Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
MEGF6	1953	broad.mit.edu	37	1	3512012	3512012	+	Splice_Site	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:3512012C>A	uc001akl.2	-	3	494	c.267_splice	c.e3-1	p.R89_splice		NM_001409	NP_001400	O75095	MEGF6_HUMAN	EGF-like-domain, multiple 3 precursor							extracellular region	calcium ion binding			large_intestine(1)	1	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		GTAGACGGTTCTAGAAAGAAA	0.617													19	55	---	---	---	---	PASS
ACOT7	11332	broad.mit.edu	37	1	6387379	6387379	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:6387379A>G	uc001ams.2	-	5	792	c.635T>C	c.(634-636)GTC>GCC	p.V212A	ACOT7_uc010nzq.1_Missense_Mutation_p.V97A|ACOT7_uc001amt.2_Missense_Mutation_p.V202A|ACOT7_uc001amu.2_RNA|ACOT7_uc001amv.2_RNA|ACOT7_uc001amq.2_Missense_Mutation_p.V161A|ACOT7_uc001amr.2_Missense_Mutation_p.V182A	NM_181864	NP_863654	O00154	BACH_HUMAN	acyl-CoA thioesterase 7 isoform hBACHb	212						mitochondrion|nucleus	carboxylesterase activity|fatty-acyl-CoA binding|palmitoyl-CoA hydrolase activity				0	Ovarian(185;0.0634)|all_lung(157;0.175)	all_cancers(23;1.42e-38)|all_epithelial(116;3.96e-23)|all_lung(118;3.69e-08)|Lung NSC(185;8.52e-07)|all_hematologic(16;6.92e-06)|Colorectal(325;4.53e-05)|Acute lymphoblastic leukemia(12;5e-05)|all_neural(13;0.000164)|Breast(487;0.000688)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;9.16e-37)|GBM - Glioblastoma multiforme(13;5.89e-29)|OV - Ovarian serous cystadenocarcinoma(86;7.63e-19)|Colorectal(212;1.27e-07)|COAD - Colon adenocarcinoma(227;2.06e-05)|Kidney(185;7.74e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00129)|BRCA - Breast invasive adenocarcinoma(365;0.00132)|STAD - Stomach adenocarcinoma(132;0.00195)|READ - Rectum adenocarcinoma(331;0.0481)		GACTGGCTGGACGATGTCCCC	0.652													4	26	---	---	---	---	PASS
RERE	473	broad.mit.edu	37	1	8684379	8684379	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:8684379T>A	uc001ape.2	-	4	1196	c.386A>T	c.(385-387)GAC>GTC	p.D129V	RERE_uc001apf.2_Missense_Mutation_p.D129V|RERE_uc001aph.1_Missense_Mutation_p.D129V	NM_012102	NP_036234	Q9P2R6	RERE_HUMAN	atrophin-1 like protein isoform a	129	BAH.				multicellular organismal development|NLS-bearing substrate import into nucleus	mitochondrion	poly-glutamine tract binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|central_nervous_system(1)	2	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		CAGTTTGAAGTCTTGAATGCT	0.383													75	168	---	---	---	---	PASS
VPS13D	55187	broad.mit.edu	37	1	12414036	12414036	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:12414036G>T	uc001atv.2	+	47	9578	c.9437G>T	c.(9436-9438)TGT>TTT	p.C3146F	VPS13D_uc001atw.2_Missense_Mutation_p.C3121F|VPS13D_uc001atx.2_Missense_Mutation_p.C2333F	NM_015378	NP_056193	Q5THJ4	VP13D_HUMAN	vacuolar protein sorting 13D isoform 1	3145					protein localization					ovary(4)|pancreas(1)	5	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CATAGGTTTTGTGTGGCTATA	0.313													30	70	---	---	---	---	PASS
ARHGEF10L	55160	broad.mit.edu	37	1	17948358	17948358	+	Splice_Site	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:17948358G>T	uc001ban.2	+	11	1102	c.943_splice	c.e11-1	p.V315_splice	ARHGEF10L_uc009vpe.1_Splice_Site_p.V276_splice|ARHGEF10L_uc001bao.2_Splice_Site_p.V276_splice|ARHGEF10L_uc001bap.2_Splice_Site_p.V276_splice|ARHGEF10L_uc010ocr.1_Splice_Site_p.V73_splice|ARHGEF10L_uc001baq.2_Splice_Site_p.V81_splice|ARHGEF10L_uc010ocs.1_Splice_Site_p.V93_splice|ARHGEF10L_uc001bar.2_Splice_Site_p.V93_splice	NM_018125	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF)						regulation of Rho protein signal transduction	cytoplasm	Rho guanyl-nucleotide exchange factor activity			large_intestine(1)|ovary(1)|pancreas(1)	3		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GGCCCGAGCAGGTGGTCCGGA	0.582													41	183	---	---	---	---	PASS
CSMD2	114784	broad.mit.edu	37	1	34191144	34191144	+	Intron	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34191144A>G	uc001bxn.1	-						CSMD2_uc001bxm.1_Intron	NM_052896	NP_443128	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2							integral to membrane|plasma membrane	protein binding			ovary(6)|skin(5)|pancreas(1)	12		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAATCTGCCAAATGACAGAAA	0.488													25	48	---	---	---	---	PASS
RHBDL2	54933	broad.mit.edu	37	1	39384712	39384712	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39384712G>A	uc001ccu.1	-	2	401	c.173C>T	c.(172-174)TCC>TTC	p.S58F	RHBDL2_uc010oin.1_Missense_Mutation_p.S58F|RHBDL2_uc010oio.1_Missense_Mutation_p.S138F|RHBDL2_uc001ccv.2_Missense_Mutation_p.S58F	NM_017821	NP_060291	Q9NX52	RHBL2_HUMAN	rhomboid protease 2	58					proteolysis	integral to membrane|plasma membrane	serine-type endopeptidase activity				0	Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;8.23e-17)			TGTTCCTCGGGACTTTTCGGG	0.552													72	132	---	---	---	---	PASS
KIAA0467	23334	broad.mit.edu	37	1	43915782	43915782	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:43915782G>A	uc001cjk.1	+	56	7860	c.7398G>A	c.(7396-7398)CTG>CTA	p.L2466L	KIAA0467_uc001cjl.1_Silent_p.L454L	NM_015284	NP_056099	Q5T011	SZT2_HUMAN	hypothetical protein LOC23334	3365						peroxisome					0	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				AGGTTGTGCTGAATCAGAAGT	0.542													6	120	---	---	---	---	PASS
CC2D1B	200014	broad.mit.edu	37	1	52828404	52828404	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:52828404C>G	uc001ctq.1	-	3	222	c.84G>C	c.(82-84)ATG>ATC	p.M28I	CC2D1B_uc001cts.2_5'Flank	NM_032449	NP_115825	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	28										ovary(2)	2						GGCCAAACTCCATAAAGAGCC	0.572													52	172	---	---	---	---	PASS
DAB1	1600	broad.mit.edu	37	1	57480937	57480937	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:57480937G>A	uc001cys.1	-	14	1737	c.1063C>T	c.(1063-1065)CCA>TCA	p.P355S	DAB1_uc001cyt.1_Missense_Mutation_p.P353S|DAB1_uc001cyq.1_Missense_Mutation_p.P353S|DAB1_uc001cyr.1_Missense_Mutation_p.P269S|DAB1_uc009vzw.1_Missense_Mutation_p.P337S|DAB1_uc009vzx.1_Missense_Mutation_p.P355S	NM_021080	NP_066566	O75553	DAB1_HUMAN	disabled homolog 1	388					cell differentiation|nervous system development					skin(2)|ovary(1)	3						GCCACAGTTGGCCAGGGCTGC	0.652													47	86	---	---	---	---	PASS
CDC7	8317	broad.mit.edu	37	1	91989991	91989991	+	Nonstop_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:91989991G>T	uc001doe.2	+	12	1889	c.1724G>T	c.(1723-1725)TGA>TTA	p.*575L	CDC7_uc001dof.2_Nonstop_Mutation_p.*575L|CDC7_uc010osw.1_Nonstop_Mutation_p.*547L|CDC7_uc009wdc.2_Nonstop_Mutation_p.*575L|CDC7_uc009wdd.2_Nonstop_Mutation_p.*218L	NM_003503	NP_003494	O00311	CDC7_HUMAN	cell division cycle 7	575					cell cycle checkpoint|cell division|DNA replication|G1/S transition of mitotic cell cycle|M/G1 transition of mitotic cell cycle|positive regulation of cell proliferation|regulation of S phase	cytoplasm|nucleoplasm	ATP binding|metal ion binding|protein binding|protein serine/threonine kinase activity			stomach(2)|large_intestine(1)|ovary(1)|central_nervous_system(1)	5		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		ATGAGCTTGTGATAATGGATC	0.328													29	112	---	---	---	---	PASS
WNT2B	7482	broad.mit.edu	37	1	113059863	113059863	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113059863C>T	uc001ecb.2	+	4	1317	c.802C>T	c.(802-804)CGC>TGC	p.R268C	WNT2B_uc001eca.2_Missense_Mutation_p.R249C|WNT2B_uc009wgg.2_Missense_Mutation_p.R176C	NM_024494	NP_078613	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family,	268					chondrocyte differentiation|cornea development in camera-type eye|dorsal/ventral axis specification|forebrain regionalization|hemopoietic stem cell proliferation|iris morphogenesis|lens development in camera-type eye|lung induction|male gonad development|neuron differentiation|positive regulation of branching involved in ureteric bud morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|Wnt receptor signaling pathway, calcium modulating pathway	extracellular space|plasma membrane|proteinaceous extracellular matrix	frizzled-2 binding|signal transducer activity			ovary(2)|breast(2)|skin(1)	5	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCTGCGGCGACGCTATGATGG	0.607													32	73	---	---	---	---	PASS
GDAP2	54834	broad.mit.edu	37	1	118424471	118424471	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:118424471A>C	uc001ehf.2	-	12	1575	c.1276T>G	c.(1276-1278)TTT>GTT	p.F426V	GDAP2_uc001ehg.2_Missense_Mutation_p.F426V	NM_017686	NP_060156	Q9NXN4	GDAP2_HUMAN	ganglioside induced differentiation associated	426	CRAL-TRIO.									ovary(2)	2		all_cancers(81;0.0156)|all_lung(203;5.81e-05)|Lung NSC(69;0.000446)|all_epithelial(167;0.00295)		Lung(183;0.0583)|LUSC - Lung squamous cell carcinoma(189;0.194)		GGATGTACAAAATAAACAGCC	0.313													30	67	---	---	---	---	PASS
LCE3A	353142	broad.mit.edu	37	1	152595351	152595351	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:152595351C>A	uc010pdt.1	-	1	229	c.229G>T	c.(229-231)GGG>TGG	p.G77W		NM_178431	NP_848518	Q5TA76	LCE3A_HUMAN	late cornified envelope 3A	77					keratinization						0	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGAGCTCCCGCCTTGCTGA	0.557													48	79	---	---	---	---	PASS
NUP210L	91181	broad.mit.edu	37	1	154033014	154033014	+	Splice_Site	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154033014A>T	uc001fdw.2	-	20	2922	c.2850_splice	c.e20+1	p.E950_splice	NUP210L_uc009woq.2_Intron|NUP210L_uc010peh.1_Splice_Site_p.E950_splice	NM_207308	NP_997191	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like isoform 1							integral to membrane				skin(5)|ovary(4)|large_intestine(1)|central_nervous_system(1)	11	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TCTAGAGCTCACCTCAACAGA	0.423													72	137	---	---	---	---	PASS
GBA	2629	broad.mit.edu	37	1	155209779	155209779	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:155209779T>G	uc001fjh.2	-	3	355	c.205A>C	c.(205-207)ACC>CCC	p.T69P	RAG1AP1_uc010pey.1_Intron|GBA_uc010pfw.1_Intron|GBA_uc010pfx.1_Missense_Mutation_p.T69P|GBA_uc001fji.2_Missense_Mutation_p.T69P|GBA_uc001fjj.2_Missense_Mutation_p.T69P|GBA_uc001fjk.2_Missense_Mutation_p.T69P|GBA_uc001fjl.2_Missense_Mutation_p.T69P|GBA_uc010pfy.1_5'UTR|GBA_uc009wqk.1_Intron	NM_000157	NP_000148	P04062	GLCM_HUMAN	glucocerebrosidase precursor	69					carbohydrate metabolic process|cell death|cellular response to tumor necrosis factor|ceramide biosynthetic process|glucosylceramide catabolic process|lysosome organization|negative regulation of interleukin-6 production|negative regulation of MAP kinase activity|positive regulation of protein dephosphorylation|sphingosine biosynthetic process|termination of signal transduction	lysosomal lumen|lysosomal membrane	cation binding|glucosylceramidase activity|receptor binding			ovary(1)|skin(1)	2	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)		Alglucerase(DB00088)|Imiglucerase(DB00053)	GCAGGAAAGGTCGGGGGGTCA	0.602									Gaucher_disease_type_I				16	32	---	---	---	---	PASS
MEF2D	4209	broad.mit.edu	37	1	156450724	156450724	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:156450724C>A	uc001fpc.2	-	4	688	c.298G>T	c.(298-300)GAG>TAG	p.E100*	MEF2D_uc001fpb.2_Nonsense_Mutation_p.E100*|MEF2D_uc001fpd.2_Nonsense_Mutation_p.E100*|MEF2D_uc001fpe.1_Nonsense_Mutation_p.E100*|MEF2D_uc009wsa.2_RNA	NM_005920	NP_005911	Q14814	MEF2D_HUMAN	myocyte enhancer factor 2D	100					apoptosis|muscle organ development|nervous system development|positive regulation of transcription from RNA polymerase II promoter	nucleus	activating transcription factor binding|histone deacetylase binding|RNA polymerase II regulatory region sequence-specific DNA binding|sequence-specific DNA binding RNA polymerase II transcription factor activity			ovary(1)	1	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCGTCGGGCTCGGGGCTGTCG	0.667											OREG0013874	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	48	117	---	---	---	---	PASS
METTL13	51603	broad.mit.edu	37	1	171753323	171753323	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171753323G>T	uc001ghz.2	+	2	944	c.597G>T	c.(595-597)CAG>CAT	p.Q199H	METTL13_uc001gia.2_Missense_Mutation_p.Q113H|METTL13_uc001gib.2_Intron|METTL13_uc010pml.1_Missense_Mutation_p.Q198H	NM_015935	NP_057019	Q8N6R0	MTL13_HUMAN	CGI-01 protein isoform 1	199							methyltransferase activity|protein binding			kidney(1)	1						CAGAGCCTCAGTTCTCCTTGC	0.582													55	102	---	---	---	---	PASS
PTGS2	5743	broad.mit.edu	37	1	186648497	186648497	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:186648497G>A	uc001gsb.2	-	2	263	c.126C>T	c.(124-126)TGC>TGT	p.C42C	PTGS2_uc009wyo.2_5'UTR	NM_000963	NP_000954	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 precursor	42	EGF-like.				cellular component movement|cyclooxygenase pathway|hormone biosynthetic process|positive regulation of brown fat cell differentiation|positive regulation of cell migration involved in sprouting angiogenesis|positive regulation of fever generation|positive regulation of fibroblast growth factor production|positive regulation of nitric oxide biosynthetic process|positive regulation of platelet-derived growth factor production|positive regulation of prostaglandin biosynthetic process|positive regulation of transforming growth factor-beta production|positive regulation vascular endothelial growth factor production|regulation of blood pressure|response to oxidative stress|xenobiotic metabolic process	endoplasmic reticulum lumen|endoplasmic reticulum membrane|microsome|neuron projection|nucleus	enzyme binding|heme binding|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen|peroxidase activity|prostaglandin-endoperoxide synthase activity			ovary(1)|central_nervous_system(1)	2					Acetaminophen(DB00316)|Aspirin(DB00945)|Balsalazide(DB01014)|Bromfenac(DB00963)|Carprofen(DB00821)|Celecoxib(DB00482)|Ciclopirox(DB01188)|Diclofenac(DB00586)|Diflunisal(DB00861)|Epoprostenol(DB01240)|Etodolac(DB00749)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|gamma-Homolinolenic acid(DB00154)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lumiracoxib(DB01283)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Rofecoxib(DB00533)|Salicyclic acid(DB00936)|Salsalate(DB01399)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Valdecoxib(DB00580)	GGGTACAATCGCACTTATACT	0.438													5	78	---	---	---	---	PASS
CRB1	23418	broad.mit.edu	37	1	197316552	197316552	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197316552C>A	uc001gtz.2	+	4	1066	c.931C>A	c.(931-933)CAC>AAC	p.H311N	CRB1_uc010poz.1_Missense_Mutation_p.H242N|CRB1_uc001gty.1_Missense_Mutation_p.H311N|CRB1_uc010ppa.1_RNA|CRB1_uc009wza.2_Intron|CRB1_uc010ppb.1_Missense_Mutation_p.H311N|CRB1_uc010ppc.1_RNA	NM_201253	NP_957705	P82279	CRUM1_HUMAN	crumbs homolog 1 precursor	311	Extracellular (Potential).|EGF-like 8.				cell-cell signaling|establishment or maintenance of cell polarity	apical plasma membrane|extracellular region|integral to membrane	calcium ion binding|protein binding			ovary(5)|skin(3)|large_intestine(1)	9						AAAACCTTGTCACAATAATGC	0.408													73	138	---	---	---	---	PASS
IRF6	3664	broad.mit.edu	37	1	209964185	209964185	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:209964185G>A	uc001hhq.1	-	7	978	c.715C>T	c.(715-717)CAG>TAG	p.Q239*	IRF6_uc010psm.1_Nonsense_Mutation_p.Q144*|IRF6_uc009xct.1_Nonsense_Mutation_p.Q239*	NM_006147	NP_006138	O14896	IRF6_HUMAN	interferon regulatory factor 6	239					cell cycle arrest|interferon-gamma-mediated signaling pathway|mammary gland epithelial cell differentiation|negative regulation of cell proliferation|positive regulation of transcription, DNA-dependent|type I interferon-mediated signaling pathway	cytoplasm|nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(81;0.0351)		GTCATGGTCTGCCCGTACTCC	0.572										HNSCC(57;0.16)			80	139	---	---	---	---	PASS
INTS7	25896	broad.mit.edu	37	1	212193539	212193539	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:212193539T>C	uc001hiw.1	-	3	401	c.296A>G	c.(295-297)AAT>AGT	p.N99S	INTS7_uc009xdb.1_Missense_Mutation_p.N99S|INTS7_uc001hix.1_5'UTR|INTS7_uc001hiy.1_Missense_Mutation_p.N99S|INTS7_uc010pta.1_Intron	NM_015434	NP_056249	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	99					snRNA processing	integrator complex	protein binding				0				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TTCATCCACATTTAGAATCTT	0.338													34	51	---	---	---	---	PASS
RPS6KC1	26750	broad.mit.edu	37	1	213414125	213414125	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:213414125C>T	uc010ptr.1	+	11	1465	c.1306C>T	c.(1306-1308)CCT>TCT	p.P436S	RPS6KC1_uc001hkd.2_Missense_Mutation_p.P424S|RPS6KC1_uc010pts.1_Missense_Mutation_p.P224S|RPS6KC1_uc010ptt.1_Missense_Mutation_p.P224S|RPS6KC1_uc010ptu.1_Missense_Mutation_p.P255S|RPS6KC1_uc010ptv.1_5'UTR|RPS6KC1_uc001hke.2_Missense_Mutation_p.P255S	NM_012424	NP_036556	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide	436	Protein kinase 1.				cell communication|signal transduction	early endosome|membrane	ATP binding|phosphatidylinositol binding|protein binding|protein serine/threonine kinase activity			lung(4)|ovary(3)|breast(1)	8				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		AGTGAAAAAACCTACACTTGC	0.413													90	208	---	---	---	---	PASS
SDCCAG8	10806	broad.mit.edu	37	1	243652445	243652445	+	Intron	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:243652445A>G	uc001hzw.2	+						SDCCAG8_uc010pyk.1_Intron|SDCCAG8_uc010pyl.1_Intron|SDCCAG8_uc001hzx.2_Intron|AKT3_uc001hzz.1_Intron	NM_006642	NP_006633	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8						establishment of cell polarity|G2/M transition of mitotic cell cycle|tube formation	cell-cell junction|centriole|cytosol	protein binding				0	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		GGACCCAGGTACTGTGCAGAA	0.622													5	27	---	---	---	---	PASS
OR13G1	441933	broad.mit.edu	37	1	247835882	247835882	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:247835882C>A	uc001idi.1	-	1	462	c.462G>T	c.(460-462)TGG>TGT	p.W154C		NM_001005487	NP_001005487	Q8NGZ3	O13G1_HUMAN	olfactory receptor, family 13, subfamily G,	154	Helical; Name=4; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			skin(1)	1	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			CTGTGTGCACCCAGGAATTGG	0.473													32	77	---	---	---	---	PASS
COLEC11	78989	broad.mit.edu	37	2	3652013	3652013	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:3652013C>A	uc002qya.2	+	2	231	c.83C>A	c.(82-84)GCT>GAT	p.A28D	COLEC11_uc002qxz.2_Translation_Start_Site|COLEC11_uc002qyb.2_Missense_Mutation_p.A28D|COLEC11_uc002qyc.2_Missense_Mutation_p.A28D|COLEC11_uc010ewo.2_Missense_Mutation_p.A28D|COLEC11_uc010ewp.2_5'Flank|COLEC11_uc010ewq.2_5'Flank|COLEC11_uc010ewr.2_5'Flank|COLEC11_uc010ews.2_5'Flank	NM_024027	NP_076932	Q9BWP8	COL11_HUMAN	collectin sub-family member 11 isoform a	28						collagen	mannose binding				0	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CCTCAGCCGGCTGGCGATGAC	0.647													45	130	---	---	---	---	PASS
NBAS	51594	broad.mit.edu	37	2	15607790	15607790	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:15607790G>A	uc002rcc.1	-	18	2042	c.2016C>T	c.(2014-2016)TCC>TCT	p.S672S	NBAS_uc002rcd.1_RNA	NM_015909	NP_056993	A2RRP1	NBAS_HUMAN	neuroblastoma-amplified protein	672										ovary(2)|liver(1)|skin(1)	4						TCATTTACTTGGAAAAGTTCA	0.328													19	48	---	---	---	---	PASS
PPM1B	5495	broad.mit.edu	37	2	44428979	44428979	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:44428979G>T	uc002rtt.2	+	2	1069	c.641G>T	c.(640-642)GGC>GTC	p.G214V	PPM1B_uc002rts.2_Missense_Mutation_p.G214V|PPM1B_uc002rtu.2_Missense_Mutation_p.G214V|PPM1B_uc002rtv.2_Intron|PPM1B_uc002rtw.2_Missense_Mutation_p.G214V|PPM1B_uc002rtx.2_Missense_Mutation_p.G214V	NM_002706	NP_002697	O75688	PPM1B_HUMAN	protein phosphatase 1B isoform 1	214					protein dephosphorylation	protein serine/threonine phosphatase complex	magnesium ion binding|manganese ion binding|protein binding|protein serine/threonine phosphatase activity			kidney(1)|skin(1)	2		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				GATGGCAAGGGCCCAACAGAA	0.438													37	77	---	---	---	---	PASS
TTC7A	57217	broad.mit.edu	37	2	47300936	47300936	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:47300936G>C	uc002rvo.2	+	20	2819	c.2451G>C	c.(2449-2451)CAG>CAC	p.Q817H	TTC7A_uc002rvm.2_Missense_Mutation_p.Q783H|TTC7A_uc010fbb.2_Missense_Mutation_p.Q841H|TTC7A_uc010fbc.2_Missense_Mutation_p.Q463H|TTC7A_uc002rvp.2_Missense_Mutation_p.Q698H|C2orf61_uc010fbd.2_Intron|TTC7A_uc002rvq.2_Missense_Mutation_p.Q557H|TTC7A_uc002rvr.2_Missense_Mutation_p.Q266H	NM_020458	NP_065191	Q9ULT0	TTC7A_HUMAN	tetratricopeptide repeat domain 7A	817	TPR 9.						binding			breast(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)			AGGCGTGGCAGGGCCTGGGCG	0.662													45	60	---	---	---	---	PASS
AFTPH	54812	broad.mit.edu	37	2	64779427	64779427	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:64779427G>T	uc002sdc.2	+	1	851	c.819G>T	c.(817-819)CTG>CTT	p.L273L	AFTPH_uc002scz.2_Silent_p.L273L|AFTPH_uc002sda.2_Silent_p.L273L|AFTPH_uc002sdb.2_Silent_p.L273L	NM_203437	NP_982261	Q6ULP2	AFTIN_HUMAN	aftiphilin protein isoform a	273					protein transport	AP-1 adaptor complex|cytosol|nucleus	clathrin binding			ovary(2)	2						TCAATGAACTGAATTCTGTAA	0.348													46	77	---	---	---	---	PASS
SEMA4C	54910	broad.mit.edu	37	2	97526534	97526534	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97526534G>A	uc002sxh.3	-	15	2491	c.2331C>T	c.(2329-2331)CAC>CAT	p.H777H	ANKRD39_uc002sxd.3_5'Flank|SEMA4C_uc002sxf.3_Silent_p.H277H|SEMA4C_uc002sxe.2_Silent_p.H318H|SEMA4C_uc002sxg.3_Silent_p.H830H	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor	777	Cytoplasmic (Potential).				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2						CACCCCCCAGGTGAAGCCGAG	0.677													48	145	---	---	---	---	PASS
SEMA4C	54910	broad.mit.edu	37	2	97526535	97526535	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:97526535T>A	uc002sxh.3	-	15	2490	c.2330A>T	c.(2329-2331)CAC>CTC	p.H777L	ANKRD39_uc002sxd.3_5'Flank|SEMA4C_uc002sxf.3_Missense_Mutation_p.H277L|SEMA4C_uc002sxe.2_Missense_Mutation_p.H318L|SEMA4C_uc002sxg.3_Missense_Mutation_p.H830L	NM_017789	NP_060259	Q9C0C4	SEM4C_HUMAN	semaphorin 4C precursor	777	Cytoplasmic (Potential).				muscle cell differentiation|nervous system development|positive regulation of stress-activated MAPK cascade	cell junction|integral to membrane|postsynaptic density|postsynaptic membrane|synaptic vesicle membrane	receptor activity			skin(2)	2						ACCCCCCAGGTGAAGCCGAGT	0.672													49	137	---	---	---	---	PASS
BUB1	699	broad.mit.edu	37	2	111411055	111411055	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:111411055C>A	uc002tgc.2	-	17	2034	c.1922G>T	c.(1921-1923)TGT>TTT	p.C641F	BUB1_uc010yxh.1_Missense_Mutation_p.C621F|BUB1_uc010fkb.2_Missense_Mutation_p.C641F	NM_004336	NP_004327	O43683	BUB1_HUMAN	budding uninhibited by benzimidazoles 1	641					apoptosis|cell division|chromosome segregation|interspecies interaction between organisms|mitotic cell cycle spindle assembly checkpoint|mitotic prometaphase|regulation of sister chromatid cohesion	condensed chromosome kinetochore|cytosol	ATP binding|protein binding|protein serine/threonine kinase activity			lung(2)|breast(2)|stomach(1)|ovary(1)|kidney(1)	7		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		GTTTTCCTCACAAGAATCCAA	0.383													40	86	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116593753	116593753	+	Silent	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116593753A>T	uc002tla.1	+	22	2428	c.1971A>T	c.(1969-1971)GCA>GCT	p.A657A	DPP10_uc002tlb.1_Silent_p.A607A|DPP10_uc002tlc.1_Silent_p.A653A|DPP10_uc002tle.2_Silent_p.A661A|DPP10_uc002tlf.1_Silent_p.A650A	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	657	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						GCTATATTGCATCAATGATCT	0.269													22	36	---	---	---	---	PASS
RALB	5899	broad.mit.edu	37	2	121043651	121043651	+	Missense_Mutation	SNP	G	A	A	rs139389446		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:121043651G>A	uc002tmk.2	+	3	506	c.316G>A	c.(316-318)GAA>AAA	p.E106K	RALB_uc010yys.1_Missense_Mutation_p.E128K|RALB_uc002tml.2_Missense_Mutation_p.E127K|RALB_uc002tmm.2_RNA|RALB_uc010yyt.1_Intron	NM_002881	NP_002872	P11234	RALB_HUMAN	v-ral simian leukemia viral oncogene homolog B	106					apoptosis|cell cycle|cytokinesis|nerve growth factor receptor signaling pathway|Ras protein signal transduction|regulation of exocyst assembly|regulation of exocyst localization	cytosol|midbody|plasma membrane	GTP binding|GTPase activity|protein binding			lung(3)	3		Prostate(154;0.122)				AGCAACTGCCGAATTCAGGTA	0.443													5	110	---	---	---	---	PASS
LRP1B	53353	broad.mit.edu	37	2	141055406	141055406	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:141055406G>T	uc002tvj.1	-	84	13910	c.12938C>A	c.(12937-12939)CCG>CAG	p.P4313Q		NM_018557	NP_061027	Q9NZR2	LRP1B_HUMAN	low density lipoprotein-related protein 1B	4313	Extracellular (Potential).|EGF-like 12.				protein transport|receptor-mediated endocytosis	integral to membrane	calcium ion binding			lung(17)|skin(12)|ovary(12)|pancreas(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|liver(1)|kidney(1)	50		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		GGTGTATTCCGGCTGGCAGTG	0.448										TSP Lung(27;0.18)			127	315	---	---	---	---	PASS
FIGN	55137	broad.mit.edu	37	2	164467190	164467190	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:164467190G>A	uc002uck.1	-	3	1463	c.1152C>T	c.(1150-1152)TCC>TCT	p.S384S		NM_018086	NP_060556	Q5HY92	FIGN_HUMAN	fidgetin	384						nuclear matrix	ATP binding|nucleoside-triphosphatase activity			large_intestine(2)|ovary(1)|skin(1)	4						GCTGTTCAGAGGACATTAGCT	0.458													41	89	---	---	---	---	PASS
