Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
PRDM16	63976	broad.mit.edu	37	1	3319418	3319418	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3319418G>T	uc001akf.2	+	6	820	c.740G>T	c.(739-741)CGC>CTC	p.R247L	PRDM16_uc001akc.2_Missense_Mutation_p.R247L|PRDM16_uc001akd.2_Missense_Mutation_p.R247L|PRDM16_uc001ake.2_Missense_Mutation_p.R247L|PRDM16_uc009vlh.2_5'UTR	NM_022114	NP_071397	Q9HAZ2	PRD16_HUMAN	PR domain containing 16 isoform 1	247	C2H2-type 1; atypical.				brown fat cell differentiation|negative regulation of granulocyte differentiation|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transforming growth factor beta receptor signaling pathway|negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|regulation of cellular respiration|transcription, DNA-dependent	transcriptional repressor complex	protein binding|sequence-specific DNA binding|transcription coactivator activity|zinc ion binding			lung(3)|ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	7	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		GACCTGCGGCGCCATAAGAAG	0.637			T	EVI1	MDS|AML								35	61	---	---	---	---	PASS
CCDC27	148870	broad.mit.edu	37	1	3672112	3672112	+	Silent	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3672112C>A	uc001akv.2	+	3	615	c.534C>A	c.(532-534)GGC>GGA	p.G178G		NM_152492	NP_689705	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	178										skin(1)	1	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CCAGGCGGGGCTCAGACACGA	0.632													45	237	---	---	---	---	PASS
MTOR	2475	broad.mit.edu	37	1	11259718	11259718	+	Silent	SNP	C	G	G	rs145404035		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:11259718C>G	uc001asd.2	-	27	4108	c.3987G>C	c.(3985-3987)CTG>CTC	p.L1329L		NM_004958	NP_004949	P42345	MTOR_HUMAN	FK506 binding protein 12-rapamycin associated	1329					cell growth|cellular response to hypoxia|insulin receptor signaling pathway|nerve growth factor receptor signaling pathway|peptidyl-serine phosphorylation|phosphatidylinositol-mediated signaling|protein autophosphorylation|protein catabolic process|response to amino acid stimulus|response to nutrient|T cell costimulation|TOR signaling cascade	endoplasmic reticulum membrane|Golgi membrane|lysosome|mitochondrial outer membrane|phosphatidylinositol 3-kinase complex|PML body|TORC1 complex|TORC2 complex	ATP binding|phosphoprotein binding|protein serine/threonine kinase activity			central_nervous_system(7)|lung(6)|ovary(6)|skin(3)|kidney(3)|large_intestine(2)|breast(2)	29						GATCTTCATTCAGTTCAGACC	0.507													41	121	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19501466	19501466	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19501466C>T	uc001bbi.2	-	21	2839	c.2835G>A	c.(2833-2835)TTG>TTA	p.L945L	UBR4_uc001bbm.1_Silent_p.L156L	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	945					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CAAGTCGGTTCAAATCATCCT	0.438													6	144	---	---	---	---	PASS
UBR4	23352	broad.mit.edu	37	1	19501471	19501471	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:19501471C>T	uc001bbi.2	-	21	2834	c.2830G>A	c.(2830-2832)GAT>AAT	p.D944N	UBR4_uc001bbm.1_Missense_Mutation_p.D155N	NM_020765	NP_065816	Q5T4S7	UBR4_HUMAN	retinoblastoma-associated factor 600	944					interspecies interaction between organisms	cytoplasm|cytoskeleton|integral to membrane|nucleus	calmodulin binding|ubiquitin-protein ligase activity|zinc ion binding			kidney(10)|ovary(7)|breast(4)|pancreas(2)|skin(2)	25		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CGGTTCAAATCATCCTCTGAG	0.433													6	146	---	---	---	---	PASS
DDOST	1650	broad.mit.edu	37	1	20979440	20979440	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:20979440G>T	uc001bdo.1	-	9	1161	c.1018C>A	c.(1018-1020)CTC>ATC	p.L340I	DDOST_uc009vpw.1_Missense_Mutation_p.L340I|DDOST_uc010odd.1_Missense_Mutation_p.L139I|DDOST_uc010ode.1_Missense_Mutation_p.L303I	NM_005216	NP_005207	P39656	OST48_HUMAN	dolichyl-diphosphooligosaccharide-protein	340	Lumenal (Potential).				innate immune response|post-translational protein modification|response to cytokine stimulus|T cell activation	integral to membrane|microsome|oligosaccharyltransferase complex	dolichyl-diphosphooligosaccharide-protein glycotransferase activity|protein binding				0		all_lung(284;2.98e-05)|Lung NSC(340;3.25e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.17e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000141)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.00046)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCATTTGAGAGCTGCTGGATC	0.522													4	125	---	---	---	---	PASS
COL16A1	1307	broad.mit.edu	37	1	32167759	32167759	+	Silent	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:32167759G>A	uc001btk.1	-	2	401	c.36C>T	c.(34-36)CTC>CTT	p.L12L	COL16A1_uc001btl.3_Silent_p.L12L	NM_001856	NP_001847	Q07092	COGA1_HUMAN	alpha 1 type XVI collagen precursor	12					cell adhesion|female pregnancy|integrin-mediated signaling pathway	collagen type XVI	integrin binding|structural molecule activity			ovary(8)	8		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CCCAAAGACCGAGCAGCCACA	0.587													7	57	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34190222	34190222	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34190222C>A	uc001bxn.1	-	18	2688	c.2659G>T	c.(2659-2661)GCG>TCG	p.A887S	CSMD2_uc001bxm.1_Missense_Mutation_p.A927S	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	887	Sushi 5.|Extracellular (Potential).					integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCACCAGCGCGCCCACGTAG	0.567													40	58	---	---	---	---	PASS
CLCA1	1179	broad.mit.edu	37	1	86964384	86964384	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:86964384C>A	uc001dlt.2	+	13	2372	c.2243C>A	c.(2242-2244)CCT>CAT	p.P748H		NM_001285	NP_001276	A8K7I4	CLCA1_HUMAN	chloride channel accessory 1 precursor	748					calcium ion transport	extracellular space|integral to plasma membrane	chloride channel activity			ovary(1)	1		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		GCTCCCATACCTGATCTCTTC	0.483													54	105	---	---	---	---	PASS
GFI1	2672	broad.mit.edu	37	1	92941667	92941667	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:92941667G>T	uc001dou.3	-	7	1352	c.1188C>A	c.(1186-1188)TTC>TTA	p.F396L	GFI1_uc001dov.3_Missense_Mutation_p.F396L|GFI1_uc001dow.3_Missense_Mutation_p.F396L	NM_001127215	NP_001120687	Q99684	GFI1_HUMAN	growth factor independent 1	396	C2H2-type 6.				negative regulation of calcidiol 1-monooxygenase activity|negative regulation of NF-kappaB transcription factor activity|negative regulation of transcription from RNA polymerase II promoter|regulation of transcription involved in G1/S phase of mitotic cell cycle|transcription, DNA-dependent|viral reproduction	nucleus	protein binding|transcription regulatory region DNA binding|zinc ion binding			large_intestine(1)	1		all_lung(203;0.00292)|Lung NSC(277;0.0115)|all_neural(321;0.185)|Glioma(108;0.203)		OV - Ovarian serous cystadenocarcinoma(397;9.04e-07)|Epithelial(280;1.17e-05)|all cancers(265;5.61e-05)|GBM - Glioblastoma multiforme(16;0.0191)		GGTCGCAGCCGAAGGGCTTGA	0.607													13	18	---	---	---	---	PASS
HORMAD1	84072	broad.mit.edu	37	1	150689735	150689735	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150689735C>G	uc001evk.1	-	3	163	c.57G>C	c.(55-57)AAG>AAC	p.K19N	HORMAD1_uc001evl.1_Missense_Mutation_p.K19N|HORMAD1_uc001evm.1_5'UTR	NM_032132	NP_115508	Q86X24	HORM1_HUMAN	HORMA domain containing 1	19					blastocyst development|cell differentiation|meiotic DNA double-strand break formation|meiotic recombination checkpoint|meiotic sister chromatid cohesion|mitosis|oogenesis|regulation of homologous chromosome segregation|spermatogenesis|synaptonemal complex assembly	chromosome|nucleus				ovary(2)|central_nervous_system(1)	3	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			CAGTTGATATCTTATTGGGAA	0.343													6	293	---	---	---	---	PASS
FCRL2	79368	broad.mit.edu	37	1	157740401	157740401	+	Silent	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:157740401C>G	uc001fre.2	-	3	167	c.108G>C	c.(106-108)CTG>CTC	p.L36L	FCRL2_uc001frd.2_5'Flank|FCRL2_uc010phz.1_Silent_p.L36L|FCRL2_uc009wsp.2_Silent_p.L36L|FCRL2_uc010pia.1_Silent_p.L36L	NM_030764	NP_110391	Q96LA5	FCRL2_HUMAN	Fc receptor-like 2 precursor	36	Ig-like C2-type 1.|Extracellular (Potential).				cell-cell signaling	integral to membrane|plasma membrane|soluble fraction	receptor activity|SH3/SH2 adaptor activity			ovary(1)|pancreas(1)	2	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCTGGCATTTCAGAACGATGC	0.438													5	139	---	---	---	---	PASS
SPTA1	6708	broad.mit.edu	37	1	158597422	158597422	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158597422A>G	uc001fst.1	-	40	5856	c.5657T>C	c.(5656-5658)CTA>CCA	p.L1886P		NM_003126	NP_003117	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1886	Spectrin 18.				actin filament capping|actin filament organization|axon guidance|regulation of cell shape	cytosol|intrinsic to internal side of plasma membrane|spectrin|spectrin-associated cytoskeleton	actin filament binding|calcium ion binding|structural constituent of cytoskeleton			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|breast(1)	8	all_hematologic(112;0.0378)					CACCTTATTTAGGATGTCTTC	0.423													63	201	---	---	---	---	PASS
PVRL4	81607	broad.mit.edu	37	1	161042609	161042609	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:161042609C>T	uc001fxo.2	-	9	1674	c.1375G>A	c.(1375-1377)GAA>AAA	p.E459K	ARHGAP30_uc001fxk.2_5'Flank|ARHGAP30_uc001fxl.2_5'Flank|ARHGAP30_uc001fxm.2_5'Flank|ARHGAP30_uc009wtx.2_5'Flank|ARHGAP30_uc001fxn.1_5'Flank|PVRL4_uc010pjy.1_Missense_Mutation_p.E113K|PVRL4_uc010pjz.1_Missense_Mutation_p.E168K	NM_030916	NP_112178	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4 precursor	459	Cytoplasmic (Potential).				adherens junction organization|cell adhesion|cell junction assembly	adherens junction|extracellular region|integral to membrane				ovary(2)	2	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			GACAGCAGTTCAGTCTGTGTT	0.562													25	53	---	---	---	---	PASS
PAPPA2	60676	broad.mit.edu	37	1	176668640	176668640	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:176668640G>T	uc001gkz.2	+	8	4315	c.3151G>T	c.(3151-3153)GTG>TTG	p.V1051L	PAPPA2_uc009www.2_RNA	NM_020318	NP_064714	Q9BXP8	PAPP2_HUMAN	pappalysin 2 isoform 1	1051					cell differentiation|proteolysis|regulation of cell growth	extracellular region|intracellular|membrane	metalloendopeptidase activity|zinc ion binding			ovary(7)|central_nervous_system(5)|skin(2)|lung(1)|breast(1)	16						CTGCAGGCCTGTGAGGTACCA	0.552													71	189	---	---	---	---	PASS
TPR	7175	broad.mit.edu	37	1	186321214	186321214	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186321214T>A	uc001grv.2	-	19	2660	c.2363A>T	c.(2362-2364)AAG>ATG	p.K788M		NM_003292	NP_003283	P12270	TPR_HUMAN	nuclear pore complex-associated protein TPR	788	Potential.				carbohydrate metabolic process|glucose transport|mitotic cell cycle spindle assembly checkpoint|mRNA transport|protein import into nucleus|regulation of glucose transport|seryl-tRNA aminoacylation|transmembrane transport|viral reproduction	condensed chromosome kinetochore|cytoplasm|nuclear membrane|nuclear pore|nucleoplasm	ATP binding|protein binding|serine-tRNA ligase activity			ovary(2)|lung(2)|urinary_tract(1)|central_nervous_system(1)|skin(1)	7		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AAGCATTTCCTTTTCCTTCTT	0.318			T	NTRK1	papillary thyroid								63	118	---	---	---	---	PASS
F13B	2165	broad.mit.edu	37	1	197024901	197024901	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197024901C>T	uc001gtt.1	-	8	1342	c.1298G>A	c.(1297-1299)GGA>GAA	p.G433E		NM_001994	NP_001985	P05160	F13B_HUMAN	coagulation factor XIII B subunit precursor	433	Sushi 7.				blood coagulation	extracellular region				upper_aerodigestive_tract(1)|central_nervous_system(1)|skin(1)	3						TATTTTTGATCCCCTCAGTAA	0.418													16	163	---	---	---	---	PASS
LHX9	56956	broad.mit.edu	37	1	197896900	197896900	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197896900G>T	uc001guk.1	+	4	1350	c.913G>T	c.(913-915)GGT>TGT	p.G305C	LHX9_uc001gui.1_Missense_Mutation_p.G296C|LHX9_uc001guj.1_Missense_Mutation_p.G311C	NM_020204	NP_064589	Q9NQ69	LHX9_HUMAN	LIM homeobox 9 isoform 1	305	Homeobox.				motor axon guidance|negative regulation of transcription, DNA-dependent	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|transcription corepressor activity|zinc ion binding			ovary(1)	1						CCAGAAAACAGGTCTGACCAA	0.478													34	104	---	---	---	---	PASS
PIK3C2B	5287	broad.mit.edu	37	1	204403630	204403630	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:204403630T>C	uc001haw.2	-	25	4102	c.3623A>G	c.(3622-3624)CAC>CGC	p.H1208R	PIK3C2B_uc010pqv.1_Missense_Mutation_p.H1180R	NM_002646	NP_002637	O00750	P3C2B_HUMAN	phosphoinositide-3-kinase, class 2 beta	1208	PI3K/PI4K.				cell communication|phosphatidylinositol-mediated signaling	endoplasmic reticulum|microsome|nucleus|phosphatidylinositol 3-kinase complex|plasma membrane	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol binding|phosphatidylinositol-4-phosphate 3-kinase activity|protein binding			lung(2)|breast(2)|stomach(1)|prostate(1)|central_nervous_system(1)	7	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GTGGAACATGTGACCAGTGGT	0.517													26	39	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233296087	233296087	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233296087C>T	uc001hvl.2	-	19	3694	c.3459G>A	c.(3457-3459)TGG>TGA	p.W1153*	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1153						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AAATCCACATCCAGGGATGAT	0.453													29	110	---	---	---	---	PASS
PCNXL2	80003	broad.mit.edu	37	1	233296088	233296088	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:233296088C>A	uc001hvl.2	-	19	3693	c.3458G>T	c.(3457-3459)TGG>TTG	p.W1153L	PCNXL2_uc001hvm.1_RNA|PCNXL2_uc009xfu.2_RNA|PCNXL2_uc001hvp.1_RNA|PCNXL2_uc009xfv.1_RNA	NM_014801	NP_055616	A6NKB5	PCX2_HUMAN	pecanex-like 2	1153						integral to membrane				central_nervous_system(1)|pancreas(1)	2		all_cancers(173;0.0347)|Prostate(94;0.137)				AATCCACATCCAGGGATGATG	0.448													29	111	---	---	---	---	PASS
C1orf150	148823	broad.mit.edu	37	1	247712512	247712512	+	Silent	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247712512C>A	uc001idf.2	+	1	64	c.19C>A	c.(19-21)CGA>AGA	p.R7R	C1orf150_uc009xgw.2_Intron|C1orf150_uc001ida.3_RNA|C1orf150_uc001idb.3_RNA|C1orf150_uc009xgx.2_Intron	NM_145278	NP_660321	Q5JQS6	CA150_HUMAN	hypothetical protein LOC148823	7											0	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0241)			TTATCTCCTGCGAAAACTCAG	0.468													38	82	---	---	---	---	PASS
VRK2	7444	broad.mit.edu	37	2	58366799	58366799	+	Splice_Site	SNP	A	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58366799A>T	uc002rzo.2	+	14	1602	c.857_splice	c.e14-2	p.C286_splice	VRK2_uc010fcb.2_Splice_Site_p.C286_splice|VRK2_uc002rzs.2_Splice_Site_p.C286_splice|VRK2_uc002rzr.2_Splice_Site_p.C286_splice|VRK2_uc010fcc.2_Splice_Site_p.C168_splice|VRK2_uc002rzv.2_Splice_Site_p.C286_splice|VRK2_uc010fcd.2_Splice_Site_p.C263_splice|VRK2_uc002rzp.2_Splice_Site_p.C286_splice|VRK2_uc010ypg.1_Splice_Site_p.C286_splice|VRK2_uc002rzq.2_Splice_Site_p.C286_splice|VRK2_uc002rzu.2_Splice_Site_p.C286_splice|VRK2_uc002rzt.2_Splice_Site_p.C168_splice	NM_001130482	NP_001123954	Q86Y07	VRK2_HUMAN	vaccinia related kinase 2 isoform 2							integral to membrane	ATP binding|protein binding|protein serine/threonine kinase activity			ovary(1)	1						AATAATTCACAGGTGAAATAG	0.318													23	88	---	---	---	---	PASS
USP34	9736	broad.mit.edu	37	2	61576402	61576402	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:61576402C>G	uc002sbe.2	-	13	1548	c.1526G>C	c.(1525-1527)AGA>ACA	p.R509T		NM_014709	NP_055524	Q70CQ2	UBP34_HUMAN	ubiquitin specific protease 34	509					positive regulation of canonical Wnt receptor signaling pathway|protein K48-linked deubiquitination|ubiquitin-dependent protein catabolic process|Wnt receptor signaling pathway		cysteine-type endopeptidase activity|protein binding|ubiquitin thiolesterase activity|ubiquitin-specific protease activity			ovary(8)|breast(5)|skin(3)|lung(2)|prostate(1)	19			Epithelial(17;0.229)			TGGAGCTGTTCTTCTAAGCTC	0.348													4	143	---	---	---	---	PASS
SPR	6697	broad.mit.edu	37	2	73118540	73118540	+	Silent	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:73118540A>G	uc002sik.2	+	3	710	c.660A>G	c.(658-660)AAA>AAG	p.K220K		NM_003124	NP_003115	P35270	SPRE_HUMAN	sepiapterin reductase	220					nitric oxide biosynthetic process|tetrahydrobiopterin biosynthetic process	cytoplasm	aldo-keto reductase (NADP) activity|NADP binding|sepiapterin reductase activity			ovary(2)	2						ACATGCGAAAAGGGCTGCAGG	0.557													3	131	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	2	90060900	90060900	+	Intron	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:90060900G>T	uc010fhm.2	+											Parts of antibodies, mostly variable regions.																		GAGGTTCAGTGGCAGTGGATC	0.498													69	194	---	---	---	---	PASS
VWA3B	200403	broad.mit.edu	37	2	98853155	98853155	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:98853155G>T	uc002syo.2	+	19	2899	c.2635G>T	c.(2635-2637)GTC>TTC	p.V879F	VWA3B_uc002syk.1_RNA|VWA3B_uc002syl.1_Missense_Mutation_p.V398F|VWA3B_uc002sym.2_Missense_Mutation_p.V879F|VWA3B_uc002syn.1_RNA|VWA3B_uc010yvi.1_Missense_Mutation_p.V536F|VWA3B_uc002syp.1_Missense_Mutation_p.V271F|VWA3B_uc002syq.1_Missense_Mutation_p.V155F|VWA3B_uc002syr.1_Missense_Mutation_p.V196F|VWA3B_uc010fih.1_RNA	NM_144992	NP_659429	Q502W6	VWA3B_HUMAN	von Willebrand factor A domain containing 3B	879										ovary(3)|large_intestine(2)|skin(1)	6						CTATGTTCCCGTCCTGGACAA	0.478													66	165	---	---	---	---	PASS
SLC35F5	80255	broad.mit.edu	37	2	114483083	114483083	+	Silent	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:114483083T>C	uc002tku.1	-	12	1546	c.1122A>G	c.(1120-1122)TTA>TTG	p.L374L	SLC35F5_uc002tkt.2_RNA	NM_025181	NP_079457	Q8WV83	S35F5_HUMAN	solute carrier family 35, member F5	374	Poly-Leu.|Helical; (Potential).				transport	integral to membrane					0						AACCTGGCCATAAGAGCAGCA	0.308													44	85	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149226468	149226468	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149226468C>G	uc002twm.3	+	9	1944	c.956C>G	c.(955-957)ACT>AGT	p.T319S	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.T319S|MBD5_uc002twn.1_5'Flank	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	319						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AATTTTTCAACTAATATGGAA	0.443													6	159	---	---	---	---	PASS
