1	-	20	2815	c.2815G>T	c.(2815-2817)GGA>TGA	p.G939*	ADAMTS20_uc001rno.1_Nonsense_Mutation_p.G93*|ADAMTS20_uc001rnp.1_Nonsense_Mutation_p.G93*	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	939	TSP type-1 3.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACAGTCTGTCCTTCATGAATG	0.423													28	137	---	---	---	---	PASS
TWF1	5756	broad.mit.edu	37	12	44196114	44196114	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44196114A>G	uc001rob.2	-	3	387	c.359T>C	c.(358-360)ATT>ACT	p.I120T	TWF1_uc001rnz.2_5'UTR|TWF1_uc001roa.2_Missense_Mutation_p.I120T|TWF1_uc001roc.2_5'UTR	NM_002822	NP_002813	Q12792	TWF1_HUMAN	twinfilin 1	86	ADF-H 1.					actin cytoskeleton|cytoplasm	actin binding|protein tyrosine kinase activity			stomach(1)	1	all_cancers(12;0.00125)	Lung NSC(34;0.0804)|all_lung(34;0.181)		GBM - Glioblastoma multiforme(48;0.0474)		AGACCATGCAATGAATATCCA	0.318													26	76	---	---	---	---	PASS
SLC48A1	55652	broad.mit.edu	37	12	48174671	48174671	+	3'UTR	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48174671C>T	uc001rqd.2	+	3					SLC48A1_uc001rqc.2_Intron	NM_017842	NP_060312	Q6P1K1	HRG1_HUMAN	heme-responsive gene 1						transport	endosome membrane|integral to membrane|lysosomal membrane					0						TCTTAGCACGCAGTGAGGAAT	0.308													5	35	---	---	---	---	PASS
MLL2	8085	broad.mit.edu	37	12	49445464	49445464	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:49445464C>A	uc001rta.3	-	10	2002	c.2002G>T	c.(2002-2004)GAA>TAA	p.E668*		NM_003482	NP_003473	O14686	MLL2_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 2	668	15 X 5 AA repeats of S/P-P-P-E/P-E/A.|Pro-rich.				chromatin silencing|histone H3-K4 methylation|oocyte growth|positive regulation of cell proliferation|positive regulation of estrogen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|response to estrogen stimulus|transcription, DNA-dependent	histone methyltransferase complex	histone-lysine N-methyltransferase activity|protein binding|transcription regulatory region DNA binding|zinc ion binding			kidney(16)|central_nervous_system(12)|lung(4)|skin(4)|ovary(3)|pancreas(2)	41						AAGGGAGATTCCTCAGGCGGT	0.642			N|F|Mis		medulloblastoma|renal					HNSCC(34;0.089)			11	77	---	---	---	---	PASS
ARHGAP9	64333	broad.mit.edu	37	12	57866396	57866396	+	Silent	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:57866396C>A	uc001sod.2	-	21	2563	c.2370G>T	c.(2368-2370)CGG>CGT	p.R790R	ARHGAP9_uc001sny.2_RNA|ARHGAP9_uc001snz.2_Silent_p.R516R|ARHGAP9_uc001soa.2_Silent_p.R389R|ARHGAP9_uc001sob.2_3'UTR|ARHGAP9_uc001soc.2_Silent_p.R700R	NM_032496	NP_115885	Q9BRR9	RHG09_HUMAN	Rho GTPase activating protein 9 isoform 1	719	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol	GTPase activator activity|protein binding			lung(1)	1			GBM - Glioblastoma multiforme(3;3.37e-34)			CCTGCTCTGGCCGAAACAGGG	0.557													16	57	---	---	---	---	PASS
AGAP2	116986	broad.mit.edu	37	12	58125404	58125404	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:58125404C>T	uc001spq.2	-	9	1975	c.1975G>A	c.(1975-1977)GAG>AAG	p.E659K	AGAP2_uc001spp.2_Missense_Mutation_p.E659K|AGAP2_uc001spr.2_Missense_Mutation_p.E323K	NM_001122772	NP_001116244	Q99490	AGAP2_HUMAN	centaurin, gamma 1 isoform PIKE-L	659					axon guidance|negative regulation of neuron apoptosis|negative regulation of protein catabolic process|protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	mitochondrion|nucleolus	ARF GTPase activator activity|GTP binding|zinc ion binding			central_nervous_system(3)|breast(2)	5						CTTCGTTTCTCGGAGTCACTA	0.522													13	68	---	---	---	---	PASS
ZDHHC17	23390	broad.mit.edu	37	12	77202834	77202834	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:77202834C>T	uc001syk.1	+	4	495	c.332C>T	c.(331-333)TCG>TTG	p.S111L	ZDHHC17_uc001syi.1_RNA|ZDHHC17_uc001syj.2_RNA	NM_015336	NP_056151	Q8IUH5	ZDH17_HUMAN	huntingtin interacting protein 14	111	ANK 1.|Cytoplasmic (Potential).				lipoprotein transport|positive regulation of I-kappaB kinase/NF-kappaB cascade	Golgi-associated vesicle membrane|integral to membrane	magnesium ion transmembrane transporter activity|protein binding|protein-cysteine S-palmitoleyltransferase activity|signal transducer activity|zinc ion binding				0						TACTATATTTCGAAAGGTGCT	0.289													6	24	---	---	---	---	PASS
NAV3	89795	broad.mit.edu	37	12	78362453	78362453	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:78362453G>T	uc001syp.2	+	5	815	c.642G>T	c.(640-642)CAG>CAT	p.Q214H	NAV3_uc001syo.2_Missense_Mutation_p.Q214H	NM_014903	NP_055718	Q8IVL0	NAV3_HUMAN	neuron navigator 3	214						nuclear outer membrane	ATP binding|nucleoside-triphosphatase activity			large_intestine(6)|ovary(5)|lung(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	17						AAGCCAGCCAGGCCAAAACCC	0.443										HNSCC(70;0.22)			9	32	---	---	---	---	PASS
PPFIA2	8499	broad.mit.edu	37	12	81747098	81747098	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:81747098G>T	uc001szo.1	-	17	1955	c.1794C>A	c.(1792-1794)CAC>CAA	p.H598Q	PPFIA2_uc010sue.1_Intron|PPFIA2_uc010sug.1_RNA|PPFIA2_uc010suh.1_RNA|PPFIA2_uc010sui.1_RNA|PPFIA2_uc010suj.1_RNA|PPFIA2_uc009zsi.1_RNA|PPFIA2_uc010suf.1_RNA|PPFIA2_uc009zsh.2_RNA	NM_003625	NP_003616	B7Z663	B7Z663_HUMAN	PTPRF interacting protein alpha 2	524										ovary(3)|lung(2)|pancreas(1)	6						TATTCCACTCGTGATCCCCAA	0.358													7	42	---	---	---	---	PASS
CEP290	80184	broad.mit.edu	37	12	88471624	88471624	+	Missense_Mutation	SNP	T	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:88471624T>G	uc001tar.2	-	40	5780	c.5436A>C	c.(5434-5436)GAA>GAC	p.E1812D	CEP290_uc001taq.2_Missense_Mutation_p.E872D	NM_025114	NP_079390	O15078	CE290_HUMAN	centrosomal protein 290kDa	1812	Potential.				cilium assembly|eye photoreceptor cell development|G2/M transition of mitotic cell cycle|hindbrain development|otic vesicle formation|positive regulation of transcription, DNA-dependent|pronephros development|protein transport	cell surface|centrosome|cytosol|nucleus|photoreceptor connecting cilium	protein binding			ovary(5)|breast(1)|pancreas(1)	7						TTAGTGAGTTTTCTCTGTTTT	0.254													4	15	---	---	---	---	PASS
SOCS2	8835	broad.mit.edu	37	12	93968918	93968918	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93968918T>A	uc001tcw.1	+	3	1150	c.560T>A	c.(559-561)CTA>CAA	p.L187Q	SOCS2_uc001tcx.1_Missense_Mutation_p.L187Q|SOCS2_uc009zsu.2_3'UTR|SOCS2_uc001tcy.1_Missense_Mutation_p.L187Q|SOCS2_uc001tcz.2_3'UTR	NM_003877	NP_003868	O14508	SOCS2_HUMAN	suppressor of cytokine signaling-2	187	SOCS box.				anti-apoptosis|growth hormone receptor signaling pathway|JAK-STAT cascade|negative regulation of signal transduction|regulation of cell growth|response to estradiol stimulus	cytoplasm	growth hormone receptor binding|insulin-like growth factor receptor binding|JAK pathway signal transduction adaptor activity|prolactin receptor binding|SH3/SH2 adaptor activity			lung(1)	1						CCAACAAGACTAAAAGATTAC	0.403													8	44	---	---	---	---	PASS
NUP37	79023	broad.mit.edu	37	12	102471172	102471172	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102471172C>A	uc001tjc.2	-	6	715	c.650G>T	c.(649-651)TGC>TTC	p.C217F	NUP37_uc009zub.1_Missense_Mutation_p.C217F	NM_024057	NP_076962	Q8NFH4	NUP37_HUMAN	nucleoporin 37kDa	217					carbohydrate metabolic process|cell division|chromosome segregation|glucose transport|mitotic prometaphase|mRNA transport|protein transport|regulation of glucose transport|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytosol|Nup107-160 complex	protein binding			ovary(1)	1						GTTTTTTAAGCACCAGTGTGC	0.393													14	112	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	103984805	103984805	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:103984805G>A	uc001tjw.2	+	2	398	c.212G>A	c.(211-213)TGC>TAC	p.C71Y		NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor	71	Extracellular (Potential).				angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						GTTCGAGATTGCAGGTACTCA	0.468													30	81	---	---	---	---	PASS
STAB2	55576	broad.mit.edu	37	12	104049365	104049365	+	Intron	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:104049365G>T	uc001tjw.2	+							NM_017564	NP_060034	Q8WWQ8	STAB2_HUMAN	stabilin 2 precursor						angiogenesis|cell adhesion|defense response to bacterium|receptor-mediated endocytosis	cytoplasm|external side of plasma membrane|integral to plasma membrane	Gram-negative bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			ovary(9)|skin(5)	14						CAGAGGTACCGTATTCTGCTT	0.388													17	50	---	---	---	---	PASS
TBX5	6910	broad.mit.edu	37	12	114804147	114804147	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:114804147A>T	uc001tvo.2	-	8	1300	c.805T>A	c.(805-807)TCC>ACC	p.S269T	TBX5_uc001tvp.2_Missense_Mutation_p.S269T|TBX5_uc001tvq.2_Missense_Mutation_p.S219T|TBX5_uc010syv.1_Missense_Mutation_p.S269T	NM_181486	NP_852259	Q99593	TBX5_HUMAN	T-box 5 isoform 1	269					cardiac left ventricle formation|cell migration involved in coronary vasculogenesis|cell-cell signaling|embryonic arm morphogenesis|induction of apoptosis|negative regulation of cardiac muscle cell proliferation|negative regulation of cell migration|negative regulation of epithelial to mesenchymal transition|pericardium development|positive regulation of cardioblast differentiation|positive regulation of transcription from RNA polymerase II promoter|ventricular septum development	cytoplasm|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription factor binding			ovary(6)|pancreas(1)|skin(1)	8	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		CTGTGGTTGGAGGCCACTTTT	0.522													29	85	---	---	---	---	PASS
RPLP0	6175	broad.mit.edu	37	12	120637201	120637201	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:120637201G>A	uc001txp.2	-	3	379	c.142C>T	c.(142-144)CGC>TGC	p.R48C	RPLP0_uc001txq.2_Missense_Mutation_p.R48C|RPLP0_uc001txr.2_Missense_Mutation_p.R48C|uc001txs.1_5'Flank	NM_053275	NP_444505	P05388	RLA0_HUMAN	ribosomal protein P0	48					endocrine pancreas development|interspecies interaction between organisms|ribosome biogenesis|translational elongation|translational termination|viral transcription	cytosolic large ribosomal subunit|nucleus	protein binding|RNA binding|structural constituent of ribosome			ovary(1)	1	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCTTCCCGCGAAGGGACATG	0.517													11	68	---	---	---	---	PASS
CLIP1	6249	broad.mit.edu	37	12	122803851	122803851	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:122803851C>T	uc001ucg.1	-	17	3400	c.3294G>A	c.(3292-3294)ATG>ATA	p.M1098I	CLIP1_uc001uch.1_Missense_Mutation_p.M1087I|CLIP1_uc001uci.1_Missense_Mutation_p.M1052I|CLIP1_uc001ucj.1_Missense_Mutation_p.M673I	NM_002956	NP_002947	P30622	CLIP1_HUMAN	restin isoform a	1098	Potential.				mitotic prometaphase|positive regulation of microtubule polymerization	centrosome|cytosol|endosome|intermediate filament|kinetochore	nucleic acid binding|protein homodimerization activity|zinc ion binding			ovary(2)|breast(1)	3	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TCTCTTTGGTCATCTGTTCCA	0.433													6	45	---	---	---	---	PASS
SCARB1	949	broad.mit.edu	37	12	125302175	125302175	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:125302175A>T	uc001ugo.3	-	2	458	c.205T>A	c.(205-207)TTC>ATC	p.F69I	SCARB1_uc001ugn.3_Missense_Mutation_p.F69I|SCARB1_uc001ugm.3_Missense_Mutation_p.F69I|SCARB1_uc010tbd.1_Missense_Mutation_p.F69I|SCARB1_uc010tbe.1_Missense_Mutation_p.F28I|SCARB1_uc001ugp.3_Missense_Mutation_p.F69I	NM_005505	NP_005496	Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1 isoform 1	69	Extracellular (Potential).				adhesion to symbiont|cell adhesion|cholesterol efflux|cholesterol homeostasis|cholesterol import|detection of lipopolysaccharide|high-density lipoprotein particle clearance|high-density lipoprotein particle remodeling|lipopolysaccharide transport|lipoprotein metabolic process|positive regulation of cholesterol storage|positive regulation of endothelial cell migration|positive regulation of nitric-oxide synthase activity|recognition of apoptotic cell|reverse cholesterol transport|triglyceride homeostasis|wound healing	caveola	1-phosphatidylinositol binding|apolipoprotein A-I binding|high-density lipoprotein particle receptor activity|lipopolysaccharide receptor activity|low-density lipoprotein particle binding|phosphatidylserine binding|transporter activity			kidney(1)	1	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	ACGTCAAAGAAGTAGACGGAG	0.587													32	69	---	---	---	---	PASS
RIMBP2	23504	broad.mit.edu	37	12	130921587	130921587	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:130921587C>A	uc001uil.2	-	10	2019	c.1855G>T	c.(1855-1857)GCC>TCC	p.A619S	RIMBP2_uc001uim.2_Missense_Mutation_p.A527S|RIMBP2_uc001uin.1_Missense_Mutation_p.A278S	NM_015347	NP_056162	O15034	RIMB2_HUMAN	RIM-binding protein 2	619	Pro-rich.					cell junction|synapse				upper_aerodigestive_tract(3)|ovary(3)|large_intestine(2)|central_nervous_system(2)|pancreas(1)	11	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		TCCATCCTGGCGTGGGGACCC	0.667													3	36	---	---	---	---	PASS
PXMP2	5827	broad.mit.edu	37	12	133272599	133272599	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:133272599C>T	uc001ukt.2	+	3	431	c.366C>T	c.(364-366)CTC>CTT	p.L122L	PGAM5_uc010tbr.1_Intron	NM_018663	NP_061133	Q9NR77	PXMP2_HUMAN	peroxisomal membrane protein 2, 22kDa	122	Helical; (Potential).					integral to membrane|peroxisomal membrane	protein binding				0	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.86e-08)|Epithelial(86;2.47e-07)|all cancers(50;6.85e-06)		CGGCCTTCCTCATGTTGTTCT	0.478													31	84	---	---	---	---	PASS
MTUS2	23281	broad.mit.edu	37	13	29608239	29608239	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:29608239G>T	uc001usl.3	+	2	2511	c.2453G>T	c.(2452-2454)AGT>ATT	p.S818I		NM_001033602	NP_001028774	Q5JR59	MTUS2_HUMAN	hypothetical protein LOC23281 isoform a	808	Sufficient for interaction with KIF2C.|Localization to the growing distal tip of microtubules.|Mediates interaction with MAPRE1.					cytoplasm|microtubule	microtubule binding|protein homodimerization activity				0						ACAGCCACCAGTCTCTACAGT	0.473													20	35	---	---	---	---	PASS
PCDH20	64881	broad.mit.edu	37	13	61986120	61986120	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:61986120C>A	uc001vid.3	-	2	2476	c.2112G>T	c.(2110-2112)CAG>CAT	p.Q704H	PCDH20_uc010thj.1_Missense_Mutation_p.Q704H	NM_022843	NP_073754	Q8N6Y1	PCD20_HUMAN	protocadherin 20	677	Cadherin 5.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(4)|breast(1)|central_nervous_system(1)	6		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		AGGAGCTTTGCTGCTCTCTGT	0.463													13	126	---	---	---	---	PASS