LRP2	4036	broad.mit.edu	37	2	170094609	170094609	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:170094609T>C	uc002ues.2	-	27	4711	c.4498A>G	c.(4498-4500)AGA>GGA	p.R1500G		NM_004525	NP_004516	P98164	LRP2_HUMAN	low density lipoprotein-related protein 2	1500	LDL-receptor class B 10.|Extracellular (Potential).				hormone biosynthetic process|protein glycosylation|receptor-mediated endocytosis|vitamin D metabolic process	coated pit|integral to membrane|lysosome	calcium ion binding|receptor activity|SH3 domain binding			ovary(13)|skin(6)|central_nervous_system(4)|large_intestine(3)|kidney(2)|pancreas(1)	29				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	Gentamicin(DB00798)|Insulin Glargine recombinant(DB00047)|Insulin Lyspro recombinant(DB00046)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)|Urokinase(DB00013)	ACCACTCTTCTGTCCGTTCCA	0.438													32	84	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185801543	185801543	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185801543G>A	uc002uph.2	+	4	2014	c.1420G>A	c.(1420-1422)GAT>AAT	p.D474N		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	474						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						TAATAATCTAGATAAAAATAA	0.343													59	139	---	---	---	---	PASS
ZNF804A	91752	broad.mit.edu	37	2	185803089	185803089	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:185803089C>A	uc002uph.2	+	4	3560	c.2966C>A	c.(2965-2967)ACT>AAT	p.T989N		NM_194250	NP_919226	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	989						intracellular	zinc ion binding			ovary(6)|skin(3)|large_intestine(1)|pancreas(1)	11						GAGACACCAACTGAGTGGCTG	0.413													59	127	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212285214	212285214	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212285214G>A	uc002veg.1	-	25	3185	c.3087C>T	c.(3085-3087)AAC>AAT	p.N1029N	ERBB4_uc002veh.1_Silent_p.N1029N|ERBB4_uc010zji.1_Silent_p.N1019N|ERBB4_uc010zjj.1_Silent_p.N1019N	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	1029	Cytoplasmic (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		GAGGTGGGATGTTGAAAGCCT	0.383										TSP Lung(8;0.080)			19	71	---	---	---	---	PASS
COL4A4	1286	broad.mit.edu	37	2	227876905	227876905	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:227876905C>A	uc010zlt.1	-	44	4979	c.4325G>T	c.(4324-4326)GGA>GTA	p.G1442V		NM_000092	NP_000083	P53420	CO4A4_HUMAN	alpha 4 type IV collagen precursor	1442	Triple-helical region.				axon guidance|glomerular basement membrane development	basal lamina|collagen type IV	extracellular matrix structural constituent|protein binding			ovary(5)|central_nervous_system(3)|pancreas(1)|breast(1)|skin(1)	11		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		ACCTGGTCCTCCAGGGTAGCC	0.542													29	52	---	---	---	---	PASS
CCL20	6364	broad.mit.edu	37	2	228678678	228678678	+	Silent	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:228678678A>C	uc002vpl.2	+	1	121	c.51A>C	c.(49-51)CTA>CTC	p.L17L	CCL20_uc002vpm.2_Silent_p.L17L	NM_004591	NP_004582	P78556	CCL20_HUMAN	chemokine (C-C motif) ligand 20 isoform 1	17					cell-cell signaling|chemotaxis|defense response to bacterium|immune response|inflammatory response|signal transduction	extracellular space	chemokine activity				0		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;7.3e-11)|all cancers(144;4.13e-08)|Lung(261;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0115)		CAGTGCTGCTACTCCACCTCT	0.468													67	158	---	---	---	---	PASS
TRPM8	79054	broad.mit.edu	37	2	234858695	234858695	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:234858695C>A	uc002vvh.2	+	9	1085	c.1045C>A	c.(1045-1047)CTG>ATG	p.L349M	TRPM8_uc010fyj.2_Missense_Mutation_p.L37M	NM_024080	NP_076985	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel,	349	Cytoplasmic (Potential).					integral to membrane				skin(4)	4		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GGAGGATGCCCTGACATCTTC	0.542													22	55	---	---	---	---	PASS
TTC21A	199223	broad.mit.edu	37	3	39169890	39169890	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:39169890C>T	uc003cjc.2	+	13	1789	c.1612C>T	c.(1612-1614)CAT>TAT	p.H538Y	TTC21A_uc003cje.2_Missense_Mutation_p.H539Y|TTC21A_uc003cjd.2_RNA|TTC21A_uc011ayx.1_Missense_Mutation_p.H490Y	NM_145755	NP_665698	Q8NDW8	TT21A_HUMAN	tetratricopeptide repeat domain 21A isoform 2	538							binding			ovary(1)	1				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CGTGGATGCCCATCTCCTCAT	0.552													51	46	---	---	---	---	PASS
EIF4E3	317649	broad.mit.edu	37	3	71745664	71745664	+	Nonsense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71745664C>A	uc003dov.3	-	4	360	c.352G>T	c.(352-354)GAG>TAG	p.E118*	EIF4E3_uc011bgc.1_Nonsense_Mutation_p.E12*|EIF4E3_uc003dox.2_Nonsense_Mutation_p.E12*|EIF4E3_uc011bgd.1_Nonsense_Mutation_p.E12*|EIF4E3_uc010hoc.2_Nonsense_Mutation_p.E12*	NM_001134651	NP_001128123	Q8N5X7	IF4E3_HUMAN	eukaryotic translation initiation factor 4E	118					regulation of translation	cytoplasm|mRNA cap binding complex	translation initiation factor activity				0		Prostate(10;0.0166)		BRCA - Breast invasive adenocarcinoma(55;2.56e-05)|Epithelial(33;2.9e-05)|Lung(16;9.28e-05)|LUSC - Lung squamous cell carcinoma(21;0.00227)		GCATTACTCTCCTCTTCCCTG	0.438													63	48	---	---	---	---	PASS
C3orf38	285237	broad.mit.edu	37	3	88205447	88205447	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:88205447G>T	uc003dqw.2	+	4	963	c.652G>T	c.(652-654)GAT>TAT	p.D218Y		NM_173824	NP_776185	Q5JPI3	CC038_HUMAN	hypothetical protein LOC285237	218					apoptosis						0		Lung NSC(201;0.17)		UCEC - Uterine corpus endometrioid carcinoma (27;0.194)|LUSC - Lung squamous cell carcinoma(29;0.00353)|Lung(72;0.00661)		CCCCAACCTAGATTCACATGG	0.433													79	86	---	---	---	---	PASS
EPHA3	2042	broad.mit.edu	37	3	89480438	89480438	+	Missense_Mutation	SNP	G	T	T	rs146856660		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:89480438G>T	uc003dqy.2	+	13	2500	c.2275G>T	c.(2275-2277)GTG>TTG	p.V759L	EPHA3_uc010hon.1_RNA	NM_005233	NP_005224	P29320	EPHA3_HUMAN	ephrin receptor EphA3 isoform a precursor	759	Cytoplasmic (Potential).|Protein kinase.					extracellular region|integral to plasma membrane	ATP binding			lung(17)|ovary(7)|large_intestine(4)|central_nervous_system(2)|stomach(1)|skin(1)|pancreas(1)	33	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAGTAACTTGGTGTGTAAGGT	0.458										TSP Lung(6;0.00050)			26	30	---	---	---	---	PASS
EPHA6	285220	broad.mit.edu	37	3	96706702	96706702	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:96706702C>T	uc010how.1	+	3	1022	c.979C>T	c.(979-981)CGG>TGG	p.R327W	EPHA6_uc003drp.1_Missense_Mutation_p.R327W	NM_001080448	NP_001073917	Q9UF33	EPHA6_HUMAN	EPH receptor A6 isoform a	232	Extracellular (Potential).					integral to plasma membrane	ATP binding|ephrin receptor activity			stomach(5)|lung(4)|central_nervous_system(3)|breast(1)|skin(1)|ovary(1)|kidney(1)	16						GGTTGAAGTACGGGGTTCTTG	0.478													89	528	---	---	---	---	PASS
IMPG2	50939	broad.mit.edu	37	3	100961722	100961722	+	Silent	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:100961722C>A	uc003duq.1	-	14	3035	c.2832G>T	c.(2830-2832)ACG>ACT	p.T944T	IMPG2_uc011bhe.1_Silent_p.T807T	NM_016247	NP_057331	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	944	Extracellular (Potential).|SEA 2.				visual perception	integral to membrane|proteinaceous extracellular matrix	extracellular matrix structural constituent|heparin binding|hyaluronic acid binding|receptor activity			ovary(2)|haematopoietic_and_lymphoid_tissue(1)	3						TCTGGAACCCCGTGAGATTTG	0.408													163	114	---	---	---	---	PASS
ABHD10	55347	broad.mit.edu	37	3	111705116	111705116	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111705116A>T	uc003dyk.3	+	3	413	c.332A>T	c.(331-333)GAT>GTT	p.D111V	ABHD10_uc011bhq.1_5'UTR	NM_018394	NP_060864	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10 precursor	111						mitochondrion	serine-type peptidase activity				0						TCCAGGTTTGATTACTCAGGA	0.343													70	73	---	---	---	---	PASS
SLC9A10	285335	broad.mit.edu	37	3	111983116	111983116	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:111983116G>A	uc003dyu.2	-	9	1175	c.953C>T	c.(952-954)ACA>ATA	p.T318I	SLC9A10_uc011bhu.1_Intron|SLC9A10_uc010hqc.2_Intron	NM_183061	NP_898884	Q4G0N8	S9A10_HUMAN	sperm-specific sodium proton exchanger	318	Helical; (Potential).				cell differentiation|multicellular organismal development|sodium ion transport|spermatogenesis	cilium|flagellar membrane|integral to membrane	solute:hydrogen antiporter activity			ovary(3)|breast(2)	5						ATACAAATATGTATGTGCAGG	0.249													6	44	---	---	---	---	PASS
FBXO40	51725	broad.mit.edu	37	3	121340300	121340300	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:121340300G>T	uc003eeg.2	+	3	234	c.24G>T	c.(22-24)CCG>CCT	p.P8P		NM_016298	NP_057382	Q9UH90	FBX40_HUMAN	F-box protein 40	8					muscle cell differentiation	centrosome|nucleus	ubiquitin-protein ligase activity|zinc ion binding			ovary(2)|lung(1)|breast(1)|central_nervous_system(1)	5				GBM - Glioblastoma multiforme(114;0.189)		GCAGATCCCCGCCAGGGCACC	0.532													138	240	---	---	---	---	PASS
NCK1	4690	broad.mit.edu	37	3	136665037	136665037	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:136665037A>G	uc003erh.2	+	3	946	c.839A>G	c.(838-840)AAT>AGT	p.N280S	NCK1_uc011bme.1_Missense_Mutation_p.N216S	NM_006153	NP_006144	P16333	NCK1_HUMAN	NCK adaptor protein 1	280					axon guidance|positive regulation of actin filament polymerization|positive regulation of T cell proliferation|regulation of translation|signal complex assembly|T cell activation|T cell receptor signaling pathway	cytosol|endoplasmic reticulum|nucleus	cytoskeletal adaptor activity|receptor binding|receptor signaling complex scaffold activity			pancreas(1)	1						TTTGCTGGCAATCCTTGGTAT	0.423													109	522	---	---	---	---	PASS
WWTR1	25937	broad.mit.edu	37	3	149374963	149374963	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374963C>A	uc003exe.2	-	1	147	c.131G>T	c.(130-132)CGG>CTG	p.R44L	WWTR1_uc003exf.2_Missense_Mutation_p.R44L|WWTR1_uc011bns.1_Missense_Mutation_p.R44L|WWTR1_uc003exh.2_Missense_Mutation_p.R44L|uc010hvg.1_RNA|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1	44					hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			GATCTTCTTCCGCCACGAGCT	0.627													11	35	---	---	---	---	PASS
OTOL1	131149	broad.mit.edu	37	3	161221714	161221714	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:161221714C>A	uc011bpb.1	+	4	1418	c.1418C>A	c.(1417-1419)TCT>TAT	p.S473Y		NM_001080440	NP_001073909	A6NHN0	OTOL1_HUMAN	otolin-1 precursor	473	C1q.					collagen					0						GAGGAAACTTCTGGAATTTCA	0.388													22	73	---	---	---	---	PASS
KCNMB3	27094	broad.mit.edu	37	3	178968856	178968856	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:178968856A>C	uc003fjm.2	-	1	548	c.36T>G	c.(34-36)CAT>CAG	p.H12Q	KCNMB3_uc003fjl.3_Intron|KCNMB3_uc011bqc.1_Intron|KCNMB3_uc003fjn.2_5'UTR|KCNMB3_uc003fjo.2_Intron|KCNMB3_uc003fjp.1_Intron	NM_014407	NP_055222	Q9NPA1	KCMB3_HUMAN	calcium-activated potassium channel beta 3	12	Cytoplasmic (Potential).				detection of calcium ion|platelet activation|regulation of action potential in neuron	voltage-gated potassium channel complex	calcium-activated potassium channel activity|potassium channel regulator activity				0	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)			ATGCAACAAAATGAAATCCCA	0.398													41	302	---	---	---	---	PASS
LAMP3	27074	broad.mit.edu	37	3	182871775	182871775	+	Missense_Mutation	SNP	C	T	T	rs150380664	byFrequency	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:182871775C>T	uc003flh.3	-	2	678	c.454G>A	c.(454-456)GTC>ATC	p.V152I		NM_014398	NP_055213	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3	152	Lumenal (Potential).|Thr-rich.				cell proliferation	integral to membrane|lysosomal membrane				ovary(2)|central_nervous_system(1)	3	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GTGTGGCTGACGGTTGATGAA	0.522													54	664	---	---	---	---	PASS
ATP13A5	344905	broad.mit.edu	37	3	193029676	193029676	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:193029676A>G	uc011bsq.1	-	20	2374	c.2374T>C	c.(2374-2376)TGT>CGT	p.C792R		NM_198505	NP_940907	Q4VNC0	AT135_HUMAN	ATPase type 13A5	792					ATP biosynthetic process|cation transport	integral to membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|metal ion binding			ovary(5)|skin(4)|large_intestine(2)	11	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AAATGGTAACAGCTTCCTCCT	0.393													30	301	---	---	---	---	PASS
KIAA0226	9711	broad.mit.edu	37	3	197409490	197409490	+	Intron	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197409490C>G	uc003fyc.2	-						KIAA0226_uc003fyd.3_Intron|KIAA0226_uc003fye.1_Intron	NM_014687	NP_055502	Q92622	RUBIC_HUMAN	hypothetical protein LOC9711 isoform 2.						autophagy|endocytosis|negative regulation of autophagy|negative regulation of endocytosis	early endosome|late endosome|lysosome	protein binding				0	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		GCAGGAGCTGCAGGAGGAAAG	0.567													74	51	---	---	---	---	PASS
IQCG	84223	broad.mit.edu	37	3	197665624	197665624	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:197665624T>G	uc003fyo.2	-	4	456	c.310A>C	c.(310-312)ACG>CCG	p.T104P	IQCG_uc003fyn.2_Missense_Mutation_p.T6P|IQCG_uc003fyp.2_Missense_Mutation_p.T104P|IQCG_uc003fyq.3_Missense_Mutation_p.T104P	NM_001134435	NP_001127907	Q9H095	IQCG_HUMAN	IQ motif containing G	104											0	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TCTAGATTCGTTCCTTCTAGA	0.358													46	842	---	---	---	---	PASS
KIAA1530	57654	broad.mit.edu	37	4	1379710	1379710	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:1379710C>T	uc003gde.3	+	14	2538	c.2091C>T	c.(2089-2091)CAC>CAT	p.H697H	KIAA1530_uc010ibv.2_Silent_p.H248H	NM_020894	NP_065945	Q2YD98	K1530_HUMAN	hypothetical protein LOC57654	697											0			OV - Ovarian serous cystadenocarcinoma(23;0.0138)			AGAAGAAGCACGAGAAGTTTT	0.572													30	47	---	---	---	---	PASS
NOP14	8602	broad.mit.edu	37	4	2944035	2944035	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:2944035C>T	uc003ggj.1	-	14	2007	c.1935G>A	c.(1933-1935)TCG>TCA	p.S645S	C4orf10_uc003gge.1_Intron|C4orf10_uc003ggh.2_Intron|C4orf10_uc003ggi.1_Intron|NOP14_uc010icp.2_Silent_p.S391S|NOP14_uc003ggk.3_Silent_p.S645S|NOP14_uc003ggl.2_Silent_p.S645S	NM_003703	NP_003694	P78316	NOP14_HUMAN	probable nucleolar complex protein 14	645					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA)	mitochondrion|Noc4p-Nop14p complex|small-subunit processome	snoRNA binding			pancreas(1)	1						CGAGCAGTTCCGAGTTCTTCC	0.592													29	44	---	---	---	---	PASS
EVC2	132884	broad.mit.edu	37	4	5578063	5578063	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:5578063T>C	uc003gij.2	-	18	3230	c.3176A>G	c.(3175-3177)AAC>AGC	p.N1059S	EVC2_uc011bwb.1_Missense_Mutation_p.N499S|EVC2_uc003gik.2_Missense_Mutation_p.N979S	NM_147127	NP_667338	Q86UK5	LBN_HUMAN	limbin	1059	Potential.					integral to membrane				large_intestine(3)|ovary(2)	5						CCCAGGTTCGTTCAGAATCCC	0.612													40	41	---	---	---	---	PASS
RHOH	399	broad.mit.edu	37	4	40245100	40245100	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:40245100G>A	uc003guz.2	+	3	818	c.94G>A	c.(94-96)GCC>ACC	p.A32T		NM_004310	NP_004301	Q15669	RHOH_HUMAN	ras homolog gene family, member H precursor	32					negative regulation of I-kappaB kinase/NF-kappaB cascade|regulation of small GTPase mediated signal transduction|regulation of transcription, DNA-dependent|small GTPase mediated signal transduction|T cell differentiation	cytosol|mitochondrion|plasma membrane	GTP binding|GTPase inhibitor activity|kinase inhibitor activity|Rho GTPase binding			ovary(1)|lung(1)	2						CTTCCCGGAGGCCTACAAGCC	0.587													32	73	---	---	---	---	PASS
ATP10D	57205	broad.mit.edu	37	4	47556863	47556863	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47556863G>A	uc003gxk.1	+	11	1920	c.1756G>A	c.(1756-1758)GAC>AAC	p.D586N	ATP10D_uc003gxl.1_Intron	NM_020453	NP_065186	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	586	Cytoplasmic (Potential).				ATP biosynthetic process|cation transport	integral to membrane|plasma membrane	ATP binding|ATPase activity, coupled to transmembrane movement of ions, phosphorylative mechanism|magnesium ion binding|phospholipid-translocating ATPase activity			ovary(2)|pancreas(1)	3						GTACATTATCGACTTTTTCAT	0.413													48	147	---	---	---	---	PASS
FAT4	79633	broad.mit.edu	37	4	126238160	126238160	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:126238160G>T	uc003ifj.3	+	1	594	c.594G>T	c.(592-594)GCG>GCT	p.A198A		NM_024582	NP_078858	Q6V0I7	FAT4_HUMAN	FAT tumor suppressor homolog 4 precursor	198	Cadherin 2.|Extracellular (Potential).				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding			ovary(9)|skin(5)|upper_aerodigestive_tract(2)|pancreas(2)	18						GCGAGGGAGCGTTCCTGCATC	0.652											OREG0016317	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	11	39	---	---	---	---	PASS
SLC10A7	84068	broad.mit.edu	37	4	147442805	147442805	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:147442805C>A	uc010ioz.2	-	1	319	c.65G>T	c.(64-66)GGA>GTA	p.G22V	SLC10A7_uc003ikr.2_Missense_Mutation_p.G22V|SLC10A7_uc010ipa.2_Missense_Mutation_p.G22V|SLC10A7_uc003iks.2_RNA|SLC10A7_uc003ikt.2_Missense_Mutation_p.G22V|SLC10A7_uc003iku.3_RNA	NM_001029998	NP_001025169	Q0GE19	NTCP7_HUMAN	solute carrier family 10 (sodium/bile acid	22	Helical; (Potential).					integral to membrane	bile acid:sodium symporter activity				0	all_hematologic(180;0.151)					CAGTTTAGCTCCAGCGATCGC	0.522													70	163	---	---	---	---	PASS
RXFP1	59350	broad.mit.edu	37	4	159493927	159493927	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:159493927C>A	uc003ipz.2	+	2	209	c.127C>A	c.(127-129)CAG>AAG	p.Q43K	RXFP1_uc010iqj.1_5'UTR|RXFP1_uc011cja.1_5'UTR|RXFP1_uc010iqo.2_Missense_Mutation_p.Q43K|RXFP1_uc011cjb.1_5'UTR|RXFP1_uc010iqk.2_5'UTR|RXFP1_uc011cjc.1_5'UTR|RXFP1_uc011cjd.1_5'UTR|RXFP1_uc010iql.2_5'UTR|RXFP1_uc011cje.1_Missense_Mutation_p.Q43K|RXFP1_uc010iqm.2_Missense_Mutation_p.Q43K|RXFP1_uc011cjf.1_5'UTR|RXFP1_uc010iqn.2_Intron	NM_021634	NP_067647	Q9HBX9	RXFP1_HUMAN	relaxin/insulin-like family peptide receptor 1	43	Extracellular (Potential).|LDL-receptor class A.					integral to membrane|plasma membrane	G-protein coupled receptor activity|metal ion binding				0	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0219)		GTGCTTGCCTCAGCTCCTGCA	0.552													69	150	---	---	---	---	PASS
FSTL5	56884	broad.mit.edu	37	4	162577607	162577607	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:162577607C>A	uc003iqh.2	-	7	1203	c.767G>T	c.(766-768)AGC>ATC	p.S256I	FSTL5_uc003iqi.2_Missense_Mutation_p.S255I|FSTL5_uc010iqv.2_Missense_Mutation_p.S255I	NM_020116	NP_064501	Q8N475	FSTL5_HUMAN	follistatin-like 5 isoform a	256	Ig-like 1.					extracellular region	calcium ion binding			ovary(2)|pancreas(2)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TGCAGTGATGCTTAGTTTCTG	0.403													27	64	---	---	---	---	PASS
GPM6A	2823	broad.mit.edu	37	4	176594881	176594881	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:176594881G>T	uc003iuf.2	-	3	1141	c.337C>A	c.(337-339)CTC>ATC	p.L113I	GPM6A_uc011ckj.1_Missense_Mutation_p.L106I|GPM6A_uc003iug.2_Missense_Mutation_p.L113I|GPM6A_uc003iuh.2_Missense_Mutation_p.L102I	NM_201591	NP_963885	P51674	GPM6A_HUMAN	glycoprotein M6A isoform 2	113	Cytoplasmic (Potential).					cell surface|integral to membrane					0		Breast(14;7.35e-05)|Melanoma(52;0.00909)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;9.21e-19)|Epithelial(43;3.01e-17)|OV - Ovarian serous cystadenocarcinoma(60;2.02e-09)|STAD - Stomach adenocarcinoma(60;0.00083)|GBM - Glioblastoma multiforme(59;0.00168)|LUSC - Lung squamous cell carcinoma(193;0.0388)		TCCCCATAGAGATCTTTGATG	0.423													26	74	---	---	---	---	PASS
ODZ3	55714	broad.mit.edu	37	4	183664378	183664378	+	Silent	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:183664378C>A	uc003ivd.1	+	18	3472	c.3435C>A	c.(3433-3435)GTC>GTA	p.V1145V	ODZ3_uc003ive.1_Silent_p.V551V	NM_001080477	NP_001073946	Q9P273	TEN3_HUMAN	odz, odd Oz/ten-m homolog 3	1145	Extracellular (Potential).				signal transduction	integral to membrane					0		all_lung(41;2.69e-14)|Lung NSC(41;1.92e-11)|Melanoma(52;1.74e-05)|Colorectal(36;0.0062)|Breast(14;0.00748)|all_hematologic(60;0.0162)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_neural(102;0.155)|Medulloblastoma(177;0.184)		all cancers(43;1.42e-24)|Epithelial(43;6.86e-23)|OV - Ovarian serous cystadenocarcinoma(60;2.16e-11)|Colorectal(24;9.75e-06)|STAD - Stomach adenocarcinoma(60;2.96e-05)|COAD - Colon adenocarcinoma(29;0.00103)|GBM - Glioblastoma multiforme(59;0.00462)|LUSC - Lung squamous cell carcinoma(40;0.0391)|READ - Rectum adenocarcinoma(43;0.0487)		AGCCTCCAGTCGTGAGTAGCA	0.483													20	61	---	---	---	---	PASS
TERT	7015	broad.mit.edu	37	5	1278882	1278882	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:1278882G>T	uc003jcb.1	-	6	2218	c.2160C>A	c.(2158-2160)ATC>ATA	p.I720I	TERT_uc003jbz.1_5'UTR|TERT_uc003jca.1_Intron|TERT_uc003jcc.1_Silent_p.I720I|TERT_uc003jcd.1_Intron|TERT_uc003jce.1_RNA	NM_198253	NP_937983	O14746	TERT_HUMAN	telomerase reverse transcriptase isoform 1	720	Reverse transcriptase.				anti-apoptosis|DNA strand elongation|replicative senescence|telomere formation via telomerase|telomere maintenance via telomerase	cytoplasm|nucleolus|PML body|telomerase holoenzyme complex	protein homodimerization activity|telomeric DNA binding|telomeric RNA binding|telomeric template RNA reverse transcriptase activity			lung(7)|ovary(2)|central_nervous_system(2)|skin(1)	12	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			TGTCCTGGGGGATGGTGTCGT	0.627									TERT_Mutation-Associated_Haematological_Disorders|Congenital_Dyskeratosis|Pulmonary_Fibrosis_Idiopathic				99	309	---	---	---	---	PASS
FBXL7	23194	broad.mit.edu	37	5	15937167	15937167	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:15937167G>A	uc003jfn.1	+	4	1829	c.1348G>A	c.(1348-1350)GCC>ACC	p.A450T		NM_012304	NP_036436	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	450	LRR 11.				ubiquitin-dependent protein catabolic process	ubiquitin ligase complex	protein binding|ubiquitin-protein ligase activity			ovary(2)|lung(1)	3						GCAGATCGTGGCCGCCAACTG	0.627													32	47	---	---	---	---	PASS
CCDC152	100129792	broad.mit.edu	37	5	42801222	42801222	+	3'UTR	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:42801222T>C	uc003jmx.3	+	9					CCDC152_uc011cpr.1_3'UTR|SEPP1_uc011cps.1_RNA|SEPP1_uc011cpt.1_RNA|SEPP1_uc011cpu.1_RNA|SEPP1_uc011cpv.1_RNA|SEPP1_uc003jna.2_RNA	NM_001134848	NP_001128320	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152												0						CTGACCCTTGTGCTTATGGTG	0.488													59	59	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50680535	50680535	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50680535G>A	uc003jor.2	+	2	737	c.189G>A	c.(187-189)GGG>GGA	p.G63G	uc003joq.1_5'Flank	NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	63	LIM zinc-binding 1.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				TTAGGGATGGGAAAACCTACT	0.398													71	239	---	---	---	---	PASS
ISL1	3670	broad.mit.edu	37	5	50683365	50683365	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:50683365G>C	uc003jor.2	+	3	808	c.260G>C	c.(259-261)AGC>ACC	p.S87T		NM_002202	NP_002193	P61371	ISL1_HUMAN	islet-1	87	LIM zinc-binding 2.				generation of precursor metabolites and energy|multicellular organismal development	nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding			central_nervous_system(2)|ovary(1)	3		Lung NSC(810;0.000845)|Breast(144;0.0411)				ATCGGCTTCAGCAAGAACGAC	0.612													9	33	---	---	---	---	PASS
CLINT1	9685	broad.mit.edu	37	5	157218922	157218922	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:157218922C>T	uc003lxj.1	-	10	1359	c.1169G>A	c.(1168-1170)GGC>GAC	p.G390D	CLINT1_uc003lxg.1_5'Flank|CLINT1_uc003lxh.1_5'UTR|CLINT1_uc003lxi.1_Missense_Mutation_p.G372D|CLINT1_uc011ddv.1_Missense_Mutation_p.G390D	NM_014666	NP_055481	Q14677	EPN4_HUMAN	epsin 4	390					endocytosis|post-Golgi vesicle-mediated transport	clathrin-coated vesicle|cytosol|Golgi apparatus|membrane|perinuclear region of cytoplasm	clathrin binding|lipid binding			ovary(2)|pancreas(1)	3	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.138)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAAGAACTCGCCACTGGAAGC	0.517													29	32	---	---	---	---	PASS
HMMR	3161	broad.mit.edu	37	5	162917423	162917423	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:162917423G>T	uc003lzf.2	+	17	2169	c.1987G>T	c.(1987-1989)GCT>TCT	p.A663S	HMMR_uc003lzh.2_Missense_Mutation_p.A664S|HMMR_uc003lzg.2_Missense_Mutation_p.A648S|HMMR_uc011dem.1_Missense_Mutation_p.A577S|uc003lzi.2_Intron	NM_012484	NP_036616	O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor isoform b	663	Hyaluronic acid-binding (Potential).					cell surface|cytoplasm	hyaluronic acid binding				0	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)		CTGTCAGCTTGCTAAAAAAAA	0.313													36	43	---	---	---	---	PASS
HIVEP1	3096	broad.mit.edu	37	6	12161866	12161866	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:12161866A>T	uc003nac.2	+	8	6861	c.6682A>T	c.(6682-6684)ACT>TCT	p.T2228S	HIVEP1_uc011diq.1_RNA	NM_002114	NP_002105	P15822	ZEP1_HUMAN	human immunodeficiency virus type I enhancer	2228					transcription, DNA-dependent	cytoplasm|nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|large_intestine(1)|central_nervous_system(1)|skin(1)	6	Breast(50;0.0639)|Ovarian(93;0.0816)	all_hematologic(90;0.117)				CCCTGTGAGTACTGACGAGGA	0.567													17	64	---	---	---	---	PASS
HIST1H1C	3006	broad.mit.edu	37	6	26056216	26056216	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:26056216C>T	uc003nfw.2	-	1	484	c.441G>A	c.(439-441)CCG>CCA	p.P147P		NM_005319	NP_005310	P16403	H12_HUMAN	histone cluster 1, H1c	147					nucleosome assembly	nucleosome|nucleus	DNA binding			ovary(3)|skin(2)	5						CGCTCTTCTTCGGAGTTGCGC	0.572													52	125	---	---	---	---	PASS
ZNF165	7718	broad.mit.edu	37	6	28054094	28054094	+	Intron	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28054094G>T	uc003nkg.2	+						ZNF165_uc003nkh.2_Intron|ZNF165_uc003nki.3_Intron	NM_003447	NP_003438	P49910	ZN165_HUMAN	zinc finger protein 165						viral reproduction	nucleus	DNA binding|protein binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0						CTGTGGTGAGGGGCAGAATGC	0.473													43	104	---	---	---	---	PASS
