Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	t_alt_count	t_ref_count	validation_status	validation_method	validation_tumor_sample	validation_alt_allele	filter
FAM131C	348487	broad.mit.edu	37	1	16385178	16385178	+	Silent	SNP	G	A	A	rs80297394		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:16385178G>A	uc001axz.3	-	7	787	c.597C>T	c.(595-597)CCC>CCT	p.P199P	FAM131C_uc010obz.1_Intron	NM_182623	NP_872429	Q96AQ9	F131C_HUMAN	hypothetical protein LOC348487	199											0		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.32e-08)|COAD - Colon adenocarcinoma(227;5.56e-06)|BRCA - Breast invasive adenocarcinoma(304;9.12e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGGCCGCTGGGAAGGCTGT	0.647													3	7	---	---	---	---	PASS
MACF1	23499	broad.mit.edu	37	1	39823488	39823488	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:39823488G>A	uc010oiu.1	+	9	7317	c.7186G>A	c.(7186-7188)GAA>AAA	p.E2396K	MACF1_uc010ois.1_Missense_Mutation_p.E1894K|MACF1_uc001cda.1_Missense_Mutation_p.E1802K|MACF1_uc001cdc.1_Missense_Mutation_p.E981K|MACF1_uc001cdb.1_Missense_Mutation_p.E981K	NM_033044	NP_149033	Q9UPN3	MACF1_HUMAN	microfilament and actin filament cross-linker	3961					cell cycle arrest|Golgi to plasma membrane protein transport|positive regulation of Wnt receptor signaling pathway|regulation of epithelial cell migration|regulation of focal adhesion assembly|regulation of microtubule-based process|Wnt receptor signaling pathway|wound healing	Golgi apparatus|microtubule|ruffle membrane	actin filament binding|ATPase activity|calcium ion binding|microtubule binding			ovary(8)|breast(3)|central_nervous_system(3)|skin(2)	16	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGAAGGCAAAGAACCATCAGA	0.428													11	82	---	---	---	---	PASS
ASB17	127247	broad.mit.edu	37	1	76397634	76397634	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:76397634G>A	uc001dhe.1	-	1	483	c.343C>T	c.(343-345)CTC>TTC	p.L115F	ASB17_uc001dhf.1_RNA	NM_080868	NP_543144	Q8WXJ9	ASB17_HUMAN	ankyrin repeat and SOCS box-containing 17	115					intracellular signal transduction					ovary(1)	1						GTCTTCTTGAGAAGCAATTCC	0.338													27	71	---	---	---	---	PASS
PLEKHO1	51177	broad.mit.edu	37	1	150131220	150131220	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:150131220G>T	uc001ett.2	+	6	1010	c.732G>T	c.(730-732)TGG>TGT	p.W244C	PLEKHO1_uc001etr.2_Missense_Mutation_p.W72C|PLEKHO1_uc001ets.2_Missense_Mutation_p.W61C|PLEKHO1_uc001etu.2_Missense_Mutation_p.W72C	NM_016274	NP_057358	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O	244	Interaction with ATM, CKIP, IFP35 and NMI.					cytoplasm|nucleus|plasma membrane				lung(1)	1	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CCCGACCTTGGGAAAAAACAG	0.637													16	93	---	---	---	---	PASS
SHC1	6464	broad.mit.edu	37	1	154942792	154942792	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:154942792C>T	uc001ffv.2	-	1	432	c.211G>A	c.(211-213)GCC>ACC	p.A71T	SHC1_uc001ffz.1_5'Flank|SHC1_uc001ffw.2_Missense_Mutation_p.A71T|SHC1_uc001ffx.2_Intron|SHC1_uc001ffy.2_Intron	NM_183001	NP_892113	P29353	SHC1_HUMAN	SHC-transforming protein 1 isoform 1	71					activation of MAPK activity|blood coagulation|epidermal growth factor receptor signaling pathway|fibroblast growth factor receptor signaling pathway|insulin receptor signaling pathway|leukocyte migration|nerve growth factor receptor signaling pathway|positive regulation of DNA replication|Ras protein signal transduction|regulation of epidermal growth factor receptor activity|regulation of growth	cytosol|mitochondrial matrix|Shc-EGFR complex	epidermal growth factor receptor binding|insulin receptor binding|insulin-like growth factor receptor binding|phospholipid binding|protein binding|transmembrane receptor protein tyrosine kinase adaptor activity			lung(1)|skin(1)	2	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.245)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			GCCGGGTTGGCCAGCCTCAGG	0.662													3	58	---	---	---	---	PASS
CD1E	913	broad.mit.edu	37	1	158325820	158325820	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:158325820G>T	uc001fse.2	+	4	1068	c.829G>T	c.(829-831)GCT>TCT	p.A277S	CD1E_uc010pid.1_Missense_Mutation_p.A275S|CD1E_uc010pie.1_Missense_Mutation_p.A178S|CD1E_uc010pif.1_Missense_Mutation_p.A88S|CD1E_uc001fsd.2_Intron|CD1E_uc001fsk.2_Missense_Mutation_p.A187S|CD1E_uc001fsj.2_Intron|CD1E_uc001fsc.2_Missense_Mutation_p.A88S|CD1E_uc010pig.1_Intron|CD1E_uc001fsa.2_Intron|CD1E_uc001fsf.2_Missense_Mutation_p.A277S|CD1E_uc001fry.2_Intron|CD1E_uc001fsg.2_Intron|CD1E_uc001fsh.2_Missense_Mutation_p.A88S|CD1E_uc001fsi.2_Intron|CD1E_uc009wsv.2_Missense_Mutation_p.A178S|CD1E_uc001frz.2_Missense_Mutation_p.A187S|CD1E_uc009wsw.2_Missense_Mutation_p.A35S	NM_030893	NP_112155	P15812	CD1E_HUMAN	CD1E antigen isoform a precursor	277	Ig-like.				antigen processing and presentation|immune response	early endosome|Golgi membrane|integral to plasma membrane|late endosome|lysosomal lumen				skin(3)	3	all_hematologic(112;0.0378)					GGATGTGGCGGCTGGGGAGGC	0.612													18	86	---	---	---	---	PASS
XCL1	6375	broad.mit.edu	37	1	168549290	168549290	+	Intron	SNP	T	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:168549290T>G	uc001gfo.1	+							NM_002995	NP_002986	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1						CD4-positive, alpha-beta T cell proliferation|CD8-positive, alpha-beta T cell proliferation|cell-cell signaling|cellular response to interleukin-4|cellular response to transforming growth factor beta stimulus|immunoglobulin production in mucosal tissue|lymphocyte chemotaxis|negative regulation of interferon-gamma production|negative regulation of interleukin-2 production|negative regulation of sequence-specific DNA binding transcription factor activity|negative regulation of T cell cytokine production|negative regulation of T-helper 1 cell activation|negative regulation of transcription, DNA-dependent|neutrophil chemotaxis|positive regulation of activated T cell proliferation|positive regulation of B cell chemotaxis|positive regulation of granzyme A production|positive regulation of granzyme B production|positive regulation of interleukin-10 production|positive regulation of natural killer cell chemotaxis|positive regulation of neutrophil chemotaxis|positive regulation of release of sequestered calcium ion into cytosol|positive regulation of T cell chemotaxis|positive regulation of T cell cytokine production|positive regulation of T cell mediated cytotoxicity|positive regulation of thymocyte migration|positive regulation of transforming growth factor-beta production|regulation of inflammatory response|release of sequestered calcium ion into cytosol|response to virus|T-helper 1 cell cytokine production|T-helper 2 cell cytokine production	extracellular space	chemokine activity|protein homodimerization activity				0	all_hematologic(923;0.208)					TTGTTTTTTTTTCCTCACCAG	0.408													17	103	---	---	---	---	PASS
ASPM	259266	broad.mit.edu	37	1	197069639	197069639	+	Silent	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:197069639G>A	uc001gtu.2	-	18	8999	c.8742C>T	c.(8740-8742)ATC>ATT	p.I2914I	ASPM_uc001gtv.2_Intron|ASPM_uc001gtw.3_Silent_p.I762I	NM_018136	NP_060606	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle)-like, microcephaly	2914	IQ 33.				mitosis	cytoplasm|nucleus	calmodulin binding			ovary(4)|central_nervous_system(2)	6						CTTGAATAATGATAACACTGC	0.294													10	129	---	---	---	---	PASS
RNPEP	6051	broad.mit.edu	37	1	201958664	201958664	+	Intron	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:201958664G>C	uc001gxd.2	+						RNPEP_uc001gxe.2_Intron|RNPEP_uc001gxf.2_Intron	NM_020216	NP_064601	Q9H4A4	AMPB_HUMAN	arginyl aminopeptidase						leukotriene biosynthetic process		epoxide hydrolase activity|zinc ion binding			upper_aerodigestive_tract(1)	1				KIRC - Kidney renal clear cell carcinoma(1967;3.23e-08)|Colorectal(1306;0.005)		ACCCAGGTAGGAGACAAAGAC	0.547													15	168	---	---	---	---	PASS
SYT2	127833	broad.mit.edu	37	1	202574852	202574852	+	Missense_Mutation	SNP	T	G	G	rs75160100		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:202574852T>G	uc001gye.2	-	2	242	c.49A>C	c.(49-51)ACC>CCC	p.T17P	SYT2_uc010pqb.1_Missense_Mutation_p.T17P|SYT2_uc009xaf.2_Intron	NM_001136504	NP_001129976	Q8N9I0	SYT2_HUMAN	synaptotagmin II	17	Vesicular (Potential).				neurotransmitter secretion	cell junction|chromaffin granule membrane|endocytic vesicle membrane|integral to membrane|synaptic vesicle membrane	protein binding|transporter activity			ovary(2)|skin(1)	3			BRCA - Breast invasive adenocarcinoma(75;0.169)		Botulinum Toxin Type B(DB00042)	GCGGTGGTGGTGGCAGGAGCC	0.577													8	37	---	---	---	---	PASS
CHI3L1	1116	broad.mit.edu	37	1	203152863	203152863	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:203152863G>A	uc001gzi.2	-	5	542	c.371C>T	c.(370-372)CCG>CTG	p.P124L	FMOD_uc010pqi.1_Intron|CHI3L1_uc001gzk.1_5'Flank|CHI3L1_uc001gzj.2_Missense_Mutation_p.P124L	NM_001276	NP_001267	P36222	CH3L1_HUMAN	chitinase 3-like 1 precursor	124					chitin catabolic process	extracellular space|proteinaceous extracellular matrix	cation binding|chitinase activity|extracellular matrix structural constituent|sugar binding			pancreas(1)	1						CAGAAATGGCGGTACTGACTT	0.522													30	79	---	---	---	---	PASS
KLF11	8462	broad.mit.edu	37	2	10192505	10192505	+	Silent	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:10192505G>T	uc002raf.1	+	4	1572	c.1410G>T	c.(1408-1410)ACG>ACT	p.T470T	KLF11_uc010yjc.1_Silent_p.T453T	NM_003597	NP_003588	O14901	KLF11_HUMAN	Kruppel-like factor 11	470	C2H2-type 3.				apoptosis|negative regulation of cell proliferation|negative regulation of transcription from RNA polymerase II promoter|positive regulation of apoptosis|regulation of transcription involved in S phase of mitotic cell cycle	nucleus	sequence-specific DNA binding RNA polymerase II transcription factor activity|transcription regulatory region DNA binding|zinc ion binding			ovary(2)	2	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.133)|OV - Ovarian serous cystadenocarcinoma(76;0.228)		ACCACCTGACGAAGCATGCCC	0.607													27	99	---	---	---	---	PASS
PLB1	151056	broad.mit.edu	37	2	28802550	28802550	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:28802550C>T	uc002rmb.1	+	23	1542	c.1542C>T	c.(1540-1542)GAC>GAT	p.D514D	PLB1_uc010ezj.1_Silent_p.D525D|PLB1_uc002rmc.2_Silent_p.D202D|PLB1_uc002rmd.1_Silent_p.D24D	NM_153021	NP_694566	Q6P1J6	PLB1_HUMAN	phospholipase B1 precursor	514	4 X 308-326 AA approximate repeats.|2.|Extracellular (Potential).				lipid catabolic process|retinoid metabolic process|steroid metabolic process	apical plasma membrane|integral to membrane	lysophospholipase activity|phospholipase A2 activity|retinyl-palmitate esterase activity			ovary(4)|large_intestine(2)|skin(2)|breast(1)	9	Acute lymphoblastic leukemia(172;0.155)					GCGGCAATGACCTCTGTGATT	0.473													52	163	---	---	---	---	PASS
EPAS1	2034	broad.mit.edu	37	2	46597015	46597015	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:46597015G>C	uc002ruv.2	+	7	1317	c.829G>C	c.(829-831)GCC>CCC	p.A277P		NM_001430	NP_001421	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	277	PAS 2.				angiogenesis|myoblast cell fate commitment|positive regulation of transcription from RNA polymerase II promoter|response to hypoxia	transcription factor complex	histone acetyltransferase binding|protein heterodimerization activity|sequence-specific enhancer binding RNA polymerase II transcription factor activity|signal transducer activity|transcription coactivator activity|transcription factor binding			ovary(1)|skin(1)	2		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TGGCCGCTCAGCCTATGAATT	0.478													23	67	---	---	---	---	PASS
DCTN1	1639	broad.mit.edu	37	2	74594825	74594825	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:74594825G>C	uc002skx.2	-	18	2493	c.2182C>G	c.(2182-2184)CAG>GAG	p.Q728E	DCTN1_uc002skt.1_5'Flank|DCTN1_uc002skv.2_Missense_Mutation_p.Q594E|DCTN1_uc002sku.2_Missense_Mutation_p.Q594E|DCTN1_uc002skw.1_Missense_Mutation_p.Q704E|DCTN1_uc010ffd.2_Missense_Mutation_p.Q708E|DCTN1_uc002sky.2_Missense_Mutation_p.Q691E	NM_004082	NP_004073	Q14203	DCTN1_HUMAN	dynactin 1 isoform 1	728					cell death|G2/M transition of mitotic cell cycle|mitosis|nervous system development	centrosome|cytosol|kinetochore|microtubule|spindle pole	motor activity|protein binding			ovary(3)|skin(2)	5						CCCCACACCTGATAGTACTTG	0.502													26	75	---	---	---	---	PASS
MAP4K4	9448	broad.mit.edu	37	2	102481430	102481430	+	Silent	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:102481430C>G	uc002tbg.2	+	17	1960	c.1905C>G	c.(1903-1905)TCC>TCG	p.S635S	MAP4K4_uc002tbc.2_Silent_p.S712S|MAP4K4_uc002tbd.2_Silent_p.S604S|MAP4K4_uc002tbe.2_Silent_p.S550S|MAP4K4_uc002tbf.2_Silent_p.S604S|MAP4K4_uc010yvy.1_Silent_p.S627S|MAP4K4_uc002tbh.2_Silent_p.S550S|MAP4K4_uc002tbi.2_Silent_p.S434S|MAP4K4_uc010yvz.1_Silent_p.S607S|MAP4K4_uc002tbk.2_Silent_p.S90S|MAP4K4_uc002tbl.2_5'UTR	NM_145687	NP_663720	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase	635					intracellular protein kinase cascade|regulation of JNK cascade|response to stress	cytoplasm	ATP binding|protein binding|protein serine/threonine kinase activity|small GTPase regulator activity			stomach(1)|lung(1)|central_nervous_system(1)|skin(1)	4						CTGTTCTGTCCCGTCGAGATT	0.448													4	7	---	---	---	---	PASS
DPP10	57628	broad.mit.edu	37	2	116101417	116101417	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:116101417C>G	uc002tla.1	+	3	657	c.200C>G	c.(199-201)ACC>AGC	p.T67S	DPP10_uc002tlb.1_Missense_Mutation_p.T17S|DPP10_uc002tlc.1_Missense_Mutation_p.T63S|DPP10_uc002tle.2_Missense_Mutation_p.T71S|DPP10_uc002tlf.1_Missense_Mutation_p.T60S	NM_020868	NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl peptidase 10 isoform long	67	Extracellular (Potential).				proteolysis	integral to membrane|membrane fraction	serine-type peptidase activity			ovary(5)|large_intestine(2)|skin(2)|breast(1)	10						TCGTCAGAAACCAGATTGTCT	0.348													32	120	---	---	---	---	PASS