MYCBP2	23077	broad.mit.edu	37	13	77740591	77740591	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:77740591G>C	uc001vkf.2	-	42	6190	c.6099C>G	c.(6097-6099)GTC>GTG	p.V2033V	MYCBP2_uc010aev.2_Silent_p.V1437V	NM_015057	NP_055872	O75592	MYCB2_HUMAN	MYC binding protein 2	2033					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	ligase activity|protein binding|zinc ion binding			ovary(4)|breast(4)|skin(3)|lung(2)|pancreas(1)	14		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		GAACAGTTCTGACAGGAATCA	0.398													23	89	---	---	---	---	PASS
ZNF219	51222	broad.mit.edu	37	14	21558846	21558846	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:21558846G>C	uc001vzr.2	-	5	2439	c.2018C>G	c.(2017-2019)GCT>GGT	p.A673G	ZNF219_uc001vzs.2_Missense_Mutation_p.A673G|ZNF219_uc010aik.1_Missense_Mutation_p.A673G	NM_016423	NP_057507	Q9P2Y4	ZN219_HUMAN	zinc finger protein 219	673					negative regulation of transcription, DNA-dependent	integral to membrane|nucleus	DNA binding|histamine receptor activity|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(1)	1	all_cancers(95;0.00185)		OV - Ovarian serous cystadenocarcinoma(11;9.86e-11)|Epithelial(56;1.27e-08)|all cancers(55;6.06e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GCGGCCCCTAGCCCGGCGGCT	0.706													10	13	---	---	---	---	PASS
OR10G3	26533	broad.mit.edu	37	14	22038724	22038724	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:22038724G>T	uc010tmb.1	-	1	152	c.152C>A	c.(151-153)GCA>GAA	p.A51E		NM_001005465	NP_001005465	Q8NGC4	O10G3_HUMAN	olfactory receptor, family 10, subfamily G,	51	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			large_intestine(1)|central_nervous_system(1)	2	all_cancers(95;0.000987)			GBM - Glioblastoma multiforme(265;0.0139)		CCTTGGGTCTGCCCAGACAGT	0.468													16	26	---	---	---	---	PASS
SLC7A8	23428	broad.mit.edu	37	14	23596484	23596484	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23596484T>C	uc001wiz.2	-	11	2236	c.1510A>G	c.(1510-1512)ACA>GCA	p.T504A	SLC7A8_uc001wiw.2_Missense_Mutation_p.T121A|SLC7A8_uc001wix.2_Missense_Mutation_p.T301A|SLC7A8_uc010tnk.1_Missense_Mutation_p.T280A|SLC7A8_uc010tnl.1_Missense_Mutation_p.T399A|SLC7A8_uc001wiy.2_RNA|SLC7A8_uc010akj.2_Missense_Mutation_p.D286G	NM_012244	NP_036376	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (cationic amino acid	504					blood coagulation|cellular amino acid metabolic process|leukocyte migration|metal ion homeostasis|response to toxin	basolateral plasma membrane|cytoplasm|integral to plasma membrane	neutral amino acid transmembrane transporter activity|organic cation transmembrane transporter activity|peptide antigen binding|protein binding|toxin transporter activity			ovary(1)	1	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	GCCTCCTCTGTCCCTGAGCCC	0.612													26	48	---	---	---	---	PASS
MDGA2	161357	broad.mit.edu	37	14	47504448	47504448	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:47504448T>C	uc001wwj.3	-	8	1574	c.1378A>G	c.(1378-1380)ACA>GCA	p.T460A	MDGA2_uc001wwi.3_Missense_Mutation_p.T231A|MDGA2_uc010ani.2_Missense_Mutation_p.T20A	NM_001113498	NP_001106970	Q7Z553	MDGA2_HUMAN	MAM domain containing 1 isoform 1	460	Ig-like 5.				spinal cord motor neuron differentiation	anchored to membrane|plasma membrane				ovary(4)|large_intestine(1)|pancreas(1)	6						AGTTCTATTGTGTCTCCTTCT	0.388													50	54	---	---	---	---	PASS
KIAA0831	22863	broad.mit.edu	37	14	55878324	55878324	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55878324C>A	uc001xbx.1	-	1	253	c.217G>T	c.(217-219)GAG>TAG	p.E73*	FBXO34_uc001xbv.2_Intron	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor	73	Potential.				autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						CCGTACCTCTCCCGGTCGCGG	0.672													19	10	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65246624	65246624	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65246624C>T	uc001xht.2	-	20	4346	c.4292G>A	c.(4291-4293)CGA>CAA	p.R1431Q	SPTB_uc001xhr.2_Missense_Mutation_p.R1431Q|SPTB_uc001xhs.2_Missense_Mutation_p.R1431Q|SPTB_uc001xhu.2_Missense_Mutation_p.R1431Q|SPTB_uc010aqi.2_Missense_Mutation_p.R92Q	NM_000347	NP_000338	P11277	SPTB1_HUMAN	spectrin beta isoform b	1431	Spectrin 11.				actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		CTCCTCTTTTCGCACATTCAC	0.483													52	63	---	---	---	---	PASS
ACTN1	87	broad.mit.edu	37	14	69371457	69371457	+	Intron	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:69371457G>C	uc001xkl.2	-						ACTN1_uc010ttb.1_Intron|ACTN1_uc001xkm.2_Intron|ACTN1_uc001xkn.2_Intron|ACTN1_uc001xko.1_Intron|ACTN1_uc010ttd.1_Intron	NM_001102	NP_001093	P12814	ACTN1_HUMAN	actinin, alpha 1 isoform b						focal adhesion assembly|negative regulation of cellular component movement|platelet activation|platelet degranulation|regulation of apoptosis	actin cytoskeleton|cytosol|extracellular region|focal adhesion|nucleolus|platelet alpha granule lumen|pseudopodium|sarcomere	actin binding|calcium ion binding|integrin binding|vinculin binding			central_nervous_system(1)	1				BRCA - Breast invasive adenocarcinoma(234;0.00605)|all cancers(60;0.00846)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		GATCATCCTAGAGGGAGAAAA	0.522													8	71	---	---	---	---	PASS
FLVCR2	55640	broad.mit.edu	37	14	76101273	76101273	+	Silent	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76101273A>G	uc001xrs.2	+	5	1417	c.1041A>G	c.(1039-1041)GGA>GGG	p.G347G	FLVCR2_uc010tvd.1_Silent_p.G142G	NM_017791	NP_060261	Q9UPI3	FLVC2_HUMAN	feline leukemia virus subgroup C cellular	347					transmembrane transport	integral to membrane|plasma membrane	heme binding|heme transporter activity				0				BRCA - Breast invasive adenocarcinoma(234;0.029)		TGAATGCTGGAAGAATTGGCC	0.527													38	49	---	---	---	---	PASS
KIF26A	26153	broad.mit.edu	37	14	104643061	104643061	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:104643061G>T	uc001yos.3	+	12	3936	c.3936G>T	c.(3934-3936)ACG>ACT	p.T1312T		NM_015656	NP_056471	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	1312					blood coagulation|enteric nervous system development|microtubule-based movement|negative regulation of signal transduction|regulation of cell growth by extracellular stimulus	cytosol|microtubule	ATP binding|microtubule binding|microtubule motor activity			pancreas(1)	1		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTGCCACCACGCTGGGTGTGA	0.701													3	8	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106791099	106791099	+	RNA	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106791099C>T	uc010tyt.1	-	386		c.14519G>A								Parts of antibodies, mostly variable regions.												0						GATGGTGAATCGGCCCTTCAC	0.507													37	616	---	---	---	---	PASS
ATP10A	57194	broad.mit.edu	37	15	25971181	25971181	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:25971181C>A	uc010ayu.2	-	5	1002	c.896G>T	c.(895-897)CGC>CTC	p.R299L		NM_024490	NP_077816	O60312	AT10A_HUMAN	ATPase, class V, type 10A	299	Cytoplasmic (Potential).				ATP biosynthetic process|regulation of cell shape	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			pancreas(2)|ovary(1)|breast(1)|liver(1)	5		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		CAGCTTGCTGCGCTTGTAGCG	0.547													14	38	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28419575	28419575	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28419575C>G	uc001zbj.2	-	65	10129	c.10023G>C	c.(10021-10023)CAG>CAC	p.Q3341H		NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	3341					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTCTTGCAGTCTGGAAGAGGA	0.493													13	21	---	---	---	---	PASS
PIAS1	8554	broad.mit.edu	37	15	68468058	68468058	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:68468058C>T	uc002aqz.2	+	10	1349	c.1253C>T	c.(1252-1254)TCA>TTA	p.S418L	PIAS1_uc002ara.2_Missense_Mutation_p.S26L	NM_016166	NP_057250	O75925	PIAS1_HUMAN	protein inhibitor of activated STAT, 1	418					androgen receptor signaling pathway|interferon-gamma-mediated signaling pathway|JAK-STAT cascade|positive regulation of protein sumoylation|positive regulation of transcription, DNA-dependent|regulation of interferon-gamma-mediated signaling pathway|transcription, DNA-dependent	nuclear speck	androgen receptor binding|DNA binding|enzyme binding|SUMO ligase activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)	2						CCGATGAGATCAAAAAAGGAA	0.413													3	21	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79066580	79066580	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79066580C>G	uc002bej.3	-	13	2150	c.1939G>C	c.(1939-1941)GCC>CCC	p.A647P	ADAMTS7_uc010und.1_Intron|ADAMTS7_uc002bek.1_Missense_Mutation_p.A647P	NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	647	Cys-rich.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						TCGACCACGGCGTCCCGCAGC	0.622													10	8	---	---	---	---	PASS
ZFAND6	54469	broad.mit.edu	37	15	80423536	80423536	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:80423536A>G	uc002bfe.1	+	6	690	c.379A>G	c.(379-381)ACA>GCA	p.T127A	ZFAND6_uc002bff.1_Missense_Mutation_p.T127A|ZFAND6_uc002bfg.1_Missense_Mutation_p.T115A|ZFAND6_uc002bfh.1_Missense_Mutation_p.T127A|ZFAND6_uc002bfi.1_Missense_Mutation_p.T127A	NM_019006	NP_061879	Q6FIF0	ZFAN6_HUMAN	zinc finger, AN1-type domain 6	127							DNA binding|zinc ion binding				0						AGTATCAGACACAGCACAGCA	0.398													10	94	---	---	---	---	PASS
RPS2	6187	broad.mit.edu	37	16	2014633	2014633	+	5'UTR	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2014633G>T	uc002cnn.2	-	1					RPS2_uc010bsa.1_5'Flank|RPS2_uc002cnl.2_5'Flank|RPS2_uc002cnm.2_5'Flank|RPS2_uc002cno.2_Intron|SNORA10_uc002cnp.1_5'Flank|SNORA64_uc002cnq.2_5'Flank|SNHG9_uc002cnr.2_5'Flank|SNORA78_uc002cns.1_5'Flank|RNF151_uc002cnt.1_5'Flank	NM_002952	NP_002943	P15880	RS2_HUMAN	ribosomal protein S2						endocrine pancreas development|translational elongation|translational termination|viral transcription	cytosolic small ribosomal subunit|nucleoplasm	fibroblast growth factor 1 binding|fibroblast growth factor 3 binding|RNA binding|structural constituent of ribosome				0						CCATTTGCTGGGAAAAGCGAC	0.697													3	17	---	---	---	---	PASS
DCI	1632	broad.mit.edu	37	16	2296982	2296982	+	Missense_Mutation	SNP	C	T	T	rs72766670	by1000genomes	TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2296982C>T	uc002cpr.2	-	3	208	c.172G>A	c.(172-174)GCT>ACT	p.A58T	DCI_uc002cps.2_Missense_Mutation_p.A58T	NM_001919	NP_001910	P42126	ECI1_HUMAN	dodecenoyl-Coenzyme A delta isomerase precursor	58					fatty acid beta-oxidation	mitochondrial matrix	dodecenoyl-CoA delta-isomerase activity				0						TTCATCACAGCGACCCCTAAT	0.507													9	18	---	---	---	---	PASS
XYLT1	64131	broad.mit.edu	37	16	17352949	17352949	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:17352949C>A	uc002dfa.2	-	3	894	c.809G>T	c.(808-810)CGT>CTT	p.R270L		NM_022166	NP_071449	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	270	Lumenal (Potential).				glycosaminoglycan biosynthetic process	endoplasmic reticulum membrane|extracellular region|Golgi membrane|integral to membrane	acetylglucosaminyltransferase activity|protein xylosyltransferase activity			ovary(4)	4						GGACTTAGCACGGGACAGGGC	0.602													15	64	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28993679	28993679	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28993679T>C	uc010vdi.1	+	9	1108	c.968T>C	c.(967-969)CTC>CCC	p.L323P	uc010vct.1_Intron|SPNS1_uc002drx.2_Missense_Mutation_p.L250P|SPNS1_uc002dsa.2_Missense_Mutation_p.L323P|SPNS1_uc002drz.2_Missense_Mutation_p.L271P|SPNS1_uc010byp.2_Missense_Mutation_p.L249P|SPNS1_uc010byq.1_Missense_Mutation_p.L255P|LAT_uc010vdj.1_5'Flank|LAT_uc002dsb.2_5'Flank|LAT_uc002dsd.2_5'Flank|LAT_uc002dsc.2_5'Flank	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	323	Helical; (Potential).				lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						ACCCCTAGTCTCATCTTTGGA	0.637													18	33	---	---	---	---	PASS
C16orf92	146378	broad.mit.edu	37	16	30035111	30035111	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30035111G>T	uc002dvs.2	+	2	215	c.194G>T	c.(193-195)AGA>ATA	p.R65I	uc002dtf.2_Intron|BOLA2_uc010bzb.1_Intron|C16orf92_uc002dvr.2_Missense_Mutation_p.R43I	NM_001109660	NP_001103130	Q96LL3	CP092_HUMAN	hypothetical protein LOC146378 isoform 2	65						integral to membrane					0						TTCTTAGACAGACCTGACTTC	0.552													6	23	---	---	---	---	PASS
SEPHS2	22928	broad.mit.edu	37	16	30456053	30456053	+	Silent	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30456053T>C	uc010ves.1	-	2	1172	c.996A>G	c.(994-996)CAA>CAG	p.Q332Q	SEPHS2_uc002dyh.1_Silent_p.Q275Q|SEPHS2_uc010vet.1_Silent_p.Q214Q	NM_012248	NP_036380	Q99611	SPS2_HUMAN	selenophosphate synthetase 2	332					selenocysteine biosynthetic process		ATP binding|selenide, water dikinase activity			breast(2)	2						CATTTCTTTGTTGTTTTGCAA	0.458													31	48	---	---	---	---	PASS
NLRC5	84166	broad.mit.edu	37	16	57060632	57060632	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:57060632G>T	uc002ekk.1	+	6	2002	c.1777G>T	c.(1777-1779)GCT>TCT	p.A593S	NLRC5_uc010ccq.1_RNA|NLRC5_uc002ekn.2_Missense_Mutation_p.A398S|NLRC5_uc002ekl.2_Missense_Mutation_p.A398S|NLRC5_uc002ekm.2_Missense_Mutation_p.A398S|NLRC5_uc010ccr.1_RNA	NM_032206	NP_115582	Q86WI3	NLRC5_HUMAN	nucleotide-binding oligomerization domains 27	593					defense response to virus|innate immune response|negative regulation of NF-kappaB transcription factor activity|negative regulation of type I interferon production|negative regulation of type I interferon-mediated signaling pathway|positive regulation of interferon-gamma-mediated signaling pathway|positive regulation of MHC class I biosynthetic process|positive regulation of transcription from RNA polymerase II promoter|positive regulation of type I interferon-mediated signaling pathway|regulation of kinase activity	cytosol|nucleus	ATP binding|protein binding|RNA polymerase II core promoter sequence-specific DNA binding			ovary(4)|skin(2)|breast(1)	7		all_neural(199;0.225)				TGCCAAGCAGGCTGCTGTAGT	0.617													15	76	---	---	---	---	PASS
CDH11	1009	broad.mit.edu	37	16	65026887	65026887	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:65026887C>T	uc002eoi.2	-	5	1008	c.574G>A	c.(574-576)GGA>AGA	p.G192R	CDH11_uc010cdn.2_RNA|CDH11_uc002eoj.2_Missense_Mutation_p.G192R|CDH11_uc010vin.1_Missense_Mutation_p.G66R	NM_001797	NP_001788	P55287	CAD11_HUMAN	cadherin 11, type 2 preproprotein	192	Cadherin 2.|Extracellular (Potential).				adherens junction organization|cell junction assembly|homophilic cell adhesion|ossification|skeletal system development	integral to membrane|plasma membrane	calcium ion binding|protein binding			lung(10)|ovary(3)|skin(1)	14		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		GCGCTATTTCCATAAGTGGGG	0.408			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)			21	115	---	---	---	---	PASS