NKAPL	222698	broad.mit.edu	37	6	28227222	28227222	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:28227222G>T	uc003nkt.2	+	1	125	c.73G>T	c.(73-75)GGG>TGG	p.G25W	ZKSCAN4_uc011dlb.1_5'Flank	NM_001007531	NP_001007532	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	25										upper_aerodigestive_tract(1)|ovary(1)	2						CAGCTCCTCGGGGAGCCCACC	0.662													35	65	---	---	---	---	PASS
GABBR1	2550	broad.mit.edu	37	6	29595348	29595348	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:29595348G>C	uc003nmt.3	-	6	908	c.572C>G	c.(571-573)GCG>GGG	p.A191G	GABBR1_uc003nmp.3_Missense_Mutation_p.A74G|GABBR1_uc003nms.3_Missense_Mutation_p.A74G|GABBR1_uc003nmu.3_Missense_Mutation_p.A129G|GABBR1_uc011dlr.1_Missense_Mutation_p.A14G|GABBR1_uc011dls.1_Missense_Mutation_p.A191G	NM_001470	NP_001461	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor 1	191	Extracellular (Potential).				gamma-aminobutyric acid signaling pathway|negative regulation of adenylate cyclase activity|synaptic transmission	cell junction|extracellular region|integral to plasma membrane|postsynaptic membrane	G-protein coupled receptor activity|GABA-B receptor activity			ovary(5)|liver(1)|skin(1)	7					Baclofen(DB00181)|Progabide(DB00837)	CATCTCCACCGCGGGCTGGCA	0.672													6	13	---	---	---	---	PASS
HLA-DMB	3109	broad.mit.edu	37	6	32905205	32905205	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:32905205G>T	uc003ocl.1	-	3	599	c.366C>A	c.(364-366)ACC>ACA	p.T122T	HLA-DMB_uc003ocj.1_3'UTR|HLA-DMB_uc003ock.1_5'Flank|HLA-DMB_uc010jud.1_5'UTR|HLA-DMB_uc010jue.1_5'UTR|HLA-DMB_uc010juf.1_5'UTR|HLA-DMB_uc011dql.1_Silent_p.T122T	NM_002118	NP_002109	P28068	DMB_HUMAN	major histocompatibility complex, class II, DM	122	Lumenal (Potential).|Ig-like C1-type.|Beta-2.				antigen processing and presentation of peptide or polysaccharide antigen via MHC class II|interferon-gamma-mediated signaling pathway|T cell costimulation|T cell receptor signaling pathway	integral to membrane|late endosome membrane|lysosomal membrane|MHC class II protein complex					0						TAAAAGGAGTGGTTTTGGCTA	0.507													57	135	---	---	---	---	PASS
LHFPL5	222662	broad.mit.edu	37	6	35782540	35782540	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:35782540C>A	uc003olg.1	+	2	1007	c.630C>A	c.(628-630)GAC>GAA	p.D210E		NM_182548	NP_872354	Q8TAF8	TMHS_HUMAN	lipoma HMGIC fusion partner-like 5	210						integral to membrane				skin(1)	1						TCCCTGACGACTACAAGGCAG	0.597													18	27	---	---	---	---	PASS
CRISP3	10321	broad.mit.edu	37	6	49696509	49696509	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:49696509G>A	uc003ozs.2	-	8	687	c.672C>T	c.(670-672)ACC>ACT	p.T224T		NM_006061	NP_006052	P54108	CRIS3_HUMAN	cysteine-rich secretory protein 3 precursor	224					innate immune response	proteinaceous extracellular matrix|specific granule				skin(2)	2	Lung NSC(77;0.0161)		KIRC - Kidney renal clear cell carcinoma(2;0.106)|Kidney(12;0.156)			GATGTTTACAGGTTAATGTGA	0.378													34	176	---	---	---	---	PASS
IMPG1	3617	broad.mit.edu	37	6	76734920	76734920	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:76734920T>A	uc003pik.1	-	5	683	c.553A>T	c.(553-555)ATT>TTT	p.I185F		NM_001563	NP_001554	Q17R60	IMPG1_HUMAN	interphotoreceptor matrix proteoglycan 1	185					visual perception	proteinaceous extracellular matrix	extracellular matrix structural constituent|receptor activity			ovary(2)|skin(1)	3		Acute lymphoblastic leukemia(125;0.0418)|all_hematologic(105;0.222)				CCTGTTGAAATGACAATGGTT	0.323													48	107	---	---	---	---	PASS
PHIP	55023	broad.mit.edu	37	6	79700705	79700705	+	Intron	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:79700705G>A	uc003pir.2	-						PHIP_uc011dyp.1_Intron	NM_017934	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein						insulin receptor signaling pathway|negative regulation of apoptosis|positive regulation of cell proliferation|positive regulation of insulin-like growth factor receptor signaling pathway|positive regulation of mitosis	nucleus	insulin receptor binding			large_intestine(2)|central_nervous_system(2)|upper_aerodigestive_tract(1)|ovary(1)	6		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CTTGCCTACTGAAAGACAAAA	0.353													51	116	---	---	---	---	PASS
CYB5R4	51167	broad.mit.edu	37	6	84650271	84650271	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84650271G>T	uc003pkf.2	+	14	1429	c.1297G>T	c.(1297-1299)GAT>TAT	p.D433Y		NM_016230	NP_057314	Q7L1T6	NB5R4_HUMAN	cytochrome b5 reductase 4	433					cell development|detection of oxygen|generation of precursor metabolites and energy|glucose homeostasis|insulin secretion|response to antibiotic|superoxide metabolic process	endoplasmic reticulum|perinuclear region of cytoplasm	cytochrome-b5 reductase activity|heme binding|NAD(P)H oxidase activity			breast(2)	2		all_cancers(76;7e-07)|Acute lymphoblastic leukemia(125;2.69e-07)|all_hematologic(105;0.000151)|all_epithelial(107;0.00128)		BRCA - Breast invasive adenocarcinoma(397;0.0871)		AACAGAAGATGATATAATTTG	0.274													22	73	---	---	---	---	PASS
POU3F2	5454	broad.mit.edu	37	6	99282745	99282745	+	5'UTR	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:99282745G>C	uc003ppe.2	+	1						NM_005604	NP_005595	P20265	PO3F2_HUMAN	POU domain, class 3, transcription factor 2						positive regulation of cell proliferation		identical protein binding|sequence-specific DNA binding transcription factor activity				0		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0355)		CCGGCTCCGAGAGTCATGGCG	0.652													13	22	---	---	---	---	PASS
SLC35F1	222553	broad.mit.edu	37	6	118596691	118596691	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:118596691G>T	uc003pxx.3	+	5	908	c.707G>T	c.(706-708)TGG>TTG	p.W236L	SLC35F1_uc003pxy.1_Missense_Mutation_p.W41L	NM_001029858	NP_001025029	Q5T1Q4	S35F1_HUMAN	solute carrier family 35, member F1	236	Helical; (Potential).				transport	integral to membrane				breast(1)	1				GBM - Glioblastoma multiforme(226;0.217)		TCTAACGTCTGGGAAGAATAC	0.438													26	102	---	---	---	---	PASS
MYB	4602	broad.mit.edu	37	6	135511481	135511481	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:135511481G>A	uc003qfc.2	+	5	722	c.523G>A	c.(523-525)GGA>AGA	p.G175R	MYB_uc003qfh.2_Missense_Mutation_p.G175R|MYB_uc003qfi.2_Missense_Mutation_p.G175R|MYB_uc010kgi.2_Missense_Mutation_p.G175R|MYB_uc003qfq.2_Missense_Mutation_p.G175R|MYB_uc010kgj.2_Missense_Mutation_p.G175R|MYB_uc003qfo.2_Missense_Mutation_p.G175R|MYB_uc003qfu.2_Missense_Mutation_p.G175R|MYB_uc003qfl.2_RNA|MYB_uc003qfv.2_RNA|MYB_uc003qfz.2_RNA|MYB_uc003qfx.2_RNA|MYB_uc003qga.2_RNA|MYB_uc003qgb.2_RNA|MYB_uc010kgk.2_RNA|MYB_uc003qfd.2_RNA|MYB_uc003qfe.2_RNA|MYB_uc003qfg.2_RNA|MYB_uc003qff.2_RNA|MYB_uc003qfj.2_RNA|MYB_uc003qfm.2_RNA|MYB_uc003qfp.2_RNA|MYB_uc003qfn.2_RNA|MYB_uc003qfk.2_RNA|MYB_uc003qfr.2_RNA|MYB_uc003qfs.2_Intron|MYB_uc003qft.2_RNA|MYB_uc003qfw.2_Intron|MYB_uc003qfy.2_RNA|MYB_uc003qgc.2_RNA|MYB_uc003qfb.1_Missense_Mutation_p.G175R|MYB_uc003qgd.1_5'UTR	NM_005375	NP_005366	P10242	MYB_HUMAN	v-myb myeloblastosis viral oncogene homolog	175	H-T-H motif (By similarity).|HTH myb-type 3.|Interaction with HIPK2 and NLK (By similarity).				blood coagulation|chromatin remodeling|negative regulation of transcription from RNA polymerase II promoter|positive regulation of histone H3-K4 methylation|positive regulation of histone H3-K9 methylation|positive regulation of T-helper cell differentiation|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	nuclear matrix	DNA binding|protein binding			lung(1)	1	all_epithelial(2;0.109)|Breast(56;0.158)|Colorectal(23;0.221)	Lung NSC(302;3.08e-05)|Ovarian(999;0.208)		OV - Ovarian serous cystadenocarcinoma(155;0.0079)|GBM - Glioblastoma multiforme(68;0.0117)		GCTACTGCCTGGACGGTAATA	0.388			T	NFIB	adenoid cystic carcinoma								11	38	---	---	---	---	PASS
MTHFD1L	25902	broad.mit.edu	37	6	151293098	151293098	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151293098G>C	uc003qob.2	+	20	2297	c.2029G>C	c.(2029-2031)GTG>CTG	p.V677L	MTHFD1L_uc011een.1_RNA|MTHFD1L_uc011eeo.1_Missense_Mutation_p.V678L|MTHFD1L_uc003qoc.2_Missense_Mutation_p.V625L	NM_015440	NP_056255	Q6UB35	C1TM_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+	677	Formyltetrahydrofolate synthetase.				folic acid-containing compound biosynthetic process|formate metabolic process|one-carbon metabolic process|tetrahydrofolate metabolic process	mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|protein homodimerization activity			ovary(3)|large_intestine(1)	4		Ovarian(120;0.128)		OV - Ovarian serous cystadenocarcinoma(155;8.7e-12)		ACCTGTGTTCGTGCATGCGGG	0.448													65	144	---	---	---	---	PASS
C6orf97	80129	broad.mit.edu	37	6	151917692	151917692	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:151917692G>A	uc003qol.2	+	9	1779	c.1690G>A	c.(1690-1692)GCC>ACC	p.A564T		NM_025059	NP_079335	Q8IYT3	CF097_HUMAN	hypothetical protein LOC80129	564	Potential.										0		Ovarian(120;0.126)	BRCA - Breast invasive adenocarcinoma(37;0.111)	OV - Ovarian serous cystadenocarcinoma(155;1.48e-10)		AGCCAAACTGGCCGACACCAA	0.468													36	65	---	---	---	---	PASS
T	6862	broad.mit.edu	37	6	166572066	166572066	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:166572066T>A	uc003quu.1	-	9	1538	c.1045A>T	c.(1045-1047)AGC>TGC	p.S349C	T_uc003qut.1_Missense_Mutation_p.S350C|T_uc003quv.1_Missense_Mutation_p.S291C	NM_003181	NP_003172	O15178	BRAC_HUMAN	transcription factor T	349					anterior/posterior axis specification, embryo|mesoderm development|primitive streak formation	nucleus	sequence-specific DNA binding transcription factor activity			ovary(1)|pancreas(1)	2		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		GACCACAGGCTGGGGTACTGA	0.652									Chordoma_Familial_Clustering_of				5	13	---	---	---	---	PASS
FAM120B	84498	broad.mit.edu	37	6	170628197	170628197	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:170628197C>G	uc003qxp.2	+	2	1827	c.1719C>G	c.(1717-1719)GAC>GAG	p.D573E	FAM120B_uc003qxo.1_Missense_Mutation_p.D573E|FAM120B_uc011ehd.1_Intron	NM_032448	NP_115824	Q96EK7	F120B_HUMAN	family with sequence similarity 120B	573					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	protein binding			ovary(1)	1		Breast(66;0.000338)|Esophageal squamous(34;0.241)		OV - Ovarian serous cystadenocarcinoma(33;3.94e-22)|BRCA - Breast invasive adenocarcinoma(81;6.47e-06)|GBM - Glioblastoma multiforme(31;0.0899)		TGGTTTCAGACACTGAAATCT	0.403													34	72	---	---	---	---	PASS
FAM20C	56975	broad.mit.edu	37	7	208896	208896	+	Splice_Site	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:208896A>C	uc003sip.2	+	3	1016	c.785_splice	c.e3-2	p.A262_splice		NM_020223	NP_064608	Q8IXL6	DMP4_HUMAN	family with sequence similarity 20, member C							extracellular region					0		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.57e-17)|Epithelial(4;1.26e-16)|all cancers(6;4.79e-14)		TCCTTCCTGCAGCCATGAAGT	0.597													3	5	---	---	---	---	PASS
MICALL2	79778	broad.mit.edu	37	7	1477944	1477944	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:1477944G>A	uc003skj.3	-	11	2315	c.2168C>T	c.(2167-2169)ACG>ATG	p.T723M	MICALL2_uc003skh.3_Translation_Start_Site|MICALL2_uc003ski.3_Missense_Mutation_p.T210M	NM_182924	NP_891554	Q8IY33	MILK2_HUMAN	MICAL-like 2 isoform 1	723						cytoplasm|cytoskeleton	zinc ion binding			central_nervous_system(1)	1		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGAGGTCACCGTCTCGCCAGG	0.697													3	21	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21627673	21627673	+	Intron	SNP	T	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21627673T>G	uc003svc.2	+							NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11						microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TTCACTTTGATTTTTATAGCT	0.328									Kartagener_syndrome				5	86	---	---	---	---	PASS
HOXA4	3201	broad.mit.edu	37	7	27170284	27170284	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:27170284G>T	uc003sym.3	-	1	116	c.69C>A	c.(67-69)TAC>TAA	p.Y23*		NM_002141	NP_002132	Q00056	HXA4_HUMAN	homeobox A4	23	Pro-rich (part of the transcriptional activation domain).					nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)	1						TGTGCTGCGCGTACTCCTCGA	0.488													6	17	---	---	---	---	PASS
NEUROD6	63974	broad.mit.edu	37	7	31378243	31378243	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:31378243G>C	uc003tch.2	-	2	993	c.640C>G	c.(640-642)CCT>GCT	p.P214A		NM_022728	NP_073565	Q96NK8	NDF6_HUMAN	neurogenic differentiation 6	214					cell differentiation|regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding			ovary(2)	2						GTGAGCTCAGGGCTGTGGTAG	0.527													51	136	---	---	---	---	PASS
SUN3	256979	broad.mit.edu	37	7	48028393	48028393	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:48028393C>G	uc003tof.2	-	10	1043	c.946G>C	c.(946-948)GAA>CAA	p.E316Q	SUN3_uc010kyq.2_Missense_Mutation_p.E228Q|SUN3_uc003tog.2_Missense_Mutation_p.E316Q|SUN3_uc011kcf.1_Missense_Mutation_p.E304Q	NM_152782	NP_689995	Q8TAQ9	SUN3_HUMAN	Sad1 and UNC84 domain containing 1	316	SUN.					integral to membrane				central_nervous_system(1)	1						ACCTGGAGTTCAAATGTTTGA	0.358													14	106	---	---	---	---	PASS
MAGI2	9863	broad.mit.edu	37	7	77789561	77789561	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:77789561G>A	uc003ugx.2	-	16	2880	c.2626C>T	c.(2626-2628)CCA>TCA	p.P876S	MAGI2_uc003ugy.2_Missense_Mutation_p.P862S|MAGI2_uc010ldx.1_Missense_Mutation_p.P469S	NM_012301	NP_036433	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ	876						cell junction|synapse|synaptosome	phosphatase binding			ovary(5)|lung(4)|breast(1)|skin(1)	11		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				ACAGAGCCTGGACTTCTCCCG	0.493													40	76	---	---	---	---	PASS
NRCAM	4897	broad.mit.edu	37	7	107824674	107824674	+	Intron	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107824674T>C	uc003vfb.2	-						NRCAM_uc003vfc.2_Intron|NRCAM_uc011kmk.1_Intron|NRCAM_uc003vfd.2_Intron|NRCAM_uc003vfe.2_Intron	NM_001037132	NP_001032209	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule isoform A						angiogenesis|axon guidance|axonal fasciculation|cell-cell adhesion|central nervous system development|clustering of voltage-gated sodium channels|neuron migration|positive regulation of neuron differentiation|regulation of axon extension|synapse assembly	external side of plasma membrane|integral to plasma membrane	ankyrin binding			ovary(3)|breast(2)	5						TTTGAAGGCATCATAGCTCAC	0.368													40	103	---	---	---	---	PASS
ZC3HAV1	56829	broad.mit.edu	37	7	138764222	138764222	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:138764222C>G	uc003vun.2	-	4	1853	c.1465G>C	c.(1465-1467)GTT>CTT	p.V489L	ZC3HAV1_uc003vuo.2_5'Flank|ZC3HAV1_uc003vup.2_Missense_Mutation_p.V489L	NM_020119	NP_064504	Q7Z2W4	ZCCHV_HUMAN	zinc finger antiviral protein isoform 1	489					response to virus	cytoplasm|nucleus	NAD+ ADP-ribosyltransferase activity|RNA binding|zinc ion binding			ovary(1)	1						TTACCGTTAACAAGTGCTACT	0.438													24	95	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	7	142162145	142162145	+	Intron	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142162145G>T	uc011kro.1	+						uc011krp.1_Intron|uc011krr.1_Intron|uc011krx.1_RNA|uc011krw.1_Missense_Mutation_p.Q44K					SubName: Full=V_segment translation product; Flags: Fragment;																		TTCATATCCTGGGCACACTGC	0.478													84	167	---	---	---	---	PASS
TRPV5	56302	broad.mit.edu	37	7	142612065	142612065	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142612065T>C	uc003wby.1	-	11	1702	c.1438A>G	c.(1438-1440)ATC>GTC	p.I480V		NM_019841	NP_062815	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel,	480	Cytoplasmic (Potential).				protein tetramerization	apical plasma membrane|integral to plasma membrane	calcium channel activity			ovary(3)|central_nervous_system(2)|skin(1)	6	Melanoma(164;0.059)					TGGATCATGATGGTGAAGGGA	0.552													27	91	---	---	---	---	PASS
NOS3	4846	broad.mit.edu	37	7	150697679	150697679	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150697679A>G	uc003wif.2	+	10	1521	c.1225A>G	c.(1225-1227)AGT>GGT	p.S409G	NOS3_uc011kuy.1_Missense_Mutation_p.S203G|NOS3_uc011kuz.1_Missense_Mutation_p.S409G|NOS3_uc011kva.1_Missense_Mutation_p.S409G|NOS3_uc011kvb.1_Missense_Mutation_p.S409G	NM_000603	NP_000594	P29474	NOS3_HUMAN	nitric oxide synthase 3 isoform 1	409	Interaction with NOSIP.				anti-apoptosis|arginine catabolic process|blood vessel remodeling|endothelial cell migration|mitochondrion organization|negative regulation of muscle hyperplasia|negative regulation of platelet activation|nitric oxide biosynthetic process|platelet activation|positive regulation of angiogenesis|positive regulation of guanylate cyclase activity|positive regulation of vasodilation|regulation of blood vessel size|regulation of nitric-oxide synthase activity|regulation of systemic arterial blood pressure by endothelin|response to fluid shear stress|response to heat|smooth muscle hyperplasia	caveola|cytoskeleton|cytosol|Golgi membrane	actin monomer binding|arginine binding|cadmium ion binding|calmodulin binding|flavin adenine dinucleotide binding|FMN binding|heme binding|NADP binding|nitric-oxide synthase activity|tetrahydrobiopterin binding			central_nervous_system(5)|large_intestine(2)|skin(1)	8	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	L-Arginine(DB00125)|L-Citrulline(DB00155)|Rosuvastatin(DB01098)|Tetrahydrobiopterin(DB00360)	CGTGCTGCACAGTTACCAGGT	0.607													17	32	---	---	---	---	PASS
ACCN3	9311	broad.mit.edu	37	7	150746188	150746188	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:150746188C>A	uc003win.2	+	1	584	c.216C>A	c.(214-216)CAC>CAA	p.H72Q	ACCN3_uc003wio.2_Missense_Mutation_p.H72Q|ACCN3_uc003wip.2_Missense_Mutation_p.H72Q|ACCN3_uc003wiq.2_RNA	NM_004769	NP_004760	Q9UHC3	ACCN3_HUMAN	amiloride-sensitive cation channel 3 isoform a	72	Extracellular (Potential).				sensory perception|signal transduction	cytoplasm|integral to plasma membrane	ligand-gated sodium channel activity			ovary(1)|central_nervous_system(1)	2			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGTTCCACCACCAGACTGCCC	0.657													38	100	---	---	---	---	PASS
MLL3	58508	broad.mit.edu	37	7	151893021	151893021	+	Missense_Mutation	SNP	T	C	C	rs146504747	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:151893021T>C	uc003wla.2	-	28	4568	c.4349A>G	c.(4348-4350)GAT>GGT	p.D1450G	MLL3_uc003wkz.2_Missense_Mutation_p.D511G	NM_170606	NP_733751	Q8NEZ4	MLL3_HUMAN	myeloid/lymphoid or mixed-lineage leukemia 3	1450					intracellular signal transduction|regulation of transcription, DNA-dependent|transcription, DNA-dependent		DNA binding|protein binding|zinc ion binding			large_intestine(27)|pancreas(13)|ovary(9)|central_nervous_system(8)|breast(3)|upper_aerodigestive_tract(1)|urinary_tract(1)|skin(1)	63	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.0906)	OV - Ovarian serous cystadenocarcinoma(82;0.00715)	UCEC - Uterine corpus endometrioid carcinoma (81;0.0597)|BRCA - Breast invasive adenocarcinoma(188;0.0462)		TGCTAGATCATCTGAAATTAT	0.333			N		medulloblastoma								22	51	---	---	---	---	PASS
HMBOX1	79618	broad.mit.edu	37	8	28827926	28827926	+	Silent	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:28827926A>G	uc003xhd.3	+	3	732	c.390A>G	c.(388-390)GGA>GGG	p.G130G	HMBOX1_uc010lvd.2_Silent_p.G130G|HMBOX1_uc003xhc.3_Silent_p.G130G|HMBOX1_uc010lve.2_RNA|HMBOX1_uc003xhe.2_Silent_p.G130G|HMBOX1_uc011lay.1_Silent_p.G130G|HMBOX1_uc003xhf.2_Silent_p.G118G|HMBOX1_uc003xhg.2_Silent_p.G118G	NM_001135726	NP_001129198	Q6NT76	HMBX1_HUMAN	homeobox containing 1	130					negative regulation of transcription, DNA-dependent|positive regulation of transcription, DNA-dependent	cytoplasm|nucleus	sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		Ovarian(32;0.0192)		KIRC - Kidney renal clear cell carcinoma(542;0.135)|Kidney(114;0.161)		CATCCAATGGAAAGATGTCAC	0.453													41	87	---	---	---	---	PASS
ADAM2	2515	broad.mit.edu	37	8	39606952	39606952	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:39606952C>T	uc003xnj.2	-	18	1968	c.1893G>A	c.(1891-1893)AAG>AAA	p.K631K	ADAM2_uc003xnk.2_Silent_p.K612K|ADAM2_uc011lck.1_Silent_p.K568K|ADAM2_uc003xnl.2_Silent_p.K475K	NM_001464	NP_001455	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2 proprotein	631	Extracellular (Potential).|EGF-like.				cell adhesion|fusion of sperm to egg plasma membrane|proteolysis	integral to plasma membrane	integrin binding|metalloendopeptidase activity|zinc ion binding			ovary(1)|lung(1)	2		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		AGTGACAGTGCTTTTTGTTAT	0.348													81	171	---	---	---	---	PASS
RP1	6101	broad.mit.edu	37	8	55537767	55537767	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:55537767C>A	uc003xsd.1	+	4	1473	c.1325C>A	c.(1324-1326)GCA>GAA	p.A442E	RP1_uc011ldy.1_Intron	NM_006269	NP_006260	P56715	RP1_HUMAN	retinitis pigmentosa RP1 protein	442					axoneme assembly|intracellular signal transduction|photoreceptor cell maintenance|photoreceptor cell outer segment organization|phototransduction, visible light|retinal cone cell development|retinal rod cell development	cilium axoneme|cytoplasm|microtubule|microtubule associated complex|photoreceptor connecting cilium|photoreceptor inner segment|photoreceptor outer segment	microtubule binding			skin(7)|ovary(4)|pancreas(1)	12		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CAAGACCAAGCAAAGCATCGT	0.433													34	77	---	---	---	---	PASS
ADHFE1	137872	broad.mit.edu	37	8	67357485	67357485	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67357485G>T	uc003xwb.3	+	6	420	c.386G>T	c.(385-387)GGA>GTA	p.G129V	ADHFE1_uc003xwd.3_RNA|ADHFE1_uc003xwc.3_Missense_Mutation_p.G81V|ADHFE1_uc003xwe.3_RNA|ADHFE1_uc003xwf.3_Intron|ADHFE1_uc011les.1_Missense_Mutation_p.G59V|ADHFE1_uc011leq.1_Intron|ADHFE1_uc011ler.1_Intron	NM_144650	NP_653251	Q8IWW8	HOT_HUMAN	alcohol dehydrogenase, iron containing, 1	129					2-oxoglutarate metabolic process|molecular hydrogen transport	mitochondrial matrix	hydroxyacid-oxoacid transhydrogenase activity|metal ion binding			ovary(1)|lung(1)|breast(1)|skin(1)	4		Lung NSC(129;0.197)	Epithelial(68;0.0321)|all cancers(69;0.0751)|BRCA - Breast invasive adenocarcinoma(89;0.0855)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GCCCAAAAGGGAGCTTTTGAT	0.408													55	120	---	---	---	---	PASS
CSMD3	114788	broad.mit.edu	37	8	113657367	113657367	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:113657367G>T	uc003ynu.2	-	20	3440	c.3281C>A	c.(3280-3282)ACA>AAA	p.T1094K	CSMD3_uc003yns.2_Missense_Mutation_p.T366K|CSMD3_uc003ynt.2_Missense_Mutation_p.T1054K|CSMD3_uc011lhx.1_Missense_Mutation_p.T990K	NM_198123	NP_937756	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3 isoform 1	1094	Extracellular (Potential).|CUB 6.					integral to membrane|plasma membrane				ovary(21)|lung(11)|skin(11)|kidney(8)|large_intestine(6)|upper_aerodigestive_tract(2)|central_nervous_system(2)|urinary_tract(1)|breast(1)	63						AACAGTCCATGTACAATTCAG	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)			19	73	---	---	---	---	PASS
BAI1	575	broad.mit.edu	37	8	143559650	143559650	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:143559650C>A	uc003ywm.2	+	6	1673	c.1490C>A	c.(1489-1491)CCT>CAT	p.P497H		NM_001702	NP_001693	O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	497	Extracellular (Potential).|TSP type-1 4.				axonogenesis|cell adhesion|negative regulation of angiogenesis|negative regulation of cell proliferation|neuropeptide signaling pathway|peripheral nervous system development	cell-cell junction|integral to plasma membrane	G-protein coupled receptor activity|protein binding			lung(3)|ovary(2)|breast(1)|central_nervous_system(1)|pancreas(1)	8	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					TGCAACGGGCCTTCCTACGGG	0.692													5	26	---	---	---	---	PASS
DMRT1	1761	broad.mit.edu	37	9	916890	916890	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:916890C>T	uc003zgv.2	+	4	1099	c.950C>T	c.(949-951)CCG>CTG	p.P317L		NM_021951	NP_068770	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor	317					cell differentiation|male gonad development|sex determination	nucleus	DNA binding|metal ion binding|sequence-specific DNA binding transcription factor activity			ovary(1)	1		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		CCCTCTTACCCGGAAGCCAGG	0.547													38	39	---	---	---	---	PASS
C9orf79	286234	broad.mit.edu	37	9	90500146	90500146	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:90500146G>A	uc004app.3	+	4	779	c.744G>A	c.(742-744)CCG>CCA	p.P248P	C9orf79_uc004apo.1_Silent_p.P60P	NM_178828	NP_849150	Q6ZUB1	CI079_HUMAN	chromosome 9 open reading frame 79	248	Pro-rich.					integral to membrane				ovary(3)	3						CACCACAGCCGCATGGTCCCC	0.627													32	183	---	---	---	---	PASS
RNF20	56254	broad.mit.edu	37	9	104316311	104316311	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:104316311A>T	uc004bbn.2	+	14	2033	c.1943A>T	c.(1942-1944)GAT>GTT	p.D648V		NM_019592	NP_062538	Q5VTR2	BRE1A_HUMAN	ring finger protein 20	648	Potential.				histone H2B ubiquitination|histone monoubiquitination|negative regulation of cell migration|positive regulation of transcription, DNA-dependent|protein polyubiquitination|ubiquitin-dependent protein catabolic process	nucleolus|ubiquitin ligase complex	histone binding|p53 binding|transcription coactivator activity|ubiquitin protein ligase binding|ubiquitin-protein ligase activity|zinc ion binding			ovary(4)|lung(1)|breast(1)|kidney(1)|skin(1)	8		all_hematologic(171;8.99e-06)|Acute lymphoblastic leukemia(62;0.000365)|Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;2.88e-19)|STAD - Stomach adenocarcinoma(157;0.00311)		CTATTGCTGGATATGTACCGT	0.448													66	76	---	---	---	---	PASS