MBD5	55777	broad.mit.edu	37	2	149226481	149226481	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:149226481A>G	uc002twm.3	+	9	1957	c.969A>G	c.(967-969)ATA>ATG	p.I323M	MBD5_uc010zbs.1_RNA|MBD5_uc010fns.2_Missense_Mutation_p.I323M|MBD5_uc002twn.1_5'Flank	NM_018328	NP_060798	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	323						chromosome|nucleus	chromatin binding|DNA binding			skin(3)|ovary(2)	5				BRCA - Breast invasive adenocarcinoma(221;0.0569)		ATATGGAAATACCACGAGCAA	0.433													6	146	---	---	---	---	PASS
NEB	4703	broad.mit.edu	37	2	152418615	152418615	+	Intron	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152418615G>A	uc010fnx.2	-						NEB_uc002txr.2_Intron	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTCTAGGAAGGTGGCTCACCT	0.493													8	371	---	---	---	---	PASS
ABCB11	8647	broad.mit.edu	37	2	169781299	169781299	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:169781299G>C	uc002ueo.1	-	27	3759	c.3633C>G	c.(3631-3633)AAC>AAG	p.N1211K	ABCB11_uc010zda.1_Missense_Mutation_p.N629K|ABCB11_uc010zdb.1_Missense_Mutation_p.N687K	NM_003742	NP_003733	O95342	ABCBB_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP),	1211	Cytoplasmic (Potential).|ABC transporter 2.				bile acid biosynthetic process	apical plasma membrane|Golgi membrane|integral to plasma membrane|intercellular canaliculus|membrane fraction	ATP binding|bile acid-exporting ATPase activity|canalicular bile acid transmembrane transporter activity|sodium-exporting ATPase activity, phosphorylative mechanism			ovary(2)|large_intestine(2)|breast(1)	5					Adenosine triphosphate(DB00171)|Bosentan(DB00559)|Glibenclamide(DB01016)	GGGACCCAACGTTAGTTTCAT	0.413													48	144	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179395669	179395669	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179395669C>T	uc010zfg.1	-	307	98193	c.97969G>A	c.(97969-97971)GAA>AAA	p.E32657K	uc002umo.2_Intron|uc002ump.1_Intron|TTN_uc010zfh.1_Missense_Mutation_p.E26352K|TTN_uc010zfi.1_Missense_Mutation_p.E26285K|TTN_uc010zfj.1_Missense_Mutation_p.E26160K|TTN_uc002umq.2_5'Flank	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	33584							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACAGCCTTTTCAGTTACCCTG	0.488													8	441	---	---	---	---	PASS
RFTN2	130132	broad.mit.edu	37	2	198498484	198498484	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:198498484G>T	uc002uuo.3	-	4	1078	c.676C>A	c.(676-678)CAA>AAA	p.Q226K		NM_144629	NP_653230	Q52LD8	RFTN2_HUMAN	raftlin family member 2	226						plasma membrane					0						CTGCCATTTTGTTCCATTTGA	0.363													56	225	---	---	---	---	PASS
NCL	4691	broad.mit.edu	37	2	232325142	232325142	+	Intron	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232325142C>T	uc002vru.2	-						SNORD82_uc010fxw.1_RNA	NM_005381	NP_005372	P19338	NUCL_HUMAN	nucleolin						angiogenesis	cell cortex|nucleolus|ribonucleoprotein complex	nucleotide binding|protein C-terminus binding|RNA binding|telomeric DNA binding			ovary(2)|pancreas(1)	3		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		TGTTATTCATCATTTGTGCTG	0.388													75	212	---	---	---	---	PASS
AGAP1	116987	broad.mit.edu	37	2	236653377	236653377	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236653377C>T	uc002vvs.2	+	5	1027	c.432C>T	c.(430-432)TTC>TTT	p.F144F	AGAP1_uc002vvt.2_Silent_p.F144F	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1	144	Small GTPase-like.				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						TATTTGTCTTCAGCTTGGAGG	0.488													9	206	---	---	---	---	PASS
AGAP1	116987	broad.mit.edu	37	2	236653401	236653401	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:236653401C>G	uc002vvs.2	+	5	1051	c.456C>G	c.(454-456)TTC>TTG	p.F152L	AGAP1_uc002vvt.2_Missense_Mutation_p.F152L	NM_001037131	NP_001032208	Q9UPQ3	AGAP1_HUMAN	centaurin, gamma 2 isoform 1	152	Small GTPase-like.				protein transport|regulation of ARF GTPase activity|small GTPase mediated signal transduction	cytoplasm	ARF GTPase activator activity|GTP binding|zinc ion binding			ovary(2)|skin(1)	3						AAATAAGTTTCCAGACCGTTT	0.507													7	163	---	---	---	---	PASS
SLC6A11	6538	broad.mit.edu	37	3	10861396	10861396	+	Splice_Site	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10861396G>T	uc003bvz.2	+	3	426	c.392_splice	c.e3-1	p.G131_splice	SLC6A11_uc003bvy.1_Splice_Site_p.G131_splice	NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter						neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		TGTCCTTTCAGGCATTGGCTA	0.408													96	178	---	---	---	---	PASS
SLC6A11	6538	broad.mit.edu	37	3	10861397	10861397	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:10861397G>T	uc003bvz.2	+	3	426	c.392G>T	c.(391-393)GGC>GTC	p.G131V	SLC6A11_uc003bvy.1_Missense_Mutation_p.G131V	NM_014229	NP_055044	P48066	S6A11_HUMAN	solute carrier family 6 (neurotransmitter	131	Helical; Name=3; (Potential).				neurotransmitter secretion	integral to plasma membrane	gamma-aminobutyric acid:sodium symporter activity|neurotransmitter:sodium symporter activity			skin(3)|ovary(1)	4				OV - Ovarian serous cystadenocarcinoma(96;0.229)		GTCCTTTCAGGCATTGGCTAT	0.403													97	176	---	---	---	---	PASS
STAB1	23166	broad.mit.edu	37	3	52551041	52551041	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52551041C>T	uc003dej.2	+	42	4479	c.4405C>T	c.(4405-4407)CAT>TAT	p.H1469Y	STAB1_uc003dek.1_5'Flank	NM_015136	NP_055951	Q9NY15	STAB1_HUMAN	stabilin 1 precursor	1469	Extracellular (Potential).|EGF-like 11.				cell adhesion|cell-cell signaling|defense response to bacterium|inflammatory response|negative regulation of angiogenesis|receptor-mediated endocytosis	integral to plasma membrane	bacterial cell surface binding|hyaluronic acid binding|low-density lipoprotein receptor activity|protein disulfide oxidoreductase activity|scavenger receptor activity			large_intestine(3)|upper_aerodigestive_tract(2)|central_nervous_system(1)|breast(1)|skin(1)|pancreas(1)	9				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CTGCTCCCCTCATGCCAACTG	0.677													4	93	---	---	---	---	PASS
C3orf63	23272	broad.mit.edu	37	3	56675432	56675432	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56675432G>A	uc003did.3	-	15	2665	c.2564C>T	c.(2563-2565)TCT>TTT	p.S855F	C3orf63_uc003dic.3_Missense_Mutation_p.S459F|C3orf63_uc003die.3_Missense_Mutation_p.S855F	NM_015224	NP_056039	Q9UK61	CC063_HUMAN	retinoblastoma-associated protein 140 isoform b	855										ovary(3)|kidney(1)|central_nervous_system(1)	5				KIRC - Kidney renal clear cell carcinoma(284;0.0126)|Kidney(284;0.0147)		AATAGCAACAGAATACTTAGA	0.388													4	88	---	---	---	---	PASS
LRIG1	26018	broad.mit.edu	37	3	66449460	66449460	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:66449460A>G	uc003dmx.2	-	10	1180	c.1166T>C	c.(1165-1167)CTG>CCG	p.L389P	LRIG1_uc011bfu.1_Missense_Mutation_p.L9P|LRIG1_uc003dmw.2_Missense_Mutation_p.L55P|LRIG1_uc010hnz.2_Intron|LRIG1_uc010hoa.2_Missense_Mutation_p.L413P	NM_015541	NP_056356	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like	389	Extracellular (Potential).|LRR 14.					integral to membrane				skin(3)|ovary(2)	5		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		GTTTCCAAACAGAGTCCTGTA	0.473													20	23	---	---	---	---	PASS
OR5K3	403277	broad.mit.edu	37	3	98109948	98109948	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98109948G>C	uc011bgw.1	+	1	439	c.439G>C	c.(439-441)GGA>CGA	p.G147R		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						GATGACTGCAGGAGCCTACCT	0.468													60	306	---	---	---	---	PASS
OR5K3	403277	broad.mit.edu	37	3	98109949	98109949	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98109949G>T	uc011bgw.1	+	1	440	c.440G>T	c.(439-441)GGA>GTA	p.G147V		NM_001005516	NP_001005516	A6NET4	OR5K3_HUMAN	olfactory receptor, family 5, subfamily K,	147	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0						ATGACTGCAGGAGCCTACCTA	0.468													64	301	---	---	---	---	PASS
MED12L	116931	broad.mit.edu	37	3	151067921	151067921	+	Silent	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:151067921A>G	uc003eyp.2	+	15	2258	c.2220A>G	c.(2218-2220)GCA>GCG	p.A740A	MED12L_uc011bnz.1_Silent_p.A600A|P2RY12_uc011boa.1_Intron|P2RY12_uc003eyx.1_Intron	NM_053002	NP_443728	Q86YW9	MD12L_HUMAN	mediator of RNA polymerase II transcription,	740					regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	mediator complex				ovary(4)|large_intestine(1)|central_nervous_system(1)|skin(1)	7			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GTGATGAAGCAAGGCATCAGC	0.413													146	514	---	---	---	---	PASS
ZNF718	255403	broad.mit.edu	37	4	155143	155143	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:155143G>C	uc003fzt.3	+	8	801	c.668G>C	c.(667-669)AGA>ACA	p.R223T	ZNF595_uc003fzu.1_Intron|ZNF718_uc010iaz.2_RNA|ZNF718_uc003fzw.3_Missense_Mutation_p.E3Q	NM_001039127	NP_001034216	Q3SXZ3	ZN718_HUMAN	zinc finger protein 718	223					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		ATTCATGCCAGAGAGAAATTC	0.378													3	57	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5617277	5617277	+	Intron	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5617277G>C	uc003gij.2	-						EVC2_uc011bwb.1_Intron|EVC2_uc003gik.2_Intron	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin							integral to membrane				large_intestine(3)|ovary(2)	5						TGTTGCTGGAGAGGGGTTGGG	0.522													20	229	---	---	---	---	PASS
GRSF1	2926	broad.mit.edu	37	4	71698085	71698085	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:71698085C>T	uc010iia.1	-	4	836	c.753G>A	c.(751-753)GTG>GTA	p.V251V	GRSF1_uc011caz.1_Silent_p.V133V|GRSF1_uc003hfs.2_Silent_p.V89V	NM_002092	NP_002083	Q12849	GRSF1_HUMAN	G-rich RNA sequence binding factor 1 isoform 1	251	RRM 2.				mRNA polyadenylation		mRNA binding|nucleotide binding				0		all_hematologic(202;0.21)	Lung(101;0.235)			TCAAACGAACCACACCATCAT	0.393													18	87	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762470	96762470	+	3'UTR	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762470G>T	uc003htr.3	+	1						NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor						glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	GTCAGTTAAAGGGAGGCTACG	0.383													15	67	---	---	---	---	PASS
PDHA2	5161	broad.mit.edu	37	4	96762471	96762471	+	3'UTR	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:96762471G>T	uc003htr.3	+	1						NM_005390	NP_005381	P29803	ODPAT_HUMAN	pyruvate dehydrogenase E1 alpha 2 precursor						glycolysis	mitochondrial matrix	pyruvate dehydrogenase (acetyl-transferring) activity			central_nervous_system(1)	1		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.23e-06)	NADH(DB00157)	TCAGTTAAAGGGAGGCTACGT	0.378													15	65	---	---	---	---	PASS
ADH1B	125	broad.mit.edu	37	4	100231999	100231999	+	Silent	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:100231999T>C	uc003hus.3	-	8	1110	c.1026A>G	c.(1024-1026)TCA>TCG	p.S342S	ADH1A_uc011ceg.1_Intron|ADH1B_uc003hut.3_Silent_p.S302S|ADH1B_uc011ceh.1_Silent_p.S187S|ADH1B_uc011cei.1_Silent_p.S302S	NM_000668	NP_000659	P00325	ADH1B_HUMAN	class I alcohol dehydrogenase, beta subunit	342					ethanol oxidation|xenobiotic metabolic process	cytosol	alcohol dehydrogenase activity, zinc-dependent|zinc ion binding			ovary(1)|breast(1)	2				OV - Ovarian serous cystadenocarcinoma(123;1.02e-07)	Fomepizole(DB01213)|NADH(DB00157)	ACGCATCCAGTGAAAACTTCT	0.358													42	153	---	---	---	---	PASS
ANKRD50	57182	broad.mit.edu	37	4	125591827	125591827	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:125591827G>T	uc003ifg.3	-	3	2871	c.2605C>A	c.(2605-2607)CAA>AAA	p.Q869K	ANKRD50_uc011cgo.1_Missense_Mutation_p.Q690K|ANKRD50_uc010inw.2_Missense_Mutation_p.Q869K	NM_020337	NP_065070	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	869	ANK 12.									central_nervous_system(1)	1						CTAGCACCTTGTTCAATAAGT	0.388													61	198	---	---	---	---	PASS
SORBS2	8470	broad.mit.edu	37	4	186544783	186544783	+	Silent	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:186544783G>A	uc003iyl.2	-	13	2646	c.1788C>T	c.(1786-1788)TCC>TCT	p.S596S	SORBS2_uc003iyh.2_Intron|SORBS2_uc011ckw.1_Intron|SORBS2_uc003iyi.2_Intron|SORBS2_uc011ckx.1_Intron|SORBS2_uc003iyk.2_Intron|SORBS2_uc003iym.2_Silent_p.S696S|SORBS2_uc003iyn.1_Intron|SORBS2_uc011cku.1_Intron|SORBS2_uc011ckv.1_Silent_p.S500S|SORBS2_uc003iyd.2_Intron|SORBS2_uc003iye.2_Intron|SORBS2_uc003iya.2_Intron|SORBS2_uc003iyb.2_Intron|SORBS2_uc003iyc.2_Intron|SORBS2_uc003iyg.2_Silent_p.S710S|SORBS2_uc003iyf.2_Intron|SORBS2_uc003iyo.1_Intron	NM_021069	NP_066547	O94875	SRBS2_HUMAN	sorbin and SH3 domain containing 2 isoform 2	596						actin cytoskeleton|nucleus|perinuclear region of cytoplasm|Z disc	cytoskeletal adaptor activity|structural constituent of cytoskeleton|structural constituent of muscle|zinc ion binding			ovary(1)	1		all_cancers(14;4.27e-52)|all_epithelial(14;6.58e-39)|all_lung(41;1.42e-13)|Lung NSC(41;3.73e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00692)|Hepatocellular(41;0.00826)|Renal(120;0.00994)|Prostate(90;0.0101)|all_hematologic(60;0.0174)|all_neural(102;0.244)		OV - Ovarian serous cystadenocarcinoma(60;1.54e-09)|BRCA - Breast invasive adenocarcinoma(30;0.000232)|GBM - Glioblastoma multiforme(59;0.000385)|STAD - Stomach adenocarcinoma(60;0.00109)|LUSC - Lung squamous cell carcinoma(40;0.0205)		GGTCGCTGTCGGAAAACTCCA	0.582													19	65	---	---	---	---	PASS
ADAMTS16	170690	broad.mit.edu	37	5	5303866	5303866	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:5303866C>T	uc003jdl.2	+	20	3311	c.3173C>T	c.(3172-3174)TCC>TTC	p.S1058F	ADAMTS16_uc003jdk.1_Missense_Mutation_p.S1058F	NM_139056	NP_620687	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1058	TSP type-1 5.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(3)|lung(2)|large_intestine(1)|breast(1)|pancreas(1)	8						TGGCTGGTGTCCGCCTGGTCC	0.547													3	46	---	---	---	---	PASS
ADAMTS12	81792	broad.mit.edu	37	5	33576688	33576688	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:33576688G>A	uc003jia.1	-	19	3606	c.3443C>T	c.(3442-3444)ACC>ATC	p.T1148I	ADAMTS12_uc010iuq.1_Missense_Mutation_p.T1063I	NM_030955	NP_112217	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1148	Spacer 2.				proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding			ovary(4)|skin(2)|upper_aerodigestive_tract(1)|lung(1)|kidney(1)	9						TGGACCTTTGGTCAAGGTATT	0.473										HNSCC(64;0.19)			54	220	---	---	---	---	PASS
C5orf42	65250	broad.mit.edu	37	5	37148352	37148352	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:37148352T>C	uc011cpa.1	-	42	8461	c.8230A>G	c.(8230-8232)ATT>GTT	p.I2744V	C5orf42_uc003jkp.1_RNA|C5orf42_uc011coy.1_Missense_Mutation_p.I1262V|C5orf42_uc003jks.2_RNA|C5orf42_uc011coz.1_Missense_Mutation_p.I1837V	NM_023073	NP_075561	E9PH94	E9PH94_HUMAN	hypothetical protein LOC65250	2744										ovary(4)|breast(2)|skin(1)	7	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GAGAATTCAATGTGATCCACT	0.343													56	83	---	---	---	---	PASS
FGF10	2255	broad.mit.edu	37	5	44305140	44305140	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:44305140T>A	uc003jog.1	-	3	584	c.584A>T	c.(583-585)AAA>ATA	p.K195I		NM_004465	NP_004456	O15520	FGF10_HUMAN	fibroblast growth factor 10 precursor	195					actin cytoskeleton reorganization|activation of MAPK activity|bud outgrowth involved in lung branching|ERK1 and ERK2 cascade|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|insulin receptor signaling pathway|lacrimal gland development|lung saccule development|mesonephros development|negative regulation of cell cycle arrest|positive regulation of ATPase activity|positive regulation of cyclin-dependent protein kinase activity involved in G1/S|positive regulation of DNA repair|positive regulation of DNA replication|positive regulation of epithelial cell migration|positive regulation of epithelial cell proliferation involved in wound healing|positive regulation of ERK1 and ERK2 cascade|positive regulation of hair follicle cell proliferation|positive regulation of keratinocyte migration|positive regulation of keratinocyte proliferation|positive regulation of lymphocyte proliferation|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of Ras protein signal transduction|positive regulation of transcription, DNA-dependent|positive regulation of urothelial cell proliferation|protein localization at cell surface|radial glial cell differentiation|regulation of saliva secretion|response to protein stimulus|secretion by lung epithelial cell involved in lung growth|tear secretion|thymus development|urothelial cell proliferation	cell surface|extracellular space|nucleus|plasma membrane	chemoattractant activity|growth factor activity|heparin binding|type 2 fibroblast growth factor receptor binding			lung(3)	3	Lung NSC(6;1.12e-06)					AGAGGTGTTTTTCCTTCGTGT	0.438													25	386	---	---	---	---	PASS
PPIP5K2	23262	broad.mit.edu	37	5	102472515	102472515	+	Silent	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:102472515C>G	uc003kod.3	+	4	909	c.390C>G	c.(388-390)CTC>CTG	p.L130L	PPIP5K2_uc011cva.1_RNA|PPIP5K2_uc003koe.2_Silent_p.L130L|PPIP5K2_uc010jbo.1_Silent_p.L52L	NM_015216	NP_056031	O43314	VIP2_HUMAN	Histidine acid phosphatase domain containing 1	130					inositol metabolic process	cytosol	acid phosphatase activity|ATP binding|diphosphoinositol-pentakisphosphate kinase activity|inositol 1,3,4,5,6-pentakisphosphate kinase activity|inositol hexakisphosphate 5-kinase activity			ovary(1)|skin(1)	2						TGCAGTATCTCATACAAGATA	0.279													5	255	---	---	---	---	PASS
PRPF4B	8899	broad.mit.edu	37	6	4032677	4032677	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:4032677C>T	uc003mvv.2	+	2	1017	c.926C>T	c.(925-927)TCC>TTC	p.S309F	PRPF4B_uc011dhv.1_RNA	NM_003913	NP_003904	Q13523	PRP4B_HUMAN	serine/threonine-protein kinase PRP4K	309	Arg/Lys-rich (basic).					catalytic step 2 spliceosome	ATP binding|protein binding|protein serine/threonine kinase activity			breast(5)	5	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				AGGTCACGGTCCAAAGAGAGA	0.383													19	137	---	---	---	---	PASS