TTN	7273	broad.mit.edu	37	2	179593377	179593377	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:179593377C>G	uc010zfg.1	-	63	15768	c.15544G>C	c.(15544-15546)GTT>CTT	p.V5182L	TTN_uc010zfh.1_Intron|TTN_uc010zfi.1_Intron|TTN_uc010zfj.1_Intron|TTN_uc002umz.1_Missense_Mutation_p.V1843L	NM_133378	NP_596869	Q8WZ42	TITIN_HUMAN	titin isoform N2-A	6109							ATP binding|nucleic acid binding|protein serine/threonine kinase activity|protein tyrosine kinase activity			ovary(58)|stomach(19)|large_intestine(17)|lung(16)|skin(16)|breast(10)|pancreas(7)|kidney(4)|central_nervous_system(3)|urinary_tract(2)|upper_aerodigestive_tract(1)	153			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTACTGGGAACTATTTGTTTC	0.408													24	55	---	---	---	---	PASS
SATB2	23314	broad.mit.edu	37	2	200213525	200213525	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:200213525C>T	uc002uuy.1	-	7	1889	c.1072G>A	c.(1072-1074)GTG>ATG	p.V358M	SATB2_uc010fsq.1_Missense_Mutation_p.V240M|SATB2_uc002uuz.1_Missense_Mutation_p.V358M|SATB2_uc002uva.1_Missense_Mutation_p.V358M|SATB2_uc002uvb.1_Missense_Mutation_p.V101M	NM_015265	NP_056080	Q9UPW6	SATB2_HUMAN	SATB homeobox 2	358	CUT 1.					cytoplasm|nuclear matrix	sequence-specific DNA binding transcription factor activity			ovary(1)	1						GAGACTTCCACGGAAGAGTTG	0.547													79	214	---	---	---	---	PASS
CRYGA	1418	broad.mit.edu	37	2	209025628	209025628	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:209025628C>T	uc002vcq.3	-	3	442	c.425G>A	c.(424-426)CGG>CAG	p.R142Q		NM_014617	NP_055432	P11844	CRGA_HUMAN	crystallin, gamma A	142	Beta/gamma crystallin 'Greek key' 4.				visual perception		structural constituent of eye lens				0				Epithelial(149;0.067)|LUSC - Lung squamous cell carcinoma(261;0.0708)|Lung(261;0.135)		CAGATACTGCCGCCCCCGGTA	0.572													53	166	---	---	---	---	PASS
MAP2	4133	broad.mit.edu	37	2	210560619	210560619	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:210560619A>G	uc002vde.1	+	7	3973	c.3725A>G	c.(3724-3726)CAG>CGG	p.Q1242R	MAP2_uc002vdc.1_Missense_Mutation_p.Q1242R|MAP2_uc002vdd.1_Intron|MAP2_uc002vdf.1_Intron|MAP2_uc002vdg.1_Intron|MAP2_uc002vdh.1_Intron|MAP2_uc002vdi.1_Missense_Mutation_p.Q1238R	NM_002374	NP_002365	P11137	MAP2_HUMAN	microtubule-associated protein 2 isoform 1	1242					central nervous system neuron development|dendrite morphogenesis|negative regulation of microtubule depolymerization	cytoplasm|microtubule|microtubule associated complex	beta-dystroglycan binding|calmodulin binding|structural molecule activity			ovary(9)|upper_aerodigestive_tract(2)|large_intestine(2)|pancreas(2)|central_nervous_system(1)|skin(1)	17		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Estramustine(DB01196)	ATAGAAGCCCAGGGAGAATAT	0.488													29	92	---	---	---	---	PASS
ERBB4	2066	broad.mit.edu	37	2	212812187	212812187	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:212812187C>T	uc002veg.1	-	3	487	c.389G>A	c.(388-390)GGA>GAA	p.G130E	ERBB4_uc002veh.1_Missense_Mutation_p.G130E|ERBB4_uc010zji.1_Missense_Mutation_p.G130E|ERBB4_uc010zjj.1_Missense_Mutation_p.G130E|ERBB4_uc010fut.1_Missense_Mutation_p.G130E	NM_005235	NP_005226	Q15303	ERBB4_HUMAN	v-erb-a erythroblastic leukemia viral oncogene	130	Extracellular (Potential).				cell proliferation|regulation of transcription, DNA-dependent|transcription, DNA-dependent|transmembrane receptor protein tyrosine kinase signaling pathway	basolateral plasma membrane|cytoplasm|integral to membrane|nucleus	ATP binding|protein binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			lung(21)|skin(5)|stomach(2)|breast(2)|upper_aerodigestive_tract(1)|large_intestine(1)|pancreas(1)	33		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)		TTCTTGAAGTCCAAAGTTTCC	0.343										TSP Lung(8;0.080)			14	78	---	---	---	---	PASS
SCLY	51540	broad.mit.edu	37	2	238991888	238991888	+	Splice_Site	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:238991888G>A	uc010fyv.2	+	7	842	c.778_splice	c.e7-1	p.F260_splice	SCLY_uc002vxm.3_Splice_Site_p.F227_splice|SCLY_uc002vxn.2_Splice_Site_p.F260_splice|SCLY_uc010znq.1_Intron|SCLY_uc010znr.1_Splice_Site_p.F166_splice	NM_016510	NP_057594	Q96I15	SCLY_HUMAN	selenocysteine lyase						cellular amino acid metabolic process	cytosol	pyridoxal phosphate binding|selenocysteine lyase activity|transferase activity			ovary(2)	2		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;1.37e-23)|OV - Ovarian serous cystadenocarcinoma(60;4.6e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;8.25e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000128)|Lung(119;0.0118)|LUSC - Lung squamous cell carcinoma(224;0.0285)		TTTCCTTCCAGTTTTATGGTC	0.284													42	125	---	---	---	---	PASS
FOXP1	27086	broad.mit.edu	37	3	71090510	71090510	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:71090510G>A	uc003dol.2	-	7	1161	c.838C>T	c.(838-840)CAG>TAG	p.Q280*	FOXP1_uc003dom.2_Nonsense_Mutation_p.Q204*|FOXP1_uc003don.2_RNA|FOXP1_uc003doo.2_Nonsense_Mutation_p.Q280*|FOXP1_uc003dop.2_Nonsense_Mutation_p.Q280*|FOXP1_uc003doq.1_Nonsense_Mutation_p.Q279*|FOXP1_uc003doi.2_Nonsense_Mutation_p.Q180*|FOXP1_uc003doj.2_Nonsense_Mutation_p.Q180*|FOXP1_uc003dok.2_Nonsense_Mutation_p.Q93*|FOXP1_uc003dor.1_Nonsense_Mutation_p.Q58*	NM_032682	NP_116071	Q9H334	FOXP1_HUMAN	forkhead box P1 isoform 1	280					cardiac muscle cell differentiation|embryo development|immunoglobulin V(D)J recombination|pattern specification process|positive regulation of epithelial cell proliferation involved in lung morphogenesis|positive regulation of immunoglobulin production|positive regulation of mesenchymal cell proliferation|pre-B cell differentiation|regulation of sequence-specific DNA binding transcription factor activity|skeletal muscle tissue development|smooth muscle tissue development	cytoplasm|transcription factor complex	chromatin binding|DNA bending activity|double-stranded DNA binding|promoter binding|protein heterodimerization activity|protein homodimerization activity|sequence-specific DNA binding|sequence-specific enhancer binding RNA polymerase II transcription factor activity|specific RNA polymerase II transcription factor activity|specific transcriptional repressor activity|transcription activator activity|transcription factor binding|zinc ion binding			ovary(1)|lung(1)	2		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		ACTGAGAGCTGTCCATTGGTA	0.522			T	PAX5	ALL								44	91	---	---	---	---	PASS
CADM2	253559	broad.mit.edu	37	3	85935470	85935470	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:85935470G>T	uc003dqj.2	+	4	1121	c.495G>T	c.(493-495)GAG>GAT	p.E165D	CADM2_uc003dqk.2_Missense_Mutation_p.E174D|CADM2_uc003dql.2_Missense_Mutation_p.E167D	NM_153184	NP_694854	Q8N3J6	CADM2_HUMAN	immunoglobulin superfamily, member 4D	165	Ig-like C2-type 1.|Extracellular (Potential).				adherens junction organization|cell junction assembly	integral to membrane|plasma membrane				ovary(1)|lung(1)|kidney(1)|skin(1)	4		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		ATGACAAAGAGATTAAAGGTA	0.323													20	41	---	---	---	---	PASS
OR5K4	403278	broad.mit.edu	37	3	98073073	98073073	+	Missense_Mutation	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:98073073A>G	uc011bgv.1	+	1	376	c.376A>G	c.(376-378)ATA>GTA	p.I126V		NM_001005517	NP_001005517	A6NMS3	OR5K4_HUMAN	olfactory receptor, family 5, subfamily K,	126	Cytoplasmic (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			central_nervous_system(1)	1						CTATGTGGCCATATGCCACCC	0.483													48	422	---	---	---	---	PASS
KIAA2018	205717	broad.mit.edu	37	3	113379864	113379864	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:113379864G>T	uc003eam.2	-	7	1076	c.665C>A	c.(664-666)CCT>CAT	p.P222H	KIAA2018_uc003eal.2_Missense_Mutation_p.P166H	NM_001009899	NP_001009899	Q68DE3	K2018_HUMAN	hypothetical protein LOC205717	222					regulation of transcription, DNA-dependent	membrane|nucleus	calcium ion binding|DNA binding|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity			skin(2)|ovary(1)	3						AAGAGGAACAGGCTGGTTGGT	0.478													59	69	---	---	---	---	PASS
CLSTN2	64084	broad.mit.edu	37	3	140167502	140167502	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:140167502G>C	uc003etn.2	+	6	1119	c.929G>C	c.(928-930)TGT>TCT	p.C310S	CLSTN2_uc003etm.2_Missense_Mutation_p.C310S	NM_022131	NP_071414	Q9H4D0	CSTN2_HUMAN	calsyntenin 2 precursor	310	Extracellular (Potential).				homophilic cell adhesion	endoplasmic reticulum membrane|Golgi membrane|integral to membrane|plasma membrane	calcium ion binding			skin(3)|large_intestine(2)|pancreas(1)|central_nervous_system(1)	7						GGGAAGGGTTGTGACCGGGAG	0.463										HNSCC(16;0.037)			110	281	---	---	---	---	PASS
TM4SF19	116211	broad.mit.edu	37	3	196051168	196051168	+	Silent	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196051168A>G	uc003fwl.1	-	4	548	c.423T>C	c.(421-423)GGT>GGC	p.G141G	TM4SF19_uc003fwj.2_RNA|uc003fwk.1_3'UTR|TM4SF19_uc010iad.1_Silent_p.G141G|TM4SF19_uc011btv.1_Silent_p.G115G	NM_138461	NP_612470	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	141	Extracellular (Potential).					integral to membrane					0	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		TGAATGGGTAACCATATTTCC	0.433													46	122	---	---	---	---	PASS
GAK	2580	broad.mit.edu	37	4	887731	887731	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:887731G>A	uc003gbm.3	-	8	1007	c.808C>T	c.(808-810)CGA>TGA	p.R270*	GAK_uc003gbn.3_Nonsense_Mutation_p.R191*|GAK_uc010ibk.1_Nonsense_Mutation_p.R164*|GAK_uc003gbl.3_Nonsense_Mutation_p.R134*	NM_005255	NP_005246	O14976	GAK_HUMAN	cyclin G associated kinase	270	Protein kinase.				cell cycle	focal adhesion|Golgi apparatus|perinuclear region of cytoplasm	ATP binding|heat shock protein binding|protein serine/threonine kinase activity			lung(2)|central_nervous_system(1)|skin(1)	4				Colorectal(103;0.219)		TTGACTATTCGAAGTTTCGCT	0.607													3	35	---	---	---	---	PASS
KIAA1109	84162	broad.mit.edu	37	4	123195521	123195521	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:123195521G>C	uc003ieh.2	+	47	8515	c.8470G>C	c.(8470-8472)GAG>CAG	p.E2824Q	KIAA1109_uc003iel.1_Missense_Mutation_p.E759Q|KIAA1109_uc003iek.2_Missense_Mutation_p.E1443Q	NM_015312	NP_056127	Q2LD37	K1109_HUMAN	fragile site-associated protein	2824					regulation of cell growth|regulation of epithelial cell differentiation	integral to membrane|nucleus				ovary(8)|skin(2)|pancreas(1)|central_nervous_system(1)	12						AAAGATGACTGAGACTTGTGC	0.279													23	48	---	---	---	---	PASS
GRIA2	2891	broad.mit.edu	37	4	158253997	158253997	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:158253997C>T	uc003ipm.3	+	7	1368	c.909C>T	c.(907-909)GCC>GCT	p.A303A	GRIA2_uc011cit.1_Silent_p.A256A|GRIA2_uc003ipl.3_Silent_p.A303A|GRIA2_uc003ipk.3_Silent_p.A256A|GRIA2_uc010iqh.1_RNA	NM_001083619	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2 isoform 2	303	Extracellular (Potential).				synaptic transmission	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex|cell junction|endocytic vesicle membrane|endoplasmic reticulum membrane|postsynaptic membrane	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity|extracellular-glutamate-gated ion channel activity|kainate selective glutamate receptor activity			central_nervous_system(3)|ovary(1)	4	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	L-Glutamic Acid(DB00142)	CCTATGATGCCGTTCAAGTGA	0.473													8	191	---	---	---	---	PASS
NIPBL	25836	broad.mit.edu	37	5	36985487	36985487	+	Silent	SNP	T	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:36985487T>C	uc003jkl.3	+	10	2704	c.2205T>C	c.(2203-2205)ACT>ACC	p.T735T	NIPBL_uc003jkk.3_Silent_p.T735T|NIPBL_uc003jkm.1_Silent_p.T614T	NM_133433	NP_597677	Q6KC79	NIPBL_HUMAN	delangin isoform A	735					brain development|cellular protein localization|cellular response to X-ray|cognition|developmental growth|ear morphogenesis|embryonic arm morphogenesis|embryonic digestive tract morphogenesis|external genitalia morphogenesis|eye morphogenesis|face morphogenesis|gall bladder development|maintenance of mitotic sister chromatid cohesion|metanephros development|negative regulation of transcription from RNA polymerase II promoter|outflow tract morphogenesis|positive regulation of histone deacetylation|regulation of developmental growth|regulation of embryonic development|regulation of hair cycle|response to DNA damage stimulus|sensory perception of sound|uterus morphogenesis	SMC loading complex	chromo shadow domain binding|histone deacetylase binding|protein C-terminus binding|protein N-terminus binding			ovary(4)|lung(2)|large_intestine(1)|breast(1)|kidney(1)	9	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GGCCTGAAACTCCAAAGCAAA	0.488													4	93	---	---	---	---	PASS
DMXL1	1657	broad.mit.edu	37	5	118465097	118465097	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:118465097G>T	uc003ksd.2	+	10	1475	c.1294G>T	c.(1294-1296)GCA>TCA	p.A432S	DMXL1_uc010jcl.1_Missense_Mutation_p.A432S|DMXL1_uc003ksc.1_Missense_Mutation_p.A432S	NM_005509	NP_005500	Q9Y485	DMXL1_HUMAN	Dmx-like 1	432										ovary(2)	2		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTCTAATCAGGCAGATGTAAA	0.323													23	77	---	---	---	---	PASS
PCDHGA11	56105	broad.mit.edu	37	5	140800885	140800885	+	Nonsense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:140800885C>T	uc003lkq.1	+	1	349	c.91C>T	c.(91-93)CAG>TAG	p.Q31*	PCDHGA1_uc003lji.1_Intron|PCDHGA2_uc003ljk.1_Intron|PCDHGA3_uc003ljm.1_Intron|PCDHGA3_uc010jfx.1_Intron|PCDHGB1_uc003ljo.1_Intron|PCDHGA4_uc003ljq.1_Intron|PCDHGB2_uc003ljs.1_Intron|PCDHGA5_uc003lju.1_Intron|PCDHGB3_uc003ljw.1_Intron|PCDHGA6_uc003ljy.1_Intron|PCDHGA7_uc003lka.1_Intron|PCDHGB4_uc003lkc.1_Intron|PCDHGA8_uc003lkd.1_Intron|PCDHGB5_uc003lkf.1_Intron|PCDHGA9_uc003lkh.1_Intron|PCDHGB6_uc003lkj.1_Intron|PCDHGA10_uc003lkl.1_Intron|PCDHGB7_uc003lkn.1_Intron|PCDHGA11_uc003lko.1_Nonsense_Mutation_p.Q31*|PCDHGA11_uc003lkp.1_Nonsense_Mutation_p.Q31*	NM_018914	NP_061737	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11 isoform 1	31	Extracellular (Potential).|Cadherin 1.				homophilic cell adhesion	integral to membrane|plasma membrane	calcium ion binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGGGCCAGGCAGATCCGATA	0.657													19	51	---	---	---	---	PASS
CSNK1A1	1452	broad.mit.edu	37	5	148889453	148889453	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:148889453C>A	uc003lqx.1	-	7	1219	c.739G>T	c.(739-741)GTT>TTT	p.V247F	CSNK1A1_uc011dcb.1_Missense_Mutation_p.V156F|CSNK1A1_uc011dcc.1_Missense_Mutation_p.V186F|CSNK1A1_uc003lqv.1_Missense_Mutation_p.V158F|CSNK1A1_uc003lqw.1_Missense_Mutation_p.V275F|CSNK1A1_uc003lqy.1_Missense_Mutation_p.V247F|CSNK1A1_uc010jha.1_Missense_Mutation_p.V247F	NM_001892	NP_001883	P48729	KC1A_HUMAN	casein kinase 1, alpha 1 isoform 2	247	Protein kinase.				cell division|mitosis|Wnt receptor signaling pathway	centrosome|condensed chromosome kinetochore|cytosol|nuclear speck	ATP binding|protein binding|protein binding|protein serine/threonine kinase activity			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		TTACATAAAACTTCAACAGGC	0.204													3	65	---	---	---	---	PASS