CDH23	64072	broad.mit.edu	37	10	73491830	73491830	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:73491830G>A	uc001jrx.3	+	31	4179	c.3802G>A	c.(3802-3804)GTG>ATG	p.V1268M	CDH23_uc001jrz.2_Missense_Mutation_p.V884M|C10orf105_uc001jsb.1_Intron|CDH23_uc001jsc.1_Missense_Mutation_p.V76M	NM_022124	NP_071407	Q9H251	CAD23_HUMAN	cadherin-like 23 isoform 1 precursor	1268	Cadherin 12.|Extracellular (Potential).				calcium ion transport|calcium-dependent cell-cell adhesion|cytosolic calcium ion homeostasis|equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|response to stimulus|sensory perception of sound	cytosol|integral to membrane|plasma membrane|stereocilium	calcium ion binding|protein binding			central_nervous_system(5)|large_intestine(4)|ovary(2)	11						TATCATCACCGTGAATTACCT	0.567													4	59	---	---	---	---	PASS
GRID1	2894	broad.mit.edu	37	10	87615775	87615775	+	Intron	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:87615775C>T	uc001kdl.1	-						GRID1_uc009xsu.1_Intron	NM_017551	NP_060021	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1							cell junction|integral to membrane|outer membrane-bounded periplasmic space|postsynaptic membrane	extracellular-glutamate-gated ion channel activity|ionotropic glutamate receptor activity			ovary(5)|upper_aerodigestive_tract(2)|large_intestine(2)|central_nervous_system(1)	10					L-Glutamic Acid(DB00142)	GGGGTGCCCCCTCACACGTAC	0.557										Multiple Myeloma(13;0.14)			49	109	---	---	---	---	PASS
FGFR2	2263	broad.mit.edu	37	10	123279562	123279562	+	Missense_Mutation	SNP	C	G	G	rs121918499		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:123279562C>G	uc010qtk.1	-	7	1517	c.870G>C	c.(868-870)TGG>TGC	p.W290C	FGFR2_uc010qtg.1_Intron|FGFR2_uc010qth.1_Missense_Mutation_p.W175C|FGFR2_uc010qti.1_Missense_Mutation_p.W201C|FGFR2_uc010qtj.1_Missense_Mutation_p.W290C|FGFR2_uc010qtl.1_Missense_Mutation_p.W290C|FGFR2_uc010qtm.1_Missense_Mutation_p.W175C|FGFR2_uc001lfl.3_Missense_Mutation_p.W290C|FGFR2_uc001lfm.2_Missense_Mutation_p.W201C|FGFR2_uc001lfn.3_RNA|FGFR2_uc010qtn.1_Missense_Mutation_p.W309C|FGFR2_uc010qto.1_Missense_Mutation_p.W194C|FGFR2_uc001lfo.1_Missense_Mutation_p.W309C|FGFR2_uc010qtp.1_Missense_Mutation_p.W309C|FGFR2_uc001lfg.3_5'Flank	NM_000141	NP_000132	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2 isoform 1	290	Ig-like C2-type 3.|Extracellular (Potential).		W -> R (in CS).|W -> C (in PS; severe; also in a lung squamous cell carcinoma sample; somatic mutation).|W -> G (in CS).		angiogenesis|axonogenesis|bone mineralization|bone morphogenesis|branch elongation involved in salivary gland morphogenesis|branching involved in embryonic placenta morphogenesis|branching morphogenesis of a nerve|bud elongation involved in lung branching|cell fate commitment|cell growth|cell-cell signaling|cellular response to protein stimulus|embryonic digestive tract morphogenesis|embryonic pattern specification|epithelial cell proliferation involved in salivary gland morphogenesis|fibroblast growth factor receptor signaling pathway involved in hemopoiesis|fibroblast growth factor receptor signaling pathway involved in mammary gland specification|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptosis in bone marrow|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow|hair follicle morphogenesis|insulin receptor signaling pathway|lacrimal gland development|lateral sprouting from an epithelium|limb bud formation|lung alveolus development|lung lobe morphogenesis|lung-associated mesenchyme development|mammary gland bud formation|membranous septum morphogenesis|mesenchymal cell differentiation involved in lung development|mesenchymal cell proliferation involved in lung development|midbrain development|multicellular organism growth|negative regulation of transcription from RNA polymerase II promoter|odontogenesis|organ growth|otic vesicle formation|outflow tract septum morphogenesis|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cardiac muscle cell proliferation|positive regulation of cell cycle|positive regulation of cell division|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of ERK1 and ERK2 cascade|positive regulation of mesenchymal cell proliferation|positive regulation of transcription from RNA polymerase II promoter|post-embryonic development|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis|prostate epithelial cord elongation|pyramidal neuron development|regulation of branching involved in prostate gland morphogenesis|regulation of cell fate commitment|regulation of fibroblast growth factor receptor signaling pathway|regulation of multicellular organism growth|regulation of smooth muscle cell differentiation|regulation of smoothened signaling pathway|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development|ureteric bud development|ventricular cardiac muscle tissue morphogenesis|ventricular zone neuroblast division	cell cortex|cell surface|excitatory synapse|extracellular region|integral to membrane|nucleus|plasma membrane	ATP binding|fibroblast growth factor binding|fibroblast growth factor binding|fibroblast growth factor receptor activity|heparin binding|protein binding	p.W290C(2)		endometrium(44)|skin(28)|lung(11)|ovary(4)|cervix(2)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|central_nervous_system(1)	96		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)	CGTGCTTGATCCACTGGATGT	0.552		5	Mis		gastric. NSCLC|endometrial		Crouzon|Pfeiffer|and Apert syndromes		Apert_syndrome|Saethre-Chotzen_syndrome				30	48	---	---	---	---	PASS
PAOX	196743	broad.mit.edu	37	10	135204850	135204850	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:135204850G>A	uc001lmv.2	+	7	1507	c.1427G>A	c.(1426-1428)CGC>CAC	p.R476H	PAOX_uc001lmw.2_RNA|PAOX_uc001lmx.2_Silent_p.S423S|PAOX_uc001lmy.2_3'UTR|PAOX_uc001lmz.2_RNA|PAOX_uc001lna.2_RNA|PAOX_uc001lnb.2_RNA|PAOX_uc001lnc.2_RNA|MTG1_uc001lnd.2_5'Flank	NM_152911	NP_690875	Q6QHF9	PAOX_HUMAN	polyamine oxidase isoform 1	614					polyamine biosynthetic process|xenobiotic metabolic process	peroxisomal matrix	polyamine oxidase activity				0		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		GCCACACATCGCACGTTTTAC	0.622													68	85	---	---	---	---	PASS
MUC6	4588	broad.mit.edu	37	11	1026120	1026120	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:1026120C>T	uc001lsw.2	-	21	2619	c.2568G>A	c.(2566-2568)TGG>TGA	p.W856*		NM_005961	NP_005952	Q6W4X9	MUC6_HUMAN	mucin 6, gastric	856					maintenance of gastrointestinal epithelium	extracellular region	extracellular matrix structural constituent			ovary(1)	1		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGACAGGCCCACCTCCCCC	0.662													3	10	---	---	---	---	PASS
AMBRA1	55626	broad.mit.edu	37	11	46419148	46419148	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:46419148G>T	uc010rgu.1	-	18	4109	c.3749C>A	c.(3748-3750)TCT>TAT	p.S1250Y	AMBRA1_uc010rgt.1_3'UTR|AMBRA1_uc009ylc.1_Missense_Mutation_p.S1221Y|AMBRA1_uc001ncu.1_Missense_Mutation_p.S1160Y|AMBRA1_uc001ncv.2_Missense_Mutation_p.S1253Y|AMBRA1_uc001ncw.2_Missense_Mutation_p.S1131Y|AMBRA1_uc001ncx.2_Missense_Mutation_p.S1190Y	NM_017749	NP_060219	Q9C0C7	AMRA1_HUMAN	activating molecule in beclin-1-regulated	1250					autophagy|cell differentiation|nervous system development	autophagic vacuole|cytoplasmic vesicle				large_intestine(1)|ovary(1)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(35;0.0435)|Lung(87;0.182)		AGGGGAGGAAGAGGGCAGGGT	0.647													21	54	---	---	---	---	PASS
OR5T2	219464	broad.mit.edu	37	11	56000488	56000488	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56000488G>A	uc010rjc.1	-	1	174	c.174C>T	c.(172-174)GAC>GAT	p.D58D		NM_001004746	NP_001004746	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T,	58	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					GTTCAAGATTGTCTGTGAAGC	0.358													12	93	---	---	---	---	PASS
TNKS1BP1	85456	broad.mit.edu	37	11	57087823	57087823	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:57087823G>A	uc001njr.2	-	2	770	c.458C>T	c.(457-459)TCA>TTA	p.S153L	TNKS1BP1_uc001njs.2_Missense_Mutation_p.S153L|TNKS1BP1_uc009ymd.1_5'UTR	NM_033396	NP_203754	Q9C0C2	TB182_HUMAN	tankyrase 1-binding protein 1	153	Pro-rich.				nuclear-transcribed mRNA poly(A) tail shortening|telomere maintenance via telomerase	cytoskeleton|cytosol|nuclear telomeric heterochromatin	ankyrin binding|enzyme binding			skin(1)	1		all_epithelial(135;0.21)				GAAGCGCTCTGAGGCTGGGCG	0.682													52	119	---	---	---	---	PASS
AHNAK	79026	broad.mit.edu	37	11	62287531	62287531	+	Silent	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:62287531G>C	uc001ntl.2	-	5	14658	c.14358C>G	c.(14356-14358)CCC>CCG	p.P4786P	AHNAK_uc001ntk.1_Intron	NM_001620	NP_001611	Q09666	AHNK_HUMAN	AHNAK nucleoprotein isoform 1	4786					nervous system development	nucleus	protein binding			ovary(10)|pancreas(4)|skin(4)|upper_aerodigestive_tract(1)	19		Melanoma(852;0.155)				TGCTGAATTTGGGCATTTTCA	0.537													111	336	---	---	---	---	PASS
SNX32	254122	broad.mit.edu	37	11	65620388	65620388	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:65620388A>C	uc001ofr.2	+	12	1244	c.1117A>C	c.(1117-1119)AAT>CAT	p.N373H		NM_152760	NP_689973	Q86XE0	SNX32_HUMAN	sorting nexin 6B	373					cell communication|protein transport		phosphatidylinositol binding				0				READ - Rectum adenocarcinoma(159;0.171)		TTTTCGAAAGAATCTCATTGA	0.622													63	129	---	---	---	---	PASS
CWF19L2	143884	broad.mit.edu	37	11	107288983	107288983	+	Silent	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:107288983C>A	uc010rvp.1	-	9	1494	c.1464G>T	c.(1462-1464)CTG>CTT	p.L488L	CWF19L2_uc001pjh.3_RNA|CWF19L2_uc009yxo.2_RNA	NM_152434	NP_689647	Q2TBE0	C19L2_HUMAN	CWF19-like 2, cell cycle control	488							catalytic activity				0		Melanoma(852;1.75e-05)|all_epithelial(67;6.27e-05)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0258)		Epithelial(105;7.18e-06)|BRCA - Breast invasive adenocarcinoma(274;1.65e-05)|all cancers(92;1.76e-05)		CATCAACACTCAGGATGTGAA	0.388													45	111	---	---	---	---	PASS
BCL9L	283149	broad.mit.edu	37	11	118772546	118772546	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:118772546C>T	uc001pug.2	-	6	2871	c.1906G>A	c.(1906-1908)GGC>AGC	p.G636S	BCL9L_uc009zal.2_Missense_Mutation_p.G631S	NM_182557	NP_872363	Q86UU0	BCL9L_HUMAN	B-cell CLL/lymphoma 9-like	636					negative regulation of transforming growth factor beta receptor signaling pathway|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent		transcription coactivator activity			ovary(1)|pancreas(1)	2	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.103)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.66e-05)		CAGCCCATGCCTGGTCTCACG	0.607													25	46	---	---	---	---	PASS
CCND2	894	broad.mit.edu	37	12	4385368	4385368	+	Silent	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:4385368C>A	uc001qmo.2	+	2	698	c.393C>A	c.(391-393)ATC>ATA	p.I131I		NM_001759	NP_001750	P30279	CCND2_HUMAN	cyclin D2	131	Cyclin N-terminal.				cell division|positive regulation of cyclin-dependent protein kinase activity|positive regulation of protein phosphorylation	cyclin-dependent protein kinase holoenzyme complex|cytoplasm|membrane|nucleus	protein kinase binding	p.I131M(1)		haematopoietic_and_lymphoid_tissue(1)|breast(1)|kidney(1)	3			all cancers(3;4.15e-10)|GBM - Glioblastoma multiforme(3;6.34e-05)|Colorectal(7;0.00245)|OV - Ovarian serous cystadenocarcinoma(31;0.00301)|COAD - Colon adenocarcinoma(12;0.0264)|STAD - Stomach adenocarcinoma(119;0.206)			ACAACTCCATCAAGCCTCAGG	0.567			T	IGL@	NHL,CLL								3	38	---	---	---	---	PASS
IFFO1	25900	broad.mit.edu	37	12	6658975	6658975	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:6658975G>A	uc001qpd.1	-	4	1052	c.1018C>T	c.(1018-1020)CTC>TTC	p.L340F	IFFO1_uc001qoy.2_RNA|IFFO1_uc001qpa.1_5'Flank|IFFO1_uc001qpb.1_Missense_Mutation_p.L17F|IFFO1_uc001qpe.1_RNA|IFFO1_uc010sfe.1_Missense_Mutation_p.L340F|IFFO1_uc001qpf.1_Missense_Mutation_p.L340F|IFFO1_uc001qoz.1_5'Flank|IFFO1_uc001qpc.1_Missense_Mutation_p.L340F|IFFO1_uc001qpg.2_5'Flank	NM_080730	NP_542768	Q0D2I5	IFFO1_HUMAN	intermediate filament family orphan isoform 2	340						intermediate filament					0						ACATCGCAGAGCTTGGCGGTG	0.607													20	35	---	---	---	---	PASS
PRB1	5542	broad.mit.edu	37	12	11507478	11507478	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:11507478C>T	uc001qzw.1	-	2	112	c.75G>A	c.(73-75)CAG>CAA	p.Q25Q	PRB1_uc001qzu.1_Silent_p.Q25Q|PRB1_uc001qzv.1_Silent_p.Q25Q	NM_005039	NP_005030	P04280	PRP1_HUMAN	proline-rich protein BstNI subfamily 1 isoform 1	25				NLNEDVSQEESPSLIA -> SCVGFYSVFLFSLCPL (in Ref. 4; AAA36502).		extracellular region					0			OV - Ovarian serous cystadenocarcinoma(49;0.185)			GAGATTCTTCCTGGCTGACAT	0.428													62	137	---	---	---	---	PASS
GRIN2B	2904	broad.mit.edu	37	12	13716347	13716347	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:13716347G>A	uc001rbt.2	-	13	4004	c.3825C>T	c.(3823-3825)AAC>AAT	p.N1275N		NM_000834	NP_000825	Q13224	NMDE2_HUMAN	N-methyl-D-aspartate receptor subunit 2B	1275	Cytoplasmic (Potential).				response to ethanol	cell junction|N-methyl-D-aspartate selective glutamate receptor complex|outer membrane-bounded periplasmic space|postsynaptic membrane	glycine binding|N-methyl-D-aspartate selective glutamate receptor activity|zinc ion binding			central_nervous_system(4)|ovary(3)|skin(3)|lung(2)	12					Felbamate(DB00949)|Haloperidol(DB00502)|L-Glutamic Acid(DB00142)|Loperamide(DB00836)|Memantine(DB01043)	TGGTGGAGGCGTTTGACGTCA	0.582													23	80	---	---	---	---	PASS
LRRK2	120892	broad.mit.edu	37	12	40699752	40699752	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:40699752G>A	uc001rmg.3	+	28	4064	c.3943G>A	c.(3943-3945)GCC>ACC	p.A1315T	LRRK2_uc009zjw.2_Missense_Mutation_p.A153T|LRRK2_uc001rmi.2_Missense_Mutation_p.A148T	NM_198578	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	1315					activation of MAPKK activity|determination of adult lifespan|exploration behavior|intracellular distribution of mitochondria|negative regulation of branching morphogenesis of a nerve|negative regulation of dendritic spine morphogenesis|negative regulation of neuroblast proliferation|negative regulation of neuron maturation|neuromuscular junction development|neuron death|peptidyl-serine phosphorylation|positive regulation of autophagy|positive regulation of dopamine receptor signaling pathway|positive regulation of programmed cell death|positive regulation of proteasomal ubiquitin-dependent protein catabolic process|positive regulation of protein phosphorylation|positive regulation of protein ubiquitination|protein autophosphorylation|regulation of kidney size|regulation of locomotion|regulation of membrane potential|response to oxidative stress|small GTPase mediated signal transduction|tangential migration from the subventricular zone to the olfactory bulb	external side of mitochondrial outer membrane	ATP binding|GTP binding|GTP-dependent protein kinase activity|GTPase activator activity|MAP kinase kinase activity|protein homodimerization activity|tubulin binding			ovary(12)|stomach(5)|upper_aerodigestive_tract(2)|lung(2)|large_intestine(1)|urinary_tract(1)|pancreas(1)	24	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGGATGTAAAGCCAAAGACAT	0.294													26	71	---	---	---	---	PASS
KRT81	3887	broad.mit.edu	37	12	52681782	52681782	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:52681782A>G	uc001sab.2	-	5	936	c.886T>C	c.(886-888)TGG>CGG	p.W296R	KRT86_uc010snq.1_Intron|KRT86_uc009zmg.2_Intron|KRT81_uc001sac.2_Intron	NM_002281	NP_002272	Q14533	KRT81_HUMAN	keratin, hair, basic, 1	296	Rod.|Coil 2.					keratin filament	protein binding|structural molecule activity				0				BRCA - Breast invasive adenocarcinoma(357;0.189)		CTGCGGTACCAGGACTCGGCC	0.557													25	83	---	---	---	---	PASS
AMHR2	269	broad.mit.edu	37	12	53824031	53824031	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53824031C>G	uc001scx.1	+	10	1468	c.1390C>G	c.(1390-1392)CCC>GCC	p.P464A	AMHR2_uc009zmy.1_Silent_p.V462V	NM_020547	NP_065434	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II isoform	464	Cytoplasmic (Potential).|Protein kinase.				Mullerian duct regression		ATP binding|hormone binding|metal ion binding			ovary(1)|skin(1)	2					Adenosine triphosphate(DB00171)	GAGGAGGCGTCCCTACATCCC	0.602									Persistant_Mullerian_Duct_Syndrome_(type_I_and_II)				88	204	---	---	---	---	PASS
RBMS2	5939	broad.mit.edu	37	12	56982752	56982752	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:56982752G>A	uc001sln.2	+	13	1379	c.1180G>A	c.(1180-1182)GCA>ACA	p.A394T	RBMS2_uc010sqp.1_Missense_Mutation_p.A249T|RBMS2_uc010sqq.1_Missense_Mutation_p.A269T|RBMS2_uc009zou.2_Missense_Mutation_p.R149H	NM_002898	NP_002889	Q15434	RBMS2_HUMAN	RNA binding motif, single stranded interacting	394					RNA processing	nucleus	nucleotide binding|RNA binding				0						GGCAGTGGACGCACCCTCAGA	0.577													10	179	---	---	---	---	PASS
MAP1LC3B2	643246	broad.mit.edu	37	12	117014012	117014012	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:117014012G>T	uc009zwk.1	+	2	419	c.265G>T	c.(265-267)GTC>TTC	p.V89F		NM_001085481	NP_001078950	A6NCE7	MP3B2_HUMAN	microtubule-associated protein 1 light chain 3	89					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule					0						ACACAGCATGGTCAGCGTCTC	0.483													49	126	---	---	---	---	PASS
TMEM132D	121256	broad.mit.edu	37	12	129569169	129569169	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:129569169A>G	uc009zyl.1	-	6	1850	c.1522T>C	c.(1522-1524)TAC>CAC	p.Y508H	TMEM132D_uc001uia.2_Missense_Mutation_p.Y46H	NM_133448	NP_597705	Q14C87	T132D_HUMAN	transmembrane protein 132D precursor	508	Extracellular (Potential).					integral to membrane				ovary(10)|pancreas(2)|upper_aerodigestive_tract(1)|skin(1)	14	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGTGCTGGTAGGTGAAGTTC	0.537													14	70	---	---	---	---	PASS
PUS1	80324	broad.mit.edu	37	12	132428116	132428116	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:132428116C>T	uc001ujf.2	+	6	1748	c.1269C>T	c.(1267-1269)GAC>GAT	p.D423D	PUS1_uc001ujg.2_Silent_p.D395D|PUS1_uc001ujh.2_Silent_p.D395D|PUS1_uc001uji.2_Silent_p.D370D	NM_025215	NP_079491	Q9Y606	TRUA_HUMAN	pseudouridine synthase 1 isoform 1	423						mitochondrion	pseudouridine synthase activity|pseudouridylate synthase activity|RNA binding			breast(1)|central_nervous_system(1)	2	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		GTGAAGGGGACGGAGACACTG	0.602													36	114	---	---	---	---	PASS
C13orf18	80183	broad.mit.edu	37	13	46930571	46930571	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:46930571C>A	uc010acl.2	-	10	1931	c.1326G>T	c.(1324-1326)GAG>GAT	p.E442D	C13orf18_uc001vbf.3_Missense_Mutation_p.E375D|C13orf18_uc001vbg.3_Missense_Mutation_p.E170D|C13orf18_uc010tfz.1_Missense_Mutation_p.E285D|C13orf18_uc010acm.2_Missense_Mutation_p.E307D|C13orf18_uc010acn.2_Missense_Mutation_p.E227D|C13orf18_uc001vbe.3_Missense_Mutation_p.E442D|C13orf18_uc001vbh.3_Missense_Mutation_p.E442D|C13orf18_uc001vbi.3_Missense_Mutation_p.E285D|C13orf18_uc010aco.1_Missense_Mutation_p.E442D	NM_025113	NP_079389	Q9H714	CM018_HUMAN	hypothetical protein LOC80183	442											0		Lung NSC(96;2.31e-05)|Breast(56;8.04e-05)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;2.19e-05)		ACTTACTAGGCTCTACTGGAG	0.463													10	12	---	---	---	---	PASS
SUCLA2	8803	broad.mit.edu	37	13	48563082	48563082	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:48563082T>A	uc001vbs.2	-	3	363	c.306A>T	c.(304-306)TTA>TTT	p.L102F	SUCLA2_uc010tgb.1_Missense_Mutation_p.L42F|SUCLA2_uc010tgc.1_5'UTR|SUCLA2_uc010tgd.1_Missense_Mutation_p.L42F|SUCLA2_uc001vbt.1_RNA|SUCLA2_uc001vbu.1_Missense_Mutation_p.L102F	NM_003850	NP_003841	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	102	ATP-grasp.				succinyl-CoA pathway|tricarboxylic acid cycle	mitochondrial matrix	ATP binding|metal ion binding|protein binding|succinate-CoA ligase (ADP-forming) activity			central_nervous_system(1)	1		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TACCACCAGCTAAAACCTGTG	0.368													11	198	---	---	---	---	PASS
C13orf34	79866	broad.mit.edu	37	13	73321211	73321211	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:73321211G>A	uc001viv.1	+	10	1563	c.1444G>A	c.(1444-1446)GAA>AAA	p.E482K	C13orf34_uc010thq.1_Missense_Mutation_p.E257K|C13orf34_uc010aen.1_Missense_Mutation_p.E557K|C13orf34_uc010thr.1_Missense_Mutation_p.E412K|C13orf34_uc001viw.1_Missense_Mutation_p.E431K	NM_024808	NP_079084	Q6PGQ7	BORA_HUMAN	aurora borealis	482					cell division|mitosis|regulation of mitosis|regulation of mitotic spindle organization|regulation of protein localization		protein kinase binding				0		Breast(118;0.0735)		GBM - Glioblastoma multiforme(99;0.000227)		ACCTCTTGCTGAAAGCAGTGT	0.403													151	156	---	---	---	---	PASS
COL4A1	1282	broad.mit.edu	37	13	110822951	110822951	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:110822951G>T	uc001vqw.3	-	42	3807	c.3685C>A	c.(3685-3687)CAT>AAT	p.H1229N	COL4A1_uc010agl.2_Intron	NM_001845	NP_001836	P02462	CO4A1_HUMAN	alpha 1 type IV collagen preproprotein	1229	Triple-helical region.				angiogenesis|axon guidance		extracellular matrix structural constituent|platelet-derived growth factor binding			ovary(3)|lung(1)|central_nervous_system(1)|pancreas(1)	6	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			TCCGTGGCATGGCCTGGGGAT	0.672													9	9	---	---	---	---	PASS
COL4A2	1284	broad.mit.edu	37	13	111092145	111092145	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:111092145G>T	uc001vqx.2	+	16	1211	c.922G>T	c.(922-924)GGC>TGC	p.G308C		NM_001846	NP_001837	P08572	CO4A2_HUMAN	alpha 2 type IV collagen preproprotein	308	Triple-helical region.				angiogenesis|axon guidance|extracellular matrix organization|negative regulation of angiogenesis	collagen type IV	extracellular matrix structural constituent|protein binding			skin(3)|central_nervous_system(2)|ovary(1)	6	all_cancers(4;2.21e-12)|all_epithelial(4;2.63e-07)|all_lung(23;5.81e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00323)|all_neural(89;0.0565)|Lung SC(71;0.0753)|Medulloblastoma(90;0.0922)	Breast(118;0.212)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.151)			GGGTTACCCTGGCTTGAGTGG	0.478													70	61	---	---	---	---	PASS
F7	2155	broad.mit.edu	37	13	113773143	113773143	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:113773143C>T	uc001vsv.2	+	9	1273	c.1222C>T	c.(1222-1224)CAT>TAT	p.H408Y	F7_uc001vsw.2_Missense_Mutation_p.H386Y|F7_uc010tjt.1_Missense_Mutation_p.H339Y	NM_000131	NP_000122	P08709	FA7_HUMAN	coagulation factor VII isoform a precursor	408	Peptidase S1.		H -> Q (in FA7D).|H -> R (in FA7D).		anti-apoptosis|blood coagulation, extrinsic pathway|peptidyl-glutamic acid carboxylation|positive regulation of leukocyte chemotaxis|positive regulation of platelet-derived growth factor receptor signaling pathway|positive regulation of positive chemotaxis|positive regulation of protein kinase B signaling cascade|post-translational protein modification|proteolysis	endoplasmic reticulum lumen|Golgi lumen|plasma membrane	calcium ion binding|glycoprotein binding|serine-type endopeptidase activity				0	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0364)|all_epithelial(44;0.0393)|Lung NSC(25;0.128)|Breast(118;0.188)	all cancers(43;0.0737)|Epithelial(84;0.213)|BRCA - Breast invasive adenocarcinoma(86;0.218)		Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Menadione(DB00170)	TGGAGGCCCACATGCCACCCA	0.632													14	4	---	---	---	---	PASS
ABHD4	63874	broad.mit.edu	37	14	23072983	23072983	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:23072983G>A	uc001wgm.2	+	4	708	c.639G>A	c.(637-639)TGG>TGA	p.W213*	ABHD4_uc010tmz.1_3'UTR|ABHD4_uc010tna.1_Nonsense_Mutation_p.W213*|ABHD4_uc010tnb.1_Intron	NM_022060	NP_071343	Q8TB40	ABHD4_HUMAN	abhydrolase domain containing 4	213					lipid catabolic process		hydrolase activity			central_nervous_system(1)	1	all_cancers(95;5.49e-05)			GBM - Glioblastoma multiforme(265;0.0153)		CTGGGCCCTGGGGTGAGTAGC	0.522													22	38	---	---	---	---	PASS
MTHFD1	4522	broad.mit.edu	37	14	64921543	64921543	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:64921543G>A	uc001xhb.2	+	26	3055	c.2668G>A	c.(2668-2670)GAC>AAC	p.D890N	MTHFD1_uc010aqf.2_Missense_Mutation_p.D946N|ZBTB25_uc001xhc.2_Intron	NM_005956	NP_005947	P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase 1	890	Formyltetrahydrofolate synthetase.				folic acid metabolic process|folic acid-containing compound biosynthetic process|histidine biosynthetic process|methionine biosynthetic process|one-carbon metabolic process|purine nucleotide biosynthetic process	cytosol|mitochondrion	ATP binding|formate-tetrahydrofolate ligase activity|methenyltetrahydrofolate cyclohydrolase activity|methylenetetrahydrofolate dehydrogenase (NADP+) activity|methylenetetrahydrofolate dehydrogenase|protein binding			ovary(2)	2				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	NADH(DB00157)|Tetrahydrofolic acid(DB00116)	GCCCATTCGCGACATCCGCGC	0.532													10	144	---	---	---	---	PASS
SERPINA12	145264	broad.mit.edu	37	14	94964657	94964657	+	Silent	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:94964657T>C	uc001ydj.2	-	3	874	c.78A>G	c.(76-78)TCA>TCG	p.S26S		NM_173850	NP_776249	Q8IW75	SPA12_HUMAN	serine (or cysteine) proteinase inhibitor, clade	26					regulation of proteolysis	extracellular region	serine-type endopeptidase inhibitor activity			central_nervous_system(2)|ovary(1)|lung(1)	4				COAD - Colon adenocarcinoma(157;0.235)		AATTCCTTGGTGAGAAGCTCG	0.483													83	84	---	---	---	---	PASS
JAG2	3714	broad.mit.edu	37	14	105617415	105617415	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105617415A>G	uc001yqg.2	-	10	1698	c.1294T>C	c.(1294-1296)TGC>CGC	p.C432R	JAG2_uc001yqf.2_5'UTR|JAG2_uc001yqh.2_Intron	NM_002226	NP_002217	Q9Y219	JAG2_HUMAN	jagged 2 isoform a precursor	432	Extracellular (Potential).|EGF-like 6; calcium-binding (Potential).				auditory receptor cell fate commitment|cell communication|cell cycle|Notch receptor processing|Notch signaling pathway|regulation of cell migration|regulation of cell proliferation|spermatogenesis|thymic T cell selection	integral to plasma membrane	calcium ion binding|growth factor activity|Notch binding			lung(3)|breast(2)	5		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		GCGTTAAGGCATGGCTTCCCT	0.582													6	5	---	---	---	---	PASS