DST	667	broad.mit.edu	37	6	56489989	56489989	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:56489989C>T	uc003pdf.2	-	34	4725	c.4697G>A	c.(4696-4698)AGA>AAA	p.R1566K	DST_uc003pcz.3_Missense_Mutation_p.R1388K|DST_uc011dxj.1_Missense_Mutation_p.R1417K|DST_uc011dxk.1_Missense_Mutation_p.R1428K|DST_uc003pcy.3_Missense_Mutation_p.R1062K|DST_uc003pdb.2_Missense_Mutation_p.R1062K|DST_uc003pdc.3_Missense_Mutation_p.R1062K|DST_uc003pdd.3_Missense_Mutation_p.R1062K	NM_001144769	NP_001138241	Q03001	DYST_HUMAN	dystonin isoform 2	1388	Nuclear localization signal; in isoform 6 (By similarity).				cell adhesion|cell cycle arrest|cell motility|hemidesmosome assembly|integrin-mediated signaling pathway|intermediate filament cytoskeleton organization|maintenance of cell polarity|microtubule cytoskeleton organization|response to wounding	actin cytoskeleton|axon|axon part|basement membrane|cell cortex|cell leading edge|cytoplasmic membrane-bounded vesicle|endoplasmic reticulum membrane|hemidesmosome|hemidesmosome|integral to membrane|intermediate filament|intermediate filament cytoskeleton|microtubule cytoskeleton|microtubule plus end|nuclear envelope|sarcomere|Z disc	actin binding|calcium ion binding|integrin binding|microtubule plus-end binding|protein binding|protein C-terminus binding|protein homodimerization activity			ovary(7)|central_nervous_system(6)|upper_aerodigestive_tract(1)	14	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			ACTCTGCATTCTTCGGCGTTT	0.358													5	374	---	---	---	---	PASS
COL12A1	1303	broad.mit.edu	37	6	75806966	75806966	+	Intron	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:75806966T>C	uc003phs.2	-						COL12A1_uc003pht.2_Intron	NM_004370	NP_004361	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1 long isoform						cell adhesion|collagen fibril organization|skeletal system development	collagen type XII|extracellular space	extracellular matrix structural constituent conferring tensile strength			ovary(6)|large_intestine(1)|breast(1)|skin(1)	9						ATTTAGTTCTTACCGGCGGCC	0.488													16	61	---	---	---	---	PASS
MYO6	4646	broad.mit.edu	37	6	76540217	76540217	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76540217C>A	uc003pih.1	+	5	625	c.346C>A	c.(346-348)CAA>AAA	p.Q116K	MYO6_uc003pig.1_Missense_Mutation_p.Q116K|MYO6_uc003pii.1_Missense_Mutation_p.Q116K	NM_004999	NP_004990	Q9UM54	MYO6_HUMAN	myosin VI	116	Myosin head-like.				actin filament-based movement|DNA damage response, signal transduction by p53 class mediator|endocytosis|intracellular protein transport|positive regulation of transcription from RNA polymerase II promoter|regulation of secretion|sensory perception of sound|synaptic transmission	cell cortex|clathrin coated vesicle membrane|coated pit|cytosol|DNA-directed RNA polymerase II, holoenzyme|filamentous actin|Golgi apparatus|nuclear membrane|perinuclear region of cytoplasm|ruffle membrane|unconventional myosin complex	actin filament binding|ADP binding|ATP binding|calmodulin binding|minus-end directed microfilament motor activity|protein binding			kidney(1)|pancreas(1)	2		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAAGTCATATCAAGGAAAATC	0.308													4	161	---	---	---	---	PASS
SFRS18	25957	broad.mit.edu	37	6	99853903	99853903	+	Intron	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99853903C>G	uc003ppo.3	-						SFRS18_uc003ppp.3_Intron|SFRS18_uc011eag.1_Intron	NM_032870	NP_116259	Q8TF01	PNISR_HUMAN	splicing factor, arginine/serine-rich 130							nuclear speck					0		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0631)		CTTTAACATTCTACCATTTGA	0.388													9	96	---	---	---	---	PASS
AIM1	202	broad.mit.edu	37	6	106978181	106978181	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:106978181A>T	uc003prh.2	+	6	3972	c.3485A>T	c.(3484-3486)CAT>CTT	p.H1162L		NM_001624	NP_001615	Q9Y4K1	AIM1_HUMAN	absent in melanoma 1	1162	Beta/gamma crystallin 'Greek key' 3.						sugar binding			breast(4)|ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|skin(1)	9	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ATGAAAGTACATTGGGGCACG	0.348													44	188	---	---	---	---	PASS
WISP3	8838	broad.mit.edu	37	6	112389555	112389555	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:112389555T>C	uc003pvm.2	+	5	847	c.737T>C	c.(736-738)CTG>CCG	p.L246P	WISP3_uc003pvn.2_RNA|WISP3_uc003pvo.2_Missense_Mutation_p.L264P	NM_003880	NP_003871	O95389	WISP3_HUMAN	WNT1 inducible signaling pathway protein 3	246	TSP type-1.				cell-cell signaling|regulation of cell growth|signal transduction	extracellular region|soluble fraction	growth factor activity|insulin-like growth factor binding				0		all_cancers(87;0.000196)|Acute lymphoblastic leukemia(125;1.18e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00542)|Colorectal(196;0.0209)		all cancers(137;0.0283)|OV - Ovarian serous cystadenocarcinoma(136;0.0613)|Epithelial(106;0.0827)|GBM - Glioblastoma multiforme(226;0.0972)|BRCA - Breast invasive adenocarcinoma(108;0.246)		GAGAAAAGACTGTGTTACATT	0.343													18	55	---	---	---	---	PASS
SYNE1	23345	broad.mit.edu	37	6	152777171	152777171	+	Silent	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:152777171T>C	uc010kiw.2	-	23	3179	c.2577A>G	c.(2575-2577)TTA>TTG	p.L859L	SYNE1_uc003qot.3_Silent_p.L866L|SYNE1_uc003qou.3_Silent_p.L859L|SYNE1_uc010kjb.1_Silent_p.L842L|SYNE1_uc003qow.2_Silent_p.L154L|SYNE1_uc003qox.1_Silent_p.L375L|SYNE1_uc003qoz.2_Silent_p.L291L|SYNE1_uc003qoy.2_Silent_p.L426L	NM_182961	NP_892006	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	859	Cytoplasmic (Potential).				cell death|cytoskeletal anchoring at nuclear membrane|Golgi organization|muscle cell differentiation|nuclear matrix anchoring at nuclear membrane	cytoskeleton|Golgi apparatus|integral to membrane|nuclear outer membrane|postsynaptic membrane|sarcomere|SUN-KASH complex	actin binding|lamin binding			central_nervous_system(15)|upper_aerodigestive_tract(9)|ovary(8)|skin(6)|large_intestine(5)|pancreas(2)	45		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CTTGACAAGCTAACAGTTCCT	0.358										HNSCC(10;0.0054)			30	139	---	---	---	---	PASS
ETV1	2115	broad.mit.edu	37	7	13949273	13949273	+	Silent	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:13949273G>C	uc011jxq.1	-	11	1663	c.924C>G	c.(922-924)GTC>GTG	p.V308V	ETV1_uc011jxn.1_Silent_p.V268V|ETV1_uc011jxo.1_Silent_p.V205V|ETV1_uc011jxp.1_Silent_p.V250V|ETV1_uc003ssw.3_Silent_p.V285V|ETV1_uc003ssx.2_RNA|ETV1_uc011jxr.1_Silent_p.V290V|ETV1_uc011jxs.1_Silent_p.V290V|ETV1_uc010ktv.2_Missense_Mutation_p.S177C	NM_004956	NP_004947	P50549	ETV1_HUMAN	ets variant gene 1 isoform a	308					transcription from RNA polymerase II promoter	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity		TMPRSS2/ETV1(24)|EWSR1/ETV1(7)	prostate(24)|soft_tissue(4)|bone(3)|lung(2)|central_nervous_system(1)|ovary(1)	35						ATTTTTCTGGGACAACACAGG	0.388			T	EWSR1|TMPRSS2|SLC45A3|C15orf21|HNRNPA2B1. ACSL3	Ewing sarcoma|prostate								14	227	---	---	---	---	PASS
HDAC9	9734	broad.mit.edu	37	7	18630117	18630117	+	Intron	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:18630117G>A	uc003suh.2	+						HDAC9_uc003sue.2_Intron|HDAC9_uc011jyd.1_Intron|HDAC9_uc003sui.2_Intron|HDAC9_uc003suj.2_Intron|HDAC9_uc011jya.1_Intron|HDAC9_uc003sua.1_Intron|HDAC9_uc011jyb.1_Intron|HDAC9_uc003sud.1_Intron|HDAC9_uc011jyc.1_Intron|HDAC9_uc003suf.1_Intron|HDAC9_uc010kud.1_Intron|HDAC9_uc011jye.1_Intron|HDAC9_uc011jyf.1_Intron|HDAC9_uc010kue.1_Intron	NM_058176	NP_478056	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9 isoform 1						B cell differentiation|cellular response to insulin stimulus|heart development|histone H3 deacetylation|histone H4 deacetylation|inflammatory response|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription, DNA-dependent|peptidyl-lysine deacetylation|positive regulation of cell migration involved in sprouting angiogenesis|regulation of skeletal muscle fiber development|transcription, DNA-dependent	cytoplasm|histone deacetylase complex|histone methyltransferase complex|transcription factor complex	histone deacetylase activity (H3-K16 specific)|histone deacetylase binding|histone deacetylase binding|NAD-dependent histone deacetylase activity (H3-K14 specific)|NAD-dependent histone deacetylase activity (H3-K9 specific)|NAD-dependent histone deacetylase activity (H4-K16 specific)|protein binding|protein kinase C binding|repressing transcription factor binding|transcription corepressor activity			lung(2)|central_nervous_system(2)|kidney(1)	5	all_lung(11;0.187)				Valproic Acid(DB00313)	AAAGTAAGAGGCACCAGGGTA	0.468													4	7	---	---	---	---	PASS
BMPER	168667	broad.mit.edu	37	7	34094781	34094781	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34094781A>G	uc011kap.1	+	9	907	c.793A>G	c.(793-795)ACT>GCT	p.T265A		NM_133468	NP_597725	Q8N8U9	BMPER_HUMAN	BMP-binding endothelial regulator precursor	265	VWFC 4.				blood vessel endothelial cell proliferation involved in sprouting angiogenesis|endothelial cell activation|negative regulation of BMP signaling pathway|positive regulation of ERK1 and ERK2 cascade|regulation of endothelial cell migration|regulation of pathway-restricted SMAD protein phosphorylation	extracellular space				ovary(2)|central_nervous_system(1)	3						CCAGGACTCTACTGTGGTTTG	0.498													51	180	---	---	---	---	PASS
SAMD9L	219285	broad.mit.edu	37	7	92764414	92764414	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:92764414C>T	uc003umh.1	-	5	2087	c.871G>A	c.(871-873)GAA>AAA	p.E291K	SAMD9L_uc003umj.1_Missense_Mutation_p.E291K|SAMD9L_uc003umi.1_Missense_Mutation_p.E291K|SAMD9L_uc010lfb.1_Missense_Mutation_p.E291K|SAMD9L_uc003umk.1_Missense_Mutation_p.E291K|SAMD9L_uc010lfc.1_Missense_Mutation_p.E291K|SAMD9L_uc010lfd.1_Missense_Mutation_p.E291K|SAMD9L_uc011khx.1_Intron	NM_152703	NP_689916	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	291										ovary(4)	4	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			AGAAGGACTTCCACAAACCTT	0.363													7	350	---	---	---	---	PASS
ZNF498	221785	broad.mit.edu	37	7	99226808	99226808	+	Intron	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99226808C>T	uc003url.1	+						ZNF498_uc003urm.1_Intron|ZNF498_uc010lge.1_Intron|ZNF498_uc003urn.2_Intron|ZNF498_uc010lgf.1_Intron|ZNF498_uc003uro.1_Intron	NM_145115	NP_660090	Q6NSZ9	ZN498_HUMAN	zinc finger and SCAN domain containing 25						viral reproduction	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(2)	2	all_epithelial(64;1.95e-08)|Lung NSC(181;0.0066)|all_lung(186;0.011)|Esophageal squamous(72;0.0166)					TCCTCCTGTCCTGTAGGCGGT	0.512													35	74	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	100552779	100552779	+	Intron	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100552779G>T	uc003uxk.1	+						uc003uxl.1_Intron					Homo sapiens MUC3B mRNA for intestinal mucin, partial cds.																		CTGCAGGTTGGACCTTCTGCC	0.527													31	304	---	---	---	---	PASS
FEZF1	389549	broad.mit.edu	37	7	121944169	121944169	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:121944169G>T	uc003vkd.2	-	1	397	c.323C>A	c.(322-324)GCG>GAG	p.A108E	FEZF1_uc003vkc.2_Missense_Mutation_p.A108E|uc010lko.1_RNA|uc003vkf.1_5'Flank	NM_001024613	NP_001019784	A0PJY2	FEZF1_HUMAN	FEZ family zinc finger 1 isoform 1	108					cell differentiation|nervous system development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)|breast(1)	3						CGAGGGCAccgccgcgggcgc	0.602													7	13	---	---	---	---	PASS
CUL1	8454	broad.mit.edu	37	7	148457552	148457552	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:148457552C>A	uc010lpg.2	+	7	1279	c.753C>A	c.(751-753)TTC>TTA	p.F251L	CUL1_uc003wey.2_Missense_Mutation_p.F251L|CUL1_uc003wez.2_Missense_Mutation_p.F141L	NM_003592	NP_003583	Q13616	CUL1_HUMAN	cullin 1	251					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|cell cycle arrest|G1/S transition of mitotic cell cycle|induction of apoptosis by intracellular signals|interspecies interaction between organisms|negative regulation of cell proliferation|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|protein ubiquitination|S phase of mitotic cell cycle|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process	cytosol|nucleoplasm|SCF ubiquitin ligase complex	ubiquitin protein ligase binding			lung(1)	1	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00291)			GTACTGAATTCTTGCAGCAGA	0.348													6	326	---	---	---	---	PASS
SSPO	23145	broad.mit.edu	37	7	149522435	149522435	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149522435G>A	uc010lpk.2	+	101	14062	c.14062G>A	c.(14062-14064)GAC>AAC	p.D4688N	SSPO_uc010lpm.1_RNA|SSPO_uc003wgg.2_RNA|SSPO_uc003wgh.2_RNA|SSPO_uc003wgi.1_RNA	NM_198455	NP_940857	A2VEC9	SSPO_HUMAN	SCO-spondin precursor	4688	TIL 6.				cell adhesion	extracellular space	peptidase inhibitor activity				0	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGCTGTGCCGACCTCTGGGA	0.622													30	102	---	---	---	---	PASS
REPIN1	29803	broad.mit.edu	37	7	150069612	150069612	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150069612G>T	uc010lpq.1	+	4	1771	c.1282G>T	c.(1282-1284)GAG>TAG	p.E428*	REPIN1_uc003whd.2_Nonsense_Mutation_p.E417*|REPIN1_uc010lpr.1_Nonsense_Mutation_p.E485*|REPIN1_uc003whc.2_Nonsense_Mutation_p.E428*|REPIN1_uc003whe.2_Nonsense_Mutation_p.E428*	NM_013400	NP_037532	Q9BWE0	REPI1_HUMAN	replication initiator 1 isoform 1	428					DNA replication	nuclear origin of replication recognition complex	DNA binding|zinc ion binding			pancreas(1)	1	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GCACTCCGGCGAGCGGCCCTT	0.731													7	9	---	---	---	---	PASS
RNF32	140545	broad.mit.edu	37	7	156469341	156469341	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:156469341G>C	uc003wmo.2	+	9	1263	c.1081G>C	c.(1081-1083)GAA>CAA	p.E361Q	RNF32_uc010lqm.2_Missense_Mutation_p.E361Q|RNF32_uc003wmq.2_3'UTR|RNF32_uc003wmr.2_Missense_Mutation_p.E361Q|RNF32_uc003wmu.2_RNA	NM_030936	NP_112198	Q9H0A6	RNF32_HUMAN	ring finger protein 32	361						aggresome|endosome	protein binding|zinc ion binding				0	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		GAAGATTCTTGAATGTTGAAT	0.453													3	91	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25174654	25174654	+	Intron	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25174654G>T	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xei.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GGAGGTGCGCGGCATGGCCCA	0.488													54	292	---	---	---	---	PASS
DOCK5	80005	broad.mit.edu	37	8	25174655	25174655	+	Intron	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:25174655G>T	uc003xeg.2	+						DOCK5_uc010luf.1_Intron|DOCK5_uc003xeh.1_Intron|DOCK5_uc003xei.2_Intron	NM_024940	NP_079216	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5							cytoplasm	GTP binding|GTPase binding|guanyl-nucleotide exchange factor activity			ovary(3)	3		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		GAGGTGCGCGGCATGGCCCAG	0.483													52	292	---	---	---	---	PASS
MYBL1	4603	broad.mit.edu	37	8	67488371	67488371	+	Silent	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67488371G>C	uc003xwj.2	-	10	1748	c.1341C>G	c.(1339-1341)CTC>CTG	p.L447L	MYBL1_uc003xwl.2_Silent_p.L447L|MYBL1_uc003xwk.2_Silent_p.L446L	NM_001080416	NP_001073885	P10243	MYBA_HUMAN	v-myb myeloblastosis viral oncogene homolog	447	Negative regulatory domain (By similarity).				positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)|pancreas(1)	3			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			TCTTCTTTCTGAGGATGGCTG	0.448													22	191	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89068417	89068417	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89068417C>A	uc003yeb.3	-	8	1594	c.1312G>T	c.(1312-1314)GGT>TGT	p.G438C		NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	438	Extracellular (Potential).				collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						GAATCAATACCATGAGGGGGA	0.418													73	145	---	---	---	---	PASS
MMP16	4325	broad.mit.edu	37	8	89198754	89198754	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:89198754G>A	uc003yeb.3	-	3	637	c.355C>T	c.(355-357)CGA>TGA	p.R119*	MMP16_uc003yec.2_Nonsense_Mutation_p.R119*	NM_005941	NP_005932	P51512	MMP16_HUMAN	matrix metalloproteinase 16 isoform 1	119					collagen catabolic process|proteolysis	cell surface|integral to plasma membrane|proteinaceous extracellular matrix	calcium ion binding|enzyme activator activity|metalloendopeptidase activity|zinc ion binding			upper_aerodigestive_tract(2)|ovary(2)|central_nervous_system(1)|urinary_tract(1)|skin(1)|kidney(1)	8						AATGCATATCGCTTTCGACGA	0.393													15	601	---	---	---	---	PASS
SLC26A7	115111	broad.mit.edu	37	8	92378924	92378924	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:92378924G>T	uc003yex.2	+	15	1883	c.1605G>T	c.(1603-1605)CAG>CAT	p.Q535H	SLC26A7_uc003yey.2_RNA|SLC26A7_uc003yez.2_Missense_Mutation_p.Q535H|SLC26A7_uc003yfa.2_Missense_Mutation_p.Q535H	NM_052832	NP_439897	Q8TE54	S26A7_HUMAN	solute carrier family 26, member 7 isoform a	535	STAS.|Cytoplasmic (Potential).					basolateral plasma membrane|integral to membrane|recycling endosome membrane	anion:anion antiporter activity|bicarbonate transmembrane transporter activity|chloride channel activity|oxalate transmembrane transporter activity|sulfate transmembrane transporter activity			ovary(2)	2			BRCA - Breast invasive adenocarcinoma(11;0.00802)			CCTGTAATCAGCCACTTGATG	0.308													103	201	---	---	---	---	PASS
RNF19A	25897	broad.mit.edu	37	8	101270912	101270912	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101270912C>T	uc003yjj.1	-	11	2706	c.2389G>A	c.(2389-2391)GAA>AAA	p.E797K	RNF19A_uc003yjk.1_Missense_Mutation_p.E797K	NM_015435	NP_056250	Q9NV58	RN19A_HUMAN	ring finger protein 19	797	Interaction with CASR.				microtubule cytoskeleton organization|protein modification process	centrosome|integral to membrane	ligase activity|transcription factor binding|zinc ion binding			ovary(2)|central_nervous_system(1)|skin(1)	4	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			CCATGTTCTTCAGCAATATGA	0.363													15	246	---	---	---	---	PASS