MRPL22	29093	broad.mit.edu	37	5	154320669	154320669	+	5'UTR	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:154320669A>G	uc003lvy.3	+	1					GEMIN5_uc003lvx.3_5'Flank|GEMIN5_uc011ddk.1_5'Flank|MRPL22_uc003lvz.3_5'UTR	NM_014180	NP_054899	Q9NWU5	RM22_HUMAN	mitochondrial ribosomal protein L22 isoform a						translation	large ribosomal subunit|mitochondrion	structural constituent of ribosome				0	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGAGGGCGAAAGATGGCGGCG	0.552													41	154	---	---	---	---	PASS
KIF6	221458	broad.mit.edu	37	6	39563859	39563859	+	Missense_Mutation	SNP	T	G	G	rs151248135		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:39563859T>G	uc003oot.2	-	7	912	c.817A>C	c.(817-819)ATC>CTC	p.I273L	KIF6_uc010jxa.1_Missense_Mutation_p.I64L|KIF6_uc011dua.1_Missense_Mutation_p.I273L|KIF6_uc010jxb.1_Missense_Mutation_p.I273L	NM_145027	NP_659464	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	273	Kinesin-motor.				microtubule-based movement	cytoplasm|microtubule	ATP binding|microtubule motor activity|protein binding			breast(2)|central_nervous_system(1)	3						GACAAGTTGATATACTTGGCC	0.358													30	83	---	---	---	---	PASS
PRSS35	167681	broad.mit.edu	37	6	84233224	84233224	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:84233224G>C	uc003pjz.2	+	2	227	c.64G>C	c.(64-66)GAA>CAA	p.E22Q	PRSS35_uc010kbm.2_Missense_Mutation_p.E22Q	NM_153362	NP_699193	Q8N3Z0	PRS35_HUMAN	protease, serine, 35 precursor	22					proteolysis	extracellular region	serine-type endopeptidase activity			ovary(1)	1		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		TGATGGATCTGAAATGGAATG	0.413													54	198	---	---	---	---	PASS
SGK1	6446	broad.mit.edu	37	6	134495937	134495937	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:134495937C>T	uc003qen.3	-	1	98	c.9G>A	c.(7-9)GTG>GTA	p.V3V	SGK1_uc003qeo.3_Intron|SGK1_uc011ect.1_5'UTR|SGK1_uc011ecu.1_Silent_p.V3V|SGK1_uc011ecv.1_Intron|SGK1_uc011ecw.1_Intron	NM_005627	NP_005618	O00141	SGK1_HUMAN	serum/glucocorticoid regulated kinase 1 isoform	3	Necessary for localization to the cytoplasm.				apoptosis|response to stress|sodium ion transport	endoplasmic reticulum|nucleus|plasma membrane	ATP binding|protein binding|protein serine/threonine kinase activity			skin(3)|stomach(1)|lung(1)|central_nervous_system(1)	6	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00317)|GBM - Glioblastoma multiforme(68;0.00847)		CCTCAGTTTTCACCGTCATCA	0.587													26	157	---	---	---	---	PASS
VIP	7432	broad.mit.edu	37	6	153076516	153076516	+	Intron	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:153076516G>A	uc003qpe.2	+						VIP_uc003qpf.2_Intron|VIP_uc010kjd.2_Intron	NM_003381	NP_003372	P01282	VIP_HUMAN	vasoactive intestinal peptide isoform 1						body fluid secretion|G-protein coupled receptor protein signaling pathway|positive regulation of cell proliferation	extracellular region	neuropeptide hormone activity				0		Ovarian(120;0.0654)		OV - Ovarian serous cystadenocarcinoma(155;4.5e-11)|BRCA - Breast invasive adenocarcinoma(81;0.144)		TAGGTAAAGAGaatttattat	0.299													10	31	---	---	---	---	PASS
CARD11	84433	broad.mit.edu	37	7	2987233	2987233	+	Silent	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:2987233G>A	uc003smv.2	-	3	600	c.196C>T	c.(196-198)CTG>TTG	p.L66L		NM_032415	NP_115791	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	66	CARD.				positive regulation of cytokine production|positive regulation of NF-kappaB transcription factor activity|regulation of apoptosis|T cell costimulation|T cell receptor signaling pathway	cytosol|membrane raft|plasma membrane	CARD domain binding|guanylate kinase activity			haematopoietic_and_lymphoid_tissue(43)|ovary(2)|kidney(2)|skin(2)|central_nervous_system(1)	50		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TTGGATGGCAGCATAGGGGCA	0.542			Mis		DLBCL								5	177	---	---	---	---	PASS
DNAH11	8701	broad.mit.edu	37	7	21723442	21723442	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:21723442G>A	uc003svc.2	+	33	5553	c.5522G>A	c.(5521-5523)CGT>CAT	p.R1841H		NM_003777	NP_003768	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	1841	Stem (By similarity).				microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(8)|large_intestine(3)|pancreas(3)|central_nervous_system(1)	15						TCTCAACTTCGTCACCGATGG	0.443									Kartagener_syndrome				59	427	---	---	---	---	PASS
NPSR1	387129	broad.mit.edu	37	7	34884573	34884573	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:34884573T>C	uc003teg.1	+	7	951	c.823T>C	c.(823-825)TAT>CAT	p.Y275H	AAA1_uc010kwq.1_Intron|AAA1_uc011kaq.1_Intron|NPSR1_uc003teh.1_Missense_Mutation_p.Y275H|NPSR1_uc010kwt.1_Missense_Mutation_p.Y122H|NPSR1_uc010kwu.1_Missense_Mutation_p.Y65H|NPSR1_uc010kwv.1_Missense_Mutation_p.Y209H|NPSR1_uc003tei.1_Missense_Mutation_p.Y275H|NPSR1_uc010kww.1_Missense_Mutation_p.Y264H|NPSR1_uc011kar.1_Missense_Mutation_p.Y209H	NM_207172	NP_997055	Q6W5P4	NPSR1_HUMAN	G protein-coupled receptor for asthma	275	Cytoplasmic (Potential).					cytoplasm|integral to membrane|plasma membrane	vasopressin receptor activity			skin(3)|pancreas(1)	4					Halothane(DB01159)	GGCTATCAAGTATAGCATCAT	0.443													41	132	---	---	---	---	PASS
ZNF479	90827	broad.mit.edu	37	7	57188280	57188280	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:57188280G>T	uc010kzo.2	-	5	1113	c.842C>A	c.(841-843)TCC>TAC	p.S281Y		NM_033273	NP_150376	Q96JC4	ZN479_HUMAN	zinc finger protein 479	281	C2H2-type 4.				regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			ovary(3)|skin(1)	4			GBM - Glioblastoma multiforme(1;9.18e-12)			AAGTGCTGAGGAGCGCCTAAA	0.458													29	98	---	---	---	---	PASS
WBSCR17	64409	broad.mit.edu	37	7	70880936	70880936	+	Silent	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:70880936G>A	uc003tvy.2	+	4	651	c.651G>A	c.(649-651)GTG>GTA	p.V217V	WBSCR17_uc003tvz.2_5'UTR	NM_022479	NP_071924	Q6IS24	GLTL3_HUMAN	UDP-GalNAc:polypeptide	217	Catalytic subdomain A.|Lumenal (Potential).					Golgi membrane|integral to membrane	polypeptide N-acetylgalactosaminyltransferase activity|sugar binding			skin(3)|upper_aerodigestive_tract(1)|ovary(1)|pancreas(1)|central_nervous_system(1)	7		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TGGTGAAGGTGGTAAGAAATC	0.532													21	74	---	---	---	---	PASS
SEMA3E	9723	broad.mit.edu	37	7	83119520	83119520	+	Silent	SNP	C	G	G	rs148264760		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:83119520C>G	uc003uhy.1	-	2	652	c.186G>C	c.(184-186)CTG>CTC	p.L62L		NM_012431	NP_036563	O15041	SEM3E_HUMAN	semaphorin 3E precursor	62	Sema.				axon guidance	extracellular space|membrane	receptor activity			ovary(3)	3		Medulloblastoma(109;0.109)				ATTCATCCAGCAGCATTGTAT	0.413													21	71	---	---	---	---	PASS
PIK3CG	5294	broad.mit.edu	37	7	106508035	106508035	+	Missense_Mutation	SNP	T	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:106508035T>C	uc003vdv.3	+	2	114	c.29T>C	c.(28-30)GTG>GCG	p.V10A	PIK3CG_uc003vdu.2_Missense_Mutation_p.V10A|PIK3CG_uc003vdw.2_Missense_Mutation_p.V10A	NM_002649	NP_002640	P48736	PK3CG_HUMAN	phosphoinositide-3-kinase, catalytic, gamma	10					G-protein coupled receptor protein signaling pathway|phosphatidylinositol-mediated signaling|platelet activation	phosphatidylinositol 3-kinase complex	1-phosphatidylinositol-3-kinase activity|ATP binding|phosphatidylinositol-4,5-bisphosphate 3-kinase activity|protein binding			lung(16)|central_nervous_system(8)|breast(5)|pancreas(3)|stomach(2)|ovary(2)|upper_aerodigestive_tract(1)|skin(1)	38						AAACAGCCCGTGGTGCTGAGA	0.577													29	107	---	---	---	---	PASS
CFTR	1080	broad.mit.edu	37	7	117307102	117307102	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:117307102G>T	uc003vjd.2	+	27	4515	c.4383G>T	c.(4381-4383)AAG>AAT	p.K1461N	CFTR_uc011knq.1_Missense_Mutation_p.K867N	NM_000492	NP_000483	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance	1461	Cytoplasmic (Potential).				respiratory gaseous exchange	apical plasma membrane|basolateral plasma membrane|chloride channel complex|early endosome membrane	ATP binding|ATP-binding and phosphorylation-dependent chloride channel activity|channel-conductance-controlling ATPase activity|chloride channel regulator activity|enzyme binding|PDZ domain binding			central_nervous_system(2)|skin(2)|ovary(1)	5	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Glibenclamide(DB01016)	GCAAGTCTAAGCCCCAGATTG	0.512									Cystic_Fibrosis				4	100	---	---	---	---	PASS
VCPIP1	80124	broad.mit.edu	37	8	67578502	67578502	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:67578502C>T	uc003xwn.2	-	1	951	c.692G>A	c.(691-693)CGA>CAA	p.R231Q	SGK3_uc003xwp.2_5'Flank|C8orf44_uc003xwo.1_5'Flank	NM_025054	NP_079330	Q96JH7	VCIP1_HUMAN	valosin containing protein (p97)/p47 complex	231	OTU.				protein ubiquitination	endoplasmic reticulum|Golgi stack	ubiquitin-specific protease activity			lung(2)|ovary(2)|central_nervous_system(1)|breast(1)|skin(1)|kidney(1)	8		Lung NSC(129;0.142)|all_lung(136;0.227)	Epithelial(68;0.000771)|OV - Ovarian serous cystadenocarcinoma(28;0.00248)|all cancers(69;0.00296)|BRCA - Breast invasive adenocarcinoma(89;0.149)			GAAGAGCTCTCGGCCTACTAG	0.507													65	90	---	---	---	---	PASS
KCNB2	9312	broad.mit.edu	37	8	73850288	73850288	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:73850288G>A	uc003xzb.2	+	3	3286	c.2698G>A	c.(2698-2700)GAC>AAC	p.D900N		NM_004770	NP_004761	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related	900	Cytoplasmic (Potential).				regulation of smooth muscle contraction	voltage-gated potassium channel complex	delayed rectifier potassium channel activity|protein binding			skin(3)|large_intestine(1)|pancreas(1)|ovary(1)|central_nervous_system(1)	7	Breast(64;0.137)		Epithelial(68;0.105)			CAACCCAGGAGACACAGGTTA	0.348													7	233	---	---	---	---	PASS
EPPK1	83481	broad.mit.edu	37	8	144940614	144940614	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940614C>T	uc003zaa.1	-	2	14831	c.14818G>A	c.(14818-14820)GGC>AGC	p.G4940S		NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1	4940	Plectin 62.					cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ATGACGAAGCCGGTGGCCGCC	0.721													3	26	---	---	---	---	PASS
BNC2	54796	broad.mit.edu	37	9	16429961	16429961	+	Intron	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:16429961A>G	uc003zml.2	-						BNC2_uc011lmw.1_Intron|BNC2_uc003zmm.2_Intron|BNC2_uc011lmv.1_Intron|BNC2_uc003zmj.2_Intron|BNC2_uc003zmk.2_RNA|BNC2_uc003zmi.2_Intron|BNC2_uc003zmn.1_Intron	NM_017637	NP_060107	Q6ZN30	BNC2_HUMAN	basonuclin 2						regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus|plasma membrane	zinc ion binding			ovary(2)|central_nervous_system(1)	3				GBM - Glioblastoma multiforme(50;9.01e-08)		CCCATGATACAAGGAGACCGT	0.473													13	15	---	---	---	---	PASS
RAPGEF1	2889	broad.mit.edu	37	9	134504004	134504004	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:134504004C>G	uc004cbc.2	-	8	1028	c.898G>C	c.(898-900)GTG>CTG	p.V300L	RAPGEF1_uc004cbb.2_Missense_Mutation_p.V318L|RAPGEF1_uc010mzm.2_5'Flank|RAPGEF1_uc010mzn.2_Missense_Mutation_p.V305L|RAPGEF1_uc004cbd.2_Missense_Mutation_p.V305L	NM_005312	NP_005303	Q13905	RPGF1_HUMAN	guanine nucleotide-releasing factor 2 isoform a	300					activation of MAPKK activity|nerve growth factor receptor signaling pathway|regulation of small GTPase mediated signal transduction|small GTPase mediated signal transduction	cytosol|endosome	guanyl-nucleotide exchange factor activity|SH3 domain binding			lung(3)|ovary(2)|breast(1)|skin(1)	7		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		ACCACAGCCACTCGGGTAGGG	0.592													11	29	---	---	---	---	PASS
CAMSAP1	157922	broad.mit.edu	37	9	138707778	138707778	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:138707778C>A	uc004cgr.3	-	15	4345	c.4345G>T	c.(4345-4347)GCG>TCG	p.A1449S	CAMSAP1_uc004cgq.3_Missense_Mutation_p.A1339S|CAMSAP1_uc010nbg.2_Missense_Mutation_p.A1171S	NM_015447	NP_056262	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein	1449						cytoplasm|microtubule				ovary(1)|central_nervous_system(1)|pancreas(1)	3				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		GCCGCCGACGCGGTCTCCCAG	0.607													28	83	---	---	---	---	PASS
MYO3A	53904	broad.mit.edu	37	10	26463194	26463194	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:26463194G>T	uc001isn.2	+	30	4361	c.4001G>T	c.(4000-4002)AGG>ATG	p.R1334M	MYO3A_uc009xkp.1_Intron|MYO3A_uc009xkq.1_Intron	NM_017433	NP_059129	Q8NEV4	MYO3A_HUMAN	myosin IIIA	1334					protein autophosphorylation|response to stimulus|sensory perception of sound|visual perception	cytoplasm|filamentous actin|filopodium|myosin complex	actin binding|actin-dependent ATPase activity|ADP binding|ATP binding|calmodulin binding|plus-end directed microfilament motor activity|protein serine/threonine kinase activity			ovary(6)|stomach(3)|lung(3)|central_nervous_system(2)|breast(1)|skin(1)|kidney(1)|pancreas(1)	18						GTCAAAGAGAGGCAAGTTGAA	0.502													45	156	---	---	---	---	PASS
PCDH15	65217	broad.mit.edu	37	10	55582413	55582413	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:55582413A>T	uc001jju.1	-	33	5468	c.5073T>A	c.(5071-5073)AGT>AGA	p.S1691R	PCDH15_uc010qhq.1_Intron|PCDH15_uc010qhr.1_Intron|PCDH15_uc010qhs.1_Intron|PCDH15_uc010qht.1_Intron|PCDH15_uc010qhu.1_Intron|PCDH15_uc001jjv.1_Intron|PCDH15_uc010qhv.1_Missense_Mutation_p.S1688R|PCDH15_uc010qhw.1_Missense_Mutation_p.S1651R|PCDH15_uc010qhx.1_Missense_Mutation_p.S1622R|PCDH15_uc010qhy.1_Missense_Mutation_p.S1698R|PCDH15_uc010qhz.1_Missense_Mutation_p.S1693R|PCDH15_uc010qia.1_Missense_Mutation_p.S1671R|PCDH15_uc010qib.1_Missense_Mutation_p.S1668R	NM_033056	NP_149045	Q96QU1	PCD15_HUMAN	protocadherin 15 isoform CD1-4 precursor	1691	Cytoplasmic (Potential).				equilibrioception|homophilic cell adhesion|photoreceptor cell maintenance|sensory perception of sound	extracellular region|extracellular space|integral to membrane|photoreceptor outer segment|plasma membrane|stereocilium|synapse	calcium ion binding			pancreas(5)|ovary(4)|upper_aerodigestive_tract(2)|skin(2)	13		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGCAGGAGAACTGATGACAT	0.423										HNSCC(58;0.16)			36	128	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69881497	69881497	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69881497C>A	uc001jnm.3	+	3	487	c.302C>A	c.(301-303)TCT>TAT	p.S101Y	MYPN_uc001jnl.1_Missense_Mutation_p.S101Y|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.S101Y|MYPN_uc001jnp.1_Missense_Mutation_p.S101Y|MYPN_uc009xps.2_Missense_Mutation_p.S101Y|MYPN_uc009xpt.2_Missense_Mutation_p.S101Y|MYPN_uc010qit.1_5'UTR|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	101	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						AAACGACTTTCTCCTGATCAG	0.448													47	120	---	---	---	---	PASS