ADAM6	8755	broad.mit.edu	37	14	106791224	106791224	+	RNA	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106791224A>G	uc010tyt.1	-	386		c.14394T>C								Parts of antibodies, mostly variable regions.												0						AGGTGAATCCAGAGGCTGCAC	0.567													11	73	---	---	---	---	PASS
PLCB2	5330	broad.mit.edu	37	15	40586508	40586508	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:40586508C>T	uc001zld.2	-	19	2321	c.2020G>A	c.(2020-2022)GAC>AAC	p.D674N	PLCB2_uc001zlc.2_5'Flank|PLCB2_uc010bbo.2_Missense_Mutation_p.D670N|PLCB2_uc010ucm.1_Missense_Mutation_p.D674N	NM_004573	NP_004564	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	674	C2.				activation of phospholipase C activity|intracellular signal transduction|lipid catabolic process|phospholipid metabolic process|synaptic transmission	cytosol	calcium ion binding|phosphatidylinositol phospholipase C activity|signal transducer activity			ovary(3)|breast(3)|kidney(1)|pancreas(1)	8		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		TCGATGCGGTCCACTGAGAAG	0.597													25	73	---	---	---	---	PASS
SERINC4	619189	broad.mit.edu	37	15	44089090	44089090	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:44089090A>T	uc010bds.1	-	4	629	c.161T>A	c.(160-162)ATC>AAC	p.I54N	ELL3_uc001zsx.1_5'UTR|C15orf63_uc001ztb.2_Intron|SERINC4_uc001ztc.1_RNA|SERINC4_uc001ztd.1_Intron|SERINC4_uc001zte.1_Missense_Mutation_p.I54N	NM_001033517	NP_001028689	A6NH21	SERC4_HUMAN	serine incorporator 4	298	Helical; (Potential).				phospholipid biosynthetic process	integral to membrane					0		all_cancers(109;3.26e-11)|all_epithelial(112;4.82e-09)|Lung NSC(122;1.61e-06)|all_lung(180;1.5e-05)|Melanoma(134;0.0417)		GBM - Glioblastoma multiforme(94;7.81e-07)		CAGATACATGATATAGCAGCT	0.493													69	259	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49073427	49073427	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49073427T>C	uc001zwy.2	-	12	1577	c.1543A>G	c.(1543-1545)AAA>GAA	p.K515E	CEP152_uc001zwz.2_Missense_Mutation_p.K515E|CEP152_uc001zxa.1_Missense_Mutation_p.K422E	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	515					centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TTGACCTTTTTAATACCCAAA	0.343													65	197	---	---	---	---	PASS
CEP152	22995	broad.mit.edu	37	15	49081013	49081013	+	Silent	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:49081013G>C	uc001zwy.2	-	9	1192	c.1158C>G	c.(1156-1158)ACC>ACG	p.T386T	CEP152_uc001zwz.2_Silent_p.T386T|CEP152_uc001zxa.1_Silent_p.T293T	NM_014985	NP_055800	O94986	CE152_HUMAN	centrosomal protein 152kDa	386	Potential.				centrosome duplication|G2/M transition of mitotic cell cycle	centrosome|cytosol	protein kinase binding			lung(2)	2		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		CTTTAAGTGCGGTGACTGTGG	0.378													104	415	---	---	---	---	PASS
HDC	3067	broad.mit.edu	37	15	50544911	50544911	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:50544911C>T	uc001zxz.2	-	8	954	c.848G>A	c.(847-849)TGC>TAC	p.C283Y	HDC_uc001zxy.2_Missense_Mutation_p.C26Y|HDC_uc010uff.1_Missense_Mutation_p.C283Y	NM_002112	NP_002103	P19113	DCHS_HUMAN	histidine decarboxylase	283					catecholamine biosynthetic process|histidine metabolic process		histidine decarboxylase activity			large_intestine(2)|skin(2)|upper_aerodigestive_tract(1)|central_nervous_system(1)	6		all_lung(180;0.0138)		all cancers(107;1.12e-06)|GBM - Glioblastoma multiforme(94;9.95e-05)	L-Histidine(DB00117)|Pyridoxal Phosphate(DB00114)	GAACTCGGGGCACAGGAAGGC	0.562													11	52	---	---	---	---	PASS
VPS13C	54832	broad.mit.edu	37	15	62266538	62266538	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:62266538C>A	uc002agz.2	-	25	2561	c.2487G>T	c.(2485-2487)ATG>ATT	p.M829I	VPS13C_uc002aha.2_Missense_Mutation_p.M786I|VPS13C_uc002ahb.1_Missense_Mutation_p.M829I|VPS13C_uc002ahc.1_Missense_Mutation_p.M786I	NM_020821	NP_065872	Q709C8	VP13C_HUMAN	vacuolar protein sorting 13C protein isoform 2A	829					protein localization					ovary(2)	2						GTATACTGTTCATCAAATATA	0.348													52	174	---	---	---	---	PASS
ADAMTS7	11173	broad.mit.edu	37	15	79051768	79051768	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:79051768G>A	uc002bej.3	-	24	5267	c.5056C>T	c.(5056-5058)CGC>TGC	p.R1686C		NM_014272	NP_055087	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1	1686					proteolysis	proteinaceous extracellular matrix	metalloendopeptidase activity|zinc ion binding				0						CGCAGTCAGCGGCGGGCAACC	0.731													4	12	---	---	---	---	PASS
ALPK3	57538	broad.mit.edu	37	15	85400801	85400801	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:85400801G>T	uc002ble.2	+	6	3605	c.3438G>T	c.(3436-3438)GGG>GGT	p.G1146G		NM_020778	NP_065829	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1146					heart development	nucleus	ATP binding|protein serine/threonine kinase activity			stomach(3)|ovary(3)|lung(2)|skin(2)|central_nervous_system(1)|breast(1)	12			BRCA - Breast invasive adenocarcinoma(143;0.0587)			ATGTGGAGGGGCGGACCCCAG	0.632													26	196	---	---	---	---	PASS
PKD1	5310	broad.mit.edu	37	16	2152898	2152898	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:2152898G>C	uc002cos.1	-	24	9074	c.8865C>G	c.(8863-8865)CAC>CAG	p.H2955Q	PKD1_uc002cot.1_Missense_Mutation_p.H2955Q|PKD1_uc010bse.1_RNA	NM_001009944	NP_001009944	P98161	PKD1_HUMAN	polycystin 1 isoform 1 precursor	2955	Extracellular (Potential).				calcium-independent cell-matrix adhesion|homophilic cell adhesion|neuropeptide signaling pathway	basolateral plasma membrane|integral to plasma membrane	protein domain specific binding|sugar binding			central_nervous_system(2)|skin(1)	3						CCGAGCAGTTGTGCTCATTGG	0.642													6	140	---	---	---	---	PASS
ABCC1	4363	broad.mit.edu	37	16	16208628	16208628	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:16208628G>A	uc010bvi.2	+	23	3260	c.3085G>A	c.(3085-3087)GCC>ACC	p.A1029T	ABCC1_uc010bvj.2_Missense_Mutation_p.A970T|ABCC1_uc010bvk.2_Missense_Mutation_p.A973T|ABCC1_uc010bvl.2_Missense_Mutation_p.A1029T|ABCC1_uc010bvm.2_Missense_Mutation_p.A914T|ABCC1_uc002del.3_Missense_Mutation_p.A923T	NM_004996	NP_004987	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C, member 1	1029	ABC transmembrane type-1 2.|Helical; Name=13.				hormone biosynthetic process|leukotriene biosynthetic process|prostanoid metabolic process|response to drug	Golgi apparatus|integral to plasma membrane|membrane fraction|nucleus	ATP binding|ATPase activity, coupled to transmembrane movement of substances			ovary(4)	4					Daunorubicin(DB00694)|Glibenclamide(DB01016)|Probenecid(DB01032)|Saquinavir(DB01232)|Sulfinpyrazone(DB01138)	TGCAGGGATCGCCGTGTTTGG	0.617													13	28	---	---	---	---	PASS
MLKL	197259	broad.mit.edu	37	16	74709650	74709650	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:74709650C>T	uc002fdb.2	-	8	1492	c.1051G>A	c.(1051-1053)GAG>AAG	p.E351K	MLKL_uc002fdc.2_Intron	NM_152649	NP_689862	Q8NB16	MLKL_HUMAN	mixed lineage kinase domain-like isoform 1	351	Protein kinase.						ATP binding|protein binding|protein kinase activity			stomach(2)	2						TTCCTCAACTCAAATCCTGCA	0.438													6	137	---	---	---	---	PASS
MAP1LC3B	81631	broad.mit.edu	37	16	87436590	87436590	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87436590G>T	uc002fjx.2	+	4	498	c.265G>T	c.(265-267)GTC>TTC	p.V89F	MAP1LC3B_uc010chs.2_RNA	NM_022818	NP_073729	Q9GZQ8	MLP3B_HUMAN	microtubule-associated proteins 1A/1B light	89					autophagy	autophagic vacuole membrane|cytoplasmic vesicle|endomembrane system|microtubule	protein binding				0				BRCA - Breast invasive adenocarcinoma(80;0.0249)		ACACAGCATGGTCAGCGTCTC	0.458													6	75	---	---	---	---	PASS
TP53	7157	broad.mit.edu	37	17	7577550	7577550	+	Missense_Mutation	SNP	C	T	T	rs28934572		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7577550C>T	uc002gim.2	-	7	925	c.731G>A	c.(730-732)GGC>GAC	p.G244D	TP53_uc002gig.1_Missense_Mutation_p.G244D|TP53_uc002gih.2_Missense_Mutation_p.G244D|TP53_uc010cne.1_5'Flank|TP53_uc010cnf.1_Missense_Mutation_p.G112D|TP53_uc010cng.1_Missense_Mutation_p.G112D|TP53_uc002gii.1_Missense_Mutation_p.G112D|TP53_uc010cnh.1_Missense_Mutation_p.G244D|TP53_uc010cni.1_Missense_Mutation_p.G244D|TP53_uc002gij.2_Missense_Mutation_p.G244D|TP53_uc010cnj.1_RNA|TP53_uc002gin.2_Missense_Mutation_p.G151D|TP53_uc002gio.2_Missense_Mutation_p.G112D	NM_001126112	NP_001119584	P04637	P53_HUMAN	tumor protein p53 isoform a	244	|Interaction with HIPK1 (By similarity).|Interacts with the 53BP2 SH3 domain.|Interaction with AXIN1 (By similarity).		G -> A (in sporadic cancers; somatic mutation).|G -> S (in sporadic cancers; somatic mutation).|G -> R (in sporadic cancers; somatic mutation).|MG -> IC (in a sporadic cancer; somatic mutation).|G -> E (in a sporadic cancer; somatic mutation).|G -> C (in sporadic cancers; somatic mutation).|MG -> IS (in a sporadic cancer; somatic mutation).|G -> V (in LFS; germline mutation and in sporadic cancers; somatic mutation).		activation of caspase activity by cytochrome c|base-excision repair|blood coagulation|cell cycle arrest|cell differentiation|cell proliferation|cellular protein localization|cellular response to drug|cellular response to glucose starvation|cellular response to hypoxia|cellular response to ionizing radiation|cellular response to UV|determination of adult lifespan|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator|ER overload response|interspecies interaction between organisms|negative regulation of apoptosis|negative regulation of cell growth|negative regulation of cell proliferation|negative regulation of helicase activity|negative regulation of transcription from RNA polymerase II promoter|negative regulation of transcription from RNA polymerase II promoter|nucleotide-excision repair|oxidative stress-induced premature senescence|positive regulation of histone deacetylation|positive regulation of neuron apoptosis|positive regulation of peptidyl-tyrosine phosphorylation|positive regulation of reactive oxygen species metabolic process|positive regulation of thymocyte apoptosis|positive regulation of transcription from RNA polymerase II promoter|positive regulation of transcription from RNA polymerase II promoter|protein localization|protein tetramerization|Ras protein signal transduction|regulation of mitochondrial membrane permeability|replicative senescence|response to antibiotic|response to gamma radiation|response to X-ray	cytoplasm|cytosol|endoplasmic reticulum|insoluble fraction|mitochondrion|nuclear chromatin|nuclear matrix|nucleolus|nucleus|PML body|protein complex|replication fork	ATP binding|chaperone binding|chromatin binding|copper ion binding|damaged DNA binding|DNA strand annealing activity|histone acetyltransferase binding|p53 binding|protease binding|protein binding|protein heterodimerization activity|protein kinase binding|protein N-terminus binding|protein phosphatase 2A binding|RNA polymerase II transcription factor binding|sequence-specific DNA binding transcription factor activity|transcription regulatory region DNA binding|transcription regulatory region DNA binding|transcription repressor activity|ubiquitin protein ligase binding|zinc ion binding	p.G244S(35)|p.G244C(34)|p.G244D(32)|p.G244V(14)|p.G244G(13)|p.G244A(9)|p.0?(7)|p.G244fs*3(5)|p.G244R(3)|p.M243_G244>IC(1)|p.G244fs*19(1)|p.G244fs*17(1)|p.M243fs*18(1)|p.G244E(1)|p.S241_G245delSCMGG(1)|p.C242fs*98(1)|p.C242_M246>L(1)|p.G244del(1)|p.C238_M246delCNSSCMGGM(1)		large_intestine(4656)|breast(2429)|upper_aerodigestive_tract(2212)|lung(2028)|ovary(1592)|oesophagus(1462)|haematopoietic_and_lymphoid_tissue(1228)|stomach(1136)|urinary_tract(1114)|central_nervous_system(1085)|liver(805)|skin(694)|pancreas(375)|biliary_tract(247)|soft_tissue(209)|prostate(194)|endometrium(150)|bone(102)|vulva(79)|kidney(79)|cervix(68)|thyroid(54)|salivary_gland(43)|adrenal_gland(37)|peritoneum(33)|eye(24)|thymus(21)|genital_tract(16)|autonomic_ganglia(16)|small_intestine(14)|testis(11)|penis(10)|vagina(6)|meninges(5)|pituitary(4)|pleura(3)|gastrointestinal_tract_(site_indeterminate)(1)|NS(1)|Fallopian tube(1)|placenta(1)	22245		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)		GTTCATGCCGCCCATGCAGGA	0.577		111	Mis|N|F		breast|colorectal|lung|sarcoma|adrenocortical|glioma|multiple other tumour types	breast|sarcoma|adrenocortical carcinoma|glioma|multiple other tumour types		Other_conserved_DNA_damage_response_genes	Hereditary_Adrenocortical_Cancer|Endometrial_Cancer_Familial_Clustering_of|Hereditary_Breast-Ovarian_Cancer_non-BRCA1/2|Li-Fraumeni_syndrome|Osteosarcoma_Familial_Clustering_of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)			20	35	---	---	---	---	PASS
MYO15A	51168	broad.mit.edu	37	17	18022280	18022280	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18022280G>A	uc010vxh.1	+	2	504	c.166G>A	c.(166-168)GCC>ACC	p.A56T		NM_016239	NP_057323	Q9UKN7	MYO15_HUMAN	myosin XV	56	Myosin head-like.				sensory perception of sound	cytoplasm|myosin complex|stereocilium	actin binding|ATP binding|calmodulin binding|motor activity			skin(4)|ovary(2)|pancreas(1)|breast(1)|central_nervous_system(1)	9	all_neural(463;0.228)					GTTCCGCAGCGCCTCGGCCTT	0.607													20	17	---	---	---	---	PASS
ACCN1	40	broad.mit.edu	37	17	32483299	32483299	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:32483299C>G	uc002hhu.2	-	1	527	c.253G>C	c.(253-255)GTC>CTC	p.V85L		NM_001094	NP_001085	Q16515	ACCN1_HUMAN	amiloride-sensitive cation channel 1, neuronal	85	Extracellular (By similarity).				central nervous system development|peripheral nervous system development|synaptic transmission	integral to plasma membrane	ligand-gated sodium channel activity|protein binding			ovary(2)|large_intestine(1)|central_nervous_system(1)	4		Breast(31;0.042)|Ovarian(249;0.202)		UCEC - Uterine corpus endometrioid carcinoma (308;0.13)|BRCA - Breast invasive adenocarcinoma(366;0.215)	Amiloride(DB00594)	GCTGGGAAGACCAGGCTTTGA	0.582													30	53	---	---	---	---	PASS
TMEM101	84336	broad.mit.edu	37	17	42089432	42089432	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:42089432G>A	uc002ieu.2	-	4	663	c.638C>T	c.(637-639)CCT>CTT	p.P213L	TMEM101_uc010wis.1_Missense_Mutation_p.P155L	NM_032376	NP_115752	Q96IK0	TM101_HUMAN	transmembrane protein 101	213	Helical; (Potential).				positive regulation of I-kappaB kinase/NF-kappaB cascade	integral to membrane	signal transducer activity			upper_aerodigestive_tract(1)|central_nervous_system(1)	2		Breast(137;0.0264)|Prostate(33;0.0861)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CAGCATGACAGGGGGCAGCAG	0.562													42	83	---	---	---	---	PASS
COL1A1	1277	broad.mit.edu	37	17	48275825	48275825	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:48275825G>A	uc002iqm.2	-	6	638	c.512C>T	c.(511-513)TCA>TTA	p.S171L		NM_000088	NP_000079	P02452	CO1A1_HUMAN	alpha 1 type I collagen preproprotein	171	Nonhelical region (N-terminal).				axon guidance|blood vessel development|collagen biosynthetic process|collagen fibril organization|embryonic skeletal system development|leukocyte migration|platelet activation|positive regulation of canonical Wnt receptor signaling pathway|positive regulation of cell migration|positive regulation of epithelial to mesenchymal transition|positive regulation of transcription, DNA-dependent|protein localization to nucleus|sensory perception of sound|skin morphogenesis|tooth mineralization|visual perception	collagen type I|extracellular space|plasma membrane	identical protein binding|platelet-derived growth factor binding		COL1A1/PDGFB(372)	soft_tissue(372)|central_nervous_system(7)|skin(1)|breast(1)|pancreas(1)	382					Collagenase(DB00048)|Palifermin(DB00039)	TCCTCCGGTTGATTTCTCATC	0.522			T	PDGFB|USP6	dermatofibrosarcoma protuberans|aneurysmal bone cyst 		Osteogenesis imperfecta				OREG0024560	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	13	25	---	---	---	---	PASS
Unknown	0	broad.mit.edu	37	17	78282826	78282826	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:78282826A>G	uc002jyf.2	+	14	2653	c.2510A>G	c.(2509-2511)GAG>GGG	p.E837G	uc002jyg.1_Missense_Mutation_p.E568G	NM_020954	NP_066005			hypothetical protein LOC57714																		AGGATTCCCGAGGAGGCCTTG	0.478													49	144	---	---	---	---	PASS
LRRC30	339291	broad.mit.edu	37	18	7231499	7231499	+	Silent	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:7231499C>G	uc010wzk.1	+	1	363	c.363C>G	c.(361-363)GTC>GTG	p.V121V		NM_001105581	NP_001099051	A6NM36	LRC30_HUMAN	leucine rich repeat containing 30	121	LRR 3.									ovary(1)|liver(1)	2						GCCTCAAGGTCCTGTTTGTCA	0.602													25	56	---	---	---	---	PASS
IMPACT	55364	broad.mit.edu	37	18	22007887	22007887	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:22007887A>C	uc002kvh.3	+	2	153	c.41A>C	c.(40-42)GAG>GCG	p.E14A	IMPACT_uc002kvg.3_5'UTR	NM_018439	NP_060909	Q9P2X3	IMPCT_HUMAN	Impact homolog	14	RWD.										0	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					TTTCAGAATGAGGAAATTGAA	0.323													73	164	---	---	---	---	PASS
CELF4	56853	broad.mit.edu	37	18	35145471	35145471	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:35145471G>A	uc002lae.2	-	1	530	c.134C>T	c.(133-135)ACC>ATC	p.T45I	CELF4_uc010dnd.1_Missense_Mutation_p.T45I|CELF4_uc002lag.2_Missense_Mutation_p.T45I|CELF4_uc002laf.2_Missense_Mutation_p.T41I|CELF4_uc002lai.2_Missense_Mutation_p.T41I	NM_020180	NP_064565	Q9BZC1	CELF4_HUMAN	bruno-like 4, RNA binding protein isoform 1	45	Sufficient for RNA-binding and MSE- dependent splicing activity.				embryo development|germ cell development|regulation of alternative nuclear mRNA splicing, via spliceosome	cytoplasm|nucleus	BRE binding|nucleotide binding|translation repressor activity, nucleic acid binding			ovary(2)	2						CATGGGAATGGTCGACGGGTT	0.612													22	54	---	---	---	---	PASS
DCC	1630	broad.mit.edu	37	18	50731683	50731683	+	Silent	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:50731683A>T	uc002lfe.1	+	10	2258	c.1671A>T	c.(1669-1671)CCA>CCT	p.P557P	DCC_uc010xdr.1_Silent_p.P405P|DCC_uc010dpf.1_Silent_p.P212P	NM_005215	NP_005206	P43146	DCC_HUMAN	netrin receptor DCC precursor	557	Extracellular (Potential).|Fibronectin type-III 2.				apoptosis|induction of apoptosis|negative regulation of collateral sprouting|negative regulation of dendrite development	cytosol|integral to membrane				skin(8)|ovary(6)|upper_aerodigestive_tract(1)|large_intestine(1)|central_nervous_system(1)	17		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		CAAACGGTCCAGTCCAAGGTT	0.488													84	208	---	---	---	---	PASS
SERPINB11	89778	broad.mit.edu	37	18	61390434	61390434	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61390434A>G	uc002ljk.3	+	9	1042	c.980A>G	c.(979-981)TAT>TGT	p.Y327C	SERPINB11_uc010xes.1_Missense_Mutation_p.Y152C|SERPINB11_uc010dqd.2_Intron|SERPINB11_uc002ljj.3_Missense_Mutation_p.Y213C|SERPINB11_uc010dqe.2_Missense_Mutation_p.Y126C|SERPINB11_uc010dqf.2_Missense_Mutation_p.Y125C	NM_080475	NP_536723	Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B, member 11	327					regulation of proteolysis	cytoplasm	serine-type endopeptidase inhibitor activity			breast(1)	1		Esophageal squamous(42;0.129)				AAGGGCCTATATTTATCAAAA	0.478													19	39	---	---	---	---	PASS
RTTN	25914	broad.mit.edu	37	18	67816249	67816249	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:67816249G>C	uc002lkp.2	-	17	2265	c.2197C>G	c.(2197-2199)CTG>GTG	p.L733V	RTTN_uc002lko.2_RNA|RTTN_uc010xfb.1_5'UTR	NM_173630	NP_775901	Q86VV8	RTTN_HUMAN	rotatin	733							binding			ovary(3)|pancreas(2)|skin(1)|breast(1)|central_nervous_system(1)	8		Esophageal squamous(42;0.129)				CAGTTACCCAGAGGATCTTCT	0.368													62	133	---	---	---	---	PASS
DOT1L	84444	broad.mit.edu	37	19	2210489	2210489	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2210489G>T	uc002lvb.3	+	13	1132	c.1096G>T	c.(1096-1098)GGC>TGC	p.G366C	DOT1L_uc002lvc.1_5'Flank	NM_032482	NP_115871	Q8TEK3	DOT1L_HUMAN	DOT1-like, histone H3 methyltransferase	366						nucleus	DNA binding|histone-lysine N-methyltransferase activity|protein binding			pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGGTGGCCGGCCCCGCCGA	0.736													8	17	---	---	---	---	PASS
ZNF57	126295	broad.mit.edu	37	19	2917240	2917240	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:2917240T>A	uc002lwr.2	+	4	769	c.621T>A	c.(619-621)CAT>CAA	p.H207Q	ZNF57_uc010xha.1_Missense_Mutation_p.H175Q	NM_173480	NP_775751	Q68EA5	ZNF57_HUMAN	zinc finger protein 57	207	C2H2-type 2; degenerate.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			upper_aerodigestive_tract(1)|ovary(1)|skin(1)	3				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|GBM - Glioblastoma multiforme(1328;0.00161)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTTCCAACATCCTCGTTACC	0.498													29	72	---	---	---	---	PASS
TUBB4	10382	broad.mit.edu	37	19	6501604	6501604	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:6501604T>A	uc002mfg.1	-	2	195	c.88A>T	c.(88-90)ATC>TTC	p.I30F	TUBB4_uc002mff.1_5'UTR	NM_006087	NP_006078	P04350	TBB4_HUMAN	tubulin, beta 4	30					'de novo' posttranslational protein folding|G2/M transition of mitotic cell cycle|microtubule-based movement|protein polymerization	cytosol|microtubule	GTP binding|GTPase activity|protein binding|structural molecule activity			ovary(2)	2		Hepatocellular(1079;0.00213)|Renal(1328;0.0183)		Lung(535;3.23e-05)|STAD - Stomach adenocarcinoma(1328;8.24e-05)|GBM - Glioblastoma multiforme(1328;0.00839)|READ - Rectum adenocarcinoma(264;0.155)		GTGGGGTCGATGCCATGTTCG	0.582													31	73	---	---	---	---	PASS
RAVER1	125950	broad.mit.edu	37	19	10439562	10439562	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10439562T>A	uc002moa.2	-	3	643	c.563A>T	c.(562-564)CAA>CTA	p.Q188L		NM_133452	NP_597709	Q8IY67	RAVR1_HUMAN	RAVER1	171	RRM 2.					cytoplasm|nucleus	nucleotide binding|protein binding|RNA binding			ovary(1)	1			OV - Ovarian serous cystadenocarcinoma(20;1.81e-09)|Epithelial(33;3.65e-06)|all cancers(31;8.35e-06)			GCCCTTGGATTGGCCAGTGCG	0.637													4	54	---	---	---	---	PASS
KEAP1	9817	broad.mit.edu	37	19	10600447	10600447	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:10600447G>A	uc002moq.1	-	4	1564	c.1408C>T	c.(1408-1410)CGT>TGT	p.R470C	KEAP1_uc002mop.1_Missense_Mutation_p.R188C|KEAP1_uc002mor.1_Missense_Mutation_p.R470C	NM_012289	NP_036421	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	470	Kelch 3.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	centrosome|midbody|nucleus	protein binding			lung(12)|breast(3)|ovary(1)|pancreas(1)	17			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)			TAAAGGAGACGATTGAGGACA	0.557													21	39	---	---	---	---	PASS
ZNF442	79973	broad.mit.edu	37	19	12461559	12461559	+	Silent	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12461559A>G	uc002mtr.1	-	6	1451	c.840T>C	c.(838-840)TAT>TAC	p.Y280Y	ZNF442_uc010xmk.1_Silent_p.Y211Y	NM_030824	NP_110451	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	280	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			large_intestine(2)|breast(1)|kidney(1)	4						CATGTCTTACATAGGAACTGT	0.398													141	246	---	---	---	---	PASS
CCDC105	126402	broad.mit.edu	37	19	15131288	15131288	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:15131288C>T	uc002nae.2	+	3	790	c.691C>T	c.(691-693)CGA>TGA	p.R231*		NM_173482	NP_775753	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	231					microtubule cytoskeleton organization	microtubule				ovary(1)	1						GGCCTCCTGCCGAGACACTCT	0.587													6	29	---	---	---	---	PASS
ZNF101	94039	broad.mit.edu	37	19	19790295	19790295	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19790295A>G	uc002nni.1	+	4	607	c.497A>G	c.(496-498)AAG>AGG	p.K166R	ZNF101_uc010ecg.1_Missense_Mutation_p.K46R|ZNF101_uc002nnj.1_Missense_Mutation_p.K46R	NM_033204	NP_149981	Q8IZC7	ZN101_HUMAN	zinc finger protein 101	166					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(2)	2						CCAACTCGAAAGAGACCTTAT	0.468													59	162	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22362956	22362956	+	Silent	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22362956A>T	uc002nqs.1	-	3	1881	c.1563T>A	c.(1561-1563)ACT>ACA	p.T521T		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	521	C2H2-type 13.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				TCTTATGTTCAGTAAGGATCG	0.403													64	125	---	---	---	---	PASS
ZNF676	163223	broad.mit.edu	37	19	22364342	22364342	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22364342T>C	uc002nqs.1	-	3	495	c.177A>G	c.(175-177)ATA>ATG	p.I59M		NM_001001411	NP_001001411	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	59					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				AAGAATCTTCTATGCCTTGCT	0.303													29	53	---	---	---	---	PASS
ZNF91	7644	broad.mit.edu	37	19	23544209	23544209	+	Silent	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:23544209G>A	uc002nre.2	-	4	1685	c.1572C>T	c.(1570-1572)GGC>GGT	p.G524G	ZNF91_uc002nrd.2_5'Flank|ZNF91_uc010xrj.1_Silent_p.G492G	NM_003430	NP_003421	Q05481	ZNF91_HUMAN	zinc finger protein 91	524	C2H2-type 14; degenerate.					nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|zinc ion binding				0		all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TAAAAGCTTTGCCACATTCTT	0.333													47	70	---	---	---	---	PASS
CEACAM5	1048	broad.mit.edu	37	19	42219744	42219744	+	Silent	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42219744T>C	uc002ork.2	+	4	1000	c.879T>C	c.(877-879)AAT>AAC	p.N293N	CEACAM5_uc010ehz.1_3'UTR|CEACAM5_uc002orj.1_Silent_p.N293N|CEACAM5_uc002orl.2_Silent_p.N293N	NM_004363	NP_004354	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion	293	Ig-like 3.					anchored to membrane|basolateral plasma membrane|integral to plasma membrane				skin(2)	2				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CTGTGAATAATAGTGGATCCT	0.493													40	66	---	---	---	---	PASS