PABPC1	26986	broad.mit.edu	37	8	101721391	101721391	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:101721391G>A	uc003yjs.1	-	9	1810	c.1306C>T	c.(1306-1308)CGC>TGC	p.R436C	PABPC1_uc011lhc.1_Missense_Mutation_p.R404C|PABPC1_uc011lhd.1_Missense_Mutation_p.R391C|PABPC1_uc003yjt.1_Missense_Mutation_p.R433C|PABPC1_uc003yju.2_RNA	NM_002568	NP_002559	P11940	PABP1_HUMAN	poly(A) binding protein, cytoplasmic 1	436					mRNA polyadenylation|mRNA stabilization|negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|nuclear-transcribed mRNA poly(A) tail shortening|translation	catalytic step 2 spliceosome|cytosol	nucleotide binding|poly(A) RNA binding|protein C-terminus binding|translation activator activity				0	all_cancers(14;6.8e-05)|all_epithelial(15;3.16e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;6.37e-11)|all cancers(13;1.11e-08)|OV - Ovarian serous cystadenocarcinoma(57;3.91e-05)|STAD - Stomach adenocarcinoma(118;0.206)			GCAGTCCAGCGAGGACTTGGT	0.418													8	390	---	---	---	---	PASS
SCRIB	23513	broad.mit.edu	37	8	144885849	144885849	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144885849C>T	uc003yzp.1	-	23	3389	c.3382G>A	c.(3382-3384)GAC>AAC	p.D1128N	SCRIB_uc003yzn.1_5'UTR|SCRIB_uc003yzo.1_Missense_Mutation_p.D1128N	NM_015356	NP_056171	Q14160	SCRIB_HUMAN	scribble isoform b	1128	PDZ 4.|Interaction with ARHGEF7.				activation of Rac GTPase activity|apoptosis involved in morphogenesis|cell migration|cell proliferation|cell-cell adhesion|establishment of apical/basal cell polarity|interspecies interaction between organisms|mammary gland duct morphogenesis|negative regulation of mitotic cell cycle|positive chemotaxis|positive regulation of apoptosis|positive regulation of receptor recycling|protein localization to adherens junction	cell-cell adherens junction|Scrib-APC-beta-catenin complex	protein binding			urinary_tract(1)|ovary(1)|kidney(1)|central_nervous_system(1)|pancreas(1)	5	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			TCTGTGGGGTCGCGGGGGTTG	0.701													11	9	---	---	---	---	PASS
TRPM6	140803	broad.mit.edu	37	9	77422954	77422954	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:77422954T>C	uc004ajl.1	-	14	1872	c.1634A>G	c.(1633-1635)TAC>TGC	p.Y545C	TRPM6_uc004ajk.1_Missense_Mutation_p.Y540C|TRPM6_uc010mpb.1_RNA|TRPM6_uc010mpc.1_Missense_Mutation_p.Y545C|TRPM6_uc010mpd.1_Intron|TRPM6_uc010mpe.1_Intron	NM_017662	NP_060132	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel,	545	Cytoplasmic (Potential).				response to toxin	integral to membrane	ATP binding|calcium channel activity|metal ion binding|protein binding|protein serine/threonine kinase activity			lung(3)|stomach(2)|haematopoietic_and_lymphoid_tissue(1)|central_nervous_system(1)|skin(1)	8						CTCTACCTTGTATTTTCTGTA	0.368													10	287	---	---	---	---	PASS
PRUNE2	158471	broad.mit.edu	37	9	79321922	79321922	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:79321922G>C	uc010mpk.2	-	8	5392	c.5268C>G	c.(5266-5268)TTC>TTG	p.F1756L	PRUNE2_uc004akj.3_5'Flank|PRUNE2_uc010mpl.1_5'Flank	NM_015225	NP_056040	Q8WUY3	PRUN2_HUMAN	prune homolog 2	1756					apoptosis|G1 phase|induction of apoptosis	cytoplasm	metal ion binding|pyrophosphatase activity				0						GATTGTCACAGAATGGGTTTG	0.428													5	137	---	---	---	---	PASS
IARS	3376	broad.mit.edu	37	9	94991310	94991310	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:94991310C>G	uc004art.1	-	31	3639	c.3382G>C	c.(3382-3384)GAG>CAG	p.E1128Q	IARS_uc004ars.1_Intron|IARS_uc004aru.3_Missense_Mutation_p.E1128Q|IARS_uc010mqr.2_Missense_Mutation_p.E1018Q|IARS_uc010mqt.2_Missense_Mutation_p.E351Q	NM_013417	NP_038203	P41252	SYIC_HUMAN	isoleucine tRNA synthetase	1128					isoleucyl-tRNA aminoacylation	cytosol|nucleus|soluble fraction	ATP binding|isoleucine-tRNA ligase activity|protein binding			ovary(1)|skin(1)	2					L-Isoleucine(DB00167)	ACAGCCAGCTCTGTATTTTTC	0.428													17	319	---	---	---	---	PASS
PALM2-AKAP2	445815	broad.mit.edu	37	9	112898755	112898755	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:112898755G>T	uc004bei.2	+	9	1819	c.1627G>T	c.(1627-1629)GAG>TAG	p.E543*	PALM2-AKAP2_uc004bek.3_Nonsense_Mutation_p.E311*|PALM2-AKAP2_uc004bej.3_Nonsense_Mutation_p.E311*|PALM2-AKAP2_uc004bel.1_Nonsense_Mutation_p.E121*|AKAP2_uc011lwi.1_Nonsense_Mutation_p.E169*|AKAP2_uc004bem.2_Nonsense_Mutation_p.E169*|PALM2-AKAP2_uc010mtw.1_Nonsense_Mutation_p.E129*|AKAP2_uc011lwj.1_Nonsense_Mutation_p.E80*|PALM2-AKAP2_uc004ben.2_Nonsense_Mutation_p.E80*	NM_001136562	NP_001130034	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2 isoform 2	80							enzyme binding			ovary(3)|central_nervous_system(2)|skin(1)	6						ATCCTCCCCAGAGCCTGGTGC	0.577													70	150	---	---	---	---	PASS
COBRA1	25920	broad.mit.edu	37	9	140150833	140150833	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:140150833C>T	uc004cmm.3	+	3	522	c.319C>T	c.(319-321)CCG>TCG	p.P107S		NM_015456	NP_056271	Q8WX92	NELFB_HUMAN	cofactor of BRCA1	107					negative regulation of transcription, DNA-dependent|positive regulation of viral transcription|transcription elongation from RNA polymerase II promoter|viral reproduction	cytoplasm|nucleoplasm	protein binding				0	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.137)	OV - Ovarian serous cystadenocarcinoma(145;9.42e-05)|Epithelial(140;0.000766)		GGTGAAGATGCCGTCCCTGCA	0.572													4	115	---	---	---	---	PASS
CUBN	8029	broad.mit.edu	37	10	17142197	17142197	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17142197C>A	uc001ioo.2	-	14	1624	c.1572G>T	c.(1570-1572)ATG>ATT	p.M524I		NM_001081	NP_001072	O60494	CUBN_HUMAN	cubilin precursor	524	CUB 1.				cholesterol metabolic process|cobalamin transport|hormone biosynthetic process|lipoprotein metabolic process|receptor-mediated endocytosis|tissue homeostasis|vitamin D metabolic process	brush border membrane|cytosol|endosome membrane|extrinsic to external side of plasma membrane|lysosomal lumen|lysosomal membrane	calcium ion binding|cobalamin binding|protein homodimerization activity|receptor activity|transporter activity			ovary(9)|breast(4)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|kidney(1)	19					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GACAGTTGTCCATGGATTCTA	0.383													44	119	---	---	---	---	PASS
ST8SIA6	338596	broad.mit.edu	37	10	17432598	17432598	+	Silent	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:17432598C>A	uc001ipd.2	-	3	222	c.222G>T	c.(220-222)TCG>TCT	p.S74S	ST8SIA6_uc010qce.1_RNA|uc001ipe.2_Intron|uc001ipf.1_Intron	NM_001004470	NP_001004470	P61647	SIA8F_HUMAN	ST8 alpha-N-acetyl-neuraminide	74	Lumenal (Potential).				post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity			ovary(1)	1						TCAGTTGGAGCGACTTCTCAT	0.308													73	270	---	---	---	---	PASS
SLC39A12	221074	broad.mit.edu	37	10	18254544	18254544	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:18254544A>G	uc001ipo.2	+	4	949	c.676A>G	c.(676-678)AAC>GAC	p.N226D	SLC39A12_uc001ipn.2_Missense_Mutation_p.N226D|SLC39A12_uc001ipp.2_Missense_Mutation_p.N226D|SLC39A12_uc010qck.1_Missense_Mutation_p.N92D	NM_001145195	NP_001138667	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter),	226	Cytoplasmic (Potential).				zinc ion transport	integral to membrane	metal ion transmembrane transporter activity			ovary(1)|breast(1)	2						GGGACAAGGAAACTTGCCTTC	0.438													36	89	---	---	---	---	PASS
ERCC6	2074	broad.mit.edu	37	10	50690811	50690811	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50690811T>A	uc001jhs.3	-	10	2245	c.2091A>T	c.(2089-2091)TTA>TTT	p.L697F	ERCC6_uc010qgr.1_Missense_Mutation_p.L67F|ERCC6_uc001jhr.3_Missense_Mutation_p.L97F	NM_000124	NP_000115	Q03468	ERCC6_HUMAN	excision repair cross-complementing rodent	697					base-excision repair|positive regulation of transcription elongation, DNA-dependent|transcription from RNA polymerase II promoter|transcription-coupled nucleotide-excision repair	nucleolus|soluble fraction|transcription elongation factor complex	ATP binding|chromatin binding|DNA binding|DNA-dependent ATPase activity|helicase activity|protein C-terminus binding|protein complex binding|protein N-terminus binding			lung(5)|breast(5)|ovary(3)|large_intestine(2)|skin(1)	16						GCAACGTGCCTAACTTTCCCG	0.483								Direct_reversal_of_damage|NER					39	136	---	---	---	---	PASS
CHAT	1103	broad.mit.edu	37	10	50856640	50856640	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:50856640C>A	uc001jhz.2	+	9	1522	c.1369C>A	c.(1369-1371)CTG>ATG	p.L457M	CHAT_uc001jhv.1_Missense_Mutation_p.L339M|CHAT_uc001jhx.1_Missense_Mutation_p.L339M|CHAT_uc001jhy.1_Missense_Mutation_p.L339M|CHAT_uc001jia.2_Missense_Mutation_p.L339M|CHAT_uc010qgs.1_Missense_Mutation_p.L339M	NM_020549	NP_065574	P28329	CLAT_HUMAN	choline acetyltransferase isoform 2	457					neurotransmitter biosynthetic process|neurotransmitter secretion	cytosol|nucleus	choline O-acetyltransferase activity			central_nervous_system(3)	3		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)	CACTGAGCATCTGCTCAAGCA	0.582													17	34	---	---	---	---	PASS
DLG5	9231	broad.mit.edu	37	10	79581516	79581516	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:79581516T>C	uc001jzk.2	-	15	2796	c.2726A>G	c.(2725-2727)GAC>GGC	p.D909G	DLG5_uc001jzi.2_5'Flank|DLG5_uc001jzj.2_Intron|DLG5_uc009xru.1_RNA|DLG5_uc001jzl.3_Missense_Mutation_p.D513G	NM_004747	NP_004738	Q8TDM6	DLG5_HUMAN	discs large homolog 5	909					cell-cell adhesion|intracellular signal transduction|negative regulation of cell proliferation|regulation of apoptosis	cell junction|cytoplasm	beta-catenin binding|cytoskeletal protein binding|receptor signaling complex scaffold activity			ovary(5)|breast(3)	8	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			GCCACGCACGTCCACCAGCCC	0.677													12	11	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87628874	87628874	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87628874G>A	uc001kdl.1	-	6	945	c.844C>T	c.(844-846)CGG>TGG	p.R282W	GRID1_uc009xsu.1_RNA	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	282	Extracellular (Potential).					cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	AAGATTTGCCGGACCACGGTC	0.537										Multiple Myeloma(13;0.14)			12	243	---	---	---	---	PASS
PTEN	5728	broad.mit.edu	37	10	89685287	89685287	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:89685287A>G	uc001kfb.2	+	4	1213	c.182A>G	c.(181-183)CAT>CGT	p.H61R		NM_000314	NP_000305	P60484	PTEN_HUMAN	phosphatase and tensin homolog	61	Phosphatase tensin-type.		H -> R (loss of phosphatase activity towards Ins(1,3,4,5)P4).|H -> D (in VATER).		activation of mitotic anaphase-promoting complex activity|apoptosis|canonical Wnt receptor signaling pathway|cell proliferation|central nervous system development|induction of apoptosis|inositol phosphate dephosphorylation|negative regulation of cell migration|negative regulation of cyclin-dependent protein kinase activity involved in G1/S|negative regulation of focal adhesion assembly|negative regulation of G1/S transition of mitotic cell cycle|negative regulation of protein kinase B signaling cascade|negative regulation of protein phosphorylation|nerve growth factor receptor signaling pathway|phosphatidylinositol dephosphorylation|phosphatidylinositol-mediated signaling|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process|positive regulation of sequence-specific DNA binding transcription factor activity|protein stabilization|regulation of neuron projection development|T cell receptor signaling pathway	cytosol|internal side of plasma membrane|PML body	anaphase-promoting complex binding|enzyme binding|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity|lipid binding|magnesium ion binding|PDZ domain binding|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity|phosphatidylinositol-3-phosphatase activity|protein serine/threonine phosphatase activity|protein tyrosine phosphatase activity|protein tyrosine/serine/threonine phosphatase activity	p.H61R(6)|p.?(4)|p.R55fs*1(4)|p.Y27fs*1(2)|p.Y27_N212>Y(2)|p.H61P(1)|p.H61L(1)|p.V54fs*29(1)|p.R55_L70>S(1)|p.F56fs*2(1)		endometrium(831)|central_nervous_system(657)|skin(121)|haematopoietic_and_lymphoid_tissue(101)|large_intestine(99)|prostate(97)|breast(73)|lung(65)|ovary(58)|thyroid(29)|stomach(29)|upper_aerodigestive_tract(25)|cervix(24)|liver(20)|vulva(17)|kidney(15)|NS(14)|soft_tissue(13)|urinary_tract(12)|eye(8)|pancreas(6)|salivary_gland(5)|bone(5)|biliary_tract(4)|autonomic_ganglia(2)|meninges(2)|testis(1)|oesophagus(1)	2334		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GATTCAAAGCATAAAAACCAT	0.259		31	D|Mis|N|F|S		glioma| prostate|endometrial	harmartoma|glioma| prostate|endometrial			Proteus_syndrome|Cowden_syndrome|Juvenile_Polyposis|Hereditary_Mixed_Polyposis_Syndrome_type_1|Bannayan-Riley-Ruvalcaba_syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)			10	26	---	---	---	---	PASS
TBC1D12	23232	broad.mit.edu	37	10	96162370	96162370	+	5'UTR	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:96162370G>A	uc001kjr.2	+	1						NM_015188	NP_056003	O60347	TBC12_HUMAN	TBC1 domain family, member 12							intracellular	Rab GTPase activator activity				0		Colorectal(252;0.0429)				CCCACCCCCAGATGGTGGGTC	0.697													29	20	---	---	---	---	PASS
HBD	3045	broad.mit.edu	37	11	5255418	5255418	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:5255418G>T	uc001maf.1	-	2	313	c.118C>A	c.(118-120)CAG>AAG	p.Q40K		NM_000519	NP_000510	P02042	HBD_HUMAN	delta globin	40					blood coagulation	hemoglobin complex	heme binding|oxygen binding|oxygen transporter activity	p.Q40H(1)		ovary(1)	1		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;5.69e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AAGAACCTCTGGGTCCAAGGG	0.512													44	105	---	---	---	---	PASS
AMPD3	272	broad.mit.edu	37	11	10483250	10483250	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:10483250G>T	uc001mio.1	+	2	519	c.184G>T	c.(184-186)GAG>TAG	p.E62*	AMPD3_uc010rbz.1_5'UTR|AMPD3_uc001min.1_Nonsense_Mutation_p.E71*|AMPD3_uc009yfw.1_RNA|AMPD3_uc009yfx.1_Nonsense_Mutation_p.E62*|AMPD3_uc009yfz.2_RNA|AMPD3_uc001mip.1_Nonsense_Mutation_p.E69*|AMPD3_uc009yfy.2_Nonsense_Mutation_p.E62*	NM_001025389	NP_001020560	Q01432	AMPD3_HUMAN	adenosine monophosphate deaminase 3 isoform 1B	62					AMP catabolic process|purine base metabolic process|purine ribonucleoside monophosphate biosynthetic process|purine-containing compound salvage	cytosol	AMP deaminase activity|metal ion binding			large_intestine(1)|ovary(1)	2				all cancers(16;1.14e-08)|Epithelial(150;2.83e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0291)		GCTGCAGAAGGAGCTGGCAGA	0.562													14	35	---	---	---	---	PASS
ANO3	63982	broad.mit.edu	37	11	26568986	26568986	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:26568986G>C	uc001mqt.3	+	12	1323	c.1178G>C	c.(1177-1179)GGA>GCA	p.G393A	ANO3_uc010rdr.1_Missense_Mutation_p.G377A|ANO3_uc010rds.1_Missense_Mutation_p.G232A|ANO3_uc010rdt.1_Missense_Mutation_p.G247A	NM_031418	NP_113606	Q9BYT9	ANO3_HUMAN	transmembrane protein 16C	393	Cytoplasmic (Potential).					chloride channel complex	chloride channel activity			ovary(2)|central_nervous_system(1)|pancreas(1)	4						GAGAAGATTGGACTATACTTT	0.373													12	527	---	---	---	---	PASS
OR10AG1	282770	broad.mit.edu	37	11	55735361	55735361	+	Silent	SNP	T	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:55735361T>A	uc010rit.1	-	1	579	c.579A>T	c.(577-579)GTA>GTT	p.V193V		NM_001005491	NP_001005491	Q8NH19	O10AG_HUMAN	olfactory receptor, family 10, subfamily AG,	193	Helical; Name=5; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(2)	2	Esophageal squamous(21;0.0137)					ACACCACCGCTACTACATGGA	0.393													34	96	---	---	---	---	PASS
SLC43A3	29015	broad.mit.edu	37	11	57176681	57176681	+	Silent	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57176681G>T	uc001nkg.2	-	13	1748	c.1338C>A	c.(1336-1338)CTC>CTA	p.L446L	PRG2_uc001nke.2_Intron|SLC43A3_uc001nkh.2_Silent_p.L446L|SLC43A3_uc010rjr.1_Silent_p.L459L|SLC43A3_uc009yme.2_Silent_p.L446L|SLC43A3_uc001nki.2_Silent_p.L446L	NM_014096	NP_054815	Q8NBI5	S43A3_HUMAN	solute carrier family 43, member 3	446	Helical; (Potential).				transmembrane transport	integral to membrane				central_nervous_system(1)	1						AGCCTTTGATGAGGGTGAAGA	0.572													7	241	---	---	---	---	PASS
OR5B12	390191	broad.mit.edu	37	11	58207629	58207629	+	5'Flank	SNP	A	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:58207629A>C	uc010rkh.1	-							NM_001004733	NP_001004733	Q96R08	OR5BC_HUMAN	olfactory receptor, family 5, subfamily B,						sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity				0	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CTCCATTGGGAATTATGTAGC	0.418													24	89	---	---	---	---	PASS
MALAT1	378938	broad.mit.edu	37	11	65268285	65268285	+	RNA	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65268285G>T	uc010roh.1	+	1		c.3053G>T			uc001ody.2_RNA|MALAT1_uc001odz.2_5'Flank	NR_002819				Homo sapiens clone alpha1 mRNA sequence.												0						ACTTACTTATGGTAACCTTTT	0.443													4	96	---	---	---	---	PASS
MTNR1B	4544	broad.mit.edu	37	11	92715227	92715227	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:92715227G>A	uc001pdk.1	+	2	941	c.838G>A	c.(838-840)GAA>AAA	p.E280K		NM_005959	NP_005950	P49286	MTR1B_HUMAN	melatonin receptor 1B	280	Extracellular (Potential).				G-protein signaling, coupled to cyclic nucleotide second messenger|glucose homeostasis|regulation of insulin secretion|synaptic transmission	integral to plasma membrane	melatonin receptor activity			ovary(1)|central_nervous_system(1)	2		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)			Ramelteon(DB00980)	CAACCCCCAAGAAATGGCTCC	0.507													22	390	---	---	---	---	PASS
ALG9	79796	broad.mit.edu	37	11	111724408	111724408	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:111724408G>C	uc001pmb.2	-	8	852	c.753C>G	c.(751-753)TTC>TTG	p.F251L	ALG9_uc001ply.2_Missense_Mutation_p.F80L|ALG9_uc001plz.2_Missense_Mutation_p.F80L|ALG9_uc010rwm.1_Missense_Mutation_p.F251L|ALG9_uc010rwn.1_Missense_Mutation_p.F205L|ALG9_uc010rwo.1_Missense_Mutation_p.F79L|ALG9_uc009yyh.1_Missense_Mutation_p.F146L	NM_001077690	NP_001071158	Q9H6U8	ALG9_HUMAN	asparagine-linked glycosylation 9 protein	251	Helical; (Potential).				dolichol-linked oligosaccharide biosynthetic process|GPI anchor biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			large_intestine(1)|ovary(1)	2		all_cancers(61;2.34e-15)|all_epithelial(67;1.72e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;6.81e-07)|BRCA - Breast invasive adenocarcinoma(274;1.15e-06)|all cancers(92;1.3e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0587)		ACCAATGAAAGAAACTCTTCC	0.373													5	223	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	11	124135521	124135521	+	IGR	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124135521G>A								OR8G2 (39211 upstream) : OR8D1 (44216 downstream)																							TCGCTACACTGAGGGCAGGTC	0.488													16	281	---	---	---	---	PASS