MYPN	84665	broad.mit.edu	37	10	69881505	69881505	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69881505C>G	uc001jnm.3	+	3	495	c.310C>G	c.(310-312)CAG>GAG	p.Q104E	MYPN_uc001jnl.1_Missense_Mutation_p.Q104E|MYPN_uc001jnn.3_Intron|MYPN_uc001jno.3_Missense_Mutation_p.Q104E|MYPN_uc001jnp.1_Missense_Mutation_p.Q104E|MYPN_uc009xps.2_Missense_Mutation_p.Q104E|MYPN_uc009xpt.2_Missense_Mutation_p.Q104E|MYPN_uc010qit.1_Translation_Start_Site|MYPN_uc010qiu.1_RNA	NM_032578	NP_115967	Q86TC9	MYPN_HUMAN	myopalladin	104	Interaction with CARP.					nucleus|sarcomere	actin binding			ovary(3)|skin(2)	5						TTCTCCTGATCAGATGAAACA	0.443													45	120	---	---	---	---	PASS
PGAP2	27315	broad.mit.edu	37	11	3845356	3845356	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:3845356G>C	uc001lys.2	+	4	718	c.592G>C	c.(592-594)GAG>CAG	p.E198Q	PGAP2_uc001lyl.2_Missense_Mutation_p.E155Q|PGAP2_uc010qxw.1_Missense_Mutation_p.E255Q|PGAP2_uc010qxx.1_Missense_Mutation_p.R178P|PGAP2_uc001lyp.3_Intron|PGAP2_uc010qxy.1_Missense_Mutation_p.E194Q|PGAP2_uc010qxz.1_Missense_Mutation_p.E194Q|PGAP2_uc001lyn.3_Missense_Mutation_p.R90P|PGAP2_uc010qya.1_RNA|PGAP2_uc001lyr.2_Missense_Mutation_p.E137Q|PGAP2_uc010qyb.1_Missense_Mutation_p.R140P|PGAP2_uc001lyt.2_5'UTR	NM_014489	NP_055304	Q9UHJ9	PGAP2_HUMAN	FGF receptor activating protein 1 isoform 1	198					GPI anchor biosynthetic process	endoplasmic reticulum membrane|Golgi membrane|integral to membrane	protein transporter activity				0						CTCCTCCTCCGAGGACTTCAG	0.607													10	42	---	---	---	---	PASS
KIF18A	81930	broad.mit.edu	37	11	28058212	28058212	+	Splice_Site	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:28058212C>A	uc001msc.2	-	14	2131	c.1949_splice	c.e14-1	p.C650_splice		NM_031217	NP_112494	Q8NI77	KI18A_HUMAN	kinesin family member 18A						blood coagulation|microtubule depolymerization|microtubule-based movement|mitotic metaphase plate congression|mitotic prometaphase|protein transport	caveola|cytosol|kinetochore microtubule|microtubule organizing center|nucleus|ruffle	actin binding|ATP binding|microtubule plus-end binding|plus-end-directed microtubule motor activity|tubulin-dependent ATPase activity|ubiquitin binding			ovary(2)	2						GAAGATGAGCCTATTCAAAAA	0.318													9	38	---	---	---	---	PASS
OR5R1	219479	broad.mit.edu	37	11	56184914	56184914	+	Silent	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:56184914A>G	uc010rji.1	-	1	795	c.795T>C	c.(793-795)AAT>AAC	p.N265N		NM_001004744	NP_001004744	Q8NH85	OR5R1_HUMAN	olfactory receptor, family 5, subfamily R,	265	Extracellular (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(2)	2	Esophageal squamous(21;0.00448)					CCAAGGAGTGATTTGATTTGG	0.433													44	195	---	---	---	---	PASS
PYGM	5837	broad.mit.edu	37	11	64519091	64519091	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64519091C>T	uc001oax.3	-	15	2622	c.1805G>A	c.(1804-1806)CGG>CAG	p.R602Q	PYGM_uc001oay.3_Missense_Mutation_p.R514Q	NM_005609	NP_005600	P11217	PYGM_HUMAN	muscle glycogen phosphorylase isoform 1	602			R -> W (in GSD5).		glucose metabolic process|glycogen catabolic process	cytosol	glycogen phosphorylase activity|protein binding			ovary(2)	2					Pyridoxal Phosphate(DB00114)	CATCACAGTCCGAGGCACAAA	0.552													23	137	---	---	---	---	PASS
SIK3	23387	broad.mit.edu	37	11	116728678	116728678	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:116728678C>T	uc001ppy.2	-	20	3221	c.3185G>A	c.(3184-3186)GGT>GAT	p.G1062D	SIK3_uc001ppz.2_Missense_Mutation_p.G901D|SIK3_uc001pqa.2_Missense_Mutation_p.G1002D|SIK3_uc001ppw.2_Missense_Mutation_p.G419D|SIK3_uc001ppx.2_Missense_Mutation_p.G440D|SIK3_uc001pqb.2_Missense_Mutation_p.G365D	NM_025164	NP_079440	Q9Y2K2	SIK3_HUMAN	serine/threonine-protein kinase QSK	1062						cytoplasm	ATP binding|magnesium ion binding|protein binding|protein serine/threonine kinase activity			ovary(4)|breast(3)|stomach(2)|lung(1)|skin(1)|kidney(1)	12						GTCATGGCAACCTTTGGTCAA	0.537													7	153	---	---	---	---	PASS
OR8B8	26493	broad.mit.edu	37	11	124310149	124310149	+	Missense_Mutation	SNP	T	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:124310149T>A	uc010sal.1	-	1	833	c.833A>T	c.(832-834)TAT>TTT	p.Y278F		NM_012378	NP_036510	Q15620	OR8B8_HUMAN	olfactory receptor, family 8, subfamily B,	278	Helical; Name=7; (Potential).				sensory perception of smell	integral to membrane|plasma membrane	olfactory receptor activity			ovary(1)	1		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0277)		CACAGTGGTATAGAATAGGGA	0.408													40	119	---	---	---	---	PASS
PUS7L	83448	broad.mit.edu	37	12	44136321	44136321	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:44136321A>C	uc001rnq.3	-	5	1790	c.1301T>G	c.(1300-1302)TTT>TGT	p.F434C	PUS7L_uc001rnr.3_Missense_Mutation_p.F434C|PUS7L_uc001rns.3_Missense_Mutation_p.F434C|PUS7L_uc009zkb.2_Missense_Mutation_p.F121C	NM_001098615	NP_001092085	Q9H0K6	PUS7L_HUMAN	pseudouridylate synthase 7 homolog (S.	434	TRUD.				pseudouridine synthesis|tRNA processing		pseudouridine synthase activity|RNA binding			pancreas(1)	1	all_cancers(12;0.00027)	Lung NSC(34;0.114)|all_lung(34;0.24)		GBM - Glioblastoma multiforme(48;0.0402)		TCCCTTCCCAAATCTCTGTGG	0.313													48	160	---	---	---	---	PASS
SLC38A2	54407	broad.mit.edu	37	12	46756368	46756368	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:46756368C>A	uc001rpg.2	-	14	1673	c.1233G>T	c.(1231-1233)TGG>TGT	p.W411C	SLC38A2_uc010sli.1_Missense_Mutation_p.W249C|SLC38A2_uc001rph.2_Missense_Mutation_p.W311C	NM_018976	NP_061849	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2	411	Cytoplasmic (Potential).				cellular nitrogen compound metabolic process|glutamate secretion|neurotransmitter secretion|sodium ion transport	integral to membrane|plasma membrane	amino acid transmembrane transporter activity|symporter activity			urinary_tract(1)|skin(1)	2	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		GACTATGACGCCACCAACTGA	0.318													24	101	---	---	---	---	PASS
EIF4B	1975	broad.mit.edu	37	12	53421697	53421697	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:53421697G>C	uc001sbh.3	+	7	1005	c.799G>C	c.(799-801)GAT>CAT	p.D267H	EIF4B_uc009zmp.1_RNA|EIF4B_uc010snu.1_Missense_Mutation_p.D267H|EIF4B_uc010snv.1_Missense_Mutation_p.D228H|EIF4B_uc001sbi.2_Missense_Mutation_p.D19H	NM_001417	NP_001408	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	267	Arg-rich.|Asp-rich.				insulin receptor signaling pathway|nuclear-transcribed mRNA poly(A) tail shortening|regulation of translational initiation	cytosol|eukaryotic translation initiation factor 4F complex	nucleotide binding|translation initiation factor activity			breast(1)|kidney(1)	2						CAGAGACTATGATAGAGGTAA	0.363													43	103	---	---	---	---	PASS
HAL	3034	broad.mit.edu	37	12	96379721	96379721	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:96379721C>T	uc001tem.1	-	14	1468	c.1171G>A	c.(1171-1173)GTC>ATC	p.V391I	HAL_uc009zti.1_RNA|HAL_uc010suw.1_Missense_Mutation_p.V183I|HAL_uc010sux.1_Missense_Mutation_p.V391I	NM_002108	NP_002099	P42357	HUTH_HUMAN	histidine ammonia-lyase	391					biosynthetic process|histidine catabolic process	cytosol	histidine ammonia-lyase activity			ovary(2)|skin(1)	3					L-Histidine(DB00117)	GCATCCTGGACGCGATCACAG	0.418													6	101	---	---	---	---	PASS
DTX1	1840	broad.mit.edu	37	12	113531514	113531514	+	Intron	SNP	T	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:113531514T>C	uc001tuk.1	+							NM_004416	NP_004407	Q86Y01	DTX1_HUMAN	deltex homolog 1						negative regulation of neuron differentiation|Notch signaling pathway|regulation of Notch signaling pathway|transcription from RNA polymerase II promoter	cytoplasm|nucleus	Notch binding|SH3 domain binding|transcription coactivator activity|ubiquitin protein ligase binding|zinc ion binding			lung(2)|ovary(1)|central_nervous_system(1)	4						GAGTACGCCCTCCACGCCCTG	0.587													11	29	---	---	---	---	PASS
PITPNM2	57605	broad.mit.edu	37	12	123481933	123481933	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:123481933G>A	uc001uej.1	-	10	1550	c.1411C>T	c.(1411-1413)CTT>TTT	p.L471F	PITPNM2_uc001uek.1_Missense_Mutation_p.L471F	NM_020845	NP_065896	Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein,	471					metabolic process|transport	endomembrane system|integral to membrane|intracellular membrane-bounded organelle	calcium ion binding|lipid binding			ovary(1)|central_nervous_system(1)|skin(1)	3	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		CGGATGGCAAGGCGGCCCAGG	0.667													12	97	---	---	---	---	PASS
KIAA0831	22863	broad.mit.edu	37	14	55878363	55878363	+	Nonsense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:55878363G>A	uc001xbx.1	-	1	214	c.178C>T	c.(178-180)CAG>TAG	p.Q60*	FBXO34_uc001xbv.2_Intron	NM_014924	NP_055739	Q6ZNE5	BAKOR_HUMAN	Barkor	60					autophagic vacuole assembly|positive regulation of autophagy	autophagic vacuole|endoplasmic reticulum|pre-autophagosomal structure membrane	protein binding				0						TCGCCGCTCTGAACGCATTTG	0.662													8	13	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65218954	65218954	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65218954C>T	uc010aqi.2	-	15	2680	c.2665G>A	c.(2665-2667)GAA>AAA	p.E889K	SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a	Error:AA_residue_mismatch_between_GAF_and_UniProt_prot_seqs_after_alignment					actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		TGCTGCATTTCTACAGCAACA	0.363													10	16	---	---	---	---	PASS
SPTB	6710	broad.mit.edu	37	14	65219028	65219028	+	Missense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65219028C>G	uc010aqi.2	-	15	2606	c.2591G>C	c.(2590-2592)GGA>GCA	p.G864A	SPTB_uc001xhr.2_Intron|SPTB_uc001xhs.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a	Error:Variant_position_missing_in_P11277_after_alignment					actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		tccctcttctccctTACTTTT	0.219													6	9	---	---	---	---	PASS
RIN3	79890	broad.mit.edu	37	14	93142874	93142874	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:93142874G>A	uc001yap.2	+	8	2542	c.2390G>A	c.(2389-2391)CGC>CAC	p.R797H	RIN3_uc010auk.2_Missense_Mutation_p.R459H|RIN3_uc001yaq.2_Missense_Mutation_p.R722H|RIN3_uc001yas.1_Missense_Mutation_p.R459H	NM_024832	NP_079108	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	797	VPS9.				endocytosis|signal transduction	cytoplasmic membrane-bounded vesicle|early endosome	GTPase activator activity|Ras GTPase binding			lung(2)|ovary(1)	3		all_cancers(154;0.0701)				GTGCTGGCCCGCAGCAACCTC	0.602													15	97	---	---	---	---	PASS
DYNC1H1	1778	broad.mit.edu	37	14	102445718	102445718	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:102445718G>A	uc001yks.2	+	3	571	c.407G>A	c.(406-408)CGG>CAG	p.R136Q		NM_001376	NP_001367	Q14204	DYHC1_HUMAN	cytoplasmic dynein 1 heavy chain 1	136	Stem (By similarity).				cytoplasmic mRNA processing body assembly|G2/M transition of mitotic cell cycle|microtubule-based movement|mitotic spindle organization|stress granule assembly|transport	centrosome|cytoplasmic dynein complex|cytosol|Golgi apparatus|microtubule	ATP binding|ATPase activity, coupled|microtubule motor activity|protein binding			ovary(7)|central_nervous_system(2)|pancreas(1)	10						TCTCAGCTCCGGGTCCTTACA	0.403													48	233	---	---	---	---	PASS
TRPM1	4308	broad.mit.edu	37	15	31334348	31334348	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:31334348C>T	uc001zfm.2	-	16	1955	c.1827G>A	c.(1825-1827)CAG>CAA	p.Q609Q	TRPM1_uc010azy.2_Silent_p.Q516Q|TRPM1_uc001zfl.2_RNA	NM_002420	NP_002411	Q7Z4N2	TRPM1_HUMAN	transient receptor potential cation channel,	609	Cytoplasmic (Potential).				cellular response to light stimulus|visual perception	integral to plasma membrane	calcium channel activity|receptor activity			ovary(2)|pancreas(1)|skin(1)	4		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		GGAAGGGATACTGGAACCGAC	0.473													11	16	---	---	---	---	PASS
TYRO3	7301	broad.mit.edu	37	15	41862298	41862298	+	Silent	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:41862298G>A	uc001zof.1	+	10	1550	c.1326G>A	c.(1324-1326)ACG>ACA	p.T442T		NM_006293	NP_006284	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase precursor	442	Helical; (Potential).					integral to plasma membrane	ATP binding|receptor signaling protein tyrosine kinase activity|transmembrane receptor protein tyrosine kinase activity			ovary(3)|lung(2)|central_nervous_system(1)	6		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		CCCTGGTGACGGCTGCTGCCC	0.612													9	64	---	---	---	---	PASS
AP3S2	10239	broad.mit.edu	37	15	90378852	90378852	+	Silent	SNP	C	A	A	rs112739850	byFrequency	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:90378852C>A	uc002boq.3	-	6	913	c.477G>T	c.(475-477)GCG>GCT	p.A159A	AP3S2_uc002bos.3_Silent_p.A360A|AP3S2_uc010bns.2_RNA|AP3S2_uc002bor.3_RNA|AP3S2_uc010bnt.2_RNA	NM_005829	NP_005820	P59780	AP3S2_HUMAN	adaptor-related protein complex 3, sigma 2	159					intracellular protein transport|vesicle-mediated transport	cytoplasmic vesicle membrane|Golgi apparatus|membrane coat	protein transporter activity				0	Lung NSC(78;0.0181)|all_lung(78;0.0384)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.223)			ACACAGCCCGCGCAGGGGCTG	0.438													54	121	---	---	---	---	PASS