PSG1	5669	broad.mit.edu	37	19	43376204	43376204	+	Intron	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:43376204A>G	uc002ovb.2	-						PSG3_uc002ouf.2_Intron|PSG1_uc002oug.1_Intron|PSG11_uc002ouw.2_Intron|PSG7_uc002ous.1_Intron|PSG7_uc002out.1_Intron|PSG10_uc002ouv.1_Intron|PSG1_uc002oun.2_Intron|PSG1_uc002our.1_Intron|PSG1_uc010eio.1_Intron|PSG1_uc002oux.1_Intron|PSG1_uc002ouy.1_Intron|PSG1_uc002ouz.1_Intron|PSG1_uc002ova.1_Intron|PSG1_uc002ovc.2_Intron|PSG1_uc002ovd.1_Intron	NM_006905	NP_008836	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1						female pregnancy	extracellular region				ovary(2)	2		Prostate(69;0.00682)				TCCACTGTGCAGAAAACAGGG	0.522													73	166	---	---	---	---	PASS
KLC3	147700	broad.mit.edu	37	19	45850779	45850779	+	Intron	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:45850779G>C	uc002pbf.1	+						KLC3_uc010ejy.1_Intron|KLC3_uc002pbg.1_Intron	NM_177417	NP_803136	Q6P597	KLC3_HUMAN	kinesin light chain 3							cytoplasm|kinesin complex|microtubule	microtubule motor activity			ovary(1)	1		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGAAAGGTGGGTGTTGGGAGT	0.652													14	48	---	---	---	---	PASS
NPAS1	4861	broad.mit.edu	37	19	47542420	47542420	+	Intron	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:47542420G>A	uc002pfw.2	+						NPAS1_uc002pfx.2_Intron|NPAS1_uc002pfy.2_Intron|NPAS1_uc010xyj.1_Intron	NM_002517	NP_002508	Q99742	NPAS1_HUMAN	neuronal PAS domain protein 1						central nervous system development	nucleus	DNA binding|sequence-specific DNA binding transcription factor activity|signal transducer activity				0		all_cancers(25;4.31e-08)|all_epithelial(76;2.96e-06)|all_lung(116;7.86e-06)|Lung NSC(112;2.31e-05)|all_neural(266;0.026)|Ovarian(192;0.0392)|Breast(70;0.102)		all cancers(93;6.02e-05)|OV - Ovarian serous cystadenocarcinoma(262;7.35e-05)|Epithelial(262;0.00389)|GBM - Glioblastoma multiforme(486;0.0252)		GTGGGTGTGAGCAGTCAGGCT	0.602													11	39	---	---	---	---	PASS
CA11	770	broad.mit.edu	37	19	49143088	49143088	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:49143088G>A	uc002pjz.1	-	5	1086	c.524C>T	c.(523-525)TCC>TTC	p.S175F	SEC1_uc010xzv.1_Intron|SEC1_uc002pka.2_Intron|SEC1_uc010xzw.1_Intron|SEC1_uc010ema.2_Intron|DBP_uc002pjx.3_5'Flank|DBP_uc002pjy.2_5'Flank|DBP_uc010elz.1_5'Flank	NM_001217	NP_001208	O75493	CAH11_HUMAN	carbonic anhydrase XI precursor	175						extracellular region					0		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)		GGGGCCGCGGGAGGCAGCGCT	0.488													49	110	---	---	---	---	PASS
ZNF761	388561	broad.mit.edu	37	19	53959049	53959049	+	Nonsense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:53959049A>T	uc010eqp.2	+	7	1746	c.1288A>T	c.(1288-1290)AAA>TAA	p.K430*	ZNF761_uc010ydy.1_Nonsense_Mutation_p.K376*|ZNF761_uc002qbt.1_Nonsense_Mutation_p.K376*	NM_001008401	NP_001008401	Q86XN6	ZN761_HUMAN	zinc finger protein 761	430	C2H2-type 8.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(1)	1				GBM - Glioblastoma multiforme(134;0.00786)		AATACATCGGAAAATTCATAC	0.393													22	167	---	---	---	---	PASS
NLRP13	126204	broad.mit.edu	37	19	56443409	56443409	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:56443409T>C	uc010ygg.1	-	1	294	c.269A>G	c.(268-270)CAG>CGG	p.Q90R		NM_176810	NP_789780	Q86W25	NAL13_HUMAN	NACHT, leucine rich repeat and PYD containing	90	DAPIN.						ATP binding			skin(4)|ovary(3)|pancreas(1)|lung(1)	9		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ATTCATTGTCTGGAAGATGCC	0.507													11	139	---	---	---	---	PASS
ZNF460	10794	broad.mit.edu	37	19	57802555	57802555	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57802555A>G	uc002qog.2	+	3	968	c.646A>G	c.(646-648)ATC>GTC	p.I216V	ZNF460_uc010ygv.1_Missense_Mutation_p.I175V	NM_006635	NP_006626	Q14592	ZN460_HUMAN	zinc finger protein 460	216	C2H2-type 1.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding				0		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TCAGCATCACATCATCCATAC	0.527													45	110	---	---	---	---	PASS
ZNF543	125919	broad.mit.edu	37	19	57839516	57839516	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:57839516G>T	uc002qoi.1	+	4	1031	c.686G>T	c.(685-687)TGC>TTC	p.C229F		NM_213598	NP_998763	Q08ER8	ZN543_HUMAN	zinc finger protein 543	229	C2H2-type 2.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			skin(1)|pancreas(1)	2		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCCTATGAATGCACAGAGTGT	0.448													48	89	---	---	---	---	PASS
TMC2	117532	broad.mit.edu	37	20	2575462	2575462	+	Intron	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2575462G>C	uc002wgf.1	+						TMC2_uc002wgg.1_Intron|TMC2_uc010zpw.1_Intron|TMC2_uc010zpx.1_Intron	NM_080751	NP_542789	Q8TDI7	TMC2_HUMAN	transmembrane cochlear-expressed protein 2							integral to membrane				ovary(3)	3						TGGCTTTGCTGTCCCCCAGGG	0.498													40	81	---	---	---	---	PASS
CHGB	1114	broad.mit.edu	37	20	5904465	5904465	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:5904465G>A	uc002wmg.2	+	4	1981	c.1675G>A	c.(1675-1677)GAG>AAG	p.E559K	CHGB_uc010zqz.1_Missense_Mutation_p.E242K	NM_001819	NP_001810	P05060	SCG1_HUMAN	chromogranin B precursor	559						extracellular region	hormone activity			breast(3)|skin(2)|ovary(1)	6						GACCTTGAACGAGAAGAATTT	0.468													28	71	---	---	---	---	PASS
SPTLC3	55304	broad.mit.edu	37	20	13074196	13074196	+	Silent	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:13074196T>C	uc002wod.1	+	6	1087	c.798T>C	c.(796-798)GGT>GGC	p.G266G		NM_018327	NP_060797	Q9NUV7	SPTC3_HUMAN	serine palmitoyltransferase, long chain base	266					sphingoid biosynthetic process	integral to membrane|serine C-palmitoyltransferase complex	pyridoxal phosphate binding|serine C-palmitoyltransferase activity|transferase activity, transferring nitrogenous groups				0					Pyridoxal Phosphate(DB00114)	GACTCTCAGGTGCAACCATAA	0.418													30	107	---	---	---	---	PASS
SEMG1	6406	broad.mit.edu	37	20	43836328	43836328	+	Silent	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:43836328T>C	uc002xni.2	+	2	447	c.390T>C	c.(388-390)CAT>CAC	p.H130H	SEMG1_uc002xnj.2_Silent_p.H130H|SEMG2_uc010ggz.2_Intron|SEMG1_uc002xnh.2_Silent_p.H130H	NM_003007	NP_002998	P04279	SEMG1_HUMAN	semenogelin I preproprotein	130					insemination|sexual reproduction	extracellular space|stored secretory granule	structural molecule activity			skin(2)	2		Myeloproliferative disorder(115;0.0122)				TTATACACCATAAAGGAGGCA	0.413													31	89	---	---	---	---	PASS
MC3R	4159	broad.mit.edu	37	20	54824588	54824588	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:54824588T>C	uc002xxb.2	+	1	801	c.689T>C	c.(688-690)GTG>GCG	p.V230A		NM_019888	NP_063941	P41968	MC3R_HUMAN	melanocortin 3 receptor	267	Cytoplasmic (Potential).				activation of phospholipase C activity by G-protein coupled receptor protein signaling pathway coupled to IP3 second messenger|positive regulation of cAMP biosynthetic process	integral to plasma membrane	melanocyte-stimulating hormone receptor activity|neuropeptide binding|protein binding			ovary(2)|breast(2)	4			Colorectal(105;0.202)			GCCGACGGGGTGGCCCCACAG	0.607													21	83	---	---	---	---	PASS
PCK1	5105	broad.mit.edu	37	20	56138687	56138687	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:56138687G>T	uc002xyn.3	+	6	1028	c.865G>T	c.(865-867)GGG>TGG	p.G289W	PCK1_uc010zzm.1_Intron	NM_002591	NP_002582	P35558	PCKGC_HUMAN	cytosolic phosphoenolpyruvate carboxykinase 1	289	GTP.				gluconeogenesis|glucose homeostasis|glycerol biosynthetic process from pyruvate|response to insulin stimulus	cytosol|nucleus	carboxylic acid binding|GTP binding|magnesium ion binding|manganese ion binding|phosphoenolpyruvate carboxykinase (GTP) activity			skin(1)	1	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			CAGCGCCTGCGGGAAGACCAA	0.547													54	101	---	---	---	---	PASS
TMPRSS15	5651	broad.mit.edu	37	21	19744574	19744574	+	Silent	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:19744574A>T	uc002ykw.2	-	6	631	c.600T>A	c.(598-600)GCT>GCA	p.A200A		NM_002772	NP_002763	P98073	ENTK_HUMAN	enterokinase precursor	200	Extracellular (Potential).|LDL-receptor class A 1.				proteolysis	brush border|integral to membrane	scavenger receptor activity|serine-type endopeptidase activity			ovary(5)|upper_aerodigestive_tract(1)|breast(1)|skin(1)	8						AAAATAAATCAGCTTTTATAC	0.378													42	80	---	---	---	---	PASS
SON	6651	broad.mit.edu	37	21	34925604	34925604	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34925604C>T	uc002yse.1	+	3	4116	c.4067C>T	c.(4066-4068)GCT>GTT	p.A1356V	SON_uc002ysb.1_Missense_Mutation_p.A1356V|SON_uc002ysc.2_Missense_Mutation_p.A1356V|SON_uc002ysd.2_Missense_Mutation_p.A347V|SON_uc002ysf.1_Intron|SON_uc002ysg.2_Missense_Mutation_p.A347V	NM_138927	NP_620305	P18583	SON_HUMAN	SON DNA-binding protein isoform F	1356					anti-apoptosis|cytokinesis|mRNA processing|regulation of cell cycle|regulation of RNA splicing|RNA splicing|spindle pole body separation	nuclear speck	DNA binding|double-stranded RNA binding			ovary(4)|skin(2)	6						GAGTCTTCAGCTATGGCTGTC	0.552													17	28	---	---	---	---	PASS
SGSM1	129049	broad.mit.edu	37	22	25275485	25275485	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:25275485T>A	uc003abg.2	+	15	1809	c.1652T>A	c.(1651-1653)TTC>TAC	p.F551Y	SGSM1_uc003abh.2_Missense_Mutation_p.F551Y|SGSM1_uc010guu.1_Missense_Mutation_p.F496Y|SGSM1_uc003abj.2_Missense_Mutation_p.F496Y|SGSM1_uc003abi.1_Missense_Mutation_p.F471Y	NM_001039948	NP_001035037	Q2NKQ1	SGSM1_HUMAN	RUN and TBC1 domain containing 2 isoform 1	551						Golgi apparatus	Rab GTPase activator activity			ovary(2)|central_nervous_system(2)|pancreas(1)	5						TCCAGAGCCTTCTATGGATGT	0.453													14	39	---	---	---	---	PASS
SEZ6L	23544	broad.mit.edu	37	22	26706808	26706808	+	Intron	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:26706808G>T	uc003acb.2	+						SEZ6L_uc003acc.2_Intron|SEZ6L_uc011akc.1_Intron|SEZ6L_uc003acd.2_Intron|SEZ6L_uc011akd.1_Intron|SEZ6L_uc003ace.2_Intron|SEZ6L_uc003acf.1_Intron|SEZ6L_uc010gvc.1_Intron	NM_021115	NP_066938	Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like							endoplasmic reticulum membrane|integral to membrane				ovary(4)|central_nervous_system(1)|pancreas(1)	6						TGAAGGTGAGGGTCCCTGGGA	0.592													48	94	---	---	---	---	PASS
HSCB	150274	broad.mit.edu	37	22	29138228	29138228	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:29138228G>C	uc003aea.2	+	1	186	c.145G>C	c.(145-147)GGC>CGC	p.G49R	CHEK2_uc003adt.1_5'Flank|CHEK2_uc003adu.1_5'Flank|CHEK2_uc003adv.1_5'Flank|CHEK2_uc003adw.1_5'Flank|CHEK2_uc003adx.1_5'Flank|CHEK2_uc003ady.1_5'Flank|CHEK2_uc003adz.1_5'Flank	NM_172002	NP_741999	Q8IWL3	HSC20_HUMAN	J-type co-chaperone HSC20 precursor	49					iron-sulfur cluster assembly|protein folding	mitochondrion	chaperone binding|heat shock protein binding|metal ion binding			kidney(1)	1						CGGCCCATGGGGCCCCGGGCG	0.647													43	62	---	---	---	---	PASS
FOXRED2	80020	broad.mit.edu	37	22	36901931	36901931	+	Intron	SNP	C	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:36901931C>G	uc003apn.3	-						FOXRED2_uc003apo.3_Intron|FOXRED2_uc003app.3_Intron	NM_024955	NP_079231	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2						ER-associated protein catabolic process	endoplasmic reticulum lumen	flavin adenine dinucleotide binding|oxidoreductase activity|protein binding			lung(1)|kidney(1)	2						TGAGCTCTGGCACCGGCCTTA	0.572													60	149	---	---	---	---	PASS
PKDREJ	10343	broad.mit.edu	37	22	46655253	46655253	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:46655253G>A	uc003bhh.2	-	1	3967	c.3967C>T	c.(3967-3969)CAC>TAC	p.H1323Y		NM_006071	NP_006062	Q9NTG1	PKDRE_HUMAN	receptor for egg jelly-like protein precursor	1323	Cytoplasmic (Potential).|PLAT.				acrosome reaction|neuropeptide signaling pathway	integral to membrane	calcium ion binding|ion channel activity			breast(3)|ovary(2)	5		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00459)		AGCCAAATGTGCCTGCTAAAC	0.453													61	135	---	---	---	---	PASS
SFRS17A	8227	broad.mit.edu	37	X	1714314	1714314	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:1714314C>T	uc004cqa.2	+	3	996	c.800C>T	c.(799-801)TCA>TTA	p.S267L	SFRS17A_uc010ncx.1_Missense_Mutation_p.S267L|SFRS17A_uc004cqb.2_RNA|ASMT_uc004cqd.2_5'Flank	NM_005088	NP_005079	Q02040	AK17A_HUMAN	DNA segment on chromosome X and Y (unique) 155	267					B cell activation|mRNA processing|regulation of transcription, DNA-dependent|RNA splicing|signal transduction	nuclear speck|spliceosomal complex	nucleotide binding|protein binding|RNA binding				0		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGTGATGCCTCAATTAAGAAG	0.517													84	219	---	---	---	---	PASS
NHS	4810	broad.mit.edu	37	X	17745563	17745563	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:17745563C>T	uc004cxx.2	+	6	3612	c.3274C>T	c.(3274-3276)CAT>TAT	p.H1092Y	NHS_uc011mix.1_Missense_Mutation_p.H1113Y|NHS_uc004cxy.2_Missense_Mutation_p.H936Y|NHS_uc004cxz.2_Missense_Mutation_p.H915Y|NHS_uc004cya.2_Missense_Mutation_p.H815Y	NM_198270	NP_938011	Q6T4R5	NHS_HUMAN	Nance-Horan syndrome protein isoform 1	1092						nucleus				skin(3)|ovary(2)|breast(1)|central_nervous_system(1)	7	Hepatocellular(33;0.183)					TGTTTTTACTCATAATAAGCA	0.423													106	255	---	---	---	---	PASS
CDKL5	6792	broad.mit.edu	37	X	18671607	18671607	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18671607G>T	uc004cym.2	+	21	3289	c.3036G>T	c.(3034-3036)CAG>CAT	p.Q1012H	CDKL5_uc004cyn.2_Missense_Mutation_p.Q1012H|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	1012					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					ACAGGGCCCAGGTAAACCAAG	0.567													12	61	---	---	---	---	PASS
CDKL5	6792	broad.mit.edu	37	X	18671608	18671608	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:18671608G>T	uc004cym.2	+	21	3290	c.3037G>T	c.(3037-3039)GTA>TTA	p.V1013L	CDKL5_uc004cyn.2_Missense_Mutation_p.V1013L|RS1_uc004cyo.2_Intron	NM_003159	NP_003150	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	1013					neuron migration|positive regulation of axon extension|positive regulation of dendrite morphogenesis|positive regulation of Rac GTPase activity|protein autophosphorylation	dendrite cytoplasm|dendritic growth cone|nucleus	ATP binding|cyclin-dependent protein kinase activity|Rac GTPase binding			ovary(2)|large_intestine(1)|stomach(1)|central_nervous_system(1)|skin(1)	6	Hepatocellular(33;0.183)					CAGGGCCCAGGTAAACCAAGC	0.567													12	62	---	---	---	---	PASS
IL1RAPL1	11141	broad.mit.edu	37	X	29938132	29938132	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:29938132A>C	uc004dby.2	+	8	1486	c.978A>C	c.(976-978)GAA>GAC	p.E326D		NM_014271	NP_055086	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	326	Extracellular (Potential).|Ig-like C2-type 3.				innate immune response|negative regulation of calcium ion transport via voltage-gated calcium channel activity|negative regulation of exocytosis|regulation of neuron projection development	cytoplasm|integral to membrane|plasma membrane	protein binding|transmembrane receptor activity			ovary(3)|lung(1)|pancreas(1)	5						CTGTGGAAGAAGGTGACTTGG	0.408													78	171	---	---	---	---	PASS
PHF16	9767	broad.mit.edu	37	X	46893157	46893157	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:46893157G>T	uc004dgx.2	+	7	873	c.822G>T	c.(820-822)TGG>TGT	p.W274C	PHF16_uc004dgy.2_Missense_Mutation_p.W274C	NM_001077445	NP_001070913	Q92613	JADE3_HUMAN	PHD finger protein 16	274					histone H3 acetylation|histone H4-K12 acetylation|histone H4-K5 acetylation|histone H4-K8 acetylation	histone acetyltransferase complex	zinc ion binding				0						GGACTAAATGGGCTCATGTCA	0.542													7	15	---	---	---	---	PASS
PPP1R3F	89801	broad.mit.edu	37	X	49142924	49142924	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:49142924A>C	uc004dnh.1	+	4	1788	c.1772A>C	c.(1771-1773)GAA>GCA	p.E591A	PPP1R3F_uc011mnd.1_Missense_Mutation_p.E262A|PPP1R3F_uc004dni.2_Missense_Mutation_p.E245A|PPP1R3F_uc004dnj.1_Missense_Mutation_p.E245A	NM_033215	NP_149992	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory (inhibitor)	591	Extracellular (Potential).					integral to membrane				ovary(2)|skin(1)	3	Ovarian(276;0.236)					TCCAGCCCAGAAGGGGACAGC	0.637													20	47	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53573708	53573708	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53573708A>T	uc004dsp.2	-	69	11117	c.10715T>A	c.(10714-10716)GTG>GAG	p.V3572E	HUWE1_uc004dsn.2_Missense_Mutation_p.V2380E|HUWE1_uc004dsq.1_5'Flank	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	3572					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						GCCAGAGGACACCATCTTAAA	0.493													10	48	---	---	---	---	PASS
HUWE1	10075	broad.mit.edu	37	X	53596671	53596671	+	Silent	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:53596671C>A	uc004dsp.2	-	48	6831	c.6429G>T	c.(6427-6429)GGG>GGT	p.G2143G	HUWE1_uc004dsn.2_Silent_p.G967G	NM_031407	NP_113584	Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1	2143					base-excision repair|cell differentiation|histone ubiquitination|protein monoubiquitination|protein polyubiquitination|protein ubiquitination involved in ubiquitin-dependent protein catabolic process	cytoplasm|nucleus	DNA binding|protein binding|ubiquitin-protein ligase activity			ovary(8)|large_intestine(4)|breast(4)|kidney(1)	17						CTGTGCCACTCCCTGCAGCAG	0.572													34	139	---	---	---	---	PASS
WNK3	65267	broad.mit.edu	37	X	54321216	54321216	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:54321216A>G	uc004dtd.1	-	8	1902	c.1463T>C	c.(1462-1464)GTG>GCG	p.V488A	WNK3_uc004dtc.1_Missense_Mutation_p.V488A	NM_001002838	NP_001002838	Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3 isoform 2	488					intracellular protein kinase cascade|positive regulation of establishment of protein localization in plasma membrane|positive regulation of peptidyl-threonine phosphorylation|positive regulation of rubidium ion transmembrane transporter activity|positive regulation of rubidium ion transport|positive regulation of sodium ion transmembrane transporter activity|positive regulation of sodium ion transport|protein autophosphorylation	adherens junction|tight junction	ATP binding|protein binding|protein serine/threonine kinase activity|rubidium ion transmembrane transporter activity|sodium ion transmembrane transporter activity			lung(4)|ovary(3)|kidney(2)|central_nervous_system(2)	11						TATTGGCGTCACCCGGTCTCT	0.438													25	86	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62885761	62885761	+	Intron	SNP	G	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62885761G>A	uc004dvl.2	-						ARHGEF9_uc004dvj.1_Intron|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Intron|ARHGEF9_uc004dvm.1_Intron|ARHGEF9_uc011mot.1_Intron|ARHGEF9_uc004dvn.2_Intron	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9						apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						AGGGGGCAGGGTTACCTTCTT	0.572													9	31	---	---	---	---	PASS
ARHGEF9	23229	broad.mit.edu	37	X	62885773	62885773	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:62885773C>A	uc004dvl.2	-	7	1888	c.1049G>T	c.(1048-1050)TGC>TTC	p.C350F	ARHGEF9_uc004dvj.1_Missense_Mutation_p.C239F|ARHGEF9_uc004dvk.1_Intron|ARHGEF9_uc011mos.1_Missense_Mutation_p.C329F|ARHGEF9_uc004dvm.1_Missense_Mutation_p.C329F|ARHGEF9_uc011mot.1_Missense_Mutation_p.C297F|ARHGEF9_uc004dvn.2_Missense_Mutation_p.C357F	NM_015185	NP_056000	O43307	ARHG9_HUMAN	Cdc42 guanine exchange factor 9	350	PH.				apoptosis|induction of apoptosis by extracellular signals|ion transmembrane transport|nerve growth factor receptor signaling pathway|regulation of Rho protein signal transduction|small GTPase mediated signal transduction|synaptic transmission	cytosol	Rho guanyl-nucleotide exchange factor activity			ovary(5)|large_intestine(1)|central_nervous_system(1)|pancreas(1)	8						TACCTTCTTGCAGAGGACCAT	0.587													11	38	---	---	---	---	PASS
LAS1L	81887	broad.mit.edu	37	X	64751322	64751322	+	Intron	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:64751322A>G	uc004dwa.1	-						LAS1L_uc004dwc.1_Intron|LAS1L_uc004dwd.1_Intron	NM_031206	NP_112483	Q9Y4W2	LAS1L_HUMAN	LAS1-like							MLL1 complex|nucleolus	protein binding			ovary(3)|large_intestine(1)	4						TATTTACCTGATTACAGGGGA	0.303													54	120	---	---	---	---	PASS
HEPH	9843	broad.mit.edu	37	X	65408293	65408293	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:65408293C>A	uc011moz.1	+	5	787	c.727C>A	c.(727-729)CAT>AAT	p.H243N	HEPH_uc004dwn.2_Missense_Mutation_p.H243N|HEPH_uc004dwo.2_5'UTR|HEPH_uc010nkr.2_Missense_Mutation_p.H243N|HEPH_uc011mpa.1_Missense_Mutation_p.H243N	NM_138737	NP_620074	Q9BQS7	HEPH_HUMAN	hephaestin isoform a	240	Extracellular (Potential).|Plastocyanin-like 2.				cellular iron ion homeostasis|copper ion transport|transmembrane transport	integral to membrane|plasma membrane	copper ion binding|oxidoreductase activity			lung(5)|ovary(4)	9						CCTCAGCTGGCATCTCAATGA	0.502													12	28	---	---	---	---	PASS
FOXO4	4303	broad.mit.edu	37	X	70321032	70321032	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70321032C>T	uc004dys.1	+	2	1305	c.952C>T	c.(952-954)CTG>TTG	p.L318L	FOXO4_uc010nkz.2_Intron|FOXO4_uc004dyt.1_Silent_p.L263L	NM_005938	NP_005929	P98177	FOXO4_HUMAN	forkhead box O4	318					cell cycle arrest|cell differentiation|embryo development|G1 phase of mitotic cell cycle|insulin receptor signaling pathway|mitotic cell cycle G2/M transition DNA damage checkpoint|muscle organ development|negative regulation of angiogenesis|negative regulation of cell proliferation|negative regulation of smooth muscle cell differentiation|nerve growth factor receptor signaling pathway|pattern specification process|phosphatidylinositol-mediated signaling|positive regulation of transcription from RNA polymerase II promoter|regulation of sequence-specific DNA binding transcription factor activity|tissue development	cytosol|transcription factor complex	DNA bending activity|double-stranded DNA binding|promoter binding|protein kinase binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding			central_nervous_system(2)|prostate(1)	3	Renal(35;0.156)					TTCCCATTCCCTGCTATCTCG	0.552											OREG0019856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	143	---	---	---	---	PASS
IL2RG	3561	broad.mit.edu	37	X	70328447	70328447	+	Splice_Site	SNP	A	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70328447A>C	uc004dyw.1	-	6	868	c.854_splice	c.e6+1	p.R285_splice	CXorf65_uc011mpo.1_5'Flank|CXorf65_uc011mpp.1_5'Flank|IL2RG_uc004dyv.1_Intron|IL2RG_uc004dyx.1_Splice_Site_p.R95_splice	NM_000206	NP_000197	P31785	IL2RG_HUMAN	interleukin 2 receptor, gamma precursor						immune response|interleukin-4-mediated signaling pathway|interspecies interaction between organisms	external side of plasma membrane|integral to plasma membrane	cytokine receptor activity|interleukin-2 binding			pancreas(1)	1	Renal(35;0.156)				Aldesleukin(DB00041)|Denileukin diftitox(DB00004)	TCCAAATCTCACCGTTCCAGC	0.463									Severe_Combined_Immunodeficiency_X-linked				6	13	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70351922	70351922	+	Splice_Site	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70351922G>T	uc004dyy.2	+	30	4319	c.4120_splice	c.e30-1	p.E1374_splice	MED12_uc011mpq.1_Splice_Site_p.E1374_splice|MED12_uc004dyz.2_Splice_Site_p.E1374_splice|MED12_uc004dza.2_Splice_Site_p.E1221_splice|MED12_uc010nla.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12						androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					ATCCTCCCCAGGAGATGAACT	0.498													32	112	---	---	---	---	PASS
MED12	9968	broad.mit.edu	37	X	70351923	70351923	+	Nonsense_Mutation	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70351923G>T	uc004dyy.2	+	30	4319	c.4120G>T	c.(4120-4122)GAG>TAG	p.E1374*	MED12_uc011mpq.1_Nonsense_Mutation_p.E1374*|MED12_uc004dyz.2_Nonsense_Mutation_p.E1374*|MED12_uc004dza.2_Nonsense_Mutation_p.E1221*|MED12_uc010nla.2_Intron	NM_005120	NP_005111	Q93074	MED12_HUMAN	mediator complex subunit 12	1374					androgen receptor signaling pathway|negative regulation of Wnt receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|protein C-terminus binding|protein domain specific binding|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			ovary(1)|breast(1)|central_nervous_system(1)|skin(1)	4	Renal(35;0.156)					TCCTCCCCAGGAGATGAACTC	0.493													31	110	---	---	---	---	PASS
OGT	8473	broad.mit.edu	37	X	70776963	70776963	+	Intron	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:70776963T>A	uc004eaa.1	+						BCYRN1_uc011mpt.1_Intron|OGT_uc004eab.1_Intron|OGT_uc004eac.2_Intron|OGT_uc004ead.2_Intron	NM_181672	NP_858058	O15294	OGT1_HUMAN	O-linked GlcNAc transferase isoform 1						cellular response to retinoic acid|positive regulation of granulocyte differentiation|positive regulation of histone H3-K4 methylation|positive regulation of proteolysis|protein O-linked glycosylation|signal transduction	cytosol|MLL5-L complex	enzyme activator activity|protein binding|protein N-acetylglucosaminyltransferase activity			ovary(3)|kidney(1)|pancreas(1)	5	Renal(35;0.156)					AAGGTACTACTGTTTATTATA	0.363													35	110	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79978075	79978075	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79978075C>A	uc004edt.2	-	17	2125	c.1862G>T	c.(1861-1863)GGA>GTA	p.G621V	BRWD3_uc010nmi.1_5'Flank|BRWD3_uc004edo.2_Missense_Mutation_p.G217V|BRWD3_uc004edp.2_Missense_Mutation_p.G450V|BRWD3_uc004edq.2_Missense_Mutation_p.G217V|BRWD3_uc010nmj.1_Missense_Mutation_p.G217V|BRWD3_uc004edr.2_Missense_Mutation_p.G291V|BRWD3_uc004eds.2_Missense_Mutation_p.G217V|BRWD3_uc004edu.2_Missense_Mutation_p.G291V|BRWD3_uc004edv.2_Missense_Mutation_p.G217V|BRWD3_uc004edw.2_Missense_Mutation_p.G217V|BRWD3_uc004edx.2_Missense_Mutation_p.G217V|BRWD3_uc004edy.2_Missense_Mutation_p.G217V|BRWD3_uc004edz.2_Missense_Mutation_p.G291V|BRWD3_uc004eea.2_Missense_Mutation_p.G291V|BRWD3_uc004eeb.2_Missense_Mutation_p.G217V	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	621										ovary(4)	4						AGCCACATATCCCAGCTGTGG	0.383													51	169	---	---	---	---	PASS
BRWD3	254065	broad.mit.edu	37	X	79999534	79999534	+	Silent	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:79999534T>A	uc004edt.2	-	8	1073	c.810A>T	c.(808-810)ATA>ATT	p.I270I	BRWD3_uc004edo.2_5'UTR|BRWD3_uc004edp.2_Silent_p.I99I|BRWD3_uc004edq.2_5'UTR|BRWD3_uc010nmj.1_5'UTR|BRWD3_uc004edr.2_5'UTR|BRWD3_uc004eds.2_5'UTR|BRWD3_uc004edu.2_5'UTR|BRWD3_uc004edv.2_5'UTR|BRWD3_uc004edw.2_5'UTR|BRWD3_uc004edx.2_5'UTR|BRWD3_uc004edy.2_5'UTR|BRWD3_uc004edz.2_5'UTR|BRWD3_uc004eea.2_5'UTR|BRWD3_uc004eeb.2_Intron	NM_153252	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	270	WD 4.									ovary(4)	4						TTCTTACCTGTATGGAAGTAA	0.378													50	157	---	---	---	---	PASS