GFOD2	81577	broad.mit.edu	37	16	67709423	67709423	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67709423C>A	uc002eub.2	-	3	1088	c.793G>T	c.(793-795)GCC>TCC	p.A265S	GFOD2_uc002eua.1_RNA|GFOD2_uc002euc.2_Missense_Mutation_p.A160S	NM_030819	NP_110446	Q3B7J2	GFOD2_HUMAN	glucose-fructose oxidoreductase domain	265						proteinaceous extracellular matrix	binding|oxidoreductase activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0151)|Epithelial(162;0.0505)|all cancers(182;0.242)		TAGAGGTCGGCTCCCCGGGCG	0.622													12	71	---	---	---	---	PASS
TMCO7	79613	broad.mit.edu	37	16	68936358	68936358	+	Silent	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:68936358A>C	uc002ewi.3	+	9	1630	c.1618A>C	c.(1618-1620)AGA>CGA	p.R540R		NM_024562	NP_078838	Q9C0B7	TMCO7_HUMAN	transmembrane and coiled-coil domains 7	540						integral to membrane	binding				0		Ovarian(137;0.0568)		OV - Ovarian serous cystadenocarcinoma(108;0.0446)|Epithelial(162;0.198)		GTGTCAGTTTAGAGTTGCCAC	0.478													35	215	---	---	---	---	PASS
CALB2	794	broad.mit.edu	37	16	71392738	71392738	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:71392738G>A	uc002faa.3	+	1	113	c.43G>A	c.(43-45)GAG>AAG	p.E15K	CALB2_uc010vme.1_RNA|CALB2_uc002fac.3_Missense_Mutation_p.E15K	NM_001740	NP_001731	P22676	CALB2_HUMAN	calbindin 2 isoform 1	15							calcium ion binding				0		Ovarian(137;0.125)				GCACCTGGCCGAGCTGACGGC	0.662													8	26	---	---	---	---	PASS
RFWD3	55159	broad.mit.edu	37	16	74670477	74670477	+	Splice_Site	SNP	T	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74670477T>G	uc002fda.2	-	8	1293	c.1195_splice	c.e8-1	p.D399_splice	RFWD3_uc010cgq.2_Splice_Site_p.D399_splice	NM_018124	NP_060594	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3						DNA repair|mitotic cell cycle G1/S transition DNA damage checkpoint|response to ionizing radiation	nucleus	MDM2 binding|p53 binding|ubiquitin-protein ligase activity|zinc ion binding			lung(2)|breast(1)	3						TTGCAAGTCCTAAAATGAAAA	0.383													13	45	---	---	---	---	PASS
CNTNAP4	85445	broad.mit.edu	37	16	76572187	76572187	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:76572187T>C	uc002feu.1	+	21	3555	c.3170T>C	c.(3169-3171)TTT>TCT	p.F1057S	CNTNAP4_uc002fev.1_Missense_Mutation_p.F921S|CNTNAP4_uc010chb.1_Missense_Mutation_p.F984S|CNTNAP4_uc002fex.1_Missense_Mutation_p.F1060S	NM_033401	NP_207837	Q9C0A0	CNTP4_HUMAN	cell recognition protein CASPR4 isoform 1	1057	Extracellular (Potential).|Laminin G-like 4.				cell adhesion|signal transduction	integral to membrane	receptor binding			ovary(1)|pancreas(1)	2						TTGCTGCTTTTTGTGAGCTCC	0.388													40	187	---	---	---	---	PASS
IRF8	3394	broad.mit.edu	37	16	85948115	85948115	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:85948115C>A	uc002fjh.2	+	6	647	c.590C>A	c.(589-591)GCG>GAG	p.A197E	IRF8_uc010chp.2_Intron	NM_002163	NP_002154	Q02556	IRF8_HUMAN	interferon regulatory factor 8	197			A -> T (in a breast cancer sample; somatic mutation).		interferon-gamma-mediated signaling pathway|negative regulation of transcription from RNA polymerase II promoter|type I interferon-mediated signaling pathway	nucleus	DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity	p.A197T(1)		breast(2)|ovary(1)	3		Prostate(104;0.0771)				ACCTACGACGCGCACCATTCA	0.602													35	39	---	---	---	---	PASS
ANKRD11	29123	broad.mit.edu	37	16	89352526	89352526	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89352526C>T	uc002fmx.1	-	8	1274	c.813G>A	c.(811-813)CTG>CTA	p.L271L	ANKRD11_uc002fmy.1_Silent_p.L271L|ANKRD11_uc002fnc.1_Silent_p.L271L|ANKRD11_uc002fnb.1_Silent_p.L228L	NM_013275	NP_037407	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	271	ANK 4.					nucleus				ovary(4)|large_intestine(1)|central_nervous_system(1)	6		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGGCCACTTTCAGCGGCGTCT	0.602													34	216	---	---	---	---	PASS
SCARF1	8578	broad.mit.edu	37	17	1542992	1542992	+	Nonsense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1542992G>C	uc002fsz.1	-	7	1234	c.1184C>G	c.(1183-1185)TCA>TGA	p.S395*	SCARF1_uc002fsy.1_Nonsense_Mutation_p.S395*|SCARF1_uc002fta.1_RNA|SCARF1_uc010cjv.1_Intron	NM_003693	NP_003684	Q14162	SREC_HUMAN	scavenger receptor class F, member 1 isoform 1	395	Extracellular (Potential).				cell adhesion|neuron remodeling|positive regulation of axon regeneration|receptor-mediated endocytosis	integral to membrane	low-density lipoprotein particle binding|scavenger receptor activity			skin(1)	1				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ACAAGGAACTGAGCAGTTGTT	0.612													2	9	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	A	A	rs121912654		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7578461C>A	uc002gim.2	-	5	663	c.469G>T	c.(469-471)GTC>TTC	p.V157F	TP53_uc002gig.1_Missense_Mutation_p.V157F|TP53_uc002gih.2_Missense_Mutation_p.V157F|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.V25F|TP53_uc010cng.1_Missense_Mutation_p.V25F|TP53_uc002gii.1_Missense_Mutation_p.V25F|TP53_uc010cnh.1_Missense_Mutation_p.V157F|TP53_uc010cni.1_Missense_Mutation_p.V157F|TP53_uc002gij.2_Missense_Mutation_p.V157F|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.V64F|TP53_uc002gio.2_Missense_Mutation_p.V25F|TP53_uc010vug.1_Missense_Mutation_p.V118F	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	157	Required for interaction with FBXO42.||Interaction with HIPK1 (By similarity).|Interaction with AXIN1 (By similarity).		V -> I (in sporadic cancers; somatic mutation).|V -> G (in sporadic cancers; somatic mutation).|V -> A (in sporadic cancers; somatic mutation).|V -> L (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.V157F(139)|p.V157I(10)|p.V157D(8)|p.V157G(7)|p.0?(7)|p.V157L(6)|p.V157V(5)|p.V157fs*13(3)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.V157A(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		ATGGCGCGGACGCGGGTGCCG	0.617		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			23	39	---	---	---	---	PASS
MYH13	8735	broad.mit.edu	37	17	10235464	10235464	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10235464G>T	uc002gmk.1	-	20	2340	c.2250C>A	c.(2248-2250)CTC>CTA	p.L750L		NM_003802	NP_003793	Q9UKX3	MYH13_HUMAN	myosin, heavy polypeptide 13, skeletal muscle	750	Myosin head-like.				muscle contraction	muscle myosin complex|myofibril|myosin filament	actin binding|ATP binding|calmodulin binding|microfilament motor activity			ovary(4)|skin(2)	6						CGATGGAGTTGAGGAGCTTCT	0.552													50	52	---	---	---	---	PASS
MYH4	4622	broad.mit.edu	37	17	10352316	10352316	+	Silent	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:10352316A>G	uc002gmn.2	-	31	4341	c.4230T>C	c.(4228-4230)GCT>GCC	p.A1410A	uc002gml.1_Intron	NM_017533	NP_060003	Q9Y623	MYH4_HUMAN	myosin, heavy polypeptide 4, skeletal muscle	1410	Potential.				muscle filament sliding	muscle myosin complex|myosin filament|sarcomere	actin binding|ATP binding|calmodulin binding|microfilament motor activity|structural constituent of muscle			ovary(10)|skin(2)|central_nervous_system(1)	13						TGGAATTCACAGCTTCTACAT	0.463													12	61	---	---	---	---	PASS
DNAH9	1770	broad.mit.edu	37	17	11535923	11535923	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:11535923C>A	uc002gne.2	+	8	1606	c.1538C>A	c.(1537-1539)TCT>TAT	p.S513Y		NM_001372	NP_001363	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9 isoform 2	513	Potential.|Stem (By similarity).				cell projection organization|cellular component movement|microtubule-based movement|spermatogenesis	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			skin(10)|ovary(4)|breast(3)|central_nervous_system(2)|pancreas(1)	20		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AATGACGTCTCTGAATTTAAC	0.393													22	83	---	---	---	---	PASS
GSDMB	55876	broad.mit.edu	37	17	38068665	38068665	+	Silent	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38068665T>C	uc010cwj.2	-	2	326	c.321A>G	c.(319-321)TCA>TCG	p.S107S	GSDMB_uc010cwk.2_RNA|GSDMB_uc010cwl.2_RNA|GSDMB_uc010cwm.2_RNA|GSDMB_uc002htg.2_Silent_p.S107S|GSDMB_uc002hth.2_Silent_p.S107S|GSDMB_uc010wem.1_Silent_p.S107S	NM_001042471	NP_001035936	Q8TAX9	GSDMB_HUMAN	gasdermin B isoform 1	107						cytoplasm				breast(1)|pancreas(1)	2						GGAAACTGCCTGAAATTGTTA	0.428													28	69	---	---	---	---	PASS
STAT3	6774	broad.mit.edu	37	17	40474455	40474455	+	Nonsense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40474455G>C	uc002hzl.1	-	21	2186	c.1946C>G	c.(1945-1947)TCA>TGA	p.S649*	STAT3_uc002hzk.1_Nonsense_Mutation_p.S649*|STAT3_uc002hzm.1_Nonsense_Mutation_p.S649*|STAT3_uc010wgh.1_Nonsense_Mutation_p.S551*|STAT3_uc002hzn.1_Nonsense_Mutation_p.S649*	NM_139276	NP_644805	P40763	STAT3_HUMAN	signal transducer and activator of transcription	649	SH2.				cellular component movement|eating behavior|eye photoreceptor cell differentiation|glucose homeostasis|interleukin-6-mediated signaling pathway|interspecies interaction between organisms|JAK-STAT cascade involved in growth hormone signaling pathway|negative regulation of transcription from RNA polymerase II promoter|nerve growth factor receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|protein import into nucleus|response to estradiol stimulus|sexual reproduction|temperature homeostasis	cytosol|nucleus|plasma membrane	calcium ion binding|ligand-regulated transcription factor activity|protein dimerization activity|protein kinase binding|sequence-specific DNA binding transcription factor activity|signal transducer activity|transcription factor binding|transcription regulatory region DNA binding			ovary(1)|lung(1)|breast(1)|central_nervous_system(1)	4		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		TTCAGCAAATGACATGTTGTT	0.473									Hyperimmunoglobulin_E_Recurrent_Infection_Syndrome				37	224	---	---	---	---	PASS
FAM134C	162427	broad.mit.edu	37	17	40761340	40761340	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:40761340C>T	uc002ial.2	-	1	106	c.3G>A	c.(1-3)ATG>ATA	p.M1I	TUBG1_uc002ian.2_5'Flank|FAM134C_uc010wgq.1_5'UTR|FAM134C_uc002iam.1_5'UTR|FAM134C_uc010cyk.1_Intron	NM_178126	NP_835227	Q86VR2	F134C_HUMAN	hypothetical protein LOC162427	1						integral to membrane				upper_aerodigestive_tract(1)|ovary(1)	2		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.134)		CGGCCTCAGCCATCTCCCCGC	0.682													14	52	---	---	---	---	PASS
RNF43	54894	broad.mit.edu	37	17	56435697	56435697	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:56435697G>A	uc002iwf.2	-	8	3396	c.1440C>T	c.(1438-1440)GTC>GTT	p.V480V	RNF43_uc010wnv.1_Silent_p.V439V|RNF43_uc002iwh.3_Silent_p.V480V|RNF43_uc002iwg.3_Silent_p.V480V|RNF43_uc010dcw.2_Silent_p.V353V	NM_017763	NP_060233	Q68DV7	RNF43_HUMAN	ring finger protein 43 precursor	480	Cytoplasmic (Potential).|Ser-rich.					endoplasmic reticulum membrane|integral to membrane|nuclear envelope	ligase activity|protein binding|zinc ion binding			ovary(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCGTGCAGTTGACCACAGAGT	0.567													24	67	---	---	---	---	PASS
KLHL14	57565	broad.mit.edu	37	18	30349716	30349716	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:30349716G>T	uc002kxm.1	-	2	1227	c.839C>A	c.(838-840)TCA>TAA	p.S280*		NM_020805	NP_065856	Q9P2G3	KLH14_HUMAN	kelch-like 14	280						cytosol|endoplasmic reticulum membrane				ovary(1)	1						GAAATCCACTGACTGGACCCG	0.647													9	63	---	---	---	---	PASS
HAUS1	115106	broad.mit.edu	37	18	43703282	43703282	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43703282A>T	uc002lbu.2	+	6	698	c.618A>T	c.(616-618)AGA>AGT	p.R206S	HAUS1_uc002lbv.2_Missense_Mutation_p.R130S	NM_138443	NP_612452	Q96CS2	HAUS1_HUMAN	coiled-coil domain containing 5	206					cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|spindle pole				ovary(1)	1						TTTCAGCCAGAGGCATGGATG	0.313													42	106	---	---	---	---	PASS
DSEL	92126	broad.mit.edu	37	18	65179671	65179671	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:65179671C>A	uc002lke.1	-	2	3429	c.2205G>T	c.(2203-2205)AAG>AAT	p.K735N		NM_032160	NP_115536	Q8IZU8	DSEL_HUMAN	dermatan sulfate epimerase-like	725						integral to membrane	isomerase activity|sulfotransferase activity			ovary(3)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	6		Esophageal squamous(42;0.129)				TGAATCTTGTCTTCAGGTTAT	0.398													11	32	---	---	---	---	PASS
TSHZ1	10194	broad.mit.edu	37	18	72998506	72998506	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:72998506G>C	uc002lly.2	+	2	1572	c.1009G>C	c.(1009-1011)GAT>CAT	p.D337H		NM_005786	NP_005777	Q6ZSZ6	TSH1_HUMAN	teashirt family zinc finger 1	382						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GTCAGCCAAGGATCAGAAAGC	0.632													16	35	---	---	---	---	PASS
SALL3	27164	broad.mit.edu	37	18	76755006	76755006	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:76755006C>T	uc002lmt.2	+	2	3015	c.3015C>T	c.(3013-3015)TTC>TTT	p.F1005F	SALL3_uc010dra.2_Intron	NM_171999	NP_741996	Q9BXA9	SALL3_HUMAN	sal-like 3	1005	C2H2-type 7.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Esophageal squamous(42;0.129)|Melanoma(33;0.16)|Prostate(75;0.167)		OV - Ovarian serous cystadenocarcinoma(15;4.69e-06)|BRCA - Breast invasive adenocarcinoma(31;0.0256)		AGCGGCCATTCGTCTGCGCGC	0.517													12	54	---	---	---	---	PASS
HCN2	610	broad.mit.edu	37	19	603849	603849	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:603849A>T	uc002lpe.2	+	2	991	c.938A>T	c.(937-939)GAC>GTC	p.D313V		NM_001194	NP_001185	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic	313	Extracellular (Potential).				cell-cell signaling|muscle contraction	voltage-gated potassium channel complex	cAMP binding|protein binding|sodium channel activity|voltage-gated potassium channel activity				0		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AAGGGCATTGACTCCGAGGTC	0.587													15	40	---	---	---	---	PASS
POLRMT	5442	broad.mit.edu	37	19	619277	619277	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:619277G>A	uc002lpf.1	-	14	3142	c.3086C>T	c.(3085-3087)TCT>TTT	p.S1029F		NM_005035	NP_005026	O00411	RPOM_HUMAN	mitochondrial DNA-directed RNA polymerase	1029	Mediates interaction with TEFM.				transcription initiation from mitochondrial promoter	mitochondrial nucleoid	DNA binding|DNA-directed RNA polymerase activity|protein binding			ovary(1)|pancreas(1)	2		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGATAGTGAGAGGCCTCCCA	0.637													5	100	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2185903	2185903	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2185903G>A	uc002lvb.3	+	3	211	c.175G>A	c.(175-177)GTT>ATT	p.V59I		NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	59						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAGAATTACGTTTTAATTGA	0.488													18	424	---	---	---	---	PASS
MATK	4145	broad.mit.edu	37	19	3781673	3781673	+	Intron	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3781673G>A	uc002lyt.2	-						MATK_uc002lyv.2_Intron|MATK_uc002lyu.2_Intron|MATK_uc010dtq.2_Intron	NM_139355	NP_647612	P42679	MATK_HUMAN	megakaryocyte-associated tyrosine kinase isoform						cell proliferation|mesoderm development|positive regulation of cell proliferation	cytoplasm|nucleus	ATP binding|non-membrane spanning protein tyrosine kinase activity			stomach(2)|ovary(1)|lung(1)|large_intestine(1)	5		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|STAD - Stomach adenocarcinoma(1328;0.18)		CCAGCCCGCTGTGGAGTGAAG	0.562													8	36	---	---	---	---	PASS