ETS1	2113	broad.mit.edu	37	11	128360395	128360395	+	Silent	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:128360395G>A	uc010sbs.1	-	2	475	c.159C>T	c.(157-159)TTC>TTT	p.F53F	ETS1_uc001qej.2_Silent_p.F97F|ETS1_uc009zch.2_Intron|ETS1_uc009zcg.2_Silent_p.F53F	NM_005238	NP_005229	P14921	ETS1_HUMAN	v-ets erythroblastosis virus E26 oncogene	53	PNT.				cell motility|immune response|induction of apoptosis|negative regulation of cell cycle|negative regulation of cell cycle|negative regulation of cell proliferation|PML body organization|positive regulation of cellular component movement|positive regulation of erythrocyte differentiation|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription, DNA-dependent|response to antibiotic|transcription from RNA polymerase II promoter	nucleus|nucleus	protein binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|sequence-specific DNA binding transcription factor activity|transcription factor binding			lung(4)|central_nervous_system(1)|pleura(1)	6	all_hematologic(175;0.0537)	Lung NSC(97;0.000542)|all_lung(97;0.000665)|Breast(109;0.00765)|all_neural(223;0.0351)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;1.47e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0174)|LUSC - Lung squamous cell carcinoma(976;0.0815)|Lung(307;0.0833)		TGAAACCACTGAAAGTAGCTT	0.408													12	212	---	---	---	---	PASS
BARX2	8538	broad.mit.edu	37	11	129321248	129321248	+	Missense_Mutation	SNP	C	A	A	rs146199848	byFrequency	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:129321248C>A	uc001qfc.3	+	4	841	c.791C>A	c.(790-792)CCG>CAG	p.P264Q		NM_003658	NP_003649	Q9UMQ3	BARX2_HUMAN	BarH-like homeobox 2	264											0	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CCACCAGACCCGCCCCAGGAG	0.567													32	80	---	---	---	---	PASS
ADAMTS8	11095	broad.mit.edu	37	11	130286846	130286846	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:130286846G>A	uc001qgg.3	-	3	1443	c.1085C>T	c.(1084-1086)GCC>GTC	p.A362V		NM_007037	NP_008968	Q9UP79	ATS8_HUMAN	ADAM metallopeptidase with thrombospondin type 1	362	Peptidase M12B.				negative regulation of cell proliferation|proteolysis	proteinaceous extracellular matrix	heparin binding|integrin binding|low affinity phosphate transmembrane transporter activity|metalloendopeptidase activity|zinc ion binding			central_nervous_system(1)	1	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.039)|Lung(977;0.213)		TAGTTCATGGGCCAGGGTGTG	0.557													78	281	---	---	---	---	PASS
CLEC4A	50856	broad.mit.edu	37	12	8290778	8290778	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:8290778C>T	uc001qtz.1	+	6	856	c.609C>T	c.(607-609)TGC>TGT	p.C203C	CLEC4A_uc009zga.1_Silent_p.C164C|CLEC4A_uc001qub.1_Silent_p.C170C|CLEC4A_uc001quc.1_Silent_p.C131C|CLEC4A_uc009zgb.1_3'UTR	NM_016184	NP_057268	Q9UMR7	CLC4A_HUMAN	C-type lectin domain family 4, member A isoform	203	Extracellular (Potential).|C-type lectin.				cell adhesion|cell surface receptor linked signaling pathway|innate immune response	integral to plasma membrane	sugar binding|transmembrane receptor activity				0				Kidney(36;0.0915)		ATGAGCGCTGCGTTGTGCTAA	0.443													11	175	---	---	---	---	PASS
PLEKHA5	54477	broad.mit.edu	37	12	19501339	19501339	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:19501339G>A	uc001reb.2	+	19	2493	c.2407G>A	c.(2407-2409)GAT>AAT	p.D803N	PLEKHA5_uc010sie.1_Missense_Mutation_p.D964N|PLEKHA5_uc001rea.2_Missense_Mutation_p.D861N|PLEKHA5_uc009zin.2_Missense_Mutation_p.D561N|PLEKHA5_uc010sif.1_Missense_Mutation_p.D792N|PLEKHA5_uc010sig.1_Missense_Mutation_p.D785N|PLEKHA5_uc010sih.1_Missense_Mutation_p.D758N|PLEKHA5_uc001rec.1_Missense_Mutation_p.D612N|PLEKHA5_uc009zio.2_Intron	NM_019012	NP_061885	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A	803							1-phosphatidylinositol binding|protein binding			ovary(1)|kidney(1)|skin(1)	3	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CAAGGGTCCAGATTATAGACT	0.333													4	179	---	---	---	---	PASS
TSPAN11	441631	broad.mit.edu	37	12	31135496	31135496	+	Silent	SNP	C	T	T	rs138636959	byFrequency	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:31135496C>T	uc010sju.1	+	6	866	c.486C>T	c.(484-486)GCC>GCT	p.A162A	TSPAN11_uc001rjp.2_Silent_p.A162A|TSPAN11_uc010sjv.1_Silent_p.A152A	NM_001080509	NP_001073978	A1L157	TSN11_HUMAN	tetraspanin 11	162						integral to membrane					0	all_lung(12;3.11e-10)|Lung NSC(12;5.24e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					ACAGCTCAGCCGACTGGCAGC	0.657													4	46	---	---	---	---	PASS
KIF21A	55605	broad.mit.edu	37	12	39756974	39756974	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39756974G>C	uc001rly.2	-	7	1091	c.945C>G	c.(943-945)AGC>AGG	p.S315R	KIF21A_uc001rlx.2_Missense_Mutation_p.S315R|KIF21A_uc001rlz.2_Missense_Mutation_p.S315R|KIF21A_uc010skl.1_Missense_Mutation_p.S315R|KIF21A_uc001rma.1_Missense_Mutation_p.S323R	NM_017641	NP_060111	Q7Z4S6	KI21A_HUMAN	kinesin family member 21A	315					microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity			ovary(4)|pancreas(1)|lung(1)|skin(1)	7		Lung NSC(34;0.179)|all_lung(34;0.213)				TGGCCCTCTTGCTCTTGTCTC	0.388													75	200	---	---	---	---	PASS
ADAMTS20	80070	broad.mit.edu	37	12	43824238	43824238	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:43824238C>T	uc010skx.1	-	23	3298	c.3298G>A	c.(3298-3300)GAT>AAT	p.D1100N	ADAMTS20_uc001rno.1_Missense_Mutation_p.D254N|ADAMTS20_uc001rnp.1_Missense_Mutation_p.D254N	NM_025003	NP_079279	P59510	ATS20_HUMAN	a disintegrin-like and metalloprotease with	1100	TSP type-1 6.					proteinaceous extracellular matrix	zinc ion binding			central_nervous_system(5)|ovary(4)|lung(3)|large_intestine(2)|skin(2)|urinary_tract(1)|kidney(1)|pancreas(1)	19	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CATTTAACATCTCGCATCTGA	0.388													13	69	---	---	---	---	PASS
DGKA	1606	broad.mit.edu	37	12	56346885	56346885	+	Missense_Mutation	SNP	C	G	G	rs1395282		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56346885C>G	uc001sij.2	+	22	2268	c.2004C>G	c.(2002-2004)ATC>ATG	p.I668M	DGKA_uc001sik.2_Missense_Mutation_p.I668M|DGKA_uc001sil.2_Missense_Mutation_p.I668M|DGKA_uc001sim.2_Missense_Mutation_p.I668M|DGKA_uc001sin.2_Missense_Mutation_p.I668M|DGKA_uc009zof.2_Missense_Mutation_p.I314M|DGKA_uc001sio.2_Missense_Mutation_p.I410M	NM_001345	NP_001336	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	668					activation of protein kinase C activity by G-protein coupled receptor protein signaling pathway|intracellular signal transduction|platelet activation	plasma membrane	ATP binding|calcium ion binding|diacylglycerol kinase activity			ovary(3)|pancreas(1)	4					Vitamin E(DB00163)	TGGGCCAAATCTATACCAAGC	0.522													11	133	---	---	---	---	PASS
OXA1L	5018	broad.mit.edu	37	14	23240354	23240354	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23240354C>A	uc001wgn.2	+	8	1247	c.1247C>A	c.(1246-1248)CCT>CAT	p.P416H	OXA1L_uc001wgo.2_RNA|OXA1L_uc010akc.2_Missense_Mutation_p.P416H|OXA1L_uc001wgp.2_Missense_Mutation_p.P340H|OXA1L_uc001wgq.2_Missense_Mutation_p.P120H	NM_005015	NP_005006	Q15070	OXA1L_HUMAN	oxidase (cytochrome c) assembly 1-like	356	Mitochondrial matrix (Potential).				aerobic respiration|mitochondrial proton-transporting ATP synthase complex assembly|mitochondrial respiratory chain complex I assembly|negative regulation of ATPase activity|negative regulation of oxidoreductase activity|protein insertion into membrane|protein tetramerization	integral to mitochondrial membrane|mitochondrial respiratory chain|protein complex	protein homodimerization activity|ribosome binding			central_nervous_system(1)	1	all_cancers(95;8.44e-05)			GBM - Glioblastoma multiforme(265;0.0096)		GACAAATTACCTCCACGGGAA	0.463													4	194	---	---	---	---	PASS
HSPA2	3306	broad.mit.edu	37	14	65008837	65008837	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65008837C>A	uc001xhj.2	+	2	1346	c.1270C>A	c.(1270-1272)CCC>ACC	p.P424T	HSPA2_uc001xhk.3_Missense_Mutation_p.P424T	NM_021979	NP_068814	P54652	HSP72_HUMAN	heat shock 70kDa protein 2	424					response to unfolded protein|spermatid development	cell surface	ATP binding|unfolded protein binding			skin(1)	1				all cancers(60;0.00515)|OV - Ovarian serous cystadenocarcinoma(108;0.00584)|BRCA - Breast invasive adenocarcinoma(234;0.045)		CACCACGATCCCCACCAAGCA	0.587													37	80	---	---	---	---	PASS
MPP5	64398	broad.mit.edu	37	14	67746180	67746180	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:67746180G>A	uc001xjc.2	+	3	759	c.293G>A	c.(292-294)GGA>GAA	p.G98E	MPP5_uc001xjd.2_Missense_Mutation_p.G64E|MPP5_uc001xjb.1_Missense_Mutation_p.G98E	NM_022474	NP_071919	Q8N3R9	MPP5_HUMAN	membrane protein, palmitoylated 5	98	Interaction with PARD6B (By similarity).				tight junction assembly	cytoplasm|endomembrane system|tight junction	protein domain specific binding			ovary(1)	1				all cancers(60;0.000388)|OV - Ovarian serous cystadenocarcinoma(108;0.00762)|BRCA - Breast invasive adenocarcinoma(234;0.0106)		CCAAAGACCGGAATAGATAAC	0.378													6	212	---	---	---	---	PASS
ADAM21	8747	broad.mit.edu	37	14	70925837	70925837	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70925837G>T	uc001xmd.2	+	1	1621	c.1621G>T	c.(1621-1623)GGT>TGT	p.G541C		NM_003813	NP_003804	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21 preproprotein	541	Cys-rich.|Extracellular (Potential).				proteolysis|single fertilization	integral to membrane	metalloendopeptidase activity|zinc ion binding			pancreas(1)|skin(1)	2				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AAACCGTTTTGGTCACTGTGG	0.378													8	262	---	---	---	---	PASS
ESRRB	2103	broad.mit.edu	37	14	76949083	76949083	+	Silent	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:76949083C>A	uc001xsq.1	+	5	835	c.768C>A	c.(766-768)GGC>GGA	p.G256G	ESRRB_uc001xsr.2_Silent_p.G256G|ESRRB_uc001xso.2_RNA	NM_004452	NP_004443	A2VDJ2	A2VDJ2_HUMAN	estrogen-related receptor beta	256						nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|zinc ion binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(234;0.0213)		TCATCATTGGCTGGGCCAAGC	0.607													6	162	---	---	---	---	PASS
GALC	2581	broad.mit.edu	37	14	88417033	88417033	+	Silent	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:88417033T>C	uc001xvt.2	-	11	1620	c.1221A>G	c.(1219-1221)CAA>CAG	p.Q407Q	GALC_uc010tvw.1_RNA|GALC_uc010tvx.1_Silent_p.Q381Q|GALC_uc010tvy.1_Silent_p.Q384Q|GALC_uc010tvz.1_Silent_p.Q351Q	NM_000153	NP_000144	P54803	GALC_HUMAN	galactosylceramidase isoform a precursor	407					carbohydrate metabolic process|galactosylceramide catabolic process	lysosome	cation binding|galactosylceramidase activity				0						AGGTGGCAAATTGTTGTGACA	0.289													17	67	---	---	---	---	PASS
HERC2	8924	broad.mit.edu	37	15	28518105	28518105	+	Silent	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:28518105G>T	uc001zbj.2	-	8	952	c.846C>A	c.(844-846)CCC>CCA	p.P282P	HERC2_uc001zbl.1_5'UTR	NM_004667	NP_004658	O95714	HERC2_HUMAN	hect domain and RLD 2	282					DNA repair|intracellular protein transport|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	nucleus	guanyl-nucleotide exchange factor activity|heme binding|protein binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(4)|skin(3)|upper_aerodigestive_tract(1)|central_nervous_system(1)	13		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GGTCCTGCAGGGGGATGCTTC	0.602													15	115	---	---	---	---	PASS
RYR3	6263	broad.mit.edu	37	15	33923440	33923440	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:33923440C>A	uc001zhi.2	+	23	2883	c.2813C>A	c.(2812-2814)GCT>GAT	p.A938D	RYR3_uc010bar.2_Missense_Mutation_p.A938D	NM_001036	NP_001027	Q15413	RYR3_HUMAN	ryanodine receptor 3	938	4 X approximate repeats.|1.|Cytoplasmic (By similarity).				cellular calcium ion homeostasis	integral to membrane	calcium ion binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(5)|central_nervous_system(4)|lung(1)	10		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TGCCACATTGCTCATGTTAAC	0.448													3	20	---	---	---	---	PASS
ZNF280D	54816	broad.mit.edu	37	15	56981653	56981653	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:56981653G>T	uc002adu.2	-	8	732	c.515C>A	c.(514-516)TCA>TAA	p.S172*	ZNF280D_uc002adv.2_Nonsense_Mutation_p.S159*|ZNF280D_uc010bfq.2_Nonsense_Mutation_p.S172*|ZNF280D_uc002adw.1_Nonsense_Mutation_p.S200*|ZNF280D_uc010bfr.1_RNA	NM_017661	NP_060131	Q6N043	Z280D_HUMAN	suppressor of hairy wing homolog 4 isoform 1	172					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(1)|ovary(1)|skin(1)	3				all cancers(107;0.0399)|GBM - Glioblastoma multiforme(80;0.0787)		TGATAAAAATGAACTTTCACT	0.274													8	47	---	---	---	---	PASS
TBC1D21	161514	broad.mit.edu	37	15	74176528	74176528	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:74176528G>C	uc002avz.2	+	4	392	c.309G>C	c.(307-309)AAG>AAC	p.K103N	TBC1D21_uc010ulc.1_Missense_Mutation_p.K67N	NM_153356	NP_699187	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	103	Rab-GAP TBC.					intracellular	Rab GTPase activator activity			ovary(2)	2						TGTATGAGAAGATTCAGCCCC	0.507													61	157	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85405926	85405926	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85405926G>A	uc002ble.2	+	10	4963	c.4796G>A	c.(4795-4797)TGC>TAC	p.C1599Y	ALPK3_uc010upc.1_5'Flank	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1599	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GACTCTGGCTGCTGGGGGGAC	0.582													48	104	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85406841	85406841	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85406841G>T	uc002ble.2	+	11	5242	c.5075G>T	c.(5074-5076)CGG>CTG	p.R1692L	ALPK3_uc010upc.1_5'Flank	NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1692	Alpha-type protein kinase.				heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GCAGAAGCCCGGGCCGCGCCT	0.552													15	55	---	---	---	---	PASS
CHD2	1106	broad.mit.edu	37	15	93498730	93498730	+	Silent	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93498730C>G	uc002bsp.2	+	15	2372	c.1797C>G	c.(1795-1797)CTC>CTG	p.L599L	CHD2_uc002bso.1_Silent_p.L599L	NM_001271	NP_001262	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	599	Helicase ATP-binding.				regulation of transcription from RNA polymerase II promoter	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(1)|skin(1)	2	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			ATGAGATCCTCTTGAAAGATA	0.343													3	48	---	---	---	---	PASS
LRRK1	79705	broad.mit.edu	37	15	101592036	101592036	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:101592036A>T	uc002bwr.2	+	24	3879	c.3560A>T	c.(3559-3561)TAC>TTC	p.Y1187F	LRRK1_uc010usb.1_RNA|LRRK1_uc010usc.1_RNA|LRRK1_uc002bws.2_5'Flank	NM_024652	NP_078928	Q38SD2	LRRK1_HUMAN	leucine-rich repeat kinase 1	1187					small GTPase mediated signal transduction	mitochondrion	ATP binding|GTP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|lung(4)|central_nervous_system(3)|large_intestine(1)	12	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			GATGTGCAGTACTTCGACATG	0.642													23	64	---	---	---	---	PASS
CCDC78	124093	broad.mit.edu	37	16	773026	773026	+	Intron	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:773026G>A	uc002cjg.2	-						CCDC78_uc002cjf.2_Intron|CCDC78_uc002cji.3_3'UTR|CCDC78_uc002cjj.3_3'UTR|CCDC78_uc002cjh.2_Intron	NM_001031737	NP_001026907	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78											central_nervous_system(1)	1		Hepatocellular(780;0.0218)				GCTCTGCCTGGCATGGGGATG	0.642													4	91	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18844332	18844332	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18844332G>C	uc002dfm.2	-	51	9085	c.8722C>G	c.(8722-8724)CAG>GAG	p.Q2908E	SMG1_uc010bwb.2_Missense_Mutation_p.Q2768E|SMG1_uc010bwa.2_Missense_Mutation_p.Q1639E	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	2908					DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						AAGTAGGCCTGAAGAGATTCC	0.488													7	537	---	---	---	---	PASS
SMG1	23049	broad.mit.edu	37	16	18870975	18870975	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:18870975G>C	uc002dfm.2	-	27	4219	c.3856C>G	c.(3856-3858)CAG>GAG	p.Q1286E	SMG1_uc010bwb.2_Missense_Mutation_p.Q1146E|SMG1_uc010bwa.2_Missense_Mutation_p.Q17E	NM_015092	NP_055907	Q96Q15	SMG1_HUMAN	PI-3-kinase-related kinase SMG-1	1286	FAT.|Interaction with SMG8 and SMG9.				DNA repair|mRNA export from nucleus|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay|peptidyl-serine phosphorylation|phosphatidylinositol phosphorylation|protein autophosphorylation	cytoplasm|nucleus	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			breast(5)|stomach(4)|lung(4)|kidney(2)|ovary(1)	16						ATGGATTTCTGAAGTTCCCTC	0.348													8	84	---	---	---	---	PASS
ACSM5	54988	broad.mit.edu	37	16	20441054	20441054	+	Silent	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:20441054T>C	uc002dhe.2	+	8	1203	c.1056T>C	c.(1054-1056)CCT>CCC	p.P352P		NM_017888	NP_060358	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	352					fatty acid metabolic process	mitochondrial matrix	ATP binding|butyrate-CoA ligase activity|GTP binding|metal ion binding			ovary(2)	2						CCCTCAACCCTGACGTGAGGG	0.562													43	120	---	---	---	---	PASS
TOX3	27324	broad.mit.edu	37	16	52497890	52497890	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:52497890G>C	uc002egw.2	-	3	535	c.364C>G	c.(364-366)CTC>GTC	p.L122V	TOX3_uc010vgt.1_Missense_Mutation_p.L117V|TOX3_uc010vgu.1_Missense_Mutation_p.L122V	NM_001080430	NP_001073899	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	122					apoptosis|negative regulation of neuron apoptosis|positive regulation of anti-apoptosis|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	chromatin binding|estrogen response element binding|phosphoprotein binding|protein homodimerization activity				0						TGTTCCACGAGATTTCTTGAG	0.438													5	211	---	---	---	---	PASS