CPXCR1	53336	broad.mit.edu	37	X	88008902	88008902	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:88008902C>T	uc004efd.3	+	3	746	c.487C>T	c.(487-489)CAG>TAG	p.Q163*	CPXCR1_uc004efc.3_Nonsense_Mutation_p.Q163*	NM_033048	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	163						intracellular	zinc ion binding			ovary(3)	3						ATATTTCTCTCAGGCTGCAGG	0.388													32	119	---	---	---	---	PASS
PCDH11X	27328	broad.mit.edu	37	X	91131779	91131779	+	Splice_Site	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:91131779G>T	uc004efk.1	+	2	1386	c.541_splice	c.e2-1	p.S181_splice	PCDH11X_uc004efl.1_Splice_Site_p.S181_splice|PCDH11X_uc004efo.1_Splice_Site_p.S181_splice|PCDH11X_uc010nmv.1_Splice_Site_p.S181_splice|PCDH11X_uc004efm.1_Splice_Site_p.S181_splice|PCDH11X_uc004efn.1_Splice_Site_p.S181_splice|PCDH11X_uc004efh.1_Splice_Site_p.S181_splice|PCDH11X_uc004efj.1_Splice_Site_p.S181_splice	NM_032968	NP_116750	Q9BZA7	PC11X_HUMAN	protocadherin 11 X-linked isoform c						homophilic cell adhesion	integral to plasma membrane	calcium ion binding			large_intestine(2)	2						ATGTTTTCCAGAGTCAAAACA	0.274													27	104	---	---	---	---	PASS
ARMCX2	9823	broad.mit.edu	37	X	100912250	100912250	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:100912250T>A	uc004eid.2	-	3	680	c.325A>T	c.(325-327)AGT>TGT	p.S109C	ARMCX2_uc004eie.3_Missense_Mutation_p.S109C|ARMCX2_uc004eif.3_Missense_Mutation_p.S109C|ARMCX2_uc004eig.3_Missense_Mutation_p.S109C|ARMCX2_uc010nnt.2_Missense_Mutation_p.S109C	NM_177949	NP_808818	Q7L311	ARMX2_HUMAN	ALEX2 protein	109	Ala-rich.					integral to membrane	binding			ovary(6)	6						CCTGCCCCACTCTGAGCCTCA	0.627													96	99	---	---	---	---	PASS
NRK	203447	broad.mit.edu	37	X	105197019	105197019	+	Intron	SNP	A	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:105197019A>T	uc004emd.2	+						NRK_uc011msi.1_Intron	NM_198465	NP_940867	Q7Z2Y5	NRK_HUMAN	Nik related kinase								ATP binding|protein serine/threonine kinase activity|small GTPase regulator activity			breast(7)|ovary(3)|lung(2)|large_intestine(1)|central_nervous_system(1)	14						TTTCATTTGTATTGTAGCTTT	0.388										HNSCC(51;0.14)			11	30	---	---	---	---	PASS
COL4A5	1287	broad.mit.edu	37	X	107869498	107869498	+	Silent	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:107869498C>T	uc004enz.1	+	36	3367	c.3165C>T	c.(3163-3165)TCC>TCT	p.S1055S	COL4A5_uc011mso.1_Silent_p.S1055S|COL4A5_uc004eob.1_Silent_p.S663S	NM_033380	NP_203699	P29400	CO4A5_HUMAN	type IV collagen alpha 5 isoform 2 precursor	1055	Triple-helical region.				axon guidance	collagen type IV	extracellular matrix structural constituent|protein binding			ovary(3)|central_nervous_system(1)	4						AACCTGGCTCCCCAGGATTAC	0.458									Alport_syndrome_with_Diffuse_Leiomyomatosis				36	232	---	---	---	---	PASS
AMMECR1	9949	broad.mit.edu	37	X	109444273	109444273	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109444273C>T	uc004eoo.2	-	5	877	c.796G>A	c.(796-798)GAC>AAC	p.D266N	AMMECR1_uc004eop.2_Missense_Mutation_p.D229N|AMMECR1_uc004eoq.2_Missense_Mutation_p.D143N	NM_015365	NP_056180	Q9Y4X0	AMER1_HUMAN	AMMECR1 protein isoform 1	266	AMMECR1.										0						TGTATATGGTCCCATCCTGTA	0.378													81	258	---	---	---	---	PASS
RGAG1	57529	broad.mit.edu	37	X	109694824	109694824	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:109694824G>C	uc004eor.1	+	3	1225	c.979G>C	c.(979-981)GTC>CTC	p.V327L	RGAG1_uc011msr.1_Missense_Mutation_p.V327L	NM_020769	NP_065820	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	327										lung(2)|upper_aerodigestive_tract(1)|ovary(1)	4						GCTACTGTCAGTCCCAGATGC	0.498													206	630	---	---	---	---	PASS
CAPN6	827	broad.mit.edu	37	X	110492160	110492160	+	Intron	SNP	T	C	C			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:110492160T>C	uc004epc.1	-						CAPN6_uc011msu.1_Intron	NM_014289	NP_055104	Q9Y6Q1	CAN6_HUMAN	calpain 6						microtubule bundle formation|proteolysis|regulation of cytoskeleton organization	perinuclear region of cytoplasm|spindle microtubule	calcium-dependent cysteine-type endopeptidase activity|microtubule binding			ovary(2)|upper_aerodigestive_tract(1)|large_intestine(1)|lung(1)|skin(1)	6						TGCCCATTTTTACCTTGAAGA	0.443													36	579	---	---	---	---	PASS
ALG13	79868	broad.mit.edu	37	X	111002983	111002983	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111002983C>A	uc011msy.1	+	27	3204	c.3170C>A	c.(3169-3171)TCT>TAT	p.S1057Y	ALG13_uc011msx.1_Missense_Mutation_p.S874Y|ALG13_uc011msz.1_Missense_Mutation_p.S979Y|ALG13_uc011mta.1_Missense_Mutation_p.S874Y|ALG13_uc011mtb.1_Missense_Mutation_p.S874Y			Q9NP73	ALG13_HUMAN	SubName: Full=Asparagine-linked glycosylation 13 homolog (S. cerevisiae);	1057					dolichol-linked oligosaccharide biosynthetic process|lipid glycosylation|post-translational protein modification|protein N-linked glycosylation via asparagine	endoplasmic reticulum membrane	carbohydrate binding|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity			lung(1)	1						AATGCTGATTCTTCATCTGTC	0.423													11	43	---	---	---	---	PASS
TRPC5	7224	broad.mit.edu	37	X	111025340	111025340	+	Silent	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:111025340A>G	uc004epl.1	-	8	2842	c.1923T>C	c.(1921-1923)TTT>TTC	p.F641F	TRPC5_uc004epm.1_Silent_p.F641F	NM_012471	NP_036603	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel,	641	Cytoplasmic (Potential).				axon guidance	calcium channel complex|integral to plasma membrane	protein binding|store-operated calcium channel activity			urinary_tract(1)	1						TCGTCCTTGCAAACTTCCACT	0.428													48	211	---	---	---	---	PASS
LRCH2	57631	broad.mit.edu	37	X	114422790	114422790	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:114422790T>A	uc010nqe.2	-	2	524	c.493A>T	c.(493-495)AGC>TGC	p.S165C	LRCH2_uc004epz.2_Missense_Mutation_p.S165C|RBMXL3_uc011mte.1_5'Flank	NM_020871	NP_065922	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH)	165	LRR 4.									ovary(1)	1						TTTCCTTACCTAATGTTAAGG	0.284													4	22	---	---	---	---	PASS
ODZ1	10178	broad.mit.edu	37	X	123615730	123615730	+	Silent	SNP	G	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:123615730G>T	uc004euj.2	-	21	3844	c.3780C>A	c.(3778-3780)GTC>GTA	p.V1260V	ODZ1_uc011muj.1_Silent_p.V1266V|ODZ1_uc010nqy.2_Silent_p.V1267V	NM_014253	NP_055068	Q9UKZ4	TEN1_HUMAN	odz, odd Oz/ten-m homolog 1 isoform 3	1260	Extracellular (Potential).				immune response|negative regulation of cell proliferation|nervous system development|signal transduction	extracellular region	heparin binding			ovary(11)|breast(4)|large_intestine(2)|skin(2)|pancreas(2)|upper_aerodigestive_tract(1)|lung(1)	23						TCAACTTGTAGACTTTGCGAG	0.438													152	223	---	---	---	---	PASS
OCRL	4952	broad.mit.edu	37	X	128722228	128722228	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:128722228C>A	uc004euq.2	+	21	2494	c.2329C>A	c.(2329-2331)CCT>ACT	p.P777T	OCRL_uc004eur.2_Missense_Mutation_p.P769T|OCRL_uc010nrb.2_5'Flank	NM_000276	NP_000267	Q01968	OCRL_HUMAN	phosphatidylinositol polyphosphate 5-phosphatase	777	Rho-GAP.				regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	clathrin-coated vesicle|cytosol|early endosome|Golgi stack|Golgi-associated vesicle	GTPase activator activity|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|protein binding			lung(2)|ovary(1)|kidney(1)	4						TACCAGCATTCCTGAGACAAT	0.443													40	143	---	---	---	---	PASS
IGSF1	3547	broad.mit.edu	37	X	130419191	130419191	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:130419191C>T	uc004ewd.2	-	5	867	c.629G>A	c.(628-630)TGG>TAG	p.W210*	IGSF1_uc004ewe.3_Nonsense_Mutation_p.W199*|IGSF1_uc004ewf.2_Nonsense_Mutation_p.W190*|IGSF1_uc004ewg.2_Nonsense_Mutation_p.W210*	NM_001555	NP_001546	Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1 isoform 1	210	Ig-like C2-type 2.|Extracellular (Potential).				regulation of transcription, DNA-dependent	extracellular region|integral to membrane	inhibin beta-A binding|inhibin beta-B binding			ovary(3)|lung(1)|central_nervous_system(1)	5						GGGCTCTGACCACAGGGTGGG	0.552													37	168	---	---	---	---	PASS
SLC9A6	10479	broad.mit.edu	37	X	135067759	135067759	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135067759C>T	uc004ezj.2	+	1	174	c.98C>T	c.(97-99)GCA>GTA	p.A33V	SLC9A6_uc004ezk.2_Missense_Mutation_p.A33V|SLC9A6_uc011mvx.1_Intron	NM_006359	NP_006350	Q92581	SL9A6_HUMAN	solute carrier family 9 (sodium/hydrogen	33	Helical; (Potential).				regulation of pH	early endosome membrane|endoplasmic reticulum membrane|integral to membrane|microsome|plasma membrane|recycling endosome membrane	sodium:hydrogen antiporter activity			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TTGCTCCTCGCAGTGGGCGTC	0.711													20	57	---	---	---	---	PASS
RBMX	27316	broad.mit.edu	37	X	135961171	135961171	+	Intron	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:135961171C>A	uc004fae.1	-						RBMX_uc011mwf.1_Intron|RBMX_uc004fad.1_Intron|RBMX_uc011mwg.1_Intron|RBMX_uc004faf.1_Intron|RBMX_uc010nsf.1_Intron|RBMX_uc004fag.1_Intron	NM_002139	NP_002130	P38159	HNRPG_HUMAN	RNA binding motif protein, X-linked isoform 1							catalytic step 2 spliceosome|heterogeneous nuclear ribonucleoprotein complex|nucleoplasm	nucleotide binding|protein binding|RNA binding			ovary(1)	1	Acute lymphoblastic leukemia(192;0.000127)					TGTAGACAATCTCACCTTTCC	0.413													67	225	---	---	---	---	PASS
BCAP31	10134	broad.mit.edu	37	X	152986426	152986426	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152986426A>G	uc011myz.1	-	3	250	c.94T>C	c.(94-96)TGG>CGG	p.W32R	BCAP31_uc011myy.1_5'UTR|BCAP31_uc004fid.2_Missense_Mutation_p.W99R|BCAP31_uc011mza.1_Missense_Mutation_p.W32R|BCAP31_uc004fie.2_Missense_Mutation_p.W32R	NM_001139441	NP_001132913	P51572	BAP31_HUMAN	B-cell receptor-associated protein 31 isoform b	32	Cytoplasmic (Potential).				cellular component disassembly involved in apoptosis|immune response|intracellular protein transport|vesicle-mediated transport	cytosol|endoplasmic reticulum membrane|ER-Golgi intermediate compartment membrane|integral to plasma membrane	receptor binding				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ATCTTCTGCCATCTGTGAAGA	0.473													36	46	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	152991559	152991559	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:152991559C>A	uc004fif.2	+	1	1237	c.838C>A	c.(838-840)CGC>AGC	p.R280S	BCAP31_uc004fid.2_5'Flank|BCAP31_uc011myz.1_5'Flank|BCAP31_uc011mza.1_5'Flank|BCAP31_uc004fie.2_5'Flank	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	280	ABC transmembrane type-1.		R -> C (in X-ALD).		fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGGGAGCTGCGCTACATGCA	0.692													8	16	---	---	---	---	PASS
ABCD1	215	broad.mit.edu	37	X	153005583	153005583	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153005583A>G	uc004fif.2	+	6	1925	c.1526A>G	c.(1525-1527)AAT>AGT	p.N509S	ABCD1_uc004fig.2_Missense_Mutation_p.N9S	NM_000033	NP_000024	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member	509	ATP (By similarity).|ABC transporter.				fatty acid beta-oxidation using acyl-CoA oxidase|peroxisomal membrane transport|peroxisome organization	cytosol|integral to peroxisomal membrane	ATP binding|ATPase activity, coupled to transmembrane movement of substances|identical protein binding|peroxisomal fatty-acyl-CoA transporter activity				0	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACAGGCCCCAATGGCTGCGGC	0.647													44	181	---	---	---	---	PASS
NAA10	8260	broad.mit.edu	37	X	153195637	153195637	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153195637C>T	uc004fjm.1	-	8	622	c.511G>A	c.(511-513)GTG>ATG	p.V171M	NAA10_uc004fjn.1_Missense_Mutation_p.V156M	NM_003491	NP_003482	P41227	NAA10_HUMAN	alpha-N-acetyltransferase 1A	171					DNA packaging|internal protein amino acid acetylation|N-terminal protein amino acid acetylation	cytoplasm|nucleus	peptide alpha-N-acetyltransferase activity|protein binding			ovary(1)	1						CCCAGCACCACGTGCCTGCCC	0.617													52	215	---	---	---	---	PASS
IRAK1	3654	broad.mit.edu	37	X	153279714	153279714	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:153279714C>T	uc004fjs.1	-	11	1397	c.1318G>A	c.(1318-1320)GAG>AAG	p.E440K	IRAK1_uc004fjr.1_Missense_Mutation_p.E440K|IRAK1_uc004fjt.1_Intron|IRAK1_uc010nur.2_Intron|IRAK1_uc004fju.2_Missense_Mutation_p.E466K	NM_001569	NP_001560	P51617	IRAK1_HUMAN	interleukin-1 receptor-associated kinase 1	440	Protein kinase.				activation of MAPK activity|activation of NF-kappaB-inducing kinase activity|anti-apoptosis|innate immune response|interleukin-1-mediated signaling pathway|JNK cascade|lipopolysaccharide-mediated signaling pathway|MyD88-dependent toll-like receptor signaling pathway|MyD88-independent toll-like receptor signaling pathway|negative regulation of NF-kappaB transcription factor activity|nerve growth factor receptor signaling pathway|positive regulation of I-kappaB kinase/NF-kappaB cascade|positive regulation of NF-kappaB transcription factor activity|positive regulation of NF-kappaB transcription factor activity|positive regulation of transcription, DNA-dependent|protein autophosphorylation|protein oligomerization|regulation of cytokine-mediated signaling pathway|stress-activated MAPK cascade|Toll signaling pathway|toll-like receptor 1 signaling pathway|toll-like receptor 2 signaling pathway|toll-like receptor 3 signaling pathway|toll-like receptor 4 signaling pathway|transmembrane receptor protein serine/threonine kinase signaling pathway	cytosol|endosome membrane|interleukin-1 receptor complex	ATP binding|NF-kappaB-inducing kinase activity|protein binding|protein heterodimerization activity|protein homodimerization activity|ubiquitin-protein ligase activity			lung(5)|ovary(2)|breast(1)|central_nervous_system(1)	9	all_cancers(53;3.7e-16)|all_epithelial(53;3.44e-10)|all_lung(58;2.06e-07)|Lung NSC(58;2.72e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TCAGCCTCCTCTTCCACCAGG	0.567													112	151	---	---	---	---	PASS
C1orf94	84970	broad.mit.edu	37	1	34684558	34684559	+	3'UTR	DEL	AC	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:34684558_34684559delAC	uc001bxs.3	+	7					C1orf94_uc001bxt.2_3'UTR	NM_032884	NP_116273	Q6P1W5	CA094_HUMAN	hypothetical protein LOC84970 isoform b								protein binding				0		Myeloproliferative disorder(586;0.0393)				GGCACAAGCTACACACACACAC	0.396													5	3	---	---	---	---	
FAF1	11124	broad.mit.edu	37	1	51180667	51180667	+	Intron	DEL	A	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:51180667delA	uc009vyx.1	-						FAF1_uc009vyw.1_Intron|FAF1_uc001cse.1_Intron	NM_007051	NP_008982	Q9UNN5	FAF1_HUMAN	FAS-associated factor 1						apoptosis|cytoplasmic sequestering of NF-kappaB|positive regulation of apoptosis|positive regulation of protein complex assembly|proteasomal ubiquitin-dependent protein catabolic process|regulation of protein catabolic process	CD95 death-inducing signaling complex|cytosol|perinuclear region of cytoplasm	heat shock protein binding|NF-kappaB binding|protein kinase binding|protein kinase regulator activity	p.0?(1)		ovary(1)|pancreas(1)	2				GBM - Glioblastoma multiforme(3;3.18e-11)|all cancers(3;0.00526)		GATATAAAGTAAAAAAAAACC	0.274													4	2	---	---	---	---	
CTBS	1486	broad.mit.edu	37	1	85039999	85040007	+	In_Frame_Del	DEL	GCAGCGCCA	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:85039999_85040007delGCAGCGCCA	uc001dka.2	-	1	157_165	c.92_100delTGGCGCTGC	c.(91-102)CTGGCGCTGCGG>CGG	p.LAL31del	CTBS_uc001dkc.2_5'UTR|CTBS_uc001dkd.2_5'UTR|CTBS_uc001dkb.2_5'UTR	NM_004388	NP_004379	Q01459	DIAC_HUMAN	chitobiase, di-N-acetyl- precursor	31_33						lysosome	cation binding				0				all cancers(265;0.00727)|Epithelial(280;0.0192)|OV - Ovarian serous cystadenocarcinoma(397;0.166)		GCCGCGAGCCgcagcgccagcagcgccag	0.589													9	4	---	---	---	---	
ERO1LB	56605	broad.mit.edu	37	1	236385071	236385072	+	Intron	INS	-	TTAATA	TTAATA	rs10647377		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:236385071_236385072insTTAATA	uc001hxt.2	-							NM_019891	NP_063944	Q86YB8	ERO1B_HUMAN	endoplasmic reticulum oxidoreductin 1-Lbeta						electron transport chain|protein thiol-disulfide exchange|transport	endoplasmic reticulum membrane	flavin adenine dinucleotide binding|oxidoreductase activity, acting on a sulfur group of donors, disulfide as acceptor|unfolded protein binding				0	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.123)|Acute lymphoblastic leukemia(190;0.205)|Prostate(94;0.219)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			ACACATATACTTTAATTTTTTC	0.282													3	4	---	---	---	---	
C2orf43	60526	broad.mit.edu	37	2	21000848	21000849	+	Intron	DEL	AC	-	-	rs111544765		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:21000848_21000849delAC	uc002rec.2	-						C2orf43_uc002rea.1_Intron|C2orf43_uc002reb.1_Intron|C2orf43_uc010yka.1_Intron|C2orf43_uc010ykb.1_Intron|C2orf43_uc010ykc.1_Intron|C2orf43_uc010ykd.1_Intron|C2orf43_uc010yke.1_Intron|C2orf43_uc010ykf.1_Intron	NM_021925	NP_068744	Q9H6V9	CB043_HUMAN	hypothetical protein LOC60526												0	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGTGacacaaacacacacacac	0.252													4	2	---	---	---	---	
ATAD2B	54454	broad.mit.edu	37	2	24103432	24103433	+	Intron	INS	-	A	A	rs75314008		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:24103432_24103433insA	uc002rek.3	-						ATAD2B_uc010yki.1_Intron|ATAD2B_uc010exx.1_Intron	NM_017552	NP_060022	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B								ATP binding|nucleoside-triphosphatase activity			central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					gactctgtctcaaaaaaaaaaa	0.178													4	2	---	---	---	---	
SPTBN1	6711	broad.mit.edu	37	2	54895818	54895818	+	3'UTR	DEL	T	-	-	rs78796985		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:54895818delT	uc002rxu.2	+	36					SPTBN1_uc010you.1_3'UTR	NM_003128	NP_003119	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1 isoform 1						actin filament capping|axon guidance	cytosol|nucleolus|plasma membrane|sarcomere|spectrin	actin binding|calmodulin binding|protein binding|structural constituent of cytoskeleton			ovary(3)|breast(2)|central_nervous_system(2)|skin(1)	8			Lung(47;0.24)			ATGTGGTTGattttttttttt	0.413													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	58479808	58479808	+	IGR	DEL	A	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:58479808delA								FANCL (11293 upstream) : None (None downstream)																							TTTGtaaattaaaaaaaaaaa	0.234													7	4	---	---	---	---	
BAZ2B	29994	broad.mit.edu	37	2	160231046	160231047	+	Intron	INS	-	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:160231046_160231047insT	uc002uao.2	-						BAZ2B_uc002uap.2_Intron	NM_013450	NP_038478	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|protein binding|zinc ion binding			ovary(3)|skin(1)	4						TCCTCATCTTATTTTTTTTTCT	0.312													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	2	232451623	232451623	+	IGR	DEL	A	-	-	rs78129699		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:232451623delA								NMUR1 (56441 upstream) : C2orf57 (5989 downstream)																							actctatctcaaaaaaaaaaa	0.124													3	3	---	---	---	---	
PRKAR2A	5576	broad.mit.edu	37	3	48802614	48802616	+	Intron	DEL	AAC	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:48802614_48802616delAAC	uc010hki.1	-						PRKAR2A_uc003cux.1_Intron|PRKAR2A_uc003cuy.1_Intron	NM_004157	NP_004148	P13861	KAP2_HUMAN	cAMP-dependent protein kinase, regulatory						activation of phospholipase C activity|activation of protein kinase A activity|blood coagulation|cellular response to glucagon stimulus|energy reserve metabolic process|intracellular signal transduction|nerve growth factor receptor signaling pathway|regulation of insulin secretion|transmembrane transport|water transport	centrosome|cytosol|membrane fraction	cAMP binding|cAMP-dependent protein kinase regulator activity			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		TTGAAAACCTAACAACAGAATAG	0.335													14	14	---	---	---	---	
NEK4	6787	broad.mit.edu	37	3	52775253	52775253	+	Intron	DEL	A	-	-	rs35123782		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:52775253delA	uc003dfq.3	-						NEK4_uc011bej.1_Intron|NEK4_uc003dfr.2_Intron	NM_003157	NP_003148	P51957	NEK4_HUMAN	NIMA-related kinase 4						cell division|mitosis	nucleus	ATP binding|metal ion binding|protein serine/threonine kinase activity			large_intestine(1)	1				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		actccgtctcaaaaaaaaaaa	0.129													4	2	---	---	---	---	
IL17RB	55540	broad.mit.edu	37	3	53898562	53898563	+	Intron	INS	-	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:53898562_53898563insA	uc003dha.2	+							NM_018725	NP_061195	Q9NRM6	I17RB_HUMAN	interleukin 17B receptor precursor						defense response|regulation of cell growth	extracellular region|integral to plasma membrane	cytokine receptor activity			ovary(2)|pancreas(1)	3				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		actatgtctccaaaaaaaaaaa	0.183													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	84741480	84741480	+	Intron	DEL	A	-	-	rs140144338		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:84741480delA	uc003dqi.2	-											Homo sapiens cDNA clone IMAGE:4824471.																		CCTGTCCCAGAAAAAAAAAAA	0.388													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	90167658	90167659	+	IGR	DEL	AA	-	-	rs139949740		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:90167658_90167659delAA								EPHA3 (636376 upstream) : None (None downstream)																							actctatctcaaaaaaaaaaaa	0.000													5	3	---	---	---	---	
ARHGAP31	57514	broad.mit.edu	37	3	119128712	119128712	+	Intron	DEL	T	-	-	rs149651758		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:119128712delT	uc003ecj.3	+							NM_020754	NP_065805	Q2M1Z3	RHG31_HUMAN	Cdc42 GTPase-activating protein						regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|focal adhesion|lamellipodium	GTPase activator activity			ovary(2)	2						TGAAAAAAAATTTTTTTTTGA	0.378													6	6	---	---	---	---	
MUC13	56667	broad.mit.edu	37	3	124626850	124626851	+	Intron	DEL	TC	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:124626850_124626851delTC	uc003ehq.1	-							NM_033049	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, epithelial transmembrane							extracellular region|integral to membrane|plasma membrane					0						TCCTTTTTGATCTCTCTCTCTC	0.322													4	2	---	---	---	---	
WWTR1	25937	broad.mit.edu	37	3	149374544	149374551	+	Intron	DEL	TCTCTCTT	-	-	rs10665547		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:149374544_149374551delTCTCTCTT	uc003exe.2	-						WWTR1_uc003exf.2_Intron|WWTR1_uc011bns.1_Intron|WWTR1_uc003exh.2_Intron|uc010hvg.1_5'Flank|uc003exi.1_5'Flank	NM_015472	NP_056287	Q9GZV5	WWTR1_HUMAN	WW domain containing transcription regulator 1						hippo signaling cascade|negative regulation of canonical Wnt receptor signaling pathway|negative regulation of catenin import into nucleus|negative regulation of protein kinase activity|negative regulation of protein phosphorylation|positive regulation of cell proliferation|positive regulation of epithelial to mesenchymal transition|regulation of SMAD protein import into nucleus|stem cell division|transcription, DNA-dependent	cytoplasm	transcription coactivator activity			breast(3)|skin(1)	4			LUSC - Lung squamous cell carcinoma(72;0.0378)|Lung(72;0.048)			ACGCACCAtctctctctttctctctctc	0.365													7	6	---	---	---	---	
SLIT2	9353	broad.mit.edu	37	4	20569126	20569126	+	Intron	DEL	C	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:20569126delC	uc003gpr.1	+						SLIT2_uc003gps.1_Intron	NM_004787	NP_004778	O94813	SLIT2_HUMAN	slit homolog 2 precursor						apoptosis involved in luteolysis|axon extension involved in axon guidance|branching morphogenesis of a tube|cell migration involved in sprouting angiogenesis|cellular response to heparin|cellular response to hormone stimulus|chemorepulsion involved in postnatal olfactory bulb interneuron migration|corticospinal neuron axon guidance through spinal cord|induction of negative chemotaxis|motor axon guidance|negative regulation of actin filament polymerization|negative regulation of cell growth|negative regulation of cellular response to growth factor stimulus|negative regulation of chemokine-mediated signaling pathway|negative regulation of endothelial cell migration|negative regulation of lamellipodium assembly|negative regulation of mononuclear cell migration|negative regulation of neutrophil chemotaxis|negative regulation of protein phosphorylation|negative regulation of retinal ganglion cell axon guidance|negative regulation of small GTPase mediated signal transduction|negative regulation of smooth muscle cell chemotaxis|negative regulation of vascular permeability|positive regulation of apoptosis|positive regulation of axonogenesis|response to cortisol stimulus|retinal ganglion cell axon guidance|Roundabout signaling pathway|ureteric bud development	cell surface|cytoplasm|extracellular space|plasma membrane	calcium ion binding|GTPase inhibitor activity|heparin binding|laminin-1 binding|protein homodimerization activity|proteoglycan binding|Roundabout binding			central_nervous_system(4)|skin(4)|ovary(3)	11						ACTATACTTGCCCCTTCTTCT	0.438													76	59	---	---	---	---	
PDS5A	23244	broad.mit.edu	37	4	39918636	39918636	+	Intron	DEL	A	-	-	rs10001599	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:39918636delA	uc003guv.3	-						PDS5A_uc010ifo.2_Intron|PDS5A_uc003guw.3_Intron	NM_001100399	NP_001093869	Q29RF7	PDS5A_HUMAN	PDS5, regulator of cohesion maintenance, homolog						cell division|mitosis|negative regulation of DNA replication	chromatin|nucleus	identical protein binding				0						Caaaaaaattaaaaaaaaaaa	0.308													4	2	---	---	---	---	