STAP2	55620	broad.mit.edu	37	19	4329999	4329999	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:4329999G>A	uc002mab.2	-	5	511	c.414C>T	c.(412-414)GTC>GTT	p.V138V	STAP2_uc002mac.2_Silent_p.V138V|STAP2_uc002mad.2_Silent_p.V31V	NM_001013841	NP_001013863	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	138	SH2.					cytoplasm|nucleus	protein binding			central_nervous_system(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTTGGCCAAGACTTCAGACA	0.647													6	32	---	---	---	---	PASS
EMR1	2015	broad.mit.edu	37	19	6921840	6921840	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6921840C>A	uc002mfw.2	+	14	1775	c.1737C>A	c.(1735-1737)TGC>TGA	p.C579*	EMR1_uc010dvc.2_Nonsense_Mutation_p.C579*|EMR1_uc010dvb.2_Nonsense_Mutation_p.C527*|EMR1_uc010xji.1_Nonsense_Mutation_p.C438*|EMR1_uc010xjj.1_Nonsense_Mutation_p.C402*	NM_001974	NP_001965	Q14246	EMR1_HUMAN	egf-like module containing, mucin-like, hormone	579	GPS.|Extracellular (Potential).|Ser/Thr-rich.				cell adhesion|neuropeptide signaling pathway	integral to plasma membrane	calcium ion binding|G-protein coupled receptor activity			ovary(3)|lung(1)|skin(1)	5	all_hematologic(4;0.166)					ATACCATCTGCAGCTGTAATC	0.502													25	117	---	---	---	---	PASS
FBN3	84467	broad.mit.edu	37	19	8154773	8154773	+	Intron	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:8154773C>T	uc002mjf.2	-						FBN3_uc002mje.2_Intron	NM_032447	NP_115823	Q75N90	FBN3_HUMAN	fibrillin 3 precursor							proteinaceous extracellular matrix	calcium ion binding|extracellular matrix structural constituent			ovary(6)|skin(3)|pancreas(1)|central_nervous_system(1)	11						GGGTGAGGGGCTCACCTTCTC	0.652													3	17	---	---	---	---	PASS
MUC16	94025	broad.mit.edu	37	19	9017356	9017356	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9017356G>C	uc002mkp.2	-	26	38172	c.37968C>G	c.(37966-37968)CTC>CTG	p.L12656L		NM_024690	NP_078966	Q8WXI7	MUC16_HUMAN	mucin 16	12658	SEA 4.|Extracellular (Potential).				cell adhesion	extracellular space|extrinsic to membrane|integral to membrane|plasma membrane	protein binding			lung(30)|ovary(15)|breast(8)|large_intestine(1)|skin(1)|prostate(1)|pancreas(1)	57						CATTGACATAGAGACTGTTCC	0.567													24	259	---	---	---	---	PASS
OR7D4	125958	broad.mit.edu	37	19	9324709	9324709	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9324709G>T	uc002mla.1	-	1	805	c.805C>A	c.(805-807)CAG>AAG	p.Q269K		NM_001005191	NP_001005191	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D,	269	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)|central_nervous_system(1)|skin(1)	4						GAGCTGCTCTGGGAAGAATGG	0.547													7	46	---	---	---	---	PASS
OR7D4	125958	broad.mit.edu	37	19	9324710	9324710	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:9324710G>T	uc002mla.1	-	1	804	c.804C>A	c.(802-804)TCC>TCA	p.S268S		NM_001005191	NP_001005191	Q8NG98	OR7D4_HUMAN	olfactory receptor, family 7, subfamily D,	268	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity	p.S268F(1)		ovary(2)|central_nervous_system(1)|skin(1)	4						AGCTGCTCTGGGAAGAATGGG	0.547													7	44	---	---	---	---	PASS
PRKCSH	5589	broad.mit.edu	37	19	11547298	11547298	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11547298C>T	uc002mrt.2	+	3	504	c.168C>T	c.(166-168)TGC>TGT	p.C56C	CCDC151_uc002mrs.2_5'Flank|CCDC151_uc010dxz.2_5'Flank|PRKCSH_uc002mru.2_Silent_p.C56C|PRKCSH_uc010xlz.1_Silent_p.C56C|PRKCSH_uc010dya.2_Missense_Mutation_p.A25V|PRKCSH_uc002mrv.1_Silent_p.C56C|PRKCSH_uc010dyb.2_Silent_p.C56C	NM_002743	NP_002734	P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H isoform 1	56					innate immune response|intracellular protein kinase cascade|post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen	calcium ion binding|protein kinase C binding				0						ATGACTATTGCGACTGCAAAG	0.383													3	37	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12541337	12541337	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12541337T>C	uc002mtu.2	-	4	1847	c.1649A>G	c.(1648-1650)CAT>CGT	p.H550R		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	550	C2H2-type 15.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						AATTCTTTCATGTACCTTTAA	0.393													23	77	---	---	---	---	PASS
CALR	811	broad.mit.edu	37	19	13054428	13054428	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:13054428G>A	uc002mvu.2	+	8	1118	c.1038G>A	c.(1036-1038)ACG>ACA	p.T346T	CALR_uc002mvv.2_5'Flank|RAD23A_uc002mvw.1_5'Flank|RAD23A_uc002mvx.1_5'Flank|RAD23A_uc002mvz.1_5'Flank|RAD23A_uc002mwa.1_5'Flank|RAD23A_uc002mvy.1_5'Flank|RAD23A_uc010xmw.1_5'Flank	NM_004343	NP_004334	P27797	CALR_HUMAN	calreticulin precursor	346	C-domain.				cell cycle arrest|cellular senescence|glucocorticoid receptor signaling pathway|negative regulation of neuron differentiation|negative regulation of retinoic acid receptor signaling pathway|negative regulation of steroid hormone receptor signaling pathway|negative regulation of transcription from RNA polymerase II promoter|negative regulation of translation|peptide antigen assembly with MHC class I protein complex|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of DNA replication|positive regulation of phagocytosis|post-translational protein modification|protein export from nucleus|protein maturation by protein folding|protein N-linked glycosylation via asparagine|protein stabilization|regulation of apoptosis|sequestering of calcium ion	cytosol|endoplasmic reticulum lumen|extracellular space|MHC class I peptide loading complex|nucleus|perinuclear region of cytoplasm|polysome|proteinaceous extracellular matrix	androgen receptor binding|calcium ion binding|chaperone binding|complement component C1q binding|DNA binding|integrin binding|mRNA binding|protein binding involved in protein folding|sugar binding|ubiquitin protein ligase binding|unfolded protein binding|zinc ion binding			ovary(1)	1					Alteplase(DB00009)|Anistreplase(DB00029)|Antihemophilic Factor(DB00025)|Reteplase(DB00015)|Tenecteplase(DB00031)	GCAACGAGACGTGGGGCGTAA	0.602													10	41	---	---	---	---	PASS
EMR2	30817	broad.mit.edu	37	19	14883226	14883226	+	Missense_Mutation	SNP	C	A	A	rs115448457		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14883226C>A	uc002mzp.1	-	5	739	c.283G>T	c.(283-285)GTG>TTG	p.V95L	EMR2_uc010xnw.1_Missense_Mutation_p.V95L|EMR2_uc002mzo.1_Missense_Mutation_p.V95L|EMR2_uc002mzq.1_Missense_Mutation_p.V95L|EMR2_uc002mzr.1_Missense_Mutation_p.V95L|EMR2_uc002mzs.1_Missense_Mutation_p.V95L|EMR2_uc002mzt.1_Missense_Mutation_p.V95L|EMR2_uc002mzu.1_Missense_Mutation_p.V95L|EMR2_uc010xnx.1_RNA|EMR2_uc010xny.1_RNA	NM_013447	NP_038475	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone	95	Extracellular (Potential).|EGF-like 2; calcium-binding.				cell adhesion|neuropeptide signaling pathway	integral to membrane|plasma membrane	calcium ion binding|G-protein coupled receptor activity			lung(2)|ovary(1)|skin(1)	4						GGGCTGCACACGCAGTCGTAG	0.512													29	77	---	---	---	---	PASS
ZNF14	7561	broad.mit.edu	37	19	19822987	19822987	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19822987C>A	uc002nnk.1	-	4	1257	c.1103G>T	c.(1102-1104)TGT>TTT	p.C368F		NM_021030	NP_066358	P17017	ZNF14_HUMAN	zinc finger protein 14	368	C2H2-type 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)	3		Renal(1328;0.0474)				TGATTTGCCACATCGTTTACA	0.363													5	75	---	---	---	---	PASS
LGI4	163175	broad.mit.edu	37	19	35617286	35617286	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:35617286C>A	uc002nxx.2	-	8	1781	c.1187G>T	c.(1186-1188)CGC>CTC	p.R396L	LGI4_uc002nxy.1_Missense_Mutation_p.R224L|LGI4_uc002nxz.1_Missense_Mutation_p.R224L	NM_139284	NP_644813	Q8N135	LGI4_HUMAN	leucine-rich repeat LGI family, member 4	396	EAR 3.					extracellular region				pancreas(1)	1	all_lung(56;7.56e-09)|Lung NSC(56;1.1e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			TCTCTCGAAGCGGCCACCGGT	0.677													5	23	---	---	---	---	PASS
ZNF565	147929	broad.mit.edu	37	19	36673999	36673999	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36673999C>G	uc002odn.2	-	5	977	c.869G>C	c.(868-870)CGT>CCT	p.R290P	ZNF565_uc010ees.2_Missense_Mutation_p.R225P|ZNF565_uc002odo.2_Missense_Mutation_p.R290P	NM_152477	NP_689690	Q8N9K5	ZN565_HUMAN	zinc finger protein 565	290	C2H2-type 5.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)|skin(1)	2	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.206)			TTGGGAGCCACGAATGAAAGC	0.502													8	93	---	---	---	---	PASS
ZNF829	374899	broad.mit.edu	37	19	37382620	37382620	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:37382620C>G	uc002ofa.1	-	6	1435	c.1073G>C	c.(1072-1074)AGA>ACA	p.R358T	ZNF345_uc002oez.2_Intron	NM_001037232	NP_001032309	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	358	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAGGCCTTTCTACATTCTTC	0.378													9	29	---	---	---	---	PASS
ZNF540	163255	broad.mit.edu	37	19	38090575	38090575	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:38090575T>C	uc002ogq.2	+	3	390	c.58T>C	c.(58-60)TGG>CGG	p.W20R	ZNF540_uc002ogu.2_Missense_Mutation_p.W20R|ZNF540_uc010efq.2_Missense_Mutation_p.W20R	NM_152606	NP_689819	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	20	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)	1			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCAGAAGGAATGGGAGTGCCT	0.403													27	93	---	---	---	---	PASS
PRX	57716	broad.mit.edu	37	19	40901692	40901692	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40901692G>A	uc002onr.2	-	7	2836	c.2567C>T	c.(2566-2568)TCA>TTA	p.S856L	PRX_uc002onq.2_Missense_Mutation_p.S717L|PRX_uc002ons.2_3'UTR	NM_181882	NP_870998	Q9BXM0	PRAX_HUMAN	periaxin isoform 2	856					axon ensheathment	cytoplasm|nucleus|plasma membrane	protein binding			ovary(2)	2			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TAGCTCCACTGAAGGCAGAGT	0.632													15	57	---	---	---	---	PASS
CYP2A13	1553	broad.mit.edu	37	19	41594427	41594427	+	Silent	SNP	G	A	A	rs71579360		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:41594427G>A	uc002opt.2	+	1	60	c.51G>A	c.(49-51)GTG>GTA	p.V17V		NM_000766	NP_000757	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A,	17					xenobiotic metabolic process	endoplasmic reticulum membrane|microsome	aromatase activity|coumarin 7-hydroxylase activity|electron carrier activity|heme binding			ovary(2)|skin(1)	3					Clomipramine(DB01242)|Nicotine(DB00184)	GCCTGACTGTGATGGTCTTGA	0.577													18	41	---	---	---	---	PASS
ATP1A3	478	broad.mit.edu	37	19	42482868	42482868	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42482868C>G	uc002osg.2	-	12	1674	c.1520G>C	c.(1519-1521)CGC>CCC	p.R507P	ATP1A3_uc010xwf.1_Missense_Mutation_p.R518P|ATP1A3_uc010xwg.1_Missense_Mutation_p.R477P|ATP1A3_uc010xwh.1_Missense_Mutation_p.R520P|ATP1A3_uc002osh.2_Missense_Mutation_p.R507P	NM_152296	NP_689509	P13637	AT1A3_HUMAN	Na+/K+ -ATPase alpha 3 subunit	507	Cytoplasmic (Potential).				ATP biosynthetic process	endoplasmic reticulum|Golgi apparatus	ATP binding|metal ion binding|sodium:potassium-exchanging ATPase activity			ovary(1)|pancreas(1)	2						GGTGGAGCAGCGGTCCAGGAT	0.622													24	102	---	---	---	---	PASS
PSG3	5671	broad.mit.edu	37	19	43233400	43233400	+	Missense_Mutation	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43233400T>A	uc002oue.2	-	5	1250	c.1118A>T	c.(1117-1119)CAG>CTG	p.Q373L	PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Missense_Mutation_p.Q373L|PSG3_uc010eil.2_Missense_Mutation_p.Q395L	NM_021016	NP_066296	Q16557	PSG3_HUMAN	pregnancy specific beta-1-glycoprotein 3	373	Ig-like C2-type 3.			Missing (in Ref. 9).	defense response|female pregnancy	extracellular region				ovary(1)|skin(1)	2		Prostate(69;0.00682)				TCCTGATAGCTGAAACTTCCC	0.458													72	262	---	---	---	---	PASS
ZNF229	7772	broad.mit.edu	37	19	44934665	44934665	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:44934665G>C	uc002oze.1	-	6	725	c.291C>G	c.(289-291)TTC>TTG	p.F97L	ZNF229_uc010ejk.1_5'UTR|ZNF229_uc010ejl.1_Missense_Mutation_p.F91L	NM_014518	NP_055333	Q9UJW7	ZN229_HUMAN	zinc finger protein 229	97	KRAB.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(2)|ovary(1)|pancreas(1)	4		Prostate(69;0.0352)				TGTGTGAAAAGAACCTTAATT	0.408													15	67	---	---	---	---	PASS
SYMPK	8189	broad.mit.edu	37	19	46351134	46351134	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:46351134G>C	uc002pdn.2	-	7	797	c.552C>G	c.(550-552)ATC>ATG	p.I184M	SYMPK_uc002pdo.1_Missense_Mutation_p.I184M|SYMPK_uc002pdp.1_Missense_Mutation_p.I184M|SYMPK_uc002pdq.1_Missense_Mutation_p.I184M	NM_004819	NP_004810	Q92797	SYMPK_HUMAN	symplekin	184					cell adhesion|mRNA processing	cytoplasm|cytoskeleton|nucleoplasm|tight junction	protein binding			ovary(1)	1		all_neural(266;0.0299)|Ovarian(192;0.0308)		OV - Ovarian serous cystadenocarcinoma(262;0.00509)|GBM - Glioblastoma multiforme(486;0.0593)		CCACAAACTTGATGGCGTGGG	0.597													12	37	---	---	---	---	PASS
LMTK3	114783	broad.mit.edu	37	19	49006263	49006263	+	Intron	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49006263G>A	uc002pjk.2	-							NM_001080434	NP_001073903			lemur tyrosine kinase 3											lung(5)|central_nervous_system(1)	6		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CCTGTGGAGTGAGGAGGTGGC	0.552													6	21	---	---	---	---	PASS
VRK3	51231	broad.mit.edu	37	19	50482395	50482395	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50482395G>A	uc002prg.2	-	14	1479	c.1381C>T	c.(1381-1383)CGT>TGT	p.R461C	VRK3_uc002prh.1_Missense_Mutation_p.R461C|VRK3_uc002pri.1_Missense_Mutation_p.R411C|VRK3_uc010ens.2_Missense_Mutation_p.R461C|VRK3_uc010ybl.1_Missense_Mutation_p.R411C|VRK3_uc010ybm.1_Missense_Mutation_p.R230C	NM_016440	NP_057524	Q8IV63	VRK3_HUMAN	vaccinia related kinase 3 isoform 1	461						nucleus	ATP binding|protein kinase activity			stomach(1)|skin(1)	2		all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00166)|OV - Ovarian serous cystadenocarcinoma(262;0.00652)		GGAGACACACGCAGATCCTGC	0.572													15	63	---	---	---	---	PASS
SYT3	84258	broad.mit.edu	37	19	51132551	51132551	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51132551C>T	uc002pst.2	-	4	1915	c.1281G>A	c.(1279-1281)TCG>TCA	p.S427S	SYT3_uc002psv.2_Silent_p.S427S|SYT3_uc010ycd.1_Silent_p.S427S	NM_032298	NP_115674	Q9BQG1	SYT3_HUMAN	synaptotagmin III	427	Cytoplasmic (Potential).					cell junction|endosome|integral to membrane|synaptic vesicle membrane	metal ion binding|transporter activity			ovary(2)|breast(1)	3		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GGCCACTGACCGAGCCGCCCT	0.672													7	14	---	---	---	---	PASS