PDPR	55066	broad.mit.edu	37	16	70166087	70166087	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:70166087G>A	uc002eyf.1	+	9	1838	c.881G>A	c.(880-882)CGG>CAG	p.R294Q	CLEC18C_uc002exy.2_Intron|PDPR_uc010vlr.1_Missense_Mutation_p.R194Q|PDPR_uc002eyg.1_Missense_Mutation_p.R22Q	NM_017990	NP_060460	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory	294					glycine catabolic process|pyruvate metabolic process|regulation of acetyl-CoA biosynthetic process from pyruvate	mitochondrial matrix	aminomethyltransferase activity|oxidoreductase activity			breast(1)	1				BRCA - Breast invasive adenocarcinoma(221;0.124)		ATTTATATTCGGAACTGGCAG	0.473													6	112	---	---	---	---	PASS
PMFBP1	83449	broad.mit.edu	37	16	72166728	72166728	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:72166728C>T	uc002fcc.3	-	10	1538	c.1366G>A	c.(1366-1368)GCG>ACG	p.A456T	PMFBP1_uc002fcd.2_Missense_Mutation_p.A456T|PMFBP1_uc002fce.2_RNA|PMFBP1_uc002fcf.2_Missense_Mutation_p.A311T	NM_031293	NP_112583	Q8TBY8	PMFBP_HUMAN	polyamine modulated factor 1 binding protein 1	456	Potential.									ovary(2)	2		Ovarian(137;0.179)				TTGCACTCCGCCTCCTTGGAC	0.582													23	326	---	---	---	---	PASS
SDR42E1	93517	broad.mit.edu	37	16	82033204	82033204	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:82033204G>C	uc002fgu.2	-	3	822	c.694C>G	c.(694-696)CAC>GAC	p.H232D		NM_145168	NP_660151	Q8WUS8	D42E1_HUMAN	short chain dehydrogenase/reductase family 42E,	232					steroid biosynthetic process	integral to membrane	3-beta-hydroxy-delta5-steroid dehydrogenase activity|binding				0						GCCAGAATGTGAGCCTGCACC	0.532													82	216	---	---	---	---	PASS
CDH13	1012	broad.mit.edu	37	16	83520150	83520150	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:83520150T>C	uc002fgx.2	+	7	970	c.850T>C	c.(850-852)TAT>CAT	p.Y284H	CDH13_uc010vns.1_Missense_Mutation_p.Y331H|CDH13_uc010vnt.1_Missense_Mutation_p.Y30H|CDH13_uc010vnu.1_Missense_Mutation_p.Y245H	NM_001257	NP_001248	P55290	CAD13_HUMAN	cadherin 13 preproprotein	284	Cadherin 2.				adherens junction organization|calcium-dependent cell-cell adhesion|cell junction assembly|endothelial cell migration|homophilic cell adhesion|keratinocyte proliferation|lamellipodium assembly|localization within membrane|low-density lipoprotein particle mediated signaling|negative regulation of cell adhesion|negative regulation of cell proliferation|positive regulation of calcium-mediated signaling|positive regulation of cell migration|positive regulation of cell-matrix adhesion|positive regulation of endothelial cell proliferation|positive regulation of positive chemotaxis|positive regulation of smooth muscle cell proliferation|positive regulation of survival gene product expression|Rac protein signal transduction|regulation of endocytosis|regulation of epidermal growth factor receptor signaling pathway|Rho protein signal transduction|sprouting angiogenesis	anchored to membrane|caveola|extracellular space|integral to membrane|neuron projection	adiponectin binding|cadherin binding|calcium ion binding|low-density lipoprotein particle binding			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		CCTCCTGCGGTATAATATCCG	0.537													36	77	---	---	---	---	PASS
SLC25A11	8402	broad.mit.edu	37	17	4841830	4841830	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:4841830C>G	uc002fzo.1	-	4	636	c.523G>C	c.(523-525)GAG>CAG	p.E175Q	SLC25A11_uc002fzp.1_Missense_Mutation_p.E171Q|RNF167_uc002fzq.2_5'Flank|RNF167_uc002fzr.2_5'Flank|RNF167_uc002fzs.2_5'Flank|RNF167_uc002fzt.2_5'Flank|RNF167_uc002fzu.2_5'Flank|RNF167_uc002fzv.2_5'Flank|RNF167_uc002fzw.1_5'Flank|RNF167_uc002fzx.2_5'Flank	NM_003562	NP_003553	Q02978	M2OM_HUMAN	solute carrier family 25 member 11 isoform 1	175	Solcar 2.				gluconeogenesis	integral to plasma membrane|mitochondrial inner membrane	oxoglutarate:malate antiporter activity				0						AGGACACCCTCTTCCCGGGTG	0.587													7	193	---	---	---	---	PASS
NF1	4763	broad.mit.edu	37	17	29679291	29679291	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:29679291C>T	uc002hgg.2	+	51	7807	c.7474C>T	c.(7474-7476)CAG>TAG	p.Q2492*	NF1_uc002hgh.2_Nonsense_Mutation_p.Q2471*|NF1_uc010cso.2_Nonsense_Mutation_p.Q680*|NF1_uc010wbt.1_Intron|NF1_uc010wbu.1_RNA	NM_001042492	NP_001035957	P21359	NF1_HUMAN	neurofibromin isoform 1	2492					actin cytoskeleton organization|adrenal gland development|artery morphogenesis|camera-type eye morphogenesis|cerebral cortex development|collagen fibril organization|forebrain astrocyte development|forebrain morphogenesis|heart development|liver development|MAPKKK cascade|metanephros development|myelination in peripheral nervous system|negative regulation of cell migration|negative regulation of endothelial cell proliferation|negative regulation of MAP kinase activity|negative regulation of MAPKKK cascade|negative regulation of neuroblast proliferation|negative regulation of oligodendrocyte differentiation|negative regulation of transcription factor import into nucleus|osteoblast differentiation|phosphatidylinositol 3-kinase cascade|pigmentation|positive regulation of adenylate cyclase activity|positive regulation of neuron apoptosis|Ras protein signal transduction|regulation of blood vessel endothelial cell migration|regulation of bone resorption|response to hypoxia|smooth muscle tissue development|spinal cord development|sympathetic nervous system development|visual learning|wound healing	axon|cytoplasm|dendrite|intrinsic to internal side of plasma membrane|nucleus	protein binding|Ras GTPase activator activity			soft_tissue(159)|central_nervous_system(56)|lung(28)|large_intestine(27)|haematopoietic_and_lymphoid_tissue(18)|ovary(18)|autonomic_ganglia(12)|breast(3)|skin(3)|stomach(2)|thyroid(1)|prostate(1)|kidney(1)|pancreas(1)	330		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		AAAGGAGACTCAGCCATGGTC	0.473			D|Mis|N|F|S|O		neurofibroma|glioma	neurofibroma|glioma			Neurofibromatosis_type_1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)			7	144	---	---	---	---	PASS
RHBDL3	162494	broad.mit.edu	37	17	30621462	30621462	+	Splice_Site	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:30621462G>C	uc002hhe.1	+	5	682	c.668_splice	c.e5+1	p.G223_splice	RHBDL3_uc010csw.1_Splice_Site_p.G215_splice|RHBDL3_uc010csx.1_Splice_Site_p.G223_splice|RHBDL3_uc010csy.1_Splice_Site_p.G125_splice|RHBDL3_uc002hhf.1_Splice_Site_p.G125_splice	NM_138328	NP_612201	P58872	RHBL3_HUMAN	rhomboid protease 3						proteolysis	integral to membrane	calcium ion binding|serine-type endopeptidase activity			ovary(1)	1		Breast(31;0.116)|Ovarian(249;0.182)				TGCATGCAGGGTGAGTACCTG	0.408													40	97	---	---	---	---	PASS
GAS2L2	246176	broad.mit.edu	37	17	34079743	34079743	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:34079743G>A	uc002hjv.1	-	1	155	c.127C>T	c.(127-129)CGC>TGC	p.R43C		NM_139285	NP_644814	Q8NHY3	GA2L2_HUMAN	growth arrest-specific 2 like 2	43	CH.				cell cycle arrest	cytoplasm|cytoskeleton				ovary(1)|skin(1)	2		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TAGAGGTCGCGAAGCCACTCA	0.612													4	98	---	---	---	---	PASS
KRT33A	3883	broad.mit.edu	37	17	39503459	39503459	+	Missense_Mutation	SNP	G	A	A	rs143073969		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:39503459G>A	uc002hwk.1	-	4	641	c.604C>T	c.(604-606)CGC>TGC	p.R202C		NM_004138	NP_004129	O76009	KT33A_HUMAN	keratin 33A	202	Rod.|Coil 1B.					intermediate filament	protein binding|structural molecule activity				0		Breast(137;0.000496)				AGCTGGCAGCGCAGGGTGTTA	0.502													5	76	---	---	---	---	PASS
SLC4A1	6521	broad.mit.edu	37	17	42332032	42332032	+	Splice_Site	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42332032T>C	uc002igf.3	-	16	2040	c.1891_splice	c.e16-1	p.K631_splice		NM_000342	NP_000333	P02730	B3AT_HUMAN	solute carrier family 4, anion exchanger, member						bicarbonate transport|cellular ion homeostasis	basolateral plasma membrane|cortical cytoskeleton|integral to plasma membrane|Z disc	ankyrin binding|chloride transmembrane transporter activity|inorganic anion exchanger activity|protein anchor|protein homodimerization activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		CGAGAGTTTCTGTGGGAGGGG	0.617													11	27	---	---	---	---	PASS
KPNB1	3837	broad.mit.edu	37	17	45748153	45748153	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:45748153C>T	uc002ilt.1	+	12	1838	c.1502C>T	c.(1501-1503)TCT>TTT	p.S501F	KPNB1_uc010wkw.1_Missense_Mutation_p.S356F|KPNB1_uc010wkx.1_Missense_Mutation_p.S285F	NM_002265	NP_002256	Q14974	IMB1_HUMAN	karyopherin beta 1	501					DNA fragmentation involved in apoptotic nuclear change|NLS-bearing substrate import into nucleus|protein import into nucleus, translocation|ribosomal protein import into nucleus|viral genome transport in host cell|viral infectious cycle	cytosol|nuclear pore|nucleoplasm	nuclear localization sequence binding|protein domain specific binding|zinc ion binding			ovary(1)|pancreas(1)|skin(1)	3						TGCTTATCTTCTTCATTTGAA	0.428													6	273	---	---	---	---	PASS
ARSG	22901	broad.mit.edu	37	17	66364803	66364803	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:66364803C>T	uc002jhc.2	+	7	1615	c.819C>T	c.(817-819)CTC>CTT	p.L273L	ARSG_uc002jhb.1_Silent_p.L109L	NM_014960	NP_055775	Q96EG1	ARSG_HUMAN	Arylsulfatase G precursor	273					sulfur compound metabolic process	endoplasmic reticulum|extracellular space|lysosome	arylsulfatase activity|metal ion binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(8;5.34e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTGCAGGGCTCTGGGAGATGG	0.542													12	207	---	---	---	---	PASS
COG1	9382	broad.mit.edu	37	17	71189264	71189264	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:71189264C>G	uc002jjg.2	+	1	92	c.56C>G	c.(55-57)GCG>GGG	p.A19G	COG1_uc002jjh.2_Missense_Mutation_p.A19G|COG1_uc002jjf.1_Missense_Mutation_p.A19G	NM_018714	NP_061184	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	19					Golgi organization|intra-Golgi vesicle-mediated transport|protein transport	Golgi membrane|Golgi transport complex	protein binding			ovary(1)	1			LUSC - Lung squamous cell carcinoma(166;0.197)			CGCGACCCTGCGGCTCTTTTC	0.662													7	12	---	---	---	---	PASS
QRICH2	84074	broad.mit.edu	37	17	74270310	74270310	+	3'UTR	SNP	G	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:74270310G>T	uc002jrd.1	-	19					QRICH2_uc010wsz.1_Missense_Mutation_p.P1359H|QRICH2_uc010dgw.1_3'UTR	NM_032134	NP_115510	Q9H0J4	QRIC2_HUMAN	glutamine rich 2								protein binding			ovary(1)|pancreas(1)|lung(1)|central_nervous_system(1)|skin(1)	5						GGCCCTCGGAGGAAGGTCTAT	0.637													4	132	---	---	---	---	PASS
ENGASE	64772	broad.mit.edu	37	17	77081697	77081697	+	Intron	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:77081697C>T	uc002jwv.2	+						ENGASE_uc002jww.2_Intron	NM_001042573	NP_001036038	Q8NFI3	ENASE_HUMAN	endo-beta-N-acetylglucosaminidase							cytosol	mannosyl-glycoprotein endo-beta-N-acetylglucosaminidase activity			skin(1)	1						CCTTTCGCCCCGTAGCTGCTA	0.657													4	36	---	---	---	---	PASS
DSG1	1828	broad.mit.edu	37	18	28926164	28926164	+	Intron	SNP	A	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:28926164A>G	uc002kwp.2	+						DSG1_uc010xbp.1_Intron	NM_001942	NP_001933	Q02413	DSG1_HUMAN	desmoglein 1 preproprotein						calcium-dependent cell-cell adhesion|cell-cell junction assembly|cellular component disassembly involved in apoptosis|homophilic cell adhesion|protein stabilization	cytosol|desmosome|integral to membrane|internal side of plasma membrane	calcium ion binding|gamma-catenin binding|toxin binding			skin(3)|ovary(2)|central_nervous_system(2)	7			OV - Ovarian serous cystadenocarcinoma(10;0.00559)			TCTGTCAGGTAAGGTCCCTAG	0.438													28	55	---	---	---	---	PASS
DTNA	1837	broad.mit.edu	37	18	32462135	32462135	+	Silent	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:32462135G>C	uc010dmn.1	+	20	2185	c.2184G>C	c.(2182-2184)CTG>CTC	p.L728L	DTNA_uc002kxw.2_Silent_p.L671L|DTNA_uc010dmj.2_Silent_p.L668L|DTNA_uc002kxz.2_Silent_p.L675L|DTNA_uc002kxy.2_Silent_p.L668L|DTNA_uc010xby.1_Silent_p.L418L|DTNA_uc010xbz.1_Silent_p.L437L|DTNA_uc010xca.1_Silent_p.L380L|DTNA_uc002kye.2_Silent_p.L376L	NM_001390	NP_001381	Q9Y4J8	DTNA_HUMAN	dystrobrevin alpha isoform 1	728					neuromuscular synaptic transmission|signal transduction|striated muscle contraction	cell junction|cytoplasm|synapse	calcium ion binding|protein binding|zinc ion binding				0						AGGAATACCTGAAACAGAAGC	0.512													4	96	---	---	---	---	PASS
RRAS	6237	broad.mit.edu	37	19	50138920	50138920	+	Intron	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50138920G>A	uc002pop.1	-							NM_006270	NP_006261	P10301	RRAS_HUMAN	related RAS viral (r-ras) oncogene homolog						axon guidance|Ras protein signal transduction|synaptic transmission	intracellular|plasma membrane	GDP binding|GTP binding|GTPase activity|protein binding			ovary(1)	1				OV - Ovarian serous cystadenocarcinoma(262;0.00114)|GBM - Glioblastoma multiforme(134;0.0206)		GGTATTTCCTGTGGGAAAACG	0.632													27	167	---	---	---	---	PASS
ACPT	93650	broad.mit.edu	37	19	51295492	51295492	+	Intron	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:51295492C>T	uc002pta.1	+							NM_033068	NP_149059	Q9BZG2	PPAT_HUMAN	testicular acid phosphatase precursor							integral to membrane	acid phosphatase activity				0		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00641)|GBM - Glioblastoma multiforme(134;0.028)		CAGCCCCGCGCATCCAGGGCT	0.697													5	54	---	---	---	---	PASS
NLRP4	147945	broad.mit.edu	37	19	56363671	56363671	+	Silent	SNP	C	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56363671C>A	uc002qmd.3	+	2	647	c.225C>A	c.(223-225)ATC>ATA	p.I75I		NM_134444	NP_604393	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	75	DAPIN.						ATP binding			ovary(5)|skin(4)|lung(3)|upper_aerodigestive_tract(1)|kidney(1)|pancreas(1)	15		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		CCTTAAGAATCTTTCAAAAGA	0.443													4	125	---	---	---	---	PASS
PLAGL2	5326	broad.mit.edu	37	20	30784525	30784525	+	Silent	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:30784525G>A	uc002wxn.2	-	3	1438	c.1221C>T	c.(1219-1221)CTC>CTT	p.L407L		NM_002657	NP_002648	Q9UPG8	PLAL2_HUMAN	pleiomorphic adenoma gene-like 2	407						nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|skin(1)	2			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TAGCAGCGCAGAGGGCCTCAG	0.652													4	44	---	---	---	---	PASS
ZBTB46	140685	broad.mit.edu	37	20	62378374	62378374	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:62378374G>A	uc002ygv.1	-	5	1880	c.1679C>T	c.(1678-1680)GCG>GTG	p.A560V	ZBTB46_uc002ygu.2_RNA	NM_025224	NP_079500	Q86UZ6	ZBT46_HUMAN	zinc finger and BTB domain containing 46	560					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding|zinc ion binding			large_intestine(1)|ovary(1)	2	all_cancers(38;2.09e-12)|all_epithelial(29;3.8e-14)|Lung NSC(23;7.61e-10)|all_lung(23;2.64e-09)					CGCCAACAGCGCATCCTCAGG	0.711													3	40	---	---	---	---	PASS
DNAJC28	54943	broad.mit.edu	37	21	34861439	34861439	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34861439C>G	uc002yrv.2	-	2	711	c.262G>C	c.(262-264)GAT>CAT	p.D88H	DNAJC28_uc002yrw.2_Missense_Mutation_p.D88H	NM_017833	NP_060303	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28	88	J.						heat shock protein binding				0						GTTGCAGAATCAGCAGTATTA	0.413													9	232	---	---	---	---	PASS
COL6A2	1292	broad.mit.edu	37	21	47532209	47532209	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47532209G>C	uc002zia.1	+	3	514	c.432G>C	c.(430-432)CAG>CAC	p.Q144H	COL6A2_uc002zhy.1_Missense_Mutation_p.Q144H|COL6A2_uc002zhz.1_Missense_Mutation_p.Q144H|COL6A2_uc002zib.1_Intron	NM_001849	NP_001840	P12110	CO6A2_HUMAN	alpha 2 type VI collagen isoform 2C2 precursor	144	VWFA 1.|Nonhelical region.				axon guidance|cell-cell adhesion|extracellular matrix organization|protein heterotrimerization	collagen|extracellular space|protein complex	extracellular matrix structural constituent|protein binding, bridging			central_nervous_system(7)|ovary(1)	8	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TGACGGAGCAGATCCGGCAGG	0.692													4	25	---	---	---	---	PASS
LOC96610	96610	broad.mit.edu	37	22	22712517	22712517	+	RNA	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22712517C>T	uc011aim.1	+	41		c.4305C>T								Parts of antibodies, mostly variable regions.												0						GGCTCCAAGTCTGGCACCTCA	0.582													17	281	---	---	---	---	PASS
NPTXR	23467	broad.mit.edu	37	22	39224304	39224304	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:39224304C>T	uc003awk.2	-	2	992	c.838G>A	c.(838-840)GAG>AAG	p.E280K		NM_014293	NP_055108	O95502	NPTXR_HUMAN	neuronal pentraxin receptor	280	Extracellular (Potential).					integral to membrane	metal ion binding			central_nervous_system(2)|skin(1)	3	Melanoma(58;0.04)					TGCTCCAGCTCAGCCACACGA	0.612													35	94	---	---	---	---	PASS
EFCAB6	64800	broad.mit.edu	37	22	43996133	43996133	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43996133C>T	uc003bdy.1	-	23	2907	c.2692G>A	c.(2692-2694)GAG>AAG	p.E898K	EFCAB6_uc003bdz.1_Missense_Mutation_p.E746K|EFCAB6_uc010gzi.1_Missense_Mutation_p.E746K|EFCAB6_uc010gzj.1_Missense_Mutation_p.E124K	NM_022785	NP_073622	Q5THR3	EFCB6_HUMAN	CAP-binding protein complex interacting protein	898	EF-hand 10.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	calcium ion binding			ovary(3)|skin(2)|upper_aerodigestive_tract(1)|pancreas(1)	7		Ovarian(80;0.0247)|all_neural(38;0.025)				CCTTTTCCCTCGGTGTCGTAT	0.428													6	329	---	---	---	---	PASS
MBTPS2	51360	broad.mit.edu	37	X	21900556	21900556	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:21900556T>C	uc004dae.2	+	11	1540	c.1343T>C	c.(1342-1344)CTG>CCG	p.L448P	MBTPS2_uc010nfr.2_Missense_Mutation_p.L41P	NM_015884	NP_056968	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase,	448	Helical; (Potential).				cholesterol metabolic process|proteolysis	Golgi membrane|integral to membrane	metal ion binding|metalloendopeptidase activity			ovary(1)	1						CCCAGGTACCTGATTTCCCTC	0.413													3	149	---	---	---	---	PASS
GATA1	2623	broad.mit.edu	37	X	48652460	48652460	+	Silent	SNP	C	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:48652460C>T	uc004dkq.3	+	6	1222	c.1131C>T	c.(1129-1131)AGC>AGT	p.S377S		NM_002049	NP_002040	P15976	GATA1_HUMAN	GATA binding protein 1	377					basophil differentiation|eosinophil differentiation|erythrocyte development|megakaryocyte differentiation|platelet aggregation|platelet formation|positive regulation of anti-apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|regulation of glycoprotein biosynthetic process|transcription from RNA polymerase II promoter	nuclear membrane|nucleolus|nucleoplasm	C2H2 zinc finger domain binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			haematopoietic_and_lymphoid_tissue(246)|lung(2)	248						GGCCTGTTAGCCACCTCATGC	0.662			Mis|F		megakaryoblastic leukemia of Downs Syndrome								12	5	---	---	---	---	PASS