SPNS1	83985	broad.mit.edu	37	16	28992923	28992923	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:28992923G>T	uc010vdi.1	+	7	936	c.796G>T	c.(796-798)GCT>TCT	p.A266S	uc010vct.1_Intron|SPNS1_uc002drx.2_Missense_Mutation_p.A193S|SPNS1_uc002dsa.2_Missense_Mutation_p.A266S|SPNS1_uc002drz.2_Missense_Mutation_p.A266S|SPNS1_uc010byp.2_Missense_Mutation_p.A244S|SPNS1_uc010byq.1_Missense_Mutation_p.A198S	NM_001142448	NP_001135920	Q9H2V7	SPNS1_HUMAN	spinster homolog 1 isoform 1	266					lipid transport|transmembrane transport	integral to membrane|mitochondrial inner membrane	protein binding				0						AGATCTGAGGGCTCTGGCAAG	0.602											OREG0023712	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	9	158	---	---	---	---	PASS
ITGAE	3682	broad.mit.edu	37	17	3704418	3704418	+	Silent	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:3704418C>A	uc002fwo.3	-	1	120	c.21G>T	c.(19-21)CTG>CTT	p.L7L		NM_002208	NP_002199	P38570	ITAE_HUMAN	integrin, alpha E precursor	7					cell adhesion|integrin-mediated signaling pathway	integrin complex	receptor activity			large_intestine(2)|breast(1)|pancreas(1)	4				UCEC - Uterine corpus endometrioid carcinoma (3;0.0813)		CTATGCAGAGCAGAGTGTGGA	0.627													18	20	---	---	---	---	PASS
TMEM95	339168	broad.mit.edu	37	17	7259963	7259963	+	3'UTR	SNP	A	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7259963A>C	uc002ggh.1	+	7					TMEM95_uc002ggf.1_3'UTR|TMEM95_uc002ggg.1_Missense_Mutation_p.T179P	NM_198154	NP_937797	Q3KNT9	TMM95_HUMAN	transmembrane protein 95							integral to membrane					0		Prostate(122;0.173)				GACGCTGAAAACCTCCCAGCC	0.592													7	35	---	---	---	---	PASS
RARA	5914	broad.mit.edu	37	17	38510742	38510742	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:38510742C>T	uc002huk.1	+	7	1451	c.996C>T	c.(994-996)ATC>ATT	p.I332I	RARA_uc002hul.3_Silent_p.I332I|RARA_uc010wfe.1_Silent_p.I235I|RARA_uc002hun.1_Silent_p.I327I	NM_000964	NP_000955	P10276	RARA_HUMAN	retinoic acid receptor, alpha isoform 1	332	Ligand-binding.				apoptotic cell clearance|cellular response to estrogen stimulus|cellular response to retinoic acid|estrogen receptor signaling pathway|negative regulation of granulocyte differentiation|negative regulation of interferon-gamma production|negative regulation of tumor necrosis factor production|positive regulation of binding|positive regulation of cell cycle|positive regulation of cell proliferation|positive regulation of interleukin-13 production|positive regulation of interleukin-4 production|positive regulation of interleukin-5 production|positive regulation of T-helper 2 cell differentiation|positive regulation of transcription from RNA polymerase II promoter|protein phosphorylation|regulation of transcription from RNA polymerase II promoter by nuclear hormone receptor|response to estradiol stimulus	cytoplasm|nucleoplasm	chromatin DNA binding|enzyme binding|protein domain specific binding|protein heterodimerization activity|receptor binding|retinoic acid binding|retinoic acid receptor activity|retinoic acid-responsive element binding|sequence-specific DNA binding transcription factor activity|steroid hormone receptor activity|transcription coactivator activity|transcription corepressor activity|zinc ion binding			ovary(1)|lung(1)|breast(1)	3		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00143)		Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Etretinate(DB00926)|Isotretinoin(DB00982)|Tamibarotene(DB04942)|Tazarotene(DB00799)	TCAGCGCCATCTGCCTCATCT	0.682			T	PML|ZNF145|TIF1|NUMA1|NPM1	APL								14	47	---	---	---	---	PASS
CCDC57	284001	broad.mit.edu	37	17	80136939	80136939	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:80136939C>A	uc002kdz.1	-	10	1693	c.1338G>T	c.(1336-1338)GAG>GAT	p.E446D	CCDC57_uc002kdx.1_Missense_Mutation_p.E446D|CCDC57_uc010dik.1_Intron	NM_198082	NP_932348	Q2TAC2	CCD57_HUMAN	coiled-coil domain containing 57	446	Potential.									ovary(2)	2	Breast(20;0.00285)|all_neural(118;0.0878)|all_lung(278;0.0949)|Lung NSC(278;0.128)|Ovarian(332;0.227)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0253)			GAATCAGGGCCTCTGACTTTT	0.622													20	49	---	---	---	---	PASS
ZCCHC2	54877	broad.mit.edu	37	18	60241410	60241410	+	Missense_Mutation	SNP	A	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:60241410A>C	uc002lip.3	+	13	2096	c.2096A>C	c.(2095-2097)GAG>GCG	p.E699A	ZCCHC2_uc002lio.2_RNA|ZCCHC2_uc002liq.2_Missense_Mutation_p.E169A	NM_017742	NP_060212	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	699					cell communication	cytoplasm	nucleic acid binding|phosphatidylinositol binding|zinc ion binding			lung(1)|prostate(1)	2						CTAGGAAATGAGAATGGAAAC	0.423													113	300	---	---	---	---	PASS
CNN1	1264	broad.mit.edu	37	19	11660497	11660497	+	Missense_Mutation	SNP	T	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:11660497T>G	uc002msc.1	+	7	945	c.781T>G	c.(781-783)TAT>GAT	p.Y261D	CNN1_uc010xmb.1_Missense_Mutation_p.Y211D|CNN1_uc010xmc.1_Missense_Mutation_p.Y211D	NM_001299	NP_001290	P51911	CNN1_HUMAN	calponin 1, basic, smooth muscle	261	Calponin-like 3.				actomyosin structure organization|regulation of smooth muscle contraction	cytoskeleton	actin binding|calmodulin binding				0						CATGACGGTGTATGGGCTGCC	0.632													3	62	---	---	---	---	PASS
ZNF443	10224	broad.mit.edu	37	19	12541874	12541874	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:12541874C>T	uc002mtu.2	-	4	1310	c.1112G>A	c.(1111-1113)GGG>GAG	p.G371E		NM_005815	NP_005806	Q9Y2A4	ZN443_HUMAN	zinc finger protein 443	371	C2H2-type 9.				induction of apoptosis|regulation of transcription, DNA-dependent|response to stress|transcription, DNA-dependent	nucleus	DNA binding|zinc ion binding			pancreas(1)	1						AAAGCCTTTCCCACATATCTT	0.423													105	332	---	---	---	---	PASS
DCAF15	90379	broad.mit.edu	37	19	14069908	14069908	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:14069908C>T	uc002mxt.2	+	7	842	c.836C>T	c.(835-837)GCG>GTG	p.A279V	DCAF15_uc002mxu.2_5'Flank	NM_138353	NP_612362	Q66K64	DCA15_HUMAN	DDB1 and CUL4 associated factor 15	279										central_nervous_system(1)	1						TGCCCCCTGGCGCCTGCCAGC	0.657													8	132	---	---	---	---	PASS
NCAN	1463	broad.mit.edu	37	19	19338756	19338756	+	Missense_Mutation	SNP	A	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:19338756A>T	uc002nlz.2	+	8	2426	c.2327A>T	c.(2326-2328)GAT>GTT	p.D776V	NCAN_uc010ecc.1_Missense_Mutation_p.D340V	NM_004386	NP_004377	O14594	NCAN_HUMAN	chondroitin sulfate proteoglycan 3 precursor	776					axon guidance|cell adhesion	extracellular region	calcium ion binding|hyaluronic acid binding|sugar binding			ovary(4)	4			Epithelial(12;0.00544)			GCCACTGTAGATGAGGTGCAG	0.612													37	139	---	---	---	---	PASS
ZNF99	7652	broad.mit.edu	37	19	22942393	22942393	+	Silent	SNP	A	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:22942393A>G	uc010xrh.1	-	4	381	c.381T>C	c.(379-381)TGT>TGC	p.C127C		NM_001080409	NP_001073878			zinc finger protein 99											ovary(1)|skin(1)	2		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCTTATGTCCACATCTTGCAT	0.323													25	101	---	---	---	---	PASS
RYR1	6261	broad.mit.edu	37	19	39019663	39019663	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39019663C>T	uc002oit.2	+	76	11237	c.11107C>T	c.(11107-11109)CTG>TTG	p.L3703L	RYR1_uc002oiu.2_Silent_p.L3698L|RYR1_uc002oiv.1_Silent_p.L618L|RYR1_uc010xuf.1_Silent_p.L623L	NM_000540	NP_000531	P21817	RYR1_HUMAN	skeletal muscle ryanodine receptor isoform 1	3703					muscle contraction|release of sequestered calcium ion into cytosol|response to caffeine|response to hypoxia	cell cortex|cytosol|I band|integral to plasma membrane|junctional sarcoplasmic reticulum membrane|smooth endoplasmic reticulum|terminal cisterna	calcium ion binding|calmodulin binding|receptor activity|ryanodine-sensitive calcium-release channel activity			ovary(7)|pancreas(2)|breast(1)|central_nervous_system(1)|skin(1)	12	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Dantrolene(DB01219)	CCAGTTGGTCCTGCACTTCAG	0.517													9	38	---	---	---	---	PASS
SIRT2	22933	broad.mit.edu	37	19	39384061	39384061	+	Missense_Mutation	SNP	G	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:39384061G>T	uc002ojt.1	-	4	419	c.219C>A	c.(217-219)AGC>AGA	p.S73R	SIRT2_uc010egh.1_Missense_Mutation_p.S36R|SIRT2_uc010egi.1_Missense_Mutation_p.S36R|SIRT2_uc002ojs.1_Missense_Mutation_p.S53R|SIRT2_uc002oju.1_Missense_Mutation_p.S36R|SIRT2_uc010egj.1_Missense_Mutation_p.S36R|SIRT2_uc002ojv.1_Missense_Mutation_p.S73R	NM_012237	NP_036369	Q8IXJ6	SIRT2_HUMAN	sirtuin 2 isoform 1	73	Deacetylase sirtuin-type.				cell division|chromatin silencing at rDNA|chromatin silencing at telomere|mitosis|negative regulation of striated muscle tissue development|protein ADP-ribosylation|regulation of exit from mitosis|regulation of phosphorylation|response to redox state	chromatin silencing complex|cytoplasm|microtubule	histone acetyltransferase binding|histone deacetylase binding|NAD+ binding|NAD-dependent histone deacetylase activity|transcription factor binding|tubulin deacetylase activity|ubiquitin binding|zinc ion binding				0	all_cancers(60;6.83e-06)|Ovarian(47;0.0454)		Lung(45;0.00125)|LUSC - Lung squamous cell carcinoma(53;0.00191)			CACAGCGTTCGCTCTGCATGT	0.587													11	43	---	---	---	---	PASS
FCGBP	8857	broad.mit.edu	37	19	40420081	40420081	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:40420081C>T	uc002omp.3	-	6	2921	c.2913G>A	c.(2911-2913)GTG>GTA	p.V971V		NM_003890	NP_003881	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein precursor	971	VWFD 2.					extracellular region	protein binding			ovary(4)|skin(4)|central_nervous_system(1)	9	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AGTCCGTGCGCACGACGGCAT	0.592													13	94	---	---	---	---	PASS
CRX	1406	broad.mit.edu	37	19	48342889	48342889	+	Missense_Mutation	SNP	G	A	A	rs142111462		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:48342889G>A	uc002phq.3	+	4	769	c.565G>A	c.(565-567)GCC>ACC	p.A189T		NM_000554	NP_000545	O43186	CRX_HUMAN	cone-rod homeobox protein	189					organ morphogenesis|response to stimulus|visual perception		leucine zipper domain binding|sequence-specific DNA binding|sequence-specific DNA binding transcription factor activity			breast(1)|central_nervous_system(1)	2		all_cancers(25;2.76e-09)|all_epithelial(76;7.01e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000266)|all cancers(93;0.000788)|Epithelial(262;0.0226)|GBM - Glioblastoma multiforme(486;0.0521)		TCTGACCTCCGCCCCCTATGC	0.667													17	109	---	---	---	---	PASS
TMC4	147798	broad.mit.edu	37	19	54664257	54664257	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:54664257G>C	uc010erf.2	-	14	2149	c.2017C>G	c.(2017-2019)CTG>GTG	p.L673V	LENG1_uc002qdm.2_5'Flank|TMC4_uc002qdn.2_Missense_Mutation_p.L387V|TMC4_uc002qdo.2_Missense_Mutation_p.L667V	NM_001145303	NP_001138775	Q7Z404	TMC4_HUMAN	transmembrane channel-like 4 isoform 1	673	Helical; (Potential).					integral to membrane				pancreas(1)	1	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					gagttagccagAGCCACAGTG	0.418													12	94	---	---	---	---	PASS
FAM113A	64773	broad.mit.edu	37	20	2818880	2818880	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:2818880G>A	uc002wgz.1	-	6	1336	c.839C>T	c.(838-840)CCT>CTT	p.P280L	FAM113A_uc002whb.1_Missense_Mutation_p.P131L|FAM113A_uc002wha.1_Missense_Mutation_p.P131L|FAM113A_uc010zqa.1_Missense_Mutation_p.P127L|FAM113A_uc002whc.1_Missense_Mutation_p.P229L|VPS16_uc002whe.2_5'Flank|VPS16_uc002whf.2_5'Flank|VPS16_uc002whd.2_5'Flank	NM_022760	NP_073597	Q9H1Q7	F113A_HUMAN	hypothetical protein LOC64773	280							hydrolase activity|protein binding			ovary(2)	2						GGGCTCACCAGGGGGATAGCC	0.617													24	157	---	---	---	---	PASS
CDC25B	994	broad.mit.edu	37	20	3782409	3782409	+	Missense_Mutation	SNP	G	C	C			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:3782409G>C	uc002wjn.2	+	9	1659	c.881G>C	c.(880-882)AGT>ACT	p.S294T	CDC25B_uc010zqk.1_Missense_Mutation_p.S230T|CDC25B_uc010zql.1_Missense_Mutation_p.S216T|CDC25B_uc010zqm.1_Intron|CDC25B_uc002wjl.2_Missense_Mutation_p.S182T|CDC25B_uc002wjm.2_Missense_Mutation_p.S182T|CDC25B_uc002wjo.2_Missense_Mutation_p.S280T|CDC25B_uc002wjp.2_Missense_Mutation_p.S253T|CDC25B_uc002wjq.2_Missense_Mutation_p.S94T|CDC25B_uc010gbc.2_5'Flank	NM_021873	NP_068659	P30305	MPIP2_HUMAN	cell division cycle 25B isoform 1	294					cell division|G2/M transition of mitotic cell cycle|mitosis|positive regulation of cell proliferation	cytosol|microtubule organizing center|nucleoplasm	protein binding|protein tyrosine phosphatase activity			lung(3)|ovary(2)	5						AGTCTCATTAGTGCCCCACTG	0.572													15	50	---	---	---	---	PASS
C20orf12	55184	broad.mit.edu	37	20	18374420	18374420	+	Missense_Mutation	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:18374420C>T	uc010zsa.1	-	17	2010	c.1801G>A	c.(1801-1803)GAA>AAA	p.E601K	C20orf12_uc010zrz.1_Missense_Mutation_p.E120K|C20orf12_uc002wqp.3_Missense_Mutation_p.E292K|C20orf12_uc002wqr.3_RNA|C20orf12_uc002wqs.3_Missense_Mutation_p.E468K|C20orf12_uc002wqq.3_Missense_Mutation_p.E582K	NM_001099407	NP_001092877	Q9NVP4	CT012_HUMAN	hypothetical protein LOC55184	409						intracellular	zinc ion binding			ovary(1)	1		Myeloproliferative disorder(85;0.0122)				TTGATTTTTTCAATAGTATCT	0.388													30	62	---	---	---	---	PASS
HUNK	30811	broad.mit.edu	37	21	33296887	33296887	+	Silent	SNP	C	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:33296887C>T	uc002yph.2	+	2	729	c.369C>T	c.(367-369)ATC>ATT	p.I123I		NM_014586	NP_055401	P57058	HUNK_HUMAN	hormonally upregulated Neu-associated kinase	123	Protein kinase.				multicellular organismal development|signal transduction		ATP binding|protein serine/threonine kinase activity			stomach(1)|skin(1)	2						ACCCCAATATCACTCAGCTCC	0.478													16	79	---	---	---	---	PASS
SYNJ1	8867	broad.mit.edu	37	21	34003386	34003386	+	Silent	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:34003386C>A	uc002yqh.2	-	32	4758	c.4758G>T	c.(4756-4758)CCG>CCT	p.P1586P	SYNJ1_uc011ads.1_3'UTR|SYNJ1_uc002yqf.2_3'UTR|SYNJ1_uc002yqg.2_Silent_p.P1500P|SYNJ1_uc002yqi.2_3'UTR|SYNJ1_uc002yqe.3_Silent_p.P172P	NM_003895	NP_003886	O43426	SYNJ1_HUMAN	synaptojanin 1 isoform a	1547	Pro-rich.						inositol-polyphosphate 5-phosphatase activity|nucleotide binding|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity|RNA binding			ovary(4)|skin(1)	5						TGGTGCCGGGCGGGAGCAGAG	0.507													27	93	---	---	---	---	PASS