C19orf75	284369	broad.mit.edu	37	19	51768616	51768616	+	Intron	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51768616C>A	uc002pwb.1	+						C19orf75_uc010eov.1_Intron|C19orf75_uc010ycw.1_Intron	NM_173635	NP_775906	Q8N7X8	CS075_HUMAN	hypothetical protein LOC284369							integral to membrane				ovary(1)|pancreas(1)	2						CCCTTCCTCCCCACAGTACCT	0.537													30	101	---	---	---	---	PASS
PPP2R1A	5518	broad.mit.edu	37	19	52716078	52716078	+	Missense_Mutation	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:52716078G>C	uc002pyp.2	+	5	802	c.643G>C	c.(643-645)GAC>CAC	p.D215H	PPP2R1A_uc010ydk.1_Missense_Mutation_p.D160H|PPP2R1A_uc010epm.1_Missense_Mutation_p.D255H|PPP2R1A_uc002pyq.2_Missense_Mutation_p.D36H	NM_014225	NP_055040	P30153	2AAA_HUMAN	alpha isoform of regulatory subunit A, protein	215	PP2A subunit B binding.|SV40 small T antigen binding.|HEAT 6.|Polyoma small and medium T antigens Binding.				ceramide metabolic process|chromosome segregation|G2/M transition of mitotic cell cycle|inactivation of MAPK activity|induction of apoptosis|negative regulation of cell growth|negative regulation of tyrosine phosphorylation of Stat3 protein|protein complex assembly|protein dephosphorylation|regulation of cell adhesion|regulation of cell differentiation|regulation of DNA replication|regulation of transcription, DNA-dependent|regulation of Wnt receptor signaling pathway|response to organic substance|RNA splicing|second-messenger-mediated signaling	chromosome, centromeric region|cytosol|membrane|microtubule cytoskeleton|mitochondrion|nucleus|protein phosphatase type 2A complex|soluble fraction	antigen binding|protein heterodimerization activity|protein phosphatase type 2A regulator activity			endometrium(31)|ovary(28)|lung(2)|breast(2)|skin(1)|kidney(1)|pancreas(1)	66				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		CCTGGCCTCTGACGAGCAGGT	0.602			Mis		clear cell ovarian carcinoma								62	171	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56436388	56436388	+	Silent	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56436388G>C	uc010ygg.1	-	2	358	c.333C>G	c.(331-333)ACC>ACG	p.T111T		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	111							ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		GCAGCTCTTGGGTCTGCACAT	0.443													13	70	---	---	---	---	PASS
C20orf46	55321	broad.mit.edu	37	20	1161765	1161765	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:1161765G>T	uc010gaa.1	-	3	717	c.498C>A	c.(496-498)TAC>TAA	p.Y166*	C20orf46_uc002weq.1_Nonsense_Mutation_p.Y166*	NM_018354	NP_060824	Q9NUR3	CT046_HUMAN	hypothetical protein LOC55321	166						integral to membrane	protein binding			ovary(1)	1						CTAGGCGGGCGTAGTACATCT	0.622													9	28	---	---	---	---	PASS
TGM3	7053	broad.mit.edu	37	20	2308908	2308908	+	Nonsense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2308908G>A	uc002wfx.3	+	9	1327	c.1230G>A	c.(1228-1230)TGG>TGA	p.W410*		NM_003245	NP_003236	Q08188	TGM3_HUMAN	transglutaminase 3 precursor	410					cell envelope organization|hair follicle morphogenesis|keratinization|peptide cross-linking|protein tetramerization	cytoplasm|extrinsic to internal side of plasma membrane	acyltransferase activity|calcium ion binding|GDP binding|GTP binding|GTPase activity|magnesium ion binding|protein-glutamine gamma-glutamyltransferase activity			large_intestine(4)|ovary(3)|breast(1)|skin(1)	9					L-Glutamine(DB00130)	GCAAACAGTGGAAGAATTCCG	0.542													24	50	---	---	---	---	PASS
SIGLEC1	6614	broad.mit.edu	37	20	3677795	3677795	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3677795C>T	uc002wja.2	-	9	2317	c.2317G>A	c.(2317-2319)GCC>ACC	p.A773T	SIGLEC1_uc002wiz.3_Missense_Mutation_p.A773T	NM_023068	NP_075556	Q9BZZ2	SN_HUMAN	sialoadhesin precursor	773	Ig-like C2-type 7.|Extracellular (Potential).				cell-cell adhesion|cell-matrix adhesion|endocytosis|inflammatory response	extracellular region|integral to membrane|plasma membrane	sugar binding			pancreas(4)|ovary(2)|skin(2)|breast(1)|central_nervous_system(1)	10						ATGCGGCAGGCGTAAAGGGCA	0.632													25	41	---	---	---	---	PASS
ZNF133	7692	broad.mit.edu	37	20	18296277	18296277	+	Missense_Mutation	SNP	A	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18296277A>G	uc010gcq.2	+	5	1087	c.782A>G	c.(781-783)CAG>CGG	p.Q261R	ZNF133_uc010zrv.1_Missense_Mutation_p.Q264R|ZNF133_uc010zrw.1_Missense_Mutation_p.Q198R|ZNF133_uc010gcr.2_Missense_Mutation_p.Q261R|ZNF133_uc010zrx.1_Missense_Mutation_p.Q166R|ZNF133_uc002wql.3_Missense_Mutation_p.Q260R|ZNF133_uc010gcs.2_Missense_Mutation_p.Q260R|ZNF133_uc010zry.1_Missense_Mutation_p.Q166R|ZNF133_uc002wqm.2_Missense_Mutation_p.Q261R	NM_003434	NP_003425	P52736	ZN133_HUMAN	zinc finger protein 133	261	C2H2-type 2.					nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|pancreas(1)	2						GCCAGACACCAGAAGGCACAC	0.557													21	52	---	---	---	---	PASS
TGIF2	60436	broad.mit.edu	37	20	35219627	35219627	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35219627G>A	uc002xfn.2	+	3	680	c.507G>A	c.(505-507)AGG>AGA	p.R169R	C20orf24_uc002xfo.2_Intron	NM_021809	NP_068581	Q9GZN2	TGIF2_HUMAN	TGFB-induced factor homeobox 2	169	Repressive function.					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			pancreas(1)|skin(1)	2	Breast(12;0.114)	Myeloproliferative disorder(115;0.00878)				TGCTGACCAGGGCTGAGGCTG	0.632													35	48	---	---	---	---	PASS
C20orf118	140711	broad.mit.edu	37	20	35509121	35509121	+	Missense_Mutation	SNP	A	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:35509121A>T	uc002xgg.1	+	4	414	c.406A>T	c.(406-408)ACA>TCA	p.T136S		NM_080628	NP_542195	A0PJX2	CT118_HUMAN	hypothetical protein LOC140711	136	TLD.										0		Myeloproliferative disorder(115;0.00874)				TACTGGCGAGACATTCCTCTT	0.527													14	151	---	---	---	---	PASS
SLC12A5	57468	broad.mit.edu	37	20	44680515	44680515	+	Intron	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:44680515G>T	uc010zxl.1	+						SLC12A5_uc002xrb.2_Intron	NM_001134771	NP_001128243	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium-chloride						potassium ion transport|sodium ion transport	integral to membrane	potassium:chloride symporter activity			ovary(2)|large_intestine(1)|central_nervous_system(1)|skin(1)	5		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	CATTGGTAACGCTATTGGGGG	0.617													28	42	---	---	---	---	PASS
NCOA3	8202	broad.mit.edu	37	20	46281693	46281693	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:46281693G>T	uc002xtk.2	+	22	4345	c.4140G>T	c.(4138-4140)CAG>CAT	p.Q1380H	NCOA3_uc002xtl.2_Missense_Mutation_p.Q1376H|NCOA3_uc002xtm.2_Missense_Mutation_p.Q1375H|NCOA3_uc002xtn.2_Missense_Mutation_p.Q1379H|NCOA3_uc010zyc.1_Missense_Mutation_p.Q1175H	NM_181659	NP_858045	Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3 isoform a	1380					androgen receptor signaling pathway|cellular lipid metabolic process|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nucleoplasm	androgen receptor binding|histone acetyltransferase activity|ligand-dependent nuclear receptor binding|protein N-terminus binding|signal transducer activity|thyroid hormone receptor binding			ovary(3)|lung(1)|skin(1)	5						CCCAGCAGCAGTTTGCCCACC	0.468													15	180	---	---	---	---	PASS
ZGPAT	84619	broad.mit.edu	37	20	62340457	62340457	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62340457G>A	uc002ygk.2	+	2	703	c.525G>A	c.(523-525)AAG>AAA	p.K175K	ARFRP1_uc002yga.2_5'Flank|ARFRP1_uc002ygc.2_5'Flank|ARFRP1_uc002ygh.3_5'Flank|ARFRP1_uc011abf.1_5'Flank|ARFRP1_uc011abg.1_5'Flank|ARFRP1_uc002yge.2_5'Flank|ARFRP1_uc002ygd.2_5'Flank|ARFRP1_uc002ygf.2_5'Flank|ARFRP1_uc002ygg.2_5'Flank|ARFRP1_uc011abh.1_5'Flank|ZGPAT_uc002ygi.2_Silent_p.K175K|ZGPAT_uc002ygj.2_Silent_p.K175K|ZGPAT_uc010gkk.1_Intron|ZGPAT_uc010gkl.1_Silent_p.K175K|ZGPAT_uc002ygm.2_Silent_p.K175K|ZGPAT_uc002ygn.3_RNA	NM_032527	NP_115916	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	175	C3H1-type.				negative regulation of epidermal growth factor receptor activity|negative regulation of transcription, DNA-dependent	nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CCACTCACAAGTCTCTGAAGC	0.572													9	157	---	---	---	---	PASS
TPTE	7179	broad.mit.edu	37	21	10944750	10944750	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:10944750C>A	uc002yip.1	-	11	852	c.484G>T	c.(484-486)GAT>TAT	p.D162Y	TPTE_uc002yis.1_RNA|TPTE_uc002yiq.1_Missense_Mutation_p.D144Y|TPTE_uc002yir.1_Missense_Mutation_p.D124Y|TPTE_uc010gkv.1_Missense_Mutation_p.D24Y	NM_199261	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	162					signal transduction	integral to membrane	ion channel activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity			ovary(2)|lung(1)|breast(1)|skin(1)	5			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		ATGGCAGTATCTAAAATGTTA	0.308													29	230	---	---	---	---	PASS
POTED	317754	broad.mit.edu	37	21	14982885	14982885	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:14982885C>A	uc002yjb.1	+	1	388	c.336C>A	c.(334-336)AGC>AGA	p.S112R		NM_174981	NP_778146	Q86YR6	POTED_HUMAN	pote protein	112						plasma membrane				ovary(3)|skin(3)	6						GCAGGGGGAGCGGCAAGAGCA	0.577													21	32	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19737458	19737458	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19737458G>T	uc002ykw.2	-	7	803	c.772C>A	c.(772-774)CGT>AGT	p.R258S		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	258	Extracellular (Potential).|CUB 1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						TTGTATTACCGTATGATCCAC	0.343													19	53	---	---	---	---	PASS
KRTAP10-5	386680	broad.mit.edu	37	21	45999820	45999820	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45999820G>A	uc002zfl.1	-	1	662	c.636C>T	c.(634-636)ACC>ACT	p.T212T	C21orf29_uc002zfe.1_Intron|C21orf29_uc010gpv.1_Intron	NM_198694	NP_941967	P60370	KR105_HUMAN	keratin associated protein 10-5	212	22 X 5 AA repeats of C-C-X(3).|18.					keratin filament					0						TGCAGCAGGAGGTGGTGCAGC	0.647													49	98	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47541465	47541465	+	Intron	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47541465C>G	uc002zia.1	+						COL6A2_uc002zhy.1_Intron|COL6A2_uc002zhz.1_Intron|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor						axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		CTCTCCTGCCCTCAGGGATCT	0.652													10	33	---	---	---	---	PASS
HPS4	89781	broad.mit.edu	37	22	26853846	26853846	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26853846G>A	uc003acl.2	-	13	2593	c.1934C>T	c.(1933-1935)GCG>GTG	p.A645V	HPS4_uc003aci.2_Missense_Mutation_p.A640V|HPS4_uc003acj.2_Missense_Mutation_p.A509V|HPS4_uc003ack.2_Missense_Mutation_p.A436V|HPS4_uc003acn.2_Missense_Mutation_p.A491V|HPS4_uc003ach.2_Missense_Mutation_p.A380V	NM_022081	NP_071364	Q9NQG7	HPS4_HUMAN	light ear protein isoform a	645					lysosome organization|positive regulation of eye pigmentation|protein stabilization|protein targeting	lysosome|melanosome|membrane fraction|platelet dense granule	protein homodimerization activity				0						TTCATAAAGCGCGGGCAGCTG	0.632									Hermansky-Pudlak_syndrome				4	54	---	---	---	---	PASS
SEC14L4	284904	broad.mit.edu	37	22	30890178	30890178	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:30890178G>T	uc003aid.2	-	7	639	c.539C>A	c.(538-540)GCA>GAA	p.A180E	SEC14L4_uc011akz.1_Missense_Mutation_p.A180E|SEC14L4_uc003aie.2_Missense_Mutation_p.A165E|SEC14L4_uc003aif.2_Missense_Mutation_p.A126E	NM_174977	NP_777637	Q9UDX3	S14L4_HUMAN	SEC14p-like protein TAP3 isoform a	180	CRAL-TRIO.					integral to membrane|intracellular	lipid binding|transporter activity			skin(1)	1					Vitamin E(DB00163)	AGGATAATTTGCTTCCAGGAT	0.512													29	80	---	---	---	---	PASS
EIF3L	51386	broad.mit.edu	37	22	38273833	38273833	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38273833A>C	uc003auf.2	+	11	1317	c.1230A>C	c.(1228-1230)GAA>GAC	p.E410D	EIF3L_uc003aue.1_Missense_Mutation_p.E410D|EIF3L_uc011ann.1_Missense_Mutation_p.E362D|EIF3L_uc003aug.2_Missense_Mutation_p.E302D|EIF3L_uc003auh.2_Missense_Mutation_p.E143D	NM_016091	NP_057175	Q9Y262	EIF3L_HUMAN	eukaryotic translation initiation factor 3	410						eukaryotic translation initiation factor 3 complex	protein binding|translation initiation factor activity			ovary(1)	1						AAGTCTATGAAGAACTTTTCA	0.507													25	58	---	---	---	---	PASS
ATF4	468	broad.mit.edu	37	22	39917932	39917932	+	Silent	SNP	C	G	G	rs147705048		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39917932C>G	uc003axz.2	+	3	661	c.381C>G	c.(379-381)GTC>GTG	p.V127V	ATF4_uc011aol.1_Silent_p.V39V|ATF4_uc003aya.2_Silent_p.V127V	NM_182810	NP_877962	P18848	ATF4_HUMAN	activating transcription factor 4	127					cellular amino acid metabolic process|gluconeogenesis|positive regulation of transcription from RNA polymerase II promoter|response to endoplasmic reticulum stress|transcription from RNA polymerase II promoter	cytoplasm|plasma membrane	protein dimerization activity|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity				0	Melanoma(58;0.04)					CCCCCCTAGTCCAGGAGACTA	0.522													53	201	---	---	---	---	PASS
PLXNB2	23654	broad.mit.edu	37	22	50719566	50719566	+	Nonsense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50719566C>A	uc003bkv.3	-	23	3821	c.3715G>T	c.(3715-3717)GAG>TAG	p.E1239*	PLXNB2_uc003bkt.1_Nonsense_Mutation_p.E31*|PLXNB2_uc003bku.1_Nonsense_Mutation_p.E224*	NM_012401	NP_036533	O15031	PLXB2_HUMAN	plexin B2 precursor	1239	Cytoplasmic (Potential).				regulation of small GTPase mediated signal transduction	integral to membrane|intracellular	GTPase activator activity|protein binding|receptor activity			ovary(4)|central_nervous_system(1)|skin(1)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TCCAGGCCCTCCAGCTGGGAC	0.662													7	17	---	---	---	---	PASS
ODF3B	440836	broad.mit.edu	37	22	50969224	50969224	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:50969224G>A	uc003bmh.2	-	6	735	c.598C>T	c.(598-600)CCC>TCC	p.P200S	TYMP_uc003bmb.3_5'Flank|TYMP_uc003bmc.3_5'Flank|TYMP_uc003bmd.3_5'Flank|TYMP_uc010hbd.2_5'Flank|TYMP_uc003bme.3_5'Flank|TYMP_uc003bmf.3_5'Flank|TYMP_uc011arz.1_5'Flank|ODF3B_uc003bmg.2_Missense_Mutation_p.P176L	NM_001014440	NP_001014440	A8MYP8	ODF3B_HUMAN	outer dense fiber of sperm tails 3B	200	DUF1309.										0						GTGAACTGGGGGGCCCGGGAC	0.692													3	19	---	---	---	---	PASS
ACR	49	broad.mit.edu	37	22	51178279	51178279	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:51178279G>A	uc003bnh.3	+	3	451	c.439G>A	c.(439-441)GAG>AAG	p.E147K	uc003bng.2_5'Flank|ACR_uc010hbh.1_Missense_Mutation_p.E147K	NM_001097	NP_001088	P10323	ACRO_HUMAN	acrosin precursor	147	Peptidase S1.				acrosome matrix dispersal|activation of adenylate cyclase activity	acrosomal matrix|protein complex	amidase activity|copper ion binding|DNA binding|drug binding|fucose binding|mannose binding|protein binding|serine-type endopeptidase activity|zinc ion binding				0		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;1.1e-06)|LUAD - Lung adenocarcinoma(64;0.247)		TGCCCTCGTGGAGATCACCCC	0.547													44	122	---	---	---	---	PASS