FAAH2	158584	broad.mit.edu	37	X	57515355	57515355	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:57515355G>A	uc004dvc.2	+	11	1738	c.1589G>A	c.(1588-1590)GGA>GAA	p.G530E		NM_174912	NP_777572	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2	530						integral to membrane	carbon-nitrogen ligase activity, with glutamine as amido-N-donor|hydrolase activity			ovary(3)	3						GTCTGTCCAGGAAAGTTTTAG	0.483										HNSCC(52;0.14)			4	63	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100911754	100911754	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100911754G>A	uc004eid.2	-	3	1176	c.821C>T	c.(820-822)GCG>GTG	p.A274V	ARMCX2_uc004eie.3_Missense_Mutation_p.A274V|ARMCX2_uc004eif.3_Missense_Mutation_p.A274V|ARMCX2_uc004eig.3_Missense_Mutation_p.A274V|ARMCX2_uc010nnt.2_Missense_Mutation_p.A274V	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	274	Ala-rich.					integral to membrane	binding			ovary(6)	6						CGCTCCAGTCGCTGATGTGGC	0.562													39	187	---	---	---	---	PASS
TMLHE	55217	broad.mit.edu	37	X	154774821	154774821	+	Silent	SNP	G	C	C			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:154774821G>C	uc004fnn.2	-	2	283	c.117C>G	c.(115-117)GTC>GTG	p.V39V	TMLHE_uc004fno.2_Silent_p.V39V|TMLHE_uc004fnp.3_Silent_p.V39V	NM_018196	NP_060666	Q9NVH6	TMLH_HUMAN	trimethyllysine hydroxylase, epsilon	39					carnitine biosynthetic process	mitochondrial matrix	iron ion binding|L-ascorbic acid binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|trimethyllysine dioxygenase activity			ovary(1)	1	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Succinic acid(DB00139)|Vitamin C(DB00126)	GGTGCCAATGGACAGCTAAAG	0.463													8	100	---	---	---	---	PASS
PLK3	1263	broad.mit.edu	37	1	45270777	45270778	+	Intron	INS	-	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:45270777_45270778insA	uc001cmn.2	+						PLK3_uc001cmo.2_Intron	NM_004073	NP_004064	Q9H4B4	PLK3_HUMAN	polo-like kinase 3							membrane	ATP binding|protein binding|protein serine/threonine kinase activity				0	Acute lymphoblastic leukemia(166;0.155)					gactccatctcaaaaaaaaaaa	0.193													5	3	---	---	---	---	
DAB1	1600	broad.mit.edu	37	1	57537737	57537738	+	Intron	INS	-	A	A	rs60921398		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57537737_57537738insA	uc001cys.1	-						DAB1_uc001cyt.1_Intron|DAB1_uc001cyq.1_Intron|DAB1_uc001cyr.1_Intron|DAB1_uc009vzw.1_Intron|DAB1_uc009vzx.1_Intron	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1						cell differentiation|nervous system development					skin(2)|ovary(1)	3						ACCCATTAGTTaaaaaaaaaaa	0.342													3	3	---	---	---	---	
USH2A	7399	broad.mit.edu	37	1	215916729	215916730	+	Intron	DEL	TG	-	-	rs6540907		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:215916729_215916730delTG	uc001hku.1	-							NM_206933	NP_996816	O75445	USH2A_HUMAN	usherin isoform B						maintenance of organ identity|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	basement membrane|cytoplasm|integral to membrane|stereocilium membrane	collagen binding			ovary(20)|upper_aerodigestive_tract(2)|skin(2)|kidney(1)|central_nervous_system(1)	26				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		tatatatatatgtgtgtgtgtg	0.178										HNSCC(13;0.011)			6	4	---	---	---	---	
AHCTF1	25909	broad.mit.edu	37	1	247076399	247076400	+	Intron	INS	-	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247076399_247076400insT	uc001ibu.1	-						AHCTF1_uc001ibv.1_Intron	NM_015446	NP_056261	Q8WYP5	ELYS_HUMAN	transcription factor ELYS						cytokinesis|mitotic prometaphase|mRNA transport|nuclear pore complex assembly|protein transport|transmembrane transport	condensed chromosome kinetochore|cytosol|nuclear matrix|nuclear membrane|nuclear pore|nucleoplasm	DNA binding			ovary(5)|skin(2)	7	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TTTAAAATACCTTTTTTTTTTT	0.302													4	2	---	---	---	---	
MSH2	4436	broad.mit.edu	37	2	47643747	47643747	+	Intron	DEL	T	-	-	rs66560884		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47643747delT	uc002rvy.1	+						MSH2_uc010yoh.1_Intron|MSH2_uc002rvz.2_Intron|MSH2_uc010fbg.2_Intron	NM_000251	NP_000242	P43246	MSH2_HUMAN	mutS homolog 2						B cell differentiation|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|double-strand break repair|intra-S DNA damage checkpoint|isotype switching|maintenance of DNA repeat elements|male gonad development|meiotic gene conversion|meiotic mismatch repair|negative regulation of neuron apoptosis|negative regulation of reciprocal meiotic recombination|positive regulation of helicase activity|postreplication repair|response to UV-B|response to X-ray|somatic hypermutation of immunoglobulin genes	MutSalpha complex|MutSbeta complex|nuclear chromosome	ATP binding|DNA-dependent ATPase activity|double-strand/single-strand DNA junction binding|guanine/thymine mispair binding|loop DNA binding|protein C-terminus binding|protein homodimerization activity|protein kinase binding|Y-form DNA binding			large_intestine(33)|haematopoietic_and_lymphoid_tissue(6)|endometrium(4)|ovary(3)|cervix(2)|central_nervous_system(2)|stomach(1)|small_intestine(1)|breast(1)|skin(1)|prostate(1)	55		all_hematologic(82;0.0359)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			tttaaataagttttttttttt	0.184			D|Mis|N|F|S		colorectal|endometrial|ovarian	colorectal|endometrial|ovarian		MMR	Lynch_syndrome|Muir-Torre_syndrome|Turcot_syndrome|Constitutional_Mismatch_Repair_Deficiency_Syndrome				5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	55931429	55931430	+	IGR	INS	-	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:55931429_55931430insT								PNPT1 (10418 upstream) : EFEMP1 (161673 downstream)																							tccttcctttcttttttttttg	0.203													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	109739836	109739839	+	IGR	DEL	CTCC	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:109739836_109739839delCTCC								EDAR (134008 upstream) : SH3RF3 (6158 downstream)																							ccatccttctctccctccctccct	0.314													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	139045439	139045442	+	3'UTR	DEL	TTTT	-	-	rs78349226		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:139045439_139045442delTTTT	uc010zbk.1	-	1										SubName: Full=cDNA, FLJ79100, highly similar to 14-3-3 protein epsilon (14-3-3E);																		TTGAAAACTGtttttttaaaaaaa	0.377													6	3	---	---	---	---	
LRP1B	53353	broad.mit.edu	37	2	141298313	141298314	+	Intron	INS	-	C	C	rs148238992	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141298313_141298314insC	uc002tvj.1	-							NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B						protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CTAGTGCACAACAGGAGGGTAA	0.396										TSP Lung(27;0.18)			4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	167615586	167615587	+	IGR	INS	-	AGGG	AGGG			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:167615586_167615587insAGGG								SCN7A (264869 upstream) : XIRP2 (129410 downstream)																							ggaaggaaggaaggaaaggGGC	0.193													4	2	---	---	---	---	
ZSWIM2	151112	broad.mit.edu	37	2	187712685	187712686	+	Intron	INS	-	TGATTTTTCAT	TGATTTTTCAT	rs140128829	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:187712685_187712686insTGATTTTTCAT	uc002upu.1	-							NM_182521	NP_872327	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM domain containing 2						apoptosis		zinc ion binding			ovary(2)|skin(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			AGTCTCTAGGCTTCATTATTTA	0.312													4	2	---	---	---	---	
KCTD18	130535	broad.mit.edu	37	2	201362780	201362782	+	Intron	DEL	TCT	-	-	rs71715967		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:201362780_201362782delTCT	uc002uvs.2	-						KCTD18_uc002uvt.2_Intron|KCTD18_uc002uvu.1_Intron	NM_152387	NP_689600	Q6PI47	KCD18_HUMAN	potassium channel tetramerization domain							voltage-gated potassium channel complex	voltage-gated potassium channel activity			ovary(1)	1						TATTTTGATCTCTTTTTATCATA	0.276													3	4	---	---	---	---	
USP37	57695	broad.mit.edu	37	2	219328252	219328253	+	Intron	DEL	AC	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:219328252_219328253delAC	uc002vie.2	-						USP37_uc010fvs.1_Intron|USP37_uc010zkf.1_Intron|USP37_uc002vif.2_Intron|USP37_uc002vig.2_Intron	NM_020935	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37						ubiquitin-dependent protein catabolic process	nucleus	cysteine-type peptidase activity|ubiquitin thiolesterase activity			skin(3)|ovary(1)|prostate(1)	5		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GAAGTTCtttactttttttttt	0.173													10	5	---	---	---	---	
VPRBP	9730	broad.mit.edu	37	3	51467342	51467343	+	Intron	INS	-	A	A	rs112905156		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:51467342_51467343insA	uc003dbe.1	-							NM_014703	NP_055518	Q9Y4B6	VPRBP_HUMAN	HIV-1 Vpr binding protein						interspecies interaction between organisms	cytoplasm|nucleus	protein binding			ovary(1)|skin(1)	2				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGAAGAAAGGGAAAAAAAAAAA	0.401													4	2	---	---	---	---	
ARHGEF3	50650	broad.mit.edu	37	3	56771523	56771524	+	Intron	INS	-	A	A	rs11443478		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:56771523_56771524insA	uc003dig.2	-						ARHGEF3_uc011bew.1_Intron|ARHGEF3_uc003dih.2_Intron|ARHGEF3_uc011bev.1_Intron|ARHGEF3_uc003dif.2_Intron|ARHGEF3_uc010hmy.1_Intron|ARHGEF3_uc003dii.2_Intron	NM_019555	NP_062455	Q9NR81	ARHG3_HUMAN	Rho guanine nucleotide exchange factor 3 isoform						apoptosis|induction of apoptosis by extracellular signals|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|Rho protein signal transduction	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0161)|Kidney(284;0.019)|OV - Ovarian serous cystadenocarcinoma(275;0.193)		TGGGAAAAGAGAAAAAAAAAAA	0.347													7	4	---	---	---	---	
ALDH1L1	10840	broad.mit.edu	37	3	125878066	125878067	+	Intron	DEL	CA	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:125878066_125878067delCA	uc003eim.1	-						ALDH1L1_uc010hse.1_Intron|ALDH1L1_uc011bki.1_Intron|ALDH1L1_uc003eio.2_5'Flank|ALDH1L1_uc010hsf.1_Intron|ALDH1L1_uc003eip.1_5'Flank|ALDH1L1_uc011bkj.1_Intron	NM_012190	NP_036322	O75891	AL1L1_HUMAN	aldehyde dehydrogenase 1 family, member L1						10-formyltetrahydrofolate catabolic process|biosynthetic process		acyl carrier activity|cofactor binding|formyltetrahydrofolate dehydrogenase activity|hydroxymethyl-, formyl- and related transferase activity|methyltransferase activity			large_intestine(1)|ovary(1)|central_nervous_system(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.0462)	Tetrahydrofolic acid(DB00116)	cacatgcgtgcacacacacaca	0.000													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374552	149374553	+	Intron	DEL	TC	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374552_149374553delTC	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			tctctctctttctctctctctc	0.361													6	3	---	---	---	---	
BCHE	590	broad.mit.edu	37	3	165515095	165515099	+	Intron	DEL	CCCTT	-	-	rs142594104		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:165515095_165515099delCCCTT	uc003fem.3	-						BCHE_uc003fen.3_Intron	NM_000055	NP_000046	P06276	CHLE_HUMAN	butyrylcholinesterase precursor						choline metabolic process|cocaine metabolic process|synaptic transmission, cholinergic	endoplasmic reticulum lumen|extracellular space|membrane	acetylcholinesterase activity|beta-amyloid binding|carboxylesterase activity|cholinesterase activity|enzyme binding			ovary(3)|pancreas(1)	4					Ambenonium(DB01122)|Atropine(DB00572)|Bambuterol(DB01408)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinnarizine(DB00568)|Demecarium bromide(DB00944)|Dibucaine(DB00527)|Donepezil(DB00843)|Echothiophate Iodide(DB01057)|Edrophonium(DB01010)|Ethopropazine(DB00392)|Etomidate(DB00292)|Galantamine(DB00674)|Hexafluronium bromide(DB00941)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Mivacurium(DB01226)|Neostigmine(DB01400)|Pancuronium(DB01337)|Pralidoxime(DB00733)|Procainamide(DB01035)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Terbutaline(DB00871)|Trimethaphan(DB01116)	ctccctcccccccttccttccttcc	0.034													8	4	---	---	---	---	
FRAS1	80144	broad.mit.edu	37	4	79101922	79101922	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:79101922delT	uc003hlb.2	+						FRAS1_uc003hkw.2_Intron	NM_025074	NP_079350	Q86XX4	FRAS1_HUMAN	Fraser syndrome 1						cell communication	integral to membrane|plasma membrane	metal ion binding			large_intestine(5)	5						AATGACAGTCTTTTTTTTTTT	0.343													6	3	---	---	---	---	
AHRR	57491	broad.mit.edu	37	5	311306	311307	+	Intron	DEL	TG	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:311306_311307delTG	uc003jav.2	+						AHRR_uc003jaw.2_Intron|AHRR_uc010isy.2_Intron|PDCD6_uc003jat.1_Intron|PDCD6_uc003jau.1_Intron	NM_020731	NP_065782	A9YTQ3	AHRR_HUMAN	arylhydrocarbon receptor repressor						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|signal transducer activity			breast(2)	2			Epithelial(17;0.0011)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00354)|Lung(60;0.0863)			AGCCTTGCATTGTGTGTGTTAG	0.520													12	6	---	---	---	---	
DNAH5	1767	broad.mit.edu	37	5	13842159	13842160	+	Intron	INS	-	A	A	rs147371351	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:13842159_13842160insA	uc003jfd.2	-							NM_001369	NP_001360	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5						microtubule-based movement	cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(14)|skin(13)|upper_aerodigestive_tract(1)|central_nervous_system(1)|breast(1)|pancreas(1)	31	Lung NSC(4;0.00476)					TTCAAAACAATAAAAAAAAAAG	0.183									Kartagener_syndrome				5	8	---	---	---	---	
C5orf35	133383	broad.mit.edu	37	5	56209591	56209591	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:56209591delT	uc003jqx.2	+						C5orf35_uc003jqy.2_Intron	NM_153706	NP_714917	Q8NE22	CE035_HUMAN	hypothetical protein LOC133383											ovary(1)	1		Lung NSC(810;0.000861)|Prostate(74;0.0305)|Breast(144;0.173)		OV - Ovarian serous cystadenocarcinoma(10;2.58e-39)		TACTAAAGTCTTTTTTTTTTT	0.259													4	2	---	---	---	---	
MYOZ3	91977	broad.mit.edu	37	5	150052109	150052110	+	Intron	INS	-	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:150052109_150052110insA	uc003lss.2	+						MYOZ3_uc003lsr.2_Intron	NM_001122853	NP_001116325	Q8TDC0	MYOZ3_HUMAN	myozenin 3							sarcomere	protein binding			skin(1)	1		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGAGGGGCGGGAAGCCAGTCAC	0.411													6	3	---	---	---	---	
OOEP	441161	broad.mit.edu	37	6	74082632	74082632	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:74082632delT	uc003pgv.3	-							NM_001080507	NP_001073976	A6NGQ2	OOEP_HUMAN	oocyte expressed protein homolog							cytoplasm					0						ttttctttccttttttttttt	0.378													5	3	---	---	---	---	
ARMC2	84071	broad.mit.edu	37	6	109285993	109285993	+	Intron	DEL	A	-	-	rs77214837		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:109285993delA	uc003pss.3	+						ARMC2_uc011eao.1_Intron	NM_032131	NP_115507	Q8NEN0	ARMC2_HUMAN	armadillo repeat containing 2								binding				0		all_cancers(87;1.14e-07)|Acute lymphoblastic leukemia(125;2.3e-10)|all_hematologic(75;3.3e-08)|all_epithelial(87;0.000111)|Colorectal(196;0.03)|all_lung(197;0.11)		Epithelial(106;0.000197)|BRCA - Breast invasive adenocarcinoma(108;0.000236)|all cancers(137;0.000279)|OV - Ovarian serous cystadenocarcinoma(136;0.00434)		actctgtctcaaaaaaaaaaa	0.114													6	3	---	---	---	---	
RNF216L	441191	broad.mit.edu	37	7	5015788	5015788	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:5015788delT	uc003snp.3	+						RNF216L_uc003snq.3_Intron|RNF216L_uc010ksr.2_Intron|RNF216L_uc011jwe.1_Intron	NR_023384				Homo sapiens cDNA FLJ42538 fis, clone BRACE3004113.												0						GTTTGTGTGGTTTTTTTTTTT	0.323													10	6	---	---	---	---	
DYNC1I1	1780	broad.mit.edu	37	7	95566269	95566270	+	Intron	DEL	CA	-	-	rs73228465		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:95566269_95566270delCA	uc003uoc.3	+						DYNC1I1_uc003uod.3_Intron|DYNC1I1_uc003uob.2_Intron|DYNC1I1_uc003uoe.3_Intron|DYNC1I1_uc010lfl.2_Intron	NM_004411	NP_004402	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1						vesicle transport along microtubule	condensed chromosome kinetochore|cytoplasmic dynein complex|microtubule|perinuclear region of cytoplasm|spindle pole|vesicle	microtubule binding|microtubule motor activity			ovary(3)|kidney(1)	4	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			gaatatgtctcacacacacaca	0.030													3	3	---	---	---	---	
FER1L6	654463	broad.mit.edu	37	8	125034095	125034096	+	Intron	INS	-	T	T	rs138450142	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:125034095_125034096insT	uc003yqw.2	+						uc003yqx.1_Intron	NM_001039112	NP_001034201	Q2WGJ9	FR1L6_HUMAN	fer-1-like 6							integral to membrane				ovary(5)|skin(5)|central_nervous_system(1)	11	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			AGCTTTATTCATTTTTTTTTCA	0.386													9	7	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33386733	33386734	+	Intron	INS	-	A	A	rs144694820	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33386733_33386734insA	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_Intron|AQP7_uc010mjt.2_Intron|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_Intron|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		gaggaacacagaggcgatggct	0.158													5	3	---	---	---	---	
FAM166B	730112	broad.mit.edu	37	9	35562393	35562394	+	Frame_Shift_Ins	INS	-	TAGT	TAGT	rs142582869	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:35562393_35562394insTAGT	uc010mkr.2	-	5	793_794	c.722_723insACTA	c.(721-723)TATfs	p.Y241fs	FAM166B_uc011lov.1_Frame_Shift_Ins_p.Y229fs|FAM166B_uc011low.1_Frame_Shift_Ins_p.M226fs|FAM166B_uc003zwy.2_3'UTR	NM_001164310	NP_001157782	A8MTA8	F166B_HUMAN	hypothetical protein LOC730112 isoform 1	241											0						CGTAGCCCCCATAGTTAGGTAA	0.564													10	8	---	---	---	---	