AIRE	326	broad.mit.edu	37	21	45706878	45706878	+	Missense_Mutation	SNP	C	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:45706878C>A	uc002zei.2	+	3	452	c.325C>A	c.(325-327)CCC>ACC	p.P109T		NM_000383	NP_000374	O43918	AIRE_HUMAN	autoimmune regulator isoform 1	109					positive regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|nucleus	chromatin binding|histone binding|transcription regulatory region DNA binding|translation regulator activity|zinc ion binding			skin(1)	1				Colorectal(79;0.0806)		CCTCAGCCAGCCCCGGAAGGG	0.667									Autoimmune_PolyEndocrinopathy_Candidiasis_Ectodermal_Dystrophy				4	61	---	---	---	---	PASS
TOP3B	8940	broad.mit.edu	37	22	22324788	22324788	+	Intron	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:22324788G>A	uc002zvs.2	-						TOP3B_uc010gtm.1_5'Flank|TOP3B_uc002zvr.2_5'Flank|TOP3B_uc010gtl.2_Intron|TOP3B_uc002zvt.3_Intron	NM_003935	NP_003926	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta						DNA topological change	nucleus	ATP binding|DNA topoisomerase type I activity|protein binding			kidney(1)	1	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CCTGGGGGTGGGGAGTGGCCA	0.612													10	18	---	---	---	---	PASS
DEPDC5	9681	broad.mit.edu	37	22	32297747	32297747	+	Nonsense_Mutation	SNP	C	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32297747C>G	uc003als.2	+	40	4444	c.4302C>G	c.(4300-4302)TAC>TAG	p.Y1434*	DEPDC5_uc011als.1_Nonsense_Mutation_p.Y1365*|DEPDC5_uc011alu.1_Nonsense_Mutation_p.Y1465*|DEPDC5_uc011alv.1_RNA|DEPDC5_uc003alt.2_Nonsense_Mutation_p.Y1456*|DEPDC5_uc003alu.2_Nonsense_Mutation_p.Y883*|DEPDC5_uc003alv.2_RNA|DEPDC5_uc003alw.2_Nonsense_Mutation_p.Y732*|DEPDC5_uc011alx.1_Nonsense_Mutation_p.Y282*|DEPDC5_uc010gwk.2_Nonsense_Mutation_p.Y460*|DEPDC5_uc011aly.1_Nonsense_Mutation_p.Y282*	NM_014662	NP_055477	O75140	DEPD5_HUMAN	DEP domain containing 5 isoform 1	1434					intracellular signal transduction					ovary(4)|central_nervous_system(3)|pancreas(1)	8						CCGAAACGTACTGGGATCGAA	0.428													8	38	---	---	---	---	PASS
DDX53	168400	broad.mit.edu	37	X	23019367	23019367	+	Missense_Mutation	SNP	G	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:23019367G>A	uc004daj.2	+	1	1281	c.1193G>A	c.(1192-1194)CGC>CAC	p.R398H		NM_182699	NP_874358	Q86TM3	DDX53_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 53	398	Helicase ATP-binding.					nucleus	ATP binding|ATP-dependent helicase activity|RNA binding			large_intestine(1)|ovary(1)|kidney(1)	3						TTAGATGTGCGCCCAGACCGA	0.393													12	667	---	---	---	---	PASS
KIF1B	23095	broad.mit.edu	37	1	10318364	10318365	+	Intron	DEL	GT	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:10318364_10318365delGT	uc001aqx.3	+						KIF1B_uc001aqv.3_Intron|KIF1B_uc001aqw.3_Intron|KIF1B_uc001aqy.2_Intron|KIF1B_uc001aqz.2_Intron|KIF1B_uc001ara.2_Intron|KIF1B_uc001arb.2_Intron|KIF1B_uc009vmt.2_Intron	NM_015074	NP_055889	O60333	KIF1B_HUMAN	kinesin family member 1B isoform b						anterograde axon cargo transport|apoptosis|neuromuscular synaptic transmission|neuron-neuron synaptic transmission	cytoplasmic vesicle membrane|microtubule|microtubule associated complex|mitochondrion	ATP binding|ATPase activity|kinesin binding|microtubule motor activity|protein binding			ovary(2)|upper_aerodigestive_tract(1)	3	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		gtgtttgtgagtgtgtgtgtgt	0.248													4	2	---	---	---	---	
FAM54B	56181	broad.mit.edu	37	1	26149357	26149358	+	Intron	DEL	CT	-	-	rs150838925		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:26149357_26149358delCT	uc001bkq.3	+						FAM54B_uc001bkr.3_Intron|FAM54B_uc010oet.1_Intron|FAM54B_uc009vrz.2_Intron|LOC646471_uc010oeu.1_RNA|FAM54B_uc001bks.3_Intron|FAM54B_uc001bkt.3_Intron|FAM54B_uc001bku.3_5'UTR|FAM54B_uc001bkv.3_5'Flank	NM_001099625	NP_001093095	Q9H019	FA54B_HUMAN	hypothetical protein LOC56181 isoform a											pancreas(1)	1		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;1.96e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|BRCA - Breast invasive adenocarcinoma(304;0.00095)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0649)		GGACTTAGAGCTAAGTGTTGGG	0.351													5	8	---	---	---	---	
NSUN4	387338	broad.mit.edu	37	1	46810951	46810951	+	Intron	DEL	T	-	-	rs146311377		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:46810951delT	uc001cpr.1	+						NSUN4_uc010omc.1_Intron|NSUN4_uc009vyf.1_Intron|NSUN4_uc009vyg.1_Intron|NSUN4_uc001cpt.1_Intron|NSUN4_uc001cps.1_Intron	NM_199044	NP_950245	Q96CB9	NSUN4_HUMAN	NOL1/NOP2/Sun domain family 4 protein								methyltransferase activity				0	Acute lymphoblastic leukemia(166;0.155)					agactaggcatttttttgagg	0.139													8	5	---	---	---	---	
ST7L	54879	broad.mit.edu	37	1	113119845	113119845	+	Intron	DEL	A	-	-	rs71775909		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:113119845delA	uc001ecd.2	-						ST7L_uc009wgh.2_Intron|ST7L_uc001ecc.2_Intron|ST7L_uc010owg.1_Intron|ST7L_uc010owh.1_Intron|ST7L_uc001ece.2_Intron|ST7L_uc001ecf.2_Intron|ST7L_uc001ecg.2_Intron|ST7L_uc010owi.1_Intron|ST7L_uc001ech.2_Intron|ST7L_uc001eci.2_Intron|ST7L_uc009wgi.1_Intron|ST7L_uc010owj.1_Intron	NM_017744	NP_060214	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7-like isoform 1						negative regulation of cell growth	integral to membrane	binding				0	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GAGGACTAACaaaaaaaaaaa	0.174													8	4	---	---	---	---	
BAT2L2	23215	broad.mit.edu	37	1	171487093	171487093	+	Intron	DEL	G	-	-	rs80115932		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:171487093delG	uc010pmg.1	+						BAT2L2_uc001ghr.1_Intron	NM_015172	NP_055987	Q9Y520	PRC2C_HUMAN	HBxAg transactivated protein 2								protein C-terminus binding				0						tttattGTATGGTATattgtg	0.065													6	5	---	---	---	---	
TEDDM1	127670	broad.mit.edu	37	1	182368631	182368631	+	3'UTR	DEL	A	-	-	rs36049878		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr1:182368631delA	uc001gpe.2	-	1						NM_172000	NP_741997	Q5T9Z0	TEDM1_HUMAN	putative membrane protein HE9							integral to membrane				ovary(2)	2						actctgtctcaaaaaaaaaaa	0.179													5	4	---	---	---	---	
BCL11A	53335	broad.mit.edu	37	2	60694948	60694949	+	Intron	INS	-	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:60694948_60694949insT	uc002sae.1	-						BCL11A_uc002sab.2_Intron|BCL11A_uc002sac.2_Intron|BCL11A_uc010ypi.1_Intron|BCL11A_uc010ypj.1_Intron|BCL11A_uc002sad.1_Intron|BCL11A_uc002saf.1_Intron	NM_022893	NP_075044	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A isoform 1						negative regulation of axon extension|negative regulation of collateral sprouting|negative regulation of dendrite development|positive regulation of collateral sprouting|positive regulation of neuron projection development|positive regulation of transcription from RNA polymerase II promoter|protein sumoylation|regulation of dendrite development|regulation of transcription, DNA-dependent|transcription, DNA-dependent	cytoplasm|cytoplasm|nucleus|nucleus	nucleic acid binding|protein heterodimerization activity|protein homodimerization activity|zinc ion binding			central_nervous_system(6)|breast(3)|ovary(2)|skin(2)	13			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			ggtgatggtactggtggtgatg	0.000			T	IGH@	B-CLL								4	2	---	---	---	---	
NEB	4703	broad.mit.edu	37	2	152417311	152417312	+	Intron	INS	-	C	C	rs150437657	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr2:152417311_152417312insC	uc010fnx.2	-						NEB_uc002txr.2_Intron	NM_004543	NP_004534	P20929	NEBU_HUMAN	nebulin isoform 3						muscle filament sliding|muscle organ development|regulation of actin filament length|somatic muscle development	actin cytoskeleton|cytosol|Z disc	actin binding|structural constituent of muscle			ovary(8)|large_intestine(5)|breast(3)|central_nervous_system(2)|skin(1)|pancreas(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.219)		TCTCACACACTCCCTACTAACT	0.411													8	5	---	---	---	---	
CNOT10	25904	broad.mit.edu	37	3	32758895	32758896	+	Intron	INS	-	T	T	rs75168073		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:32758895_32758896insT	uc003cfc.1	+						CNOT10_uc011axi.1_Intron|CNOT10_uc003cfd.1_Intron|CNOT10_uc003cfe.1_Intron|CNOT10_uc010hfv.1_Intron|CNOT10_uc011axj.1_Intron|CNOT10_uc010hfw.1_Intron	NM_015442	NP_056257	Q9H9A5	CNOTA_HUMAN	CCR4-NOT transcription complex, subunit 10						nuclear-transcribed mRNA poly(A) tail shortening	cytosol	protein binding			central_nervous_system(1)|skin(1)	2						ctatagtttaattttttttttt	0.109													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	3	81882174	81882177	+	IGR	DEL	TTCC	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:81882174_81882177delTTCC								GBE1 (71224 upstream) : None (None downstream)																							tatcttccttttccttccttcctt	0.074													3	3	---	---	---	---	
CEP97	79598	broad.mit.edu	37	3	101483456	101483456	+	Intron	DEL	A	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:101483456delA	uc003dvk.1	+						CEP97_uc011bhf.1_Intron|CEP97_uc003dvl.1_Intron|CEP97_uc003dvm.1_Intron	NM_024548	NP_078824	Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa							centrosome|nucleus	protein binding			ovary(2)	2						actccatctcaaaaaaaaaaa	0.000													5	3	---	---	---	---	
UROC1	131669	broad.mit.edu	37	3	126216641	126216645	+	Intron	DEL	GGCTT	-	-	rs71797104		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:126216641_126216645delGGCTT	uc003eiz.1	-						UROC1_uc010hsi.1_Intron	NM_144639	NP_653240	Q96N76	HUTU_HUMAN	urocanase domain containing 1 isoform 1						histidine catabolic process	cytosol	urocanate hydratase activity			ovary(1)	1				GBM - Glioblastoma multiforme(114;0.17)		GGAGGGCAGAGGCTTGGTGTGGGTG	0.590													5	4	---	---	---	---	
PHC3	80012	broad.mit.edu	37	3	169829102	169829109	+	Intron	DEL	GAAGGAAC	-	-	rs11280273	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:169829102_169829109delGAAGGAAC	uc010hws.1	-						PHC3_uc003fgl.2_Intron|PHC3_uc011bpq.1_Intron	NM_024947	NP_079223	Q8NDX5	PHC3_HUMAN	polyhomeotic like 3						multicellular organismal development	PcG protein complex	DNA binding|zinc ion binding			ovary(1)|central_nervous_system(1)	2	all_cancers(22;2.67e-22)|all_epithelial(15;4.73e-27)|all_lung(20;6.31e-17)|Lung NSC(18;2.61e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			aggaaggaaggaaggaacgaacgaacga	0.000													4	2	---	---	---	---	
MUC4	4585	broad.mit.edu	37	3	195512373	195512374	+	In_Frame_Ins	INS	-	GAT	GAT	rs140335395	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:195512373_195512374insGAT	uc011bto.1	-	2	6537_6538	c.6077_6078insATC	c.(6076-6078)TCC>TCATCC	p.2026_2026S>SS	MUC4_uc003fvo.2_Intron|MUC4_uc003fvp.2_Intron|MUC4_uc010hzu.1_Intron	NM_018406	NP_060876	Q99102	MUC4_HUMAN	mucin 4 isoform a	798	Ser-rich.				cell-matrix adhesion	integral to plasma membrane|proteinaceous extracellular matrix	ErbB-2 class receptor binding|extracellular matrix constituent, lubricant activity				0	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGTCACCAGTGGATGCTGAGGA	0.579													4	2	---	---	---	---	
PIGZ	80235	broad.mit.edu	37	3	196684042	196684043	+	Intron	INS	-	TGTG	TGTG	rs147601077	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr3:196684042_196684043insTGTG	uc003fxh.2	-							NM_025163	NP_079439	Q86VD9	PIGZ_HUMAN	phosphatidylinositol glycan anchor biosynthesis,						GPI anchor biosynthetic process	integral to membrane|intrinsic to endoplasmic reticulum membrane	alpha-1,2-mannosyltransferase activity			ovary(3)	3	all_cancers(143;1.05e-08)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.29e-24)|all cancers(36;2.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.03e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00603)		gctccaggttttgtgtgtgtgt	0.000													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	4	32779983	32779984	+	IGR	INS	-	CTTTCTTTCTT	CTTTCTTTCTT	rs138164136	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:32779983_32779984insCTTTCTTTCTT								None (None upstream) : None (None downstream)																							ttccttccttccttTCTttctt	0.005													3	3	---	---	---	---	
NFXL1	152518	broad.mit.edu	37	4	47916234	47916234	+	Intron	DEL	A	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:47916234delA	uc010igh.2	-						uc003gxr.1_5'Flank|NFXL1_uc003gxp.2_Intron|NFXL1_uc003gxq.3_Intron|NFXL1_uc010igi.2_Intron	NM_152995	NP_694540	Q6ZNB6	NFXL1_HUMAN	nuclear transcription factor, X-box binding-like							integral to membrane|nucleus	sequence-specific DNA binding transcription factor activity|zinc ion binding			ovary(1)|lung(1)|skin(1)	3						TGCAAAGGAGAAAAAAAAAAA	0.627													4	3	---	---	---	---	
NUP54	53371	broad.mit.edu	37	4	77052191	77052192	+	Intron	INS	-	T	T	rs147143586	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:77052191_77052192insT	uc003hjs.2	-						NUP54_uc010ije.2_Intron|NUP54_uc011cbs.1_Intron|NUP54_uc011cbt.1_Intron|NUP54_uc003hjt.2_Intron	NM_017426	NP_059122	Q7Z3B4	NUP54_HUMAN	nucleoporin 54kDa						carbohydrate metabolic process|glucose transport|mRNA transport|regulation of glucose transport|transmembrane transport|viral reproduction	cytoplasm|nuclear membrane|nuclear pore|nucleoplasm				ovary(1)|lung(1)	2						TTACCATAATCTTTTTTTTTCT	0.272													4	5	---	---	---	---	
MANBA	4126	broad.mit.edu	37	4	103556367	103556368	+	Intron	INS	-	T	T	rs143140380	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr4:103556367_103556368insT	uc003hwg.2	-						MANBA_uc011ces.1_Intron	NM_005908	NP_005899	O00462	MANBA_HUMAN	mannosidase, beta A, lysosomal precursor						carbohydrate metabolic process|protein modification process	lysosome	beta-mannosidase activity|cation binding			ovary(1)	1		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;4.44e-08)		atgtgactaagtaacttctcag	0.045													3	4	---	---	---	---	
KIF2A	3796	broad.mit.edu	37	5	61657534	61657535	+	Intron	INS	-	T	T	rs11418602		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:61657534_61657535insT	uc003jsy.3	+						KIF2A_uc003jsz.3_Intron|KIF2A_uc010iwp.2_Intron|KIF2A_uc003jsx.3_Intron|KIF2A_uc010iwq.2_Intron	NM_004520	NP_004511	O00139	KIF2A_HUMAN	kinesin heavy chain member 2 isoform 1						blood coagulation|cell differentiation|cell division|microtubule-based movement|mitotic prometaphase|mitotic spindle organization|nervous system development	centrosome|cytosol|microtubule|spindle pole	ATP binding|microtubule motor activity|protein binding				0		Lung NSC(810;8.94e-06)|Prostate(74;0.0132)|Ovarian(174;0.051)|Breast(144;0.077)		Lung(70;0.14)		ATTCACaataattttttttttt	0.144													2	4	---	---	---	---	