P2RY8	286530	broad.mit.edu	37	X	1585301	1585301	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1585301G>T	uc004cpz.2	-	2	399	c.151C>A	c.(151-153)CGC>AGC	p.R51S		NM_178129	NP_835230	Q86VZ1	P2RY8_HUMAN	G-protein coupled purinergic receptor P2Y8	51	Cytoplasmic (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			lung(5)	5		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GGCCCCATGCGCCGGCACAGC	0.637			T	CRLF2	B-ALL|Downs associated ALL								12	48	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15287980	15287980	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15287980C>A	uc004cwl.2	-	1	264	c.17G>T	c.(16-18)GGG>GTG	p.G6V	ASB9_uc004cwk.2_Missense_Mutation_p.G6V|ASB9_uc004cwm.2_Missense_Mutation_p.G6V|ASB9_uc010ner.2_Missense_Mutation_p.G6V|ASB9_uc004cwn.2_Missense_Mutation_p.G6V	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	6					intracellular signal transduction						0	Hepatocellular(33;0.183)					ATCCATGCCCCCTTGTTTGCC	0.567													12	105	---	---	---	---	PASS
ASB9	140462	broad.mit.edu	37	X	15287981	15287981	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:15287981C>G	uc004cwl.2	-	1	263	c.16G>C	c.(16-18)GGG>CGG	p.G6R	ASB9_uc004cwk.2_Missense_Mutation_p.G6R|ASB9_uc004cwm.2_Missense_Mutation_p.G6R|ASB9_uc010ner.2_Missense_Mutation_p.G6R|ASB9_uc004cwn.2_Missense_Mutation_p.G6R	NM_001031739	NP_001026909	Q96DX5	ASB9_HUMAN	ankyrin repeat and SOCS box-containing 9 isoform	6					intracellular signal transduction						0	Hepatocellular(33;0.183)					TCCATGCCCCCTTGTTTGCCA	0.567													11	104	---	---	---	---	PASS
PDHA1	5160	broad.mit.edu	37	X	19375842	19375842	+	Intron	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:19375842G>T	uc004czg.3	+						PDHA1_uc004czh.3_Intron|PDHA1_uc011mjc.1_Intron|PDHA1_uc011mjd.1_Intron|PDHA1_uc010nfk.2_Intron|PDHA1_uc010nfl.2_Intron	NM_000284	NP_000275	P08559	ODPA_HUMAN	pyruvate dehydrogenase E1 alpha 1 precursor						glycolysis|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	protein binding|pyruvate dehydrogenase (acetyl-transferring) activity			ovary(1)	1	Hepatocellular(33;0.183)				NADH(DB00157)	AGTCAGGTACGCTCATGGGCA	0.493													38	131	---	---	---	---	PASS
MAGEB2	4113	broad.mit.edu	37	X	30237316	30237316	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:30237316C>A	uc004dbz.2	+	2	722	c.619C>A	c.(619-621)CTC>ATC	p.L207I		NM_002364	NP_002355	O15479	MAGB2_HUMAN	melanoma antigen family B, 2	207	MAGE.						protein binding			ovary(1)	1						TCTGATGCCTCTCCTGGGTGT	0.493													11	33	---	---	---	---	PASS
XK	7504	broad.mit.edu	37	X	37553744	37553744	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:37553744C>A	uc004ddq.2	+	2	533	c.451C>A	c.(451-453)CAG>AAG	p.Q151K		NM_021083	NP_066569	P51811	XK_HUMAN	membrane transport protein XK	151	Helical; (Potential).				amino acid transport	integral to membrane	protein binding|transporter activity				0		all_lung(315;0.175)				CTCAGCCCCCCAGCTGACCCT	0.522													2	5	---	---	---	---	PASS
CACNA1F	778	broad.mit.edu	37	X	49068374	49068374	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49068374C>A	uc004dnb.2	-	35	4179	c.4117G>T	c.(4117-4119)GTG>TTG	p.V1373L	CACNA1F_uc010nip.2_Missense_Mutation_p.V1362L	NM_005183	NP_005174	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type,	1373	Extracellular (Potential).|IV.				axon guidance|detection of light stimulus involved in visual perception	voltage-gated calcium channel complex	protein binding|voltage-gated calcium channel activity			breast(3)|ovary(1)|kidney(1)|skin(1)	6					Verapamil(DB00661)	AGAAGCAGCACAGCCTGTGGA	0.552													18	77	---	---	---	---	PASS
FOXP3	50943	broad.mit.edu	37	X	49109673	49109673	+	Intron	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49109673G>T	uc004dnf.3	-						FOXP3_uc011mnb.1_Intron|FOXP3_uc011mnc.1_Intron|FOXP3_uc004dne.3_Intron|FOXP3_uc010niq.1_Intron	NM_014009	NP_054728	Q9BZS1	FOXP3_HUMAN	forkhead box P3 isoform a						B cell homeostasis|cerebellum development|chromatin remodeling|embryo development|myeloid cell homeostasis|negative regulation of activated T cell proliferation|negative regulation of chronic inflammatory response|negative regulation of CREB transcription factor activity|negative regulation of cytokine secretion|negative regulation of histone acetylation|negative regulation of histone deacetylation|negative regulation of interferon-gamma biosynthetic process|negative regulation of interferon-gamma production|negative regulation of interleukin-10 production|negative regulation of interleukin-2 biosynthetic process|negative regulation of interleukin-2 production|negative regulation of interleukin-4 production|negative regulation of interleukin-5 production|negative regulation of interleukin-6 production|negative regulation of isotype switching to IgE isotypes|negative regulation of NF-kappaB transcription factor activity|negative regulation of T cell cytokine production|negative regulation of tumor necrosis factor production|pattern specification process|positive regulation of CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation|positive regulation of histone acetylation|positive regulation of immature T cell proliferation in thymus|positive regulation of peripheral T cell tolerance induction|positive regulation of T cell anergy|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transforming growth factor-beta1 production|post-embryonic development|regulation of isotype switching to IgG isotypes|response to virus|T cell homeostasis|T cell receptor signaling pathway|tolerance induction to self antigen	cytoplasm|cytoplasm|nucleus|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|histone acetyltransferase binding|histone deacetylase binding|NF-kappaB binding|NFAT protein binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription corepressor activity|zinc ion binding				0	Ovarian(276;0.236)					TCTGTCAGAGGGTGGGGATGA	0.577													7	15	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50350935	50350935	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50350935G>T	uc004dpe.2	-	6	3233	c.3207C>A	c.(3205-3207)AGC>AGA	p.S1069R	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	1069					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AGGCCCGGGTGCTTTGGGGCG	0.597													24	63	---	---	---	---	PASS
SHROOM4	57477	broad.mit.edu	37	X	50351168	50351168	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:50351168T>C	uc004dpe.2	-	6	3000	c.2974A>G	c.(2974-2976)AAG>GAG	p.K992E	SHROOM4_uc004dpd.3_RNA	NM_020717	NP_065768	Q9ULL8	SHRM4_HUMAN	shroom family member 4	992					actin filament organization|brain development|cell morphogenesis|cognition	apical plasma membrane|basal plasma membrane|internal side of plasma membrane|nucleus	actin filament binding			upper_aerodigestive_tract(1)	1	Ovarian(276;0.236)					AAGCTAGTCTTGGAATGAGCC	0.303													7	60	---	---	---	---	PASS
SPIN4	139886	broad.mit.edu	37	X	62570029	62570029	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62570029C>T	uc004dvf.2	-	1	1190	c.670G>A	c.(670-672)GTG>ATG	p.V224M		NM_001012968	NP_001012986	Q56A73	SPIN4_HUMAN	spindlin family, member 4	224					gamete generation					ovary(1)|lung(1)	2						GGCTTCGCCACCACTTGATGT	0.438													35	115	---	---	---	---	PASS
STARD8	9754	broad.mit.edu	37	X	67937293	67937293	+	Silent	SNP	C	A	A	rs138134354	byFrequency	TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:67937293C>A	uc004dxa.2	+	5	669	c.297C>A	c.(295-297)CCC>CCA	p.P99P	STARD8_uc004dxb.2_Silent_p.P179P|STARD8_uc004dxc.3_Silent_p.P99P	NM_014725	NP_055540	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain	99					regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion	GTPase activator activity			breast(3)|ovary(2)|pancreas(1)	6						GCCGTGCCCCCAGCTCGAGTG	0.652													12	41	---	---	---	---	PASS
PJA1	64219	broad.mit.edu	37	X	68383037	68383037	+	Silent	SNP	T	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:68383037T>A	uc004dxh.2	-	2	331	c.45A>T	c.(43-45)GGA>GGT	p.G15G	PJA1_uc011mpi.1_Intron|PJA1_uc004dxg.2_Silent_p.G15G|PJA1_uc004dxi.2_Intron	NM_145119	NP_660095	Q8NG27	PJA1_HUMAN	praja 1 isoform a	15							zinc ion binding				0						ACTGATACCCTCCTGTTGGAT	0.542													37	112	---	---	---	---	PASS
DLG3	1741	broad.mit.edu	37	X	69712107	69712107	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:69712107G>A	uc004dyi.1	+	11	1999	c.1671G>A	c.(1669-1671)CAG>CAA	p.Q557Q	DLG3_uc004dyj.1_Silent_p.Q220Q|DLG3_uc011mpn.1_Silent_p.Q73Q	NM_021120	NP_066943	Q92796	DLG3_HUMAN	synapse-associated protein 102 isoform a	557	SH3.				axon guidance|negative regulation of cell proliferation|synaptic transmission	plasma membrane	guanylate kinase activity			large_intestine(1)|pancreas(1)	2	Renal(35;0.156)					AAAGTGAGCAGATCGGTGTGA	0.488													16	53	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70351454	70351454	+	Missense_Mutation	SNP	A	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70351454A>C	uc004dyy.2	+	29	4301	c.4102A>C	c.(4102-4104)AAG>CAG	p.K1368Q	MED12_uc011mpq.1_Missense_Mutation_p.K1368Q|MED12_uc004dyz.2_Missense_Mutation_p.K1368Q|MED12_uc004dza.2_Missense_Mutation_p.K1215Q|MED12_uc010nla.2_5'UTR	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1368					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					GCTCATGATCAAGCAGACCCC	0.557													19	68	---	---	---	---	PASS
PHKA1	5255	broad.mit.edu	37	X	71802349	71802349	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:71802349C>G	uc004eax.3	-	31	3698	c.3397G>C	c.(3397-3399)GTC>CTC	p.V1133L	PHKA1_uc004eay.3_Missense_Mutation_p.V1120L|PHKA1_uc011mqi.1_Missense_Mutation_p.V1061L|PHKA1_uc010nll.2_Missense_Mutation_p.V165L	NM_002637	NP_002628	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle) isoform	1133					glucose metabolic process|glycogen catabolic process	cytosol|plasma membrane	calmodulin binding|glucan 1,4-alpha-glucosidase activity|phosphorylase kinase activity			ovary(3)|skin(1)	4	Renal(35;0.156)					ATGGTGAGGACAAGGATGGCT	0.448													10	83	---	---	---	---	PASS
RLIM	51132	broad.mit.edu	37	X	73811707	73811707	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:73811707G>A	uc004ebu.2	-	5	1733	c.1443C>T	c.(1441-1443)TCC>TCT	p.S481S	RLIM_uc004ebw.2_Silent_p.S481S	NM_183353	NP_899196	Q9NVW2	RNF12_HUMAN	ring finger protein, LIM domain interacting	481	Ser-rich.|Poly-Ser.				random inactivation of X chromosome|transcription, DNA-dependent|ubiquitin-dependent protein catabolic process	cytoplasm|transcriptional repressor complex	transcription corepressor activity|ubiquitin-protein ligase activity|zinc ion binding			ovary(2)	2						TTTCACCAccggaactggaac	0.284													20	51	---	---	---	---	PASS
ZDHHC15	158866	broad.mit.edu	37	X	74644568	74644568	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:74644568C>A	uc004ecg.2	-	8	1133	c.655G>T	c.(655-657)GTG>TTG	p.V219L	ZDHHC15_uc004ech.2_Missense_Mutation_p.V210L|ZDHHC15_uc011mqo.1_RNA	NM_144969	NP_659406	Q96MV8	ZDH15_HUMAN	zinc finger, DHHC-type containing 15 isoform 1	219	Helical; (Potential).					integral to membrane	zinc ion binding			ovary(2)	2						ATGCAGGCCACAAAGAGAAGA	0.388													7	22	---	---	---	---	PASS
P2RY10	27334	broad.mit.edu	37	X	78216935	78216935	+	Silent	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78216935C>T	uc004ede.2	+	4	1287	c.918C>T	c.(916-918)TAC>TAT	p.Y306Y	P2RY10_uc004edf.2_Silent_p.Y306Y	NM_014499	NP_055314	O00398	P2Y10_HUMAN	G-protein coupled purinergic receptor P2Y10	306	Helical; Name=7; (Potential).					integral to membrane|plasma membrane	purinergic nucleotide receptor activity, G-protein coupled			ovary(2)|lung(2)|breast(1)	5						TTCTTTATTACTTTATGGCTT	0.488													64	207	---	---	---	---	PASS
ITM2A	9452	broad.mit.edu	37	X	78618572	78618572	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:78618572C>A	uc004edh.2	-	3	643	c.308G>T	c.(307-309)GGA>GTA	p.G103V	ITM2A_uc011mqr.1_Missense_Mutation_p.G59V	NM_004867	NP_004858	O43736	ITM2A_HUMAN	integral membrane protein 2A	103						integral to membrane	protein binding			lung(2)	2						AGGCTCTCCTCCACGAAGGGA	0.443													12	40	---	---	---	---	PASS
DACH2	117154	broad.mit.edu	37	X	86067949	86067949	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:86067949G>T	uc004eew.2	+	8	1501	c.1331G>T	c.(1330-1332)GGA>GTA	p.G444V	DACH2_uc004eex.2_Missense_Mutation_p.G431V|DACH2_uc010nmq.2_Missense_Mutation_p.G310V|DACH2_uc011mra.1_Missense_Mutation_p.G277V|DACH2_uc010nmr.2_Missense_Mutation_p.G225V|DACH2_uc004eey.2_Missense_Mutation_p.G127V|DACH2_uc004eez.2_Missense_Mutation_p.G127V	NM_053281	NP_444511	Q96NX9	DACH2_HUMAN	dachshund 2 isoform a	444					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|nucleotide binding			ovary(4)|pancreas(1)	5						GGATTCCCTGGACCATTCATT	0.423													9	26	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91133468	91133468	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91133468C>G	uc004efk.1	+	2	3074	c.2229C>G	c.(2227-2229)GAC>GAG	p.D743E	PCDH11X_uc004efl.1_Missense_Mutation_p.D743E|PCDH11X_uc004efo.1_Missense_Mutation_p.D743E|PCDH11X_uc010nmv.1_Missense_Mutation_p.D743E|PCDH11X_uc004efm.1_Missense_Mutation_p.D743E|PCDH11X_uc004efn.1_Missense_Mutation_p.D743E|PCDH11X_uc004efh.1_Missense_Mutation_p.D743E|PCDH11X_uc004efj.1_Missense_Mutation_p.D743E	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c	743	Cadherin 7.|Extracellular (Potential).				homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ATGTTACAGACCTTGGTTTAC	0.413													13	96	---	---	---	---	PASS
SRPX2	27286	broad.mit.edu	37	X	99924320	99924320	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:99924320C>A	uc004egb.2	+	10	1651	c.1171C>A	c.(1171-1173)CGC>AGC	p.R391S		NM_014467	NP_055282	O60687	SRPX2_HUMAN	sushi-repeat-containing protein, X-linked 2	391					angiogenesis|cell motility|cell-cell adhesion|positive regulation of cell migration involved in sprouting angiogenesis|regulation of phosphorylation	cytoplasm|extracellular region	receptor binding			ovary(2)	2						GGAGGTGGGGCGCATCCGGGA	0.612													10	37	---	---	---	---	PASS
TCEAL6	158931	broad.mit.edu	37	X	101396002	101396002	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101396002G>A	uc004eiq.2	-	3	463	c.302C>T	c.(301-303)CCG>CTG	p.P101L		NM_001006938	NP_001006939	Q6IPX3	TCAL6_HUMAN	transcription elongation factor A (SII)-like 6	101					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus				ovary(1)	1						ATCTCCAGCCGGGCGCTTTTC	0.612													40	151	---	---	---	---	PASS