FRMPD1	22844	broad.mit.edu	37	9	37736882	37736883	+	Intron	DEL	GC	-	-	rs151329428		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:37736882_37736883delGC	uc004aag.1	+						FRMPD1_uc004aah.1_Intron|FRMPD1_uc011lqm.1_Intron|FRMPD1_uc011lqn.1_Intron	NM_014907	NP_055722	Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1							cytoskeleton|cytosol|plasma membrane				ovary(4)|central_nervous_system(2)|skin(2)|breast(1)	9				GBM - Glioblastoma multiforme(29;0.00655)		gtgtatgtgtgCGCACACACAC	0.376													4	4	---	---	---	---	
FBXO18	84893	broad.mit.edu	37	10	5945294	5945295	+	Intron	INS	-	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:5945294_5945295insT	uc001iis.2	+						FBXO18_uc001iir.2_Intron|FBXO18_uc009xig.2_Intron|FBXO18_uc001iit.2_Intron	NM_178150	NP_835363	Q8NFZ0	FBX18_HUMAN	F-box only protein, helicase, 18 isoform 2						DNA repair	nucleus	ATP binding|ATP-dependent DNA helicase activity|DNA binding			ovary(2)|skin(1)	3						TTTCCATGAAGttttttttttt	0.163													9	4	---	---	---	---	
E2F8	79733	broad.mit.edu	37	11	19255692	19255693	+	Intron	INS	-	A	A	rs76020624		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:19255692_19255693insA	uc001mpm.2	-						E2F8_uc009yhv.2_Intron|E2F8_uc001mpn.3_Intron	NM_024680	NP_078956	A0AVK6	E2F8_HUMAN	E2F family member 8						cell cycle	transcription factor complex	DNA binding|sequence-specific DNA binding transcription factor activity			skin(1)	1						agactccgtctaaaaaaaaaaa	0.119													6	4	---	---	---	---	
SLC6A5	9152	broad.mit.edu	37	11	20636505	20636506	+	Intron	INS	-	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:20636505_20636506insA	uc001mqd.2	+						SLC6A5_uc009yic.2_Intron	NM_004211	NP_004202	Q9Y345	SC6A5_HUMAN	solute carrier family 6 (neurotransmitter						synaptic transmission	integral to membrane|plasma membrane	glycine:sodium symporter activity|neurotransmitter:sodium symporter activity			ovary(2)|breast(1)|skin(1)	4					Glycine(DB00145)	GTTTGGCTTCCAAGAGCAGATT	0.441													23	10	---	---	---	---	
ANO1	55107	broad.mit.edu	37	11	69971959	69971959	+	Intron	DEL	C	-	-	rs60749334		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:69971959delC	uc001opj.2	+						ANO1_uc001opk.1_Intron|ANO1_uc001opl.1_Intron|ANO1_uc010rqk.1_Intron	NM_018043	NP_060513	Q5XXA6	ANO1_HUMAN	anoctamin 1, calcium activated chloride channel						multicellular organismal development	chloride channel complex|cytoplasm|plasma membrane	intracellular calcium activated chloride channel activity			ovary(1)|pancreas(1)	2						caaaaaaaaacaaaaaaagag	0.264													13	11	---	---	---	---	
CPNE8	144402	broad.mit.edu	37	12	39268405	39268406	+	Intron	INS	-	TA	TA			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:39268405_39268406insTA	uc001rls.1	-							NM_153634	NP_705898	Q86YQ8	CPNE8_HUMAN	copine VIII											pancreas(1)	1	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				ACATAATTGTGTatatatatat	0.213													4	4	---	---	---	---	
YAF2	10138	broad.mit.edu	37	12	42554844	42554845	+	Intron	DEL	TG	-	-	rs138264549		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:42554844_42554845delTG	uc001rmv.2	-						YAF2_uc001rmw.2_Intron|YAF2_uc010sko.1_Intron|YAF2_uc010skp.1_Intron	NM_005748	NP_005739	Q8IY57	YAF2_HUMAN	YY1 associated factor 2						negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	protein binding|transcription coactivator activity|transcription corepressor activity|zinc ion binding				0	all_cancers(12;0.000425)	Lung NSC(34;0.0402)|all_lung(34;0.057)		GBM - Glioblastoma multiforme(48;0.0514)		ACCAAAAAACTGTGACAGCCTA	0.287													4	4	---	---	---	---	
HOXC12	3228	broad.mit.edu	37	12	54348571	54348572	+	5'Flank	INS	-	A	A	rs55739629		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:54348571_54348572insA	uc010soq.1	+							NM_173860	NP_776272	P31275	HXC12_HUMAN	homeobox C12						multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			upper_aerodigestive_tract(1)	1						GGATGGTGGGGGGGGGGGATCG	0.594													4	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	74669120	74669120	+	Intron	DEL	T	-	-	rs113849001		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:74669120delT	uc009zrx.1	-						uc001sxc.2_Intron					Homo sapiens cDNA clone IMAGE:3926153, partial cds.																		TTTTTTGGGGTTTTTTTTTTT	0.303													5	5	---	---	---	---	
PLXNC1	10154	broad.mit.edu	37	12	94620767	94620767	+	Intron	DEL	C	-	-	rs63735761		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:94620767delC	uc001tdc.2	+							NM_005761	NP_005752	O60486	PLXC1_HUMAN	plexin C1 precursor						axon guidance|cell adhesion	integral to membrane|intracellular|plasma membrane	receptor activity|receptor binding			ovary(2)|central_nervous_system(1)	3						ccactgcactcccagcctggg	0.104													7	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	12	129497863	129497864	+	IGR	INS	-	TT	TT	rs10655206		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129497863_129497864insTT								GLT1D1 (28354 upstream) : TMEM132D (58407 downstream)																							TGGCAGAATCCTTTTTTTTTTT	0.371													10	6	---	---	---	---	
ULK1	8408	broad.mit.edu	37	12	132403325	132403326	+	Intron	INS	-	GT	GT	rs67230512		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132403325_132403326insGT	uc001uje.2	+							NM_003565	NP_003556	O75385	ULK1_HUMAN	Unc-51-like kinase 1						autophagy|protein localization|regulation of autophagy	autophagic vacuole|cytosol|pre-autophagosomal structure|ULK1-ATG13-FIP200 complex	ATP binding|protein complex binding|protein serine/threonine kinase activity			ovary(1)|lung(1)|central_nervous_system(1)|skin(1)	4	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		tggggtgtcgggtgtggggtgt	0.134													4	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	13	55014796	55014797	+	IGR	INS	-	TTTT	TTTT			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:55014796_55014797insTTTT								MIR1297 (128613 upstream) : None (None downstream)																							tttcaggttcctttTTTTTTTT	0.188													4	2	---	---	---	---	
POTEG	404785	broad.mit.edu	37	14	19563209	19563210	+	Intron	INS	-	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:19563209_19563210insT	uc001vuz.1	+						POTEG_uc001vva.1_Intron|POTEG_uc010ahc.1_Intron|uc001vvb.2_RNA	NM_001005356	NP_001005356	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											ovary(1)	1						AGATAAGAGGGTTTTTTTTTTG	0.347													5	3	---	---	---	---	
TEP1	7011	broad.mit.edu	37	14	20837170	20837170	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:20837170delT	uc001vxe.2	-						TEP1_uc010ahj.1_Intron|TEP1_uc010ahk.2_Intron|TEP1_uc010tlf.1_Intron|TEP1_uc010tlg.1_Intron	NM_007110	NP_009041	Q99973	TEP1_HUMAN	telomerase-associated protein 1						telomere maintenance via recombination	chromosome, telomeric region|cytoplasm|nuclear matrix|soluble fraction|telomerase holoenzyme complex	ATP binding|RNA binding			ovary(5)	5	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TTAGTAtttcttttttttttt	0.264													4	2	---	---	---	---	
NOVA1	4857	broad.mit.edu	37	14	27066713	27066714	+	5'UTR	INS	-	T	T			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:27066713_27066714insT	uc001wpy.2	-	1					NOVA1_uc001wpz.2_5'UTR|NOVA1_uc001wqa.2_5'UTR|NOVA1_uc001wqb.2_5'UTR	NM_002515	NP_002506	P51513	NOVA1_HUMAN	neuro-oncological ventral antigen 1 isoform 1						locomotory behavior|RNA splicing|synaptic transmission	nucleus	RNA binding			skin(2)|upper_aerodigestive_tract(1)|breast(1)|liver(1)	5				GBM - Glioblastoma multiforme(265;0.0135)		tttcttttttcttttttttttt	0.356													5	5	---	---	---	---	
CYP46A1	10858	broad.mit.edu	37	14	100166602	100166603	+	Intron	DEL	GA	-	-	rs72330651		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:100166602_100166603delGA	uc001ygo.2	+						CYP46A1_uc001ygn.1_Intron	NM_006668	NP_006659	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46						bile acid biosynthetic process|cholesterol catabolic process|nervous system development|xenobiotic metabolic process	endoplasmic reticulum membrane|integral to membrane|microsome	cholesterol 24-hydroxylase activity|electron carrier activity|heme binding|steroid hydroxylase activity				0		Melanoma(154;0.0866)|all_epithelial(191;0.179)				AGTCAAAAGGGAGAGAGAGAGA	0.574													2	4	---	---	---	---	
CA12	771	broad.mit.edu	37	15	63668011	63668011	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:63668011delT	uc002amc.2	-						CA12_uc002amd.2_Intron|CA12_uc002ame.2_Intron	NM_001218	NP_001209	O43570	CAH12_HUMAN	carbonic anhydrase XII isoform 1 precursor						one-carbon metabolic process	integral to membrane	carbonate dehydratase activity|zinc ion binding			ovary(1)	1					Acetazolamide(DB00819)	tttctttttcttttttttttt	0.164													5	3	---	---	---	---	
FSD2	123722	broad.mit.edu	37	15	83438317	83438318	+	Intron	INS	-	A	A	rs71455426		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:83438317_83438318insA	uc002bjd.2	-						FSD2_uc010uol.1_Intron|FSD2_uc010uom.1_Intron	NM_001007122	NP_001007123	A1L4K1	FSD2_HUMAN	fibronectin type III and SPRY domain containing											central_nervous_system(1)	1						ggactcatctcaaaaaaaaaaa	0.149													4	3	---	---	---	---	
ST8SIA2	8128	broad.mit.edu	37	15	93007302	93007303	+	Intron	INS	-	T	T	rs34156050		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:93007302_93007303insT	uc002bra.2	+						ST8SIA2_uc002brb.2_Intron	NM_006011	NP_006002	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide						axon guidance|N-glycan processing|oligosaccharide biosynthetic process|post-translational protein modification|protein N-linked glycosylation via asparagine	integral to Golgi membrane	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity				0	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			TGtttcttttcttttttttttt	0.441													6	3	---	---	---	---	
NUBP1	4682	broad.mit.edu	37	16	10850369	10850369	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:10850369delT	uc002daa.1	+						NUBP1_uc010bum.1_Intron|NUBP1_uc002dab.1_Intron	NM_002484	NP_002475	P53384	NUBP1_HUMAN	nucleotide binding protein 1						cell growth|cellular iron ion homeostasis|iron-sulfur cluster assembly	cytosol	4 iron, 4 sulfur cluster binding|ATP binding|metal ion binding|nucleoside-triphosphatase activity|protein binding			ovary(1)|skin(1)	2						CATGGTACCCTTTTTTTTTTT	0.398													3	3	---	---	---	---	
BFAR	51283	broad.mit.edu	37	16	14738020	14738020	+	Intron	DEL	A	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:14738020delA	uc002dco.2	+						BFAR_uc002dcm.2_Intron|BFAR_uc002dcn.2_Intron|BFAR_uc002dcp.2_Intron|BFAR_uc010uzh.1_5'Flank	NM_016561	NP_057645	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator						anti-apoptosis|apoptosis	endoplasmic reticulum membrane|integral to plasma membrane|membrane fraction	structural molecule activity|zinc ion binding			ovary(1)|skin(1)	2						actgtgtctcaaaaaaaaaaa	0.119													7	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	21890632	21890632	+	Intron	DEL	A	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:21890632delA	uc002djr.3	-						uc002djs.3_Intron|uc010vbo.1_RNA	NM_130464	NP_569731			nuclear pore complex interacting protein-like 3																		TTTCTCTTACAAAAAAAAAAA	0.224													3	5	---	---	---	---	
CDH15	1013	broad.mit.edu	37	16	89254413	89254429	+	Intron	DEL	GGGTGGGAGGGGAGGGT	-	-	rs138367841		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:89254413_89254429delGGGTGGGAGGGGAGGGT	uc002fmt.2	+							NM_004933	NP_004924	P55291	CAD15_HUMAN	cadherin 15 preproprotein						adherens junction organization|cell junction assembly|homophilic cell adhesion|muscle cell differentiation|positive regulation of muscle cell differentiation	integral to membrane|plasma membrane	calcium ion binding			skin(1)	1				BRCA - Breast invasive adenocarcinoma(80;0.0261)		GCAGGAGGGAGGGTGGGAGGGGAGGGTGGGCTGAGGG	0.645													3	3	---	---	---	---	
TP53	7157	broad.mit.edu	37	17	7579585	7579585	+	Frame_Shift_Del	DEL	G	-	-	rs11575998		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7579585delG	uc002gim.2	-	4	296	c.102delC	c.(100-102)CCCfs	p.P34fs	TP53_uc002gig.1_Frame_Shift_Del_p.P34fs|TP53_uc002gih.2_Frame_Shift_Del_p.P34fs|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_5'Flank|TP53_uc010cng.1_5'Flank|TP53_uc002gii.1_5'Flank|TP53_uc010cnh.1_Frame_Shift_Del_p.P34fs|TP53_uc010cni.1_Frame_Shift_Del_p.P34fs|TP53_uc002gij.2_Frame_Shift_Del_p.P34fs|TP53_uc010cnj.1_5'Flank|TP53_uc002gin.2_Intron|TP53_uc002gio.2_Intron|TP53_uc010vug.1_5'UTR|TP53_uc010cnk.1_Frame_Shift_Del_p.P49fs	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	34	Transcription activation (acidic).|Interaction with HRMT1L2.		P -> L (in a sporadic cancer; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.0?(7)|p.P34L(2)|p.?(1)|p.S33fs*23(1)|p.P34fs*8(1)|p.P36fs*7(1)|p.P13fs*18(1)|p.S33fs*6(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GGGACGGCAAGGGGGACTGTA	0.383		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			191	120	---	---	---	---	
NBR1	4077	broad.mit.edu	37	17	41361882	41361882	+	Intron	DEL	T	-	-	rs35534808		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:41361882delT	uc010czd.2	+						NBR1_uc010diz.2_Intron|NBR1_uc010whv.1_Intron|NBR1_uc010whw.1_Intron|TMEM106A_uc002idn.1_5'Flank|TMEM106A_uc010why.1_5'Flank|TMEM106A_uc010cze.1_5'Flank|TMEM106A_uc010whz.1_5'Flank	NM_031862	NP_114068	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1						macroautophagy|protein oligomerization	autophagic vacuole|cytoplasmic vesicle|cytosol|late endosome|lysosome|sarcomere	ubiquitin binding|zinc ion binding			skin(1)	1		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		ttatacagaattttttttttt	0.303													3	3	---	---	---	---	
CD226	10666	broad.mit.edu	37	18	67563417	67563418	+	Intron	INS	-	T	T	rs33943534		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67563417_67563418insT	uc010dqo.2	-						CD226_uc002lkm.3_Intron	NM_006566	NP_006557	Q15762	CD226_HUMAN	CD226 molecule precursor						cell adhesion|cell recognition|positive regulation of Fc receptor mediated stimulatory signaling pathway|positive regulation of immunoglobulin mediated immune response|positive regulation of mast cell activation|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target	cell surface|integral to plasma membrane|membrane raft	cell adhesion molecule binding|integrin binding|protein kinase binding|receptor activity				0		Esophageal squamous(42;0.129)				CTTTATACTACttttttttttt	0.173													4	2	---	---	---	---	
HSD17B14	51171	broad.mit.edu	37	19	49337748	49337749	+	Intron	INS	-	A	A			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49337748_49337749insA	uc002pkv.1	-						HSD17B14_uc010emk.1_Intron	NM_016246	NP_057330	Q9BPX1	DHB14_HUMAN	dehydrogenase/reductase (SDR family) member 10						steroid catabolic process	centrosome|cytosol	estradiol 17-beta-dehydrogenase activity|protein binding|testosterone 17-beta-dehydrogenase (NADP+) activity				0		all_epithelial(76;7e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000341)|all cancers(93;0.000764)|GBM - Glioblastoma multiforme(486;0.0233)|Epithelial(262;0.0346)		gaggggctgaggtctggactcc	0.000													4	2	---	---	---	---	
SRC	6714	broad.mit.edu	37	20	36014806	36014806	+	Intron	DEL	C	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:36014806delC	uc002xgx.2	+						SRC_uc002xgy.2_Intron	NM_005417	NP_005408	P12931	SRC_HUMAN	proto-oncogene tyrosine-protein kinase SRC						axon guidance|bone resorption|cell junction assembly|cellular membrane organization|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|interspecies interaction between organisms|intracellular protein kinase cascade|leukocyte migration|nerve growth factor receptor signaling pathway|platelet activation|positive regulation of integrin activation|Ras protein signal transduction|regulation of bone resorption|regulation of vascular permeability|response to interleukin-1|signal complex assembly|T cell costimulation	caveola|cytosol|mitochondrial inner membrane	ATP binding|heme binding|integrin binding|ion channel binding|non-membrane spanning protein tyrosine kinase activity|SH2 domain binding|SH3/SH2 adaptor activity			large_intestine(10)|lung(1)|central_nervous_system(1)|endometrium(1)	13		Myeloproliferative disorder(115;0.00878)			Dasatinib(DB01254)	ctcgcttgctccctccagccc	0.468													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	49068651	49068651	+	IGR	DEL	A	-	-	rs71190560		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:49068651delA								CEBPB (259439 upstream) : PTPN1 (58240 downstream)																							ggaaggaaggaaaggaaggaa	0.060													2	5	---	---	---	---	
TTLL1	25809	broad.mit.edu	37	22	43435575	43435576	+	3'UTR	INS	-	A	A	rs143546633	by1000genomes	TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:43435575_43435576insA	uc003bdi.2	-	11					TTLL1_uc010gzh.2_3'UTR|TTLL1_uc003bdj.2_3'UTR|TTLL1_uc003bdh.2_3'UTR	NM_012263	NP_036395	O95922	TTLL1_HUMAN	tubulin tyrosine ligase-like family, member 1						protein polyglutamylation	cytoplasm|microtubule	ATP binding|tubulin-glutamic acid ligase activity|tubulin-tyrosine ligase activity			skin(1)	1		Ovarian(80;0.0694)		BRCA - Breast invasive adenocarcinoma(115;0.00461)		GGTTAAAAATTAAAAAAAAAAG	0.312													3	3	---	---	---	---	
STS	412	broad.mit.edu	37	X	7193971	7193971	+	Intron	DEL	T	-	-			TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:7193971delT	uc004cry.3	+							NM_000351	NP_000342	P08842	STS_HUMAN	steryl-sulfatase precursor						female pregnancy|steroid catabolic process	endoplasmic reticulum membrane|endosome|Golgi apparatus|integral to membrane|lysosome|microsome|plasma membrane	metal ion binding|steryl-sulfatase activity			central_nervous_system(1)	1		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Estrone(DB00655)	ttttcctcccttttttttttt	0.373									Ichthyosis				3	3	---	---	---	---	
NXF5	55998	broad.mit.edu	37	X	101093121	101093122	+	Intron	INS	-	G	G	rs145072756		TCGA-60-2707-01	TCGA-60-2707-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:101093121_101093122insG	uc011mrk.1	-						NXF5_uc004eih.1_Intron|NXF5_uc004eii.1_Intron|NXF5_uc004eij.1_Intron|NXF5_uc004eik.1_Intron|NXF5_uc004eil.1_Intron	NM_032946	NP_116564	Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5						mRNA export from nucleus|multicellular organismal development	actin cytoskeleton|cytoplasm|nucleus	nucleocytoplasmic transporter activity|nucleotide binding|protein binding|RNA binding			central_nervous_system(1)	1						GCTGCACGGGTGCCCAGCCTGT	0.540													4	2	---	---	---	---	