C4orf22	255119	broad.mit.edu	37	4	81283670	81283671	+	Intron	INS	-	T	T	rs138991121	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:81283670_81283671insT	uc003hmf.2	+						C4orf22_uc010ijp.2_Intron	NM_152770	NP_689983	Q6V702	CD022_HUMAN	hypothetical protein LOC255119											skin(2)	2						AGCAATTGACATTTTTTTTTCA	0.257													2	5	---	---	---	---	
EMCN	51705	broad.mit.edu	37	4	101343980	101343980	+	Intron	DEL	T	-	-	rs71878999		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:101343980delT	uc003hvr.2	-						EMCN_uc011cel.1_Intron|EMCN_uc011cem.1_Intron	NM_016242	NP_057326	Q9ULC0	MUCEN_HUMAN	endomucin isoform 1							extracellular region|integral to membrane|plasma membrane					0				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		ctttcttttcttttttttttt	0.284													3	3	---	---	---	---	
PDZD2	23037	broad.mit.edu	37	5	32000586	32000597	+	Intron	DEL	TTTGTTTTTGTT	-	-	rs71863988		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:32000586_32000597delTTTGTTTTTGTT	uc003jhl.2	+						PDZD2_uc003jhm.2_Intron|PDZD2_uc011cnx.1_Intron	NM_178140	NP_835260	O15018	PDZD2_HUMAN	PDZ domain containing 2						cell adhesion	cell-cell junction|endoplasmic reticulum|extracellular region|nucleus				central_nervous_system(4)|ovary(2)|skin(2)|large_intestine(1)	9						CCTTAAGAAGtttgtttttgtttttgtttttg	0.222													6	4	---	---	---	---	
Unknown	0	broad.mit.edu	37	5	116051908	116051908	+	IGR	DEL	T	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:116051908delT								SEMA6A (141357 upstream) : None (None downstream)																							AAAATTGCCATTTACGCCCCT	0.483													10	11	---	---	---	---	
LOX	4015	broad.mit.edu	37	5	121410015	121410016	+	Intron	INS	-	T	T	rs145567866	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:121410015_121410016insT	uc003ksu.2	-						LOX_uc010jcp.2_5'Flank|LOX_uc010jcq.2_Intron|LOX_uc011cwk.1_Intron|LOX_uc010jcr.2_Intron	NM_002317	NP_002308	P28300	LYOX_HUMAN	lysyl oxidase preproprotein						protein modification process	extracellular space	copper ion binding|protein-lysine 6-oxidase activity			lung(1)	1		all_cancers(142;0.0124)|Prostate(80;0.0322)|Ovarian(225;0.0814)|Breast(839;0.143)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;2.14e-11)|OV - Ovarian serous cystadenocarcinoma(64;7.87e-10)|all cancers(49;2.49e-09)|COAD - Colon adenocarcinoma(49;0.02)		TCATGCTAGGGTTTTTTTTTCC	0.327													4	3	---	---	---	---	
FLT4	2324	broad.mit.edu	37	5	180049924	180049926	+	Intron	DEL	CAC	-	-	rs145833534		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:180049924_180049926delCAC	uc003mma.3	-						FLT4_uc003mlz.3_Intron|FLT4_uc003mmb.1_Intron|FLT4_uc011dgy.1_Intron	NM_002020	NP_002011	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4 isoform 2						positive regulation of cell proliferation	integral to plasma membrane	ATP binding|protein phosphatase binding|vascular endothelial growth factor receptor activity			lung(7)|skin(2)|ovary(2)|stomach(1)|central_nervous_system(1)|breast(1)|kidney(1)	15	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Sorafenib(DB00398)|Sunitinib(DB01268)	GGTCGCTGTGCACCACCCCCCCC	0.591									Congenital_Hereditary_Lymphedema				4	2	---	---	---	---	
LRRC16A	55604	broad.mit.edu	37	6	25450066	25450066	+	Intron	DEL	T	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:25450066delT	uc011djw.1	+						LRRC16A_uc010jpx.2_Intron|LRRC16A_uc010jpy.2_Intron|LRRC16A_uc003nez.1_5'Flank	NM_017640	NP_060110	Q5VZK9	LR16A_HUMAN	leucine rich repeat containing 16A						actin filament organization|blood coagulation|cell migration|lamellipodium assembly|ruffle organization|urate metabolic process	cytosol|lamellipodium|nucleus				ovary(1)|breast(1)|central_nervous_system(1)|pancreas(1)	4						ACAAAATTTATTTCTATGTGC	0.343													18	12	---	---	---	---	
AQP1	358	broad.mit.edu	37	7	30963272	30963272	+	3'UTR	DEL	G	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:30963272delG	uc003tbv.1	+	4					AQP1_uc011kac.1_3'UTR|AQP1_uc010kwf.1_3'UTR|AQP1_uc010kwg.1_3'UTR|AQP1_uc010kwh.1_3'UTR	NM_198098	NP_932766	P29972	AQP1_HUMAN	aquaporin 1						ammonium transport|cell volume homeostasis|cellular hyperosmotic response|cellular response to cAMP|cellular response to copper ion|cellular response to dexamethasone stimulus|cellular response to hydrogen peroxide|cellular response to hypoxia|cellular response to mechanical stimulus|cellular response to mercury ion|cellular response to nitric oxide|cellular response to retinoic acid|cellular response to salt stress|cellular response to UV|cerebrospinal fluid secretion|cGMP biosynthetic process|establishment or maintenance of actin cytoskeleton polarity|lateral ventricle development|maintenance of symbiont-containing vacuole via substance secreted by host|negative regulation of apoptosis|odontogenesis|pancreatic juice secretion|positive regulation of angiogenesis|positive regulation of fibroblast proliferation|positive regulation of saliva secretion|renal water transport|response to drug|transepithelial water transport	apical plasma membrane|basal plasma membrane|brush border membrane|cytoplasm|integral to plasma membrane|nuclear membrane|sarcolemma|symbiont-containing vacuole	ammonia transmembrane transporter activity|carbon dioxide transmembrane transporter activity|glycerol transmembrane transporter activity|intracellular cGMP activated cation channel activity|nitric oxide transmembrane transporter activity|potassium channel activity|potassium ion transmembrane transporter activity|protein binding|water channel activity				0		Melanoma(862;0.16)			Acetazolamide(DB00819)	CATCCACGTAGGGGGCAGGGG	0.612													7	5	---	---	---	---	
VSTM2A	222008	broad.mit.edu	37	7	54617475	54617475	+	Intron	DEL	C	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:54617475delC	uc010kzf.2	+						VSTM2A_uc010kze.2_Intron|VSTM2A_uc003tqc.3_Intron	NM_182546	NP_872352	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2							extracellular region					0			STAD - Stomach adenocarcinoma(5;0.0525)			AAAAATGGAACAAAATCATTT	0.368													12	7	---	---	---	---	
CCL26	10344	broad.mit.edu	37	7	75419496	75419497	+	5'Flank	INS	-	CTTTCTTTCTTTCTTT	CTTTCTTTCTTTCTTT	rs150074330	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:75419496_75419497insCTTTCTTTCTTTCTTT	uc003udt.1	-							NM_006072	NP_006063	Q9Y258	CCL26_HUMAN	chemokine (C-C motif) ligand 26 precursor						cell-cell signaling|chemotaxis|immune response|inflammatory response|positive regulation of actin filament polymerization|positive regulation of cell migration|positive regulation of endothelial cell proliferation|positive regulation of Rac GTPase activity|signal transduction	extracellular space	chemokine activity				0						ttccttccttcctttctttctt	0.000													4	3	---	---	---	---	
GAL3ST4	79690	broad.mit.edu	37	7	99757342	99757343	+	3'UTR	INS	-	A	A	rs78325297		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:99757342_99757343insA	uc003utt.2	-	3					C7orf43_uc010lgp.2_5'Flank|C7orf43_uc011kjj.1_5'Flank|C7orf43_uc003utr.2_5'Flank|C7orf43_uc003uts.2_5'Flank|GAL3ST4_uc003utu.2_3'UTR|GAL3ST4_uc010lgq.2_3'UTR	NM_024637	NP_078913	Q96RP7	G3ST4_HUMAN	galactose-3-O-sulfotransferase 4						cell-cell signaling|oligosaccharide metabolic process|proteoglycan biosynthetic process|sulfur compound metabolic process	Golgi cisterna membrane|integral to membrane|membrane fraction	3'-phosphoadenosine 5'-phosphosulfate binding|galactosylceramide sulfotransferase activity|proteoglycan sulfotransferase activity			ovary(3)	3	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					gactccgtttcaaaaaaaaaaa	0.257													3	3	---	---	---	---	
DLGAP2	9228	broad.mit.edu	37	8	1626678	1626678	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:1626678delC	uc003wpl.2	+	9	2444	c.2347delC	c.(2347-2349)CCGfs	p.P783fs	DLGAP2_uc003wpm.2_Frame_Shift_Del_p.P769fs	NM_004745	NP_004736	Q9P1A6	DLGP2_HUMAN	discs large-associated protein 2	862					neuron-neuron synaptic transmission	cell junction|neurofilament|postsynaptic density|postsynaptic membrane	protein binding				0		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		GAGGATGTCTCCGTGCCGCAG	0.597													10	7	---	---	---	---	
KIAA1967	57805	broad.mit.edu	37	8	22472240	22472240	+	Intron	DEL	G	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:22472240delG	uc003xch.2	+						KIAA1967_uc003xci.2_Intron|KIAA1967_uc003xcj.1_Intron	NM_199205	NP_954675	Q8N163	K1967_HUMAN	p30 DBC protein						apoptosis|positive regulation of apoptosis	mitochondrial matrix|nucleus	enzyme binding|enzyme inhibitor activity			ovary(1)|central_nervous_system(1)|skin(1)	3		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00593)|Colorectal(74;0.0157)|COAD - Colon adenocarcinoma(73;0.064)		ACTGTGTGGTGGACTTCCCCA	0.527													5	8	---	---	---	---	
CHD7	55636	broad.mit.edu	37	8	61655401	61655402	+	Frame_Shift_Ins	INS	-	T	T			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:61655401_61655402insT	uc003xue.2	+	2	1887_1888	c.1410_1411insT	c.(1408-1413)GAATTGfs	p.E470fs		NM_017780	NP_060250	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	470_471	Pro-rich.				central nervous system development|chromatin modification|cognition|cranial nerve development|face development|heart morphogenesis|in utero embryonic development|inner ear morphogenesis|nose development|palate development|regulation of growth hormone secretion|regulation of transcription, DNA-dependent|retina development in camera-type eye|skeletal system development|T cell differentiation|transcription, DNA-dependent	nucleus	ATP binding|chromatin binding|DNA binding|helicase activity			ovary(4)|large_intestine(1)|central_nervous_system(1)|lung(1)|breast(1)|pancreas(1)	9		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CACCAAGGGAATTGACTGGGCA	0.550													28	14	---	---	---	---	
HAUS6	54801	broad.mit.edu	37	9	19082749	19082750	+	Intron	INS	-	A	A			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:19082749_19082750insA	uc003znk.2	-						HAUS6_uc011lmz.1_Intron|HAUS6_uc003znl.1_Intron|HAUS6_uc003znm.1_Intron	NM_017645	NP_060115	Q7Z4H7	HAUS6_HUMAN	HAUS augmin-like complex, subunit 6						cell division|centrosome organization|mitosis|spindle assembly	centrosome|HAUS complex|microtubule|nucleus|spindle				ovary(2)	2						aattctgtctcaaaaaaaaaac	0.099													5	3	---	---	---	---	
AQP7	364	broad.mit.edu	37	9	33395300	33395300	+	Intron	DEL	C	-	-	rs77570582		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:33395300delC	uc003zst.2	-						SUGT1P1_uc010mjq.1_Intron|AQP7_uc003zsu.1_Intron|AQP7_uc010mjs.2_5'Flank|AQP7_uc010mjt.2_5'UTR|AQP7_uc011lnx.1_Intron|AQP7_uc011lny.1_5'UTR|AQP7_uc003zss.3_Intron|AQP7_uc011lnz.1_Intron|AQP7_uc011loa.1_Intron	NM_001170	NP_001161	O14520	AQP7_HUMAN	aquaporin 7						excretion|generation of precursor metabolites and energy	cell-cell junction|cytoplasm|integral to plasma membrane	glycerol channel activity|water channel activity				0			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		AGCAGCCTCGCCCACACACGC	0.602													8	4	---	---	---	---	
COL5A1	1289	broad.mit.edu	37	9	137618893	137618896	+	Intron	DEL	GGAT	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:137618893_137618896delGGAT	uc004cfe.2	+							NM_000093	NP_000084	P20908	CO5A1_HUMAN	alpha 1 type V collagen preproprotein						axon guidance|cell adhesion|collagen biosynthetic process|collagen fibril organization|eye morphogenesis|fibril organization|integrin biosynthetic process|skin development|wound healing, spreading of epidermal cells	collagen type V	heparin binding|integrin binding|platelet-derived growth factor binding|proteoglycan binding			skin(4)|ovary(3)|pancreas(2)|central_nervous_system(1)|kidney(1)	11		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		atgagtgaacggatggatggatgg	0.176													2	5	---	---	---	---	
UBAC1	10422	broad.mit.edu	37	9	138852863	138852863	+	Intron	DEL	G	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138852863delG	uc004cgt.2	-						UBAC1_uc004cgs.1_Intron|UBAC1_uc004cgu.2_Intron	NM_016172	NP_057256	Q9BSL1	UBAC1_HUMAN	ubiquitin associated domain containing 1							Golgi apparatus|plasma membrane	protein binding			skin(2)	2		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.1e-06)|Epithelial(140;7.79e-06)		GAGGGGGCCCGGCCTTACGTG	0.731													10	17	---	---	---	---	
KIAA1984	84960	broad.mit.edu	37	9	139697328	139697328	+	Intron	DEL	G	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:139697328delG	uc004cjf.2	+							NM_001039374	NP_001034463	Q5T5S1	K1984_HUMAN	hypothetical protein LOC84960											ovary(1)	1	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GCCCAGGGCTGGGGGCCCCCC	0.701													7	4	---	---	---	---	
PDCD11	22984	broad.mit.edu	37	10	105159972	105159973	+	Intron	INS	-	G	G			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:105159972_105159973insG	uc001kwy.1	+							NM_014976	NP_055791	Q14690	RRP5_HUMAN	programmed cell death 11						mRNA processing|rRNA processing	nucleolus	RNA binding|transcription factor binding			ovary(2)|breast(2)|skin(2)|central_nervous_system(1)	7		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;7.21e-09)|all cancers(201;1.17e-08)|BRCA - Breast invasive adenocarcinoma(275;0.208)		GGAACATTGGCGGCCCCCCCCC	0.480													4	2	---	---	---	---	
CTTN	2017	broad.mit.edu	37	11	70281531	70281531	+	3'UTR	DEL	T	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:70281531delT	uc001opv.3	+	18					CTTN_uc001opu.2_Intron|CTTN_uc001opw.3_3'UTR|CTTN_uc010rqm.1_Intron|CTTN_uc001opx.2_3'UTR	NM_005231	NP_005222	Q14247	SRC8_HUMAN	cortactin isoform a							cell cortex|cytoskeleton|lamellipodium|ruffle|soluble fraction	protein binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(2;4.34e-41)|LUSC - Lung squamous cell carcinoma(11;1.51e-13)|STAD - Stomach adenocarcinoma(18;0.0513)	Lung(977;0.0234)|LUSC - Lung squamous cell carcinoma(976;0.133)		GCATTGATGGTTTTTTTTTTC	0.408													5	3	---	---	---	---	
PUS7L	83448	broad.mit.edu	37	12	44130669	44130669	+	Intron	DEL	A	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44130669delA	uc001rnq.3	-						PUS7L_uc001rnr.3_Intron|PUS7L_uc001rns.3_Intron|PUS7L_uc009zkb.2_Intron	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.						pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		CCCTGCTATTAAAAAAAAAAA	0.308													6	3	---	---	---	---	
SOCS2	8835	broad.mit.edu	37	12	93968379	93968379	+	Intron	DEL	T	-	-	rs35259505		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:93968379delT	uc001tcw.1	+						uc001tcv.1_5'Flank|uc001tcu.2_5'Flank|SOCS2_uc001tcx.1_Intron|SOCS2_uc009zsu.2_3'UTR|SOCS2_uc001tcy.1_Intron|SOCS2_uc001tcz.2_3'UTR	NM_003877	NP_003868	O14508	SOCS2_HUMAN	suppressor of cytokine signaling-2						anti-apoptosis|growth hormone receptor signaling pathway|JAK-STAT cascade|negative regulation of signal transduction|regulation of cell growth|response to estradiol stimulus	cytoplasm	growth hormone receptor binding|insulin-like growth factor receptor binding|JAK pathway signal transduction adaptor activity|prolactin receptor binding|SH3/SH2 adaptor activity			lung(1)	1						ACACACCACCTTTTTTTTTTT	0.328													4	2	---	---	---	---	
MYBPC1	4604	broad.mit.edu	37	12	102008088	102008089	+	Intron	DEL	GT	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102008088_102008089delGT	uc001tii.2	+						MYBPC1_uc001tif.1_Intron|MYBPC1_uc001tig.2_Intron|MYBPC1_uc010svq.1_Intron|MYBPC1_uc001tih.2_Intron|MYBPC1_uc001tij.2_Intron|MYBPC1_uc010svr.1_Intron|MYBPC1_uc010svs.1_Intron|MYBPC1_uc010svt.1_Intron|MYBPC1_uc010svu.1_Intron|MYBPC1_uc001tik.2_Intron	NM_206820	NP_996556	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type isoform 3						cell adhesion|muscle filament sliding	cytosol|myofibril|myosin filament	actin binding|structural constituent of muscle|titin binding			ovary(2)|liver(1)|skin(1)	4						ATGCAGTAGGGTGTGTGTGTGT	0.411													4	2	---	---	---	---	
ATXN2	6311	broad.mit.edu	37	12	111951477	111951477	+	Intron	DEL	A	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:111951477delA	uc001tsj.2	-						ATXN2_uc001tsh.2_Intron|ATXN2_uc001tsi.2_Intron|ATXN2_uc001tsk.2_Intron|ATXN2_uc001tsm.1_Intron	NM_002973	NP_002964	Q99700	ATX2_HUMAN	ataxin 2						cell death|cytoplasmic mRNA processing body assembly|regulation of translation|RNA metabolic process|RNA transport|stress granule assembly	nucleus|perinuclear region of cytoplasm|polysome|stress granule|trans-Golgi network	protein C-terminus binding|RNA binding			ovary(1)|breast(1)	2						TTAAAAATAGAAAAAAAAAAA	0.199													4	2	---	---	---	---	
RPH3A	22895	broad.mit.edu	37	12	113312837	113312838	+	Intron	DEL	TG	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113312837_113312838delTG	uc010syl.1	+						RPH3A_uc001ttz.2_Intron|RPH3A_uc001tty.2_Intron|RPH3A_uc009zwe.1_Intron|RPH3A_uc010sym.1_Intron|RPH3A_uc001tua.2_Intron	NM_001143854	NP_001137326	Q9Y2J0	RP3A_HUMAN	rabphilin 3A homolog isoform 1						intracellular protein transport	cell junction|synaptic vesicle	Rab GTPase binding|transporter activity|zinc ion binding			ovary(3)|central_nervous_system(2)|skin(2)	7				BRCA - Breast invasive adenocarcinoma(302;0.00453)		TCCTTCCTGCTGTGTGTGTGTG	0.564													6	3	---	---	---	---	
UGGT2	55757	broad.mit.edu	37	13	96552961	96552962	+	Intron	DEL	TG	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:96552961_96552962delTG	uc001vmt.2	-							NM_020121	NP_064506	Q9NYU1	UGGG2_HUMAN	UDP-glucose ceramide glucosyltransferase-like 2						post-translational protein modification|protein folding|protein N-linked glycosylation via asparagine	endoplasmic reticulum lumen|ER-Golgi intermediate compartment	UDP-glucose:glycoprotein glucosyltransferase activity			ovary(2)|central_nervous_system(1)	3						CACCGTCCTCTGTGTGTGTCAG	0.441													19	19	---	---	---	---	
KHNYN	23351	broad.mit.edu	37	14	24901672	24901674	+	In_Frame_Del	DEL	GAG	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:24901672_24901674delGAG	uc001wph.3	+	3	1407_1409	c.1205_1207delGAG	c.(1204-1209)CGAGGC>CGC	p.G403del	KHNYN_uc010tpc.1_In_Frame_Del_p.G444del|KHNYN_uc010alw.2_In_Frame_Del_p.G403del|CBLN3_uc001wpg.3_5'Flank	NM_015299	NP_056114	O15037	KHNYN_HUMAN	hypothetical protein LOC23351	403										ovary(2)|liver(1)	3						CAATGGAAACGAGGCGCCCGAGG	0.655											OREG0022627	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	26	12	---	---	---	---	
Unknown	0	broad.mit.edu	37	15	20454213	20454214	+	IGR	INS	-	T	T	rs144687403		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:20454213_20454214insT								None (None upstream) : GOLGA6L6 (282880 downstream)																							GACCCTCAAGCtttttttttct	0.267													4	2	---	---	---	---	
PDIA2	64714	broad.mit.edu	37	16	332559	332559	+	Intron	DEL	G	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:332559delG	uc002cgn.1	+						ARHGDIG_uc002cgm.1_Intron|PDIA2_uc010bqt.1_5'Flank|PDIA2_uc002cgo.1_5'Flank	NM_006849	NP_006840	Q13087	PDIA2_HUMAN	protein disulfide isomerase A2 precursor						apoptosis|cell redox homeostasis|glycerol ether metabolic process|protein folding|protein retention in ER lumen|response to hypoxia	endoplasmic reticulum lumen	electron carrier activity|protein binding|protein disulfide isomerase activity|protein disulfide oxidoreductase activity|steroid binding			central_nervous_system(1)|skin(1)	2		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				GGAACGGGGCGGGGGGGGGAA	0.692													4	3	---	---	---	---	
SRCAP	10847	broad.mit.edu	37	16	30725221	30725222	+	Intron	INS	-	TT	TT	rs71374028		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:30725221_30725222insTT	uc002dze.1	+						SRCAP_uc002dzf.2_Intron|SRCAP_uc002dzg.1_Intron|SRCAP_uc010bzz.1_Intron	NM_006662	NP_006653	Q6ZRS2	SRCAP_HUMAN	Snf2-related CBP activator protein						interspecies interaction between organisms|regulation of transcription from RNA polymerase II promoter|transcription, DNA-dependent	Golgi apparatus|nucleus|protein complex	ATP binding|DNA binding|helicase activity|histone acetyltransferase activity|transcription coactivator activity			ovary(3)|skin(1)	4			Colorectal(24;0.198)			CATCAAttctgttttttttttt	0.223													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	87255723	87255725	+	Intron	DEL	CAC	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:87255723_87255725delCAC	uc002fjt.1	-											Homo sapiens cDNA FLJ43761 fis, clone TESTI2048109.																		ccaccaccatcaccaccaccacc	0.000													5	3	---	---	---	---	
P2RX1	5023	broad.mit.edu	37	17	3802503	3802504	+	Intron	INS	-	T	T	rs71381525		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3802503_3802504insT	uc002fww.2	-							NM_002558	NP_002549	P51575	P2RX1_HUMAN	purinergic receptor P2X1						platelet activation	integral to plasma membrane	calcium channel activity|extracellular ATP-gated cation channel activity|purinergic nucleotide receptor activity			ovary(1)|skin(1)	2				LUAD - Lung adenocarcinoma(2;1.9e-05)|Lung(3;0.0173)		ACTCCtttttcttttttttttt	0.252													4	2	---	---	---	---	
PLSCR3	57048	broad.mit.edu	37	17	7307103	7307103	+	Intron	DEL	A	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7307103delA	uc002ggr.1	-						PLSCR3_uc010cmg.1_Intron|C17orf61_uc002ggs.2_Intron	NM_020360	NP_065093	Q9NRY6	PLS3_HUMAN	phospholipid scramblase 3						phospholipid scrambling	integral to membrane|plasma membrane	calcium ion binding|calcium-dependent protein binding|phospholipid scramblase activity|SH3 domain binding				0		Prostate(122;0.173)				GAGAAAGGGCACCCCCCCCCC	0.627													4	2	---	---	---	---	
MED13	9969	broad.mit.edu	37	17	60070140	60070141	+	Intron	INS	-	T	T	rs138009503	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:60070140_60070141insT	uc002izo.2	-							NM_005121	NP_005112	Q9UHV7	MED13_HUMAN	mediator complex subunit 13						androgen receptor signaling pathway|positive regulation of transcription from RNA polymerase II promoter|transcription initiation from RNA polymerase II promoter	mediator complex	ligand-dependent nuclear receptor transcription coactivator activity|receptor activity|RNA polymerase II transcription cofactor activity|thyroid hormone receptor binding|vitamin D receptor binding			large_intestine(1)|ovary(1)	2						cttattattacttttttttgag	0.000													4	4	---	---	---	---	
BAHCC1	57597	broad.mit.edu	37	17	79419160	79419185	+	Intron	DEL	GGGAGGGTCGCAGCACCCCCACCCCC	-	-	rs67000403		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:79419160_79419185delGGGAGGGTCGCAGCACCCCCACCCCC	uc002kaf.2	+						BAHCC1_uc002kae.2_Intron|hsa-mir-3186|MI0014229_5'Flank	NM_001080519	NP_001073988	Q9P281	BAHC1_HUMAN	BAH domain and coiled-coil containing 1								DNA binding			ovary(1)	1	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0224)|OV - Ovarian serous cystadenocarcinoma(97;0.116)			GGGGGGGCCTGGGAGGGTCGCAGCACCCCCACCCCCGGGAGGCGCC	0.726													4	2	---	---	---	---	
MYO5B	4645	broad.mit.edu	37	18	47352665	47352666	+	3'UTR	INS	-	A	A	rs149289525	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:47352665_47352666insA	uc002leb.2	-	40					MYO5B_uc002ldz.2_3'UTR|MYO5B_uc002lea.2_3'UTR	NM_001080467	NP_001073936	Q9ULV0	MYO5B_HUMAN	myosin VB						protein transport	myosin complex	actin binding|ATP binding|calmodulin binding|motor activity			ovary(2)|skin(2)|central_nervous_system(1)	5				READ - Rectum adenocarcinoma(32;0.103)		GCAGTAGGTACAAAAAATAATG	0.347													4	2	---	---	---	---	
COX7A1	1346	broad.mit.edu	37	19	36642561	36642562	+	Intron	INS	-	C	C	rs150771533	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:36642561_36642562insC	uc002odm.1	-							NM_001864	NP_001855	P24310	CX7A1_HUMAN	cytochrome c oxidase subunit VIIa polypeptide 1						generation of precursor metabolites and energy	integral to membrane|mitochondrial respiratory chain	cytochrome-c oxidase activity|electron carrier activity				0	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			CACCCCCCCCGACCCCCCACCT	0.698													8	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	20	58889651	58889662	+	Intron	DEL	CATTCTCCCATT	-	-	rs114216255	by1000genomes	TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:58889651_58889662delCATTCTCCCATT	uc002ybl.2	+						uc010gjw.1_Intron					Homo sapiens cDNA FLJ35486 fis, clone SMINT2008491.																		tccatccatccattctcccattcatccatcct	0.000													6	3	---	---	---	---	
DNAJC28	54943	broad.mit.edu	37	21	34861875	34861875	+	Intron	DEL	T	-	-	rs77181674		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34861875delT	uc002yrv.2	-						DNAJC28_uc002yrw.2_Intron	NM_017833	NP_060303	Q9NX36	DJC28_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 28								heat shock protein binding				0						AACTTTttccttttttttttt	0.154													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	X	9373793	9373793	+	5'Flank	DEL	C	-	-	rs112728045		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:9373793delC	uc004csk.2	-											DQ576926																		TGCACACTGACCACATCGGGA	0.488													6	3	---	---	---	---	
SLC6A14	11254	broad.mit.edu	37	X	115586131	115586132	+	Intron	DEL	TT	-	-			TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:115586131_115586132delTT	uc004eqi.2	+							NM_007231	NP_009162	Q9UN76	S6A14_HUMAN	solute carrier family 6 (amino acid						cellular amino acid metabolic process|response to toxin	integral to membrane	amino acid transmembrane transporter activity|neurotransmitter:sodium symporter activity			ovary(2)|pancreas(1)	3					L-Proline(DB00172)	GTAATTAACATTTTTTTGGTAG	0.337													127	121	---	---	---	---	
AFF2	2334	broad.mit.edu	37	X	148059145	148059152	+	Intron	DEL	ACACACAC	-	-	rs147274832		TCGA-60-2710-01	TCGA-60-2710-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:148059145_148059152delACACACAC	uc004fcp.2	+						AFF2_uc004fcq.2_Intron|AFF2_uc004fcr.2_Intron|AFF2_uc011mxb.1_Intron|AFF2_uc004fcs.2_Intron|AFF2_uc011mxc.1_Intron	NM_002025	NP_002016	P51816	AFF2_HUMAN	fragile X mental retardation 2						brain development|mRNA processing|regulation of RNA splicing|RNA splicing	nuclear speck	G-quadruplex RNA binding|protein binding			ovary(3)|pancreas(2)	5	Acute lymphoblastic leukemia(192;6.56e-05)					CAGCATTTAGacacacacacacacacac	0.298													4	2	---	---	---	---	