PLP1	5354	broad.mit.edu	37	X	103042767	103042767	+	Missense_Mutation	SNP	T	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:103042767T>C	uc010nov.2	+	5	774	c.494T>C	c.(493-495)CTG>CCG	p.L165P	RAB9B_uc004eli.1_Intron|PLP1_uc004elk.2_Missense_Mutation_p.L165P|PLP1_uc004elj.2_Missense_Mutation_p.L130P|PLP1_uc011msf.1_Missense_Mutation_p.L110P|PLP1_uc010nox.2_Missense_Mutation_p.L119P	NM_001128834	NP_001122306	P60201	MYPR_HUMAN	proteolipid protein 1 isoform 1	165	Helical; Name=3; (Probable).		Missing (in HLD1).		cell death|synaptic transmission	integral to membrane				ovary(1)	1						GTGTGGCTCCTGGTGTTTGCC	0.507													7	191	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105139491	105139491	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105139491G>T	uc004emd.2	+	7	858	c.555G>T	c.(553-555)CTG>CTT	p.L185L	NRK_uc010npc.1_5'UTR	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	185	Protein kinase.						ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						ATGTGCTGCTGACTCATAATG	0.363										HNSCC(51;0.14)			28	90	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105169003	105169003	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105169003G>T	uc004emd.2	+	19	3595	c.3292G>T	c.(3292-3294)GAC>TAC	p.D1098Y	NRK_uc010npc.1_Missense_Mutation_p.D766Y	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase	1098							ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TGCGTCTCAGGACTTTGAATA	0.453										HNSCC(51;0.14)			26	85	---	---	---	---	PASS
CXorf57	55086	broad.mit.edu	37	X	105868450	105868450	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105868450G>T	uc004emi.3	+	3	1068	c.917G>T	c.(916-918)AGT>ATT	p.S306I	CXorf57_uc004emj.3_Missense_Mutation_p.S306I|CXorf57_uc004emh.2_Missense_Mutation_p.S306I	NM_018015	NP_060485	Q6NSI4	CX057_HUMAN	hypothetical protein LOC55086	306										ovary(1)|lung(1)|breast(1)	3						GTTAAAAAGAGTTATCCATTC	0.393													33	112	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106046203	106046203	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106046203G>A	uc004emo.2	+	1	285	c.120G>A	c.(118-120)GGG>GGA	p.G40G	TBC1D8B_uc004emm.2_Silent_p.G40G|TBC1D8B_uc004emn.2_Silent_p.G40G	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	40						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						AAGGCGGAGGGGGGCTCACAG	0.567													17	42	---	---	---	---	PASS
TBC1D8B	54885	broad.mit.edu	37	X	106097468	106097468	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:106097468G>A	uc004emo.2	+	14	2459	c.2294G>A	c.(2293-2295)CGC>CAC	p.R765H	MORC4_uc004emp.3_Intron	NM_017752	NP_060222	Q0IIM8	TBC8B_HUMAN	TBC1 domain family, member 8B (with GRAM domain)	765						intracellular	calcium ion binding|Rab GTPase activator activity			ovary(2)|central_nervous_system(1)|skin(1)	4						CATAGTATGCGCTGTCGAAAT	0.348													17	62	---	---	---	---	PASS
PGRMC1	10857	broad.mit.edu	37	X	118370482	118370482	+	Silent	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118370482G>T	uc004erb.2	+	1	272	c.156G>T	c.(154-156)GCG>GCT	p.A52A	PGRMC1_uc011mts.1_Silent_p.A52A	NM_006667	NP_006658	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	52	Cytoplasmic (Potential).					cell surface|endoplasmic reticulum membrane|integral to membrane|microsome|nucleolus	heme binding|protein binding|receptor activity|steroid binding				0						ACCAGCCGGCGGCCAGCGGCG	0.701													7	30	---	---	---	---	PASS
UBE2A	7319	broad.mit.edu	37	X	118708716	118708716	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118708716G>T	uc004erl.2	+	1	218	c.42G>T	c.(40-42)AAG>AAT	p.K14N	UBE2A_uc004erm.2_Missense_Mutation_p.K14N|UBE2A_uc004ern.2_RNA|UBE2A_uc004ero.2_5'Flank	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1	14					histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						GGGACTTCAAGAGGTAAACCG	0.766								Direct_reversal_of_damage|Rad6_pathway					3	16	---	---	---	---	PASS
UBE2A	7319	broad.mit.edu	37	X	118708728	118708728	+	Intron	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:118708728G>A	uc004erl.2	+						UBE2A_uc004erm.2_Intron|UBE2A_uc004ern.2_Intron|UBE2A_uc004ero.2_5'Flank	NM_003336	NP_003327	P49459	UBE2A_HUMAN	ubiquitin-conjugating enzyme E2A isoform 1						histone H2A ubiquitination|positive regulation of cell proliferation|postreplication repair|protein autoubiquitination|protein K11-linked ubiquitination|protein K48-linked ubiquitination|response to UV|ubiquitin-dependent protein catabolic process		ATP binding|ubiquitin protein ligase binding|ubiquitin-protein ligase activity				0						GGTAAACCGAGGGGACGGCCG	0.756								Direct_reversal_of_damage|Rad6_pathway					3	15	---	---	---	---	PASS
ZBTB33	10009	broad.mit.edu	37	X	119387961	119387961	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119387961C>A	uc004esn.1	+	2	919	c.691C>A	c.(691-693)CCT>ACT	p.P231T	ZBTB33_uc010nqm.1_Missense_Mutation_p.P231T	NM_006777	NP_006768	Q86T24	KAISO_HUMAN	kaiso	231					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent|Wnt receptor signaling pathway	cytoplasm|nucleolus|plasma membrane	DNA binding|protein binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						AGATGTTGCACCTAGTGCTAG	0.468													8	83	---	---	---	---	PASS
CUL4B	8450	broad.mit.edu	37	X	119660631	119660631	+	Nonsense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:119660631G>T	uc004esw.2	-	22	3164	c.2727C>A	c.(2725-2727)TAC>TAA	p.Y909*	CUL4B_uc010nqq.2_Nonsense_Mutation_p.Y610*|CUL4B_uc004esv.2_Nonsense_Mutation_p.Y891*	NM_003588	NP_003579	Q13620	CUL4B_HUMAN	cullin 4B isoform 1	909					cell cycle|DNA repair|ubiquitin-dependent protein catabolic process	Cul4B-RING ubiquitin ligase complex|nucleus	protein binding|ubiquitin protein ligase binding			lung(1)|central_nervous_system(1)|pancreas(1)	3						CAATATAGTTGTACTGGTTTG	0.363													15	95	---	---	---	---	PASS
THOC2	57187	broad.mit.edu	37	X	122772854	122772854	+	Missense_Mutation	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:122772854C>G	uc004etu.2	-	17	1803	c.1771G>C	c.(1771-1773)GAT>CAT	p.D591H	THOC2_uc011muh.1_Missense_Mutation_p.D516H	NM_001081550	NP_001075019	Q8NI27	THOC2_HUMAN	THO complex 2	591					intronless viral mRNA export from host nucleus|mRNA processing|RNA splicing	THO complex part of transcription export complex	protein binding|RNA binding			ovary(3)	3						ATTAAGTTATCATACTTCTGT	0.343													71	207	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123164847	123164847	+	Missense_Mutation	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123164847G>T	uc004etz.3	+	4	499	c.160G>T	c.(160-162)GGC>TGC	p.G54C	STAG2_uc004eua.2_Missense_Mutation_p.G54C|STAG2_uc004eub.2_Missense_Mutation_p.G54C|STAG2_uc004euc.2_Missense_Mutation_p.G54C|STAG2_uc004eud.2_Missense_Mutation_p.G54C|STAG2_uc004eue.2_Missense_Mutation_p.G54C	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b	54					cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						AGCAGAAAAGGGCAAAGGTGG	0.413													10	63	---	---	---	---	PASS
STAG2	10735	broad.mit.edu	37	X	123227995	123227995	+	Splice_Site	SNP	G	C	C			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123227995G>C	uc004etz.3	+	31	3933	c.3594_splice	c.e31+1	p.L1198_splice	STAG2_uc004eua.2_Splice_Site_p.L1235_splice|STAG2_uc004eub.2_Splice_Site_p.L1198_splice|STAG2_uc004euc.2_Splice_Site_p.L1235_splice|STAG2_uc004eud.2_Splice_Site_p.L1198_splice|STAG2_uc004eue.2_Splice_Site_p.L1198_splice	NM_006603	NP_006594	Q8N3U4	STAG2_HUMAN	stromal antigen 2 isoform b						cell division|meiosis|mitotic metaphase/anaphase transition|mitotic prometaphase|negative regulation of DNA endoreduplication|sister chromatid cohesion	chromatin|chromosome, centromeric region|nucleoplasm	protein binding			ovary(4)|skin(1)	5						TATAGATTTGGTAAGAAACTT	0.328													43	141	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123518143	123518143	+	Missense_Mutation	SNP	C	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123518143C>A	uc004euj.2	-	29	6681	c.6617G>T	c.(6616-6618)GGA>GTA	p.G2206V	ODZ1_uc011muj.1_Missense_Mutation_p.G2212V|ODZ1_uc010nqy.2_Missense_Mutation_p.G2213V	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2206	Extracellular (Potential).|YD 19.				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						CTGAATTTCTCCTAATCTGGT	0.423													27	93	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123518144	123518144	+	Missense_Mutation	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123518144C>T	uc004euj.2	-	29	6680	c.6616G>A	c.(6616-6618)GGA>AGA	p.G2206R	ODZ1_uc011muj.1_Missense_Mutation_p.G2212R|ODZ1_uc010nqy.2_Missense_Mutation_p.G2213R	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	2206	Extracellular (Potential).|YD 19.				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TGAATTTCTCCTAATCTGGTG	0.423													25	93	---	---	---	---	PASS
MIR891A	100126341	broad.mit.edu	37	X	145109344	145109344	+	RNA	SNP	G	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:145109344G>T	hsa-mir-891a|MI0005524	-			c.47G>T																				0						atgtgCCACTGAGTATTTTAC	0.353													11	63	---	---	---	---	PASS
FATE1	89885	broad.mit.edu	37	X	150889981	150889981	+	Intron	SNP	C	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:150889981C>T	uc004fex.2	+							NM_033085	NP_149076	Q969F0	FATE1_HUMAN	fetal and adult testis expressed transcript							endoplasmic reticulum|integral to membrane				ovary(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					TCGGTAAGAGCTGAGGGTCTG	0.592													9	56	---	---	---	---	PASS
GABRE	2564	broad.mit.edu	37	X	151124173	151124173	+	Intron	SNP	C	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151124173C>G	uc004ffi.2	-						GABRE_uc011myd.1_Intron	NM_004961	NP_004952	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor,						gamma-aminobutyric acid signaling pathway	cell junction|chloride channel complex|integral to plasma membrane|postsynaptic membrane	chloride channel activity|extracellular ligand-gated ion channel activity|GABA-A receptor activity			ovary(2)	2	Acute lymphoblastic leukemia(192;6.56e-05)					CCTGTTTCTCCTCTTACCTAG	0.512													27	106	---	---	---	---	PASS
MAGEA12	4111	broad.mit.edu	37	X	151900625	151900625	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:151900625G>A	uc010ntp.2	-	3	530	c.176C>T	c.(175-177)CCA>CTA	p.P59L	MAGEA12_uc004fgb.2_Intron|MAGEA12_uc004fgc.2_Missense_Mutation_p.P59L|CSAG1_uc004fge.2_5'Flank|CSAG1_uc004fgf.2_5'Flank|CSAG1_uc004fgd.2_5'Flank	NM_005367	NP_005358	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	59										skin(1)	1	Acute lymphoblastic leukemia(192;6.56e-05)					GGGAGGACTTGGTGACTCGGC	0.602													31	123	---	---	---	---	PASS
ZNF275	10838	broad.mit.edu	37	X	152612647	152612647	+	Silent	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152612647G>A	uc004fhg.1	+	4	681	c.504G>A	c.(502-504)GCG>GCA	p.A168A	ZNF275_uc011mym.1_Silent_p.A168A|ZNF275_uc011myn.1_Silent_p.A105A			A6NFS0	A6NFS0_HUMAN	SubName: Full=cDNA FLJ16723 fis, clone UTERU3004418, highly similar to Zinc finger protein 275; SubName: Full=Putative uncharacterized protein ZNF275;	168						intracellular	nucleic acid binding|zinc ion binding			ovary(1)	1	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AGAATGCCGCGGAGAAGAGGG	0.602													5	48	---	---	---	---	PASS
VBP1	7411	broad.mit.edu	37	X	154448556	154448556	+	Missense_Mutation	SNP	G	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154448556G>A	uc004fnc.2	+	2	249	c.190G>A	c.(190-192)GAA>AAA	p.E64K	VBP1_uc004fnd.2_Missense_Mutation_p.E27K	NM_003372	NP_003363	P61758	PFD3_HUMAN	von Hippel-Lindau binding protein 1	64					'de novo' posttranslational protein folding	nucleus|prefoldin complex	unfolded protein binding				0	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					TAAGTTTATGGAACTCAACCT	0.299													10	57	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	1	4235749	4235750	+	IGR	INS	-	G	G			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:4235749_4235750insG								LOC100133612 (401872 upstream) : LOC284661 (236361 downstream)																							GAGGCCCCCCAGACCAGCCTGT	0.584													4	3	---	---	---	---	
RERE	473	broad.mit.edu	37	1	8858758	8858758	+	Intron	DEL	T	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8858758delT	uc001ape.2	-						RERE_uc001apf.2_Intron	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a						multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		Cttttttttcttttttttttt	0.214													4	2	---	---	---	---	
DFFA	1676	broad.mit.edu	37	1	10527571	10527572	+	Intron	INS	-	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10527571_10527572insT	uc001arj.2	-						DFFA_uc001ark.2_Intron	NM_004401	NP_004392	O00273	DFFA_HUMAN	DNA fragmentation factor, 45kDa, alpha						DNA fragmentation involved in apoptotic nuclear change|intracellular signal transduction|negative regulation of apoptosis	cytosol|mitochondrion|nucleoplasm|plasma membrane	deoxyribonuclease activity|identical protein binding				0	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.25e-07)|COAD - Colon adenocarcinoma(227;7.25e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000296)|Kidney(185;0.00074)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0487)		CTCttctttcattttttttttt	0.188													4	3	---	---	---	---	
USP33	23032	broad.mit.edu	37	1	78163754	78163754	+	Intron	DEL	T	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:78163754delT	uc001dht.2	-						USP33_uc009wca.1_5'Flank|USP33_uc001dhs.2_Intron|USP33_uc001dhu.2_Intron	NM_015017	NP_055832	Q8TEY7	UBP33_HUMAN	ubiquitin specific protease 33 isoform 1						axon guidance|cell migration|endocytosis|protein K48-linked deubiquitination|protein K63-linked deubiquitination|regulation of G-protein coupled receptor protein signaling pathway|ubiquitin-dependent protein catabolic process	perinuclear region of cytoplasm|VCB complex	cysteine-type endopeptidase activity|G-protein-coupled receptor binding|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity|zinc ion binding			lung(2)|ovary(1)	3						TAGTTAAttcttttttttttt	0.129													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	1	94871896	94871896	+	IGR	DEL	G	-	-	rs12091363		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:94871896delG								ARHGAP29 (131272 upstream) : ABCD3 (12037 downstream)																							aTTTTGTTTTGTTTTTTTTTT	0.184													3	5	---	---	---	---	
CHI3L2	1117	broad.mit.edu	37	1	111772303	111772304	+	Intron	INS	-	AAAAAAA	AAAAAAA	rs61237890		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:111772303_111772304insAAAAAAA	uc001eam.2	+						CHI3L2_uc001ean.2_Intron|CHI3L2_uc001eao.2_5'Flank|CHI3L2_uc009wga.2_5'Flank	NM_004000	NP_003991	Q15782	CH3L2_HUMAN	chitinase 3-like 2 isoform a						chitin catabolic process	extracellular space	cation binding|chitinase activity			central_nervous_system(1)	1		all_cancers(81;1.89e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0171)|Colorectal(144;0.0387)|all cancers(265;0.0464)|LUSC - Lung squamous cell carcinoma(189;0.0872)|Epithelial(280;0.0994)|COAD - Colon adenocarcinoma(174;0.141)		gactccgtctcaaaaaaaaaaa	0.193													6	4	---	---	---	---	