HSPA9	3313	broad.mit.edu	37	5	137896598	137896598	+	Intron	DEL	T	-	-	rs66854799		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr5:137896598delT	uc003ldf.2	-						HSPA9_uc011cyw.1_Intron	NM_004134	NP_004125	P38646	GRP75_HUMAN	heat shock 70kDa protein 9 precursor						anti-apoptosis|protein folding	cell surface|mitochondrial nucleoid	ATP binding|unfolded protein binding				0			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			TCCAGGTTCATTTTTTTTTTT	0.264													4	2	---	---	---	---	
LRRC1	55227	broad.mit.edu	37	6	53787794	53787794	+	3'UTR	DEL	T	-	-	rs67155925		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:53787794delT	uc003pcd.1	+	14						NM_018214	NP_060684	Q9BTT6	LRRC1_HUMAN	leucine rich repeat containing 1							cytoplasm|membrane				ovary(1)	1	Lung NSC(77;0.0147)			BRCA - Breast invasive adenocarcinoma(397;0.0745)		CCCGGTGTGATTTTTTTTTTT	0.458													9	8	---	---	---	---	
ACAT2	39	broad.mit.edu	37	6	160199454	160199455	+	Intron	DEL	TT	-	-	rs71808548		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr6:160199454_160199455delTT	uc010kjy.2	+						ACAT2_uc011efw.1_Intron	NM_005891	NP_005882	Q9BWD1	THIC_HUMAN	acetyl-Coenzyme A acetyltransferase 2							mitochondrion|nucleolus	acetyl-CoA C-acetyltransferase activity|protein binding			ovary(1)|central_nervous_system(1)	2		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		CTTCCCAAGGTTTaaaaaaaaa	0.317													4	6	---	---	---	---	
TXNDC3	51314	broad.mit.edu	37	7	37916284	37916284	+	Intron	DEL	T	-	-	rs11334674		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:37916284delT	uc003tfn.2	+							NM_016616	NP_057700	Q8N427	TXND3_HUMAN	thioredoxin domain containing 3						cell differentiation|cell redox homeostasis|CTP biosynthetic process|GTP biosynthetic process|multicellular organismal development|spermatogenesis|UTP biosynthetic process	cytoplasm|microtubule cytoskeleton	ATP binding|nucleoside diphosphate kinase activity			ovary(1)|breast(1)|central_nervous_system(1)	3						TTCTTGGATATAATAGGGAGA	0.249									Kartagener_syndrome				3	3	---	---	---	---	
WBSCR27	155368	broad.mit.edu	37	7	73249451	73249456	+	Intron	DEL	CTCTCC	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:73249451_73249456delCTCTCC	uc003tzj.2	-						RFC2_uc011kfa.1_Intron	NM_152559	NP_689772	Q8N6F8	WBS27_HUMAN	Williams-Beuren syndrome chromosome region 27											central_nervous_system(1)	1		Lung NSC(55;0.159)				TGGGGACGCTctctccctctccctct	0.277													4	2	---	---	---	---	
SRRT	51593	broad.mit.edu	37	7	100485641	100485642	+	Intron	INS	-	T	T			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:100485641_100485642insT	uc003uwy.2	+						SRRT_uc010lhl.1_Intron|SRRT_uc003uxa.2_Intron|SRRT_uc003uwz.2_Intron	NM_015908	NP_056992	Q9BXP5	SRRT_HUMAN	arsenate resistance protein 2 isoform a						cell proliferation|primary miRNA processing|response to arsenic-containing substance	cytoplasm|nucleoplasm	protein binding			ovary(2)	2						CCCCGCAGTAATTCATGTCCCT	0.594													60	28	---	---	---	---	
SLC26A4	5172	broad.mit.edu	37	7	107338764	107338764	+	Intron	DEL	T	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:107338764delT	uc003vep.2	+						SLC26A4_uc011kmb.1_Intron|SLC26A4_uc011kmc.1_Intron|SLC26A4_uc011kmd.1_Intron	NM_000441	NP_000432	O43511	S26A4_HUMAN	pendrin						regulation of pH|regulation of protein localization|sensory perception of sound	apical plasma membrane|integral to membrane	chloride transmembrane transporter activity|inorganic anion exchanger activity|iodide transmembrane transporter activity|secondary active sulfate transmembrane transporter activity			ovary(3)|central_nervous_system(2)|skin(2)	7						GCTGAATGTCttttttttttt	0.214									Pendred_syndrome				6	3	---	---	---	---	
CHCHD3	54927	broad.mit.edu	37	7	132719268	132719269	+	Intron	INS	-	TTT	TTT	rs56769155		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:132719268_132719269insTTT	uc003vre.2	-						CHCHD3_uc010lmi.2_Intron|CHCHD3_uc003vrf.2_Intron|CHCHD3_uc010lmj.2_Intron|CHCHD3_uc011kpn.1_Intron	NM_017812	NP_060282	Q9NX63	CHCH3_HUMAN	coiled-coil-helix-coiled-coil-helix domain						inner mitochondrial membrane organization|mitochondrial fusion	mitochondrial inner membrane	protein complex scaffold				0						TGGATCCAGTCttttttttttt	0.342													6	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	142013698	142013699	+	Intron	DEL	CT	-	-	rs36111580		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:142013698_142013699delCT	uc011kro.1	+						uc011krp.1_Intron					SubName: Full=V_segment translation product; Flags: Fragment;																		CTGAGTGTGACTCTGCCCCGTC	0.307													3	4	---	---	---	---	
KRBA1	84626	broad.mit.edu	37	7	149419581	149419581	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:149419581delC	uc003wfz.2	+	6	934	c.535delC	c.(535-537)CCCfs	p.P179fs	KRBA1_uc010lpj.2_RNA|KRBA1_uc003wga.2_RNA|KRBA1_uc003wgb.2_5'Flank	NM_032534	NP_115923	A5PL33	KRBA1_HUMAN	KRAB A domain containing 1	179										ovary(1)|central_nervous_system(1)	2	Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCAGCCCTCCCACCCATAG	0.627													16	7	---	---	---	---	
Unknown	0	broad.mit.edu	37	7	155739522	155739525	+	IGR	DEL	TTCC	-	-	rs5888641		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr7:155739522_155739525delTTCC								SHH (134555 upstream) : C7orf4 (593660 downstream)																							ccttccttctttccttccttcctt	0.000													4	2	---	---	---	---	
EPPK1	83481	broad.mit.edu	37	8	144940069	144940070	+	3'UTR	INS	-	A	A	rs11371106		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr8:144940069_144940070insA	uc003zaa.1	-	3						NM_031308	NP_112598	P58107	EPIPL_HUMAN	epiplakin 1							cytoplasm|cytoskeleton	protein binding|structural molecule activity			pancreas(1)|skin(1)	2	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			taaagaatgacaaaaaaaaaaa	0.347													4	2	---	---	---	---	
PTPRD	5789	broad.mit.edu	37	9	8331407	8331416	+	Intron	DEL	TTATTTTCAC	-	-	rs10976963		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:8331407_8331416delTTATTTTCAC	uc003zkk.2	-						PTPRD_uc003zkp.2_Intron|PTPRD_uc003zkq.2_Intron|PTPRD_uc003zkr.2_Intron|PTPRD_uc003zks.2_Intron|PTPRD_uc003zkl.2_Intron|PTPRD_uc003zkm.2_Intron|PTPRD_uc003zkn.2_Intron|PTPRD_uc003zko.2_Intron	NM_002839	NP_002830	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D						transmembrane receptor protein tyrosine phosphatase signaling pathway	integral to plasma membrane	protein binding|transmembrane receptor protein tyrosine phosphatase activity			lung(14)|large_intestine(3)|ovary(2)|breast(2)|urinary_tract(1)	22		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TTTCCTCTGATTATTTTCACTTATTTTCAC	0.276										TSP Lung(15;0.13)			5	5	---	---	---	---	
C9orf72	203228	broad.mit.edu	37	9	27562675	27562675	+	Intron	DEL	T	-	-	rs72085371		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr9:27562675delT	uc003zqq.2	-						C9orf72_uc003zqr.1_Intron	NM_018325	NP_060795	Q96LT7	CI072_HUMAN	hypothetical protein LOC203228 isoform a											ovary(3)|central_nervous_system(1)	4		all_neural(11;7.57e-10)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.00016)		ctttcttttcttttttttttt	0.129													5	3	---	---	---	---	
FRMD4A	55691	broad.mit.edu	37	10	13820618	13820623	+	Intron	DEL	TGTGTT	-	-	rs11258597	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:13820618_13820623delTGTGTT	uc001ims.2	-						FRMD4A_uc009xjf.1_Intron|FRMD4A_uc001imt.1_Intron|FRMD4A_uc001imu.1_Intron	NM_018027	NP_060497	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A							cytoplasm|cytoskeleton	binding			ovary(1)|skin(1)|pancreas(1)	3						tgtgtgtgtgtgtgtttgtgtgtgtg	0.335													3	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	10	69634054	69634054	+	IGR	DEL	G	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:69634054delG								DNAJC12 (36117 upstream) : SIRT1 (10373 downstream)																							aaaaaaaaaagaaaagaaaac	0.199													4	2	---	---	---	---	
ENTPD7	57089	broad.mit.edu	37	10	101461048	101461049	+	Intron	DEL	TT	-	-	rs111380688		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:101461048_101461049delTT	uc001kqa.3	+						ENTPD7_uc009xwl.2_Intron	NM_020354	NP_065087	Q9NQZ7	ENTP7_HUMAN	ectonucleoside triphosphate diphosphohydrolase							cytoplasmic vesicle membrane|integral to membrane	hydrolase activity			ovary(1)	1		Colorectal(252;0.234)		Epithelial(162;4.72e-10)|all cancers(201;3.75e-08)		ACAAAAGTGAtttttttttttt	0.198													3	3	---	---	---	---	
C10orf76	79591	broad.mit.edu	37	10	103744836	103744839	+	Intron	DEL	ACAC	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:103744836_103744839delACAC	uc009xwy.1	-						C10orf76_uc009xwx.1_Intron	NM_024541	NP_078817	Q5T2E6	CJ076_HUMAN	hypothetical protein LOC79591							integral to membrane					0		Colorectal(252;0.123)		Epithelial(162;2.41e-08)|all cancers(201;6.41e-07)		aaaTATATATacacacacacacac	0.015													3	3	---	---	---	---	
GBF1	8729	broad.mit.edu	37	10	104104222	104104223	+	Intron	INS	-	GTTT	GTTT	rs146202778	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr10:104104222_104104223insGTTT	uc001kux.1	+						GBF1_uc001kuw.2_Intron|GBF1_uc001kuy.1_Intron|GBF1_uc001kuz.1_Intron	NM_004193	NP_004184	Q92538	GBF1_HUMAN	golgi-specific brefeldin A resistant guanine						COPI coating of Golgi vesicle|post-Golgi vesicle-mediated transport|regulation of ARF protein signal transduction|retrograde vesicle-mediated transport, Golgi to ER	Golgi membrane	ARF guanyl-nucleotide exchange factor activity|protein binding			ovary(1)|central_nervous_system(1)	2		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		AGTTTGGTTAGgtttgtttgtt	0.233													4	2	---	---	---	---	
SLC22A20	440044	broad.mit.edu	37	11	64997532	64997532	+	Intron	DEL	T	-	-	rs150430504	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr11:64997532delT	uc010roc.1	+							NM_001004326	NP_001004326	A6NK97	S22AK_HUMAN	solute carrier family 22, member 20						ion transport	integral to membrane	transmembrane transporter activity			central_nervous_system(1)	1						ccttccttcctttccttcctt	0.000													4	2	---	---	---	---	
COL2A1	1280	broad.mit.edu	37	12	48380331	48380332	+	Intron	INS	-	G	G	rs144941834	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:48380331_48380332insG	uc001rqu.2	-						COL2A1_uc009zkw.2_Intron|COL2A1_uc001rqv.2_Intron	NM_001844	NP_001835	P02458	CO2A1_HUMAN	collagen, type II, alpha 1 isoform 1 precursor						axon guidance|collagen fibril organization|embryonic skeletal joint morphogenesis|sensory perception of sound|visual perception	collagen type II	identical protein binding|platelet-derived growth factor binding			ovary(1)|skin(1)	2		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GTTTCAGGGCTGGGGGGGGGCT	0.550													3	3	---	---	---	---	
CHPT1	56994	broad.mit.edu	37	12	102113732	102113733	+	Intron	INS	-	TAAA	TAAA	rs143042949	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr12:102113732_102113733insTAAA	uc001tin.2	+						CHPT1_uc001tio.2_Intron|CHPT1_uc001tip.1_Intron	NM_020244	NP_064629	Q8WUD6	CHPT1_HUMAN	choline phosphotransferase 1						platelet activating factor biosynthetic process|regulation of cell growth	Golgi membrane|integral to membrane|microsome	diacylglycerol binding|diacylglycerol cholinephosphotransferase activity|metal ion binding				0						aaaaaaaaagttaaaaaaaagt	0.139													4	2	---	---	---	---	
LOC284232	284232	broad.mit.edu	37	13	19420047	19420053	+	RNA	DEL	TTCGTAT	-	-	rs117180361	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr13:19420047_19420053delTTCGTAT	uc010tcj.1	-	1		c.26057_26063delATACGAA				NR_027995				Homo sapiens ankyrin repeat domain 20 family, member A2 pseudogene (LOC284232), non-coding RNA.												0						ATAACATTTCTTCGTATTTTATATTTT	0.246													10	5	---	---	---	---	
SPTB	6710	broad.mit.edu	37	14	65220572	65220572	+	Intron	DEL	C	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:65220572delC	uc001xhr.2	-						SPTB_uc001xhs.2_Intron|SPTB_uc010aqi.2_Intron	NM_001024858	NP_001020029	P11277	SPTB1_HUMAN	spectrin beta isoform a						actin filament capping|axon guidance	cell surface|cytosol|intrinsic to internal side of plasma membrane|protein complex|spectrin|spectrin-associated cytoskeleton	actin filament binding|structural constituent of cytoskeleton			ovary(7)|skin(2)|lung(1)|central_nervous_system(1)	11		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GATGGCTGTTCTCAGCAAAAT	0.592													31	15	---	---	---	---	
Unknown	0	broad.mit.edu	37	14	70933867	70933868	+	IGR	INS	-	AC	AC	rs148801077	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:70933867_70933868insAC								ADAM21 (7246 upstream) : ADAM20 (55211 downstream)																							Aacacacccagacacacacaca	0.178													5	3	---	---	---	---	
FAM161B	145483	broad.mit.edu	37	14	74401307	74401307	+	Intron	DEL	T	-	-	rs77040630		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:74401307delT	uc001xpd.1	-							NM_152445	NP_689658			hypothetical protein LOC145483											ovary(1)	1						acccagctaattttttttttt	0.000													4	2	---	---	---	---	
SMEK1	55671	broad.mit.edu	37	14	91943454	91943455	+	Intron	INS	-	T	T	rs66932962		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:91943454_91943455insT	uc001xzn.2	-						SMEK1_uc001xzm.2_Intron|SMEK1_uc001xzo.2_Intron|SMEK1_uc010atz.2_Intron|SMEK1_uc001xzp.1_Intron|SMEK1_uc001xzq.1_Intron	NM_032560	NP_115949	Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1							microtubule organizing center|nucleus	protein binding				0		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		GCAATGCTGTCTTTTTTTTTTT	0.238													4	2	---	---	---	---	
KIAA0284	283638	broad.mit.edu	37	14	105353958	105353959	+	Frame_Shift_Ins	INS	-	G	G			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:105353958_105353959insG	uc010axb.2	+	12	3606_3607	c.3382_3383insG	c.(3382-3384)CGGfs	p.R1128fs	INF2_uc010tyi.1_Intron|KIAA0284_uc001ypr.2_Frame_Shift_Ins_p.R1058fs|KIAA0284_uc001yps.2_Frame_Shift_Ins_p.R1034fs|KIAA0284_uc001ypt.2_5'Flank	NM_001112726	NP_001106197	Q9Y4F5	K0284_HUMAN	hypothetical protein LOC283638 isoform 1	1128						cytoplasm|microtubule				breast(1)	1		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000472)|OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0149)|GBM - Glioblastoma multiforme(11;0.116)	Epithelial(152;0.178)		CCGGCTGAGGCGGGCCCGGCTG	0.733													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106016171	106016171	+	Intron	DEL	T	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106016171delT	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						Ggccggaaggttttttttttt	0.353													4	2	---	---	---	---	