TARBP1	6894	broad.mit.edu	37	1	234608725	234608726	+	Intron	INS	-	T	T	rs141043621	by1000genomes	TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:234608725_234608726insT	uc001hwd.2	-							NM_005646	NP_005637	Q13395	TARB1_HUMAN	TAR RNA binding protein 1						regulation of transcription from RNA polymerase II promoter|RNA processing	nucleus	RNA binding|RNA methyltransferase activity			ovary(2)|skin(1)	3	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCAGAGGGAGATTTTTTTTTGC	0.257													3	3	---	---	---	---	
SCCPDH	51097	broad.mit.edu	37	1	246927733	246927734	+	Intron	INS	-	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:246927733_246927734insT	uc001ibr.2	+							NM_016002	NP_057086	Q8NBX0	SCPDH_HUMAN	saccharopine dehydrogenase (putative)							midbody	binding|saccharopine dehydrogenase (NAD+, L-glutamate-forming) activity			ovary(1)	1	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		CCATTACAATATATTCTTTTTA	0.257													25	12	---	---	---	---	
CENPA	1058	broad.mit.edu	37	2	27016302	27016303	+	Intron	INS	-	T	T	rs146173642	by1000genomes	TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:27016302_27016303insT	uc002rhr.2	+						CENPA_uc002rht.2_Intron|CENPA_uc002rhs.2_Intron	NM_001809	NP_001800	P49450	CENPA_HUMAN	centromere protein A isoform a						CenH3-containing nucleosome assembly at centromere|establishment of mitotic spindle orientation|interspecies interaction between organisms|kinetochore assembly|mitotic prometaphase|protein localization to chromosome, centromeric region	condensed nuclear chromosome kinetochore|cytosol|nucleoplasm|nucleosome	chromatin binding|DNA binding|protein binding				0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTAGTAAAGGTTGATCTAGTT	0.406													3	4	---	---	---	---	
NRXN1	9378	broad.mit.edu	37	2	51149776	51149776	+	Intron	DEL	A	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:51149776delA	uc010fbq.2	-						NRXN1_uc002rxe.3_Intron	NM_001135659	NP_001129131	P58400	NRX1B_HUMAN	neurexin 1 isoform alpha2 precursor						angiogenesis|neuron cell-cell adhesion|neuronal signal transduction	cell surface|endocytic vesicle|integral to membrane|presynaptic membrane	cell adhesion molecule binding|receptor binding			ovary(2)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AGCAGAGTGGAAAAGGAACAG	0.453													12	11	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	175585079	175585079	+	Intron	DEL	A	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:175585079delA	uc002uiw.2	+											Homo sapiens cDNA FLJ11228 fis, clone PLACE1008329.																		TTTCATTCTCAAAAAAAAAAA	0.368											OREG0015078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	5	3	---	---	---	---	
FANCD2	2177	broad.mit.edu	37	3	10088533	10088536	+	Intron	DEL	AATC	-	-	rs148201951		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10088533_10088536delAATC	uc003buw.2	+						FANCD2_uc003bux.1_Intron|FANCD2_uc003buy.1_Intron|FANCD2_uc010hcw.1_5'Flank	NM_033084	NP_149075	Q9BXW9	FACD2_HUMAN	Fanconi anemia complementation group D2 isoform						DNA repair|response to gamma radiation	nucleoplasm	protein binding|protein binding			central_nervous_system(2)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.148)		tttttgcattaatcattttaattg	0.005			D|Mis|N|F			AML|leukemia		Involved_in_tolerance_or_repair_of_DNA_crosslinks	Fanconi_Anemia				5	3	---	---	---	---	
UBP1	7342	broad.mit.edu	37	3	33454074	33454074	+	Intron	DEL	A	-	-	rs35702863		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:33454074delA	uc003cfq.3	-						UBP1_uc003cfr.3_Intron|UBP1_uc010hga.2_Intron	NM_014517	NP_055332	Q9NZI7	UBIP1_HUMAN	upstream binding protein 1 (LBP-1a) isoform a						negative regulation of transcription, DNA-dependent|regulation of transcription from RNA polymerase II promoter|viral genome replication	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity			kidney(2)	2						gctctgtctcaaaaaaaaaaa	0.149													3	3	---	---	---	---	
TLR2	7097	broad.mit.edu	37	4	154623915	154623920	+	Intron	DEL	TGTGTG	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:154623915_154623920delTGTGTG	uc003inq.2	+						TLR2_uc003inr.2_Intron|TLR2_uc003ins.2_Intron	NM_003264	NP_003255	O60603	TLR2_HUMAN	toll-like receptor 2 precursor						cellular response to diacyl bacterial lipopeptide|cellular response to lipoteichoic acid|cellular response to triacyl bacterial lipopeptide|detection of diacyl bacterial lipopeptide|detection of triacyl bacterial lipopeptide|I-kappaB phosphorylation|induction of apoptosis|inflammatory response|innate immune response|MyD88-dependent toll-like receptor signaling pathway|positive regulation of chemokine production|positive regulation of interferon-beta production|positive regulation of interleukin-12 production|positive regulation of interleukin-18 production|positive regulation of interleukin-6 production|positive regulation of interleukin-8 production|positive regulation of NF-kappaB import into nucleus|positive regulation of NF-kappaB transcription factor activity|positive regulation of nitric-oxide synthase biosynthetic process|positive regulation of toll-like receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|positive regulation of tumor necrosis factor production|positive regulation of Wnt receptor signaling pathway|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 4 signaling pathway	cytoplasm|integral to plasma membrane|Toll-like receptor 1-Toll-like receptor 2 protein complex	Gram-positive bacterial cell surface binding|lipopolysaccharide receptor activity|peptidoglycan binding|protein heterodimerization activity|transmembrane receptor activity|triacyl lipopeptide binding			ovary(1)|lung(1)|breast(1)	3	all_hematologic(180;0.093)	Renal(120;0.117)				TCTCTCTCTTtgtgtgtgtgtgtgtg	0.277													7	4	---	---	---	---	
KIAA0319	9856	broad.mit.edu	37	6	24576991	24576991	+	Intron	DEL	A	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:24576991delA	uc011djo.1	-						KIAA0319_uc011djp.1_Intron|KIAA0319_uc003neh.1_Intron|KIAA0319_uc011djq.1_Intron|KIAA0319_uc011djr.1_Intron|KIAA0319_uc010jpt.1_Intron	NM_014809	NP_055624	Q5VV43	K0319_HUMAN	KIAA0319 precursor						negative regulation of dendrite development|neuron migration	early endosome membrane|integral to membrane|plasma membrane	protein binding			ovary(1)|skin(1)	2						ctatttaattaaaaaaaaaaa	0.000													4	2	---	---	---	---	
PNPLA8	50640	broad.mit.edu	37	7	108151500	108151501	+	Intron	INS	-	G	G	rs40873	by1000genomes	TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:108151500_108151501insG	uc003vff.1	-						PNPLA8_uc003vfg.1_Intron|PNPLA8_uc003vfh.1_Intron|PNPLA8_uc003vfi.1_Intron|PNPLA8_uc003vfj.1_Intron|PNPLA8_uc003vfk.1_Intron	NM_015723	NP_056538	Q9NP80	PLPL8_HUMAN	patatin-like phospholipase domain containing 8						fatty acid metabolic process|lipid catabolic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|membrane fraction|perinuclear region of cytoplasm|peroxisomal membrane	ATP binding|calcium-independent phospholipase A2 activity|lysophospholipase activity			breast(2)	2						AAAAAAAAAAAAAAgaaaactg	0.153													4	2	---	---	---	---	
CSMD1	64478	broad.mit.edu	37	8	3216949	3216950	+	Intron	DEL	AA	-	-	rs34858861		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:3216949_3216950delAA	uc011kwk.1	-						CSMD1_uc011kwj.1_Intron|CSMD1_uc003wqe.2_Intron	NM_033225	NP_150094	Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1 precursor							integral to membrane				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TGCTATTACTAAAAAAAAAAAA	0.307													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	8	109585253	109585254	+	IGR	INS	-	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:109585253_109585254insT								TTC35 (86117 upstream) : TMEM74 (33826 downstream)																							CTTCCACCTCATTTGGTGGTAC	0.406													4	5	---	---	---	---	
EFR3A	23167	broad.mit.edu	37	8	132998636	132998644	+	Intron	DEL	TCATTTAAT	-	-	rs72073007		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:132998636_132998644delTCATTTAAT	uc003yte.2	+							NM_015137	NP_055952	Q14156	EFR3A_HUMAN	EFR3 homolog A							plasma membrane	binding			ovary(3)|breast(1)|central_nervous_system(1)	5	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTTGTGTCTGTCATTTAATTCATTTAATT	0.297													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	9	69876385	69876386	+	IGR	INS	-	TCT	TCT			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:69876385_69876386insTCT								LOC100133920 (211436 upstream) : FOXD4L5 (299323 downstream)																							TTCTTCTCTTCTCTTCTTGTTT	0.277													9	5	---	---	---	---	
APBA1	320	broad.mit.edu	37	9	72046058	72046059	+	3'UTR	DEL	AA	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:72046058_72046059delAA	uc004ahh.2	-	13						NM_001163	NP_001154	Q02410	APBA1_HUMAN	amyloid beta A4 precursor protein-binding,						axon cargo transport|cell adhesion|intracellular protein transport|nervous system development|protein complex assembly|synaptic transmission	synaptic vesicle				lung(1)	1						CCTGGTATTGaaaaaaaaaaaa	0.480													4	3	---	---	---	---	
BTAF1	9044	broad.mit.edu	37	10	93773991	93773991	+	Intron	DEL	T	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:93773991delT	uc001khr.2	+							NM_003972	NP_003963	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription						negative regulation of transcription, DNA-dependent	nucleus	ATP binding|DNA binding|helicase activity|sequence-specific DNA binding transcription factor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Colorectal(252;0.0846)				GCTTTTTAAGttttttttttt	0.149													4	2	---	---	---	---	
ROBO3	64221	broad.mit.edu	37	11	124750448	124750453	+	In_Frame_Del	DEL	CGGAGT	-	-	rs71859853		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124750448_124750453delCGGAGT	uc001qbc.2	+	27	4285_4290	c.4093_4098delCGGAGT	c.(4093-4098)CGGAGTdel	p.RS1367del	ROBO3_uc001qbd.2_In_Frame_Del_p.RS292del|ROBO3_uc010sar.1_In_Frame_Del_p.RS416del|ROBO3_uc001qbe.2_In_Frame_Del_p.RS292del|ROBO3_uc001qbf.1_In_Frame_Del_p.RS251del	NM_022370	NP_071765	Q96MS0	ROBO3_HUMAN	roundabout, axon guidance receptor, homolog 3	1367_1368	Cytoplasmic (Potential).				axon midline choice point recognition	integral to membrane	receptor activity			breast(1)|central_nervous_system(1)	2	all_hematologic(175;0.215)	Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|Breast(109;0.0481)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0296)		TGgccggagccggagtcggagtcaga	0.519													3	3	---	---	---	---	
DENND5B	160518	broad.mit.edu	37	12	31545072	31545073	+	Intron	INS	-	A	A			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31545072_31545073insA	uc001rki.1	-						DENND5B_uc001rkh.1_Intron|DENND5B_uc009zjq.1_Intron	NM_144973	NP_659410	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B							integral to membrane				ovary(1)|central_nervous_system(1)	2						gattccgtctcaaaaaaaaaaa	0.149													4	2	---	---	---	---	
MTHFD1	4522	broad.mit.edu	37	14	64894246	64894250	+	Intron	DEL	CCTCC	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64894246_64894250delCCTCC	uc001xhb.2	+						MTHFD1_uc010aqe.2_Intron|MTHFD1_uc010aqf.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1						folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	CTCCTTCAGTCCTCCCAGGCCCACG	0.512													55	45	---	---	---	---	
CBFB	865	broad.mit.edu	37	16	67116033	67116033	+	Intron	DEL	A	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:67116033delA	uc002era.2	+						CBFB_uc002erb.2_Intron|CBFB_uc010vja.1_Intron	NM_001755	NP_001746	Q13951	PEBB_HUMAN	core-binding factor, beta subunit isoform 2						transcription from RNA polymerase II promoter	nucleus	protein binding|sequence-specific DNA binding transcription factor activity|transcription coactivator activity			breast(2)	2		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		CTGTTTCAGGAAAAAAAAAAA	0.129			T	MYH11	AML								4	2	---	---	---	---	
PSTPIP2	9050	broad.mit.edu	37	18	43609839	43609839	+	Intron	DEL	G	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:43609839delG	uc002lbp.3	-						PSTPIP2_uc002lbq.3_Intron	NM_024430	NP_077748	Q9H939	PPIP2_HUMAN	proline-serine-threonine phosphatase interacting							membrane				ovary(1)	1						tcagaactttgggaggccgag	0.149													8	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	14991072	14991072	+	IGR	DEL	A	-	-	rs34163436		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14991072delA								OR7A10 (38383 upstream) : OR7A17 (168 downstream)																							AAAGCTTTATAAAGGAATACA	0.313													1	5	---	---	---	---	
CEACAM21	90273	broad.mit.edu	37	19	42083433	42083434	+	Intron	DEL	AC	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42083433_42083434delAC	uc002ore.3	+						CEACAM21_uc002orc.1_Intron|CEACAM21_uc002ord.1_Intron|CEACAM21_uc002orf.2_Intron|CEACAM21_uc002org.3_Intron	NM_001098506	NP_001091976	Q3KPI0	CEA21_HUMAN	carcinoembryonic antigen-related cell adhesion							integral to membrane				ovary(1)	1						ACCCAGTAGGacacacacacac	0.302													3	3	---	---	---	---	
NLRP2	55655	broad.mit.edu	37	19	55511961	55511961	+	Intron	DEL	A	-	-	rs34129339		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55511961delA	uc002qij.2	+						NLRP2_uc010yfp.1_Intron|NLRP2_uc010esn.2_Intron|NLRP2_uc010eso.2_Intron|NLRP2_uc010esp.2_Intron	NM_017852	NP_060322	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						apoptosis|positive regulation of caspase activity|positive regulation of interleukin-1 beta secretion	cytoplasm	ATP binding|Pyrin domain binding			ovary(1)|skin(1)	2			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		actgtcttttaaaaaaaaaaa	0.194													4	2	---	---	---	---	
RIPK4	54101	broad.mit.edu	37	21	43169304	43169305	+	Intron	INS	-	T	T			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:43169304_43169305insT	uc002yzn.1	-							NM_020639	NP_065690	P57078	RIPK4_HUMAN	ankyrin repeat domain 3							cytoplasm|nucleus	ATP binding|protein serine/threonine kinase activity			ovary(2)|central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)	7						TCAAAGACAGGTCCACTCACCT	0.515													45	20	---	---	---	---	
OSBP2	23762	broad.mit.edu	37	22	31298126	31298127	+	Intron	DEL	CC	-	-	rs56186828		TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:31298126_31298127delCC	uc003aiy.1	+						OSBP2_uc011ala.1_Intron|OSBP2_uc010gwc.1_Intron|OSBP2_uc011alb.1_Intron|OSBP2_uc003aiz.1_Intron|OSBP2_uc003aja.1_Intron|OSBP2_uc011alc.1_Intron|OSBP2_uc003ajb.2_Intron|OSBP2_uc011ald.1_Intron|OSBP2_uc010gwd.1_Intron	NM_030758	NP_110385	Q969R2	OSBP2_HUMAN	oxysterol binding protein 2 isoform a						lipid transport	membrane	lipid binding			breast(1)|skin(1)	2						AAAAAAAAAACCAAAAAAAAAA	0.282													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	147280217	147280217	+	IGR	DEL	C	-	-			TCGA-56-6545-01	TCGA-56-6545-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:147280217delC								FMR1NB (172037 upstream) : AFF2 (301922 downstream)																							GGGGGGGCGGCGGGGAGGGGC	0.567													4	2	---	---	---	---	