ADAM6	8755	broad.mit.edu	37	14	106714239	106714240	+	Intron	DEL	AC	-	-	rs112875057		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr14:106714239_106714240delAC	uc010tyt.1	-											Parts of antibodies, mostly variable regions.												0						AGAAAGGAAAACCTTCTCCCGG	0.559													4	4	---	---	---	---	
MEGF11	84465	broad.mit.edu	37	15	66257236	66257237	+	Intron	INS	-	A	A	rs138144863	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:66257236_66257237insA	uc002apm.2	-						MEGF11_uc002apl.2_Intron|MEGF11_uc002apn.1_Intron	NM_032445	NP_115821	A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11 precursor							basolateral plasma membrane|integral to membrane				pancreas(1)	1						CGCCCATTCCCAGCTCATACCT	0.673													3	4	---	---	---	---	
NEO1	4756	broad.mit.edu	37	15	73552425	73552425	+	Intron	DEL	C	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr15:73552425delC	uc002avm.3	+						NEO1_uc010ukx.1_Intron|NEO1_uc010uky.1_Intron|NEO1_uc010ukz.1_Intron|NEO1_uc002avn.3_Intron	NM_002499	NP_002490	Q92859	NEO1_HUMAN	neogenin homolog 1 precursor						axon guidance|cell adhesion|positive regulation of muscle cell differentiation	Golgi apparatus|integral to plasma membrane|nucleus				pancreas(1)	1						TTTTTTTTTTCTTAGAATGCA	0.333													4	2	---	---	---	---	
Unknown	0	broad.mit.edu	37	16	33395820	33395821	+	IGR	INS	-	CAG	CAG	rs144984499	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr16:33395820_33395821insCAG								SLC6A10P (499357 upstream) : MIR1826 (569687 downstream)																							aataataataataataatTTTT	0.183													4	5	---	---	---	---	
RTN4RL1	146760	broad.mit.edu	37	17	1840292	1840292	+	Frame_Shift_Del	DEL	C	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:1840292delC	uc002ftp.2	-	2	843	c.824delG	c.(823-825)GGCfs	p.G275fs		NM_178568	NP_848663	Q86UN2	R4RL1_HUMAN	reticulon 4 receptor-like 1 precursor	275	LRRCT.				axon regeneration	anchored to plasma membrane	receptor activity				0						GGAGCTGGAGCCCCGGAACCT	0.706													6	4	---	---	---	---	
RAP1GAP2	23108	broad.mit.edu	37	17	2703722	2703743	+	Intron	DEL	GGCTGTCCCGGGGACTCCTCCA	-	-	rs72122107		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:2703722_2703743delGGCTGTCCCGGGGACTCCTCCA	uc010ckd.2	+						RAP1GAP2_uc010cke.2_Intron	NM_015085	NP_055900	Q684P5	RPGP2_HUMAN	RAP1 GTPase activating protein 2 isoform 1						regulation of small GTPase mediated signal transduction	centrosome|cytosol|perinuclear region of cytoplasm	GTPase activator activity			ovary(1)	1						TGGTGGTTTGGGCTGTCCCGGGGACTCCTCCATACAGATGCT	0.595													8	4	---	---	---	---	
DNAH2	146754	broad.mit.edu	37	17	7667784	7667784	+	Intron	DEL	T	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:7667784delT	uc002giu.1	+							NM_020877	NP_065928	Q9P225	DYH2_HUMAN	dynein heavy chain domain 3						ciliary or flagellar motility|microtubule-based movement	axonemal dynein complex|cilium axoneme|cytoplasm|microtubule	ATP binding|ATPase activity|microtubule motor activity			ovary(6)|skin(6)|central_nervous_system(1)	13		all_cancers(10;4.66e-07)|Prostate(122;0.081)				cttcttcctcttttttttttt	0.174													3	3	---	---	---	---	
SMCR8	140775	broad.mit.edu	37	17	18221387	18221392	+	In_Frame_Del	DEL	AAGCCC	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:18221387_18221392delAAGCCC	uc002gsy.3	+	1	2794_2799	c.2284_2289delAAGCCC	c.(2284-2289)AAGCCCdel	p.KP762del		NM_144775	NP_658988	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region,	762_763										central_nervous_system(1)	1						CTGCTACGCTAAGCCCGTGAAACATT	0.539													94	44	---	---	---	---	
PSMB3	5691	broad.mit.edu	37	17	36909737	36909737	+	Intron	DEL	T	-	-	rs35484180		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:36909737delT	uc002hqr.2	+							NM_002795	NP_002786	P49720	PSB3_HUMAN	proteasome beta 3 subunit						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process|apoptosis|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest|G1/S transition of mitotic cell cycle|interspecies interaction between organisms|M/G1 transition of mitotic cell cycle|mRNA metabolic process|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle|regulation of apoptosis|regulation of cellular amino acid metabolic process|S phase of mitotic cell cycle|viral reproduction	cytoplasm|nucleus|proteasome core complex	protein binding|threonine-type endopeptidase activity				0						CTTCCCtttcttttttttttt	0.264													5	3	---	---	---	---	
NME1-NME2	654364	broad.mit.edu	37	17	49247504	49247504	+	Intron	DEL	T	-	-	rs112707943		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:49247504delT	uc002itk.2	+						NME1-NME2_uc002itj.2_Intron|NME2_uc002itl.2_Intron|NME2_uc002itm.2_Intron|NME2_uc002itn.2_Intron|NME2_uc002ito.2_Intron	NM_002512	NP_002503	P22392	NDKB_HUMAN	nucleoside diphosphate kinase B						cell adhesion|CTP biosynthetic process|GTP biosynthetic process|negative regulation of apoptosis|nucleobase, nucleoside and nucleotide interconversion|positive regulation of epithelial cell proliferation|positive regulation of keratinocyte differentiation|UTP biosynthetic process	cytosol|lamellipodium|nucleus|ruffle	ATP binding|DNA binding|metal ion binding|nucleoside diphosphate kinase activity|protein binding|protein histidine kinase activity|sequence-specific DNA binding transcription factor activity				0			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			ATCTGTGCCCttttttttttt	0.244													8	4	---	---	---	---	
HELZ	9931	broad.mit.edu	37	17	65164098	65164098	+	Intron	DEL	T	-	-	rs35055892		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr17:65164098delT	uc010wqk.1	-						HELZ_uc002jfv.3_Intron|HELZ_uc002jfx.3_Intron	NM_014877	NP_055692			helicase with zinc finger domain											ovary(1)|pancreas(1)	2	all_cancers(12;1.24e-11)|Breast(2;1.05e-17)|all_epithelial(3;3.87e-13)					CAAAAAAAAAttttttttttt	0.129													4	2	---	---	---	---	
VPS4B	9525	broad.mit.edu	37	18	61078577	61078577	+	Intron	DEL	T	-	-	rs76661872		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr18:61078577delT	uc002lix.2	-						VPS4B_uc010dpx.2_Intron|VPS4B_uc010dpy.2_Intron|VPS4B_uc010dpz.1_Intron	NM_004869	NP_004860	O75351	VPS4B_HUMAN	vacuolar protein sorting factor 4B						cell cycle|cell division|cellular membrane organization|endosome to lysosome transport via multivesicular body sorting pathway|intracellular cholesterol transport|protein transport|response to lipid	cytosol|early endosome|late endosome membrane|lysosome|nucleus|vacuolar membrane	ATP binding|ATPase activity, coupled|protein C-terminus binding			ovary(1)	1						AAGTGGAGTATTTTTTTTTTT	0.249													6	4	---	---	---	---	
TLE2	7089	broad.mit.edu	37	19	3013986	3013986	+	Intron	DEL	A	-	-	rs138074658		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3013986delA	uc002lww.2	-						TLE2_uc010xhb.1_Intron|TLE2_uc010dth.2_Intron|TLE2_uc010xhc.1_Intron|TLE2_uc010dti.2_Intron|TLE2_uc010xhd.1_Intron	NM_003260	NP_003251	Q04725	TLE2_HUMAN	transducin-like enhancer protein 2 isoform 1						negative regulation of canonical Wnt receptor signaling pathway|negative regulation of transcription, DNA-dependent|organ morphogenesis|transcription, DNA-dependent|Wnt receptor signaling pathway	nucleus	protein binding|transcription corepressor activity				0				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		tgtaaaatgtatttttttttt	0.129													5	3	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	3131446	3131446	+	IGR	DEL	C	-	-	rs66993077		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:3131446delC								GNA11 (9994 upstream) : GNA15 (4745 downstream)																							aaaaaaaaaacaaaaaaaaaa	0.348													9	5	---	---	---	---	
INSR	3643	broad.mit.edu	37	19	7153065	7153066	+	Intron	DEL	CA	-	-	rs113402674		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:7153065_7153066delCA	uc002mgd.1	-						INSR_uc002mge.1_Intron|INSR_uc002mgf.2_Intron	NM_000208	NP_000199	P06213	INSR_HUMAN	insulin receptor isoform Long precursor						activation of MAPK activity|activation of protein kinase B activity|carbohydrate metabolic process|fibroblast growth factor receptor signaling pathway|G-protein coupled receptor protein signaling pathway|glucose homeostasis|heart morphogenesis|peptidyl-tyrosine phosphorylation|positive regulation of cell migration|positive regulation of cell proliferation|positive regulation of developmental growth|positive regulation of DNA replication|positive regulation of glucose import|positive regulation of glycogen biosynthetic process|positive regulation of glycolysis|positive regulation of MAPKKK cascade|positive regulation of mitosis|positive regulation of nitric oxide biosynthetic process|positive regulation of protein kinase B signaling cascade|positive regulation of protein phosphorylation|positive regulation of respiratory burst|protein autophosphorylation|protein heterotetramerization|regulation of embryonic development|regulation of transcription, DNA-dependent|transformation of host cell by virus	caveola|endosome membrane|insulin receptor complex|microsome	ATP binding|GTP binding|insulin binding|insulin receptor activity|insulin receptor substrate binding|insulin-like growth factor I binding|insulin-like growth factor II binding|insulin-like growth factor receptor binding|metal ion binding|phosphatidylinositol 3-kinase binding|PTB domain binding|receptor signaling protein tyrosine kinase activity|SH2 domain binding			ovary(4)|lung(3)|central_nervous_system(2)|large_intestine(1)|stomach(1)|skin(1)	12					Insulin Glargine recombinant(DB00047)|Insulin recombinant(DB00030)|Insulin, porcine(DB00071)	cacacccccccacacacacaca	0.054													9	5	---	---	---	---	
Unknown	0	broad.mit.edu	37	19	42438346	42438347	+	IGR	INS	-	GT	GT	rs60945794		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:42438346_42438347insGT								ARHGEF1 (4052 upstream) : RABAC1 (22487 downstream)																							AGAAGCTCAGCgtgtgtgtgtg	0.455													3	3	---	---	---	---	
PTOV1	53635	broad.mit.edu	37	19	50358117	50358118	+	Frame_Shift_Ins	INS	-	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:50358117_50358118insA	uc002pqf.1	+	4	592_593	c.422_423insA	c.(421-423)ATCfs	p.I141fs	PTOV1_uc010ybf.1_Frame_Shift_Ins_p.I109fs|PTOV1_uc002ppz.3_RNA|PTOV1_uc002pqb.3_Frame_Shift_Ins_p.I109fs|PTOV1_uc002pqa.2_RNA|PTOV1_uc002pqc.1_RNA|PTOV1_uc002pqd.2_RNA|PTOV1_uc002pqe.1_RNA	NM_017432	NP_059128	Q86YD1	PTOV1_HUMAN	prostate tumor overexpressed 1	141					regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus|perinuclear region of cytoplasm|plasma membrane					0		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.0132)		CAGAAGCTGATCATGCAGCTGA	0.658													53	31	---	---	---	---	
TNNT1	7138	broad.mit.edu	37	19	55652162	55652163	+	Intron	INS	-	TAA	TAA	rs148036599	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr19:55652162_55652163insTAA	uc002qjb.3	-						TNNT1_uc002qiz.3_Intron|TNNT1_uc002qja.3_Intron|TNNT1_uc002qjc.3_Intron|TNNT1_uc002qje.3_Intron|TNNT1_uc002qjd.3_Intron|TNNT1_uc002qjf.2_Intron	NM_003283	NP_003274	P13805	TNNT1_HUMAN	troponin T1, skeletal, slow isoform a						muscle filament sliding|negative regulation of muscle contraction	cytosol|troponin complex	tropomyosin binding			ovary(1)	1			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.047)		aataataatagtaataataata	0.218													5	5	---	---	---	---	
COL9A3	1299	broad.mit.edu	37	20	61471746	61471747	+	Intron	INS	-	CT	CT	rs140852150	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr20:61471746_61471747insCT	uc002ydm.2	+						COL9A3_uc002ydn.2_Intron	NM_001853	NP_001844	Q14050	CO9A3_HUMAN	alpha 3 type IX collagen precursor						axon guidance	collagen type IX					0	Breast(26;5.68e-08)					CTTTGTGTGCCGTTCCCTCGGC	0.688													6	3	---	---	---	---	
DOPEY2	9980	broad.mit.edu	37	21	37619142	37619156	+	Intron	DEL	TTATGTTATGTTATG	-	-	rs67162183		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:37619142_37619156delTTATGTTATGTTATG	uc002yvg.2	+						DOPEY2_uc011aeb.1_Intron|DOPEY2_uc002yvh.2_Intron	NM_005128	NP_005119	Q9Y3R5	DOP2_HUMAN	pad-1-like						endoplasmic reticulum organization|Golgi to endosome transport|multicellular organismal development|protein transport	Golgi membrane				ovary(1)|central_nervous_system(1)	2						TTCTGATCCAttatgttatgttatgttatgttatg	0.205													4	3	---	---	---	---	
DIP2A	23181	broad.mit.edu	37	21	47978322	47978323	+	Intron	INS	-	A	A	rs34920477		TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr21:47978322_47978323insA	uc002zjo.2	+						DIP2A_uc011afz.1_Intron|DIP2A_uc002zjr.2_Frame_Shift_Ins_p.L296fs|DIP2A_uc002zjs.2_5'Flank	NM_015151	NP_055966	Q14689	DIP2A_HUMAN	disco-interacting protein 2A isoform a						multicellular organismal development	nucleus	catalytic activity|transcription factor binding			ovary(2)	2	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		GTGCCTGGGGCTGCGGTTCTCG	0.604													4	2	---	---	---	---	
BPIL2	254240	broad.mit.edu	37	22	32853547	32853558	+	5'Flank	DEL	TCCATCCATCCA	-	-	rs71320927	by1000genomes	TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:32853547_32853558delTCCATCCATCCA	uc003amn.2	-						BPIL2_uc010gwo.2_5'Flank|BPIL2_uc011amb.1_Intron|BPIL2_uc003amo.3_Intron	NM_174932	NP_777592	Q8NFQ6	BPIL2_HUMAN	bactericidal/permeability-increasing							extracellular region	lipopolysaccharide binding|phospholipid binding			ovary(1)|skin(1)	2						catccatccgtccatccatccatccatccatc	0.057											OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay	6	5	---	---	---	---	
MICALL1	85377	broad.mit.edu	37	22	38313564	38313568	+	Intron	DEL	GTGTG	-	-			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chr22:38313564_38313568delGTGTG	uc003aui.2	+							NM_033386	NP_203744	Q8N3F8	MILK1_HUMAN	molecule interacting with Rab13							cytoplasm|cytoskeleton	protein binding|zinc ion binding			breast(1)	1	Melanoma(58;0.045)					ccccgggcccgtgtgaagcgggagc	0.185													4	6	---	---	---	---	
SSX7	280658	broad.mit.edu	37	X	52681586	52681587	+	Intron	INS	-	A	A			TCGA-60-2712-01	TCGA-60-2712-01									Somatic	Phase_I	Capture				Illumina GAIIx	g.chrX:52681586_52681587insA	uc004dqx.1	-							NM_173358	NP_775494	Q7RTT5	SSX7_HUMAN	synovial sarcoma, X breakpoint 7						regulation of transcription, DNA-dependent|transcription, DNA-dependent	nucleus	nucleic acid binding			skin(1)	1	Ovarian(276;0.236)					gactcagactcaaaaaaaaaga	0.228													4	2	---	---	---	---	
